U.S. patent application number 10/641455 was filed with the patent office on 2004-09-02 for antisense modulation of p38 mitogen activated protein kinase expression.
Invention is credited to Gaarde, William A., McKay, Robert, Monia, Brett P., Nero, Pamela, Wong, Wai Shiu Fred.
Application Number | 20040171566 10/641455 |
Document ID | / |
Family ID | 34193611 |
Filed Date | 2004-09-02 |
United States Patent
Application |
20040171566 |
Kind Code |
A1 |
Monia, Brett P. ; et
al. |
September 2, 2004 |
Antisense modulation of p38 mitogen activated protein kinase
expression
Abstract
Compositions and methods for the treatment and diagnosis of
diseases or conditions amenable to treatment through modulation of
expression of a gene encoding a p38 mitogen-activated protein
kinase (p38 MAPK) are provided. Methods for the treatment and
diagnosis of diseases or conditions associated with aberrant
expression of one or more p38 MAPKs are also provided.
Inventors: |
Monia, Brett P.; (Encinitas,
CA) ; Gaarde, William A.; (Carlsbad, CA) ;
Nero, Pamela; (Philadelphia, PA) ; McKay, Robert;
(Poway, CA) ; Wong, Wai Shiu Fred; (Singapore,
SG) |
Correspondence
Address: |
Licata & Tyrrell P.C.
66 E. Main Street
Marlton
NJ
08053
US
|
Family ID: |
34193611 |
Appl. No.: |
10/641455 |
Filed: |
August 15, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10641455 |
Aug 15, 2003 |
|
|
|
10238442 |
Sep 9, 2002 |
|
|
|
10238442 |
Sep 9, 2002 |
|
|
|
09640101 |
Aug 15, 2000 |
|
|
|
6448079 |
|
|
|
|
09640101 |
Aug 15, 2000 |
|
|
|
09286904 |
Apr 6, 1999 |
|
|
|
6140124 |
|
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
C12N 2310/14 20130101;
Y02P 20/582 20151101; C12Y 207/11024 20130101; C12N 2310/321
20130101; C12N 2310/3341 20130101; A61K 38/00 20130101; C12N
2310/315 20130101; A61K 31/7052 20130101; C12N 15/1137 20130101;
C12N 2310/11 20130101; C12N 2310/341 20130101; C12N 2310/3525
20130101; C12N 2310/321 20130101; C12N 2310/346 20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Claims
What is claimed is:
1. A method for treating airway hyperresponsiveness or pulmonary
inflammation in an individual in need thereof, comprising
administering to said individual an antisense compound 8 to 30
nucleobases in length targeted to a nucleic acid molecule encoding
a human p38.alpha. MAP kinase protein to said individual.
2. The method of claim 1, wherein said antisense compound is an
antisense oligonucleotide.
3. The method of claim 2, wherein at least one covalent linkage of
said antisense compound is a modified covalent linkage.
4. The method of claim 2, wherein at least one nucleotide of said
antisense compound has a modified sugar moiety.
5. The method of claim 2, wherein at least one nucleotide of said
antisense compound has a modified nucleobase.
6. The method of claim 1, further comprising administering an
anti-asthma medication to said individual.
7. The method of claim 1 wherein said antisense compound comprises
at least one lipophilic moiety which enhances the cellular uptake
of said antisense compound.
8. The method of claim 1, wherein said antisense compound is
aerosolized and inhaled by said individual.
9. The method of claim 1, wherein said antisense compound is
administered intranasally, intrapulmonarily or intratracheally.
10. The method of claim 1, wherein said airway hyperresponsiveness
or pulmonary inflammation is associated with asthma.
11. A pharmaceutical composition comprising an antisense
oligonucleotide targeted to nucleic acid encoding human p38.alpha.
MAP kinase in a formulation suitable for intranasal, intrapulmonary
or intratracheal administration.
12. The pharmaceutical composition of claim 11, wherein said
composition is in a metered dose inhaler or nebulizer.
Description
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 10/238,442, filed Sep. 9, 2002, which is a
continuation of U.S. patent application Ser. No. 09/640,101 filed
Aug. 15, 2000, now issued as U.S. Pat. No. 6,448,079, which is a
continuation-in-part of U.S. patent application Ser. No.
09/286,904, filed Apr. 6, 1999, now issued as U.S. Pat. No.
6,140,124.
FIELD OF THE INVENTION
[0002] This invention relates to compositions and methods for
modulating expression of p38 mitogen activated protein kinase
genes, a family of naturally present cellular genes involved in
signal transduction, and inflammatory and apoptotic responses. This
invention is also directed to methods for inhibiting inflammation
or apoptosis; these methods can be used diagnostically or
therapeutically. Furthermore, this invention is directed to
treatment of diseases or conditions associated with expression of
p38 mitogen activated protein kinase genes.
BACKGROUND OF THE INVENTION
[0003] Cellular responses to external factors, such as growth
factors, cytokines, and stress conditions, result in altered gene
expression. These signals are transmitted from the cell surface to
the nucleus by signal transduction pathways. Beginning with an
external factor binding to an appropriate receptor, a cascade of
signal transduction events is initiated. These responses are
mediated through activation of various enzymes and the subsequent
activation of specific transcription factors. These activated
transcription factors then modulate the expression of specific
genes.
[0004] The phosphorylation of enzymes plays a key role in the
transduction of extracellular signals into the cell. Mitogen
activated protein kinases (MAPKs), enzymes which effect such
phosphorylations are targets for the action of growth factors,
hormones, and other agents involved in cellular metabolism,
proliferation and differentiation (Cobb et al., J. Biol. Chem.,
1995, 270, 14843). Mitogen activated protein kinases were initially
discovered due to their ability to be tyrosine phosphorylated in
response to exposure to bacterial lipopolysaccharides or
hyperosmotic conditons (Han et al, Science, 1994, 265, 808). These
conditions activate inflammatory and apoptotic responses mediated
by MAPK. In general, MAP kinases are involved in a variety of
signal transduction pathways (sometimes overlapping and sometimes
parallel) that function to convey extracellular stimuli to
protooncogene products to modulate cellular proliferation and/or
differentiation (Seger et al., FASEB J., 1995, 9, 726; Cano et al.,
Trends Biochem. Sci., 1995, 20, 117).
[0005] One of the MAPK signal transduction pathways involves the
MAP kinases p38.alpha. and p38.beta. (also known as CSaids Binding
Proteins, CSBP). These MAP kinases are responsible for the
phosphorylation of ATF-2, MEFC2 and a variety of other cellular
effectors that may serve as substrates for p38 MAPK proteins
(Kummer et al, J. Biol. Chem., 1997, 272, 20490). Phosphorylation
of p38 MAPKs potentiates the ability of these factors to activate
transcription (Raingeaud et al, Mol. Cell Bio., 1996, 16, 1247; Han
et al, Nature, 1997, 386, 296). Among the genes activated by the
p38 MAPK signaling pathway is IL-6 (De Cesaris, P., et al., J.
Biol. Chem., 1998, 273, 7566-7571).
[0006] Besides p38.alpha. and p38.beta., other p38 MAPK family
members have been described, including p38.gamma. (Li et al,
Biochem. Biophys. Res. Commun., 1996, 228, 334), and p38.delta.
(Jiang et al, J. Biol. Chem., 1997, 272, 30122). The term "p38" as
used herein shall mean a member of the p38 MAPK family, including
but not limited to p38.alpha., p38.beta., p38.gamma. and
p38.delta., their isoforms (Kumar et al, Biochem. Biophys. Res.
Commun., 1997, 235, 533) and other members of the p38 MAPK family
of proteins whether they function as p38 MAP kinases per se or
not.
[0007] Modulation of the expression of one or more p38 MAPKs is
desirable in order to interfere with inflammatory or apoptotic
responses associated with disease states and to modulate the
transcription of genes stimulated by ATF-2, MEFC2 and other p38
MAPK phosphorylation substrates.
[0008] Inhibitors of p38 MAPKs have been shown to have efficacy in
animal models of arthritis (Badger, A. M., et al., J. Pharmacol.
Exp. Ther., 1996, 279, 1453-1461) and angiogenesis (Jackson, J. R.,
et al., J. Pharmacol. Exp. Ther., 1998, 284, 687-692). MacKay, K.
and Mochy-Rosen, D. (J. Biol. Chem., 1999, 274, 6272-6279)
demonstrate that an inhibitor of p38 MAPKs prevents apoptosis
during ischemia in cardiac myocytes, suggesting that p38 MAPK
inhibitors can be used for treating ischemic heart disease. p38
MAPK also is required for T-cell HIV-1 replication (Cohen et al,
Mol. Med., 1997, 3, 339) and may be a useful target for AIDS
therapy. Other diseases believed to be amenable to treatment by
inhibitors of p38 MAPKs are disclosed in U.S. Pat. No. 5,559,137,
herein incorporated by reference.
[0009] Therapeutic agents designed to target p38 MAPKs include
small molecule inhibitors and antisense oligonucleotides. Small
molecule inhibitors based on pyridinyl imidazole are described in
U.S. Pat. Nos. 5,670,527; 5,658,903; 5,656,644; 5,559,137;
5,593,992; and 5,593,991. WO 98/27098 and WO 99/00357 describe
additional small molecule inhibitors, one of which has entered
clinical trials. Other small molecule inhibitors are also
known.
[0010] Antisense therapy represents a potentially more specific
therapy for targeting p38 MAPKs and, in particular, specific p38
MAPK isoforms. Nagata, Y., et al. (Blood, 1998, 6, 1859-1869)
disclose an antisense phosphothioester oligonucleotide targeted to
the translational start site of mouse p38b (p38.beta.). Aoshiba,
K., et al. (J. Immunol., 1999, 162, 1692-1700) and Cohen, P. S., et
al. (Mol. Med., 1997, 3, 339-346) disclose a phosphorothioate
antisense oligonucleotide targeted to the coding regions of human
p38.alpha., human p38.beta. and rat p38.
[0011] There remains a long-felt need for improved compositions and
methods for modulating the expression of p38 MAP kinases.
SUMMARY OF THE INVENTION
[0012] The present invention provides antisense compounds which are
targeted to nucleic acids encoding a p38 MAPK and are capable of
modulating p38 MAPK expression. The present invention also provides
oligonucleotides targeted to nucleic acids encoding a p38 MAPK. The
present invention also comprises methods of modulating the
expression of a p38 MAPK, in cells and tissues, using the
oligonucleotides of the invention. Methods of inhibiting p38 MAPK
expression are provided; these methods are believed to be useful
both therapeutically and diagnostically. These methods are also
useful as tools, for example, for detecting and determining the
role of p38 MAPKs in various cell functions and physiological
processes and conditions and for diagnosing conditions associated
with expression of p38 MAPKs.
[0013] The present invention also comprises methods for diagnosing
and treating inflammatory diseases, particularly rheumatoid
arthritis and asthma. These methods are believed to be useful, for
example, in diagnosing p38 MAPK-associated disease progression.
These methods employ the oligonucleotides of the invention. These
methods are believed to be useful both therapeutically, including
prophylactically, and as clinical research and diagnostic
tools.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIGS. 1A-1B are graphs showing the effect of inhaled
p38.alpha. MAP kinase antisense oligonucleotide ISIS 101757 (ASO,
FIG. 1A) and mismatched control oligonucleotide ISIS 101758 (MM
ASO, FIG. 1B) on ovalbumin (OVA)-induced airway hyperresponsiveness
in a murine asthma model.
[0015] FIG. 2 is a graph showing that inhaled ISIS 101757 increases
the provocation concentration of methacholine required to achieve
doubling of airway reactivity (PC200) in OVA-challenged mice.
[0016] FIGS. 3A-3B are graphs showing the effect of inhaled ISIS
101757 (FIG. 3A) and 101758 (FIG. 3B) on immune cells in
broncheolar lavage (BAL) fluid of OVA-challenged mice.
EOS=eosinpophils, NEU=neutrophils, MAC=macrophages,
LYM=lymphocyes.
[0017] FIG. 4 is a graph showing aerosolized ISIS 101757
concentration in mouse lung vs. dose.
[0018] FIG. 5 is a graph showing dose-dependent inhibition of the
penh response to methacholine (50 mg/ml) challenge by ISIS 101757.
ISIS 101757 doses are in mg/kg .alpha.-axis).
[0019] FIG. 6 is a graph showing ISIS 101757 concentration
(.mu.g/g) in the lungs vs. dose (intratracheal administration).
DETAILED DESCRIPTION OF THE INVENTION
[0020] p38 MAPKs play an important role in signal transduction in
response to cytokines, growth factors and other cellular stimuli.
Specific responses elicited by p38 include inflammatory and
apoptotic responses. Modulation of p38 may be useful in the
treatment of inflammatory diseases, such as rheumatoid
arthritis.
[0021] The present invention employs antisense compounds,
particularly oligonucleotides, for use in modulating the function
of nucleic acid molecules encoding a p38 MAPK, ultimately
modulating the amount of a p38 MAPK produced. This is accomplished
by providing oligonucleotides which specifically hybridize with
nucleic acids, preferably mRNA, encoding a p38 MAPK.
[0022] The antisense compounds may be used to modulate the function
of a particular p38 MAPK isoform, e.g. for research purposes to
determine the role of a particular isoform in a normal or disease
process, or to treat a disease or condition that may be associated
with a particular isoform. It may also be desirable to target
multiple p38 MAPK isoforms. In each case, antisense compounds can
be designed by taking advantage of sequence homology between the
various isoforms. If an antisense compound to a particular isoform
is desired, then the antisense compound is designed to a unique
region in the desired isoform's gene sequence. With such a
compound, it is desirable that this compound does not inhibit the
expression of other isoforms. Less desirable, but acceptable, are
compounds that do not "substantially" inhibit other isoforms. By
"substantially", it is intended that these compounds do not inhibit
the expression of other isoforms greater than 25%; more preferred
are compounds that do not inhibit other isoforms greater than 10%.
If an antisense compound is desired to target multiple p38
isoforms, then regions of significant homology between the isoforms
can be used.
[0023] This relationship between an antisense compound such as an
oligonucleotide and its complementary nucleic acid target, to which
it hybridizes, is commonly referred to as "antisense". "Targeting"
an oligonucleotide to a chosen nucleic acid target, in the context
of this invention, is a multistep process. The process usually
begins with identifying a nucleic acid sequence whose function is
to be modulated. This may be, as examples, a cellular gene (or mRNA
made from the gene) whose expression is associated with a
particular disease state, or a foreign nucleic acid from an
infectious agent. In the present invention, the target is a nucleic
acid encoding a p38 MAPK; in other words, a p38 MAPK gene or RNA
expressed from a p38 MAPK gene. p38 MAPK mRNA is presently the
preferred target. The targeting process also includes determination
of a site or sites within the nucleic acid sequence for the
antisense interaction to occur such that modulation of gene
expression will result.
[0024] In accordance with this invention, persons of ordinary skill
in the art will understand that messenger RNA includes not only the
information to encode a protein using the three letter genetic
code, but also associated ribonucleotides which form a region known
to such persons as the 5'-untranslated region, the 3'-untranslated
region, the 5' cap region and intron/exon junction ribonucleotides.
Thus, oligonucleotides may be formulated in accordance with this
invention which are targeted wholly or in part to these associated
ribonucleotides as well as to the informational ribonucleotides.
The oligonucleotide may therefore be specifically hybridizable with
a transcription initiation site region, a translation initiation
codon region, a 5' cap region, an intron/exon junction, coding
sequences, a translation termination codon region or sequences in
the 5'- or 3'-untranslated region. Since, as is known in the art,
the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon." A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
p38, regardless of the sequence(s) of such codons. It is also known
in the art that a translation termination codon (or "stop codon")
of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and
5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and
5'-TGA, respectively). The terms "start codon region" and
"translation initiation codon region" refer to a portion of such an
mRNA or gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
initiation codon. This region is a preferred target region.
Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. This region is a preferred target region. The
open reading frame (ORF) or "coding region," which is known in the
art to refer to the region between the translation initiation codon
and the translation termination codon, is also a region which may
be targeted effectively. Other preferred target regions include the
5' untranslated region (5'UTR), known in the art to refer to the
portion of an mRNA in the 5' direction from the translation
initiation codon, and thus including nucleotides between the 5' cap
site and the translation initiation codon of an mRNA or
corresponding nucleotides on the gene) and the 3' untranslated
region (3'UTR), known in the art to refer to the portion of an mRNA
in the 3' direction from the translation termination codon, and
thus including nucleotides between the translation termination
codon and 3' end of an mRNA or corresponding nucleotides on the
gene). mRNA splice sites may also be preferred target regions, and
are particularly useful in situations where aberrant splicing is
implicated in disease, or where an overproduction of a particular
mRNA splice product is implicated in disease. Aberrant fusion
junctions due to rearrangements or deletions may also be preferred
targets.
[0025] Once the target site or sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired modulation.
[0026] "Hybridization", in the context of this invention, means
hydrogen bonding, also known as Watson-Crick base pairing, between
complementary bases, usually on opposite nucleic acid strands or
two regions of a nucleic acid strand. Guanine and cytosine are
examples of complementary bases which are known to form three
hydrogen bonds between them. Adenine and thymine are examples of
complementary bases which form two hydrogen bonds between them.
[0027] "Specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between the DNA or RNA
target and the oligonucleotide.
[0028] It is understood that an oligonucleotide need not be 100%
complementary to its target nucleic acid sequence to be
specifically hybridizable. An oligonucleotide is specifically
hybridizable when binding of the oligonucleotide to the target
interferes with the normal function of the target molecule to cause
a loss of utility, and there is a sufficient degree of
complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which
specific binding is desired, i.e., under physiological conditions
in the case of in vivo assays or therapeutic treatment and, in the
case of in vitro assays, under conditions in which the assays are
conducted.
[0029] Hybridization of antisense oligonucleotides with mRNA
interferes with one or more of the normal functions of mRNA. The
functions of mRNA to be interfered with include all vital functions
such as, for example, translocation of the RNA to the site of
protein translation, translation of protein from the RNA, splicing
of the RNA to yield one or more mRNA species, and catalytic
activity which may be engaged in by the RNA.
[0030] The overall effect of interference with mRNA function is
modulation of p38 MAPK expression. In the context of this invention
"modulation" means either inhibition or stimulation; i.e., either a
decrease or increase in expression. This modulation can be measured
in ways which are routine in the art, for example by Northern blot
assay of mRNA expression as taught in the examples of the instant
application or by Western blot or ELISA assay of protein
expression, or by an immunoprecipitation assay of protein
expression, as taught in the examples of the instant application.
Effects on cell proliferation or tumor cell growth can also be
measured, as taught in the examples of the instant application.
[0031] The oligonucleotides of this invention can be used in
diagnostics, therapeutics, prophylaxis, and as research reagents
and in kits. Since the oligonucleotides of this invention hybridize
to nucleic acids encoding a p38 MAPK, sandwich, calorimetric and
other assays can easily be constructed to exploit this fact.
Furthermore, since the oligonucleotides of this invention hybridize
specifically to nucleic acids encoding particular isoforms of p38
MAPK, such assays can be devised for screening of cells and tissues
for particular p38 MAPK isoforms. Such assays can be utilized for
diagnosis of diseases associated with various p38 MAPK isoforms.
Provision of means for detecting hybridization of oligonucleotide
with a p38 MAPK gene or mRNA can routinely be accomplished. Such
provision may include enzyme conjugation, radiolabelling or any
other suitable detection systems. Kits for detecting the presence
or absence of p38 MAPK may also be prepared.
[0032] The present invention is also suitable for diagnosing
abnormal inflammatory states in tissue or other samples from
patients suspected of having an inflammatory disease such as
rheumatoid arthritis. The ability of the oligonucleotides of the
present invention to inhibit inflammation may be employed to
diagnose such states. A number of assays may be formulated
employing the present invention, which assays will commonly
comprise contacting a tissue sample with an oligonucleotide of the
invention under conditions selected to permit detection and,
usually, quantitation of such inhibition. In the context of this
invention, to "contact" tissues or cells with an oligonucleotide or
oligonucleotides means to add the oligonucleotide(s), usually in a
liquid carrier, to a cell suspension or tissue sample, either in
vitro or ex vivo, or to administer the oligonucleotide(s) to cells
or tissues within an animal. Similarly, the present invention can
be used to distinguish p38 MAPK-associated diseases, from diseases
having other etiologies, in order that an efficacious treatment
regime can be designed.
[0033] The oligonucleotides of this invention may also be used for
research purposes. Thus, the specific hybridization exhibited by
the oligonucleotides may be used for assays, purifications,
cellular product preparations and in other methodologies which may
be appreciated by persons of ordinary skill in the art.
[0034] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid or
deoxyribonucleic acid. This term includes oligonucleotides composed
of naturally-occurring nucleobases, sugars and covalent intersugar
(backbone) linkages as well as oligonucleotides having
non-naturally-occurring portions which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced binding to target and increased
stability in the presence of nucleases.
[0035] The antisense compounds in accordance with this invention
preferably comprise from about 5 to about 50 nucleobases.
Particularly preferred are antisense oligonucleotides comprising
from about 8 to about 30 nucleobases (i.e. from about 8 to about 30
linked nucleosides). Preferred embodiments comprise at least an
8-nucleobase portion of a sequence of an antisense compound which
inhibits the expression of a p38 mitogen activated kinase. As is
known in the art, a nucleoside is a base-sugar combination. The
base portion of the nucleoside is normally a heterocyclic base. The
two most common classes of such heterocyclic bases are the purines
and the pyrimidines. Nucleotides are nucleosides that further
include a phosphate group covalently linked to the sugar portion of
the nucleoside. For those nucleosides that include a pentofuranosyl
sugar, the phosphate group can be linked to either the 2=, 3=or
5=hydroxyl moiety of the sugar. In forming oligonucleotides, the
phosphate groups covalently link adjacent nucleosides to one
another to form a linear polymeric compound. In turn the respective
ends of this linear polymeric structure can be further joined to
form a circular structure, however, open linear structures are
generally preferred. Within the oligonucleotide structure, the
phosphate groups are commonly referred to as forming the
internucleoside backbone of the oligonucleotide. The normal linkage
or backbone of RNA and DNA is a 3=to 5=phosphodiester linkage.
[0036] While the preferred form of antisense compound is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. This phenomenon occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing.
[0037] The first evidence that dsRNA could lead to gene silencing
in animals came in 1995 from work in the nematode, Caenorhabditis
elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et
al. have shown that the primary interference effects of dsRNA are
posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA,
1998, 95, 15502-15507). The posttranscriptional antisense mechanism
defined in Caenorhabditis elegans resulting from exposure to
double-stranded RNA (dsRNA) has since been designated RNA
interference (RNAi). This term has been generalized to mean
antisense-mediated gene silencing involving the introduction of
dsRNA leading to the sequence-specific reduction of endogenous
targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811).
Recently, it has been shown that it is, in fact, the
single-stranded RNA oligomers of antisense polarity of the dsRNAs
which are the potent inducers of RNAi (Tijsterman et al., Science,
2002, 295, 694-697). Single stranded and double stranded RNA (RNAi)
inhibition of human p38 MAP kinase is also within the scope of the
present invention.
[0038] Oligomer and Monomer Modifications
[0039] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric compound can be further joined to form a circular
compound, however, linear compounds are generally preferred. In
addition, linear compounds may have internal nucleobase
complementarity and may therefore fold in a manner as to produce a
fully or partially double-stranded compound. Within
oligonucleotides, the phosphate groups are commonly referred to as
forming the internucleoside linkage or in conjunction with the
sugar ring the backbone of the oligonucleotide. The normal
internucleoside linkage that makes up the backbone of RNA and DNA
is a 3' to 5' phosphodiester linkage.
[0040] Modified Internucleoside Linkages
[0041] Specific examples of preferred antisense oligomeric
compounds useful in this invention include oligonucleotides
containing modified e.g. non-naturally occurring internucleoside
linkages. As defined in this specification, oligonucleotides having
modified internucleoside linkages include internucleoside linkages
that retain a phosphorus atom and internucleoside linkages that do
not have a phosphorus atom. For the purposes of this specification,
and as sometimes referenced in the art, modified oligonucleotides
that do not have a phosphorus atom in their internucleoside
backbone can also be considered to be oligonucleosides.
[0042] In the C. elegans system, modification of the
internucleotide linkage (phosphorothioate) did not significantly
interfere with RNAi activity. Based on this observation, it is
suggested that certain preferred oligomeric compounds of the
invention can also have one or more modified internucleoside
linkages. A preferred phosphorus containing modified
internucleoside linkage is the phosphorothioate internucleoside
linkage.
[0043] Preferred modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphoro-dithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and borano-phosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred
oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0044] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0045] In more preferred embodiments of the invention, oligomeric
compounds have one or more phosphorothioate and/or heteroatom
internucleoside linkages, in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester internucleotide linkage is represented as
--O--P(.dbd.O)(OH)--O--CH.sub.2- --]. The MMI type internucleoside
linkages are disclosed in the above referenced U.S. Pat. No.
5,489,677. Preferred amide internucleoside linkages are disclosed
in the above referenced U.S. Pat. No. 5,602,240.
[0046] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0047] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0048] Oligomer Mimetics
[0049] Another preferred group of oligomeric compounds amenable to
the present invention includes oligonucleotide mimetics. The term
mimetic as it is applied to oligonucleotides is intended to include
oligomeric compounds wherein only the furanose ring or both the
furanose ring and the internucleotide linkage are replaced with
novel groups, replacement of only the furanose ring is also
referred to in the art as being a sugar surrogate. The heterocyclic
base moiety or a modified heterocyclic base moiety is maintained
for hybridization with an appropriate target nucleic acid. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA oligomeric compounds, the
sugar-backbone of an oligonucleotide is replaced with an amide
containing backbone, in particular an aminoethylglycine backbone.
The nucleobases are retained and are bound directly or indirectly
to aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of
PNA oligomeric compounds include, but are not limited to, U.S. Pat.
Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA oligomeric
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0050] One oligonucleotide mimetic that has been reported to have
excellent hybridization properties is peptide nucleic acids (PNA).
The backbone in PNA compounds is two or more linked
aminoethylglycine units which gives PNA an amide containing
backbone. The heterocyclic base moieties are bound directly or
indirectly to aza nitrogen atoms of the amide portion of the
backbone. Representative United States patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is
herein incorporated by reference. Further teaching of PNA compounds
can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
[0051] PNA has been modified to incorporate numerous modifications
since the basic PNA structure was first prepared. The basic
structure is shown below: 1
[0052] wherein
[0053] Bx is a heterocyclic base moiety;
[0054] T.sub.4 is hydrogen, an amino protecting group,
--C(O)R.sub.5, substituted or unsubstituted C.sub.1-C.sub.10 alkyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkenyl, substituted
or unsubstituted C.sub.2-C.sub.10 alkynyl, alkylsulfonyl,
arylsulfonyl, a chemical functional group, a reporter group, a
conjugate group, a D or L .alpha.-amino acid linked via the
.alpha.-carboxyl group or optionally through the .omega.-carboxyl
group when the amino acid is aspartic acid or glutamic acid or a
peptide derived from D, L or mixed D and L amino acids linked
through a carboxyl group, wherein the substituent groups are
selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl,
nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0055] T.sub.5 is --OH, --N(Z.sub.1) Z.sub.2, R.sub.5, D or L
.alpha.-amino acid linked via the .alpha.-amino group or optionally
through the .omega.-amino group when the amino acid is lysine or
ornithine or a peptide derived from D, L or mixed D and L amino
acids linked through an amino group, a chemical functional group, a
reporter group or a conjugate group;
[0056] Z.sub.1 is hydrogen, C.sub.1-C.sub.6 alkyl, or an amino
protecting group;
[0057] Z.sub.2 is hydrogen, C.sub.1-C.sub.6 alkyl, an amino
protecting group, --C(.dbd.O).sub.n--(CH.sub.2).sub.n-J-Z.sub.3, a
D or L .alpha.-amino acid linked via the .alpha.-carboxyl group or
optionally through the .omega.-carboxyl group when the amino acid
is aspartic acid or glutamic acid or a peptide derived from D, L or
mixed D and L amino acids linked through a carboxyl group;
[0058] Z.sub.3 is hydrogen, an amino protecting group,
--C.sub.1-C.sub.6 alkyl, --C(.dbd.O)--CH.sub.3, benzyl, benzoyl, or
--(CH.sub.2).sub.n--N(H- )Z.sub.1;
[0059] each J is O, S or NH;
[0060] R.sub.5 is a carbonyl protecting group; and
[0061] n is from 2 to about 50.
[0062] Another class of oligonucleotide mimetic that has been
studied is based on linked morpholino units (morpholino nucleic
acid) having heterocyclic bases attached to the morpholino ring. A
number of linking groups have been reported that link the
morpholino monomeric units in a morpholino nucleic acid. A
preferred class of linking groups have been selected to give a
non-ionic oligomeric compound. The non-ionic morpholino-based
oligomeric compounds are less likely to have undesired interactions
with cellular proteins. Morpholino-based oligomeric compounds are
non-ionic mimics of oligonucleotides which are less likely to form
undesired interactions with cellular proteins (Dwaine A. Braasch
and David R. Corey, Biochemistry, 2002, 41 (14), 4503-4510).
Morpholino-based oligomeric compounds are disclosed in U.S. Pat.
No. 5,034,506, issued Jul. 23, 1991. The morpholino class of
oligomeric compounds have been prepared having a variety of
different linking groups joining the monomeric subunits.
[0063] Morpholino nucleic acids have been prepared having a variety
of different linking groups (L.sub.2) joining the monomeric
subunits. The basic formula is shown below: 2
[0064] wherein
[0065] T.sub.1 is hydroxyl or a protected hydroxyl;
[0066] T.sub.5 is hydrogen or a phosphate or phosphate
derivative;
[0067] L.sub.2 is a linking group; and
[0068] n is from 2 to about 50.
[0069] A further class of oligonucleotide mimetic is referred to as
cyclohexenyl nucleic acids (CeNA). The furanose ring normally
present in an DNA/RNA molecule is replaced with a cyclohenyl ring.
CeNA DMT protected phosphoramidite monomers have been prepared and
used for oligomeric compound synthesis following classical
phosphoramidite chemistry. Fully modified CeNA oligomeric compounds
and oligonucleotides having specific positions modified with CeNA
have been prepared and studied (see Wang et al., J. Am. Chem. Soc.,
2000, 122, 8595-8602). In general the incorporation of CeNA
monomers into a DNA chain increases its stability of a DNA/RNA
hybrid. CeNA oligoadenylates formed complexes with RNA and DNA
complements with similar stability to the native complexes. The
study of incorporating CeNA structures into natural nucleic acid
structures was shown by NMR and circular dichrdism to proceed with
easy conformational adaptation. Furthermore the incorporation of
CeNA into a sequence targeting RNA was stable to serum and able to
activate E. Coli RNase resulting in cleavage of the target RNA
strand.
[0070] The general formula of CeNA is shown below: 3
[0071] wherein
[0072] each Bx is a heterocyclic base moiety;
[0073] T.sub.1 is hydroxyl or a protected hydroxyl; and
[0074] T2 is hydroxyl or a protected hydroxyl.
[0075] Another class of oligonucleotide mimetic (anhydrohexitol
nucleic acid) can be prepared from one or more anhydrohexitol
nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett.,
1999, 9, 1563-1566) and would have the general formula: 4
[0076] A further preferred modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4'
carbon atom of the sugar ring thereby forming a
2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar
moiety. The linkage is preferably a methylene (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and
LNA analogs display very high duplex thermal stabilities with
complementary DNA and RNA (Tm=+3 to +10 C), stability towards
3'-exonucleolytic degradation and good solubility properties. The
basic structure of LNA showing the bicyclic ring system is shown
below: 5
[0077] The conformations of LNAs determined by 2D NMR spectroscopy
have shown that the locked orientation of the LNA nucleotides, both
in single-stranded LNA and in duplexes, constrains the phosphate
backbone in such a way as to introduce a higher population of the
N-type conformation (Petersen et al., J. Mol. Recognit., 2000, 13,
44-53). These conformations are associated with improved stacking
of the nucleobases (Wengel et al., Nucleosides Nucleotides, 1999,
18, 1365-1370).
[0078] LNA has been shown to form exceedingly stable LNA:LNA
duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120,
13252-13253). LNA:LNA hybridization was shown to be the most
thermally stable nucleic acid type duplex system, and the
RNA-mimicking character of LNA was established at the duplex level.
Introduction of 3 LNA monomers (T or A) significantly increased
melting points (Tm=+15/+11) toward DNA complements. The
universality of LNA-mediated hybridization has been stressed by the
formation of exceedingly stable LNA:LNA duplexes. The RNA-mimicking
of LNA was reflected with regard to the N-type conformational
restriction of the monomers and to the secondary structure of the
LNA:RNA duplex.
[0079] LNAs also form duplexes with complementary DNA, RNA or LNA
with high thermal affinities. Circular dichroism (CD) spectra show
that duplexes involving fully modified LNA (esp. LNA:RNA)
structurally resemble an A-form RNA:RNA duplex. Nuclear magnetic
resonance (NMR) examination of an LNA:DNA duplex confirmed the
3'-endo conformation of an LNA monomer. Recognition of
double-stranded DNA has also been demonstrated suggesting strand
invasion by LNA. Studies of mismatched sequences show that LNAs
obey the Watson-Crick base pairing rules with generally improved
selectivity compared to the corresponding unmodified reference
strands.
[0080] Novel types of LNA-oligomeric compounds, as well as the
LNAs, are useful in a wide range of diagnostic and therapeutic
applications. Among these are antisense applications, PCR
applications, strand-displacement oligomers, substrates for nucleic
acid polymerases and generally as nucleotide based drugs. Potent
and nontoxic antisense oligonucleotides containing LNAs have been
described (Wahlestedt et al., Proc. Natl. Acad. Sci. U.S. A., 2000,
97, 5633-5638.) The authors have demonstrated that LNAs confer
several desired properties to antisense agents. LNA/DNA copolymers
were not degraded readily in blood serum and cell extracts. LNA/DNA
copolymers exhibited potent antisense activity in assay systems as
disparate as G-protein-coupled receptor signaling in living rat
brain and detection of reporter genes in Escherichia coli.
Lipofectin-mediated efficient delivery of LNA into living human
breast cancer cells has also been accomplished.
[0081] The synthesis and preparation of the LNA monomers adenine,
cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along
with their oligomerization, and nucleic acid recognition properties
have been described (Koshkin et al., Tetrahedron, 1998, 54,
3607-3630). LNAs and preparation thereof are also described in WO
98/39352 and WO 99/14226.
[0082] The first analogs of LNA, phosphorothioate-LNA and
2'-thio-LNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs containing oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., PCT International Application WO 98-DK393 19980914).
Furthermore, synthesis of 2'-amino-LNA, a novel conformationally
restricted high-affinity oligonucleotide analog with a handle has
been described in the art (Singh et al., J. Org. Chem., 1998, 63,
10035-10039). In addition, 2'-Amino- and 2`-methylamino-LNA`s have
been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0083] Further oligonucleotide mimetics have been prepared to
include bicyclic and tricyclic nucleoside analogs having the
formulas (amidite monomers shown): 6
[0084] (see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439;
Steffens et al., J. Am. Chem. Soc., 1999, 121, 3249-3255; and
Renneberg et al., J. Am. Chem. Soc., 2002, 124, 5993-6002). These
modified nucleoside analogs have been oligomerized using the
phosphoramidite approach and the resulting oligomeric compounds
containing tricyclic nucleoside analogs have shown increased
thermal stabilities (Tm's) when hybridized to DNA, RNA and itself.
Oligomeric compounds containing bicyclic nucleoside analogs have
shown thermal stabilities approaching that of DNA duplexes.
[0085] Another class of oligonucleotide mimetic is referred to as
phosphonomonoester nucleic acids incorporate a phosphorus group in
a backbone the backbone. This class of olignucleotide mimetic is
reported to have useful physical and biological and pharmacological
properties in the areas of inhibiting gene expression (antisense
oligonucleotides, ribozymes, sense oligonucleotides and
triplex-forming oligonucleotides), as probes for the detection of
nucleic acids and as auxiliaries for use in molecular biology.
[0086] The general formula (for definitions of Markush variables
see: U.S. Pat. Nos. 5,874,553 and 6,127,346 herein incorporated by
reference in their entirety) is shown below. 7
[0087] Another oligonucleotide mimetic has been reported wherein
the furanosyl ring has been replaced by a cyclobutyl moiety.
[0088] Modified Sugars
[0089] Oligomeric compounds of the invention may also contain one
or more substituted sugar moieties. Preferred oligomeric compounds
comprise a sugar substituent group selected from: OH; F; O--, S--,
or N-alkyl; O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be
substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2
to C.sub.10 alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.su- b.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
a sugar substituent group selected from: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-C--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylamino-ethoxyethoxy (also known in the art as
2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2.
[0090] Other preferred sugar substituent groups include methoxy
(--O--CH.sub.3), aminopropoxy
(--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), allyl
(--CH.sub.2--CH.dbd.CH.sub.2), --O-allyl
(--O--CH.sub.2--CH.dbd.CH.- sub.2) and fluoro (F). 2'-Sugar
substituent groups may be in the arabino (up) position or ribo
(down) position. A preferred 2'-arabino modification is 2'-F.
Similar modifications may also be made at other positions on the
oligomeric compound, particularly the 3' position of the sugar on
the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and
the 5' position of 5' terminal nucleotide. Oligomeric compounds may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0091] Further representative sugar substituent groups include
groups of formula I.sub.a or II.sub.a: 8
[0092] wherein:
[0093] R.sub.b is O, S or NH;
[0094] R.sub.d is a single bond, O, S or C(.dbd.O);
[0095] R.sub.e is C.sub.1-C.sub.10 alkyl, N(R.sub.k) (R.sub.m),
N(R.sub.k) (R.sub.n), N.dbd.C(R.sub.p) (R.sub.q), N.dbd.C(R.sub.p)
(R.sub.r) or has formula III.sub.a; 9
[0096] R.sub.p and R.sub.q are each independently hydrogen or
C.sub.1-C.sub.10 alkyl;
[0097] R.sub.r is --R.sub.x--R.sub.y;
[0098] each R.sub.s, R.sub.t, R.sub.u and R.sub.v is,
independently, hydrogen, C(O)R.sub.w, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0099] or optionally, R.sub.u and R.sub.v, together form a
phthalimido moiety with the nitrogen atom to which they are
attached;
[0100] each R.sub.w is, independently, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, trifluoromethyl, cyanoethyloxy, methoxy,
ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy,
2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy,
butyryl, iso-butyryl, phenyl or aryl;
[0101] R.sub.k is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y;
[0102] R.sub.p is hydrogen, a nitrogen protecting group or
--R.sub.x--R.sub.y;
[0103] R.sub.x is a bond or a linking moiety;
[0104] R.sub.y is a chemical functional group, a conjugate group or
a solid support medium;
[0105] each R.sub.m and R.sub.n is, independently, H, a nitrogen
protecting group, substituted or unsubstituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein the
substituent groups are selected from hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl, alkynyl; NH.sub.3.sup.+, N(R.sub.u) (R.sub.v),
guanidino and acyl where said acyl is an acid amide or an
ester;
[0106] or R.sub.m and R.sub.n, together, are a nitrogen protecting
group, are joined in a ring structure that optionally includes an
additional heteroatom selected from N and O or are a chemical
functional group;
[0107] R.sub.i is OR.sub.z, SR.sub.z, or N(R.sub.z).sub.2;
[0108] each R.sub.z is, independently, H, C.sub.1-C.sub.8 alkyl,
C.sub.1-C.sub.8 haloalkyl, C(.dbd.NH)N(H)R.sub.u,
C(.dbd.O)N(H)R.sub.u or OC(.dbd.O)N(H)R.sub.u;
[0109] R.sub.f, R.sub.g and R.sub.h comprise a ring system having
from about 4 to about 7 carbon atoms or having from about 3 to
about 6 carbon atoms and 1 or 2 heteroatoms wherein said
heteroatoms are selected from oxygen, nitrogen and sulfur and
wherein said ring system is aliphatic, unsaturated aliphatic,
aromatic, or saturated or unsaturated heterocyclic;
[0110] R.sub.j is alkyl or haloalkyl having 1 to about 10 carbon
atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2
to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms,
N(R.sub.k) (R.sub.m) OR.sub.k, halo, SR.sub.k or CN;
[0111] m.sub.a is 1 to about 10;
[0112] each mb is, independently, 0 or 1;
[0113] mc is 0 or an integer from 1 to 10;
[0114] md is an integer from 1 to 10;
[0115] me is from 0, 1 or 2; and
[0116] provided that when mc is 0, md is greater than 1.
[0117] Representative substituents groups of Formula I are
disclosed in United States patent application Ser. No. 09/130,973,
filed Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy
Oligonucleotides," hereby incorporated by reference in its
entirety.
[0118] Representative cyclic substituent groups of Formula II are
disclosed in U.S. patent application Ser. No. 09/123,108, filed
Jul. 27, 1998, entitled "RNA Targeted 2'-Oligomeric compounds that
are Conformationally Preorganized," hereby incorporated by
reference in its entirety.
[0119] Particularly preferred sugar substituent groups include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and
m are from 1 to about 10.
[0120] Representative guanidino substituent groups that are shown
in formula III and IV are disclosed in co-owned U.S. patent
application Ser. No. 09/349,040, entitled "Functionalized
Oligomers", filed Jul. 7, 1999, hereby incorporated by reference in
its entirety.
[0121] Representative acetamido substituent groups are disclosed in
U.S. Pat. No. 6,147,200 which is hereby incorporated by reference
in its entirety.
[0122] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in International Patent Application PCT/US99/17895,
entitled "2'-O-Dimethylaminoethyloxyethyl-Oligomeric compounds",
filed Aug. 6, 1999, hereby incorporated by reference in its
entirety.
[0123] Modified Nucleobases/Naturally Occurring Nucleobases
[0124] Oligomeric compounds may also include nucleobase (often
referred to in the art simply as "base" or "heterocyclic base
moiety") modifications or substitutions. As used herein,
"unmodified" or "natural" nucleobases include the purine bases
adenine (A) and guanine (G), and the pyrimidine bases thymine (T),
cytosine (C) and uracil (U). Modified nucleobases also referred
herein as heterocyclic base moieties include other synthetic and
natural nucleobases such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine
and other alkynyl derivatives of pyrimidine bases, 6-azo uracil,
cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil,
8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other
8-substituted adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine
and 3-deazaguanine and 3-deazaadenine.
[0125] Heterocyclic base moieties may also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Further nucleobases include those disclosed in U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the oligomeric
compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0126] In one aspect of the present invention oligomeric compounds
are prepared having polycyclic heterocyclic compounds in place of
one or more heterocyclic base moieties. A number of tricyclic
heterocyclic compounds have been previously reported. These
compounds are routinely used in antisense applications to increase
the binding properties of the modified strand to a target strand.
The most studied modifications are targeted to guanosines hence
they have been termed G-clamps or cytidine analogs. Many of these
polycyclic heterocyclic compounds have the general formula: 10
[0127] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10.dbd.O,
R.sub.11--R.sub.14.dbd.H) [Kurchavov, et al., Nucleosides and
Nucleotides, 1997, 16, 1837-1846], 1,3-diazaphenothiazine-2-one
(R.sub.10.dbd.S, R.sub.11--R.sub.14.dbd.H), [Lin, K.-Y.; Jones, R.
J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874] and
6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R.sub.10.dbd.O,
R.sub.11--R.sub.14.dbd.F) [Wang, J.; Lin, K.-Y., Matteucci, M.
Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into
oligonucleotides these base modifications were shown to hybridize
with complementary guanine and the latter was also shown to
hybridize with adenine and to enhance helical thermal stability by
extended stacking interactions (also see U.S. Patent Application
entitled "Modified Peptide Nucleic Acids" filed May 24, 2002, Ser.
No. 10/155,920; and U.S. Patent Application entitled "Nuclease
Resistant Chimeric Oligonucleotides" filed May 24, 2002, Ser. No.
10/013,295, both of which are commonly owned with this application
and are herein incorporated by reference in their entirety).
[0128] Further helix-stabilizing properties have been observed when
a cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10.dbd.O,
R.sub.11.dbd.--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14.dbd.H)
[Lin, K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532].
Binding studies demonstrated that a single incorporation could
enhance the binding affinity of a model oligonucleotide to its
complementary target DNA or RNA with a .DELTA.T.sub.m of up to
18.degree. relative to 5-methyl cytosine (dC5.sup.me), which is the
highest known affinity enhancement for a single modification, yet.
On the other hand, the gain in helical stability does not
compromise the specificity of the oligonucleotides. The T.sub.m
data indicate an even greater discrimination between the perfect
match and mismatched sequences compared to dC5.sup.me. It was
suggested that the tethered amino group serves as an additional
hydrogen bond donor to interact with the Hoogsteen face, namely the
O6, of a complementary guanine thereby forming 4 hydrogen bonds.
This means that the increased affinity of G-clamp is mediated by
the combination of extended base stacking and additional specific
hydrogen bonding.
[0129] Further tricyclic heterocyclic compounds and methods of
using them that are amenable to the present invention are disclosed
in U.S. Pat. Ser. No. 6,028,183, which issued on May 22, 2000, and
U.S. Pat. Ser. No. 6,007,992, which issued on Dec. 28, 1999, the
contents of both are commonly assigned with this application and
are incorporated herein in their entirety.
[0130] The enhanced binding affinity of the phenoxazine derivatives
together with their uncompromised sequence specificity makes them
valuable nucleobase analogs for the development of more potent
antisense-based drugs. In fact, promising data have been derived
from in vitro experiments demonstrating that heptanucleotides
containing phenoxazine substitutions are capable to activate
RNaseH, enhance cellular uptake and exhibit an increased antisense
activity [Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120,
8531-8532]. The activity enhancement was even more pronounced in
case of G-clamp, as a single substitution was shown to
significantly improve the in vitro potency of a 20mer
2'-deoxyphosphorothioate oligonucleotides [Flanagan, W. M.; Wolf,
J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci,
M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518]. Nevertheless,
to optimize oligonucleotide design and to better understand the
impact of these heterocyclic modifications on the biological
activity, it is important to evaluate their effect on the nuclease
stability of the oligomers.
[0131] Further modified polycyclic heterocyclic compounds useful as
heterocyclcic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
patent application Ser. No. 09/996,292 filed Nov. 28, 2001, certain
of which are commonly owned with the instant application, and each
of which is herein incorporated by reference.
[0132] The oligonucleotides of the present invention also include
variants in which a different base is present at one or more of the
nucleotide positions in the oligonucleotide. For example, if the
first nucleotide is an adenosine, variants may be produced which
contain thymidine, guanosine or cytidine at this position. This may
be done at any of the positions of the oligonucleotide. Thus, a
20-mer may comprise 60 variations (20 positions.times.3 alternates
at each position) in which the original nucleotide is substituted
with any of the three alternate nucleotides. These oligonucleotides
are then tested using the methods described herein to determine
their ability to inhibit expression of HCV mRNA and/or HCV
replication.
[0133] Conjugates
[0134] A further preferred substitution that can be appended to the
oligomeric compounds of the invention involves the linkage of one
or more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting oligomeric
compounds. In one embodiment such modified oligomeric compounds are
prepared by covalently attaching conjugate groups to functional
groups such as hydroxyl or amino groups. Conjugate groups of the
invention include intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, polyethers, groups that enhance
the pharmacodynamic properties of oligomers, and groups that
enhance the pharmacokinetic properties of oligomers. Typical
conjugates groups include cholesterols, lipids, phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Representative conjugate groups are disclosed in International
Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire
disclosure of which is incorporated herein by reference. Conjugate
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-o-hexadecyl-rac-gly- cero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0135] The oligomeric compounds of the invention may also be
conjugated to active drug substances, for example, aspirin,
warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen,
ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in United States patent application
Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated
herein by reference in its entirety.
[0136] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0137] Chimeric Oligomeric Compounds
[0138] It is not necessary for all positions in an oligomeric
compound to be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
oligomeric compound or even at a single monomeric subunit such as a
nucleoside within a oligomeric compound. The present invention also
includes oligomeric compounds which are chimeric oligomeric
compounds. "Chimeric" oligomeric compounds or "chimeras," in the
context of this invention, are oligomeric compounds that contain
two or more chemically distinct regions, each made up of at least
one monomer unit, i.e., a nucleotide in the case of a nucleic acid
based oligomer.
[0139] Chimeric oligomeric compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
oligomeric compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
inhibition of gene expression. Consequently, comparable results can
often be obtained with shorter oligomeric compounds when chimeras
are used, compared to for example phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0140] Chimeric oligomeric compounds of the invention may be formed
as composite structures of two or more oligonucleotides,
oligonucleotide analogs, oligonucleosides and/or oligonucleotide
mimetics as described above. Such oligomeric compounds have also
been referred to in the art as hybrids hemimers, gapmers or
inverted gapmers. Representative United States patents that teach
the preparation of such hybrid structures include, but are not
limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0141] 3'-Endo Modifications
[0142] In one aspect of the present invention oligomeric compounds
include nucleosides synthetically modified to induce a 3'-endo
sugar conformation. A nucleoside can incorporate synthetic
modifications of the heterocyclic base, the sugar moiety or both to
induce a desired 3'-endo sugar conformation. These modified
nucleosides are used to mimic RNA like nucleosides so that
particular properties of an oligomeric compound can be enhanced
while maintaining the desirable 3'-endo conformational geometry.
There is an apparent preference for an RNA type duplex (A form
helix, predominantly 3'-endo) as a requirement (e.g. trigger) of
RNA interference which is supported in part by the fact that
duplexes composed of 2'-deoxy-2'-F-nucleosides appears efficient in
triggering RNAi response in the C. elegans system. Properties that
are enhanced by using more stable 3'-endo nucleosides include but
aren't limited to modulation of pharmacokinetic properties through
modification of protein binding, protein off-rate, absorption and
clearance; modulation of nuclease stability as well as chemical
stability; modulation of the binding affinity and specificity of
the oligomer (affinity and specificity for enzymes as well as for
complementary sequences); and increasing efficacy of RNA cleavage.
The present invention provides oligomeric triggers of RNAi having
one or more nucleosides modified in such a way as to favor a
C3'-endo type conformation. 11
[0143] Nucleoside conformation is influenced by various factors
including substitution at the 2', 3' or 4'-positions of the
pentofuranosyl sugar. Electronegative substituents generally prefer
the axial positions, while sterically demanding substituents
generally prefer the equatorial positions (Principles of Nucleic
Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation
can be achieved while maintaining the 2'-OH as a recognition
element, as illustrated in FIG. 2, below (Gallo et al.,
Tetrahedronl (2001), 57, 5707-5713. Harry- O'kuru et al., J. Org.
Chem., (1997), 62(6), 1754-1759 and Tang et al., J. Org. Chem
(1999), 64, 747-754.) Alternatively, preference for the 3'-endo
conformation can be achieved by deletion of the 2'-OH as
exemplified by 2'deoxy-2' F-nucleosides (Kawasaki et al., J. Med.
Chel . (1993), 36, 831-841), which adopts the 3'-endo conformation
positioning the electronegative fluorine atom in the axial
position. Other modifications of the ribose ring, for example
substitution at the 4'-position to give 4'-F modified nucleosides
(Guillerm et al., Bioorganic and Medicinal Chemistry Lettersl
(1995), 5, 1455-1460 and Owen et al., J. Org. Chem . (1976), 41,
3010-3017), or for example modification to yield methanocarba
nucleoside analogs (Jacobson et al., J. Med. Chem. Lett . (2000),
43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry
Letters (2001), 11, 1333-1337) also induce preference for the
3'-endo conformation. Along similar lines, oligomeric triggers of
RNAi response might be composed of one or more nucleosides modified
in such a way that conformation is locked into a C3'-endo type
conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem.
Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids
(ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters
(2002), 12, 73-76.) Examples of modified nucleosides amenable to
the present invention are shown below in Table I. These examples
are meant to be representative and not exhaustive.
1TABLE I 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
30
[0144] The preferred conformation of modified nucleosides and their
oligomers can be estimated by various methods such as molecular
dynamics calculations, nuclear magnetic resonance spectroscopy and
CD measurements. Hence, modifications predicted to induce RNA like
conformations, A-form duplex geometry in an oligomeric context, are
selected for use in the modified oligoncleotides of the present
invention. The synthesis of numerous modified nucleosides amenable
to the present invention are known in the art (see for example,
Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B.
Townsend, 1988, Plenum press., and the examples section below.)
[0145] In one aspect, the present invention is directed to
oligonucleotides that are prepared having enhanced properties
compared to native RNA against nucleic acid targets. A target is
identified and an oligonucleotide is selected having an effective
length and sequence that is complementary to a portion of the
target sequence. Each nucleoside of the selected sequence is
scrutinized for possible enhancing modifications. A preferred
modification would be the replacement of one or more RNA
nucleosides with nucleosides that have the same 3'-endo
conformational geometry. Such modifications can enhance chemical
and nuclease stability relative to native RNA while at the same
time being much cheaper and easier to synthesize and/or incorporate
into an oligonulceotide. The selected sequence can be further
divided into regions and the nucleosides of each region evaluated
for enhancing modifications that can be the result of a chimeric
configuration. Consideration is also given to the 5' and 3'-termini
as there are often advantageous modifications that can be made to
one or more of the terminal nucleosides. The oligomeric compounds
of the present invention include at least one 5'-modified phosphate
group on a single strand or on at least one 5'-position of a double
stranded sequence or sequences. Further modifications are also
considered such as internucleoside linkages, conjugate groups,
substitute sugars or bases, substitution of one or more nucleosides
with nucleoside mimetics and any other modification that can
enhance the selected sequence for its intended target. The terms
used to describe the conformational geometry of homoduplex nucleic
acids are "A Form" for RNA and "B Form" for DNA. The respective
conformational geometry for RNA and DNA duplexes was determined
from X-ray diffraction analysis of nucleic acid fibers (Arnott and
Hukins, Biochem. Biophys. Res. Comm., 1970, 47, 1504.) In general,
RNA:RNA duplexes are more stable and have higher melting
temperatures (Tm's) than DNA:DNA duplexes (Sanger et al.,
Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New
York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815;
Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The
increased stability of RNA has been attributed to several
structural features, most notably the improved base stacking
interactions that result from an A-form geometry (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2'
hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e.,
also designated as Northern pucker, which causes the duplex to
favor the A-form geometry. In addition, the 2' hydroxyl groups of
RNA can form a network of water mediated hydrogen bonds that help
stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35,
8489-8494). On the other hand, deoxy nucleic acids prefer a C2'
endo sugar pucker, i.e., also known as Southern pucker, which is
thought to impart a less stable B-form geometry (Sanger, W. (1984)
Principles of Nucleic Acid Structure, Springer-Verlag, New York,
N.Y.). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and O4'-endo pucker. This is consistent with
Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who
pointed out that in considering the furanose conformations which
give rise to B-form duplexes consideration should also be given to
a O4'-endo pucker contribution.
[0146] DNA:RNA hybrid duplexes, however, are usually less stable
than pure RNA:RNA duplexes, and depending on their sequence may be
either more or less stable than DNA:DNA duplexes (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid
duplex is intermediate between A- and B-form geometries, which may
result in poor stacking interactions (Lane et al., Eur. J.
Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993,
233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of
the duplex formed between a target RNA and a synthetic sequence is
central to therapies such as but not limited to antisense and RNA
interference as these mechanisms require the binding of a synthetic
oligonucleotide strand to an RNA target strand. In the case of
antisense, effective inhibition of the mRNA requires that the
antisense DNA have a very high binding affinity with the mRNA.
Otherwise the desired interaction between the synthetic
oligonucleotide strand and target mRNA strand will occur
infrequently, resulting in decreased efficacy.
[0147] One routinely used method of modifying the sugar puckering
is the substitution of the sugar at the 2'-position with a
substituent group that influences the sugar geometry. The influence
on ring conformation is dependant on the nature of the substituent
at the 2'-position. A number of different substituents have been
studied to determine their sugar puckering effect. For example,
2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the
2'-iodo exhibits the lowest population (7%). The populations of
adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively. Furthermore, the effect of the 2'-fluoro group of
adenosine dimers
(2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosin- e) is
further correlated to the stabilization of the stacked
conformation.
[0148] As expected, the relative duplex stability can be enhanced
by replacement of 2'-OH groups with 2'-F groups thereby increasing
the C3'-endo population. It is assumed that the highly polar nature
of the 2'-F bond and the extreme preference for C3'-endo puckering
may stabilize the stacked conformation in an A-form duplex. Data
from UV hypochromicity, circular dichroism, and .sup.1H NMR also
indicate that the degree of stacking decreases as the
electronegativity of the halo substituent decreases. Furthermore,
steric bulk at the 2'-position of the sugar moiety is better
accommodated in an A-form duplex than a B-form duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate
is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen
bonding capabilities. These substituent effects are thought to be
determined by the molecular size, electronegativity, and
hydrophobicity of the substituent. Melting temperatures of
complementary strands is also increased with the 2'-substituted
adenosine diphosphates. It is not clear whether the 3'-endo
preference of the conformation or the presence of the substituent
is responsible for the increased binding. However, greater overlap
of adjacent bases (stacking) can be achieved with the 3'-endo
conformation.
[0149] One synthetic 2'-modification that imparts increased
nuclease resistance and a very high binding affinity to nucleotides
is the 2-methoxyethoxy (2'-MOE, 2'-OCH.sub.2CH.sub.2OCH.sub.3) side
chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One
of the immediate advantages of the 2'-MOE substitution is the
improvement in binding affinity, which is greater than many similar
2' modifications such as O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-O-methoxyethyl substituent also have
been shown to be antisense inhibitors of gene expression with
promising features for in vivo use (Martin, P., Helv. Chim. Acta,
1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176;
Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and
Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
Relative to DNA, the oligonucleotides having the 2'-MOE
modification displayed improved RNA affinity and higher nuclease
resistance. Chimeric oligonucleotides having 2'-MOE substituents in
the wing nucleosides and an internal region of
deoxy-phosphorothioate nucleotides (also termed a gapped
oligonucleotide or gapmer) have shown effective reduction in the
growth of tumors in animal models at low doses. 2'-MOE substituted
oligonucleotides have also shown outstanding promise as antisense
agents in several disease states. One such MOE substituted
oligonucleotide is presently being investigated in clinical trials
for the treatment of CMV retinitis.
[0150] Chemistries Defined
[0151] Unless otherwise defined herein, alkyl means
C.sub.1-C.sub.12, preferably C.sub.1-C.sub.8, and more preferably
C.sub.1-C.sub.6, straight or (where possible) branched chain
aliphatic hydrocarbyl.
[0152] Unless otherwise defined herein, heteroalkyl means
C.sub.1-C.sub.12, preferably C.sub.1-C.sub.8, and more preferably
C.sub.1-C.sub.6, straight or (where possible) branched chain
aliphatic hydrocarbyl containing at least one, and preferably about
1 to about 3, hetero atoms in the chain, including the terminal
portion of the chain. Preferred heteroatoms include N, O and S.
Unless otherwise defined herein, cycloalkyl means C.sub.3-C.sub.12,
preferably C.sub.3-C.sub.8, and more preferably C.sub.3-C.sub.6,
aliphatic hydrocarbyl ring.
[0153] Unless otherwise defined herein, alkenyl means
C.sub.2-C.sub.12, preferably C.sub.2-C.sub.8, and more preferably
C.sub.2-C.sub.6 alkenyl, which may be straight or (where possible)
branched hydrocarbyl moiety, which contains at least one
carbon-carbon double bond.
[0154] Unless otherwise defined herein, alkynyl means
C.sub.2-C.sub.12, preferably C.sub.2-C.sub.8, and more preferably
C.sub.2-C.sub.6 alkynyl, which may be straight or (where possible)
branched hydrocarbyl moiety, which contains at least one
carbon-carbon triple bond.
[0155] Unless otherwise defined herein, heterocycloalkyl means a
ring moiety containing at least three ring members, at least one of
which is carbon, and of which 1, 2 or three ring members are other
than carbon. Preferably the number of carbon atoms varies from 1 to
about 12, preferably 1 to about 6, and the total number of ring
members varies from three to about 15, preferably from about 3 to
about 8. Preferred ring heteroatoms are N, O and S. Preferred
heterocycloalkyl groups include morpholino, thiomorpholino,
piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl,
homomorpholino, homothiomorpholino, pyrrolodinyl,
tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl,
tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and
tetrahydroisothiazolyl.
[0156] Unless otherwise defined herein, aryl means any hydrocarbon
ring structure containing at least one aryl ring. Preferred aryl
rings have about 6 to about 20 ring carbons. Especially preferred
aryl rings include phenyl, napthyl, anthracenyl, and
phenanthrenyl.
[0157] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least one fully unsaturated ring, the ring consisting
of carbon and non-carbon atoms. Preferably the ring system contains
about 1 to about 4 rings. Preferably the number of carbon atoms
varies from 1 to about 12, preferably 1 to about 6, and the total
number of ring members varies from three to about 15, preferably
from about 3 to about 8. Preferred ring heteroatoms are N, O and S.
Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl,
imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl,
quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl,
etc.
[0158] Unless otherwise defined herein, where a moiety is defined
as a compound moiety, such as hetarylalkyl (hetaryl and alkyl),
aralkyl (aryl and alkyl), etc., each of the sub-moieties is as
defined herein.
[0159] Unless otherwise defined herein, an electron withdrawing
group is a group, such as the cyano or isocyanato group that draws
electronic charge away from the carbon to which it is attached.
Other electron withdrawing groups of note include those whose
electronegativities exceed that of carbon, for example halogen,
nitro, or phenyl substituted in the ortho- or para-position with
one or more cyano, isothiocyanato, nitro or halo groups.
[0160] Unless otherwise defined herein, the terms halogen and halo
have their ordinary meanings. Preferred halo (halogen) substituents
are Cl, Br, and I.
[0161] The aforementioned optional substituents are, unless
otherwise herein defined, suitable substituents depending upon
desired properties. Included are halogens (Cl, Br, I), alkyl,
alkenyl, and alkynyl moieties, NO.sub.2, NH.sub.3 (substituted and
unsubstituted), acid moieties (e.g. --CO.sub.2H,
--OSO.sub.3H.sub.2, etc.), heterocycloalkyl moieties, hetaryl
moieties, aryl moieties, etc. In all the preceding formulae, the
squiggle (.about.) indicates a bond to an oxygen or sulfur of the
5'-phosphate.
[0162] Phosphate protecting groups include those described in U.S.
Pat. Nos. 5,760,209, U.S. Pat. No. 5,614,621, U.S. Pat. No.
6,051,699, U.S. Pat. No. 6,020,475, U.S. Pat. No. 6,326,478, U.S.
Pat. No. 6,169,177, U.S. Pat. No. 6,121,437, U.S. Pat. No.
6,465,628 each of which is expressly incorporated herein by
reference in its entirety.
[0163] The oligonucleotides in accordance with this invention
(single stranded or double stranded) preferably comprise from about
8 to about 80 nucleotides, more preferably from about 12-50
nucleotides and most preferably from about 15 to 30 nucleotides. As
is known in the art, a nucleotide is a base-sugar combination
suitably bound to an adjacent nucleotide through a phosphodiester,
phosphorothioate or other covalent linkage.
[0164] The oligonucleotides of the present invention also include
variants in which a different base is present at one or more of the
nucleotide positions in the oligonucleotide. For example, if the
first nucleotide is an adenosine, variants may be produced which
contain thymidine, guanosine or cytidine at this position. This may
be done at any of the positions of the oligonucleotide. Thus, a
20-mer may comprise 60 variations (20 positions.times.3 alternates
at each position) in which the original nucleotide is substituted
with any of the three alternate nucleotides. These oligonucleotides
are then tested using the methods described herein to determine
their ability to inhibit expression of p38.alpha. MAP kinase
mRNA.
[0165] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed; the actual synthesis
of the oligonucleotides is well within the talents of the
routineer. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and 2'-alkoxy or
2'-alkoxyalkoxy derivatives, including 2'-O-methoxyethyl
oligonucleotides [Martin, P., Helv. Chim. Acta, 78, 486 (1995)]. It
is also well known to use similar techniques and commercially
available modified amidites and controlled-pore glass (CPG)
products such as biotin, fluorescein, acridine or psoralen-modified
amidites and/or CPG (available from Glen Research, Sterling Va.) to
synthesize fluorescently labeled, biotinylated or other conjugated
oligonucleotides.
[0166] The antisense compounds of the present invention include
bioequivalent compounds, including pharmaceutically acceptable
salts and prodrugs. This is intended to encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to pharmaceutically
acceptable salts of the nucleic acids of the invention and prodrugs
of such nucleic acids.
[0167] Pharmaceutically acceptable "salts" are physiologically and
pharmaceutically acceptable salts of the nucleic acids of the
invention: i.e., salts that retain the desired biological activity
of the parent compound and do not impart undesired toxicological
effects thereto [see, for example, Berge et al., "Pharmaceutical
Salts," J. of Pharma Sci., 66:1 (1977)].
[0168] For oligonucleotides, examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0169] The oligonucleotides of the invention may additionally or
alternatively be prepared to be delivered in a "prodrug" form. The
term "prodrug" indicates a therapeutic agent that is prepared in an
inactive form that is converted to an active form (i.e., drug)
within the body or cells thereof by the action of endogenous
enzymes or other chemicals and/or conditions. In particular,
prodrug versions of the oligonucleotides of the invention are
prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives
according to the methods disclosed in WO 93/24510 to Gosselin et
al., published Dec. 9, 1993.
[0170] For therapeutic or prophylactic treatment, oligonucleotides
are administered in accordance with this invention. Oligonucleotide
compounds of the invention may be formulated in a pharmaceutical
composition, which may include pharmaceutically acceptable
carriers, thickeners, diluents, buffers, preservatives, surface
active agents, neutral or cationic lipids, lipid complexes,
liposomes, penetration enhancers, carrier compounds and other
pharmaceutically acceptable carriers or excipients and the like in
addition to the oligonucleotide. Such compositions and formulations
are comprehended by the present invention.
[0171] Pharmaceutical compositions comprising the oligonucleotides
of the present invention may include penetration enhancers in order
to enhance the alimentary delivery of the oligonucleotides.
Penetration enhancers may be classified as belonging to one of five
broad categories, i.e., fatty acids, bile salts, chelating agents,
surfactants and non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, 8:91-192; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1).
One or more penetration enhancers from one or more of these broad
categories may be included.
[0172] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional
compatible pharmaceutically-active materials such as, e.g.,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the composition of present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the invention.
[0173] Regardless of the method by which the oligonucleotides of
the invention are introduced into a patient, colloidal dispersion
systems may be used as delivery vehicles to enhance the in vivo
stability of the oligonucleotides and/or to target the
oligonucleotides to a particular organ, tissue or cell type.
Colloidal dispersion systems include, but are not limited to,
macromolecule complexes, nanocapsules, microspheres, beads and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, liposomes and lipid:oligonucleotide complexes of
uncharacterized structure. A preferred colloidal dispersion system
is a plurality of liposomes. Liposomes are microscopic spheres
having an aqueous core surrounded by one or more outer layers made
up of lipids arranged in a bilayer configuration [see, generally,
Chonn et al., Current Op. Biotech., 6, 698 (1995)].
[0174] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, epidermal and transdermal), oral or parenteral.
Parenteral administration includes intravenous drip, subcutaneous,
intraperitoneal or intramuscular injection, pulmonary
administration, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer, metered dose inhaler or dry
powder inhaler; intratracheal, intranasal, or intracranial, e.g.,
intrathecal or intraventricular, administration. Oligonucleotides
with at least one 2'-O-methoxyethyl modification are believed to be
particularly useful for oral administration.
[0175] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0176] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be
desirable.
[0177] Compositions for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. In some cases it may be more
effective to treat a patient with an oligonucleotide of the
invention in conjunction with other traditional therapeutic
modalities in order to increase the efficacy of a treatment
regimen. In the context of the invention, the term "treatment
regimen" is meant to encompass therapeutic, palliative and
prophylactic modalities. For example, a patient may be treated with
conventional chemotherapeutic agents, particularly those used for
tumor and cancer treatment. Examples of such chemotherapeutic
agents include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA),
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX),
colchicine,taxol, vincristine, vinblastine, etoposide,
trimetrexate, teniposide, cisplatin and diethylstilbestrol (DES).
See, generally, The Merck Manual of Diagnosis and Therapy, 15th
Ed., pp. 1206-1228, Berkow et al., eds., Rahay, N.J., 1987). When
used with the compounds of the invention, such chemotherapeutic
agents may be used individually (e.g., 5-FU and oligonucleotide),
sequentially (e.g., 5-FU and oligonucleotide for a period of time
followed by MTX and oligonucleotide), or in combination with one or
more other such chemotherapeutic agents (e.g., 5-FU, MTX and
oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).
[0178] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0179] Thus, in the context of this invention, by "therapeutically
effective amount" is meant the amount of the compound which is
required to have a therapeutic effect on the treated mammal. This
amount, which will be apparent to the skilled artisan, will depend
upon the type of mammal, the age and weight of the mammal, the type
of disease to be treated, perhaps even the gender of the mammal,
and other factors which are routinely taken into consideration when
treating a mammal with a disease. A therapeutic effect is assessed
in the mammal by measuring the effect of the compound on the
disease state in the animal. For example, if the disease to be
treated is cancer, therapeutic effects are assessed by measuring
the rate of growth or the size of the tumor, or by measuring the
production of compounds such as cytokines, production of which is
an indication of the progress or regression of the tumor.
[0180] The following examples illustrate the present invention and
are not intended to limit the same.
EXAMPLES
[0181] Eample 1
Synthesis of Oligonucleotides
[0182] Unmodified oligodeoxynucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 380B) using
standard phosphoramidite chemistry with oxidation by iodine.
.beta.-cyanoethyldiisopropyl-phosphoramidites were purchased from
Applied Biosystems (Foster City, Calif.). For phosphorothioate
oligonucleotides, the standard oxidation bottle was replaced by a
0.2 M solution of .sup.3H-1,2-benzodithiole-3-one 1,1-dioxide in
acetonitrile for the stepwise thiation of the phosphite linkages.
The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step.
[0183] 2'-methoxy oligonucleotides are synthesized using 2'-methoxy
.beta.-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham,
Mass.) and the standard cycle for unmodified oligonucleotides,
except the wait step after pulse delivery of tetrazole and base was
increased to 360 seconds. Other 2'-alkoxy oligonucleotides were
synthesized by a modification of this method, using appropriate
2'-modified amidites such as those available from Glen Research,
Inc., Sterling, Va.
[0184] 2'-fluoro oligonucleotides are synthesized as described in
Kawasaki et al., J. Med. Chem., 36, 831 (1993). Briefly, the
protected nucleoside N.sup.6-benzoyl-2'-deoxy-2'-fluoroadenosine is
synthesized utilizing commercially available
9-.beta.-D-arabinofuranosyladenine as starting material and by
modifying literature procedures whereby the 2'-.alpha.-fluoro atom
is introduced by a S.sub.N2-displacement of a 2'-.beta.-O-trifyl
group. Thus N.sup.6-benzoyl-9-.beta.-D-arabinofuranosy- ladenine is
selectively protected in moderate yield as the
3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the
THP and N.sup.6-benzoyl groups is accomplished using standard
methodologies and standard methods are used to obtain the
5'-dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite
intermediates.
[0185] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished
using tetraisopropyldisiloxanyl (TPDS) protected
9-.beta.-D-arabinofuranosylgua- nine as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group is followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation is followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies are used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidit- es.
[0186] Synthesis of 2'-deoxy-2'-fluorouridine is accomplished by
the modification of a known procedure in which
2,2'-anhydro-1-B-D-arabinofura- nosyluracil is treated with 70%
hydrogen fluoride-pyridine. Standard procedures are used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0187] 2'-deoxy-2'-fluorocytidine is synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N.sup.4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures are
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0188] 2'-(2-methoxyethyl)-modified amidites were synthesized
according to Martin, P., Helv. Chim. Acta, 78,486 (1995). For ease
of synthesis, the last nucleotide was a deoxynucleotide.
2'-O--CH.sub.2CH.sub.2OCH.sub.3-cy- tosines may be 5-methyl
cytosines. Synthesis of 5-Methyl Cytosine Monomers:
[0189]
2,2'-Anhydro[1-(.beta.-D-arabinofuranosyl)-5-methyluridine]:
[0190] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M),
diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g,
0.024 M) were added to DMF (300 mL). The mixture was heated to
reflux, with stirring, allowing the evolved carbon dioxide gas to
be released in a controlled manner. After 1 hour, the slightly
darkened solution was concentrated under reduced pressure. The
resulting syrup was poured into diethylether (2.5 L), with
stirring. The product formed a gum. The ether was decanted and the
residue was dissolved in a minimum amount of methanol (ca. 400 mL).
The solution was poured into fresh ether (2.5 L) to yield a stiff
gum. The ether was decanted and the gum was dried in a vacuum oven
(60.degree. C. at 1 mm Hg for 24 hours) to give a solid which was
crushed to a light tan powder (57 g, 85% crude yield). The material
was used as is for further reactions.
[0191] 2'-O-Methoxyethyl-5-methyluridine:
[0192] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of
product.
[0193] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:
[0194] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0195]
3'-O-Acetyl-2'-O-methoxyethyl-51-O-dimethoxytrityl-5-methyluridine:
[0196] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by tic by first quenching the tic
sample with the addition of MeOH. Upon completion of the reaction,
as judged by tic, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/Hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%).
[0197]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine:
[0198] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10EC, and the resulting
mixture stirred for an additional 2 hours. The first solution was
added dropwise, over a 45 minute period, to the later solution. The
resulting reaction mixture was stored overnight in a cold room.
Salts were filtered from the reaction mixture and the solution was
evaporated. The residue was dissolved in EtOAc (1 L) and the
insoluble solids were removed by filtration. The filtrate was
washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0199] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine:
[0200] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (tlc showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
[0201]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine:
[0202] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, tlc showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/-Hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0203]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine-3'-amidite:
[0204]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine (74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L)
Tetrazole diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (tlc showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using
EtOAc.backslash.Hexane (3:1) as the eluting solvent. The pure
fractions were combined to give 90.6 g (87%) of the title
compound.
[0205] 5-methyl-2'-deoxycytidine (5-me-C) containing
oligonucleotides were synthesized according to published methods
[Sanghvi et al., Nucl. Acids Res., 21, 3197 (1993)] using
commercially available phosphoramidites (Glen Research, Sterling
Va. or ChemGenes, Needham Mass.).
[0206] 2=-O-(dimethylaminooxyethyl) Nucleoside Amidites
[0207] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
[0208]
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0209] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g,
0.013eq, 0.0054 mmol) are dissolved in dry pyridine (500 ml) at
ambient temperature under an argon atmosphere and with mechanical
stirring. tert-Butyldiphenylchlor- osilane (125.8 g, 119.0 mL,
1.1eq, 0.458 mmol) is added in one portion. The reaction is stirred
for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate)
indicates a complete reaction. The solution is concentrated under
reduced pressure to a thick oil. This is partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer is dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil is
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution is cooled to -10.degree. C. The resulting
crystalline product is collected by filtration, washed with ethyl
ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to
149 g (74.8%) of white solid. TLC and NMR are used to check
consistency with pure product.
[0210]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0211] In a 2 L stainless steel, unstirred pressure reactor is
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) is added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are
added with manual stirring. The reactor is sealed and heated in an
oil bath until an internal temperature of 160.degree. C. is reached
and then maintained for 16 h (pressure<100 psig). The reaction
vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired
product and Rf 0.82 for ara-T side product, ethyl acetate)
indicates % conversion to the product. In order to avoid additional
side product formation, the reaction is stopped, concentrated under
reduced pressure (10 to 1 mm Hg) in a warm water bath
(40-100.degree. C.) with the more extreme conditions used to remove
the ethylene glycol. [Alternatively, once the low boiling solvent
is gone, the remaining solution can be partitioned between ethyl
acetate and water. The product will be in the organic phase.] The
residue is purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions are combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. TLC and NMR are used to
determine consistency with pure product.
[0212]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne
[0213]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819, 86%).
[0214]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine
[0215]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) is dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) is added dropwise at
-10.degree. C. to 0.degree. C. After 1 hr the mixture is filtered,
the filtrate is washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase is washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution is concentrated to get
2'-O-(aminooxyethyl) thymidine, which is then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1eg.)
is added and the mixture for 1 hr. Solvent is removed under vacuum;
residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri-
dine as white foam.
[0216]
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-met-
hyluridine
[0217]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) is dissolved in a solution of 1M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) is added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture is
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel is removed from the ice bath and stirred at room temperature
for 2 hr, the reaction monitored by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) is
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase is dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue is dissolved in a solution of 1M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) is added and
the reaction mixture is stirred at room temperature for 10 minutes.
Reaction mixture cooled to 10.degree. C. in an ice bath, sodium
cyanoborohydride (0.39 g, 6.13 mmol) is added and reaction mixture
stirred at 10.degree. C. for 10 minutes. After 10 minutes, the
reaction mixture is removed from the ice bath and stirred at room
temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3 (25
mL) solution is added and extracted with ethyl acetate (2.times.25
mL). Ethyl acetate layer is dried over anhydrous Na.sub.2SO.sub.4
and evaporated to dryness. The residue obtained is purified by
flash column chromatography and eluted with 5% MeOH in
CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylam-
inooxyethyl]-5-methyluridine as a white foam (14.6 g).
[0218] 2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0219] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) is
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF is then added to
5'-O-tert-butyldiphenylsily-
l-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction is
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent is removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg).
[0220] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0221] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) is dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It is then co-evaporated with anhydrous pyridine (20
mL). The residue obtained is dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) is added to the
mixture and the reaction mixture is stirred at room temperature
until all of the starting material disappeared. Pyridine is removed
under vacuum and the residue chromatographed and eluted with 10%
MeOH in CH.sub.2Cl.sub.2 (containing a few drops of pyridine) to
get 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-m- ethyluridine (1.13
g).
[0222]
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2--
cyanoethyl)-N,N-diisopropylphosphoramidite]
[0223] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) is co-evaporated with toluene (20 mL). To the residue
N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) is added and
dried over P.sub.2O.sub.5 under high vacuum overnight at 40.degree.
C. Then the reaction mixture is dissolved in anhydrous acetonitrile
(8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1'-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) is added. The reaction mixture is stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent is evaporated, then the residue is dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer is dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained is chromatographed (ethyl acetate as
eluent) to get 5'-O-DMT-2'-O-(2-N,N-dim-
ethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N-diisopropylphos-
phoramidite] as a foam (1.04 g).
[0224] 2'-(Aminooxyethoxy) Nucleoside Amidites
[0225] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the
art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as
described in the following paragraphs. Adenosine, cytidine and
thymidine nucleoside amidites are prepared similarly.
[0226]
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-
-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidi-
te]
[0227] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside
along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl)
diaminopurine riboside may be resolved and converted to
2'-O-(2-ethylacetyl)guanosine by treatment with adenosine
deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO
94/02501 A1 940203.) Standard protection procedures should afford
2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'--
dimethoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime-
thoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphen-
ylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine-3'-[-
(2-cyanoethyl)-N,N-diisopropylphosphoramidite].
[0228] Oligonucleotides having methylene (methylimino) (MMI)
backbones are synthesized according to U.S. Pat. No. 5,378,825,
which is coassigned to the assignee of the present invention and is
incorporated herein in its entirety. For ease of synthesis, various
nucleoside dimers containing MMI linkages were synthesized and
incorporated into oligonucleotides. Other nitrogen-containing
backbones are synthesized according to WO 92/20823 which is also
coassigned to the assignee of the present invention and
incorporated herein in its entirety.
[0229] Oligonucleotides having amide backbones are synthesized
according to De Mesmaeker et al., Acc. Chem. Res., 28, 366 (1995).
The amide moiety is readily accessible by simple and well-known
synthetic methods and is compatible with the conditions required
for solid phase synthesis of oligonucleotides.
[0230] Oligonucleotides with morpholino backbones are synthesized
according to U.S. Pat. No. 5,034,506 (Summerton and Weller).
[0231] Peptide-nucleic acid (PNA) oligomers are synthesized
according to P. E. Nielsen et al., Science, 254, 1497 (1991).
[0232] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides are
purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes
ethanol. Synthesized oligonucleotides were analyzed by
polyacrylamide gel electrophoresis on denaturing gels and judged to
be at least 85% full length material. The relative amounts of
phosphorothioate and phosphodiester linkages obtained in synthesis
were periodically checked by .sup.31P nuclear magnetic resonance
spectroscopy, and for some studies oligonucleotides were purified
by HPLC, as described by Chiang et al., J. Biol. Chem., 266, 18162
(1991). Results obtained with HPLC-purified material were similar
to those obtained with non-HPLC purified material.
Example 2
Human p38.alpha. Oligonucleotide Sequences
[0233] Antisense oligonucleotides were designed to target human
p38.alpha.. Target sequence data are from the p38 MAPK cDNA
sequence; Genbank accession number L35253, provided herein as SEQ
ID NO: 1. Oligonucleotides was synthesized as chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of eight 2'-deoxynucleotides,
which is flanked on both sides (5' and 3' directions) by
six-nucleotide "wings." The wings are composed of 2'-methoxyethyl
(2'-MOE) nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
2'-MOE cytosines were 5-methylcytosines. These oligonucleotide
sequences are shown in Table 1.
[0234] The human Jurkat T-cell line (American Type Culture
Collection, Manassas, Va.) was maintained in RPMI 1640 growth media
supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan,
Utah). HUVEC cells (Clonetics, San Diego, Calif.) were cultivated
in endothelial basal media supplemented with 10% FBS (Hyclone,
Logan, Utah).
[0235] Jurkat cells were grown to approximately 75% confluency and
resuspended in culture media at a density of 1.times.10.sup.7
cells/ml. A total of 3.6.times.10.sup.6 cells were employed for
each treatment by combining 360 .mu.l of cell suspension with
oligonucleotide at the indicated concentrations to reach a final
volume of 400 .mu.l. Cells were then transferred to an
electroporation cuvette and electroporated using an Electrocell
Manipulator 600 instrument (Biotechnologies and Experimental
Research, Inc.) employing 150 V, 1000 .mu.F, at 13 .OMEGA..
Electroporated cells were then transferred to conical tubes
containing 5 ml of culture media, mixed by inversion, and plated
onto 10 cm culture dishes.
[0236] HUVEC cells were allowed to reach 75% confluency prior to
use. The cells were washed twice with warm (37.degree. C.)
OPTI-MEM.TM. (Life Technologies). The cells were incubated in the
presence of the appropriate culture medium, without the growth
factors added, and the oligonucleotide formulated in LIPOFECTIN7
(Life Technologies), a 1:1 (w/w) liposome formulation of the
cationic lipid N-[1-(2,3-dioleyloxy)pro-
pyl]-n,n,n-trimethylammonium chloride (DOTMA), and dioleoyl
phosphotidylethanolamine (DOPE) in membrane filtered water. HUVEC
cells were treated with 100 nM oligonucleotide in 10 .mu.g/ml
LIPOFECTIN7. Treatment was for four hours.
[0237] Total mRNA was isolated using the RNEASY7 Mini Kit (Qiagen,
Valencia, Calif.; similar kits from other manufacturers may also be
used), separated on a 1% agarose gel, transferred to HYBOND.TM.-N+
membrane (Amersham Pharmacia Biotech, Piscataway, N.J.), a
positively charged nylon membrane, and probed. p38 MAPK probes were
made using the Prime-A-Gene7 kit (Promega Corporation, Madison,
Wis.), a random primer labeling kit, using mouse p38.alpha. or
p38.beta. cDNA as a template. A glyceraldehyde 3-phosphate
dehydrogenase (G3PDH) probe was purchased from Clontech (Palo Alto,
Calif.), Catalog Number 9805-1. The fragments were purified from
low-melting temperature agarose, as described in Maniatis, T., et
al., Molecular Cloning: A Laboratory Manual, 1989. The G3PDH probe
was labeled with REDIVUE.TM. .sup.32P-dCTP (Amersham Pharmacia
Biotech, Piscataway, N.J.) and Strip-EZ labelling kit (Ambion,
Austin, Tex.). mRNA was quantitated by a PhosphoImager (Molecular
Dynamics, Sunnyvale, Calif.).
2TABLE 1 Nucleotide Sequences of Human p38.alpha. Chimeric (deoxy
gapped) Phosphorothioate Oligonucleotides SEQ TARGET GENE GENE ISIS
NUCLEOTIDE SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' .fwdarw. 3')
NO: CO-ORDINATES.sup.2 REGION 16486 AAGACCGGGCCCGGAATTCC 3
0001-0020 5'-UTR 16487 GTGGAGGCCAGTCCCCGGGA 4 0044-0063 5'-UTR
16488 TGGCAGCAAAGTGCTGCTGG 5 0087-0106 5'-UTR 16489
CAGAGAGCCTCCTGGGAGGG 6 0136-0155 5'-UTR 16490 TGTGCCGAATCTCGGCCTCT
7 0160-0179 5'-UTR 16491 GGTCTCGGGCGACCTCTCCT 8 0201-0220 5'-UTR
16492 CAGCCGCGGGACCAGCGGCG 9 0250-0269 5'-UTR 16493
CATTTTCCAGCGGCAGCCGC 10 0278-0297 AUG 16494 TCCTGAGACATTTTCCAGCG 11
0286-0305 AUG 16495 CTGCCGGTAGAACGTGGGCC 12 0308-0327 coding 16496
GTAAGCTTCTGACATTTCAC 13 0643-0662 coding 16497 TTTAGGTCCCTGTGAATTAT
14 0798-0817 coding 16498 ATGTTCTTCCAGTCAACAGC 15 0939-0958 coding
16499 TAAGGAGGTCCCTGCTTTCA 16 1189-1208 coding 16500
AACCAGGTGCTCAGGACTCC 17 1368-1387 stop 16501 GAAGTGGGATCAACAGAACA
18 1390-1409 3'-UTR 16502 TGAAAAGGCCTTCCCCTCAC 19 1413-1432 3'-UTR
16503 AGGCACTTGAATAATATTTG 20 1444-1463 3'-UTR 16504
CTTCCACCATGGAGGAAATC 21 1475-1494 3'-UTR 16505 ACACATGCACACACACTAAC
22 1520-1539 3'-UTR .sup.1Emboldened residues, 2'-methoxyethoxy-
residues (others are 2'-deoxy-) including "C" residues,
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Co-ordinates from Genbank Accession No. L35253, locus name
"HUMMAPKNS", SEQ ID NO. 1.
[0238] For an initial screen of human p38.alpha. antisense
oligonucleotides, Jurkat cells were electroporated with 10 .mu.M
oligonucleotide. mRNA was measured by Northern blot. Results are
shown in Table 2. Oligonucleotides 16496 (SEQ ID NO. 13), 16500
(SEQ ID NO. 17) and 16503 (SEQ ID NO. 20) gave 35% or greater
inhibition of p38.alpha. mRNA.
3TABLE 2 Inhibition of Human p38.alpha. mRNA expression in Jurkat
Cells by Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides
SEQ GENE ISIS ID TARGET % mRNA % mRNA No: NO: REGION EXPRESSION
INHIBITION control -- -- 100% 0% 16486 3 5'-UTR 212% -- 16487 4
5'-UTR 171% -- 16488 5 5'-UTR 157% -- 16489 6 5'-UTR 149% -- 16490
7 5'-UTR 152% -- 16491 8 5'-UTR 148% -- 16492 9 5'-UTR 125% --
16493 10 AUG 101% -- 16494 11 AUG 72% 28% 16495 12 coding 72% 28%
16496 13 coding 61% 39% 16497 14 coding 104% -- 16498 15 coding 88%
12% 16499 16 coding 74% 26% 16500 17 stop 63% 37% 16501 18 3'-UTR
77% 23% 16502 19 3'-UTR 79% 21% 16503 20 3'-UTR 65% 35% 16504 21
3'-UTR 72% 28% 16505 22 3'-UTR 93% 7%
[0239] The most active human p38.alpha. oligonucleotides were
chosen for dose response studies. Oligonucleotide 16490 (SEQ ID NO.
7) which showed no inhibition in the initial screen was included as
a negative control. Jurkat cells were grown and treated as
described above except the concentration of oligonucleotide was
varied as indicated in Table 3. Results are shown in Table 3. Each
of the active oligonucleotides showed a dose response effect with
IC.sub.50s around 10 nM. Maximum inhibition was approximately 70%
with 16500 (SEQ ID NO 17). The most active oligonucleotides were
also tested for their ability to inhibit p38.beta.. None of these
oligonucleotides significantly reduced p38.beta. mRNA
expression.
4TABLE 3 Dose Response of p38.alpha. mRNA in Jurkat cells to human
p38.alpha. Chimeric (deoxy gapped) Phosphorothioate
Oligonucleotides SEQ ID ASO Gene % mRNA % mRNA ISIS # NO: Target
Dose Expression Inhibition control -- -- -- 100% 0% 16496 13 coding
2.5 nM 94% 6% " " " 5 nM 74% 26% " " " 10 nM 47% 53% " " " 20 nM
41% 59% 16500 17 stop 2.5 nM 82% 18% " " " 5 nM 71% 29% " " " 10 nM
49% 51% " " " 20 nM 31% 69% 16503 20 3'-UTR 2.5 nM 74% 26% " " " 5
nM 61% 39% " " " 10 nM 53% 47% " " " 20 nM 41% 59% 16490 7 5'-UTR
2.5 nM 112% -- " " " 5 nM 109% -- " " " 10 nM 104% -- " " " 20 nM
97% 3%
Example 3
Human p38.beta. Oligonucleotide Sequences
[0240] Antisense oligonucleotides were designed to target human
p38.beta.. Target sequence data are from the p38.beta. MAPK cDNA
sequence; Genbank accession number U53442, provided herein as SEQ
ID NO: 23. Oligonucleotides was synthesized as chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
2'-MOE cytosines were 5-methyl-cytosines. These oligonucleotide
sequences are shown in Table 4.
5TABLE 4 Nucleotide Sequences of Human p38.beta. Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' .fwdarw. 3') NO:
CO-ORDINATES.sup.2 REGION 17891 CGACATGTCCGGAGCAGAAT 25 0006-0025
AUG 17892 TTCAGCTCCTGCCGGTAGAA 26 0041-0060 coding 17893
TGCGGCACCTCCCACACGGT 27 0065-0084 coding 17894 CCGAACAGACGGAGCCGTAT
28 0121-0140 coding 17895 GTGCTTCAGGTGCTTGAGCA 29 0240-0259 coding
17896 GCGTGAAGACGTCCAGAAGC 30 0274-0293 coding 17897
ACTTGACGATGTTGTTCAGG 31 0355-0374 coding 17898 AACGTGCTCGTCAAGTGCCA
32 0405-0424 coding 17899 ATCCTGAGCTCACAGTCCTC 33 0521-0540 coding
17900 ACTGTTTGGTTGTAATGCAT 34 0635-0654 coding 17901
ATGATGCGCTTCAGCTGGTC 35 0731-0750 coding 17902 GCCAGTGCCTCAGGTGCACT
36 0935-0954 coding 17903 AACGCTCTCATCATATGGCT 37 1005-1024 coding
17904 CAGCACCTCACTGCTCAATC 38 1126-1145 stop 17905
TCTGTGACCATAGGAGTGTG 39 1228-1247 3'-UTR 17906 ACACATGTTTGTGCATGCAT
40 1294-1313 3'-UTR 17907 CCTACACATGGCAAGCACAT 41 1318-1337 3'-UTR
17908 TCCAGGCTGAGCAGCTCTAA 42 1581-1600 3'-UTR 17909
AGTGCACGCTCATCCACACG 43 1753-1772 3'-UTR 17910 CTTGCCAGATATGGCTGCTG
44 1836-1855 3'-UTR .sup.1Emboldened residues, 2'-methoxyethoxy-
residues (others are 2'-deoxy-) including "C" residues,
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Co-ordinates from Genbank Accession No. U53442, locus name
"HSU53442", SEQ ID NO. 23.
[0241] For an initial screen of human p38.beta. antisense
oligonucleotides, HUVEC cells were cultured and treated as
described in Example 2. mRNA was measured by Northern blot as
described in Example 2. Results are shown in Table 5. Every
oligonucleotide tested gave at least 50% inhibition.
Oligonucleotides 17892 (SEQ ID NO. 26), 17893 (SEQ ID NO. 27),
17894 (SEQ ID NO. 28), 17899 (SEQ ID NO. 33), 17901 (SEQ ID NO.
35), 17903 (SEQ ID NO. 37), 17904 (SEQ ID NO. 38), 17905 (SEQ ID
NO. 39), 17907 (SEQ ID NO. 41), 17908 (SEQ ID NO. 42), and 17909
(SEQ ID NO. 43) gave greater than approximately 85% inhibition and
are preferred.
6TABLE 5 Inhibition of Human p38.beta. mRNA expression in Huvec
Cells by Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides
SEQ GENE ISIS ID TARGET % mRNA % mRNA No: NO: REGION EXPRESSION
INHIBITION control -- -- 100% 0% 17891 25 AUG 22% 78% 17892 26
coding 10% 90% 17893 27 coding 4% 96% 17894 28 coding 13% 87% 17895
29 coding 25% 75% 17896 30 coding 24% 76% 17897 31 coding 25% 75%
17898 32 coding 49% 51% 17899 33 coding 5% 95% 17900 34 coding 40%
60% 17901 35 coding 15% 85% 17902 36 coding 49% 51% 17903 37 coding
11% 89% 17904 38 stop 9% 91% 17905 39 3'-UTR 14% 86% 17906 40
3'-UTR 22% 78% 17907 41 3'-UTR 8% 92% 17908 42 3'-UTR 17% 83% 17909
43 3'-UTR 13% 87% 17910 44 3'-UTR 26% 74%
[0242] Oligonucleotides 17893 (SEQ ID NO. 27), 17899 (SEQ ID
NO:33), 17904 (SEQ ID NO. 38), and 17907 (SEQ ID NO. 41) were
chosen for dose response studies. HUVEC cells were cultured and
treated as described in Example 2 except that the oligonucleotide
concentration was varied as shown in Table 6. The Lipofectin7/Oligo
ratio was maintained at 3 .mu.g Lipofectin7/100 nM oligo, per ml.
mRNA was measured by Northern blot as described in Example 2.
[0243] Results are shown in Table 6. Each oligonucleotide tested
had an IC.sub.50 of less than 10 nM. The effect of these
oligonucleotides on human p38.alpha. was also determined. Only
oligonucleotide 17893 (SEQ ID NO. 27) showed an effect on
p38.alpha. mRNA expression. The IC.sub.50 of this oligonucleotide
was approximately 4 fold higher for p38.alpha. compared to
p38.beta..
7TABLE 6 Dose Response of p38.beta. in Huvec cells to human
p38.beta. Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides
SEQ ID ASO Gene % mRNA % mRNA ISIS # NO: Target Dose Expression
Inhibition control -- -- -- 100% 0% 17893 27 coding 10 nM 37% 63% "
" " 25 nM 18% 82% " " " 50 nM 16% 84% " " " 100 nM 19% 81% 17899 33
coding 10 nM 37% 63% " " " 25 nM 23% 77% " " " 50 nM 18% 82% " " "
100 nM 21% 79% 17904 38 stop 10 nM 31% 69% " " " 25 nM 21% 79% " "
" 50 nM 17% 83% " " " 100 nM 19% 81% 17907 41 3'-UTR 10 nM 37% 63%
" " " 25 nM 22% 78% " " " 50 nM 18% 72% " " " 100 nM 18% 72%
Example 4
Rat p38.alpha. Oligonucleotide Sequences
[0244] Antisense oligonucleotides were designed to target rat
p38.alpha.. Target sequence data are from the p38 MAPK cDNA
sequence; Genbank accession number U73142, provided herein as SEQ
ID NO: 45. Oligonucleotides was synthesized as chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages in the wings
are phosphodiester (P.dbd.O). Internucleoside linkages in the
central gap are phosphorothioate (P.dbd.S). All 2'-MOE cytosines
and 2'-OH cytosines were 5-methyl-cytosines. These oligonucleotide
sequences are shown in Table 7.
[0245] bEND.3, a mouse endothelial cell line (gift of Dr. Werner
Risau; see Montesano et al., Cell, 1990, 62, 435, and Stepkowski et
al., J. Immunol., 1994, 153, 5336) were grown in high-glucose DMEM
(Life Technologies, Gaithersburg, Md.) medium containing 10% fetal
bovine serum (FBS) and 1% Penicillin/Streptomycinin. Cells were
plated at approximately 2.times.10.sup.5 cells per 100 mm dish.
Within 48 hours of plating, the cells were washed with
phosphate-buffered saline (Life Technologies). Then, Opti-MEM7
medium containing 3 .mu.g/mL LIPOFECTIN.sup.7 and an appropriate
amount of oligonucleotide were added to the cells. As a control,
cells were treated with LIPOFECTIN.sup.7 without oligonucleotide
under the same conditions and for the same times as the
oligonucleotide-treated samples.
[0246] After 4 hours at 37.degree. C., the medium was replaced with
high glucose DMEM medium containing 10% FBS and 1%
Penicillin/Streptomycinin. The cells were typically allowed to
recover overnight (about 18 to 24 hours) before RNA and/or protein
assays were performed as described in Example 2. The p38.alpha.,
p38.beta. and G3PDH probes used were identical to those described
in Example 2.
8TABLE 7 Nucleotide Sequences of Rat p38.alpha. Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' .fwdarw. 3') NO
CO-ORDINATES.sup.2 REGION 21844
CoToGoCoGsAsCsAsTsTsTsTsCsCsAsGoCoGoGoC 47 0001-0020 AUG 21845
GoGoToAoAsGsCsTsTsCsTsGsAsCsAsCoToToCoA 48 0361-0380 coding 21846
GoGoCoCoAsGsAsGsAsCsTsGsAsAsTsGoToAoGoT 49 0781-0800 coding 21871
CoAoToCoAsTsCsAsGsGsGsTsCsGsTsGoGoToAoC 50 0941-0960 coding 21872
GoGoCoAoCsAsAsAsGsCsTsAsAsTsGsAoCo- ToToC 51 1041-1060 coding 21873
AoGoGoToGsCsTsCsAsGsGsAsCs- TsCsCoAoToToT 52 1081-1100 stop 21874
GoGoAoToGsGsAsCsAsGsAsAsCsAsGsAoAoGoCoA 53 1101-1120 3'-UTR 21875
GoAoGoCoAsGsGsCsAsGsAsCsTsGsCsCoAoAoGoG 54 1321-1340 3'-UTR 21876
AoGoGoCoTsAsGsAsGsCsCsCsAsGsGsAoGoCoCoA 55 1561-1580 3'-UTR 21877
GoAoGoCoCsTsGsTsGsCsCsTsGsGsCsAoCoToGoG 56 1861-1880 3'-UTR 21878
ToGoCoAoCsCsAsCsAsAsGsCsAsCsCsToGo- GoAoG 57 2081-2100 3'-UTR 21879
GoGoCoToAsCsCsAsTsGsAsGsTs- GsAsGoAoAoGoA 58 2221-2240 3'-UTR 21880
GoToCoCoCsTsGsCsAsCsTsGsAsTsAsGoAoGoAoA 59 2701-2720 3'-UTR 21881
ToCoToToCsCsAsAsTsGsGsAsGsAsAsAoCoToGoG 60 3001-3020 3'-UTR
[0247] .sup.1Emboldened residues, 2'-methoxyethoxy-residues (others
are 2'-deoxy-); 2'-MOE cytosines and 2'-deoxy cytosine residues are
5-methyl-cytosines; "s" linkages are phosphorothioate linkages; "o"
linkages are phosphodiester linkages. .sup.2 Co-ordinates from
Genbank Accession No. U73142, locus name "RNU73142", SEQ ID NO.
45.
[0248] Rat p38.alpha. antisense oligonucleotides were screened in
bEND.3 cells for inhibition of p38.alpha. and p38.beta. mRNA
expression. The concentration of oligonucleotide used was 100 nM.
Results are shown in Table 8. Oligonucleotides 21844 (SEQ ID NO.
47), 21845 (SEQ ID NO. 48), 21872 (SEQ ID NO. 51), 21873 (SEQ ID
NO. 52), 21875 (SEQ ID NO. 54), and 21876 (SEQ ID NO.
[0249] 55) showed greater than approximately 70% inhibition of
p38.alpha. mRNA with minimal effects on p38.beta. mRNA levels.
Oligonucleotide 21871 (SEQ ID NO. 50) inhibited both p38.alpha. and
p38.beta. levels greater than 70%.
9TABLE 8 Inhibition of Mouse p38 mRNA expression in bEND.3 Cells by
Chimeric (deoxy gapped) Mixed Backbone p38.alpha. Antisense
Oligonucleotides SEQ GENE ISIS ID TARGET % p38.alpha. mRNA %
p38.beta. mRNA No: NO: REGION INHIBITION INHIBITION control -- --
0% 0% 21844 47 AUG 81% 20% 21845 48 coding 75% 25% 21871 50 coding
90% 71% 21872 51 coding 87% 23% 21873 52 stop 90% 3% 21874 53
3'-UTR 38% 21% 21875 54 3'-UTR 77% -- 21876 55 3'-UTR 69% -- 21877
56 3'-UTR 55% 13% 21878 57 3'-UTR 25% 10% 21879 58 3'-UTR -- --
21881 60 3'-UTR -- --
[0250] Several of the most active oligonucleotides were selected
for dose response studies. bEND.3 cells were cultured and treated
as described above, except that the concentration of
oligonucleotide was varied as noted in Table 9. Results are shown
in Table 9.
10TABLE 9 Dose Response of bEND.3 cells to rat p38.beta. Chimeric
(deoxy gapped) Phosphorothioate Oligonucleotides SEQ ID ASO Gene %
p38.alpha. mRNA % p38.beta. mRNA ISIS # NO: Target Dose Inhibition
Inhibition control -- -- -- 100% 0% 21844 47 AUG 1 nM -- -- " " " 5
nM -- -- " " " 25 nM 36% 8% " " " 100 nM 80% 5% 21871 50 coding 1
nM 1% -- " " " 5 nM 23% 4% " " " 25 nM 34% 24% " " " 100 nM 89% 56%
21872 51 stop 1 nM -- -- " " " 5 nM -- -- " " " 25 nM 35% -- " " "
100 nM 76% 1% 21873 52 stop 1 nM -- 53% " " " 5 nM -- 31% " " " 25
nM 54% 28% " " " 100 nM 92% 25% 21875 54 3'-UTR 1 nM -- 11% " " " 5
nM -- 16% " " " 25 nM 33% 2% " " " 100 nM 72% 4%
Example 5
Mouse p38.beta. Oligonucleotide Sequences
[0251] Antisense oligonucleotides were designed to target mouse
p38.beta.. Target sequence data are from a mouse EST sequence;
Genbank accession number AI119044, provided herein as SEQ ID NO 61.
Oligonucleotides was synthesized as chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings." The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages in the wings are phosphodiester
(P.dbd.O). Internucleoside linkages in the central gap are
phosphorothioate (P.dbd.S). All 2'-MOE cytosines and 2'-OH
cytosines were 5-methyl-cytosines. These oligonucleotide sequences
are shown in Table 10.
11TABLE 10 Nucleotide Sequences of Mouse p38.beta. Chimeric (deoxy
gapped) Phosphorothioate Oligonucleotides TARGET SEQ GENE ISIS
NUCLEOTIDE SEQUENCE' ID NUCLEOTIDE NO. (5' .fwdarw. 3') NO:
CO-ORDINATES.sup.2 100800 CoAoCoAoGsAsAsGsCsAsGsCsTsGsGsAoGoCoGoA
63 0051-0070 100801 ToGoCoGoGsCsAsCsCsTsCsCsCsAsTsAoCoToGoT 64
0119-0138 100802 CoCoCoToGsCsAsGsCsCsGsCsTsGsCsGoGoCoAoC 65
0131-0150 100803 GoCoAoGoAsCsTsGsAsGsCsCsGsTsAsGoGoCoGoC 66
0171-0190 100804 ToToAoCoAsGsCsCsAsCsCsTsTsCsTsGoGoCoGoC 67
0211-0230 100805 GoToAoToGsTsCsCsTsCsCsTsCsGsCsGoToGoGoA 68
0261-0280 100806 AoToGoGoAsTsGsTsGsGsCsCsGsGsCsGoToGoAoA 69
0341-0360 100807 GoAoAoToTsGsAsAsCsAsTsGsCsTsCsAoToCoGoC 70
0441-0460 100808 AoCoAoToTsGsCsTsGsGsGsCsTsTsCsAoGoGoToC 71
0521-0540 100809 AoToCoCoTsCsAsGsCsTsCsGsCsAsGsToCoCoToC 72
0551-0570 100810 ToAoCoCoAsCsCsGsTsGsTsGsGsCsCsAoCoAoT- oA 73
0617-0636 100811 CoAoGoToTsTsAsGsCsAsTsGsAsTsCsToCoT- oGoG 74
0644-0663 100812 CoAoGoGoCsCsAsCsAsGsAsCsCsAsGsAoT- oGoToC 75
0686-0705 100813 CoCoToToCsCsAsGsCsAsGsTsTsCsAsA- oGoCoCoA 76
0711-0730 101123 CoAoGoCoAsCsCsAsTsGsGsAsCsGsC- sGoGoAoAoC 77 21871
mismatch .sup.1Emboldened residues, 2'-methoxyethoxy- residues
(others are 2'-deoxy-), including 2'-MOE and 2'-deoxy residues,
5-methyl-cytosines; "s" linkages are phosphorothioate linkages, "o"
linkages are phosphodiester. .sup.2Co-ordinates from Genbank
Accession No. AI119044, locus name "AI119044", SEQ ID NO. 61.
[0252] Mouse p38.beta. antisense sequences were screened in bEND.3
cells as described in Example 4. Results are shown in Table 11.
[0253] Oligonucleotides 100800 (SEQ ID NO. 63), 100801 (SEQ ID NO.
64), 100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID
NO. 68), 100807 (SEQ ID NO. 70), 100808 (SEQ ID NO. 71), 100809
(SEQ ID NO. 72), 100810 (SEQ ID NO. 73), 100811 (SEQ ID NO.74), and
100813 (SEQ ID NO. 76) resulted in at least 50% inhibition of
p38.beta. mRNA expression. Oligonucleotides 100801 (SEQ ID NO.64),
100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID NO.
68), 100809 (SEQ ID NO. 72), and 100810 (SEQ ID NO. 73) resulted in
at least 70% inhibition and are preferred. Oligonucleotides 100801
(SEQ ID NO. 64), 100805 (SEQ ID NO. 68), and 100811 (SEQ ID NO. 74)
resulted in significant inhibition of p38.alpha. mRNA expression in
addition to their effects on p38.beta..
12TABLE 11 Inhibition of Mouse p38 mRNA expression in bEND.3 Cells
by Chimeric (deoxy gapped) Mixed Backbone p38.beta. Antisense
Oligonucleotides ISIS SEQ ID % p38.beta. mRNA % p38.alpha. mRNA No:
NO: INHIBITION INHIBITION control -- 0% 0% 100800 63 51% -- 100801
64 74% 31% 100802 65 35% -- 100803 66 74% 18% 100804 67 85% 18%
100805 68 78% 58% 100806 69 22% 3% 100807 70 64% -- 100808 71 53%
13% 100809 72 84% 14% 100810 73 72% 1% 100811 74 60% 43% 100812 75
36% 17% 100813 76 54% --
Example 6
Effect of p38 MAPK Antisense Oligonucleotides on IL-6 Secretion
[0254] p38 MAPK antisense oligonucleotides were tested for their
ability to reduce IL-6 secretion. bEND.3 cells were cultured and
treated as described in Example 4 except that 48 hours after
oligonucleotide treatment, cells were stimulated for 6 hours with 1
ng/mL recombinant mouse IL-1 (R&D Systems, Minneapolis, Minn.).
IL-6 was measured in the medium using an IL-6 ELISA kit (Endogen
Inc., Woburn, Mass.).
[0255] Results are shown in Table 12. Oligonucleotides targeting a
specific p38 MAPK isoform were effective in reducing IL-6 secretion
greater than approximately 50%.
13TABLE 12 Effect of p38 Antisense Oligonucleotides on IL-6
secretion ISIS SEQ ID DOSE % IL-6 No: NO: GENE TARGET (.mu.M)
INHIBITION control -- -- 0% 21873 52 p38.alpha. 100 49% 100804 67
p38.beta. 100 57% 21871 50 p38.alpha. and p38.beta. 200 23%
Example 7
Activity of p38.alpha. Antisense Oligonucleotides in Rat
Cardiomyocytes
[0256] Rat p38.alpha. antisense oligonucleotides were screened in
Rat A-10 cells. A-10 cells (American Type Culture Collection,
Manassas, Va.) were grown in high-glucose DMEM (Life Technologies,
Gaithersburg, Md.) medium containing 10% fetal calf serum (FCS).
Cells were treated with oligonucleotide as described in Example 2.
Oligonucleotide concentration was 200 nM. mRNA was isolated 24
hours after time zero and quantitated by Northern blot as described
in Example 2.
[0257] Results are shown in Table 13. Oligonucleotides 21845 (SEQ
ID NO. 48), 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50), 21872
(SEQ ID NO. 51), 21873 (SEQ ID NO. 52), 21874 (SEQ ID NO. 53),
21875 (SEQ ID NO. 54), 21877 (SEQ ID NO. 56), 21878 (SEQ ID NO.
57), 21879 (SEQ ID NO. 58), and 21881 (SEQ ID NO. 60) inhibited
p38.alpha. mRNA expression by 65% or greater in this assay.
Oligonucleotides 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50),
21872 (SEQ ID NO. 51), 21877 (SEQ ID NO. 56), and 21879 (SEQ ID NO.
58) inhibited p38.alpha. mRNA expression by greater than 85% and
are preferred.
14TABLE 13 Inhibition of Rat p38.alpha. mRNA expression in A-10
Cells by Chimeric (deoxy gapped) Mixed Backbone p38.alpha.
Antisense Oligonucleotides SEQ GENE ISIS ID TARGET % p38.alpha.
mRNA % p38.alpha. mRNA No: NO: REGION EXPRESSION INHIBITION control
-- -- 100% 0% 21844 47 AUG 75% 25% 21845 48 coding 25% 75% 21846 49
coding 8% 92% 21871 50 coding 12% 88% 21872 51 coding 13% 87% 21873
52 stop 19% 81% 21874 53 3'-UTR 22% 78% 21875 54 3'-UTR 26% 74%
21876 55 3'-UTR 61% 39% 21877 56 3'-UTR 12% 88% 21878 57 3'-UTR 35%
65% 21879 58 3'-UTR 11% 89% 21881 60 3'-UTR 31% 69%
[0258] The most active oligonucleotide in this screen (SEQ ID NO.
49) was used in rat cardiac myocytes prepared from neonatal rats
(Zechner, D., et. al., J. Cell Biol., 1997, 139, 115-127). Cells
were grown as described in Zechner et al. and transfected with
oligonucleotide as described in Example 2. Oligonucleotide
concentration was 1 .mu.M. mRNA was isolated 24 hrs after time zero
and quantitated using Northern blotting as described in Example 2.
An antisense oligonucleotide targeted to JNK-2 was used as a
non-specific target control.
[0259] Results are shown in Table 14. Oligonucleotide 21846 (SEQ ID
NO. 49) was able to reduce p38.alpha. expression in rat cardiac
myocytes by nearly 60%. The JNK-2 antisense oligonucleotide had
little effect on p38.alpha. expression.
15TABLE 14 Inhibition of Rat p38.alpha. mRNA expression in Rat
Cardiac Myocytes by A Chimeric (deoxy gapped) Mixed Backbone
p38.alpha. Antisense Oligonucleotide SEQ GENE ISIS ID TARGET %
p38.alpha. mRNA % p38.alpha. mRNA No: NO: REGION EXPRESSION
INHIBITION control -- -- 100% 0% 21846 49 coding 41% 59%
[0260] Eample 8
Additional Human p38.alpha. Oligonucleotide Sequences
[0261] Additional antisense oligonucleotides were designed to
target human p38.alpha. based on active rat sequences. Target
sequence data are from the p38 MAPK cDNA sequence; Genbank
accession number L35253, provided herein as SEQ ID NO: 1.
Oligonucleotides were synthesized as chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings." The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All 2'-MOE cytosines and 2'-OH
cytosines were 5-methyl-cytosines. These oligonucleotide sequences
are shown in Table 15.
16TABLE 15 Additional Nucleotide Sequences of Human p38.alpha.
Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides SEQ
TARGET GENE GENE ISIS NUCLEOTIDE SEQUENCE.sup.1 ID NUCLEOTIDE
TARGET NO. (5' .fwdarw. 3') NO: CO-ORDINATES.sup.2 REGION 100860
CTGAGACATTTTCCAGCGGC 78 0284-0303 Start 100861 ACGCTCGGGCACCTCCCAGA
79 0344-0363 coding 100862 AGCTTCTTCACTGCCACACG 80 0439-0458 coding
100863 AATGATGGACTGAAATGGTC 81 0464-0483 coding 100864
TCCAACAGACCAATCACATT 82 0538-0557 coding 100865
TGTAAGCTTCTGACATTTCA 83 0644-0663 coding 100866
TGAATGTATATACTTTAGAC 84 0704-0723 coding 100867
CTCACAGTCTTCATTCACAG 85 0764-0783 coding 100868
CACGTAGCCTGTCATTTCAT 86 0824-0843 coding 100869
CATCCCACTGACCAAATATC 87 0907-0926 coding 100870
TATGGTCTGTACCAGGAAAC 88 0960-0979 coding 100871
AGTCAAAGACTGAATATAGT 89 1064-1083 coding 100872
TTCTCTTATCTGAGTCCAAT 90 1164-1183 coding 100873
CATCATCAGGATCGTGGTAC 91 1224-1243 coding 100874
TCAAAGGACTGATCATAAGG 92 1258-1277 coding 100875
GGCACAAAGCTGATGACTTC 93 1324-1343 coding 100876
AGGTGCTCAGGACTCCATCT 94 1364-1383 stop 100877 GCAACAAGAGGCACTTGAAT
95 1452-1471 3'-UTR .sup.1Emboldened residues, 2'-methoxyethoxy-
residues (others are 2'-deoxy-) including "C" and "C" residues,
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2s Co-ordinates from Genbank Accession No. L35253, locus name
"HUMMAPKNS", SEQ ID NO. 1.
[0262] For an initial screen of human p38.alpha. antisense
oligonucleotides, T-24 cells, a human transitional cell bladder
carcinoma cell line, were obtained from the American Type Culture
Collection (ATCC) (Manassas, Va.). T-24 cells were routinely
cultured in complete McCoy's 5A basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence. Cells
were seeded into 96-well plates (Falcon-Primaria #3872) at a
density of 7000 cells/well for use in RT-PCR analysis. A control
oligonucleotide ISIS 118965 (TTATCCTAGCTTAGACCTAT, herein
incorporated as SEQ ID NO: 96) was synthesized as chimeric
oligonucleotide ("gapmer") 20 nucleotides in length, composed of a
central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
2'-MOE cytosines and 2'OH cytosines were 5-methyl-cytosines.
[0263] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and oligonucleotide.
mRNA was measured by Northern blot. Results are shown in Table 16.
Oligonucleotides 100861 (SEQ ID NO. 79) 100862 (SEQ ID NO. 80),
100863 (SEQ ID NO. 81), 100866 (SEQ ID NO. 84), 100867 (SEQ ID NO.
85), 100868 (SEQ ID NO. 86) 100870 (SEQ ID NO. 88), 100871 (SEQ ID
NO. 89), 100872 (SEQ NO. 90), 100873 (SEQ ID NO. 91), and 100874
(SEQ ID NO. 92) 100875 (SEQ ID NO. 93) and 100877 (SEQ ID NO. 95)
gave greater than approximately 40% inhibition and are
preferred.
17TABLE 16 Inhibition of Human p38.alpha. mRNA expression in T-24
Cells by Chimeric (deoxy gapped) Phosphorothioate Oligonucleotides
SEQ ISIS ID GENE TARGET % P38.alpha. mRNA % P38.beta. mRNA No: NO:
REGION EXPRESSION EXPRESSION 100860 78 0284-0303 73% 71% 100861 79
0344-0363 60% 47% 100862 80 0439-0458 56% 45% 100863 81 0464-0483
49% 67% 100864 82 0538-0557 66% 70% 100865 83 0644-0663 64% 63%
100866 84 0704-0723 55% 65% 100867 85 0764-0783 58% 33% 100868 86
0824-0843 47% 60% 100869 87 0907-0926 61% 100% 100870 88 0960-0979
51% No data 100871 89 1064-1083 57% 96% 100872 90 1164-1183 37% 77%
100873 91 1224-1243 34% 70% 100874 92 1258-1277 42% 76% 100875 93
1324-1343 39% 90% 100876 94 1364-1383 77% 93% 100877 95 1452-1471
47% 95%
[0264] Oligonucleotides 100872 (SEQ ID NO. 90), 100873 (SEQ ID NO.
91), 100874 (SEQ ID NO. 92), and 100875 (SEQ ID NO. 93) were chosen
for dose response studies.
[0265] Results are shown in Table 17. The effect of these
oligonucleotides on human p38.beta. was also determined.
18TABLE 17 Dose Response of p38.alpha. in T-24 cells to human
p38.alpha. Chimeric (deoxy gapped) Phosphorothioate
Oligonucleotides SEQ ID ASO Gene % p38.alpha. mRNA % p38.beta. mRNA
ISIS # NO: Target Dose Expression Inhibition Control 96 -- -- 94%
80% 118965 100872 90 coding 50 nM 45% 108% " " " 100 nM 18% 91% " "
" 200 nM 17% 92% 100873 91 coding 50 nM 19% 90% " " " 100 nM 12%
78% " " " 200 nM 8% 44% 100874 92 coding 50 nM 47% 107% " " " 100
nM 27% 101% " " " 200 nM 13% 51% 100875 93 coding 50 nM 30% 105% "
" " 100 nM 13% 92% " " " 200 nM 8% 69%
Example 9
Additional Human p38.beta. Oligonucleotide Sequences
[0266] Additional antisense oligonucleotides were designed to
target human p38.beta. based on active rat sequences. Target
sequence data are from the p38 MAPK cDNA sequence; Genbank
accession number U53442, provided herein as SEQ ID NO: 23.
[0267] Oligonucleotides was synthesized as chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages in the wings
are phosphodiester (P.dbd.O). Internucleoside linkages in the
central gap are phosphorothioate (P.dbd.S). All 2'-MOE cytosines
and 2'-OH cytosines were 5-methyl-cytosines. These oligonucleotide
sequences are shown in Table 18. A control oligonucleotide ISIS
118966 (GTTCGATCGGCTCGTGTCGA), herein incorporated as SEQ ID NO:
107) was synthesized as chimeric oligonucleotide ("gapmer") 20
nucleotides in length, composed of a central "gap" region
consisting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-nucleotide "wings." The wings
are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
in the gap and phosphodiester in the wings. All 2'-MOE cytosines
and 2'-OH cytosines were 5-methyl-cytosines.
19TABLE 18 Additional Nucleotide Sequences of Human p38.beta.
Chimeric (deoxy gapped) Mixed-Backbone Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5' .fwdarw. 3') NO:
CO-ORDINATES.sup.2 REGION 107869 ACAGACGGAGCCGTAGGCGC 97 117-136
coding 107870 CACCGCCACCTTCTGGCGCA 98 156-175 coding 107871
GTACGTTCTGCGCGCGTGGA 99 207-226 coding 107872 ATGGACGTGGCCGGCGTGAA
100 287-306 coding 107873 CAGGAATTGAACGTGCTCGT 101 414-433 coding
107874 ACGTTGCTGGGCTTCAGGTC 102 491-510 coding 107875
TACCAGCGCGTGGCCACATA 103 587-606 coding 107876 CAGTTGAGCATGATCTCAGG
104 614-633 coding 107877 CGGACCAGATATCCACTGTT 105 649-668 coding
107878 TGCCCTGGAGCAGCTCAGCC 106 682-701 coding .sup.1Emboldened
residues, 2'-methoxyethoxy- residues (others are 2'-deoxy-)
including "C" and "C" residues, 5-methyl-cytosines.
.sup.2Co-ordinates from Genbank Accession No. U53442, SEQ ID NO.
23.
[0268] For an initial screen of human p38.beta. antisense
oligonuleotides, T-24 cells, a human transitional cell bladder
carcinoma cell line, were obtained from the American Type Culture
Collection (ATCC) (Manassas, Va.). T-24 cells were routinely
cultured in complete McCoy's 5A basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence. Cells
were seeded into 96-well plates (Falcon-Primaria #3872) at a
density of 7000 cells/well for use in RT-PCR analysis. A control
oligonucleotide ISIS 118966 (TTATCCTAGCTTAGACCTAT, herein
incorporated as SEQ ID NO: 106) was synthesized as chimeric
oligonucleotide ("gapmer") 20 nucleotides in length, composed of a
central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) in the gap and phosphodiester in the
wings. All 2'-MOE cytosines and 2'-OH cytosines were
5-methyl-cytosines.
[0269] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and oligonucleotide.
mRNA was measured by Northern blot. Results are shown in Table 19.
For comparison, ISIS 17893 and ISIS 17899, both targeting human
p38.beta. (SEQ ID NO: 27) and ISIS 100802 targeting mouse p38.beta.
(SEQ ID NO: 65) described in Examples 3 and 5 above, respectively,
were included in the screen.
[0270] Oligonucleotides 107869 (SEQ ID NO. 97), 107871 (SEQ ID NO.
99), 107872 (SEQ ID NO. 100), 107873 (SEQ ID NO. 101), 107878 (SEQ
ID NO.106), 17893 (SEQ ID NO. 27), 17899 (SEQ ID NO. 33) and 100802
(SEQ ID NO.65, targeted to mouse p38.beta.) gave greater than
approximately 40% inhibition and are preferred.
20TABLE 19 Inhibition of Human p38.beta. mRNA expression in T-24
Cells by Chimeric (deoxy gapped) Mixed-Backbone Phosphorothioate
Oligonucleotides SEQ ISIS ID GENE TARGET % p38.beta. mRNA %
p38.alpha. mRNA No: NO: REGION EXPRESSION EXPRESSION 107869 97
Coding 60% 93% 107870 98 Coding 74% 97% 107871 99 Coding 60% 111%
107872 100 Coding 57% 123% 107873 101 Coding 58% 120% 107874 102
Coding 61% 100% 107875 103 Coding 92% 112% 107876 104 Coding 127%
137% 107877 105 Coding No data No data 107878 106 Coding 54% 112%
17893 27 Coding 31% 61% 17899 33 Coding 56% 117% 100802 65 Coding
47% 78%
[0271] Oligonucleotides 107871, 107872, 107873, 107874, 107875,
107877, 107878, 17893 and 17899 were chosen for dose response
studies.
[0272] Results are shown in Table 20. The effect of these
oligonucleotides on human p38.alpha. was also determined.
21TABLE 20 Dose Response of p38.beta. in T-24 cells to human
p38.beta. Chimeric (deoxy gapped) Mixed-backbone Phosphorothioate
Oligonucleotides SEQ ID ASO Gene % p38.beta. mRNA % p38.alpha. mRNA
ISIS # NO: Target Dose Expression Inhibition Control 107 -- -- 100%
100% 118966 107871 99 coding 50 nM 41% 105% " " " 100 nM 42% 132% "
" " 200 nM 10% 123% 107872 100 coding 50 nM 71% 124% " " " 100 nM
13% 84% " " " 200 nM 22% 102% 107873 101 coding 50 nM 69% 132% " "
" 100 nM 41% 119% " " " 200 nM 23% 131% 107874 102 coding 50 nM 75%
109% " " " 100 nM 34% 99% " " " 200 nM 23% 87% 107875 103 coding 50
nM 82% 93% " " " 100 nM 38% 101% " " " 200 nM 40% 91% 107877 105
coding 50 nM 50% 127% " " " 100 nM 34% 125% " " " 200 nM 22% 106%
107878 106 coding 50 nM 70% 110% " " " 100 nM 43% 109% " " " 200 nM
27% 116% 17893 27 coding 50 nM 28% 88% " " " 100 nM 27% 115% " " "
200 nM 16% 108% 17899 33 coding 50 nM 89% 87% " " " 100 nM 36% 104%
" " " 200 nM 15% 80%
[0273] These data show that the oligonucleotides designed to target
human p38.beta., do so in a target-specific and dose-dependent
manner.
Eample 10
Real-Time Quantitative PCR Analysis of p38.beta. mRNA Levels
[0274] Quantitation of p38.alpha. mRNA levels was accomplished by
real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied
Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda,
Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is
attached to the 5' end of the probe and a quencher dye (e.g.,
TAMRA, obtained from either PE-Applied Biosystems, Foster City,
Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA
Technologies Inc., Coralville, Iowa) is attached to the 3' end of
the probe. When the probe and dyes are intact, reporter dye
emission is quenched by the proximity of the 3' quencher dye.
During amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. Sequence Detection System. In
each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0275] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0276] PCR reagents were obtained from Invitrogen Corporation,
(Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20
.mu.L PCR cocktail (2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM
MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM
each of forward primer and reverse primer, 125 nM of probe, 4 Units
RNAse inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5 Units MuLV reverse
transcriptase, and 2.5.times.ROX dye) to 96-well plates containing
30 .mu.L total RNA solution (20-200 ng). The RT reaction was
carried out by incubation for 30 minutes at 48.degree. C. Following
a 10 minute incubation at 95.degree. C. to activate the
PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol were
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/extension).
[0277] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA
quantification by RiboGreen.TM. are taught in Jones, L. J., et al,
(Analytical Biochemistry, 1998, 265, 368-374).
[0278] In this assay, 170 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 485 nm and emission at 530
nm.
[0279] Probes and primers to human p38.alpha. were designed to
hybridize to a human p38.alpha. sequence, using published sequence
information (GenBank accession number L35253, incorporated herein
as SEQ ID NO:1). For human p38.alpha. the PCR primers were:
[0280] forward primer: GATGAGTGGAAAAGCCTGAC (SEQ ID NO: 108)
[0281] reverse primer: CTGCAACAAGAGGCACTTGA (SEQ ID NO: 109) and
the PCR probe was:
FAM-GATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGA-TAMRA (SEQ
ID NO: 110) where FAM is the fluorescent dye and TAMRA is the
quencher dye. For human GAPDH the PCR primers were:
[0282] forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO: 111)
[0283] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 112) and
the PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO:
113) where JOE is the fluorescent reporter dye and TAMRA is the
quencher dye.
[0284] Probes and primers to mouse p38.alpha. were designed to
hybridize to a mouse p38.alpha. sequence, using published sequence
information (GenBank accession number U10871.1, incorporated herein
as SEQ ID NO: 114). For mouse p38.alpha. the PCR primers were:
[0285] forward primer: AAGGGAACGAGAAAACTGCTGTT (SEQ ID NO: 115)
[0286] reverse primer: TATTTTAACCAGTGGTATTATCTGACATCCT (SEQ ID NO:
116) and the PCR probe was: FAM-TTGTATTTGTGAACTTGGCTGTAATCTGGTATGCC
-TAMRA
[0287] (SEQ ID NO: 117) where FAM is the fluorescent reporter dye
and TAMRA is the quencher dye. For mouse GAPDH the PCR primers
were:
[0288] forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO: 118)
[0289] reverse primer: GGGTCTCGCTCCTGGAAGAT(SEQ ID NO: 119) and the
PCR probe was: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3' (SEQ ID
NO: 120) where JOE is the fluorescent reporter dye and TAMRA is the
quencher dye.
[0290] Probes and primers to rat p38.alpha. were designed to
hybridize to a rat p38.alpha. sequence, using published sequence
information (GenBank accession number U73142, incorporated herein
as SEQ ID NO: 45). For rat p38.alpha. the PCR primers were:
[0291] forward primer: ATCATTTGGAGCCCAGAAGGA (SEQ ID NO: 121)
[0292] reverse primer: TGGAGCTGGACTGCATACTGA (SEQ ID NO: 122) and
the PCR probe was: FAM-CTGGCCAGGCCTCACCGC-TAMRA
[0293] (SEQ ID NO: 123) where FAM is the fluorescent reporter dye
and TAMRA is the quencher dye. For rat GAPDH the PCR primers
were:
[0294] forward primer: TGTTCTAGAGACAGCCGCATCTT(SEQ ID NO: 124)
[0295] reverse primer: CACCGACCTTCACCATCTTGT(SEQ ID NO: 125) and
the PCR probe was: 5' JOE-TTGTGCAGTGCCAGCCTCGTCTCA-TAMRA 3' (SEQ ID
NO: 126) where JOE is the fluorescent reporter dye and TAMRA is the
quencher dye.
Example 11
Additional Human p38.alpha. Oligonucleotide Sequences
[0296] Additional antisense oligonucleotides were designed to
target human p38.alpha. using published sequence (Genbank accession
number NM.sub.--001315.1, provided herein as SEQ ID NO: 127).
Oligonucleotides were synthesized as chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings. " The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides.
Internucleoside linkages are phosphorothioate (P.dbd.S). These
oligonucleotide sequences are shown in Table 21. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target sequence to which the compound binds. The compounds can be
analyzed for their effect on human p38.alpha. mRNA levels by
quantitative real-time PCR as described in other examples
herein.
22TABLE 21 Additional chimeric phosphorothioate antisense
oligonucleotides targeted to human p38.alpha. Target Sequence
Target SEQ ISIS # Region Accession # Site SEQUENCE ID NO: 186877
coding NM_001315.1 1271 GAGCAAAGTAGGCATGTGCA 128 186878 3' UTR
NM_001315.1 2703 GTTTCCGAAGTTTGGGATAT 129 186879 3' UTR NM_001315.1
2735 GCATTAGTTATTGGGAGTGA 130 186880 3' UTR NM_001315.1 1671
CCCTGGAGCATCCACAACCT 131 186881 coding NM_001315.1 1021
TGTACCAGGAAACAATGTTC 132 186882 5' UTR NM_001315.1 326
CGGGCAAGAAGGTGGCCCTG 133 186883 3' UTR NM_001315.1 3296
ATCGCCATCAGTCTGCCTCC 134 186884 3' UTR NM_001315.1 2312
TGACATCAAGAACCTGCTTC 135 186885 3' UTR NM_001315.1 2134
GGCCCACAAGCAGCTGTCCA 136 186886 3' UTR NM_001315.1 3063
TGAAAACGACACTTCTCCAC 137 186887 3' UTR NM_001315.1 3307
GGTGAGAGGGAATCGCCATC 138 186888 3' UTR NM_001315.1 2007
ATACTGTCAAGATCTGAGAA 139 186889 3' UTR NM_001315.1 2702
TTTCCGAAGTTTGGGATATT 140 186890 3' UTR NM_001315.1 2205
AGAGAGACGCACATATACGC 141 186891 3' UTR NM_001315.1 1516
CAACAGGCACTTGAATAATA 142 186892 coding NM_001315.1 638
ATTCCTCCAGAGACCTTGCA 143 186893 3' UTR NM_001315.1 2848
AAGACACCTTGTTACTTTTT 144 186894 3' UTR NM_001315.1 2989
TGCCCTTTCTCCCCATCAAA 145 186895 coding NM_001315.1 1096
TGGCATCCTGTTAATGAGAT 146 186896 3' UTR NM_001315.1 1477
AAGGCCTTCCCCTCACAGTG 147 186897 3' UTR NM_001315.1 3728
AATAGGCTTTATTTTAACCA 148 186898 3' UTR NM_001315.1 2455
ACCCAAGAAGTCTTCACTGG 149 186899 3' UTR NM_001315.1 3135
TTTCTTATTACACAAAAGGC 150 186900 3' UTR NM_001315.1 3445
GGAAATCACACGAGCATTTA 151 186901 coding NM_001315.1 794
GGTCCCTGTGAATTATGTCA 152 186902 3' UTR NM_001315.1 3112
AATATATGAGTCCTCATGTA 153 186903 3' UTR NM_001315.1 3511
CTAACACGTATGTGGTCACA 154 186904 3' UTR NM_001315.1 2984
TTTCTCCCCATCAAAAGGAA 155 186905 coding NM_001315.1 727
CTGAACATGGTCATCTGTAA 156 186906 3' UTR NM_001315.1 3681
ATAACTGATTACAGCCAAGT 157 186907 3' UTR NM_001315.1 2959
TTCTCAAAGGGATTCCTACA 158 186908 coding NM_001315.1 678
TCTGCCCCCATGAGATGGGT 159 186909 coding NM_001315.1 540
TTCGCATGAATGATGGACTG 160 186910 coding NM_001315.1 1275
TACTGAGCAAAGTAGGCATG 161 186911 coding NM_001315.1 1336
GTCCCTGCTTTCAAAGGACT 162 186912 coding NM_001315.1 577
CATATGTTTAAGTAACCGCA 163 186913 3' UTR NM_001315.1 2963
CACATTCTCAAAGGGATTCC 164
[0297] Additional antisense oligonucleotides were designed to
target human p38.alpha. using published sequence (Genbank accession
number NM.sub.--001315.1, provided herein as SEQ ID NO: 127.
Oligonucleotides were synthesized as oligonucleotides comprised of
2'-deoxynucleotides and phosphodiester internucleoside linkages
(P.dbd.O). These oligonucleotide sequences are shown in Table 22.
"Target site" indicates the first (5'-most) nucleotide number on
the particular target sequence to which the compound binds.
23TABLE 22 Additional phosphodiester oligonucleotides targeted to
p38.alpha. Target SEQ ISIS Sequence Target ID # Region Accession
Site SEQUENCE NO 169107 coding NM_001315.1 1420
GGACTCCATCTCTTCTTGGTCAA 165 336747 3' UTR NM_001315.1 1454
GAAGTGGGATCAACAGAACAGAAA 166 336750 coding NM_001315.1 436
AGCCCACTGGAGACAGGTTCT 167
Example 12
Mouse and Rat p38.alpha. Antisense Oligonucleotides
[0298] Antisense oligonucleotides were designed to target mouse
p38.alpha. using published sequences (Genbank accession number
U10871.1, provided herein as SEQ ID NO: 114, GenBank accession
number D83073.1, provided herein as SEQ ID NO: 168, GenBank
accession number AA002328.1, provided herein as SEQ ID NO: 169,
GenBank accession number AF128892.1, provided herein as SEQ ID NO:
170, GenBank accession number BY159314.1, provided herein as SEQ ID
NO: 171 and Genbank accession number BY257628.1, provided herein as
SEQ ID NO: 172). These compounds are shown in the tables included
in this example.
[0299] Antisense oligonucleotides were also designed to target rat
p38.alpha. using published sequences (GenBank accession number
U73142, provided herein as SEQ ID NO: 45, and Genbank accession
number U91847.1, provided herein as SEQ ID NO: 173). These
compounds are shown in the tables in this example.
[0300] Oligonucleotides were synthesized as chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings." The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. Internucleoside linkages are phosphorothioate
(P.dbd.S). In Table 23, "Target site" indicates the first (5'-most)
nucleotide number on the particular target sequence to which the
compound binds.
[0301] The compounds in Table 23 were analyzed for their effect on
mouse p38.alpha. mRNA levels by quantitative real-time PCR as
described in other examples herein. Data are averages from two
experiments in which bEND.3 cells were treated with the antisense
oligonucleotides of the present invention and are presented in the
column labeled "% inhib, mouse p38.alpha.". If present, "N.D."
indicates "no data". ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO:
174) was used as a scrambled control oligonucleotide.
[0302] The compounds in Table 23 were also analyzed for their
effect on rat p38.alpha. mRNA levels in NR-8383 cells by
quantitative real-time PCR as described in other examples herein.
The rat normal lung alveolar macrophage cell line NR-8383 was
obtained from the American Type Culture Collection (Manassas, Va.).
NR-8383 cells were routinely cultured in Ham's F12 medium
(Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10%
fetal bovine serum (Gibco/Life Technologies, Gaithersburg, Md.),
and 1% Penicillin/Streptomycin (Gibco/Life Technologies,
Gaithersburg, Md.). Cells were routinely passaged by trypsinization
and dilution when they reached 90% confluence. For transfection
with oligonucleotides, NR-8383 cells were plated on 24 well plates
at a density of 4.times.10.sup.4 cells/cm2 (8.0.times.10.sup.4
cells/well) in serum-free F12 Nutrient Medium (Gibco/Life
Technologies, Gaithersburg, Md.). After 2 hours, media was removed
and replaced with 400 ul of Ham's F12 Nutrient Medium supplemented
with 15% fetal bovine serum and 1% Penicillin/Streptomyocin. Cells
were then transfected with 300 nM of antisense oligonucleotides
mixed with FuGENE 6
[0303] Transfection Reagent (Roche Applied Science, Indianapolis,
Ind.) for 24 hours, after which mRNA was quantitated as described
in other examples herein. Data are averages from two experiments in
which NR-8383 cells were treated with the antisense
oligonucleotides of the present invention and are presented in the
column labeled "% inhib, rat p38.alpha.". If present, "N.D."
indicates "no data". ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO:
174) was used as a scrambled control oligonucleotide.
[0304] One additional compound, ISIS 186911 (SEQ ID NO: 143),
targeted to human p38.alpha., was also tested for its effect on
mouse and rat p38.alpha. mRNA expression in bEND.3 cells and
NR-8383 cells, respectively.
[0305] An asterisk (*) adjacent to the ISIS oligonucleotide number
in Table 23 indicates that the oligonucleotide targets human, mouse
and rat p38.alpha.sequences. Compounds in Table 23, with the
exception of ISIS 101753, ISIS 320119, ISIS 320120 and 320121
target both mouse and rat p38.alpha..
24TABLE 23 Inhibition of mouse and rat p38.alpha. by chimeric
phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy
gap Target % Inhib. % Inhib. Sequence Target mouse rat Seq ISIS #
Region Accession # Site Sequence p38.alpha. p38.alpha. ID NO
100864* coding L35253 538 TCCAACAGACCAATCACATT 83 57 82 101753
start U73142 1 CTGCGACATTTTCCAGCGGC 64 43 175 codon 101755* coding
U10871.1 1226 CATCATCAGGGTCGTGGTAC 84 74 176 101757* coding
U10871.1 1336 AGGTGCTCAGGACTCCATTT 88 53 177 186911* coding NM
001315.1 1336 GTCCCTGCTTTCAAAGGACT 81 40 178 306022* coding U73142
781 GGCCAGAGACTGAATGTAGT 78 53 179 320103* coding U10871.1 315
AGCTCCTGCCGGTAGAACGT 81 55 180 320104* coding U10871.1 405
TCAAAAGCAGCACACACCGA 82 42 181 320105* coding U10871.1 417
CCCGTCTTTGTATCAAAAGC 89 59 182 320106* coding U10871.1 453
AACGGTCTCGACAGCTTCTT 91 67 183 320107* coding U10871.1 483
TAGGTCCTTTTGGCGTGAAT 84 60 184 320108* coding U10871.1 600
AGATGGGTCACCAGGTACAC 61 57 185 320109* coding U10871.1 609
GCCCCCATGAGATGGGTCAC 69 34 186 320110* coding U10871.1 807
TCATCAGTGTGCCGAGCCAG 87 54 187 320111* coding U10871.1 930
GTCAACAGCTCAGCCATGAT 86 55 188 320112* coding U10871.1 940
CGTTCTTCCGGTCAACAGCT 93 58 189 320113* coding U10871.1 967
ATCAATATGGTCTGTACCAG 35 9 190 320114* coding U10871.1 987
CTTAAAATGAGCTTCAACTG 71 60 191 320115* coding U10871.1 1001
GGGTTCCAACGAGTCTTAAA 67 53 192 320116* coding U10871.1 1019
TCAGAAGCTCAGCCCCTGGG 95 73 193 320117* coding U10871.1 1030
GGAGATTTTCTTCAGAAGCT 72 55 194 320118* coding U10871.1 1040
CAGACTCTGAGGAGATTTTC 47 69 195 320119 coding U10871.1 1050
TAGTTTCTTGCAGACTCTGA 53 32 196 320120 coding U10871.1 1060
AGACTGAATGTAGTTTCTTG 74 39 197 320121 coding U10871.1 1083
TTCATCTTCGGCATCTGGGC 83 57 198 320122 coding U10871.1 1093
ATTTGCGAAGTTCATCTTCG 73 48 199 320123 coding U10871.1 1103
CAATAAATACATTTGCGAAG 79 32 200 320124 coding U10871.1 1113
GGATTGGCACCAATAAATAC 29 31 201 320125 coding U10871.1 1176
GCTGCTGTGATCCTCTTATC 67 63 202 320126 coding U10871.1 1196
AGGCATGCGCAAGAGCTTGG 90 69 203 320127 coding U10871.1 1206
TGAGCAAAGTAGGCATGCGC 73 56 204 320128 coding U10871.1 1260
TCAAAGGACTGGTCATAAGG 79 37 205 320129 coding U10871.1 1351
CATTTCTTCTTGGTCAAGGG 69 65 206 320130 stop U10871.1 1358
AGGACTCCATTTCTTCTTGG 81 61 207 codon 320131 3' UTR U10871.1 1406
CTTCCCCTCACAGTGAAGTG 92 39 208 320132 3' UTR U10871.1 1432
TATTTGGAGAGTTCCCATGA 85 56 209 320133 3' UTR U10871.1 1442
ACTTGAATGGTATTTGGAGA 52 61 210 320134 3' UTR U10871.1 1452
AACAAGAGGCACTTGAATGG 85 74 211 320135 3' UTR U10871.1 1480
ACCCCCTTCCACCATGAAGG 95 47 212 320136 3' UTR U10871.1 1608
AGCAGGCAGACTGCCAAGGA 83 34 213 320137 3' UTR U10871.1 1663
CACACACATCCCTAAGGAGA 80 44 214 320138 3' UTR U10871.1 1745
TAAAGGCAGGGCCACAGGAG 87 46 215 320139 3' UTR U10871.1 1771
GCAGCCTCTCTCTGTCACTG 87 61 216 320140 3' UTR U10871.1 1791
GGGATAGCCTCAGACCTGAA 61 37 217 320141 3' UTR U10871.1 1801
GCATGGCTGAGGGATAGCCT 83 73 218 320142 3' UTR U10871.1 1828
GAGCCAGTTGGTTCTCTTGG 85 53 219 320143 3' UTR U10871.1 1910
AGGCACAAACAGACTGACAG 88 54 220 320144 3' UTR U10871.1 1917
CCTTTTAAGGCACAAACAGA 83 39 221 320145 3' UTR U10871.1 2138
GACCTCTGCACTGAGGTGAA 52 44 222 320146 3' UTR U10871.1 2147
GGCACTGGAGACCTCTGCAC 74 57 223 320147 3' UTR U10871.1 2228
AGAGCACAGCATGCAAACAC 66 43 224 320148 3' UTR U10871.1 2259
CCAGGGCTTCCAGAAGACAG 78 33 225 320149 3' UTR U10871.1 2576
AAGGAGCTCCTGGCTTCAGG 74 25 226 320150 3' UTR U10871.1 2738
GGATTCCTACAACATACAAA 82 62 227 320151 3' UTR U10871.1 2758
GAAGGAACCACACTCTCTAA 90 47 228 320152 3' UTR U10871.1 2778
TTTGCCCTTTCTCCCCATCA 93 66 229 320153 3' UTR U10871.1 2791
AATATTAAAATAATTTGCCC 0 22 230 320154 3' UTR U10871.1 2817
TCATGTTTATAAAGGTGAAA 52 50 231 320155 3' UTR U10871.1 2827
CCCTGAGGATTCATGTTTAT 93 73 232 320156 3' UTR U10871.1 2930
GGAATTGGCTTTACACTTTC 91 64 233 320157 3' UTR U10871.1 2941
CGTCCAACACTGGAATTGGC 96 71 234 320158 3' UTR U10871.1 3042
CCTTCTGGGCTCCAAATGAT 91 71 235 320159 3' UTR U10871.1 3386
TCTGACATCCTATGGCATAC 94 69 236 320160 coding D83073.1 900
GTTAATATGGTCTGTACCAG 53 43 237 320161 coding D83073.1 910
GCTGAAGCTGGTTAATATGG 80 66 238 320162 coding D83073.1 920
CGCATTATCTGCTGAAGCTG 92 62 239 320163 coding D83073.1 955
TGTTAATGAGATAAGCAGGG 0 40 240 320164 coding D83073.1 965
CTTGGCATCCTGTTAATGAG 80 73 241 320165 coding D83073.1 975
TGCCTCATGGCTTGGCATCC 81 53 242 320166 coding D83073.1 991
ACTGAATGTAGTTTCTTGCC 53 35 243 320167 5' UTR AA002328.1 155
CTTGCCTGTAAAAACACAGA 7 11 244 320168 stop AF128892.1 1059
TCACCTCATGGCTTGGCATC 83 56 245 codon 320169 stop AF128892.1 1066
TTTGTTCTCACCTCATGGCT 92 64 246 codon 320170 3' UTR AF128892.1 1132
TGCTGGCTATACACAGACAC 83 55 247 320171 intron BY159314.1 58
TGGAAAACTGTTTTGTCAAA 35 2 248 320172 intron 3Y257628.1 39
ACTCTCGCGAGAACAGCTCC 39 0 249 320173 intron BY257628.1 72
TCCCACAGGCAGCGGCCGGG 160 250 320174 intron BY257628.1 97
CCCGCTTGGGCTCCAGTGGC 62 29 251
[0306] Additional antisense oligonucleotides were designed to
target mouse p38.alpha. using published sequences (Genbank
accession number U10871.1, provided herein as SEQ ID NO: 114).
Oligonucleotides are composed of 2'-deoxynucleotides.
Internucleoside linkages are phosphorodiester (P.dbd.O). These
oligonucleotide sequences are shown in Table 24. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target sequence to which the compound binds.
25TABLE 24 Antisense oligonucleotides targeted to mouse p38.alpha.
having 2'-deoxynucleotides and phosphodiester linkages Target
Sequence Start SEQ ISIS # Region Accession # Site SEQUENCE ID NO
137934 3' UTR U10871.1 3331 GCAGTTTTCTCGTTCC 252 CTTG 264006 coding
U10871.1 1207 CTGAGCAAAGTAGGCA 253 TGCG 320184 3' UTR U10871.1 2306
GGAGGCAATGTGGACA 254 GGAA 279221 coding U10871.1 521
CATTTTCGTGTTTCAT 255 GTGCTTC 326403 3' UTR U10871.1 3395
TATTTTAACCAGTGGT 256 ATTATCTACATCCT
[0307] Additional antisense oligonucleotides were designed to
target mouse p38.alpha. using published sequences (Genbank
accession number U10871.1, provided herein as SEQ ID NO: 114).
Oligonucleotides were synthesized as chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings." The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides.
Internucleoside linkages in the central gap region are
phosphorothioate (P.dbd.S), and internucleoside linkages in the
wings are phosphodiester (P.dbd.O). These oligonucleotide sequences
are shown in Table 25. "Target site" indicates the first (5'-most)
nucleotide number on the particular target sequence to which the
compound binds.
26TABLE 25 Chimeric oligonucleotides targeted to mouse p38a having
2'-MOE wings and a deoxy gap and mixed phophorothioate and
phosphodiester internucleoside linkages Target Sequence SEQ ISIS
Accession Start ID # Region # Site SEQUENCE NO 101369 codon
U10871.1 286 CTGCGACATCTTCCAGCG 257 GC 101370 coding U10871.1 646
GGTCAGCTTCTGGCACTT 258 CA 101372 3' UTR U10871.1 1609
AAGCAGGCAGACTGCCAA 259 GG
[0308] Additional antisense oligonucleotides were designed to
target rat p38.alpha. using published sequences (GenBank accession
number U73142, provided herein as SEQ ID NO: 45, and GenBank
accession number U91847.1, provided herein as SEQ ID NO: 173).
Oligonucleotides are composed of 2'-deoxynucleotides.
Internucleoside linkages are phosphorodiester (P.dbd.O). These
oligonucleotide sequences are shown in Table 26. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target sequence to which the compound binds.
27TABLE 26 Antisense oligonucleotides targeted to rat p38.alpha.
having 2'-deoxynucleotides and phosphodiester linkages Target
Sequence SEQ ISIS Accession Start ID # Region # Site SEQUENCE NO
336744 coding U91847.1 902 AGGCATGCGCAAGAGCTT 260 336741 coding
U91847.1 66 GGGACAGGTTCTGGTATC 261 GC 257014 coding U91847.1 224
TCTCGTGCTTCATGTGCT 262 TCA 320187 3' UTR U73142 2800
TGGAGCTGGACTGCATAC 263 TGA
[0309] Additional antisense oligonucleotides were designed to
target rat p38.alpha. using published sequences (GenBank accession
number U73142, provided herein as SEQ ID NO: 45). Oligonucleotides
were synthesized as chimeric oligonucleotides, composed
2'-deoxynucleotides and 2'-methoxyethyl (2'-MOE) nucleotides
(indicated in bold type in Table 27). Internucleoside linkages in
the central gap region are phosphorothioate (P.dbd.S), and
internucleoside linkages in the wings are phosphodiester (P.dbd.O).
These oligonucleotide sequences are shown in Table 27. "Target
site" indicates the first (5'-most) nucleotide number on the
particular target sequence to which the compound binds.
28TABLE 27 Chimeric oligonucleotides targeted to rat p38.alpha.
having 2'-MOE wings and a deoxy gap and mixed phophorothioate and
phosphodiester internucleoside linkages Target Sequence SEQ ISIS
Accession Start ID # Region # Site SEQUENCE NO 111831 coding U73142
941 CATCAGGGTCGTGGTAC 264 111830 coding U73142 942 CATCATCAGGGTCGT
265
Example 13
Mouse model of allergic inflammation
[0310] In the mouse model of allergic inflammation, mice were
sensitized and challenged with aerosolized chicken ovalbumin (OVA).
Airway responsiveness was assessed by inducing airflow obstruction
with a methacholine aerosol using a noninvasive method. This
methodology utilized unrestrained conscious mice that are placed
into the main chamber of a plthysmograph (Buxco Electronics, Inc.,
Troy, N.Y.). Pressure differences between this chamber and a
reference chamber were used to extrapolate minute volume, breathing
frequency and enhanced pause (Penh). Penh is a dimensionless
parameter that is a function of total pulmonary airflow in mice
(i.e., the sum of the airflow in the upper and lower respiratory
tracts) during the respiratory cycle of the animal. The lower the
Penh, the greater the airflow. This parameter closely correlates
with lung resistance as measured by traditional invasive techniques
using ventilated animals (Hamelmann et al., 1997). Dose-response
data were plotted as raw Penh values to increasing concentrations
of methacholine. This system was used to test the efficacy of an
antisense oligonucleotide targeted to mouse p38.alpha. (ISIS
101757; SEQ ID NO: 177). Mismatched p38.alpha. oligonucleotide
(ISIS 101758; SEQ ID NO: 266) was used as a negative control.
[0311] There are several important features common to human asthma
and the mouse model of allergic inflammation. One of these is
pulmonary inflammation, in which cytokine expression and Th2
profile is dominant. Another is goblet cell hyperplasia with
increased mucus production. Lastly, airway hyperresponsiveness
(AHR) occurs resulting in increased sensitivity to cholinergic
receptor agonists such as acetylcholine or methacholine. The
compositions and methods of the present invention may be used to
treat AHR and pulmonary inflammation. The combined use of antisense
oligonucleotides targeted to human p38 MAP kinase with one or more
conventional asthma medications including, but not limited to,
montelukast sodium (Singulair.TM.), albuterol, beclomethasone
dipropionate, triamcinolone acetonide, ipratropium bromide
(Atrovent.TM.), flunisolide, fluticasone propionate (Flovent.TM.)
and other steroids is also contemplated.
[0312] Ovalbumin-Induced Allergic Inflammation
[0313] For intratracheal administration of ISIS 101757, female
Balb/c mice (Charles Rivers Laboratory, Taconic Farms, N.Y.) were
maintained in micro-isolator cages housed in a specific
pathogen-free (SPF) facility. The sentinel cages within the animal
colony surveyed negative for viral antibodies and the presence of
known mouse pathogens. Mice were sensitized and challenged with
aerosolized chicken OVA. Briefly, 20 .mu.m alum-precipitated OVA
was injected intraperitoneally on days 0 and 14. On day 24, 25 and
26, the animals were exposed for 20 minutes to 1.0% OVA (in saline)
by nebulization. The challenge was conducted using an ultrasonic
nebulizer (PulmoSonic, The DeVilbiss Co., Somerset, Pa.). Animals
were analyzed about 24 hours following the last nebulization using
the Buxco electronics Biosystem. Lung function (Penh), lung
histology (cell infiltration and mucus production), target mRNA
reduction in the lung, inflammation (BAL cell type & number,
cytokine levels), spleen weight and serum AST/ALT were
determined.
[0314] For the aerosol studies, the protocol described above was
slightly modified. Male Balb/c mice were injected IP with OVA (20
.mu.g) in aluminum hydroxide on days 0 and 14. Aerosol dosing was
performed with nebulized sterile saline, antisense oligonucleotide
or mismatched control oligonucleotide using 25, 125 and 250
.mu.g/ml solutions (5 mg/kg) for 30 min. on days 14-20 in a closed
chamber. Aerosol lung challenge was carried out with nebulized
saline or 1% OVA for 20 min. on days 18, 19 and 20. BAL fluid was
collected at 24 hr post-last lung challenge (cell differentials) or
at 2-12 h post-challenge (cytokine analysis). AHR was measured 24
hours after OVA challenge. Mice were exposed to aerosolized
methacholine 24 hr post-last lung challenge from 2-80 mg/ml for 3
min. until a 200% increase in Penh was achieved.
[0315] Intratracheal Oligonucleotide Administration
[0316] Antisense oligonucleotides (ASOs) were dissolved in saline
and used to intratracheally dose mice every day, four times per
day, from days 15-26 of the OVA sensitization and challenge
protocol, or used as an aerosol. Specifically, the mice were
anesthetized with isofluorane and placed on a board with the front
teeth hung from a line. The nose was covered and the animal's
tongue was extended with forceps and 25 .mu.l of various doses of
ASO, or an equivalent volume of saline (control) was placed at the
back of the tongue until inhaled into the lung.
[0317] Mouse antisense oligonucleotides to p38.alpha. are
phosphorothioates with 2'-MOE modifications on nucleotides 1-5 and
16-20, and 2'-deoxy at positions 6-15. These ASOs were identified
by mouse-targeted ASO screening of 10 p38.alpha. antisense
oligonucleotides by target p38.alpha. mRNA reduction in mouse
bEND.3 cells, as described in Example 12. Dose-response
confirmation led to selection of ISIS 21873 (>70% reduction at
50 nM). ISIS 101757 contains all phosphorothioate linkages, whereas
ISIS 21873 is a mixed phosphodiester/phosphorothioate compound.
ISIS 101757 had an IC50<50 nM for reducing p38.alpha. mRNA in
endothelial cells, and an IC50 of about 250 nM in fibroblasts.
[0318] Results of Aerosol Administration
[0319] The p38.alpha. knock-down effect of ISIS 101757 was
confirmed in a mouse T cell line (EL4) and a mouse macrophage cell
line (RAW264.7) using Western blotting. ISIS 101757, but not the
mismatched control, dose-dependently suppressed
methacholine-induced AHR in sensitized mice measured by whole body
plethysmography (FIG. 1A-1B). The PC200 values for methacholine
(FIG. 2) significantly (P<0.05) reduced OVA-induced increases in
total cell counts and eosinophils recovered in BAL fluid (FIG. 3).
In addition, histological studies revealed that ISIS 101757
markedly inhibited OVA-induced inflammatory cell infiltration into
the lungs (H&E stain) and mucus hypersecretion in the airway
epithelium (PAS stain). ISIS 101757 also significantly
(P<0.05);lowered blood levels of total IgE, OVA-specific IgE and
OVA-specific IgG.sub.1 in sensitized mice as compared to the
mismatched control. Oligonucleotide levels of up to 1 .mu.g/g of
lung tissue were sufficient to achieve the pharmacological effects
described above. The aerosolized ISIS 101757 concentration in mouse
lung vs. dose is shown in FIG. 4. There was no significant effect
of aerosol oligonucleotide administration of spleen weight. These
data indicate that p38.alpha. antisense oligonucleotides are useful
for the treatment of asthma.
[0320] Intratracheal Administration Results
[0321] After intratracheal administration of ISIS 101757 as
described above, dose-dependent inhibition of the Penh response to
methacholine (50 mg/ml) challenge was observed (FIG. 5). The
oligonucleotide concentration (.mu.g/g) in lungs vs. dose is shown
in FIG. 6.
[0322] RT-PCR Analysis
[0323] RNA was harvested from experimental lungs removed on day 28
of the OVA protocol. P38.alpha. levels were measured by
quantitative RT-PCR as described in other examples herein.
[0324] Collection of Bronchial Alveolar Lavage (BAL) Fluid and
Blood Serum for the Determination of Cytokine and Chemokine
Levels
[0325] Animals were injected with a lethal dose of ketamine, the
trachea was exposed and a cannula was inserted and secured by
sutures. The lungs were lavaged twice with 0.5 ml aliquots of ice
cold PBS with 0.2% FCS. The recovered BAL fluid was centrifuged at
1,000 rpm for 10 min at 4.degree. C., frozen on dry ice and stored
at -80.degree. C. until used. Luminex was used to measure cytokine
levels in BAL fluid and serum.
[0326] BAL Cell Counts and Differentials
[0327] Cytospins of cells recovered from BAL fluid were prepared
using a Shandon Cytospin 3 (Shandon Scientific LTD, Cheshire,
England). Cell differentials were performed from slides stained
with Leukostat (Fisher Scientific, Pittsburgh, Pa.). Total cell
counts were quantified by hemocytometer and, together with the
percent type by differential, were used to calculate specific cell
number.
[0328] Tissue Histology
[0329] Before resection, lungs were inflated with 0.5 ml of 10%
phosphate-buffered formalin and fixed overnight at 4.degree. C. The
lung samples were washed free of formalin with 1.times.PBS and
subsequently dehydrated through an ethanol series prior to
equilibration in xylene and embedded in paraffin. Sections (6.mu.)
were mounted on slides and stained with hematoxylin/eosin, massons
trichome and periodic acid-schiff (PAS) reagent. Parasagittal
sections were analyzed by bright-field microscopy. Mucus cell
content was assessed as the airway epithelium staining with PAS.
Relative comparisons of mucus content were made between cohorts of
animals by counting the number of PAS-positive airways.
Example 14
Design and Screening of Duplexed Antisense Compounds Targeting
p38.alpha. MAP Kinase
[0330] In accordance with the present invention, a series of
nucleic acid duplexes comprising the antisense compounds of the
present invention and their complements can be designed to target
p38.alpha. MAP kinase. The nucleobase sequence of the antisense
strand of the duplex comprises at least a portion of an
oligonucleotide to p38.alpha. MAP kinase as described herein. The
ends of the strands may be modified by the addition of one or more
natural or modified nucleobases to form an overhang. The sense
strand of the dsRNA is then designed and synthesized as the
complement of the antisense strand and may also contain
modifications or additions to either terminus. For example, in one
embodiment, both strands of the dsRNA duplex would be complementary
over the central nucleobases, each having overhangs at one or both
termini. For example, a duplex comprising an antisense strand
having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase
overhang of deoxythymidine(dT) would have the following
structure:
29 cgagaggcggacgggaccgTT Antisense Strand
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. TTgctctccgcctgccctggc
Complement
[0331] RNA strands of the duplex can be synthesized by methods
disclosed herein or purchased from Dharmacon Research Inc.,
(Lafayette, Colo.). Once synthesized, the complementary strands are
annealed. The single strands are aliquoted and diluted to a
concentration of 50 uM. Once diluted, 30 uL of each strand is
combined with 15 uL of a 5.times.solution of annealing buffer. The
final concentration of said buffer is 100 mM potassium acetate, 30
mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume
is 75 uL. This solution is incubated for 1 minute at 90.degree. C.
and then centrifuged for 15 seconds. The tube is allowed to sit for
1 hour at 37.degree. C. at which time the dsRNA duplexes are used
in experimentation. The final concentration of the dsRNA duplex is
20 uM. This solution can be stored frozen (-20.degree. C.) and
freeze-thawed up to 5 times.
[0332] Once prepared, the duplexed antisense compounds are
evaluated for their ability to modulate p38.alpha. MAP kinase
expression according to the protocols described herein.
Example 15
Design of Phenotypic Assays and In Vivo Studies for the Use of
p38.alpha. MAP Kinase Inhibitors
[0333] Phenotypic Assays
[0334] Once p38.alpha. MAP kinase inhibitors have been identified
by the methods disclosed herein, the compounds are further
investigated in one or more phenotypic assays, each having
measurable endpoints predictive of efficacy in the treatment of a
particular disease state or condition. Phenotypic assays, kits and
reagents for their use are well known to those skilled in the art
and are herein used to investigate the role and/or association of
p38.alpha. MAP kinase in health and disease. Representative
phenotypic assays, which can be purchased from any one of several
commercial vendors, include those for determining cell viability,
cytotoxicity, proliferation or cell survival (Molecular Probes,
Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays
including enzymatic assays (Panvera, LLC, Madison, Wis.; BD
Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San
Diego, Calif.), cell regulation, signal transduction, inflammation,
oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor,
Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.),
angiogenesis assays, tube formation assays, cytokine and hormone
assays and metabolic assays (Chemicon International Inc., Temecula,
Calif.; Amersham Biosciences, Piscataway, N.J.).
[0335] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with p38.alpha. MAP kinase inhibitors identified from
the in vitro studies as well as control compounds at optimal
concentrations which are determined by the methods described above.
At the end of the treatment period, treated and untreated cells are
analyzed by one or more methods specific for the assay to determine
phenotypic outcomes and endpoints.
[0336] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0337] Analysis of the genotype of the cell (measurement of the
expression of one or more of the genes of the cell) after treatment
is also used as an indicator of the efficacy or potency of the
p38.alpha. MAP kinase inhibitors. Hallmark genes, or those genes
suspected to be associated with a specific disease state,
condition, or phenotype, are measured in both treated and untreated
cells.
Sequence CWU 0
0
* * * * *