U.S. patent application number 10/815730 was filed with the patent office on 2004-09-02 for recombinational cloning using nucleic acids having recombination sites.
This patent application is currently assigned to Invitrogen Corporation. Invention is credited to Brasch, Michael A., Fox, Donna K., Hartley, James L., Temple, Gary F..
Application Number | 20040171156 10/815730 |
Document ID | / |
Family ID | 26746186 |
Filed Date | 2004-09-02 |
United States Patent
Application |
20040171156 |
Kind Code |
A1 |
Hartley, James L. ; et
al. |
September 2, 2004 |
Recombinational cloning using nucleic acids having recombination
sites
Abstract
Recombinational cloning is provided by the use of nucleic acids,
vectors and methods, in vitro and in vivo, for moving or exchanging
segments of DNA molecules using engineered recombination sites and
recombination proteins to provide chimeric DNA molecules that have
the desired characteristic(s) and/or DNA segment(s).
Inventors: |
Hartley, James L.;
(Frederick, MD) ; Brasch, Michael A.;
(Gaithersburg, MD) ; Temple, Gary F.; (Washington
Grove, MD) ; Fox, Donna K.; (Sykesville, MD) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX PLLC
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Invitrogen Corporation
Carlsbad
CA
|
Family ID: |
26746186 |
Appl. No.: |
10/815730 |
Filed: |
April 2, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10815730 |
Apr 2, 2004 |
|
|
|
09648790 |
Aug 28, 2000 |
|
|
|
09648790 |
Aug 28, 2000 |
|
|
|
09177387 |
Oct 23, 1998 |
|
|
|
10815730 |
Apr 2, 2004 |
|
|
|
09432085 |
Nov 2, 1999 |
|
|
|
09432085 |
Nov 2, 1999 |
|
|
|
09233493 |
Jan 20, 1999 |
|
|
|
6143557 |
|
|
|
|
09233493 |
Jan 20, 1999 |
|
|
|
08663002 |
Jun 7, 1996 |
|
|
|
5888732 |
|
|
|
|
08663002 |
Jun 7, 1996 |
|
|
|
08486139 |
Jun 7, 1995 |
|
|
|
60065930 |
Oct 24, 1997 |
|
|
|
Current U.S.
Class: |
435/455 ;
435/320.1; 435/91.2 |
Current CPC
Class: |
C12N 15/66 20130101;
C12N 15/10 20130101; C12N 9/00 20130101; C12N 15/64 20130101 |
Class at
Publication: |
435/455 ;
435/320.1; 435/091.2 |
International
Class: |
C12N 015/85; C12Q
001/68; C12P 019/34 |
Claims
What is claimed is:
1. An in vitro method of cloning an amplification product
comprising: (a) obtaining an amplification product comprising a
first recombination site and a second recombination site which do
not recombine with each other; and (b) combining said amplification
product in vitro with a vector comprising a third recombination
site and a fourth recombination site which do not recombine with
each other, under conditions such that recombination occurs between
said first and third and said second and fourth recombination
sites, thereby producing a product vector.
2. The method of claim 1, further comprising inserting said product
vector into a host cell.
3. The method of claim 1, wherein said vector is an expression
vector.
4. The method of claim 1, wherein said vector comprises at least
one additional nucleic acid sequence selected from the group
consisting of a selectable marker, a cloning site, a restriction
site, a promoter, an operon, an origin of replication, and a gene
or partial gene.
5. The method of claim 1, wherein said vector comprises at least
one origin of replication.
6. The method of claim 1, wherein said vector comprises at least
one promoter.
7. The method of claim 1, wherein said vector comprises at least
one selectable marker.
8. The method of claim 1, wherein said amplification product is
linear.
9. The method of claim 1, wherein said first, second, third or
fourth recombination sites are lox sites or functional mutants
thereof.
10. The method of claim 9, wherein said lox sites are selected from
the group consisting of loxP sites and loxP511 sites.
11. The method of claim 1, wherein said first, second, third or
fourth recombination sites are att sties or functional mutants
thereof.
12. The method of claim 11, wherein said att sites are selected
from the group consisting of attB sites, attP sites, attL sites and
attR sites.
13. The method of claim 1, wherein said first, second, third or
fourth recombination sites are selected from the group consisting
of a lox site, an att site, an FRT site, and functional mutants
thereof.
14. The method of claim 1, wherein said amplification product and
said vector are combined in the presence of at least one
recombination protein.
15. The method of claim 14, wherein said recombination protein is
Cre.
16. The method of claim 14, wherein said recombination protein is
selected from the group consisting of Int, Xis and IHF.
17. The method of claim 1, wherein said amplification product is a
polymerase chain reaction product.
18. The method of claim 17, wherein said polymerase chain reaction
product is linear.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 09/648,790, filed Aug. 28, 2000, which is a
continuation of U.S. application Ser. No. 09/177,387, filed Oct.
23, 1998, which claims the benefit of the filing date of U.S.
Provisional Application No. 60/065,930, filed Oct. 24, 1997. The
present application is also a continuation-in-part of U.S.
application Ser. No. 09/432,085, filed Nov. 2, 1999, which is a
divisional of U.S. application Ser. No. 09/233,493, filed Jan. 20,
1999 (now U.S. Pat. No. 6,143,557), which is a continuation of U.S.
application Ser. No. 08/663,002, filed Jun. 7, 1996 (now U.S. Pat.
No. 5,888,732), which is a continuation-in-part of U.S. application
Ser. No. 08/486,139, filed Jun. 7, 1995 (now abandoned). The
disclosures of which applications are incorporated by reference
herein in their entireties.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to recombinant DNA technology.
DNA and vectors having engineered recombination sites are provided
for use in a recombinational cloning method that enables efficient
and specific recombination of DNA segments using recombination
proteins. The DNAs, vectors and methods are useful for a variety of
DNA exchanges, such as subcloning of DNA, in vitro or in vivo.
[0004] 2. Related Art
[0005] Site-specific recombinases. Site-specific recombinases are
proteins that are present in many organisms (e.g. viruses and
bacteria) and have been characterized to have both endonuclease and
ligase properties. These recombinases (along with associated
proteins in some cases) recognize specific sequences of bases in
DNA and exchange the DNA segments flanking those segments. The
recombinases and associated proteins are collectively referred to
as "recombination proteins" (see, e.g., Landy, A., Current Opinion
in Biotechnology 3:699-707 (1993)).
[0006] Numerous recombination systems from various organisms have
been described. See, e.g., Hoess et al., Nucleic Acids Research
14(6):2287 (1986); Abremski et al., J. Biol. Chem.261(1):391
(1986); Campbell, J. Bacteriol. 174(23):7495 (1992); Qian et al.,
J. Biol. Chem. 267(11):7794 (1992); Araki et al., J. Miol. Biol.
225(1):25 (1992); Maeser and Kahnmann Mol. Gen. Genet. 230:170-176)
(1991); Esposito et al., Nucl. Acids Res. 25(18):3605 (1997).
[0007] Many of these belong to the integrase family of recombinases
(Argos et al. EMBO J. 5:433-440 (1986)). Perhaps the best studied
of these are the Integrase/att system from bacteriophage .lambda.
(Landy, A. Current Opinions in Genetics and Devel. 3:699-707
(1993)), the Cre/loxP system from bacteriophage P1 (Hoess and
Abremski (1990) In Nucleic Acids and Molecular Biology, vol. 4.
Eds.: Eckstein and Lilley, Berlin-Heidelberg: Springer-Verlag; pp.
90-109), and the FLP/FRT system from the Saccharomyces cerevisiae
2.mu. circle plasmid (Broach et al. Cell 29:227-234 (1982)).
[0008] Backman (U.S. Pat. No. 4,673,640) discloses the in vivo use
of .lambda. recombinase to recombine a protein producing DNA
segment by enzymatic site-specific recombination using wild-type
recombination sites attB and attP.
[0009] Hasan and Szybalski (Gene 56:145-151 (1987)) discloses the
use of .lambda. Int recombinase in vivo for intramolecular
recombination between wild type attP and attB sites which flank a
promoter. Because the orientations of these sites are inverted
relative to each other, this causes an irreversible flipping of the
promoter region relative to the gene of interest.
[0010] Palazzolo et al. Gene 88:25-36 (1990), discloses phage
lambda vectors having bacteriophage .lambda. arms that contain
restriction sites positioned outside a cloned DNA sequence and
between wild-type loxP sites. Infection of E. coli cells that
express the Cre recombinase with these phage vectors results in
recombination between the loxP sites and the in vivo excision of
the plasmid replicon, including the cloned cDNA.
[0011] Psfai et al. (Nucl. Acids Res. 22:2392-2398 (1994))
discloses a method for inserting into genomic DNA partial
expression vectors having a selectable marker, flanked by two
wild-type FRT recognition sequences. FLP site-specific recombinase
as present in the cells is used to integrate the vectors into the
genome at predetermined sites. Under conditions where the replicon
is functional, this cloned genomic DNA can be amplified.
[0012] Bebee et al. (U.S. Pat. No. 5,434,066) discloses the use of
site-specific recombinases such as Cre for DNA containing two loxP
sites is used for in vivo recombination between the sites.
[0013] Boyd (Nucl. Acids Res. 21:817-821 (1993)) discloses a method
to facilitate the cloning of blunt-ended DNA using conditions that
encourage intermolecular ligation to a dephosphorylated vector that
contains a wild-type loxP site acted upon by a Cre site-specific
recombinase present in E. coli host cells.
[0014] Waterhouse et al. (PCT No. 93/19172 and Nucleic Acids Res.
21 (9):2265 (1993)) disclose an in vivo method where light and
heavy chains of a particular antibody were cloned in different
phage vectors between loxP and loxP 511 sites and used to transfect
new E. coli cells. Cre, acting in the host cells on the two
parental molecules (one plasmid, one phage), produced four products
in equilibrium: two different cointegrates (produced by
recombination at either loxP or loxP 511 sites), and two daughter
molecules, one of which was the desired product.
[0015] In contrast to the other related art, Schlake & Bode
(Biochemistry 33:12746-12751 (1994)) discloses an in vivo method to
exchange expression cassettes at defined chromosomal locations,
each flanked by a wild type and a spacer-mutated FRT recombination
site. A double-reciprocal crossover was mediated in cultured
mammalian cells by using this FLP/FRT system for site-specific
recombination.
[0016] Transposases. The family of enzymes, the transposases, has
also been used to transfer genetic information between replicons.
Transposons are structurally variable, being described as simple or
compound, but typically encode the recombinase gene flanked by DNA
sequences organized in inverted orientations. Integration of
transposons can be random or highly specific. Representatives such
as Tn7, which are highly site-specific, have been applied to the in
vivo movement of DNA segments between replicons (Lucklow et al., J.
Virol. 67:4566-4579 (1993)).
[0017] Devine and Boeke Nucl. Acids Res. 22:3765-3772 (1994),
discloses the construction of artificial transposons for the
insertion of DNA segments, in vitro, into recipient DNA molecules.
The system makes use of the integrase of yeast TY1 virus-like
particles. The DNA segment of interest is cloned, using standard
methods, between the ends of the transposon-like element TY1. In
the presence of the TY1 integrase, the resulting element integrates
randomly into a second target DNA molecule.
[0018] DNA cloning. The cloning of DNA segments currently occurs as
a daily routine in many research labs and as a prerequisite step in
many genetic analyses. The purpose of these clonings is various,
however, two general purposes can be considered: (1) the initial
cloning of DNA from large DNA or RNA segments (chromosomes, YACs,
PCR fragments, mRNA, etc.), done in a relative handful of known
vectors such as pUC, pGem, pBlueScript, and (2) the subcloning of
these DNA segments into specialized vectors for functional
analysis. A great deal of time and effort is expended both in the
transfer of DNA segments from the initial cloning vectors to the
more specialized vectors. This transfer is called subcloning.
[0019] The basic methods for cloning have been known for many years
and have changed little during that time. A typical cloning
protocol is as follows:
[0020] (1) digest the DNA of interest with one or two restriction
enzymes;
[0021] (2) gel purify the DNA segment of interest when known;
[0022] (3) prepare the vector by cutting with appropriate
restriction enzymes, treating with alkaline phosphatase, gel purify
etc., as appropriate;
[0023] (4) ligate the DNA segment to the vector, with appropriate
controls to eliminate background of uncut and self-ligated
vector;
[0024] (5) introduce the resulting vector into an E. coli host
cell;
[0025] (6) pick selected colonies and grow small cultures
overnight;
[0026] (7) make DNA minipreps; and
[0027] (8) analyze the isolated plasmid on agarose gels (often
after diagnostic restriction enzyme digestions) or by PCR.
[0028] The specialized vectors used for subcloning DNA segments are
functionally diverse. These include but are not limited to: vectors
for expressing genes in various organisms; for regulating gene
expression; for providing tags to aid in protein purification or to
allow tracking of proteins in cells; for modifying the cloned DNA
segment (e.g., generating deletions); for the synthesis of probes
(e.g., riboprobes); for the preparation of templates for DNA
sequencing; for the identification of protein coding regions; for
the fusion of various protein-coding regions; to provide large
amounts of the DNA of interest, etc. It is common that a particular
investigation will involve subcloning the DNA segment of interest
into several different specialized vectors.
[0029] As known in the art, simple subclonings can be done in one
day (e.g., the DNA segment is not large and the restriction sites
are compatible with those of the subcloning vector). However, many
other subclonings can take several weeks, especially those
involving unknown sequences, long fragments, toxic genes,
unsuitable placement of restriction sites, high backgrounds, impure
enzymes, etc. Subcloning DNA fragments is thus often viewed as a
chore to be done as few times as possible. Several methods for
facilitating the cloning of DNA segments have been described, e.g.,
as in the following references.
[0030] Ferguson, J., et al. Gene 16:191 (1981), discloses a family
of vectors for subcloning fragments of yeast DNA. The vectors
encode kanamycin resistance. Clones of longer yeast DNA segments
can be partially digested and ligated into the subcloning vectors.
If the original cloning vector conveys resistance to ampicillin, no
purification is necessary prior to transformation, since the
selection will be for kanamycin.
[0031] Hashimoto-Gotoh, T., et al. Gene 41:125 (1986), discloses a
subcloning vector with unique cloning sites within a streptomycin
sensitivity gene; in a streptomycin-resistant host, only plasmids
with inserts or deletions in the dominant sensitivity gene will
survive streptomycin selection.
[0032] Accordingly, traditional subcloning methods, using
restriction enzymes and ligase, are time consuming and relatively
unreliable. Considerable labor is expended, and if two or more days
later the desired subclone can not be found among the candidate
plasmids, the entire process must then be repeated with alternative
conditions attempted. Although site specific recombinases have been
used to recombine DNA in vivo, the successful use of such enzymes
in vitro was expected to suffer from several problems. For example,
the site specificities and efficiencies were expected to differ in
vitro; topologically-linked products were expected; and the
topology of the DNA substrates and recombination proteins was
expected to differ significantly in vitro (see, e.g., Adams et al,
J. Mol. Biol. 226:661-73 (1992)). Reactions that could go on for
many hours in vivo were expected to occur in significantly less
time in vitro before the enzymes became inactive. Multiple DNA
recombination products were expected in the biological host used,
resulting in unsatisfactory reliability, specificity or efficiency
of subcloning. Thus, in vitro recombination reactions were not
expected to be sufficiently efficient to yield the desired levels
of product.
[0033] Accordingly, there is a long felt need to provide an
alternative subcloning system that provides advantages over the
known use of restriction enzymes and ligases.
SUMMARY OF THE INVENTION
[0034] The present invention provides nucleic acids, vectors and
methods for obtaining amplified, chimeric or recombinant nucleic
acid molecules using recombination proteins and at least one
recombination site, in vitro or in vivo. These methods are highly
specific, rapid, and less labor intensive than standard cloning or
subcloning techniques. The improved specificity, speed and yields
of the present invention facilitates DNA or RNA cloning or
subcloning, regulation or exchange useful for any related
purpose.
[0035] The present invention relates to nucleic acids, vectors and
methods for moving or exchanging nucleic acid segments (preferably
DNA segments or fragments) using at least one recombination site
and at least one recombination protein to provide chimeric DNA
molecules which have the desired characteristic(s) and/or DNA
segment(s). Use of the invention thus allows for cloning or
subcloning such nucleic acid molecules into a variety of vectors.
Generally, one or more parent nucleic acid molecules (preferably
DNA molecules) are recombined to give one or more daughter
molecules, at least one of which is the desired Product molecule,
which is preferably a vector comprising the desired nucleic acid
segment. The invention thus relates to nucleic acid molecules,
vectors and methods to effect the exchange and/or to select for one
or more desired products.
[0036] One embodiment of the present invention relates to a method
of making chimeric molecule, which comprises
[0037] (a) combining in vitro or in vivo
[0038] (i) one or more Insert Donor molecules comprising a desired
nucleic acid segment flanked by a first recombination site and a
second recombination site, wherein the first and second
recombination sites do not substantially recombine with each
other;
[0039] (ii) one or more Vector Donor molecules comprising a third
recombination site and a fourth recombination site, wherein the
third and fourth recombination sites do not substantially recombine
with each other; and
[0040] (iii) one or more site specific recombination proteins
capable of recombining the first and third recombinational sites
and/or the second and fourth recombinational sites;
[0041] thereby allowing recombination to occur, so as to produce at
least one cointegrate nucleic acid molecule, at least one desired
Product nucleic acid molecule which comprises said desired segment,
and optionally a Byproduct nucleic acid molecule; and then,
optionally,
[0042] (b) selecting for the Product or Byproduct DNA molecule.
[0043] In another embodiment, the present invention relates to a
method of making chimeric molecule, which comprises
[0044] (a) combining in vitro or in vivo
[0045] (i) one or more Insert Donor molecules comprising a desired
nucleic acid segment flanked by two or more recombination sites
wherein said recombination sites do not substantially recombine
with each other;
[0046] (ii) one or more Vector Donor molecules comprising two or
more recombination sites, wherein said recombination sites do not
substantially recombine with each other; and
[0047] (iii) one or more site specific recombination proteins;
[0048] (b) incubating said combination under conditions sufficient
to transfer one or more said desired segments into one or more of
said Vector Donor molecules, thereby producing one or more Product
molecules. The resulting Product molecules may optionally be
selected or isolated away from other molecules such as cointegrate
molecules, Byproduct molecules, and unreacted Vector Donor
molecules or Insert Donor molecules. In a preferred aspect of the
invention, the Insert Donor molecules are combined with one or more
different Vector Donor molecules, thereby allowing for the
production of different Product molecules in which the nucleic acid
of interest is transferred into any number of different vectors in
the single step.
[0049] In accordance with the invention, the above methods may be
reversed to provide the original Insert Donor molecules which may
then be used in combination with one or more different Vector Donor
molecules to produce new Product or Byproduct molecules.
Alternatively, the Product molecules produced by the method of the
invention may serve as the Insert Donor molecules which may be used
directly in combination with one or more different Vector Donor
molecules, thereby producing new Product or Byproduct molecules.
Thus, nucleic acid molecules of interest may be transferred or
moved to any number of desired vectors, thereby providing an
efficient means for subcloning molecules of interest.
[0050] Thus, the invention relates to combining a Product molecule
with a second Vector Donor molecules to produce a second Product
molecule. The second Product DNA molecule may then be utilized in
combination with a third Vector Donor molecule to produce a third
Product molecule. This process of the invention may be repeated any
number of times to transfer or move the insert of interest into any
number of different vectors. In this aspect of the invention, a
combination of two or more different Vector Donor molecules may be
combined with the Product molecule to produce in a single step
different Product molecules in which the desired nucleic acid
segment (derived from the Product DNA molecule) is transferred into
any number of different vectors.
[0051] In particular, the present invention relates to a method for
cloning or subcloning one or more desired nucleic acid molecules
comprising
[0052] (a) combining in vitro or in vivo
[0053] (i) one or more Insert Donor molecules comprising one or
more desired nucleic acid segments flanked by at least two
recombination sites, wherein said recombination sites do not
substantially recombined with each other;
[0054] (ii) one or more Vector Donor molecules comprising at least
two recombination sites, wherein said recombination sites do not
substantially recombine with each other; and
[0055] (iii) one or more site specific recombination proteins;
[0056] (b) incubating said combination under conditions sufficient
to allow one or more of said desired segments to be transferred
into one or more of said Vector Donor molecules, thereby producing
one or more Product molecules;
[0057] (c) optionally selecting for or isolating said Product
molecule;
[0058] (d) combining in vitro or in vivo
[0059] (i) one or more of said Product molecules comprising said
desired segments flanked by two or more recombination sites,
wherein said recombination sites do not substantially recombine
with each other;
[0060] (ii) one or more different Vector Donor molecules comprising
two or more recombination sites, wherein said recombination sites
do not substantially recombine with each other; and
[0061] (iii) one or more site specific recombination protein;
and
[0062] (e) incubating said combination under conditions sufficient
to transfer one or more of said desired segments into one or more
of said different Vector Donor molecules, thereby producing one or
more different Product molecules.
[0063] In accordance with the invention, Vector Donor molecules may
comprise vectors which may function in a variety of systems or host
cells. Preferred vectors for use in the invention include
prokaryotic vectors, eukaryotic vectors or vectors which may
shuttle between various prokaryotic and/or eukaryotic systems (e.g.
shuttle vectors). Preferred prokaryotic vectors for use in the
invention include but are not limited to vectors which may
propagate and/or replicate in gram negative and/or gram positive
bacteria, including bacteria of the genus Escherichia, Salmonella,
Proteus, Clostridium, Klebsiella, Bacillus, Streptomyces, and
Pseudomonas and preferably in the species E. coli. Eukaryotic
vectors for use in the invention include vectors which propagate
and/or replicate and yeast cells, plant cells, mammalian cells,
(particularly human), fungal cells, insect cells, fish cells and
the like. Particular vectors of interest include but are not
limited to cloning vectors, sequencing vectors, expression vectors,
fusion vectors, two-hybrid vectors, gene therapy vectors, and
reverse two-hybrid vectors. Such vectors may be used in prokaryotic
and/or eukaryotic systems depending on the particular vector.
[0064] The Insert Donor molecules used in accordance with the
invention preferably comprise two or more recombination sites which
allow the insert (e.g. the nucleic acid segment of interest) of the
Donor molecules to be transferred or moved into one or more Vector
Donor molecules in accordance with the invention. The Insert Donor
molecules of the invention may be prepared by any number of
techniques by which two or more recombination sites are added to
the molecule of interest. Such means for including recombination
sites to prepare the Insert Donor molecules of the invention
includes mutation of a nucleic acid molecule (e.g. random or site
specific mutagenesis), recombinant techniques (e.g. ligation of
adapters or nucleic acid molecules comprising recombination sites
to linear molecules), amplification (e.g. using primers which
comprise recombination sites or portions thereof) transposition
(e.g. using transposons which comprise recombination sites),
recombination (e.g. using one or more homologous sequences
comprising recombination sites), nucleic acid synthesis (e.g.
chemical synthesis of molecules comprising recombination sites or
enzymatic synthesis using various polymerases or reverse
transcriptases) and the like. In accordance with the invention,
nucleic acid molecules to which one or more recombination sites are
added may be any nucleic acid molecule derived from any source and
may include non naturally occurring nucleic acids (e.g. RNA's; see
U.S. Pat. Nos. 5,539,082 and 5,482,836). Particularly preferred
nucleic acid molecules are DNA molecules (single stranded or double
stranded). Additionally, the nucleic acid molecules of interest for
producing Insert Donor molecules may be linear or circular and
further may comprise a particular sequence of interest (e.g. a
gene) or may be a population of molecules (e.g. molecules generated
from a genomic or cDNA libraries).
[0065] Thus, the invention relates to a number of methods for
preparing Insert Donor molecules and the Insert Donor molecules
produced by such methods. In one aspect of the invention, primers
comprising one or more recombination sites or portions thereof are
used in the nucleic acid synthesis or nucleic acid amplification to
prepare the Insert Donor molecules of the invention. Thus, the
invention relates to a method of synthesizing a nucleic acid
molecule comprising:
[0066] (a) mixing one or more nucleic acid templates with a
polypeptide having polymerase activity and one or more primers
comprising one or more recombination sites or portions thereof;
and
[0067] (b) incubating said mixture under conditions sufficient to
synthesize one or more nucleic acid molecules which are
complementary to all or a portion of said templates and which
comprises one or more recombination sites. In accordance with the
invention, the synthesized nucleic acid molecule comprising one or
more recombination sites may be used as templates under appropriate
conditions to synthesize nucleic acid molecules complementary to
all or a portion of the recombination site containing templates,
thereby forming double stranded molecules comprising one or more
recombination sites. Preferably, such second synthesis step is
performed in the presence of one or more primers comprising one or
more recombination sites. In yet another aspect, the synthesized
double stranded molecules may be amplified using primers which may
comprise one or more recombination sites.
[0068] In another aspect of the invention, one or more
recombination sites may be added to nucleic acid molecules by any
of a number of nucleic acid amplification techniques. In
particular, such method comprises:
[0069] (a) contacting a first nucleic acid molecule with a first
primer molecule which is complementary to a portion of said first
nucleic acid molecule and a second nucleic acid molecule with a
second primer molecule which is complementary to a portion of said
second nucleic acid molecule in the presence of one or more
polypeptides having polymerases activity;
[0070] (b) incubating said molecules under conditions sufficient to
form a third nucleic acid molecule complementary to all or a
portion of said first nucleic acid molecule and the fourth nucleic
acid molecule complementary to all or a portion of said second
nucleic acid molecule;
[0071] (c) denaturing said first and third and said second and
fourth nucleic acid molecules; and
[0072] (d) repeating steps (a) through (c) one or more times,
[0073] wherein said first and/or said second primer molecules
comprise one or more recombination sites or portions thereof.
[0074] In yet another aspect of the invention, a method for adding
one or more recombination sites to nucleic acid molecules may
comprise:
[0075] (a) contacting one or more nucleic acid molecules with one
or more adapters or nucleic acid molecules which comprise one or
more recombination sites or portions thereof; and
[0076] (b) incubating said mixture under conditions sufficient to
add one or more recombination sites to said nucleic acid molecules.
Preferably, linear molecules are used for adding such adapters or
molecules in accordance with the invention and such adapters or
molecules are preferably added to one or more termini of such
linear molecules. The linear molecules may be prepared by any
technique including mechanical (e.g. sonication or shearing) or
enzymatic (e.g. nucleases such as restriction endonucleases). Thus,
the method of the invention may further comprise digesting the
nucleic acid molecule with one or more nucleases (preferably any
restriction endonucleases) and ligating one or more of the
recombination site containing adapters or molecules to the molecule
of interest. Ligation may be accomplished using blunt ended or
stick ended molecules. Alternatively, topoisomerases may be used to
introduce recombination sites in accordance with the invention.
Topoisomerases cleave and rejoin nucleic acid molecules and
therefore may be used in place of nucleases and ligases.
[0077] In another aspect, one or more recombination sites may be
added to nucleic acid molecules by de novo synthesis. Thus, the
invention relates to such a method which comprises chemically
synthesizing one or more nucleic acid molecules in which
recombination sites are added by adding the appropriate sequence of
nucleotides during the synthesis process.
[0078] In another embodiment of the invention, one or more
recombination sites may be added to nucleic acid molecules of
interest by a method which comprises:
[0079] (a) contacting one or more nucleic acid molecules with one
or more integration sequences which comprise one or more
recombination sites or portions thereof; and
[0080] (b) incubation of said mixture under conditions sufficient
to incorporate said recombination site containing integration
sequences into said nucleic acid molecules. In accordance with this
aspect of the invention, integration sequences may comprise any
nucleic acid molecules which through recombination or by
integration become a part of the nucleic acid molecule of interest.
Integration sequences may be introduced in accordance with this
aspect of the invention by in vivo or in vitro recombination
(homologous recombination or illegitimate recombination) or by in
vivo or in vitro installation by using transposons, insertion
sequences, integrating viruses, homing introns, or other
integrating elements.
[0081] In another aspect, the invention relates to kits for
carrying out the methods of the invention and more specifically
relates to cloning or subcloning kits and kits for making Insert
Donor molecules of the invention. Such kits may comprise a carrier
or receptacle being compartmentalized to receive and hold therein
any number of containers. Such containers may contain any number of
components for carrying out the methods of the invention or
combinations of such components. In particular, a kit of the
invention may comprise one or more components (or combinations
thereof) selected from the group consisting of one or more
recombination proteins or recombinases, one or more Vector Donor
molecules, one or more Insert Donor molecules and one or more host
cells (e.g. competent cells).
[0082] Kits for making the Insert Donor molecules of the invention
may comprise any or a number of components and the composition of
such kits may vary depending on the specific method involved. Kits
for synthesizing Insert Donor molecules by amplification may
comprise one or more components (or combinations thereof) selected
from the group consisting of one or more polypeptides having
polymerase activity (preferably DNA polymerases and most preferably
thermostable DNA polymerases), one or more nucleotides, and one or
more primers comprising one or more recombination sites. Kits for
inserting or adding recombination sites to nucleic acid molecules
of interest may comprise one or more nucleases (preferably
restriction endonucleases), one or more ligases, one or more
topoisomerases one or more polymerases, and one or more nucleic
acid molecules or adapters comprising one or more recombination
sites. Kits for integrating recombination sites into one or more
nucleic acid molecules of interest may comprise one or more
components (or combinations thereof) selected from the group
consisting of one or more integration sequences comprising one or
more recombination sites. Such integration sequences may comprise
one or more transposons, integrating viruses, homologous
recombination sequences, one or more host cells and the like.
[0083] The invention also relates to compositions for carrying out
the methods of the invention or compositions which are produced
from carrying out the methods of the invention. In particular, such
compositions may comprise one or more Insert Donor molecules, one
or more Vector Donor molecules and one or more recombination
proteins (or combinations thereof). In a further aspect, the
compositions of the invention may comprise one or more cointegrate
molecules, one or more Product molecules and one or more Byproduct
molecule (or combinations thereof).
[0084] Compositions related to preparing Insert Donor molecules may
vary depending on the particular method utilized in preparing the
desired Insert Donor molecules. Compositions for preparing such
molecules by amplification may comprise one or more polypeptides
having polymerase activity, one or more primers comprising one or
more recombination sites, one or more nucleotides and one or more
nucleic acid molecule to be amplified (or combinations thereof).
Compositions related to inserting or adding recombination sites in
a desired nucleic acid molecule may comprise one or more nucleic
acid molecules or adapters comprising one or more recombination
sites, one or more ligases, one or more restriction endonucleases,
one or more topoisomerases, and one or more nucleic acid molecules
desired to contain such recombination sites (or combinations
thereof). Compositions related to integration of recombination
sites in a desired nucleic acid molecule may comprise one or more
integration sequences comprising one or more recombination sites
and one or more nucleic acid molecules desired to contain the
recombination sites.
[0085] In a particularly preferred aspect of the invention,
libraries (e.g. populations of genomic DNA or cDNA, or populations
of nucleic acid molecules, produced by de novo synthesis such as
random sequences or degenerate oligonucleotides) are utilized in
accordance with the present invention. By inserting or adding
recombination sites to such populations of nucleic acid molecules,
a population of Insert Donor molecules are produced. By the
recombination methods of the invention, the library may be easily
moved into different vectors (or combinations of vectors) and thus
into different host systems (prokaryotic and eukaryotic) to
evaluate and analyze the library or a particular sequences or
clones derived from the library. Alternatively, the vectors
containing the desired molecule may be used in vitro systems such
as in vitro expression systems for production of RNA and/or
protein. In a particularly preferred aspect, one or more
recombination sites are added to nucleic acid molecules of the
library by method comprising:
[0086] (a) mixing a population of linear nucleic acid molecules
with one or more adapters comprising one or more recombination
sites; and
[0087] (b) incubating said mixture under conditions sufficient to
add one or more of said adapters to one or more termini of said
linear molecules. In a preferred aspect, the population of nucleic
acid molecules are double stranded DNA molecules (preferably
genomic DNA or cDNA). A population of linear fragments for use in
the invention may be prepared by cleaving (by mechanical or
enzymatic means) the genomic or cDNA. In a preferred aspect, the
adapters are added to one or more termini of the linear
molecules.
[0088] In another particularly preferred aspect of the invention,
cDNA libraries are used to prepare a population of Insert Donor DNA
molecules of the invention. In particular, this aspect of the
invention relates to a method which comprises:
[0089] (a) contacting a population of RNA, mRNA or polyA+ RNA
templates with one or more polypeptides having reverse
transcriptase activity and one or more primers which comprises one
or more recombination sites;
[0090] (b) incubating said mixture under conditions sufficient to
synthesize a first population of DNA molecules complementary to
said templates, wherein said DNA molecules comprise one or more
recombination sites. This aspect of the invention may further
comprise incubating said synthesized DNA under conditions
sufficient to make a second population of DNA molecules
complementary to all or a portion of said first population of DNA
molecules, thereby forming a population of double stranded DNA
molecules comprising one or more recombination sites.
[0091] In a particularly preferred aspect, the Insert Donor
molecules of the invention comprise at least two recombination
sites and where the Insert Donor molecules are linear, such two or
more recombination sites are preferably located at or near both
termini of the molecules. In accordance with the invention, the use
of additional recombination sites (i.e. more than two) may be used
to facilitate subcloning of different inserts within the Insert
Donor molecule, depending on the type and placement of such
recombination sites.
[0092] Other embodiments include DNA and vectors useful in the
methods of the present invention. In particular, Vector Donor
molecules are provided in one embodiment, wherein DNA segments
within the Vector Donor are separated either by, (i) in a circular
Vector Donor, at least two recombination sites, or (ii) in a linear
Vector Donor, at least one recombination site, where the
recombination sites are preferably engineered to enhance
specificity or efficiency of recombination. One Vector Donor
embodiment comprises a first DNA segment and a second DNA segment,
the first or second segment comprising a selectable marker. A
second Vector Donor embodiment comprises a first DNA segment and a
second DNA segment, the first or second DNA segment comprising a
toxic gene. A third Vector Donor embodiment comprises a first DNA
segment and a second DNA segment, the first or second DNA segment
comprising an inactive fragment of at least one selectable marker,
wherein the inactive fragment of the Selectable marker is capable
of reconstituting a functional Selectable marker when recombined
across the first or second recombination site with another inactive
fragment of at least one Selectable marker.
[0093] Other preferred embodiments of the present invention will be
apparent to one of ordinary skill in light of what is known in the
art, in light of the following drawings and description of the
invention, and in light of the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0094] FIG. 1 depicts one general method of the present invention,
wherein the starting (parent) DNA molecules can be circular or
linear. The goal is to exchange the new subcloning vector D for the
original cloning vector B. It is desirable in one embodiment to
select for AD and against all the other molecules, including the
Cointegrate. The square and circle are sites of recombination:
e.g., loxP sites, att sites, etc. For example, segment D can
contain expression signals, new drug markers, new origins of
replication, or specialized functions for mapping or sequencing
DNA.
[0095] FIG. 2A depicts an in vitro method of recombining an Insert
Donor plasmid (here, pEZC705) with a Vector Donor plasmid (here,
pEZC726), and obtaining Product DNA and Byproduct daughter
molecules. The two recombination sites are attP and loxP on the
Vector Donor. On one segment defined by these sites is a kanamycin
resistance gene whose promoter has been replaced by the tetOP
operator/promoter from transposon Tn10. See, e.g., Sizemore et al.,
Nucl. Acids Res. 18(10):2875 (1990). In the absence of tet
repressor protein, E. coli RNA polymerase transcribes the kanamycin
resistance gene from the tetOP. If tet repressor is present, it
binds to tetOP and blocks transcription of the kanamycin resistance
gene. The other segment of pEZC726 has the tet repressor gene
expressed by a constitutive promoter. Thus cells transformed by
pEZC726 are resistant to chloramphenicol, because of the
chloramphenicol acetyl transferase gene on the same segment as
tetR, but are sensitive to kanamycin. The recombinase-mediated
reactions result in separation of the tetR gene from the regulated
kanamycin resistance gene. This separation results in kanamycin
resistance only in cells receiving the desired recombination
product. The first recombination reaction is driven by the addition
of the recombinase called Integrase. The second recombination
reaction is driven by adding the recombinase Cre to the Cointegrate
(here, pEZC7 Cointegr).
[0096] FIG. 2B depicts a restriction map of pEZC705.
[0097] FIG. 2C depicts a restriction map of pEZC726.
[0098] FIG. 2D depicts a restriction map of pEZC7 Coint.
[0099] FIG. 2E depicts a restriction map of Intprod.
[0100] FIG. 2F depicts a restriction map of Intbypro.
[0101] FIG. 3A depicts an in vitro method of recombining an Insert
Donor plasmid (here, pEZC602) with a Vector Donor plasmid (here,
pEZC629), and obtaining Product (here, EZC6prod) and Byproduct
(here, EZC6Bypr) daughter molecules. The two recombination sites
are loxP and loxP 511. One segment of pEZC629 defined by these
sites is a kanamycin resistance gene whose promoter has been
replaced by the tetOP operator/promoter from transposon Tn10. In
the absence of tet repressor protein, E. coli RNA polymerase
transcribes the kanamycin resistance gene from the tetOP. If tet
repressor is present, it binds to tetOP and blocks transcription of
the kanamycin resistance gene. The other segment of pEZC629 has the
tet repressor gene expressed by a constitutive promoter. Thus cells
transformed by pEZC629 are resistant to chloramphenicol, because of
the chloramphenicol acetyl transferase gene on the same segment as
tetR, but are sensitive to kanamycin. The reactions result in
separation of the tetR gene from the regulated kanamycin resistance
gene. This separation results in kanamycin resistance in cells
receiving the desired recombination product. The first and the
second recombination events are driven by the addition of the same
recombinase, Cre.
[0102] FIG. 3B depicts a restriction map of EZC6Bypr.
[0103] FIG. 3C depicts a restriction map of EZC6prod.
[0104] FIG. 3D depicts a restriction map of pEZC602.
[0105] FIG. 3E depicts a restriction map of pEZC629.
[0106] FIG. 3F depicts a restriction map of EZC6coint.
[0107] FIG. 4A depicts an application of the in vitro method of
recombinational cloning to subclone the chloramphenicol acetyl
transferase gene into a vector for expression in eukaryotic cells.
The Insert Donor plasmid, pEZC843, is comprised of the
chloramphenicol acetyl transferase gene of E. coli, cloned between
loxP and attB sites such that the loxP site is positioned at the
5'-end of the gene. The Vector Donor plasmid, pEZC1003, contains
the cytomegalovirus eukaryotic promoter apposed to a loxP site. The
supercoiled plasmids were combined with lambda Integrase and Cre
recombinase in vitro. After incubation, competent E. coli cells
were transformed with the recombinational reaction solution.
Aliquots of transformations were spread on agar plates containing
kanamycin to select for the Product molecule (here CMVProd).
[0108] FIG. 4B depicts a restriction map of pEZC843.
[0109] FIG. 4C depicts a restriction map of pEZC1003.
[0110] FIG. 4D depicts a restriction map of CMVBypro.
[0111] FIG. 4E depicts a restriction map of CMVProd.
[0112] FIG. 4F depicts a restriction map of CMVcoint.
[0113] FIG. 5A depicts a vector diagram of pEZC1301.
[0114] FIG. 5B depicts a vector diagram of pEZC1305.
[0115] FIG. 5C depicts a vector diagram of pEZC1309.
[0116] FIG. 5D depicts a vector diagram of pEZC1313.
[0117] FIG. 5E depicts a vector diagram of pEZC1317.
[0118] FIG. 5F depicts a vector diagram of pEZC1321.
[0119] FIG. 5G depicts a vector diagram of pEZC1405.
[0120] FIG. 5H depicts a vector diagram of pEZC1502.
[0121] FIG. 6A depicts a vector diagram of pEZC1603.
[0122] FIG. 6B depicts a vector diagram of pEZC1706.
[0123] FIG. 7A depicts a vector diagram of pEZC2901.
[0124] FIG. 7B depicts a vector diagram of pEZC2913
[0125] FIG. 7C depicts a vector diagram of pEZC3101.
[0126] FIG. 7D depicts a vector diagram of pEZC1802.
[0127] FIG. 8A depicts a vector diagram of pGEX-2TK.
[0128] FIG. 8B depicts a vector diagram of pEZC3501.
[0129] FIG. 8C depicts a vector diagram of pEZC3601.
[0130] FIG. 8D depicts a vector diagram of pEZC3609.
[0131] FIG. 8E depicts a vector diagram of pEZC3617.
[0132] FIG. 8F depicts a vector diagram of pEZC3606.
[0133] FIG. 8G depicts a vector diagram of pEZC3613.
[0134] FIG. 8H depicts a vector diagram of pEZC3621.
[0135] FIG. 8I depicts a vector diagram of GST-CAT.
[0136] FIG. 8J depicts a vector diagram of GST-phoA.
[0137] FIG. 8K depicts a vector diagram of pEZC3201.
[0138] FIG. 9A depicts a diagram of 5.2 kb PCR prod.
[0139] FIG. 9B depicts a vector diagram of pEZC1202.
[0140] FIG. 9C depicts a vector diagram of 5.2 kb clone.
[0141] FIG. 10A depicts a vector diagram of pEZC5601.
[0142] FIG. 10B depicts a vector diagram of pEZC6701.
[0143] FIG. 10C depicts a vector diagram of attL product.
[0144] FIG. 10D depicts attR product.
[0145] FIG. 11A depicts a vector diagram of pEZC7102.
[0146] FIG. 11B depicts a vector diagram of pEZC7501.
[0147] FIG. 11C depicts the attL product.
[0148] FIG. 12A depicts an amp PCR product with terminal attB
sites.
[0149] FIG. 12B depicts a tet PCR product with terminal attB
sites.
[0150] FIG. 12C depicts a restriction map of amp7102.
[0151] FIG. 12D depicts a restriction map of tet 7102.
DETAILED DESCRIPTION OF THE INVENTION
[0152] It is unexpectedly discovered in the present invention that
reversible and/or repeatable cloning and subcloning reactions can
be used to manipulate nucleic acids to form chimeric nucleic acids
using recombination proteins and recombination sites.
Recombinational cloning according to the present invention thus
uses recombination proteins with recombinant nucleic acid molecules
having at least one selected recombination site for moving or
exchanging segments of nucleic acid molecules, in vitro and in
vivo.
[0153] These methods use recombination reactions to generate
chimeric DNA or RNA molecules that have the desired
characteristic(s) and/or nucleic acid segment(s). The methods of
the invention provide a means in which nucleic acid molecule of
interest may be moved or transferred into any number of vector
systems. In accordance with the invention, such transfer to various
vector systems may be accomplished separately, sequentially or in
mass (e.g. into any number of different vectors in one step). The
improved specificity, speed and/or yields of the present invention
facilitates DNA or RNA cloning, subcloning, regulation or exchange
useful for any related purpose. Such purposes include in vitro
recombination of DNA or RNA segments and in vitro or in vivo
insertion or modification of transcribed, replicated, isolated or
genomic DNA or RNA.
[0154] Definitions
[0155] In the description that follows, a number of terms used in
recombinant DNA technology are utilized extensively. In order to
provide a clear and consistent understanding of the specification
and claims, including the scope to be given such terms, the
following definitions are provided.
[0156] Byproduct: is a daughter molecule (a new clone produced
after the second recombination event during the recombinational
cloning process) lacking the segment which is desired to be cloned
or subdloned.
[0157] Cointegrate: is at least one recombination intermediate
nucleic acid molecule of the present invention that contains both
parental (starting) molecules. It will usually be circular. In some
embodiments it can be linear.
[0158] Host: is any prokaryotic or eukaryotic organism that can be
a recipient of the recombinational cloning Product. A "host," as
the term is used herein, includes prokaryotic or eukaryotic
organisms that can be genetically engineered. For examples of such
hosts, see Maniatis et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982).
[0159] Insert or Inserts: include the desired nucleic acid segment
or a population of nucleic acid segments (segment A of FIG. 1)
which may be manipulated by the methods of the present invention.
Thus, the terms Insert(s) are meant to include a particular nucleic
acid (preferably DNA) segment or a population of segments. Such
Insert(s) can comprise one or more genes.
[0160] Insert Donor: is one of the two parental nucleic acid
molecules (e.g. RNA or DNA) of the present invention which carries
the Insert. The Insert Donor molecule comprises the Insert flanked
on both sides with recombination sites. The Insert Donor can be
linear or circular. In one embodiment of the invention, the Insert
Donor is a circular DNA molecule and further comprises a cloning
vector sequence outside of the recombination signals (see FIG. 1).
When a population of Inserts or population of nucleic acid segments
are used to make the Insert Donor, a population of Insert Donors
result and may be used in accordance with the invention.
[0161] Product: is one the desired daughter molecules comprising
the A and D sequences which is produced after the second
recombination event during the recombinational cloning process (see
FIG. 1). The Product contains the nucleic acid which was to be
cloned or subcloned. In accordance with the invention, when a
population of Insert Donors are used, the resulting population of
Product molecules will contain all or a portion of the population
of Inserts of the Insert Donors and preferably will contain a
representative population of the original molecules of the Insert
Donors.
[0162] Promoter: is a DNA sequence generally described as the
5'-region of a gene, located proximal to the start codon. The
transcription of an adjacent DNA segment is initiated at the
promoter region. A repressible promoter's rate of transcription
decreases in response to a repressing agent. An inducible
promoter's rate of transcription increases in response to an
inducing agent. A constitutive promoter's rate of transcription is
not specifically regulated, though it can vary under the influence
of general metabolic conditions.
[0163] Recognition sequence: Recognition sequences are particular
sequences which a protein, chemical compound, DNA, or RNA molecule
(e.g., restriction endonuclease, a modification methylase, or a
recombinase) recognizes and binds. In the present invention, a
recognition sequence will usually refer to a recombination site.
For example, the recognition sequence for Cre recombinase is loxP
which is a 34 base pair sequence comprised of two 13 base pair
inverted repeats (serving as the recombinase binding sites)
flanking an 8 base pair core sequence. See FIG. 1 of Sauer, B.,
Current Opinion in Biotechnology 5:521-527 (1994). Other examples
of recognition sequences are the attB, attP, attL, and attR
sequences which are recognized by the recombinase enzyme .lambda.
Integrase. attB is an approximately 25 base pair sequence
containing two 9 base pair core-type Int binding sites and a 7 base
pair overlap region. attP is an approximately 240 base pair
sequence containing core-type Int binding sites and arm-type Int
binding sites as well as sites for auxiliary proteins integration
host factor (IHF), FIS and excisionase (Xis). See Landy, Current
Opinion in Biotechnology 3:699-707 (1993). Such sites may also be
engineered according to the present invention to enhance production
of products in the methods of the invention. When such engineered
sites lack the P1 or H1 domains to make the recombination reactions
irreversible (e.g., attR or attP), such sites may be designated
attR' or attP' to show that the domains of these sites have been
modified in some way.
[0164] Recombinase: is an enzyme which catalyzes the exchange of
DNA segments at specific recombination sites.
[0165] Recombinational Cloning: is a method described herein,
whereby segments of nucleic acid molecules or populations of such
molecules are exchanged, inserted, replaced, substituted or
modified, in vitro or in vivo.
[0166] Recombination proteins: include excisive or integrative
proteins, enzymes, co-factors or associated proteins that are
involved in recombination reactions involving one or more
recombination sites. See, Landy (1994), infra.
[0167] Repression cassette: is a nucleic acid segment that contains
a repressor of a Selectable marker present in the subcloning
vector.
[0168] Selectable marker: is a DNA segment that allows one to
select for or against a molecule or a cell that contains it, often
under particular conditions. These markers can encode an activity,
such as, but not limited to, production of RNA, peptide, or
protein, or can provide a binding site for RNA, peptides, proteins,
inorganic and organic compounds or compositions and the like.
Examples of Selectable markers include but are not limited to: (1)
DNA segments that encode products which provide resistance against
otherwise toxic compounds (e.g., antibiotics); (2) DNA segments
that encode products which are otherwise lacking in the recipient
cell (e.g., tRNA genes, auxotrophic markers); (3) DNA segments that
encode products which suppress the activity of a gene product; (4)
DNA segments that encode products which can be readily identified
(e.g., phenotypic markers such as .beta.-galactosidase, green
fluorescent protein (GFP), and cell surface proteins); (5) DNA
segments that bind products which are otherwise detrimental to cell
survival and/or function; (6) DNA segments that otherwise inhibit
the activity of any of the DNA segments described in Nos. 1-5 above
(e.g., antisense oligonucleotides); (7) DNA segments that bind
products that modify a substrate (e.g. restriction endonucleases);
(8) DNA segments that can be used to isolate or identify a desired
molecule (e.g. specific protein binding sites); (9) DNA segments
that encode a specific nucleotide sequence which can be otherwise
non-functional (e.g., for PCR amplification of subpopulations of
molecules); (10) DNA segments, which when absent, directly or
indirectly confer resistance or sensitivity to particular
compounds; and/or (11) DNA segments that encode products which are
toxic in recipient cells.
[0169] Selection scheme: is any method which allows selection,
enrichment, or identification of a desired Product or Product(s)
from a mixture containing the Insert Donor, Vector Donor, any
intermediates (e.g. a Cointegrate), and/or Byproducts. The
selection schemes of one preferred embodiment have at least two
components that are either linked or unlinked during
recombinational cloning. One component is a Selectable marker. The
other component controls the expression in vitro or in vivo of the
Selectable marker, or survival of the cell harboring the plasmid
carrying the Selectable marker. Generally, this controlling element
will be a repressor or inducer of the Selectable marker, but other
means for controlling expression of the Selectable marker can be
used. Whether a repressor or activator is used will depend on
whether the marker is for a positive or negative selection, and the
exact arrangement of the various DNA segments, as will be readily
apparent to those skilled in the art. A preferred requirement is
that the selection scheme results in selection of or enrichment for
only one or more desired Products. As defined herein, selecting for
a DNA molecule includes (a) selecting or enriching for the presence
of the desired DNA molecule, and (b) selecting or enriching against
the presence of DNA molecules that are not the desired DNA
molecule.
[0170] In one embodiment, the selection schemes (which can be
carried out in reverse) will take one of three forms, which will be
discussed in terms of FIG. 1. The first, exemplified herein with a
Selectable marker and a repressor therefore, selects for molecules
having segment D and lacking segment C. The second selects against
molecules having segment C and for molecules having segment D.
Possible embodiments of the second form would have a DNA segment
carrying a gene toxic to cells into which the in vitro reaction
products are to be introduced. A toxic gene can be a DNA that is
expressed as a toxic gene product (a toxic protein or RNA), or can
be toxic in and of itself. (In the latter case, the toxic gene is
understood to carry its classical definition of "heritable
trait".)
[0171] Examples of such toxic gene products are well known in the
art, and include, but are not limited to, restriction endonucleases
(e.g., DpnI), apoptosis-related genes (e.g. ASK1 or members of the
bcl-2/ced-9 family), retroviral genes including those of the human
immunodeficiency virus (HIV), defensins such as NP-1, inverted
repeats or paired palindromic DNA sequences, bacteriophage lytic
genes such as those from .PHI.X174 or bacteriophage T4; antibiotic
sensitivity genes such as rpsL, antimicrobial sensitivity genes
such as pheS, plasmid killer genes, eukaryotic transcriptional
vector genes that produce a gene product toxic to bacteria, such as
GATA-1, and genes that kill hosts in the absence of a suppressing
function, e.g., kicB or ccdB. A toxic gene can alternatively be
selectable in vitro, e.g., a restriction site.
[0172] Many genes coding for restriction endonucleases operably
linked to inducible promoters are known, and may be used in the
present invention.
[0173] See, e.g. U.S. Pat. Nos. 4,960,707 (DpnI and DpnII);
5,000,333, 5,082,784 and 5,192,675 (KpnI); 5,147,800 (NgoAIII and
NgoAI); 5,179,015 (FspI and HaeIII): 5,200,333 (HaeII and TaqI);
5,248,605 (HpaII); 5,312,746 (ClaI); 5,231,021 and 5,304,480 (XhoI
and XhoII); 5,334,526 (AluI); 5,470,740 (NsiI); 5,534,428
(SstI/SacI); 5,202,248 (NcoI); 5,139,942 (NdeI); and 5,098,839
(PacI). See also Wilson, G. G., Nucl. Acids Res. 19:2539-2566
(1991); and Lunnen, K. D., et al., Gene 74:25-32 (1988).
[0174] In the second form, segment D carries a Selectable marker.
The toxic gene would eliminate transformants harboring the Vector
Donor, Cointegrate, and Byproduct molecules, while the Selectable
marker can be used to select for cells containing the Product and
against cells harboring only the Insert Donor.
[0175] The third form selects for cells that have both segments A
and D in cis on the same molecule, but not for cells that have both
segments in trans on different molecules. This could be embodied by
a Selectable marker that is split into two inactive fragments, one
each on segments A and D.
[0176] The fragments are so arranged relative to the recombination
sites that when the segments are brought together by the
recombination event, they reconstitute a functional Selectable
marker. For example, the recombinational event can link a promoter
with a structural gene, can link two fragments of a structural
gene, or can link genes that encode a heterodimeric gene product
needed for survival, or can link portions of a replicon.
[0177] Site-specific recombinase: is a type of recombinase which
typically has at least the following four activities (or
combinations thereof): (1) recognition of one or two specific
nucleic acid sequences; (2) cleavage of said sequence or sequences;
(3) topoisomerase activity involved in strand exchange; and (4)
ligase activity to reseal the cleaved strands of nucleic acid. See
Sauer, B., Current Opinions in Biotechnology 5:521-527 (1994).
Conservative site-specific recombination is distinguished from
homologous recombination and transposition by a high degree of
specificity for both partners. The strand exchange mechanism
involves the cleavage and rejoining of specific DNA sequences in
the absence of DNA synthesis (Landy, A. (1989) Ann. Rev. Biochem.
58:913-949).
[0178] Subcloning vector: is a cloning vector comprising a circular
or linear nucleic acid molecule which includes preferably an
appropriate replicon. In the present invention, the subcloning
vector (segment D in FIG. 1) can also contain functional and/or
regulatory elements that are desired to be incorporated into the
final product to act upon or with the cloned DNA Insert (segment A
in FIG. 1). The subcloning vector can also contain a Selectable
marker (preferably DNA).
[0179] Vector: is a nucleic acid molecule (preferably DNA) that
provides a useful biological or biochemical property to an Insert.
Examples include plasmids, phages, autonomously replicating
sequences (ARS), centromeres, and other sequences which are able to
replicate or be replicated in vitro or in a host cell, or to convey
a desired nucleic acid segment to a desired location within a host
cell. A Vector can have one or more restriction endonuclease
recognition sites at which the sequences can be cut in a
determinable fashion without loss of an essential biological
function of the vector, and into which a nucleic acid fragment can
be spliced in order to bring about its replication and cloning.
Vectors can further provide primer sites, e.g., for PCR,
transcriptional and/or translational initiation and/or regulation
sites, recombinational signals, replicons, Selectable markers, etc.
Clearly, methods of inserting a desired nucleic acid fragment which
do not require the use of homologous recombination, transpositions
or restriction enzymes (such as, but not limited to, UDG cloning of
PCR fragments (U.S. Pat. No. 5,334,575, entirely incorporated
herein by reference), T:A cloning, and the like) can also be
applied to clone a fragment into a cloning vector to be used
according to the present invention. The cloning vector can further
contain one or more selectable markers suitable for use in the
identification of cells transformed with the cloning vector.
[0180] Vector Donor: is one of the two parental nucleic acid
molecules (e.g. RNA or DNA) of the present invention which carries
the DNA segments comprising the DNA vector which is to become part
of the desired Product. The Vector Donor comprises a subcloning
vector D (or it can be called the cloning vector if the Insert
Donor does not already contain a cloning vector) and a segment C
flanked by recombination sites (see FIG. 1). Segments C and/or D
can contain elements that contribute to selection for the desired
Product daughter molecule, as described above for selection
schemes. The recombination signals can be the same or different,
and can be acted upon by the same or different recombinases. In
addition, the Vector Donor can be linear or circular.
[0181] Primer: refers to a single stranded or double stranded
oligonucleotide that is extended by covalent bonding of nucleotide
monomers during amplification or polymerization of a nucleic acid
molecule (e.g. a DNA molecule). In a preferred aspect, the primer
comprises one or more recombination sites or portions of such
recombination sites. Portions of recombination sties comprise at
least 2 bases, at least 5 bases, at least 10 bases or at least 20
bases of the recombination sites of interest. When using portions
of recombination sites, the missing portion of the recombination
site may be provided by the newly synthesized nucleic acid
molecule. Such recombination sites may be located within and/or at
one or both termini of the primer. Preferably, additional sequences
are added to the primer adjacent to the recombination site(s) to
enhance or improve recombination and/or to stabilize the
recombination site during recombination. Such stabilization
sequences may be any sequences (preferably G/C rich sequences) of
any length. Preferably, such sequences range in size from 1 to
about 1000 bases, 1 to about 500 bases, and 1 to about 100 bases, 1
to about 60 bases, 1 to about 25, 1 to about 10, 2 to about 10 and
preferably about 4 bases. Preferably, such sequences are greater
than 1 base in length and preferably greater than 2 bases in
length.
[0182] Template: refers to double stranded or single stranded
nucleic acid molecules which are to be amplified, synthesized or
sequenced. In the case of double stranded molecules, denaturation
of its strands to form a first and a second strand is preferably
performed before these molecules will be amplified, synthesized or
sequenced, or the double stranded molecule may be used directly as
a template. For single stranded templates, a primer complementary
to a portion of the template is hybridized under appropriate
conditions and one or more polypeptides having polymerase activity
(e.g. DNA polymerases and/or reverse transcriptases) may then
synthesize a nucleic acid molecule complementary to all or a
portion of said template. Alternatively, for double stranded
templates, one or more promoters may be used in combination with
one or more polymerases to make nucleic acid molecules
complementary to all or a portion of the template. The newly
synthesized molecules, according to the invention, may be equal or
shorter in length than the original template. Additionally, a
population of nucleic acid templates may be used during synthesis
or amplification to produce a population of nucleic acid molecules
typically representative of the original template population.
[0183] Adapter: is an oligonucleotide or nucleic acid fragment or
segment (preferably DNA) which comprises one or more recombination
sites (or portions of such recombination sites) which in accordance
with the invention can be added to a circular or linear Insert
Donor linear molecule, although the adapters are preferably added
at or near one or both termini of a linear molecule. Preferably,
adapters are positioned to be located on both sides (flanking) a
particularly nucleic acid molecule of interest. In accordance with
the invention, adapters may be added to nucleic acid molecules of
interest by standard recombinant techniques (e.g. restriction
digest and ligation). For example, adapters may be added to a
circular molecule by first digesting the molecule with an
appropriate restriction enzyme, adding the adapter at the cleavage
site and reforming the circular molecule which contains the
adapter(s) at the site of cleavage. Alternatively, adapters may be
ligated directly to one or more and preferably both termini of a
linear molecule thereby resulting in linear molecule(s) having
adapters at one or both termini. In one aspect of the invention,
adapters may be added to a population of linear molecules, (e.g. a
cDNA library or genomic DNA which has been cleaved or digested) to
form a population of linear molecules containing adapters at one
and preferably both termini of all or substantial portion of said
population.
[0184] Library: refers to a collection of nucleic acid molecules
(circular or linear). In one preferred embodiment, a library is
representative of all or a significant portion of the DNA content
of an organism (a "genomic" library), or a set of nucleic acid
molecules representative of all or a significant portion of the
expressed genes (a cDNA library) in a cell, tissue, organ or
organism. A library may also comprise random sequences made by de
novo synthesis, mutagenesis of one or more sequences and the like.
Such libraries may or may not be contained in one or more
vectors.
[0185] Amplification: refers to any in vitro method for increasing
a number of copies of a nucleotide sequence with the use of a
polymerase. Nucleic acid amplification results in the incorporation
of nucleotides into a DNA and/or RNA molecule or primer thereby
forming a new molecule complementary to a template. The formed
nucleic acid molecule and its template can be used as templates to
synthesize additional nucleic acid molecules. As used herein, one
amplification reaction may consist of many rounds of replication.
DNA amplification reactions include, for example, polymerase chain
reaction (PCR). One PCR reaction may consist of 5-100 "cycles" of
denaturation and synthesis of a DNA molecule.
[0186] Oligonucleotide: refers to a synthetic or natural molecule
comprising a covalently linked sequence of nucleotides which are
joined by a phosphodiester bond between the 3' position of the
deoxyribose or ribose of one nucleotide and the 5' position of the
deoxyribose or ribose of the adjacent nucleotide.
[0187] Nucleotide: refers to a base-sugar-phosphate combination.
Nucleotides are monomeric units of a nucleic acid sequence (DNA and
RNA). The term nucleotide includes ribonucleoside triphosphatase
ATP, UTP, CTG, GTP and deoxyribonucleoside triphosphates such as
dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such
derivatives include, for example, [.alpha.S]dATP, 7-deaza-dGTP and
7-deaza-dATP. The term nucleotide as used herein also refers to
dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives.
Illustrated examples of dideoxyribonucleoside triphosphates
include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and
ddTTP. According to the present invention, a "nucleotide" may be
unlabeled or detectably labeled by well known techniques.
Detectable labels include, for example, radioactive isotopes,
fluorescent labels, chemiluminescent labels, bioluminescent labels
and enzyme labels.
[0188] Hybridization: The terms "hybridization" and "hybridizing"
refers to base pairing of two complementary single-stranded nucleic
acid molecules (RNA and/or DNA) to give a double stranded molecule.
As used herein, two nucleic acid molecules may be hybridized,
although the base pairing is not completely complementary.
Accordingly, mismatched bases do not prevent hybridization of two
nucleic acid molecules provided that appropriate conditions, well
known in the art, are used.
[0189] Other terms used in the fields of recombinant DNA technology
and molecular and cell biology as used herein will be generally
understood by one of ordinary skill in the applicable arts.
[0190] Recombination Schemes
[0191] One general scheme for an in vitro or in vivo method of the
invention is shown in FIG. 1, where the Insert Donor and the Vector
Donor can be either circular or linear DNA, but is shown as
circular. Vector D is exchanged for the original cloning vector B.
The Insert Donor need not comprise a vector. The method of the
invention allows the Inserts A to be transferred into any number of
vectors. According to the invention, the Inserts may be transferred
to a particular Vector or may be transferred to a number of vectors
in one step. Additionally, the Inserts may be transferred to any
number of vectors sequentially, for example, by using the Product
DNA molecule as the Insert Donor in combination with a different
Vector Donor. The nucleic acid molecule of interest may be
transferred into a new vector thereby producing a new Product DNA
molecule. The new Product DNA molecule may then be used as starting
material to transfer the nucleic acid molecule of interest into a
new vector. Such sequential transfers can be performed a number of
times in any number of different vectors. Thus the invention allows
for cloning or subcloning nucleic acid molecules and because of the
ease and simplicity, these methods are particularly suited for high
through-put applications. In accordance with the invention, it is
desirable to select for the daughter molecule containing elements A
and D and against other molecules, including one or more
Cointegrate(s). The square and circle are different sets of
recombination sites (e.g., lox sites or att sites). Segment A or D
can contain at least one Selection Marker, expression signals,
origins of replication, or specialized functions for detecting,
selecting, expressing, mapping or sequencing DNA, where D is used
in this example. This scheme can also be reversed according to the
present invention, as described herein. The resulting product of
the reverse reaction (e.g. the Insert Donor) may then be used in
combination with one or a number of vectors to produce new product
molecules in which the Inserts are contained by any number of
vectors.
[0192] Examples of desired DNA segments that can be part of Element
A or D include, but are not limited to, PCR products, large DNA
segments, genomic clones or fragments, cDNA clones or fragments,
functional elements, etc., and genes or partial genes, which encode
useful nucleic acids or proteins. Moreover, the recombinational
cloning of the present invention can be used to make ex vivo and in
vivo gene transfer vehicles for protein expression (native or
fusion proteins) and/or gene therapy.
[0193] In FIG. 1, the scheme provides the desired Product as
containing A and Vector D, as follows. The Insert Donor (containing
A and B) is first recombined at the square recombination sites by
recombination proteins, with the Vector Donor (containing C and D),
to form a Co-integrate having each of A-D-C-B. Next, recombination
occurs at the circle recombination sites to form Product DNA (A and
D) and Byproduct DNA (C and B). However, if desired, two or more
different Co-integrates can be formed to generate two or more
Products.
[0194] In one embodiment of the present in vitro or in vivo
recombinational cloning method, a method for selecting at least one
desired Product DNA is provided. This can be understood by
consideration of the map of plasmid pEZC726 depicted in FIG. 2. The
two exemplary recombination sites are attP and loxP. On one segment
defined by these sites is a kanamycin resistance gene whose
promoter has been replaced by the tetOP operator/promoter from
transposon Tn10. In the absence of tet repressor protein, E. coli
RNA polymerase transcribes the kanamycin resistance gene from the
tetOP. If tet repressor is present, it binds to tetOP and blocks
transcription of the kanamycin resistance gene. The other segment
of pEZC726 has the tet repressor gene expressed by a constitutive
promoter. Thus cells transformed by pEZC726 are resistant to
chloramphenicol, because of the chloramphenicol acetyl transferase
gene on the same segment as tetR, but are sensitive to kanamycin.
The recombination reactions result in separation of the tetR gene
from the regulated kanamycin resistance gene. This separation
results in kanamycin resistance in cells receiving the desired
recombination Product.
[0195] Two different sets of plasmids were constructed to
demonstrate the in vitro method. One set, for use with Cre
recombinase only (cloning vector 602 and subcloning vector 629
(FIG. 3)) contained loxP and loxP 511 sites. A second set, for use
with Cre and integrase (cloning vector 705 and subcloning vector
726 (FIG. 2)) contained loxP and att sites. The efficiency of
production of the desired daughter plasmid was about 60 fold higher
using both enzymes than using Cre alone. Nineteen of twenty four
colonies from the Cre-only reaction contained the desired product,
while thirty eight of thirty eight colonies from the integrase plus
Cre reaction contained the desired product plasmid.
[0196] A variety of other selection schemes can be used that are
known in the art as they can suit a particular purpose for which
the recombinational cloning is carried out. Depending upon
individual preferences and needs, a number of different types of
selection schemes can be used in the recombinational cloning or
subcloning methods of the present invention. The skilled artisan
can take advantage of the availability of the many DNA segments or
methods for making them and the different methods of selection that
are routinely used in the art. Such DNA segments include but are
not limited to those which encodes an activity such as, but not
limited to, production of RNA, peptide, or protein, or providing a
binding site for such RNA, peptide, or protein. Examples of DNA
molecules used in devising a selection scheme are given above,
under the definition of "selection scheme"
[0197] Additional examples include but are not limited to:
[0198] (i) Generation of new primer sites for PCR (e.g.,
juxtaposition of two DNA sequences that were not previously
juxtaposed);
[0199] (ii) Inclusion of a DNA sequence acted upon by a restriction
endonuclease or other DNA modifying enzyme, chemical, ribozyme,
etc.;
[0200] (iii) Inclusion of a DNA sequence recognized by a DNA
binding protein, RNA, DNA, chemical, etc.) (e.g., for use as an
affinity tag for selecting for or excluding from a population
(Davis, Nucl. Acids Res. 24:702-706 (1996); J. Virol. 69: 8027-8034
(1995)) or for juxtaposing a promoter for in vitro
transcription;
[0201] (iv) In vitro selection of RNA ligands for the ribosomal L22
protein associated with Epstein-Barr virus-expressed RNA by using
randomized and cDNA-derived RNA libraries;
[0202] (vi) The positioning of functional elements whose activity
requires a specific orientation or juxtaposition (e.g., (a) a
recombination site which reacts poorly in trans, but when placed in
cis, in the presence of the appropriate proteins, results in
recombination that destroys certain populations of molecules;
(e.g., reconstitution of a promoter sequence that allows in vitro
RNA synthesis). The RNA can be used directly, or can be reverse
transcribed to obtain the desired DNA construct;
[0203] (vii) Selection of the desired product by size (e.g.,
fractionation) or other physical property of the molecule(s);
and
[0204] (viii) Inclusion of a DNA sequence required for a specific
modification (e.g., methylation) that allows its
identification.
[0205] After formation of the Product and Byproduct in the method
of the present invention, the selection step can be carried out
either in vitro or in vivo depending upon the particular selection
scheme which has been optionally devised in the particular
recombinational cloning procedure.
[0206] For example, an in vitro method of selection can be devised
for the Insert Donor and Vector Donor DNA molecules. Such scheme
can involve engineering a rare restriction site in the starting
circular vectors in such a way that after the recombination events
the rare cutting sites end up in the Byproduct. Hence, when the
restriction enzyme which binds and cuts at the rare restriction
site is added to the reaction mixture in vitro, all of the DNA
molecules carrying the rare cutting site, i.e., the starting DNA
molecules, the Cointegrate, and the Byproduct, will be cut and
rendered nonreplicable in the intended host cell. For example,
cutting sites in segments B and C (see FIG. 1) can be used to
select against all molecules except the Product. Alternatively,
only a cutting site in C is needed if one is able to select for
segment D, e.g., by a drug resistance gene not found on B.
[0207] Similarly, an in vitro selection method can be devised when
dealing with linear DNA molecules. DNA sequences complementary to a
PCR primer sequence can be so engineered that they are transferred,
through the recombinational cloning method, only to the Product
molecule. After the reactions are completed, the appropriate
primers are added to the reaction solution and the sample is
subjected to PCR. Hence, all or part of the Product molecule is
amplified.
[0208] Other in vivo selection schemes can be used with a variety
of host cells, particularly E. coli lines. One is to put a
repressor gene on one segment of the subcloning plasmid, and a drug
marker controlled by that repressor on the other segment of the
same plasmid. Another is to put a killer gene on segment C of the
subcloning plasmid (FIG. 1). Of course a way must exist for growing
such a plasmid, i.e., there must exist circumstances under which
the killer gene will not kill. There are a number of these genes
known which require particular strains of E. coli. One such scheme
is to use the restriction enzyme DpnI, which will not cleave unless
its recognition sequence GATC is methylated. Many popular common E.
coli strains methylate GATC sequences, but there are mutants in
which cloned DpnI can be expressed without harm. Other restriction
enzyme genes may also be used as a toxic gene for selection. In
such cases, a host containing a gem encoding the corresponding
methylase gene provides protected host for use in the invention.
Similarly, the ccdB protein is a potent poison of DNA gyrase,
efficiently trapping gyrase molecules in a cleavable complex,
resulting in DNA strand breakage and cell death. Mutations in the
gyrA subunit of DNA gyrase, specifically the gyrA462 mutation,
confers resistance to ccdB (Bernard and Couturier, J. Mol. Bio. 226
(1992) 735-745). An E. coli strain, DB2, has been constructed that
contains the gyrA462 mutation. DB2 cells containing plasmids that
express the ccdB gene are not killed by ccd B. This strain is
available from Life Technologies and has been deposited on Oct. 14,
1997 with the Collection, Agricultural Research Culture Collection
(NRRL), 1815 North University Street, Peoria, IL 61604 USA as
deposit number NRRL B-21852.
[0209] Of course analogous selection schemes can be devised for
other host organisms. For example, the tet repressor/operator of
Tn10 has been adapted to control gene expression in eukaryotes
(Gossen, M., and Bujard, H., Proc. Natl. Acad. Sci. USA
89:5547-5551 (1992)). Thus the same control of drug resistance by
the tet repressor exemplified herein or other selection schemes
described herein can be applied to select for Product in eukaryotic
cells.
[0210] Recombination Proteins
[0211] In the present invention, the exchange of DNA segments is
achieved by the use of recombination proteins, including
recombinases and associated co-factors and proteins. Various
recombination proteins are described in the art. Examples of such
recombinases include:
[0212] Cre: A protein from bacteriophage P1 (Abremski and Hoess, J.
Biol. Chem. 259(3):1509-1514 (1984)) catalyzes the exchange (i.e.,
causes recombination) between 34 bp DNA sequences called loxP
(locus of crossover) sites (See Hoess et al., Nucl. Acids Res.
14(5):2287 (1986)). Cre is available commercially (Novagen, Catalog
No. 69247-1). Recombination mediated by Cre is freely reversible.
From thermodynamic considerations it is not surprising that
Cre-mediated integration (recombination between two molecules to
form one molecule) is much less efficient than Cre-mediated
excision (recombination between two loxP sites in the same molecule
to form two daughter molecules). Cre works in simple buffers with
either magnesium or spermidine as a cofactor, as is well known in
the art. The DNA substrates can be either linear or supercoiled. A
number of mutant loxP sites have been described (Hoess et al.,
supra). One of these, loxP 511, recombines with another loxP 511
site, but will not recombine with a loxP site.
[0213] Integrase: A protein from bacteriophage lambda that mediates
the integration of the lambda genome into the E. coli chromosome.
The bacteriophage .lambda. Int recombinational proteins promote
recombination between its substrate att sites as part of the
formation or induction of a lysogenic state. Reversibility of the
recombination reactions results from two independent pathways for
integrative and excisive recombination. Each pathway uses a unique,
but overlapping, set of the 15 protein binding sites that comprise
att site DNAs. Cooperative and competitive interactions involving
four proteins (Int, Xis, IHF and FIS) determine the direction of
recombination.
[0214] Integrative recombination involves the Int and IHF proteins
and sites attP (240 bp) and attB (25 bp). Recombination results in
the formation of two new sites: attL and attR. Excisive
recombination requires Int, IHF, and Xis, and sites attL and attR
to generate attP and attB. Under certain conditions, FIS stimulates
excisive recombination. In addition to these normal reactions, it
should be appreciated that attP and attB, when placed on the same
molecule, can promote excisive recombination to generate two
excision products, one with attL and one with attR. Similarly,
intermolecular recombination between molecules containing attL and
attR, in the presence of Int, IHF and Xis, can result in
integrative recombination and the generation of attP and attB.
Hence, by flanking DNA segments with appropriate combinations of
engineered att sites, in the presence of the appropriate
recombination proteins, one can direct excisive or integrative
recombination, as reverse reactions of each other.
[0215] Each of the att sites contains a 15 bp core sequence;
individual sequence elements of functional significance lie within,
outside, and across the boundaries of this common core (Landy, A.,
Ann. Rev. Biochem. 58:913 (1989)). Efficient recombination between
the various att sites requires that the sequence of the central
common region be identical between the recombining partners,
however, the exact sequence is now found to be modifiable.
Consequently, derivatives of the att site with changes within the
core are now discovered to recombine as least as efficiently as the
native core sequences.
[0216] Integrase acts to recombine the attP site on bacteriophage
lambda (about 240 bp) with the attB site on the E. coli genome
(about 25 bp) (Weisberg, R. A. and Landy, A. in Lambda II, p. 211
(1983), Cold Spring Harbor Laboratory)), to produce the integrated
lambda genome flanked by attL (about 100 bp) and attR (about 160
bp) sites. In the absence of Xis (see below), this reaction is
essentially irreversible. The integration reaction mediated by
integrase and IHF works in vitro, with simple buffer containing
spermidine. Integrase can be obtained as described by Nash, H. A.,
Methods of Enzymology 100:210-216 (1983). IHF can be obtained as
described by Filutowicz, M., et al., Gene 147:149-150 (1994).
[0217] Numerous recombination systems from various organisms can
also be used, based on the teaching and guidance provided herein.
See, e.g., Hoess et al., Nucleic Acids Research 14(6):2287 (1986);
Abremski et al., J. Biol. Chem.261(1):391 (1986); Campbell, J.
Bacteriol. 174(23):7495 (1992); Qian et al., J. Biol. Chem.
267(11):7794 (1992); Araki et al., J. Mol. Biol. 225(1):25 (1992)).
Many of these belong to the integrase family of recombinases (Argos
et al. EMBO J. 5:433-440 (1986)). Perhaps the best studied of these
are the Integrase/att system from bacteriophage .lambda. (Landy, A.
(1993) Current Opinions in Genetics and Devel. 3:699-707), the
Cre/loxP system from bacteriophage P1 (Hoess and Abremski (1990) In
Nucleic Acids and Molecular Biology, vol. 4. Eds.: Eckstein and
Lilley, Berlin-Heidelberg: Springer-Verlag; pp. 90-109), and the
FLP/FRT system from the Saccharomyces cerevisiae 2.mu. circle
plasmid (Broach et al. Cell 29:227-234 (1982)).
[0218] Members of a second family of site-specific recombinases,
the resolvase family (e.g., .gamma..delta., Tn3 resolvase, Hin,
Gin, and Cin) are also known. Members of this highly related family
of recombinases are typically constrained to intramolecular
reactions (e.g., inversions and excisions) and can require
host-encoded factors. Mutants have been isolated that relieve some
of the requirements for host factors (Maeser and Kahnmann (1991)
Mol. Gen. Genet. 230:170-176), as well as some of the constraints
of intramolecular recombination.
[0219] Other site-specific recombinases similar to .lambda. Int and
similar to P1 Cre can be substituted for Int and Cre. Such
recombinases are known. In many cases the purification of such
other recombinases has been described in the art. In cases when
they are not known, cell extracts can be used or the enzymes can be
partially purified using procedures described for Cre and Int.
[0220] While Cre and Int are described in detail for reasons of
example, many related recombinase systems exist and their
application to the described invention is also provided according
to the present invention. The integrase family of site-specific
recombinases can be used to provide alternative recombination
proteins and recombination sites for the present invention, as
site-specific recombination proteins encoded by, for example
bacteriophage lambda, phi 80, P22, P2, 186, P4 and P1. This group
of proteins exhibits an unexpectedly large diversity of sequences.
Despite this diversity, all of the recombinases can be aligned in
their C-terminal halves. A 40-residue region near the C terminus is
particularly well conserved in all the proteins and is homologous
to a region near the C terminus of the yeast 2 mu plasmid Flp
protein. Three positions are perfectly conserved within this
family: histidine, arginine and tyrosine are found at respective
alignment positions 396, 399 and 433 within the well-conserved
C-terminal region. These residues contribute to the active site of
this family of recombinases, and suggest that tyrosine-433 forms a
transient covalent linkage to DNA during strand cleavage and
rejoining. See, e.g., Argos, P. et al., EMBO J. 5:433-40
(1986).
[0221] The recombinases of some transposons, such as those of
conjugative transposons (e.g., Tn916) (Scott and Churchward. 1995.
Ann Rev Microbiol 49:367; Taylor and Churchward, 1997. J Bacteriol
179:1837) belong to the integrase family of recombinases and in
some cases show strong preferences for specific integration sites
(Ike et al 1992. J Bacteriol 174:1801; Trieu-Cuot et al, 1993. Mol.
Microbiol 8:179).
[0222] Alternatively, IS231 and other Bacillus thuringiensis
transposable elements could be used as recombination proteins and
recombination sites. Bacillus thuringiensis is an entomopathogenic
bacterium whose toxicity is due to the presence in the sporangia of
delta-endotoxin crystals active against agricultural pests and
vectors of human and animal diseases. Most of the genes coding for
these toxin proteins are plasmid-bome and are generally
structurally associated with insertion sequences (IS231, IS232,
IS240, ISBT1 and ISBT2) and transposons (Tn4430 and Tn5401).
Several of these mobile elements have been shown to be active and
participate in the crystal gene mobility, thereby contributing to
the variation of bacterial toxicity.
[0223] Structural analysis of the iso-IS231 elements indicates that
they are related to IS1151 from Clostridium perfringens and
distantly related to IS4 and IS186 from Escherichia coli. Like the
other IS4 family members, they contain a conserved
transposase-integrase motif found in other IS families and
retroviruses. Moreover, functional data gathered from IS231A in
Escherichia coli indicate a non-replicative mode of transposition,
with a preference for specific targets. Similar results were also
obtained in Bacillus subtilis and B. thuringiensis. See, e.g.,
Mahillon, J. et al., Genetica 93:13-26 (1994); Campbell, J
Bacteriol. 7495-7499 (1992).
[0224] An unrelated family of recombinases, the transposases, have
also been used to transfer genetic information between replicons.
Transposons are structurally variable, being described as simple or
compound, but typically encode the recombinase gene flanked by DNA
sequences organized in inverted orientations. Integration of
transposons can be random or highly specific. Representatives such
as Tn7, which are highly site-specific, have been applied to the
efficient movement of DNA segments between replicons (Lucklow et
al. 1993. J. Virol 67:4566-4579).
[0225] A related element, the integron, are also
translocatable-promoting movement of drug resistance cassettes from
one replicon to another. Often these elements are defective
transposon derivatives. Transposon Tn21 contains a class I integron
called In2. The integrase (IntI1) from In2 is common to all
integrons in this class and mediates recombination between two
59-bp elements or between a 59-bp element and an att1 site that can
lead to insertion into a recipient integron. The integrase also
catalyzes excisive recombination. (Hall, 1997. Ciba Found Symp
207:192; Francia et al., 1997. J Bacteriol 179:4419).
[0226] Group II introns are mobile genetic elements encoding a
catalytic RNA and protein. The protein component possesses reverse
transcriptase, maturase and an endonuclease activity, while the RNA
possesses endonuclease activity and determines the sequence of the
target site into which the intron integrates. By modifying portions
of the RNA sequence, the integration sites into which the element
integrates can be defined. Foreign DNA sequences can be
incorporated between the ends of the intron, allowing targeting to
specific sites. This process, termed retrohoming, occurs via a
DNA:RNA intermediate, which is copied into cDNA and ultimately into
double stranded DNA (Matsuura et al., Genes and Dev 1997; Guo et
al, EMBO J, 1997). Numerous intron-encoded homing endonucleases
have been identified (Belfort and Roberts, 1997. NAR 25:3379). Such
systems can be easily adopted for application to the described
subcloning methods.
[0227] The amount of recombinase which is added to drive the
recombination reaction can be determined by using known assays.
Specifically, titration assay is used to determine the appropriate
amount of a purified recombinase enzyme, or the appropriate amount
of an extract.
[0228] Engineered Recombination Sites
[0229] The above recombinases and corresponding recombinase sites
are suitable for use in recombination cloning according to the
present invention. However, wild-type recombination sites may
contain sequences that reduce the efficiency or specificity of
recombination reactions or the function of the Product molecules as
applied in methods of the present invention. For example, multiple
stop codons in attB, attR, attP, attL and loxP recombination sites
occur in multiple reading frames on both strands, so translation
efficiencies are reduced, e.g., where the coding sequence must
cross the recombination sites, (only one reading frame is available
on each strand of loxp and attB sites) or impossible (in attP, attR
or attL).
[0230] Accordingly, the present invention also provides engineered
recombination sites that overcome these problems. For example, att
sites can be engineered to have one or multiple mutations to
enhance specificity or efficiency of the recombination reaction and
the properties of Product DNAs (e.g., att1, att2, and att3 sites);
to decrease reverse reaction (e.g., removing P1 and H1 from attR).
The testing of these mutants determines which mutants yield
sufficient recombinational activity to be suitable for
recombination subcloning according to the present invention.
[0231] Mutations can therefore be introduced into recombination
sites for enhancing site specific recombination. Such mutations
include, but are not limited to: recombination sites without
translation stop codons that allow fusion proteins to be encoded;
recombination sites recognized by the same proteins but differing
in base sequence such that they react largely or exclusively with
their homologous partners allowing multiple reactions to be
contemplated; and mutations that prevent hairpin formation of
recombination sites. Which particular reactions take place can be
specified by which particular partners are present in the reaction
mixture. For example, a tripartite protein fusion could be
accomplished with parental plasmids containing recombination sites
attR1 and attL1;and attB3; attR1; attP3 and 10xP; and/or attR3 and
10xP; and/or attR3 and attL2.
[0232] There are well known procedures for introducing specific
mutations into nucleic acid sequences. A number of these are
described in Ausubel, F. M. et al., Current Protocols in Molecular
Biology, Wiley Interscience, New York (1989-1996). Mutations can be
designed into oligonucleotides, which can be used to modify
existing cloned sequences, or in amplification reactions. Random
mutagenesis can also be employed if appropriate selection methods
are available to isolate the desired mutant DNA or RNA. The
presence of the desired mutations can be confirmed by sequencing
the nucleic acid by well known methods.
[0233] The following non-limiting methods can be used to modify or
mutate a core region of a given recombination site to provide
mutated sites that can be used in the present invention:
[0234] 1. By recombination of two parental DNA sequences by
site-specific (e.g. attL and attR to give attB) or other (e.g.
homologous) recombination mechanisms where the parental DNA
segments contain one or more base alterations resulting in the
final mutated core sequence;
[0235] 2. By mutation or mutagenesis (site-specific, PCR, random,
spontaneous, etc) directly of the desired core sequence;
[0236] 3. By mutagenesis (site-specific, PCR, random, spontaneous,
etc) of parental DNA sequences, which are recombined to generate a
desired core sequence;
[0237] 4. By reverse transcription of an RNA encoding the desired
core sequence; and
[0238] 5. By de novo synthesis (chemical synthesis) of a sequence
having the desired base changes.
[0239] The functionality of the mutant recombination sites can be
demonstrated in ways that depend on the particular characteristic
that is desired. For example, the lack of translation stop codons
in a recombination site can be demonstrated by expressing the
appropriate fusion proteins. Specificity of recombination between
homologous partners can be demonstrated by introducing the
appropriate molecules into in vitro reactions, and assaying for
recombination products as described herein or known in the art.
Other desired mutations in recombination sites might include the
presence or absence of restriction sites, translation or
transcription start signals, protein binding sites, and other known
functionalities of nucleic acid base sequences. Genetic selection
schemes for particular functional attributes in the recombination
sites can be used according to known method steps. For example, the
modification of sites to provide (from a pair of sites that do not
interact) partners that do interact could be achieved by requiring
deletion, via recombination between the sites, of a DNA sequence
encoding a toxic substance. Similarly, selection for sites that
remove translation stop sequences, the presence or absence of
protein binding sites, etc., can be easily devised by those skilled
in the art.
[0240] Accordingly, the present invention provides a nucleic acid
molecule, comprising at least one DNA segment having at least two
engineered recombination sites flanking a Selectable marker and/or
a desired DNA segment, wherein at least one of said recombination
sites comprises a core region having at least one engineered
mutation that enhances recombination in vitro in the formation of a
Cointegrate DNA or a Product DNA.
[0241] While in the preferred embodiment the recombination sites
differ in sequence and do not interact with each other, it is
recognized that sites comprising the same sequence can be
manipulated to inhibit recombination with each other. Such
conceptions are considered and incorporated herein. For example, a
protein binding site can be engineered adjacent to one of the
sites. In the presence of the protein that recognizes said site,
the recombinase fails to access the site and the other site is
therefore used preferentially. In the cointegrate this site can no
longer react since it has been changed e.g. from attB to attL. In
resolution of the cointegrate, the protein can be inactivated (e.g.
by antibody, heat or a change of buffer) and the second site can
undergo recombination.
[0242] The nucleic acid molecule can have at least one mutation
that confers at least one enhancement of said recombination, said
enhancement selected from the group consisting of substantially (i)
favoring integration; (ii) favoring recombination; (ii) relieving
the requirement for host factors; (iii) increasing the efficiency
of said Cointegrate DNA or Product DNA formation; and (iv)
increasing the specificity of said Cointegrate DNA or Product DNA
formation.
[0243] The nucleic acid molecule preferably comprises at least one
recombination site derived from attb, attP, attL or attR, such as
attR' or attP'. More preferably the att site is selected from att1,
att2, or att3, as described herein.
[0244] In a preferred embodiment, the core region comprises a DNA
sequence selected from the group consisting of:
1 (a) RKYCWGCTTTYKTRTACNAASTSGB; (SEQ ID NO:1) (m-att) (b)
AGCCWGCTTTYKTRTACNAACTSGB; (SEQ ID NO:2) (m-attB) (c)
GTTCAGCTTTCKTRTACNAACTSGB; (SEQ ID NO:3) (m-attR) (d)
AGCCWGCTTTCKTRTACNAAGTSGB; (SEQ ID NO:4) (m-attL) (e)
GTTCAGCTTTYKTRTACNAAGTSGB; (SEQ ID NO:5) (m-attP1) (f) RBYCW
GCTTTYTTRTACWAA STKGD; (SEQ ID NO:39) (n-att) (g) ASCCW
GCTTTYTTRTACWAA STKGW; (SEQ ID NO:40) (n-attB) (h) ASCCW
GCTTTYTTRTACWAA GTTGG; (SEQ ID NO:41) (n-attL) (i) GTTCA
GCTTTYTTRTACWAA STKGW; (SEQ ID NO:42) (n-attR) (j) GTTCA
GCTTTYTTRTACWAA GTTGG; (SEQ ID NO:43) (n-attP)
[0245] or a corresponding or complementary DNA or RNA sequence,
wherein R=A or G; K=G or T/U; Y=C or T/U; W=A or T/U; N=A or C or G
or T/U; S=C or G; and B=C or G or T/U, as presented in 37 C.F.R.
.sctn.1.822, which is entirely incorporated herein by reference,
wherein the core region does not contain a stop codon in one or
more reading frames.
[0246] The core region also preferably comprises a DNA sequence
selected from the group consisting of:
2 (a) AGCCTGCTTTTTTGTACAAACTTGT; (SEQ ID NO:6) (attB1) (b)
AGCCTGCTTTCTTGTACAAACTTGT; (SEQ ID NO:7) (attB2) (c)
ACCCAGCTTTCTTGTACAAAGTGGT; (SEQ ID NO:8) (attB3) (d)
GTTCAGCTTTTTTGTACAAACTTGT; (SEQ ID NO:9) (attR1) (e)
GTTCAGCTTTCTTGTACAAACTTGT; (SEQ ID NO:10) (attR2) (f)
GTTCAGCTTTCTTGTACAAAGTGGT; (SEQ ID NO:11) (attR3) (g)
AGCCTGCTTTTTTGTACAAAGTTGG; (SEQ ID NO:12) (attL1) (h)
AGCCTGCTTTCTTGTACAAAGTTGG; (SEQ ID NO:13) (attL2) (i)
ACCCAGCTTTCTTGTACAAAGTTGG; (SEQ ID NO:14) (attL3) (j)
GTTCAGCTTTTTTGTACAAAGTTGG; (SEQ ID NO:15) (attP1) (k)
GTTCAGCTTTCTTGTACAAAGTTGG; (SEQ ID NO:16) (attP2,P3)
[0247] NO:16); or a corresponding or complementary DNA or RNA
sequence.
[0248] The present invention thus also provides a method for making
a nucleic acid molecule, comprising providing a nucleic acid
molecule having at least one engineered recombination site
comprising at least one DNA sequence having at least 80-99%
homology (or any range or value therein) to at least one of the
above sequences, or any suitable recombination site, or which
hybridizes under stringent conditions thereto, as known in the
art.
[0249] Clearly, there are various types and permutations of such
well-known in vitro and in vivo selection methods, each of which
are not described herein for the sake of brevity. However, such
variations and permutations are contemplated and considered to be
the different embodiments of the present invention.
[0250] It is important to note that as a result of the preferred
embodiment being in vitro recombination reactions, non-biological
molecules such as PCR products can be manipulated via the present
recombinational cloning method. In one example, it is possible to
clone linear molecules into circular vectors.
[0251] There are a number of applications for the present
invention. These uses include, but are not limited to, changing
vectors, apposing promoters with genes, constructing genes for
fusion proteins, changing copy number, changing replicons, cloning
into phages, and cloning, e.g., PCR products (with an attB site at
one end and a loxP site at the other end), genomic DNAs, and
cDNAs.
[0252] Vector Donors
[0253] In accordance with the invention, any vector may be used to
construct the Vector Donors of the invention. In particular,
vectors known in the art and those commercially available (and
variants or derivatives thereof) may in accordance with the
invention be engineered to include one or more recombination sites
for use in the methods of the invention. Such vectors may be
obtained from, for example, Vector Laboratories Inc., InVitrogen,
Promega, Novagen, NEB, Clontech, Boehringer Mannheim, Pharmacia,
EpiCenter, OriGenes Technologies Inc., Stratagene, Perkin Elmer,
Pharmingen, Life Technologies, Inc., and Research Genetics. Such
vectors may then for example be used for cloning or subcloning
nucleic acid molecules of interest. General classes of vectors of
particular interest include prokaryotic and/or eukaryotic cloning
vectors, expression vectors, fusion vectors, two-hybrid or reverse
two-hybrid vectors, shuttle vectors for use in different hosts,
mutagenesis vectors, transcription vectors, vectors for receiving
large inserts and the like.
[0254] Other vectors of interest include viral origin vectors (M13
vectors, bacterial phage .lambda. vectors, adenovirus vectors, and
retrovirus vectors), high, low and adjustable copy number vectors,
vectors which have compatible replicons for use in combination in a
single host (pACYC184 and pBR322) and eukaryotic episomal
replication vectors (pCDM8).
[0255] Particular vectors of interest include prokaryotic
expression vectors such as pcDNA II, pSL301, pSE280, pSE380,
pSE420, pTrcHisA, B, and C, pRSET A, B, and C (Invitrogen, Inc.),
pGEMEX-1, and pGEMEX-2 (Promega, Inc.), the pET vectors (Novagen,
Inc.), pTrc99A, pKK223-3, the pGEX vectors, pEZZ18, pRIT2T, and
pMC1871 (Pharmacia, Inc.), pKK233-2 and pKK388-1 (Clontech, Inc.),
and pProEx-HT (Life Technologies, Inc.) and variants and
derivatives thereof. Vector donors can also be made from eukaryotic
expression vectors such as pFastBac, pFastBac HT, pFastBac DUAL,
pSFV, and pTet-Splice (Life Technologies, Inc.), pEUK-C1, pPUR,
pMAM, pMAMneo, pBI101, pBI121, pDR2, pCMVEBNA, and pYACneo
(Clontech), pSVK3, pSVL, pMSG, pCH110, and pKK232-8 (Pharmacia,
Inc.), p3'SS, pXT1, pSG5, pPbac, pMbac, pMC1neo, and pOG44
(Stratagene, Inc.), and pYES2, pAC360, pBlueBacHis A, B, and C,
pVL1392, pBsueBacIII, pCDM8, pcDNA1, pZeoSV, pcDNA3 pREP4, pCEP4,
and pEBVHis (Invitrogen, Inc.) and variants or derivatives
thereof.
[0256] Other vectors of particular interest include pUC18, pUC19,
pBlueScript, pSPORT, cosmids, phagemids, YAC's (yeast artificial
chromosomes), BAC's (bacterial artificial chromosomes), P1 (E. coli
phage), pQE70, pQE60, pQE9 (quagan), pBS vectors, PhageScript
vectors, BlueScript vectors, pNH8A, pNH16A, pNH18A, pNH46A
(Stratagene), pcDNA3 (InVitrogen), pGEX, pTrsfus, pTrc99A, pET-5,
pET-9, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pSPORT1,
pSPORT2, pCMVSPORT2.0 and pSV-SPORT1 (Life Technologies, Inc.) and
variants or derivatives thereof.
[0257] Additional vectors of interest include pTrxFus, pThioHis,
pLEX, pTrcHis, pTrcHis2, pRSET, pBlueBacHis2, pcDNA3.1/His,
pcDNA3.1(-/Myc-His, pSecTag, pEBVHis, pPIC9K, pPIC3.5K, pAO815,
pPICZ, pPICZ.alpha., pGAPZ, pGAPZ.alpha., pBlueBac4.5,
pBlueBacHis2, pMelBac, pSinRep5, pSinHis, pIND, pIND(SP1), pVgRXR,
pcDNA2.1. pYES2, pZErO1.1, pZErO-2.1, pCR-Blunt, pSE280, pSE380,
pSE420, pVL1392, pVL1393, pCDM8, pcDNA1.1, pcDNA1.1/Amp, pcDNA3.1,
pcDNA3.1/Zeo, pSe,SV2, pRc/CMV2, pRc/RSV, pREP4, pREP7, pREP8,
pREP9, pREP10, pCEP4, pEBVHis, pCR3.1, pCR2.1, pCR3.1-Uni, and
pCRBac from Invitrogen; .lambda.ExCell, .lambda. gt11, pTrc99A,
pKK223-3, pGEX-1.lambda.T, pGEX-2T, pGEX-2TK, pGEX-4T-1, pGEX-4T-2,
pGEX-4T-3, pGEX-3X, pGEX-5X-1, pGEX-5X-2, pGEX-5X-3, pEZZ18,
pRIT2T, pMC1871, pSVK3, pSVL, pMSG, pCH110, pKK232-8, pSL1180,
pNEO, and pUC4K from Pharmacia; pSCREEN-1b(+), pT7Blue(R),
pT7Blue-2, pCITE-4abc(+), pOCUS-2, pTAg, pET-32 LIC, pET-30 LIC,
pBAC-2cp LIC, pBACgus-2cp LIC, pT7Blue-2 LIC, pT7Blue-2,
.lambda.SCREEN-1, .lambda.BlueSTAR, pET-3abcd, pET-7abc, pET9abcd,
pET11abcd, pET12abc, pET-14b, pET-15b, pET-16b, pET-17b-pET-17xb,
pET-19b, pET-20b(+), pET-21abcd(+), pET-22b(+), pET-23abcd(+),
pET-24abcd(+), pET-25b(+), pET-26b(+), pET-27b(+), pET-28abc(+),
pET-29abc(+), pET-30abc(+), pET-31 b(+), pET-32abc(+), pET-33b(+),
pBAC-1, pBACgus-1, pBAC4x-1, pBACgus4x-1, pBAC-3cp, pBACgus-2cp,
pBACsurf-1, p1g, Signal plg, pYX, Selecta Vecta-Neo, Selecta
Vecta-Hyg, and Selecta Vecta-Gpt from Novagen; pLexA, pB42AD,
pGBT9, pAS2-1, pGAD424, pACT2, pGAD GL, pGAD GH, pGAD10, pGilda,
pEZM3, pEGFP, pEGFP-1, pEGFP-N, pEGFP-C, pEBFP, pGFPuv, pGFP,
p6xHis-GFP, pSEAP2-Basic, pSEAP2-Contral, pSEAP2-Promoter,
pSEAP2-Enhancer, p.beta.gal-Basic, p.beta.gal-Control,
p.beta.gal-Promoter, p.beta.gal-Enhancer, pCMV.beta., pTet-Off,
pTet-On, pTK-Hyg, pRetro-Off, pRetro-On, pIRES1neo, pIRES1hyg,
pLXSN, pLNCX, pLAPSN, pMAMneo, pMAMneo-CAT, pMAMneo-LUC, pPUR,
pSV2neo, pYEX 4T-1/2/3, pYEX-S1, pBacPAK-His, pBacPAK8/9, pAcUW31,
BacPAK6, pTriplEx, .lambda.gt10, .lambda.g11, pWE15, and
.lambda.TriplEx from Clontech; Lambda ZAP II, pBK-CMV, pBK-RSV,
pBluescript II KS+/-, pBluescript II SK+/-, pAD-GAL4, pBD-GAL4 Cam,
pSurfscript, Lambda FIX II, Lambda DASH, Lambda EMBL3, Lambda
EMBL4, SuperCos, pCR-Scrigt Amp, pCR-Script Cam, pCR-Script Direct,
pBS+/-, pBC KS+/-, pBC SK+/-, Phagescript, pCAL-n-EK, pCAL-n,
pCAL-c, pCAL-kc, pET-3abcd, pET-11abcd, pSPUTK, pESP-1, pCMVLacI,
pOPRSVI/MCS, pOPI3 CAT, pXT1, pSG5, pPbac, pMbac, pMC1neo, pMC1neo
Poly A, pOG44, pOG45, pFRT.beta.GAL, pNEO.beta.GAL, pRS403, pRS404,
pRS405, pRS406, pRS413, pRS414, pRS415, and pRS416 from
Stratagene.
[0258] Two-hybrid and reverse two-hybrid vectors of particular
interest include pPC86, pDBLeu, pDBTrp, pPC97, p2.5, pGAD1-3,
pGAD10, pACt, pACT2, pGADGL, pGADGH, pAS2-1, pGAD424, pGBT8, pGBT9,
pGAD-GAL4, pLexA, pBD-GAL4, pHISi, pHISi-1, placZi, pB42AD, pDG202,
pJK202, pJG4-5, pNLexA, pYESTrp and variants or derivatives
thereof.
[0259] Polymerases
[0260] Preferred polypeptides having reverse transcriptase activity
(i.e., those polypeptides able to catalyze the synthesis of a DNA
molecule from an RNA template) include, but are not limited to
Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase, Rous
Sarcoma Virus (RSV) reverse transcriptase, Avian Myeloblastosis
Virus (AMV) reverse transcriptase, Rous Associated Virus (RAV)
reverse transcriptase, Myeloblastosis Associated Virus (MAV)
reverse transcriptase, Human lrrunodeficiency Virus (HIV) reverse
transcriptase, retroviral reverse transcriptase, retrotransposon
reverse transcriptase, hepatitis B reverse transcriptase,
cauliflower mosaic virus reverse transcriptase and bacterial
reverse transcriptase. Particularly preferred are those
polypeptides having reverse transcriptase activity that are also
substantially reduced in RNAse H activity (i.e., "RNAse H.sup.-"
polypeptides). By a polypeptide that is "substantially reduced in
RNase H activity" is meant that the polypeptide has less than about
20%, more preferably less than about 15%, 10% or 5%, and most
preferably less than about 2%, of the RNase H activity of a
wildtype or RNase H.sup.+ enzyme such as wildtype M-MLV reverse
transcriptase. The RNase H activity may be determined by a variety
of assays, such as those described, for example, in U.S. Pat. No.
5,244,797, in Kotewicz, M. L. et al., Nucl. Acids Res. 16:265
(1988) and in Gerard, G. F., et al., FOCUS 14(5):91 (1992), the
disclosures of all of which are fully incorporated herein by
reference. Suitable RNAse H.sup.- polypeptides for use in the
present invention include, but are not limited to, M-MLV H.sup.-
reverse transcriptase, RSV H.sup.- reverse transcriptase, AMV
H.sup.- reverse transcriptase, RAV H.sup.- reverse transcriptase,
MAV H.sup.- reverse transcriptase, HIV H.sup.- reverse
transcriptase, and SUPERSCRIPT.TM. I reverse transcriptase and
SUPERSCRIPT.TM. II reverse transcriptase which are available
commercially, for example from Life Technologies, Inc. (Rockville,
Md.).
[0261] Other polypeptides having nucleic acid polymerase activity
suitable for use in the present methods include thermophilic DNA
polymerases such as DNA polymerase I, DNA polymerase III, Klenow
fragment, T7 polymerase, and T5 polymerase, and thermostable DNA
polymerases including, but not limited to, Thermus thermophilus
(Tth) DNA polymerase, Thermus aquaticus (Taq) DNA polymerase,
Thermotoga neopolitana (Tne) DNA polymerase, Thermotoga maritima
(Tma) DNA polymerase, Thermococcus litoralis (Tli or VENT.RTM.) DNA
polymerase, Pyrococcus furiosus (Pfu or DEEPVENT.RTM.) DNA
polymerase, Pyrococcus woosii (Pwo) DNA polymerase, Bacillus
sterothermophilus (Bst) DNA polymerase, Sulfolobus acidocaldarius
(Sac) DNA polymerase, Thermoplasma acidophilum (Tac) DNA
polymerase, Thermus flavus (Tfl/Tub) DNA polymerase, Thermus ruber
(Tru) DNA polymerase, Thermus brockianus (DYNAZYME.RTM.) DNA
polymerase, Methanobacterium thermoautotrophicum (Mth) DNA
polymerase, and mutants, variants and derivatives thereof.
[0262] It will be understood by one of ordinary skill in the
relevant arts that other suitable modifications and adaptations to
the methods and applications described herein are readily apparent
and may be made without departing from the scope of the invention
or any embodiment thereof. Having now described the present
invention in detail, the same will be more clearly understood by
reference to the following examples, which are included herewith
for purposes of illustration only and are not intended to be
limiting of the invention.
EXAMPLES
[0263] The present recombinational cloning method accomplishes the
exchange of nucleic acid segments to render something useful to the
user, such as a change of cloning vectors. These segments must be
flanked on both sides by recombination signals that are in the
proper orientation with respect to one another. In the examples
below the two parental nucleic acid molecules (e.g., plasmids) are
called the Insert Donor and the Vector Donor. The Insert Donor
contains a segment that will become joined to a new vector
contributed by the Vector Donor. The recombination intermediate(s)
that contain(s) both starting molecules is called the
Cointegrate(s). The second recombination event produces two
daughter molecules, called the Product (the desired new clone) and
the Byproduct.
Buffers
[0264] Various known buffers can be used in the reactions of the
present invention. For restriction enzymes, it is advisable to use
the buffers recommended by the manufacturer. Alternative buffers
can be readily found in the literature or can be devised by those
of ordinary skill in the art.
[0265] Examples 1-3. One exemplary buffer for lambda integrase is
comprised of 50 mM Tris-HCl, at pH 7.5-7.8, 70 mM KCl, 5 mM
spermidine, 0.5 mM EDTA, and 0.25 mg/ml bovine serum albumin, and
optionally, 10% glycerol.
[0266] One preferred buffer for P1 Cre recombinase is comprised of
50 mM Tris-HCl at pH 7.5, 33 mM NaCl, 5 mM spermidine, and 0.5
mg/ml bovine serum albumin.
[0267] The buffer for other site-specific recombinases which are
similar to lambda Int and P1 Cre are either known in the art or can
be determined empirically by the skilled artisans, particularly in
light of the above-described buffers.
Example 1
Recombinational Cloning Using Cre and Cre & Int
[0268] Two pairs of plasmids were constructed to do the in vitro
recombinational cloning method in two different ways. One pair,
pEZC705 and pEZC726 (FIG. 2A), was constructed with loxP and att
sites, to be used with Cre and .lambda. integrase. The other pair,
pEZC602 and pEZC629 (FIG. 3A), contained the loxP (wild type) site
for Cre, and a second mutant lox site, loxP 511, which differs from
loxP in one base (out of 34 total). The minimum requirement for
recombinational cloning of the present invention is two
recombination sites in each plasmid, in general X and Y, and X' and
Y'. Recombinational cloning takes place if either or both types of
site can recombine to form a Cointegrate (e.g. X and X'), and if
either or both can recombine to excise the Product and Byproduct
plasmids from the Cointegrate (e.g. Y and Y'). It is important that
the recombination sites on the same plasmid do not recombine. It
was found that the present recombinational cloning could be done
with Cre alone.
[0269] Cre-Only
[0270] Two plasmids were constructed to demonstrate this conception
(see FIG. 3A). pEZC629 was the Vector Donor plasmid. It contained a
constitutive drug marker (chloramphenicol resistance), an origin of
replication, loxP and loxP 511 sites, a conditional drug marker
(kanamycin resistance whose expression is controlled by the
operator/promoter of the tetracycline resistance operon of
transposon Tn10), and a constitutively expressed gene for the tet
repressor protein, tetR. E. coli cells containing pEZC629 were
resistant to chloramphenicol at 30 .mu./ml, but sensitive to
kanamycin at 100 .mu.g/ml. pEZC602 was the Insert Donor plasmid,
which contained a different drug marker (ampicillin resistance), an
origin, and loxP and loxP 511 sites flanking a multiple cloning
site.
[0271] This experiment was comprised of two parts as follows:
[0272] Part I: About 75 ng each of pEZC602 and pEZC629 were mixed
in a total volume of 30 .mu.l of Cre buffer (50 mM Tris-HCl pH 7.5,
33 mM NaCl, 5 mM spermidine-HCl, 500 .mu.g/ml bovine serum
albumin). Two 10 .mu.l aliquots were transferred to new tubes. One
tube received 0.5 .mu.l of Cre protein (approx. 4 units per .mu.l;
partially purified according to Abremski and Hoess, J. Biol. Chem.
259:1509 (1984)). Both tubes were incubated at 37.degree. C. for 30
minutes, then 70.degree. C. for 10 minutes. Aliquots of each
reaction were diluted and transformed into DH5.alpha.. Following
expression, aliquots were plated on 30 .mu.g/ml chloramphenicol;
100 .mu.g/ml ampicillin plus 200 .mu.g/ml methicillin; or 100
.mu.g/ml kanamycin. Results: See Table 1. The reaction without Cre
gave 1.11.times.10.sup.6 ampicillin resistant colonies (from the
Insert Donor plasmid pEZC602); 7.8.times.10.sup.5 chloramphenicol
resistant colonies (from the Vector Donor plasmid pEZC629); and 140
kanamycin resistant colonies (background). The reaction with added
Cre gave 7.5.times.10.sup.5 ampicillin resistant colonies (from the
Insert Donor plasmid pEZC602); 6.1.times.10.sup.5 chloramphenicol
resistant colonies (from the Vector Donor plasmid pEZC629); and 760
kanamycin resistant colonies (mixture of background colonies and
colonies from the recombinational cloning Product plasmid).
Analysis: Because the number of colonies on the kanamycin plates
was much higher in the presence of Cre, many or most of them were
predicted to contain the desired Product plasmid.
3TABLE 1 Chloram- Enzyme Ampicillin phenicol Kanamycin Efficiency
None 1.1 .times. 10.sup.6 7.8 .times. 10.sup.5 140 140/7.8 .times.
10.sup.5 = 0.02% Cre 7.5 .times. 10.sup.5 6.1 .times. 10.sup.5 760
760/6.1 .times. 10.sup.5 = 0.12%
[0273] Part II: Twenty four colonies from the "+Cre" kanamycin
plates were picked and inoculated into medium containing 100
.mu.g/ml kanamycin. Minipreps were done, and the miniprep DNAs,
uncut or cut with SmaI or HindIII, were electrophoresed. Results:
19 of the 24 minipreps showed supercoiled plasmid of the size
predicted for the Product plasmid. All 19 showed the predicted SmaI
and HindIII restriction fragments. Analysis: The Cre only scheme
was demonstrated. Specifically, it was determined to have yielded
about 70% (19 of 24) Product clones. The efficiency was about 0.1%
(760 kanamycin resistant clones resulted from 6.1.times.10.sup.5
chloramphenicol resistant colonies).
[0274] Cre Plus Integrase
[0275] The plasmids used to demonstrate this method are exactly
analogous to those used above, except that pEZC726, the Vector
Donor plasmid, contained an attP site in place of loxP 511, and
pEZC705, the Insert Donor plasmid, contained an attB site in place
of loxP 511 (FIG. 2A).
[0276] This experiment was comprised of three parts as follows:
[0277] Part I: About 500 ng of pEZC705 (the Insert Donor plasmid)
was cut with ScaI, which linearized the plasmid within the
ampicillin resistance gene. (This was done because the .lambda.
integrase reaction has been historically done with the attB plasmid
in a linear state (H. Nash, personal communication). However, it
was found later that the integrase reaction proceeds well with both
plasmids supercoiled.) Then, the linear plasmid was ethanol
precipitated and dissolved in 20 .mu.l of .lambda. integrase buffer
(50 mM Tris-HCl, about pH 7.8, 70 mM KCl, 5 mM spermidine-HCl, 0.5
mM EDTA, 250 .mu.g/ml bovine serum albumin). Also, about 500 ng of
the Vector Donor plasmid pEZC726 was ethanol precipitated and
dissolved in 20 .mu.l .lambda. integrase buffer. Just before use,
.lambda. integrase (2 .mu.l, 393 .mu.g/ml) was thawed and diluted
by adding 18 .mu.l cold .lambda. integrase buffer. One .mu.l IHF
(integration host factor, 2.4 mg/ml, an accessory protein) was
diluted into 150 .mu.l cold .lambda. integrase buffer. Aliquots (2
.mu.l) of each DNA were mixed with .lambda. integrase buffer, with
or without 1 .mu.l each .lambda. integrase and IHF, in a total of
10 .mu.l. The mixture was incubated at 25.degree. C. for 45
minutes, then at 70.degree. C. for 10 minutes. Half of each
reaction was applied to an agarose gel. Results: In the presence of
integrase and IHF, about 5% of the total DNA was converted to a
linear Cointegrate form. Analysis: Activity of integrase and IHF
was confirmed.
[0278] Part II: Three microliters of each reaction (i.e., with or
without integrase and IHF) were diluted into 27 .mu.l of Cre buffer
(above), then each reaction was split into two 10 .mu.l aliquots
(four altogether). To two of these reactions, 0.5 .mu.l of Cre
protein (above) were added, and all reactions were incubated at
37.degree. C. for 30 minutes, then at 70.degree. C. for 10 minutes.
TE buffer (90 .mu.l; TE: 10 mM Tris-HCl, pH 7.5, 1 mM EDTA) was
added to each reaction, and 1 .mu.l each was transformed into E.
coli DH5.alpha.. The transformation mixtures were plated on 100
.mu.g/ml ampicillin plus 200 .mu.g/ml methicillin; 30 .mu.g/ml
chloramphenicol; or 100 .mu.g/ml kanamycin. Results: See Table
2.
4TABLE 2 Ampi- Chloram- Enzyme cillin phenicol Kanamycin Efficiency
None 990 20000 4 4/2 .times. 10.sup.4 = 0.02% Cre only 280 3640 0 0
Integrase* 1040 27000 9 9/2.7 .times. 10.sup.4 = 0.03% only
Integrase* + 110 1110 76 76/1.1 .times. 10.sup.3 = 6.9% Cre
*Integrase reactions also contained IHF.
[0279] Analysis: The Cre protein impaired transformation. When
adjusted for this effect, the number of kanamycin resistant
colonies, compared to the control reactions, increased more than
100 fold when both Cre and Integrase were used. This suggests a
specificity of greater than 99%.
[0280] Part III: 38 colonies were picked from the Integrase plus
Cre plates, miniprep DNAs were made and cut with HindIII to give
diagnostic mapping information. Result: All 38 had precisely the
expected fragment sizes. Analysis: The Cre plus .lambda. integrase
method was observed to have much higher specificity than Cre-alone.
Conclusion: The Cre plus .lambda. integrase method was
demonstrated. Efficiency and specificity were much higher than for
Cre only.
Example 2
Using in vitro Recombinational Cloning to Subclone the
Chloramphenicol Acetyl Transferase Gene into a Vector for
Expression in Eukaryotic Cells (FIG. 4A)
[0281] An Insert Donor plasmid, pEZC843, was constructed,
comprising the chloramphenicol acetyl transferase gene of E. coli,
cloned between loxP and attB sites such that the loxP site was
positioned at the 5'-end of the gene (FIG. 4B). A Vector Donor
plasmid, pEZC1003, was constructed, which contained the
cytomegalovirus eukaryotic promoter apposed to a loxP site (FIG.
4C). One microliter aliquots of each supercoiled plasmid (about 50
ng crude miniprep DNA) were combined in a ten microliter reaction
containing equal parts of lambda integrase buffer (50 mM Tris-HCl,
pH 7.8, 70 mM KCl, 5 mM spermidine, 0.5 mM EDTA, 0.25 mg/ml bovine
serum albumin) and Cre recombinase buffer (50 mM Tris-HCl, pH 7.5,
33 mM NaCl, 5 mM spermidine, 0.5 mg/ml bovine serum albumin), two
units of Cre recombinase, 16 ng integration host factor, and 32 ng
lambda integrase. After incubation at 30.degree. C. for 30 minutes
and 75.degree. C. for 10 minutes, one microliter was transformed
into competent E. coli strain DH5.alpha. (Life Technologies, Inc.).
Aliquots of transformations were spread on agar plates containing
200 .mu.g/ml kanamycin and incubated at 37.degree. C. overnight. An
otherwise identical control reaction contained the Vector Donor
plasmid only. The plate receiving 10% of the control reaction
transformation gave one colony; the plate receiving 10% of the
recombinational cloning reaction gave 144 colonies. These numbers
suggested that greater than 99% of the recombinational cloning
colonies contained the desired product plasmid. Miniprep DNA made
from six recombinational cloning colonies gave the predicted size
plasmid (5026 base pairs), CMVProd. Restriction digestion with NcoI
gave the fragments predicted for the chloramphenicol acetyl
transferase cloned downstream of the CMV promoter for all six
plasmids.
Example 3
Subcloned DNA Segments Flanked by attB Sites Without Stop
Codons
[0282] Part I: Background
[0283] The above examples are suitable for transcriptional fusions,
in which transcription crosses recombination sites. However, both
attR and loxP sites contain multiple stop codons on both strands,
so translational fusions can be difficult, where the coding
sequence must cross the recombination sites, (only one reading
frame is available on each strand of loxP sites) or impossible (in
attR or attL).
[0284] A principal reason for subcloning is to fuse protein
domains. For example, fusion of the glutathione S-transferase (GST)
domain to a protein of interest allows the fusion protein to be
purified by affinity chromatography on glutathione agarose
(Pharmacia, Inc., 1995 catalog). If the protein of interest is
fused to runs of consecutive histidines (for example His6), the
fusion protein can be purified by affinity chromatography on
chelating resins containing metal ions (Qiagen, Inc.). It is often
desirable to compare amino terminal and carboxy terminal fusions
for activity, solubility, stability, and the like.
[0285] The attB sites of the bacteriophage .lambda. integration
system were examined as an alternative to loxP sites, because they
are small (25 bp) and have some sequence flexibility (Nash, H. A.
et al., Proc. Natl. Acad. Sci. USA 84:4049-4053 (1987). It was not
previously suggested that multiple mutations to remove all stop
codes would result in useful recombination sites for
recombinational subcloning.
[0286] Using standard nomenclature for site specific recombination
in lambda bacteriophage (Weisber, in Lambda III, Hendrix, et al.,
eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(1989)), the nucleotide regions that participate in the
recombination reaction in an E. coli host cell are represented as
follows:
5 attP--P1--H1--P2--X--H2--C-O-C'--H'--P'1--P'2-- P'3-- + attB
--B-O-B'-- Int, IHF .dwnarw..Arrow-up bold. Xis, Int, IHF attR
--P1--H1--P2--X--H2--C-O-B'-- + attL
--B-O-C'--H'--P'1--P'2--P'3--,
[0287] where: O represents the 15 bp core DNA sequence found in
both the phage and E. coli genomes; B and B' represent
approximately 5 bases adjacent to the core in the E. coli genome;
and P1, H1, P2, X, H2, C, C', H', P'1, P'2, and P'3 represent known
DNA sequences encoding protein binding domains in the bacteriophage
.lambda. genome.
[0288] The reaction is reversible in the presence of the protein
Xis (excisionase); recombination between attL and attR precisely
excise the .lambda. genome from its integrated state, regenerating
the circular .lambda. genome containing attP and the linear E. coli
genome containing attB.
[0289] Part II: Construction and Testing of Plasmids Containing
Mutant att Sites
[0290] Mutant attL and attR sites were constructed. Importantly,
Landy et al. (Ann. Rev. Biochem. 58:913 (1989)) observed that
deletion of the P1 and H1 domains of attP facilitated the excision
reaction and eliminated the integration reaction, thereby making
the excision reaction irreversible. Therefore, as mutations were
introduced in attR, the P1 and H1 domains were also deleted. attR'
sites in the present example lack the P1 and H1 regions and have
the NdeI site removed (base 27630 changed from C to G), and contain
sequences corresponding to bacteriophage .lambda. coordinates
27619-27738 (GenBank release 92.0, bg:LAMCG, "Complete Sequence of
Bacteriophage Lambda").
[0291] The sequence of attB produced by recombination of wild type
attL and attR sites is:
6 B O B' attBwt: 5' AGCCT GCTTTTTTATACTAA CTTGA 3' (SEQ. ID NO:60)
3' TCGGA CGAAAAAATATGATT GAACT 5' (SEQ. ID NO:44)
[0292] The stop codons are italicized and underlined. Note that
sequences of attL, attR, and attP can be derived from the attB
sequence and the boundaries of bacteriophage .lambda. contained
within attL and attR (coordinates 27619 to 27818).
[0293] When mutant attR1 (attR') and attL1 sites were recombined
the sequence attB1 was produced (mutations in bold, large
font):
7 B O B' attB1: 5' AGCCT GCTTTTTTGTACAAA CTTGT 3' (SEQ. ID NO:6) 3'
TCGGA CGAAAAAACATGTTT GAACA 5' (SEQ. ID NO:45)
[0294] Note that the four stop codons are gone.
[0295] When an additional mutation was introduced in the attR1
(attR') and attL1 sequences (bold), attR2 (attR') and attL2 sites
resulted. Recombination of attR2 and attL2 produced the attB2
site:
8 B O B' attB2: 5' AGCCT GCTTTCTTGTACAAA CTTGT 3' (SEQ. ID NO:7) 3'
TCGGA CGAAAGAACATGTTT GAACA 5' (SEQ. ID NO:46)
[0296] The recombination activities of the above attL and attR'
sites were assayed as follows. The attB site of plasmid pEZC705
(FIG. 2B) was replaced with attLwt, attL1, or attL2. The attP site
of plasmid pEZC726 (FIG. 2C) was replaced with attRwt, attR1
(attR', lacking regions P1 and H1) or attR2 (attR', lacking regions
P1 and H1). Thus, the resulting plasmids could recombine via their
loxP sites, mediated by Cre, and via their attR' and attL sites,
mediated by Int, Xis, and IHF. Pairs of plasmids were mixed and
reacted with Cre, Int, Xis, and IHF, transformed into E. coli
competent cells, and plated on agar containing kanamycin. The
results are presented in Table 3:
9TABLE 3 # of kanamycin resistant Vector donor att site Gene donor
att site colonies* attR' wt (pEZC1301) None 1 (background) " attLwt
(pEZC1313) 147 " attL1 (pEZC1317) 47 " attL2 (pEZC1321) 0 attR' 1
(pEZC1305) None 1 (background) " attLwt (pEZC1313) 4 " attL1
(pEZC1317) 128 " attL2 (pEZC1321) 0 attR' 2 (pEZC1309) None 0
(background) " attLwt (pEZC1313) 0 " attL1 (pEZC1317) 0 " attL2
(pEZC1321) 209 (*1% of each transformation was spread on a
kanamycin plate.)
[0297] The above data show that whereas the wild type att and att1
sites recombine to a small extent, the att1 and att2 sites do not
recombine detectably with each other.
[0298] Part III. Recombination was demonstrated when the core
region of both attB sites flanking the DNA segment of interest did
not contain stop codons. The physical state of the participating
plasmids was discovered to influence recombination efficiency.
[0299] The appropriate att sites were moved into pEZC705 and
pEZC726 to make the plasmids pEZC1405 (FIG. 5G) (attR'1 and attR'2)
and pEZC1502 (FIG. 5H) (attL1 and attL2). The desired DNA segment
in this experiment was a copy of the chloramphenicol resistance
gene cloned between the two attL sites of pEZC1502. Pairs of
plasmids were recombined in vitro using Int, Xis, and IHF (no Cre
because no loxP sites were present). 100 ng of each plasmid were
incubated in 10 .mu.l reactions of 50 mM Tris HCl pH about 7.8,
16.5 mM NaCl, 35 mM KCl, 5 mM spermidine, 0.25 mM EDTA, 0.375 mg/ml
BSA, 3% glycerol that contained 8.1 ng IHF, 43 ng Lnt, 4.3 ng Xis,
and 2 units Cre. Reactions were incubated at 25.degree. C. for 45
min., 65.degree. C. for 10 min, and 1 .mu.l aliquots were
transformed into DH5.alpha. cells, and spread on kanamycin plates.
The yield of desired kanamycin resistant colonies was determined
when both parental plasmids were circular, or when one plasmid was
circular and the other linear as presented in Table 4:
10TABLE 4 Vector donor.sup.1 Insert donor.sup.1 Kanamycin resistant
colonies.sup.2 Circular pEZC1405 None 30 Circular pEZC1405 Circular
pEZC1502 2680 Linear pEZC1405 None 90 Linear pEZC1405 Circular
pEZC1502 172000 Circular pEZC1405 Linear pEZC1502 73000 .sup.1DNAs
were purified with Qiagen columns, concentrations determined by
A260, and linearized with XbaI (pEZC1405) or AlwNI (pEZC1502). Each
reaction contained 100 ng of the indicated DNA. All reactions (10
.mu.l total) contained 3 .mu.l of enzyme mix (Xis, Int, and IHF).
After incubation (45 minutes at 25.degree., 10 minutes at
65.degree.), one .mu.l was used to transform E. coli DH5.alpha.
cells. .sup.2Number of colonies expected if the entire
transformation reaction (1 ml) had been plated. Either 100 .mu.l or
1 .mu.l of the transformations were actually plated.
[0300] Analysis: Recombinational cloning using mutant attR and attL
sites was confirmed. The desired DNA segment is subcloned between
attB sites that do not contain any stop codons in either strand.
The enhanced yield of Product DNA (when one parent was linear) was
unexpected because of earlier observations that the excision
reaction was more efficient when both participating molecules were
supercoiled and proteins were limiting (Nunes-Duby et al., Cell
50:779-788 (1987).
Example 4
Demonstration of Recombinational Cloning Without Inverted
Repeats
[0301] Part I: Rationale
[0302] The above Example 3 showed that plasmids containing inverted
repeats of the appropriate recombination sites (for example, attL1
and attL2 in plasmid pEZC1502) (FIG. 5H) could recombine to give
the desired DNA segment flanked by attB sites without stop codons,
also in inverted orientation. A concern was the in vivo and in
vitro influence of the inverted repeats. For example, transcription
of a desired DNA segment flanked by attB sites in inverted
orientation could yield a single stranded RNA molecule that might
form a hairpin structure, thereby inhibiting translation.
[0303] Inverted orientation of similar recombination sites can be
avoided by placing the sites in direct repeat arrangement att
sites. If parental plasmids each have a wild type attL and wild
type attR site, in direct repeat the Int, Xis, and IHF proteins
will simply remove the DNA segment flanked by those sites in an
intramolecular reaction. However, the mutant sites described in the
above Example 3 suggested that it might be possible to inhibit the
intramolecular reaction while allowing the intermolecular
recombination to proceed as desired.
[0304] Part II: Structure of Plasmids Without Inverted Repeats for
Recombinational Cloning
[0305] The attR2 sequence in plasmid pEZC1405 (FIG. 5G) was
replaced with attL2, in the opposite orientation, to make pEZC1603
(FIG. 6A). The attL2 sequence of pEZC1502 (FIG. 5H) was replaced
with attR2, in the opposite orientation, to make pEZC1706 (FIG.
6B). Each of these plasmids contained mutations in the core region
that make intramolecular reactions between att1 and att2 cores very
inefficient (see Example 3, above).
[0306] Plasmids pEZC1405, pEZC1502, pEZC1603 and pEZC1706 were
purified on Qiagen columns (Qiagen, Inc.). Aliquots of plasmids
pEZC1405 and pEZC1603 were linearized with XbaI. Aliquots of
plasmids pEZC1502 and pEZC1706 were linearized with AlwNI. One
hundred ng of plasmids were mixed in buffer (50 mM Tris HCL pH
about 7.8, 16.5 mM NaCl, 35 mM KCl, 5 mM spermidine, 0.25 mM EDTA,
0.375 mg/ml BSA, 3% glycerol) containing Int (43.5 ng), Xis (4.3
ng) and IHF (8.1 ng) in a final volume of 10 .mu.l. Reactions were
incubated for 45 minutes at 25.degree. C., 10 minutes at 65.degree.
C., and 1 .mu.l was transformed into E. coli DH5.alpha.. After
expression, aliquots were spread on agar plates containing 200
.mu.g/ml kanamycin and incubated at 37.degree. C.
[0307] Results, expressed as the number of colonies per 1 .mu.l of
recombination reaction are presented in Table 5:
11TABLE 5 Vector Donor Gene Donor Colonies Predicted % product
Circular 1405 -- 100 -- Circular 1405 Circular 1502 3740 3640/3740
= 97% Linear 1405 -- 90 -- Linear 1405 Circular 1502 172,000
171,910/172,000 = 99.9% Circular 1405 Linear 1502 73,000
72,900/73,000 = 99.9% Circular 1603 -- 80 -- Circular 1603 Circular
1706 410 330/410 = 80% Linear 1603 -- 270 -- Linear 1603 Circular
1706 7000 6730/7000 = 96% Circular 1603 Linear 1706 10,800
10,530/10,800 = 97%
[0308] Analysis. In all configurations, i.e., circular or linear,
the pEZC1405.times.pEZC1502 pair (with att sites in inverted repeat
configuration) was more efficient than pEZC1603.times.pEZC1706 pair
(with att sites mutated to avoid hairpin formation). The
pEZC1603.times.pEZC1706 pair gave higher backgrounds and lower
efficiencies than the pEZC1405.times.pEZC1502 pair. While less
efficient, 80% or more of the colonies from the
pEZC1603.times.pEZC1706 reactions were expected to contain the
desired plasmid product. Making one partner linear stimulated the
reactions in all cases.
[0309] Part III: Confirmation of Product Plasmids' Structure
[0310] Six colonies each from the linear pEZC1405 (FIG.
5G).times.circular pEZC1502 (FIG. 5H), circular
pEZC1405.times.linear pEZC1502, linear pEZC1603 (FIG.
6A).times.circular pEZC1706 (FIG. 6B), and circular
pEZC1603.times.linear pEZC1706 reactions were picked into rich
medium and miniprep DNAs were prepared. Diagnostic cuts with Ssp I
gave the predicted restriction fragments for all 24 colonies.
[0311] Analysis. Recombination reactions between plasmids with
mutant attL and attR sites on the same molecules gave the desired
plasmid products with a high degree of specificity.
Example 5
Recombinational Cloning with a Toxic Gene
[0312] Part I: Background
[0313] Restriction enzyme DpnI recognizes the sequence GATC and
cuts that sequence only if the A is methylated by the dam
methylase. Most commonly used E. coli strains are dam.sup.+.
Expression of DpnI in dam.sup.+ strains of E. coli is lethal
because the chromosome of the cell is chopped into many pieces.
However, in dam.sup.- cells expression of DpnI is innocuous because
the chromosome is immune to DpnI cutting.
[0314] In the general recombinational cloning scheme, in which the
vector donor contains two segments C and D separated by
recombination sites, selection for the desired product depends upon
selection for the presence of segment D, and the absence of segment
C. In the original Example segment D contained a drug resistance
gene (Km) that was negatively controlled by a repressor gene found
on segment C. When C was present, cells containing D were not
resistant to kanamycin because the resistance gene was turned
off.
[0315] The DpnI gene is an example of a toxic gene that can replace
the repressor gene of the above embodiment. If segment C expresses
the DpnI gene product, transforming plasmid CD into a dam.sup.+
host kills the cell. If segment D is transferred to a new plasmid,
for example by recombinational cloning, then selecting for the drug
marker will be successful because the toxic gene is no longer
present.
[0316] Part II: Construction of a Vector Donor Using DpnI as a
Toxic Gene
[0317] The gene encoding DpnI endonuclease was amplified by PCR
using primers 5'CCA CCA CAA ACG CGT CCA TGG AAT TAC ACT TTA ATT
TAG3' (SEQ. ID NO: 17) and 5'CCA CCA CAA GTC GAC GCA TGC CGA CAG
CCT TCC AAA TGT3' (SEQ ID NO: 18) and a plasmid containing the DpnI
gene (derived from plasmids obtained from Sanford A. Lacks,
Brookhaven National Laboratory, Upton, N.Y.; also available from
American Type Culture Collection as ATCC 67494) as the
template.
[0318] Additional mutations were introduced into the B and B'
regions of attL and attR', respectively, by amplifying existing
attL and attR' domains with primers containing the desired base
changes. Recombination of the mutant attL3 (made with oligo Xis115)
and attR'3 (attR', made with oligo Xis112) yielded attB3 with the
following sequence (differences from attB1 in bold):
12 B O B' ACCCA GCTTTCTTGTACAAA GTGGT (SEQ ID NO:8) TGGGT
CGAAAGAACATGTTT CACCA (SEQ ID NO:47)
[0319] The attL3 sequence was cloned in place of attL2 of an
existing Gene Donor plasmid to give the plasmid pEZC2901 (FIG. 7A).
The attR'3 sequence was cloned in place of attR'2 in an existing
Vector Donor plasmid to give plasmid pEZC2913 (FIG. 7B). The DpnI
gene was cloned into plasmid pEZC2913 to replace the tet repressor
gene. The resulting Vector Donor plasmid was named pEZC3101 (FIG.
7C). When pEZC3101 was transformed into the dam.sup.- strain SCS110
(Stratagene), hundreds of colonies resulted. When the same plasmid
was transformed into the dam+ strain DH560 , only one colony was
produced, even though the DH5.alpha. cells were about 20 fold more
competent than the SCS110 cells. When a related plasmid that did
not contain the DpnI gene was transformed into the same two cell
lines, 28 colonies were produced from the SCS110 cells, while 448
colonies resulted from the DH5.alpha. cells. This is evidence that
the Dpn I gene is being expressed on plasmid pEZC3101 (FIG. 7C),
and that it is killing the dam.sup.+ DH5.alpha. cells but not the
dam.sup.- SCS110 cells.
[0320] Part III: Demonstration of Recombinational Cloning Using
DpnI Selection
[0321] A pair of plasmids was used to demonstrate recombinational
cloning with selection for Product dependent upon the toxic gene
DpnI. Plasmid pEZC3101 (FIG. 7C) was linearized with MluI and
reacted with circular plasmid pEZC2901 (FIG. 7A). A second pair of
plasmids using selection based on control of drug resistance by a
repressor gene was used as a control: plasmid pEZC1802 (FIG. 7D)
was linearized with XbaI and reacted with circularlar plasmid
pEZC1502 (FIG. 5H). Eight microliter reactions containing buffer
(50 mM Tris HCl pH about 7.8, 16.5 mM NaCl, 35 mM KCl, 5 mM
spermidine, 0.375 mg/ml BSA, 0.25 mM EDTA, 2.5% glycerol) and
proteins Xis (2.9 ng), Int (29 ng), and IHF (5.4 ng) were incubated
for 45 minutes at 25.degree. C. then 10 minutes at 75.degree. C.,
and 1 .mu.l aliquots were transformed into DH5.alpha. (i.e., dam+)
competent cells, as presented in Table 6.
13TABLE 6 Basis of Reaction # Vector donor selection Insert donor
Colonies 1 pEZC3101/Mlu Dpn I toxicity -- 3 2 pEZC3101/Mlu Dpn I
toxicity Circular 4000 pEZC2901 3 pEZC1802/Xba Tet repressor -- 0 4
pEZC1802/Xba Tet repressor Circular 12100 pEZC1502
[0322] Miniprep DNAs were prepared from four colonies from reaction
#2, and cut with restriction enzyme Ssp I. All gave the predicted
fragments.
[0323] Analysis: Subcloning using selection with a toxic gene was
demonstrated. Plasmids of the predicted structure were
produced.
Example 6
Cloning of Genes with Uracil DNA Glycosylase and Subcloning of the
Genes with Recombinational Cloning to Make Fusion Proteins
[0324] Part I: Converting an Existing Expression Vector to a Vector
Donor for Recombinational Cloning
[0325] A cassette useful for converting existing vectors into
functional Vector Donors was made as follows. Plasmid pEZC3101
(FIG. 7C) was digested with ApaI and KpnI, treated with T4 DNA
polymerase and dNTPs to render the ends blunt, further digested
with SmaI, HpaI, and AlwNI to render the undesirable DNA fragments
small, and the 2.6 kb cassette containing the attR'1-Cm.sup.R-Dpn
I-attR'-3 domains was gel purified. The concentration of the
purified cassette was estimated to be about 75 ng DNA/.mu.l.
[0326] Plasmid pGEX-2TK (FIG. 8A) (Pharmacia) allows fusions
between the protein glutathione S transferase and any second coding
sequence that can be inserted in frame in its multiple cloning
site. pGEX-2TK DNA was digested with SmaI and treated with alkaline
phosphatase. About 75 ng of the above purified DNA cassette was
ligated with about 100 ng of the pGEX-2TK vector for 2.5 hours in a
5 .mu.l ligation, then 1 .mu.l was transformed into competent E.
coli BRL 3056 cells (a dam.sub.- derivative of DH10B; dam.sup.-
strains commercially available include DM1 from Life Technologies,
Inc., and SCS 110 from Stratagene). Aliquots of the transformation
mixture were plated on LB agar containing 100 .mu.g/ml ampicillin
(resistance gene present on pGEX-2TK) and 30 .mu.g/ml
chloramphenicol (resistance gene present on the DNA cassette).
Colonies were picked and miniprep DNAs were made. The orientation
of the cassette in pGEX-2TK was determined by diagnostic cuts with
EcoRI. A plasmid with the desired orientation was named pEZC3501
(FIG. 8B).
[0327] Part II: Cloning Reporter Genes Into an Recombinational
Cloning Gene Donor Plasmid in Three Reading Frames
[0328] Uracil DNA glycosylase (UDG) cloning is a method for cloning
PCR amplification products into cloning vectors (U.S. Pat. No.
5,334,515, entirely incorporated herein by reference). Briefly, PCR
amplification of the desired DNA segment is performed with primers
that contain uracil bases in place of thymidine bases in their 5'
ends. When such PCR products are incubated with the enzyme UDG, the
uracil bases are specifically removed. The loss of these bases
weakens base pairing in the ends of the PCR product DNA, and when
incubated at a suitable temperature (e.g., 37.degree. C.), the ends
of such products are largely single stranded. If such incubations
are done in the presence of linear cloning vectors containing
protruding 3' tails that are complementary to the 3' ends of the
PCR products, base pairing efficiently anneals the PCR products to
the cloning vector. When the annealed product is introduced into E.
coli cells by transformation, in vivo processes efficiently convert
it into a recombinant plasmid.
[0329] UDG cloning vectors that enable cloning of any PCR product
in all three reading frames were prepared from pEZC3201 (FIG. 8K)
as follows. Eight oligonucleotides were obtained from Life
Technologies, Inc. (all written 5'.fwdarw.3': rf1 top (GGCC GAT TAC
GAT ATC CCA ACG ACC GAA AAC CTG TAT TTT CAG GGT) (SEQ. ID NO:19),
rf1 bottom (CAG GTT TTC GGT CGT TGG GAT ATC GTA ATC)(SEQ. ID
NO:20), rf2 top (GGCCA GAT TAC GAT ATC CCA ACG ACC GAA AAC CTG TAT
TTT CAG GGT)(SEQ. ID NO:21), rf2 bottom (CAG GTT TTC GGT CGT TGG
GAT ATC GTA ATC T)(SEQ. ID NO:22), rf3 top (GGCCAA GAT TAC GAT ATC
CCA ACG ACC GAA AAC CTG TAT TTT CAG GGT)(SEQ. ID NO:23), rf3 bottom
(CAG GTT TTC GGT CGT TGG GAT ATC GTA ATC TT)(SEQ. ID NO:24),
carboxy top (ACC GTT TAC GTG GAC)(SEQ. ID NO:25) and carboxy bottom
(TCGA GTC CAC GTA AAC GGT TCC CAC TTA TTA)(SEQ. ID NO:26). The rf1,
2, and 3 top strands and the carboxy bottom strand were
phosphorylated on their 5' ends with T4 polynucleotide kinase, and
then the complementary strands of each pair were hybridized.
Plasmid pEZC3201 (FIG. 8K) was cut with NotI and SaII, and aliquots
of cut plasmid were mixed with the carboxy-oligo duplex (Sal I end)
and either the rf1, rf2, or rf3 duplexes (NotI ends) (10 .mu.g cut
plasmid (about 5 pmol) mixed with 250 pmol carboxy oligo duplex,
split into three 20 .mu.l volumes, added 5 .mu.l (250 pmol) of rf1,
rf2, or rf3 duplex and 2 .mu.l=2 units T4 DNA ligase to each
reaction). After 90 minutes of ligation at room temperature, each
reaction was applied to a preparative agarose gel and the 2.1 kb
vector bands were eluted and dissolved in 50 .mu.of TE.
[0330] Part III: PCR of CAT and phoA Genes
[0331] Primers were obtained from Life Technologies, Inc., to
amplify the chloramphenicol acetyl transferase (CAT) gene from
plasmid pACYC184, and phoA, the alkaline phosphatase gene from E.
coli. The primers had 12-base 5' extensions containing uracil
bases, so that treatment of PCR products with uracil DNA
glycosylase (UDG) would weaken base pairing at each end of the DNAs
and allow the 3' strands to anneal with the protruding 3' ends of
the rf1, 2, and 3 vectors described above. The sequences of the
primers (all written 5'.fwdarw.3') were: CAT left, UAU UfU CAG GGU
ATG GAG AAA AAA ATC ACT GGA TAT ACC (SEQ. ID NO:27); CAT right, UCC
CAC UUA UUA CGC CCC GCC CTG CCA CTC ATC (SEQ. ID NO:28); phoA left,
UAU UUU CAG GGU ATG CCT GTT CTG GAA AAC CGG (SEQ. ID NO:29); and
phoA right, UCC CAC UUA WUA TTT CAG CCC CAG GGC GGC TTT C (SEQ. ID
NO:30). The primers were then used for PCR reactions using known
method steps (see, e.g., U.S. Pat. No. 5,334,515, entirely
incorporated herein by reference), and the polymerase chain
reaction amplification products obtained with these primers
comprised the CAT or phoA genes with the initiating ATGs but
without any transcriptional signals. In addition, the
uracil-containing sequences on the amino termini encoded the
cleavage site for TEV protease (Life Technologies, Inc.), and those
on the carboxy terminal encoded consecutive TAA nonsense
codons.
[0332] Unpurified PCR products (about 30 ng) were mixed with the
gel purified, linear rf1, rf2, or rf3 cloning vectors (about 50 ng)
in a 10 .mu.l reaction containing 1.times.REact 4 buffer (LTI) and
1 unit UDG (LTI). After 30 minutes at 37.degree. C., 1 .mu.l
aliquots of each reaction were transformed into competent E. coli
DH5.alpha. cells (LTI) and plated on agar containing 50 .mu.g/ml
kanamycin. Colonies were picked and analysis of miniprep DNA showed
that the CAT gene had been cloned in reading frame 1 (pEZC3601)
(FIG. 8C), reading frame 2 (pEZC3609) (FIG. 8D) and reading frame 3
(pEZC3617) (FIG. 8E), and that the phoA gene had been cloned in
reading frame 1 (pEZC3606) (FIG. 8F), reading frame 2 (pEZC3613)
(FIG. 8G) and reading frame 3 (pEZC3621) (FIG. 8H).
[0333] Part IV: Subdloning of CAT or phoA from UDG Cloning Vectors
into a GST Fusion Vector
[0334] Plasmids encoding fusions between GST and either CAT or phoA
in all three reading frames were constructed by recombinational
cloning as follows. Miniprep DNA of GST vector donor pEZC3501(FIG.
8B) (derived from Pharmacia plasmid pGEX-2TK as described above)
was linearized with ClaI. About 5 ng of vector donor were mixed
with about 10 ng each of the appropriate circular gene donor
vectors containing CAT or phoA in 8 .mu.l reactions containing
buffer and recombination proteins Int, Xis, and IHF (Example 5).
After incubation, 1 .mu.l of each reaction was transformed into E.
coli strain DH5.alpha. and plated on ampicillin, as presented in
Table 7.
14TABLE 7 Colonies DNA (10% of each transformation) Linear vector
donor (pEZC3501/Cla) 0 Vector donor + CAT rf1 110 Vector donor +
CAT rf2 71 Vector donor + CAT rf3 148 Vector donor + phoA rf1 121
Vector donor + phoA rf2 128 Vector donor + phoA rf3 31
[0335] Part V: Expression of Fusion Proteins
[0336] Two colonies from each transformation were picked into 2 ml
of rich medium (CircleGrow, Bio101 Inc.) in 17.times.100 mm plastic
tubes (Falcon 2059, Becton Dickinson) containing 100 .mu.g/ml
ampicillin and shaken vigorously for about 4 hours at 37.degree.
C., at which time the cultures were visibly turbid. One ml of each
culture was transferred to a new tube containing 10 .mu.l of 10%
(w/v) IPTG to induce expression of GST. After 2 hours additional
incubation, all cultures had about the same turbidity; the A600 of
one culture was 1.5. Cells from 0.35 ml each culture were harvested
and treated with sample buffer (containing SDS and
.beta.-mercaptoethanol) and aliquots equivalent to about 0.15 A600
units of cells were applied to a Novex 4-20% gradient
polyacrylamide gel. Following electrophoresis the gel was stained
with Coomassie blue.
[0337] Results: Enhanced expression of single protein bands was
seen for all 12 cultures. The observed sizes of these proteins
correlated well with the sizes predicted for GST being fused
(through attB recombination sites without stop codons) to CAT (FIG.
8I) or phoA (FIG. 8J) in three reading frames: CAT rf1=269 amino
acids; CAT rf2=303 amino acids; CAT rf3=478 amino acids; phoA
rf1=282 amino acids; phoA rf2=280 amino acids; and phoA rf3=705
amino acids.
[0338] Analysis: Both CAT and phoA genes were subcloned into a GST
fusion vector in all three reading frames, and expression of the
six fusion proteins was demonstrated.
Example 7
Reverse Recombination and Subcloning by Recombination
[0339] Two plasmids were constructed to demonstrate reverse
recombination according to the present invention. The vector
pEZC5601 (FIG. 10A), containing attB recombination sites and termed
the attB parent plasmid (this vector may correspond to the Product
DNA), further contained an ampicillin resistance gene, an origin of
replication, an attB2 site, a tetracycline resistance gene, and an
attB0 site, as described above. Plasmid pEZC6701 (FIG. 10B),
containing attP recombination sites and termed the attP parent
plasmid (this vector may correspond to the Byproduct DNA or may
correspond to a different Vector Donor DNA), also contained a
kanamycin resistance gene, an origin of replication, an attP2 site,
a gene encoding the toxic protein ccdB, and an attP0 site.
Integrase buffer at 10.times.concentration comprised 0.25 M Tris
HCl pH 7.5, 0.25 M Tris HCl pH 8.0, 0.7 M potassium chloride, 50 mM
spermidine HCl, 5 mM EDTA, and 2.5 mg/ml BSA. Note that attP0 and
attP2 contained the P1 and H1 domains. Integrase (1.5 .mu.l of 435
ng/.mu.l) and IHF (1.5 .mu.l of 16 ng/.mu.l in 1.times.Integrase
buffer) were mixed with 13.5 .mu.l of 1.times.Int buffer to make
the recombinase mixture.
[0340] Two 8 .mu.l reactions were assembled. Reaction A contained
300 ng pEZC6701 plasmid and 2 .mu.l of recombinase mixture in
1.times.Integrase buffer. Reaction B contained 300 ng pEZC5601, 300
ng pEZC6701, and 2 .mu.l of recombinase mixture in 1.times.
Integrase buffer. Both reactions were incubated at 25.degree. C.
for 45 minutes, then at 70.degree. C. for 5 minutes, and then
cooled. TE buffer (792 .mu.l of 10 mM Tris HCl pH 7.5, 1 mM EDTA)
was added to each reaction, and 1 .mu.l of this diluted reaction
was transformed into DH5.alpha. UltraMax competent E. coli cells
(Life Technologies, Inc., Rockville, Md.). After 1 hour of
expression in non-selective medium, one tenth (100 .mu.l) of each
transformation was spread onto agar plates containing 100 .mu.g/ml
kanamycin.
[0341] After overnight incubation at 37.degree. C., the plate from
reaction A contained 1 colony, while the plate from reaction B
contained 392 colonies. Twelve colonies were picked from the
reaction B plate into rich liquid medium and grown overnight.
Miniprep DNAs prepared from these cultures were run uncut on an
agarose gel and all 12 contained a plasmid of about 3.8 kb. Six of
the miniprep DNAs were cut with restriction enzyme ClaI and run
along with pEZC6701 (the kanamycin resistant parental plasmid) also
cut with ClaI. Plasmid pEZC6701 was cut once with ClaI to give a
fragment of about 3.8 kb. The six miniprep DNAs cut twice with ClaI
to give fragments of about 900 base pairs and about 2900 base
pairs.
[0342] Analysis: Recombination between the attP sites on pEZC6701
and the attB sites on pEZC5601 resulted in the production of two
daughter plasmids, the attL product plasmid (FIG. 10C) (which may
correspond to the Vector Donor DNA or a new Byproduct DNA) that
contained the ampicillin resistance and ccdB genes, and the attR
product plasmid (FIG. 10D) (which may also correspond to the Insert
Donor DNA or a new Product DNA) that contained the kanamycin and
tetracycline resistance genes. Competent E. coli cells that
received the attL product plasmid, the attP parent plasmid
pEZC6701, or recombination intermediates, were killed by the toxic
ccdB gene product. Competent E. coli cells that received the attB
parent plasmid pEZC5601 were killed by the kanamycin selection.
Only competent E. coli cells that received the desired attR product
plasmid, comprising the kanamycin and tetracycline resistance
genes, survived to form colonies. The success of the selection
strategy was indicated by the large number of colonies from the
reaction that contained both parental plasmids, compared to the
reaction that contained only one parental plasmid. The reaction
mechanism predicted that the desired product plasmid would contain
two ClaI restriction sites, one in the kanamycin resistance gene
from the pEZC6701 attP parent plasmid and one in the tetracycline
resistance gene from the pEZC5601 attB parent plasmid. The presence
of the two sites and the sizes of the fragments resulting from the
ClaI digestion confirmed the reaction mechanism.
[0343] Thus, the present invention relates to reversal of the
recombination reaction shown in FIG. 1, in which the Product DNA
and Byproduct DNA may be combined to produce the Insert Donor DNA
and the Vector Donor DNA. Additionally, the invention provides for
subcloning recombinations, in which a Product DNA (produced
according to FIG. 1) may be combined with a new Vector Donor DNA to
produce a new Product DNA (in a different Vector background) and a
new Byproduct.
Example 8
Subcloning of Linearized Fragments
[0344] Plasmid pEZC7102 (FIG. 11A), the attP parent plasmid (which
may correspond to the Vector Donor DNA), contained segments attP1,
origin of replication, kanamycin resistance, attP3, chloramphenicol
resistance, and the toxic gene ccdb, and in the experiment
described here was supercoiled.
[0345] Plasmid pEZC7501 (FIG. 11B), the attB parent plasmid (which
may correspond to the Insert Donor DNA or the Product DNA),
contained the GFP gene cloned between attB 1 and attB3 sites in a
vector that comprised the functional domains of pCMVSPORT2.0 (Life
Technologies, Inc.). The attP sites contained the P1 and H1
domains. Plasmid pEZC7501 was used uncut, or was linearized within
the ampicillin resistance gene with Scal, or was cut with XbaI and
SalI, to yield a fragment comprising the SalI end, 22bp, the attB1
site, the GFP gene, the attB3 site, and 14 bp to the XbaI end:
15 SalI end -- 22 bp -- attB1 -- GFP -- attB3 -- 14 bp -- XbaI
end
[0346] Reactions (8 .mu.l final volume) contained about 40 ng of
each DNA, 1.times.Int buffer (25 mM Tris HCl pH 7.5, 25 mM Tris HCl
pH 8.0, 70 mM KCl, 5 mM spermidine HCl, 0.5 mM EDTA, and 0.25 mg/ml
BSA), 12.5% glycerol, 8 ng IHF, and 43 ng lambda integrase.
Reactions were incubated at 25.degree. C. for 45 minutes, then at
70.degree. C. for 5 minutes, and then cooled. Duplicate 1 .mu.l
aliquots of each reaction were transformed into DH5.alpha. UltraMax
cells and plated in duplicate on kanamycin agar plates.
[0347] The reaction that contained only (supercoiled) pEZC7102 gave
an average of 2 colonies (range 1 to 4). The reaction that
contained both pEZC7102 and supercoiled pEZC7501 gave an average of
612 colonies (range 482-762). The reaction that contained pEZC7102
and linear (ScaI-cut) pEZC7501 gave an average of 360 colonies
(range 127-605). The reaction that contained pEZC7102 and the GFP
gene on a fragment with attB sites and 22 bp and 14 bp beyond the
attB sites (pEZC7501 cut with SalI and XbaI) gave an average of 274
colonies (range 243-308).
[0348] Miniprep DNAs were prepared from 4 colonies from the
pEZC7102.times.supercoiled pEZC7510 reaction, and from 10 colonies
from the pEZC7102.times.pEZC7501/SalI+XbaI reaction. All 14 DNAs
were run uncut on an agarose gel, and the 10 DNAs from the
pEZC7102.times.pEZC7501- /SalI+XbaI reaction were cut with a
mixture of NcoI and PstI and run on an agarose gel. All the uncut
plasmids were about 2.8 kb in size. All ten plasmids cut with the
mixture of NcoI and PstI gave fragments of about 700 and 2100
bp.
[0349] The results are presented in Table 8:
16TABLE 8 Colonies Uncut Fragment (average product sizes, attP attB
of 4 Minipreps plasmid Nco + Parent Parent plates) done size Pst
digest sc 7102 -- 2 -- -- -- sc 7102 sc 7501 612 4 2.8 kb -- sc
7102 7501/ScaI 360 -- -- -- sc 7102 7501/Sa1I + 274 10 2.8 kb ca.
2100 bp, XbaI 700 bp
[0350] Analysis: It was expected that the integrative reaction
between the attB sites on plasmid pEZC7501 and the attP sites on
plasmid pEZC7102 would produce the attL product plasmid (FIG. 11C)
(corresponding to the Insert Donor DNA) containing the GFP segment
from pEZC7501, and the kanamycin--origin segment from pEZC7102. The
presence of the toxic gene ccdB on the attP parent plasmid pEZC7102
(corresponding to the Byproduct DNA) was predicted to kill all the
cells that received this plasmid. The large increase in the number
of colonies when pEZC7501 was present indicated that the desired
reaction was occurring, and that the efficiency of the reaction was
adequate even if the attB parent plasmid (corresponding to the
Product DNA) was linear (Scal cut), or if the attB sites and the
GFP gene were present an a fragment that contained little
additional sequence beyond the attB sites.
[0351] These results show that linear fragments can be suitably
subcloned into a different vector by the method of the
invention.
Example 9
Cloning Long PCR Fragments
[0352] A PCR product was designed to have an attB0 (wild type) site
at one end and a loxP site at the other end. The rationale was that
the attP0.times.attB0 reaction would go well with the attB0
molecule (the PCR product) linear, (since it involves a normal
lambda integration reaction), and that the loxP.times.loxP excision
from the cointegrate would also be efficient (the unimolecular
excision reaction is efficient, the bimolecular integration
reaction is inefficient with Cre).
[0353] The sequence of the attB-containing PCR primer was 5_-TCC
GTT GAA GCC TGC TTT TTT ATA CTA ACT TGA GCG AAG CCT CGG GGT CAG CAT
AAG G-3' (SEQ ID NO:31). The sequence of the loxp primer was 5'-CCA
ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTA TTG CCC CTT GGT GAC ATA
CTC G-3' (SEQ ID NO:32). These primers amplify a part of the human
myosin heavy chain. Polymerase chain reactions were performed using
ELONGASE.TM. and K562 human DNA as template. Polymerase chain
reactions were performed as follows. Reactions (50 microliters)
contained 100 ng K562 human DNA (Life Technologies, Inc.), 0.2
.mu.M of each primer, and 0.2 mM of each dNTP, in ELONGASE.TM.
SuperMix (Life Technologies, Inc.). Reactions in thin wall tubes
under mineral oil were denatured at 94.degree. C. for 1 minute,
then cycled 35 times at 94_C for 30 seconds, 65.degree. C. for 30
seconds, and 68.degree. C. for 8 minutes 30 seconds. Following
thermal cycling, reactions were maintained at 4.degree. C. The 5.2
kb PCR product (FIG. 9A) was gel purified.
[0354] Plasmid pEZC1202 (FIG. 9B) contained a wild-type attP site,
a chloramphenicol resistance gene, a gene encoding the tet
repressor, a wild-type loxP site, an origin of replication, and a
tet operator/promoter transcribing and controlling the
transcription of a kanamycin resistance gene. This plasmid
conferred chloramphenicol resistance but not kanamycin resistance,
because the tet repressor made by one element of the plasmid kept
the kanamycin resistance gene turned off. The pEZC1202 DNA used in
this experiment was a miniprep whose concentration was estimated to
be about 50 ng per microliter.
[0355] About 40 ng of the gel purified 5.2 kb PCR product were
included in a 10 .mu.l reaction that contained about 50 ng of
supercoiled pEZC1202, 0.2 units of Cre recombinase, 3.6 ng IHF, and
11 ng of Int in 50 mM Tris HCl pH about 7.8, 16 mM NaCl, 35 mM KCl,
0.25 mM EDTA, 0.375 mg/ml bovine serum albumin. A second reaction
that did not contain the PCR product was included as a control.
After incubating at 27.degree. for 45 min and then 70.degree. for 5
minutes, 1 .mu.l aliquots were transformed into DH5.alpha. UltraMax
competent E. coli cells (Life Technologies, Inc.). One fifth of
each expression mix was plated on agar that contained 100 .mu.g/ml
kanamycin and the plates were incubated overnight at 37.degree. C.
The reaction that contained the PCR product gave 34 colonies, while
the reaction that lacked the PCR product gave 31 colonies. After
the plates sat at room temperature for four days, 26 additional
small colonies were seen on the plate from the positive (+PCR
product) reaction, while only one additional small colony was seen
on the plate from the negative (no PCR product) reaction.
[0356] Twelve of the 26 small colonies were grown overnight in rich
broth (CircleGrow) that contained 25 .mu.g/ml kanamycin, and
miniprep DNAs were prepared from these cultures. All twelve
miniprep plasmids were about 8 kb in size, which corresponded to
the size expected for replacement of the choramphenicol resistance
and tet repressor genes in pEZC1202 with the 5.2 kb PCR product.
The predicted recombinant product is shown in FIG. 9C. Two of these
plasmids were cut with AvaI (8 sites predicted) and BamHI (4 sites
predicted). All the predicted AvaI fragments appeared to be
present. One of the BamH I sites predicted in the PCR product (the
one closest to the attB end) was absent from both minipreps, but
the other BamHI fragments were consistent with the expected
structure of the cloned 5.2 kb PCR product.
[0357] Analysis: The replacement of the choramphenicol resistance
and tet repressor genes in pEZC 1202 with the 5.2 kb PCR product
(part of the human myosin heavy chain) conferred a moderate
resistance of the host E. coli cells to kanamycin, but this
resistance was not sufficient to allow colonies to appear after
overnight incubation. Thus, colonies containing the desired
recombination product grew on kanamycin plates, but were not seen
after overnight incubation, but only after an additional room
temperature incubation. Of the 12 AvaI and BamHI restriction sites
predicted from the nucleotide sequence, 11 were confirmed
experimentally. Thus the following three observations support the
conclusion that the 5.2 kb PCR product was cloned by recombination:
(a) small, slow growing colonies appeared only on the plate from
the reaction that contained the PCR product; (b) the miniprep
plasmids from these colonies were the expected size; and (c)
diagnostic restriction cuts gave the expected fragments (with the
one above noted exception).
Example 10
Cloning of PCR Fragments
[0358] Three sets of pairs of PCR primers (Table 9) were designed
to amplify an 830 bp sequence within plasmid pEZC7501 (FIG. 11B)
comprising: attB 1-GFP-attB3, with or without additional
nucleotides at the outer ends of the 25 bp attB1 and attB3
recombination sites. (Here "outer" refers to the end of the attB
sequence that is not adjacent to the GFP gene sequence.) Primer set
A added 17 nucleotides upstream of attB1 and 15 nucleotides
downstream of attB3; primer set B added 5 and 8 nucleotides to
attB1 and attB3, respectively; and primer set C added no additional
nucleotides to either attB recombination sequence.
[0359] The primer sequences are provided in Table 9:
17TABLE 9 upper GFP A 5'-TCA CTA GTC GGC GGC CCA CA (SEQ ID NO:33)
lower GFP A 5'-GAG CGG CCC CCG CGG ACC AC (SEQ ID NO:34) upper GFP
B 5'-GGC CCA CAA GTT TGT ACA AAA (SEQ ID NO:35) lower GFP B 5'-CCC
CGC GGA CCA CTT TGT AC (SEQ ID NO:36) upper GFP C 5'-ACA AGT TTG
TAC AAA AAA GCA (SEQ ID NO:37) lower GFP C 5'-ACC ACT TTG TAC AAG
AAA GCT (SEQ ID NO:38)
[0360] PCR Reactions
[0361] Primer sets A and C were used first with the following PCR
reactions, in 50 .mu.l, in duplicate. Final concentrations
were:
[0362] 20 mM TrisHCl, pH 8.4
[0363] 50 mM KCl
[0364] 0.2 mM of all four deoxynucleotide triphosphates (dNTPs)
[0365] 400 ng/ml pEZC7501 supercoiled DNA template
[0366] 0.5 .mu.M of each primer
[0367] Recombinant Taq DNA Polymerase (BRL-GIBCO) 100 U/ml
[0368] A duplicate set of the above reactions contained 1 M
betaine.
[0369] The reactions were first heated for to 94.degree. C. for 1',
then cycled 25 times at 94.degree. C. for 45", 55.degree. C. for
30", and 72.degree. C. for 1'.
[0370] The size of the PCR reaction products was analyzed on a 1%
agarose gel in TAE buffer containing 0.5 .mu.g/ml ethidium bromide.
All reactions yielded products of the expected size, thus duplicate
reactions were pooled. As the corresponding reactions with and
without betaine were not significantly different, these also were
pooled, giving a final pooled volume for reactions with primer sets
A and C of 200 .mu.l each.
[0371] Primer set B was then used with identical reactions to those
above performed, except that the reaction volumes were increased to
100 .mu.l. After duplicate reactions and reactions plus and minus
betaine were pooled, the final volume of the reactions with primer
set B was 400 .mu.l.
[0372] The three pooled primer reaction products were stored at
-20.degree. C. for 4 weeks.
[0373] PCR Product Purification
[0374] Each of the three pooled PCR products was extracted once
with an equal volume of a mixture of Tris-buffered phenol, isoamyl
alcohol and chloroform. The aqueous supernatant then was extracted
twice with an equal volume of isobutanol, and the aqueous layer
ethanol precipitated with two volumes of ethanol, 0.1 M sodium
acetate, pH 6.2. The ethanol precipitates were recovered by
centrifugation at 13,000 rpm for 10' at room temperature, and the
supernatant discarded. The dried pellets were dissolved in TE: 100
.mu.l for reactions prepared with primer sets A and C; 200 .mu.l
for the reactions with primer set B.
[0375] To remove PCR primers and extraneous small PCR products, the
PCR products were precipitated with polyethylene glycol (PEG) by
adding 1/2 volume of a solution of 30% PEG 8000 (Sigma), 30 mM
MgCl.sub.2, mixing well, and centrifuging at 13,000 rpm for 10',
all at room temperature. The supernatant was discarded, and the
pellets were dissolved in their previous volume of TE buffer. 1
.mu.l aliquots of each of the three PCR products were checked on a
1% agarose gel to quantitate the recovery, which was estimated to
be over 90%. The concentration of each PCR product was adjusted
using TE to 40 ng/.mu.l.
[0376] Recombination Reaction with the PCR Products of Primer Sets
A, B, and C
[0377] Five 8 .mu.l reactions were assembled in 1.times.Integrase
buffer (25 mM Tris HCl pH 7.5, 25 mM Tris HCl pH 8.0, 80 mM KCl, 5
mM spermidine, 0.5 mM EDTA, 0.25 mg/ml BSA) containing: 40 ng of
pEZC7102 DNA, 2 .quadrature.1 of recombinase mixture (8 ng/.mu.l
IHF, 22 ng/.mu.l Int in 1.times.Int Buffer, 50% glycerol) the
reactions differed by the addition of either the PCR product of
primer set A (reaction A), primer set B (reaction B), or primer set
C (reaction C); the addition of no PCR product (reaction D), or the
addition of 40 ng of pEZC7501 SC (supercoiled) DNA(reaction E) as a
positive control. All reactions were performed in duplicate.
[0378] The reactions were incubated for 45' at 25.degree. C., for
10' at 70.degree. C., then held at 0-5.degree. C. 2 .mu.l aliquots
of each reaction were transformed into Max Efficiency DH5a, in a 50
.mu.l transformation reaction, and following expression in 50C
medium, 1/5 (100 .mu.l) and 4/5 (400 .mu.l) of the reactions were
plated on kanamycin-containing (50 .mu.g/ml) LB culture plates. The
results of the duplicate reactions are shown in Table 10.
18 TABLE 10 Transfection No. Colonies A 100 .mu.l 464, 668 A 400
.mu.l >1000, >1300 B 100 .mu.l 980, 1292 B 400 .mu.l
>3000, >3000 C 100 .mu.l 2, 8 C 400 .mu.l 13, 20 D 100 .mu.l
0, 0 D 400 .mu.l 0, 0 E 100 .mu.l 56, 70
[0379] Analysis of the Colonies Obtained
[0380] Miniprep DNA was prepared from 8 colonies of each of the
Recombination reactions with primer sets A, B or C. The supercoiled
DNA obtained was analyzed on a 1% agarose gel: all eight of
colonies from the recombination products of primer sets A and B
were of the predicted size (2791 bp) for correct recombination
between the PCR products (about 824 bp) and the
attB1-ori-kan.sup.r-attB3 sequence donated by pEZC 7102 (1967 bp).
Three of the eight reaction products of primer set C were of the
predicted size; the other five all were slightly larger than 4
kb.
[0381] Further analysis of the reaction products was performed
using two different restriction enzymes, AvaI and PvuII, each of
which cleaves twice (but at different locations) within the
predicted recombinant product, once within the PCR product sequence
and once within the sequence contributed by pEZC7102. Both of these
enzymes should cleave the intact pEZC7102 recombination partner
plasmid at two sites, to give fragments easily distinguished from
those of the expected recombination products.
[0382] The two restriction enzyme digests yielded the expected
sizes of fragments (2373 and 430 bp for AvaI; 2473 and 330 bp for
PvuII) from the colonies generated from the recombination reactions
with primer sets A and B, as well as for the three colonies from
primer set C that displayed the expected size of supercoiled DNA.
For the other five colonies from primer set C that yielded larger
SC DNA, however, the PvuII digest revealed fragments of approximate
size to those predicted from a digestion of pEZC7102, whereas the
AvaI digest revealed only a single fragment, approximately the size
of linearized pEZC7102 (4161 bp).
[0383] Analysis
[0384] These results indicate that PCR products generated from
templates containing a gene flanked by attB sites can serve as
efficient substrates for the reverse recombination reaction. The
addition of even short DNA sequences to the ends of the attB1 and
attB3 sites or core regions (e.g., 5 bp and 8 bp, respectively, in
primer set B) stimulated this reaction by 100 fold or more.
Surprisingly, reverse recombination reactions with PCR products
containing additional sequence beyond the attB sites appeared in
these reactions to be more efficient recombination partners than
the supercoiled positive control plasmid, pEZC7501.
[0385] All the recombination products were generated faithfully. A
low level of background colonies emerged from the relatively
inefficient recombination reactions with primer set C, which lacked
additional sequence beyond the 25 bp attB sites. This background
appeared to be due to a largely intact pEZC7102 (which encodes
kanamycin resistance) lacking an active ccdB death gene, allowing
it to survive. Consistent with this interpretation is that one of
the two restriction sites for AvaI in this plasmid was also
altered. One of the AvaI sites is present within the ccdB region of
pEZC7102. It is likely therefore that the alteration of this site
was secondary to mutational inactivation of the ccdB gene.
Example 11
Further Cloning of PCR Fragments
[0386] Two sets of 6 primers for preparing PCR products from the
plasmid pBR322 as template were used. One set (Table 11) anneals to
sequences flanking the TetR gene, including the TetR promoter. The
other set (Table 12) anneals to sequences flanking the AmpR gene,
including its promoter. The "tet" and "amp" primers used contain no
attB sequences, only sequences inherent to the pBR322 plasmid; the
"attB" primers contain, in addition to the pBR322 sequences, the 25
bp of attB 1 or attB3 sequences; the "attB+4" primers contain the
pBR322-specific sequences, plus the 25 bp attB 1 or attB3
sequences, each with four Gs at the outer end. (Here "outer" refers
to the end of the attB sequence not adjacent to the
template-specific primer sequence.)
[0387] Preparation of pBR322 Template
[0388] To improve the efficiency of the PCR reaction, the
supercoiled pBR322 DNA was linearized by incubating 3.5 .mu.g of
Suerpcoiled (SC) pBR322 DNA in a 200 .mu.l reaction with 15 units
of the restriction enzyme NdeI and final concentration of 50 mM
Tris-HCl, pH8.0, 10 mM MgCl.sub.2, and 50 mM NaCl, for one hour at
37.degree. C.
[0389] The digested pBR322 DNA was extracted once with phenol,
isoamyl alcohol, and chloroform, extracted twice with isobutanol,
and precipitated by adding two volumes of ethanol plus 0.15M sodium
acetate. The precipitate was washed once with 100% ethanol, dried,
then dissolved in TE buffer. Recovery of DNA, quantitated on a 1%
agarose gel in TAE buffer, 0.5 .quadrature.g/ml ethdium bromide,
was estimated as greater than 80%.
19TABLE 11 SEQ ID tet Primer Primer Sequence NO: tet-L AAT TCT CAT
GTT TGA GAG CTT 48 ATC tet-R CGA TGG ATA TGT TCT GCC AAG 49
attB1-tetL ACAAG TTTGTA CAAAAA AGCA GGC- 50 TAAT TCT CAT GTT TGA
CAG CTT ATC attB3-tetR ACCAC TTTGTA CAAGAA AGCT GGG- 51 TCGA TGG
ATA TGT TCT GCC AAG attB1 + 4-tetL GGGG ACAAG TTTGTA CAAAAA AGC- 52
AGGCT AAT TCT CAT GTT TGA CAG CTTATC attB3 + 4-tetR GGGG ACCAC
TTTGTA CAAGAA AGC- 53 TGGGT CGA TGG ATA TGT TCT GCC AAG
[0390]
20TABLE 12 amp SEQ ID Primer Primer Sequence NO: amp-L AAT ACA TTC
AAA TAT GTA TCC GC 54 amp-R TTA CCA ATG CTT AAT CAG TGA G 55 attB1-
ACAAG TTTGTA CAAAAA AGCA GGCT- 56 ampL AAT ACA TTC AAA TAT GTA TCC
GC attB3- ACCAC TTTGTA CAAGAA AGCT GGGT- 57 ampR TTA CCA ATG CTT
AAT CAG TGA G attB1 + GGGG ACAAG TTTGTA CAAAAA AGCA- 58 4-ampL GGCT
AAT ACA TTC AAA TAT GTA TCC- GC attB3 + GGGG ACCAC TTTGTA CAAGAA
AGCT- 59 4-ampR GGGT TTA CCA ATG CTT AAT CAG TGAG
[0391] PCR Amplification of Tet and Amp Gene Sequences
[0392] Six PCR reactions were performed, in 100 .mu.l, consisting
of 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl.sub.2, 0.2 mM
dNTPs, 2 ng linearized pBR322, 2.5 units of Taq DNA polymerase
(GIBCO-BRL), and 0.5 .mu.M of each pair of PCR primers listed in
Tables 3 and 4. The reactions were first heated to 94 C for 3';
then subjected to 25 cycles of 94.degree. C. for 45 seconds,
55.degree. C. for 30 seconds, and 72.degree. C. for 1 minute. Based
on 1% agarose gel analysis, all the reactions generated products of
the expected size, in reasonable yields.
[0393] Purification of PCR Products
[0394] The products from duplicate reactions were pooled; extracted
with an equal volume of phenol, isoamyl alcohol, and chloroform;
extracted twice with an equal volume of isobutanol; and
precipitated with two volumes of ethanol, as above. The six
precipitates were washed once with 100% ethanol, dried and
dissolved in 100 .mu.l TE. 1 .mu.l aliquots were taken for gel
analysis of the product before PEG precipitation.
[0395] To each tube was added 50 .mu.l of 30% PEG 8000, 30 mM
MgCl.sub.2. The solution was mixed well and centrifuged at 13,000
rpm for 10', at room temperature. The supernatant was carefully
removed, and the precipitate dissolved in 100 .mu.l TE. Recovery
was quantitated on a 1% agarose and estimated to be over 90%. The
gel analysis also revealed that nucleic acid products smaller than
about 300 nucleotides had been effectively removed by the PEG
precipitation step.
[0396] Recombination Reactions
[0397] Seven recombination reactions were performed, each in a
total volume of 8 .mu.l, containing 1.times.integrase buffer, 40 ng
pEZC7102 (FIG. 11A), and 2 .mu.l recombinase mixture (see above,
Example 10). Each of the reactions also contained approximately 40
ng of one of the six above PCR products or, as a positive control,
40 ng of pEZC7501 (FIG. 11B). The amp and tet PCR products with
attB sites at their termini are shown in FIGS. 12A and 12B. The
reactions were incubated at 25.degree. C. for 45', at 70.degree. C.
for 10', then held at 0-5.degree. C. for 1-2 hours until used to
transform E. coli.
[0398] E. coli Transformation with Recombination Reaction
Products
[0399] 1 .mu.l of each of the recombination reactions was
transformed into Max Efficiency DH5.alpha. in a 50
.mu.transformation reaction, and following expression in S0C
medium, 1/5 (100 .mu.l) and 4/5 (400 .mu.l) of each reaction were
plated on culture plates containing 50 .mu.g/ml kanamycin. The
plates were incubated overnight and colonies were counted. The
number of colonies obtained from each set of duplicate reactions
are displayed in Table 13:
21 TABLE 13 Recombination Reactions No. Colonies tet 100 (100
.mu.l) 6, 10 tet 400 (400 .mu.l) 27, 32 attB-tet 100 9, 6 attB-tet
400 27, 36 attB + 4-tet 100 824, 1064 attB + 4-tet 400 >2000,
>4000 amp 100 7, 13 amp 400 59, 65 attB-amp 100 18, 22 attB-amp
400 66, 66 attB + 4-amp 100 3020, 3540 attB + 4-amp 400 >5000,
>5000 pEZC7501 100 320, 394 pEZC7501 400 1188, 1400
[0400] Analysis of the Colonies Obtained
[0401] As a rapid phenotypic screen, 10 of the colonies from the
tet EZC reactions and 33 of the colonies from the attB+4-tet EZC
reactions were streaked onto an LB culture plate containing
tetracycline (15 .mu.g/ml). As a control for the potency of the
tetracycline, 3 colonies of pUC19-transformed cells, lacking a TetR
gene, were also streaked onto the plate. All colonies from the
attB+4-tet EZC reactions grew well; colonies from the tet EZC
reactions grew only very slightly, and the pUC19 colonies grew not
at all.
[0402] Analogous results were obtained by streaking colonies from
the amp PCR reactions on culture plates containing ampicillin (100
.mu.g/ml). All 21 colonies generated from the attB+4-amp
recombination reactions grew well, whereas only one of 13 colonies
from the attB-amp reactions grew in the presence of ampicillin. No
growth was seen with any of the 15 colonies from the recombination
reaction with amp PCR products.
[0403] To characterize plasmid DNA, eight colonies generated from
the six EZC reactions with PCR products were picked into LB broth
containing 50 .mu.g/ml kanamycin and grown overnight at 37.degree.
C. Miniprep DNA was prepared from 0.9 ml of each culture, and the
size of the supercoiled DNA was analyzed on a 1% agarose gel in TAE
buffer containing 0.5 .mu.g/ml ethidium bromide. The results are
displayed in Table 14. The predicted structures of the
recombination products are shown in FIG. 12C and 12D.
22TABLE 14 Recombination Number with Reactions DNA Predicted Size
(bp) Predicted Size tet SC 3386 0/8 (supercoiled) attB-tet SC 3386
1/8 attB + 4-tet SC 3386 7/7 AvaI + Bam 485, 2901 3/3 amp SC 2931
0/8 attB-amp SC 2931 3/8 attB + 4-amp SC 2931 8/8 Pst 429, 2502
3/3
[0404] Analysis
[0405] These results, based on the amplification of two different
gene sequences, tet and amp, within the plasmid pBR322 clearly
demonstrate that PCR products generated using primers containing
the 25 bp attB1 and attB3 recombination sequence serve as highly
efficient substrates for the recombination reaction. Addition of a
short sequence to the outside of each 25 bp attB site stimulates
the recombination reaction by over 100 fold, as also observed in
the experiments of Example 10. Also similar to Example 10, the
efficiency of the recombination reactions using linear PCR products
with attB sites exceeded the efficiency obtained with the positive
control SC DNA plasmid, pEZC7501.
[0406] Further, a high percentage of the reaction products are as
predicted, since all 33 colonies tested from the attB+4-tet
reactions displayed functional tetracycline resistance, and all 21
of the colonies from the attB+4-amp reactions displayed ampicillin
resistance. All 16 of the miniprep DNAs, examined from the
recombination reactions of either attB+4-tet or attB+4-amp PCR
products with pEZC7102, generated supercoiled DNA and restriction
digest fragments of the correct sizes.
Example 12
Use of Topoisomerase to Stimulate Recombination
[0407] The stimulation of the recombination reaction by making one
or the parental plasmids linear was not expected. If the
stimulation resulted from relief of some conformation constraint
arising during the two recombination reactions (formation of the
Cointegrate and resolution to the two daughter molecules), then
unwinding of the plasmids with a topoisomerase might also be
stimulatory when one or both parental plasmids were circular.
[0408] The Insert Donor was pEZC2901 (FIG. 7A), and the Vector
Donor was pECZ3101 (FIG. 7B). A portion of pEZC3101 was linearized
with Mlu I. 20 ng of pEZC2901 and/or pECZ3101 were used in each 10
.quadrature.1 reaction (29 ng Int, 2.9 ng Xis, 5.4 ng IHF in 50 mM
Tris HCl pH about 7.8, 16.5 mM NaCl, 35 mM KCl, 5 mM spermidine,
0.375 mg/ml BSA, 0.25 mM EDTA, 2% glycerol). Topoisomerase I (from
calf Thymus; Life Technologes, Inc.) was diluted from 15
units/.mu.l to the concentrations indicated in Table 15 in
1.times.EZC buffer.
23TABLE 15 1 2 3 4 5 6 7 8 9 10 Circular 3101 2 2 2 2 2 Linear 3101
2 2 2 2 2 Circular 2901 2 2 2 2 2 2 2 2 Recombinase 2 2 2 2 2 2 2 2
2 2 TE 2 2 Topoisomerase, 1:60 2 2 Topoisomerase, 1:20 2 2
Topoisomerase, 1:6 2 2 3 .times. Buffer 2 2 2 2 2 2 2 2 2 2 1
.times. Buffer 2 2 2 2
[0409] These reactions were assembled in the following order:
buffer; TE; DNAs; Clonase; Topoisomerase. The reactions were
incubated at 22.degree.-28.degree. for 45 minutes, then at
70.degree. for 5 minutes. 1 .mu.l aliquots were transformed into
UltraMax DH5.alpha. competent E. coli (Life Technologies, Inc.).
Following expression, aliquots were plated on 100 .mu.g/ml
kanamycin and incubated at 30.degree. for 48 hours. Results: see
Table 16.
24TABLE 16 Reaction Vector Insert Recom- # Colonies Donor Donor
binase Topoisomerase 1 0 linear 3101 -- + -- 2 245 linear 3101
circular + -- 2901 3 221 linear 3101 circular + 0.5 units 2901 4
290 linear 3101 circular + 1.6 units 2901 5 355 linear 3101
circular + 5 units 2901 6 0 circular 3101 + -- 7 23 circular 3101
circular + -- 2901 8 209 circular 3101 circular + 0.5 units 2901 9
119 circular 3101 circular + 1.6 units 2901 10 195 circular 3101
circular + 5 units 2901
[0410] Analysis
[0411] Linearizing the Vector Donor increased the number of
colonies about 10 fold (reaction 2 vs. reaction 7). Addition of 0.5
to 5 units of topoisomerase I to reactions containing circular
Insert Donor and linear Vector Donor had little or no effect on the
number of colonies (reaction 2 compared to reactions 3, 4, and 5;
maximum 1.4 fold). In contrast, if both parental plasmids were
circular (reaction 7-10), the addition of topoisomerase stimulated
the number of colonies 5 to 9 fold. Thus addition of topoisomerase
I to reactions in which both parental plasmids were circular
stimulated the recombination reactions nearly as much as
linearizing the Vector Donor parent. Topoisomerase I was active
when used in combination with the three recombination proteins, in
recombination buffer. The addition of topoisomerase I to the
recombination reaction relieves the necessity to linearize the
Vector Donor to achieve stimulation of the recombination
reactions.
[0412] Having now fully described the present invention in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious to one of ordinary skill in
the art that the same can be performed by modifying or changing the
invention within a wide and equivalent range of conditions,
formulations and other parameters without affecting the scope of
the invention or any specific embodiment thereof, and that such
modifications or changes are intended to be encompassed within the
scope of the appended claims.
[0413] All publications, patents and patent applications mentioned
in this specification are indicative of the level of skill of those
skilled in the art to which this invention pertains, and are herein
incorporated by reference to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporated by reference.
Sequence CWU 1
1
60 1 25 DNA Unknown OTHER 18 "n" may be any nucleotide 1 rkycwgcttt
yktrtacnaa stsgb 25 2 25 DNA Unknown OTHER 18 "n" may be any
nucleotide 2 agccwgcttt yktrtacnaa ctsgb 25 3 25 DNA Unknown OTHER
18 "n" may be any nucleotide 3 gttcagcttt cktrtacnaa ctsgb 25 4 25
DNA Unknown OTHER 18 "n" may be any nucleotide 4 agccwgcttt
cktrtacnaa gtsgb 25 5 25 DNA Unknown OTHER 18 "n" may be any
nucleotide 5 gttcagcttt yktrtacnaa gtsgb 25 6 25 DNA Unknown
Description of Unknown Organism recombination products 6 agcctgcttt
tttgtacaaa cttgt 25 7 25 DNA Unknown Description of Unknown
Organism recombination products 7 agcctgcttt cttgtacaaa cttgt 25 8
25 DNA Unknown Description of Unknown Organism recombination
products 8 acccagcttt cttgtacaaa gtggt 25 9 25 DNA Unknown
Description of Unknown Organism recombination products 9 gttcagcttt
tttgtacaaa cttgt 25 10 25 DNA Unknown Description of Unknown
Organism recombination products 10 gttcagcttt cttgtacaaa cttgt 25
11 25 DNA Unknown Description of Unknown Organism recombination
products 11 gttcagcttt cttgtacaaa gtggt 25 12 25 DNA Unknown
Description of Unknown Organism recombination products 12
agcctgcttt tttgtacaaa gttgg 25 13 25 DNA Unknown Description of
Unknown Organism recombination products 13 agcctgcttt cttgtacaaa
gttgg 25 14 25 DNA Unknown Description of Unknown Organism
recombination products 14 acccagcttt cttgtacaaa gttgg 25 15 25 DNA
Unknown Description of Unknown Organism recombination products 15
gttcagcttt tttgtacaaa gttgg 25 16 25 DNA Unknown Description of
Unknown Organism recombination products 16 gttcagcttt cttgtacaaa
gttgg 25 17 39 DNA Unknown Description of Unknown Organism
recombination products 17 ccaccacaaa cgcgtccatg gaattacact
ttaatttag 39 18 39 DNA Unknown Description of Unknown Organism
recombination products 18 ccaccacaag tcgacgcatg ccgacagcct
tccaaatgt 39 19 46 DNA Artificial Sequence Description of
Artificial Sequence synthetic oligonucleotide 19 ggccgattac
gatatcccaa cgaccgaaaa cctgtatttt cagggt 46 20 30 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 20 caggttttcg gtcgttggga tatcgtaatc 30 21 47 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 21 ggccagatta cgatatccca acgaccgaaa acctgtattt
tcagggt 47 22 31 DNA Artificial Sequence Description of Artificial
Sequence synthetic oligonucleotide 22 caggttttcg gtcgttggga
tatcgtaatc t 31 23 48 DNA Artificial Sequence Description of
Artificial Sequence synthetic oligonucleotide 23 ggccaagatt
acgatatccc aacgaccgaa aacctgtatt ttcagggt 48 24 32 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 24 caggttttcg gtcgttggga tatcgtaatc tt 32 25 15 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 25 accgtttacg tggac 15 26 31 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 26 tcgagtccac gtaaacggtt cccacttatt a 31 27 39 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 27 uauuuucagg guatggagaa aaaaatcact ggatatacc 39 28
33 DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 28 ucccacuuau uacgccccgc cctgccactc atc
33 29 33 DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 29 uauuuucagg guatgcctgt tctggaaaac cgg
33 30 34 DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 30 ucccacuuau uatttcagcc ccagggcggc tttc
34 31 58 DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 31 tccgttgaag cctgcttttt tatactaact
tgagcgaagc ctcggggtca gcataagg 58 32 58 DNA Artificial Sequence
Description of Artificial Sequence synthetic oligonucleotide 32
ccaataactt cgtatagcat acattatacg aagttattgc cccttggtga catactcg 58
33 20 DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 33 tcactagtcg gcggcccaca 20 34 20 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 34 gagcggcccc cgcggaccac 20 35 21 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 35 ggcccacaag tttgtacaaa a 21 36 20 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 36 ccccgcggac cactttgtac 20 37 21 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 37 acaagtttgt acaaaaaagc a 21 38 21 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 38 accactttgt acaagaaagc t 21 39 25 DNA Unknown
Description of Unknown Organism recombination products 39
rbycwgcttt yttrtacwaa stkgd 25 40 25 DNA Unknown Description of
Unknown Organism recombination products 40 asccwgcttt yttrtacwaa
stkgw 25 41 25 DNA Unknown Description of Unknown Organism
recombination products 41 asccwgcttt yttrtacwaa gttgg 25 42 25 DNA
Unknown Description of Unknown Organism recombination products 42
gttcagcttt yttrtacwaa stkgw 25 43 25 DNA Unknown Description of
Unknown Organism recombination products 43 gttcagcttt yttrtacwaa
gttgg 25 44 25 DNA Unknown Description of Unknown Organism
recombination products 44 tcggacgaaa aaatatgatt gaact 25 45 25 DNA
Unknown Description of Unknown Organism recombination products 45
tcggacgaaa aaacatgttt gaaca 25 46 25 DNA Unknown Description of
Unknown Organism recombination products 46 tcggacgaaa gaacatgttt
gaaca 25 47 25 DNA Unknown Description of Unknown Organism
recombination products 47 tgggtcgaaa gaacatgttt cacca 25 48 24 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 48 aattctcatg tttgacagct tatc 24 49 21 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 49 cgatggatat gttctgccaa g 21 50 49 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 50 acaagtttgt acaaaaaagc aggctaattc tcatgtttga
cagcttatc 49 51 46 DNA Artificial Sequence Description of
Artificial Sequence synthetic oligonucleotide 51 accactttgt
acaagaaagc tgggtcgatg gatatgttct gccaag 46 52 53 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 52 ggggacaagt ttgtacaaaa aagcaggcta attctcatgt
ttgacagctt atc 53 53 50 DNA Artificial Sequence Description of
Artificial Sequence synthetic oligonucleotide 53 ggggaccact
ttgtacaaga aagctgggtc gatggatatg ttctgccaag 50 54 23 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 54 aatacattca aatatgtatc cgc 23 55 22 DNA
Artificial Sequence Description of Artificial Sequence synthetic
oligonucleotide 55 ttaccaatgc ttaatcagtg ag 22 56 48 DNA Artificial
Sequence Description of Artificial Sequence synthetic
oligonucleotide 56 acaagtttgt acaaaaaagc aggctaatac attcaaatat
gtatccgc 48 57 47 DNA Artificial Sequence Description of Artificial
Sequence synthetic oligonucleotide 57 accactttgt acaagaaagc
tgggtttacc aatgcttaat cagtgag 47 58 52 DNA Artificial Sequence
Description of Artificial Sequence synthetic oligonucleotide 58
ggggacaagt ttgtacaaaa aagcaggcta atacattcaa atatgtatcc gc 52 59 51
DNA Artificial Sequence Description of Artificial Sequence
synthetic oligonucleotide 59 ggggaccact ttgtacaaga aagctgggtt
taccaatgct taatcagtga g 51 60 25 DNA Unknown Description of Unknown
Organism recombination products 60 agcctgcttt tttatactaa cttga
25
* * * * *