U.S. patent application number 10/817560 was filed with the patent office on 2004-09-02 for methods for nucleic acid manipulation.
Invention is credited to Benkovic, Stephen J., Salinas, Frank.
Application Number | 20040171060 10/817560 |
Document ID | / |
Family ID | 23092836 |
Filed Date | 2004-09-02 |
United States Patent
Application |
20040171060 |
Kind Code |
A1 |
Benkovic, Stephen J. ; et
al. |
September 2, 2004 |
Methods for nucleic acid manipulation
Abstract
A method for replicating and amplifying a target nucleic acid
sequence is described. A method of the invention involves the
formation of a recombination intermediate without the prior
denaturing of a nucleic acid duplex through the use of a
recombination factor. The recombination intermediate is treated
with a high fidelity polymerase to permit the replication and
amplification of the target nucleic acid sequence. In preferred
embodiments, the polymerase comprises a polymerase holoenzyme. In
further preferred embodiments, the recombination factor is
bacteriophage T4 UvsX protein or homologs from other species, and
the polymerase holoenzyme comprises a polymerase enzyme, a clamp
protein and a clamp loader protein, derived from viral,
bacteriophage, prokaryotic, archaebacterial, or eukaryotic
systems.
Inventors: |
Benkovic, Stephen J.; (State
College, PA) ; Salinas, Frank; (Wheaton, IL) |
Correspondence
Address: |
WELSH & KATZ, LTD
120 S RIVERSIDE PLAZA
22ND FLOOR
CHICAGO
IL
60606
US
|
Family ID: |
23092836 |
Appl. No.: |
10/817560 |
Filed: |
April 2, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10817560 |
Apr 2, 2004 |
|
|
|
10125973 |
Apr 19, 2002 |
|
|
|
60285127 |
Apr 20, 2001 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/6.12;
435/91.2 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12N 15/1027 20130101; C12Q 1/6806 20130101; C12Q 1/6844 20130101;
C12Q 2521/507 20130101; C12Q 2521/513 20130101; C12Q 2527/125
20130101; C12Q 1/6844 20130101; C12P 19/34 20130101; C12Q 1/6844
20130101; C12Q 1/686 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Goverment Interests
[0002] This invention was made with United States Government
support in the form of a grant from the National Institute of
Health, Grant No. GM13306. The United States Government has certain
rights in this invention.
Claims
What is claimed:
1. A method for replicating and amplifying a target nucleic acid
sequence comprising: a) reacting a primer that is complementary to
a target sequence within a nucleic acid duplex with the nucleic
acid duplex in the presence of a recombination factor to form a
recombination intermediate, without previously denaturing said
nucleic acid duplex; b) admixing a polymerase with said
recombination intermediate to form a polymerase complex, whereby
the polymerase replicates the target sequence.
2. The method of claim 1 wherein said polymerase is a polymerase
holoenzyme.
3. The method of claim 2 wherein said polymerase holoenzyme
comprises a polymerase enzyme, a clamp protein, and a clamp loader
protein.
4. The method of claim 3 wherein said polymerase enzyme, said clamp
protein and said clamp loader are obtained from bacteriophage
T4.
5. The method of claim 1 wherein said recombination factor is
bacteriophage T4 UvsX protein.
6. The method of claim 4 wherein said polymerase is bacteriophage
T4 gene product 43 polymerase, said clamp protein is bacteriophage
T4 gene product 45 clamp protein and said clamp loader is
bacteriophage T4 gene product 44/gene product 62 clamp loader
complex.
7. The method of claim 1 wherein said recombination factor is E.
coli Rec A protein.
8. The method of claim 1 wherein said recombination factor is
Rad51
9. The method of claim 8 wherein said Rad51 is derived from
yeast.
10. The method of claim 8 wherein said Rad51 is derived from a
eukaryote.
11. The method of claim 1 wherein said primer is designed to anneal
at complimentary sites flanking said target nucleic acid
sequence.
12. The method of claim 2 wherein said polymerase holoenzyme
complex comprises a viral, bacteriophage, eukaryote archaebacteria,
or prokaryote polymerase holoenzyme complex.
13. The method of claim 12 wherein said bacteriophage is T4
bacteriophage T4, and said polymerase holoenzyme complex includes a
bacteriophage T4 gene product 43 polymerase.
14. The method of claim 12 wherein said bacteriophage is
bacteriophage is T4, and said polymerase holoenzyme complex
includes a bacteriophage T4 gene product 45 clamp protein.
15. The method of claim 12 wherein said prokaryote is E. coli and
said polymerase holoenzyme complex includes DNA polymerase III
holoenzyme.
16. The method of claim 12 wherein said eukaryote is yeast and said
polymerase holoenzyme complex includes DNA polymerase delta.
17. The method of claim 12 wherein said eukaryote is yeast and said
polymerase holoenzyme complex includes DNA polymerase epsilon.
18. The method of claim 1 wherein a single stranded binding protein
is used to facilitate downstream strand displacement synthesis by
said polymerase.
19. The method of claim 18 wherein said single stranded binding
protein is bacteriophage T4 gene product 32.
20. The method of claim 1 wherein a single stranded binding protein
is used to destabilize the helix at or near the point of the primer
template junction.
21. A method for reproducing and amplifying a target nucleic acid
sequence within a nucleic acid duplex at a temperature below about
45.degree. C. comprising: a) catalytically inserting a primer into
said target nucleic acid sequence without previously denaturing
said nucleic acid duplex in whole or in part to form a
recombination intermediate; b) admixing said recombination
intermediate with a polymerase to form a polymerase complex,
whereby said polymerase replicates the target nucleic acid
sequence.
22. The method of claim 21 wherein said primer is pretreated with a
single stranded nucleic acid binding protein.
23. The method of claim 21 wherein said primer be pretreated with a
recombination factor.
24. The method of claim 23 wherein said recombination factor is
bacteriophage T4 UvsX.
25. The method of claim 21 wherein said polymerase is bacteriophage
T4 gene product 43 DNA polymerase.
26. The method of claims 1 or 21 wherein a helicase is used to
facilitate replication by said polymerase.
27. The method of claim 26 where said helicase is bacteriophage T4
gene product 41 DNA helicase.
28. The method of claim 26 wherein said helicase is bacteriophage
T4 replicative helicase complex, comprising bacteriophage T4 gp 41
and gp 59.
29. The method of claims 1 or 23 wherein an accessory factor is
used to stabilize the recombination factor.
30. The method of claim 29 wherein said accessory factor is
bacteriophage T4 UvsY.
31. The method of claim 1 or 21 wherein a combination of a helicase
and an accessory factor is used.
32. The method of claim 21 wherein said helicase is bacteriophage
T4 gene product 41 and said accessory factor is bacteriophage T4
UvsY.
33. A method of creating a library of nucleic acid sequences
comprising: a) incubating a first double-stranded nucleic acid with
an enzyme with exonuclease activity to form a plurality of single
stranded DNA regions having random sizes; b) treating said
plurality of single stranded DNA regions with a recombination
factor to form a plurality of pretreated single stranded DNA
regions; c) adding a second double-stranded nucleic acid to the
plurality of pretreated single stranded DNA regions to form a
plurality of three stranded crossover junctions; d) incubating said
plurality of three stranded crossover junctions with a helicase to
form a plurality of Holliday junctions; and e) resolving said
plurality of Holliday junctions by incubation with an
endonuclease.
34. The method of claim 33 wherein said recombination factor is
bacteriophage T4 UvsX.
35. The method of claim 33 wherein said helicase is bacteriophage
T4 gene products 41 and 59.
36. The method of claim 33 wherein said helicase is bacteriophage
T4 UvsW.
37. The method of claim 33 wherein said endonuclease is
bacteriophage T4 gene product 49.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority of U.S. Provisional
Application Serial No. 60/285,127 filed Apr. 20, 2001.
REFERENCE TO A MICROFICHE APPENDIX
[0003] Not applicable
BACKGROUND OF THE INVENTION
[0004] The present invention is directed towards a process for the
amplification of a target nucleic acid sequence contained in a
larger nucleic acid independent of using a thermocycle or a
thermostable polymerase. Unlike current technologies that employ a
thermocycle and are therefore dependent upon a thermostable
polymerase, the current invention allows for specific primer
template association at a low temperature that will remain constant
over the duration of the reaction.
[0005] A method for the site-specific amplification of a region of
nucleic acid is described. Current amplification technology is
based upon the Polymerase Chain Reaction (PCR). This PCR system can
be thought of as involving three main components. First DNA
oligonucleotides complementary to the flanking ends of the target
sequence are required. These DNA oligonucleotides serve as primers
for the initiation of DNA replication by the second component of
the system, a thermostable DNA dependent DNA polymerase, such as
the Taq polymerase. The use of a thermostable DNA polymerase is
absolutely required in PCR so that the polymerase activity can
survive the third component, the thermal cycle. The thermal cycle
uses high temperatures, usually 95 degrees Celsius, to melt the
target duplex DNA so that a subsequent annealing temperature,
usually in the range of 50-60 degrees Celsius, permits the
annealing of the primers to the appropriate locations flanking the
target DNA. Following the annealing step, the thermal cycle
incorporates a polymerization temperature, usually 72 degrees
Celsius, which is the optimal temperature of polymerization for the
current thermostable polymerases used in PCR.
[0006] The requirement of a thermal cycle to facilitate the
annealing of the primers flanking the target DNA to be amplified
has several drawbacks. Primer annealing temperature is an important
parameter in the success of PCR amplification. The annealing
temperature is characteristic for each oligonucleotide: it is a
function of the length and base composition of the primer as well
as the ionic strength of the reaction buffer. The theoretical
amplification value is never achieved in practice. Several factors
prevent this from occurring, including: competition of
complementary daughter strands with primers for reannealing (i.e.
two daughter strands reannealing results in no amplification); loss
of enzyme activity due to thermal denaturation, especially in the
later cycles; even without thermal denaturation, the amount of
enzyme becomes limiting due to molar target excess in later cycles
(i.e. after 25-30 cycles too many primers need extending); possible
second site primer annealing and non-productive priming. Moreover,
primers must avoid stretches of polybase sequences (e.g. poly dG)
or repeating motifs--these can hybridize with inappropriate
register on the template. Inverted repeat sequences should also be
avoided so as to prevent formation of secondary structure in the
primer, which would prevent hybridization to template.
[0007] An additional drawback is the costly need for temperature
baths, which are required to shift their temperatures up and down
rapidly, and in an automated programmed manner. These are known as
thermal cyclers or PCR machines.
[0008] A further problem with PCR is the lack of fidelity of the
various Polymerases (Table 1) under different conditions. However,
with increasing number of cycles the greater the probability of
generating various artifacts (e.g. mispriming products). It is
unusual to find procedures that have more than 40 cycles. Errors
made by DNA polymerase can affect the extension reaction of PCR
during five distinct steps: (1) the binding of the correct dNTP by
polymerase; (2) the rate of phosphodiester bond formation; (3) the
rate of pyrophosphate release; (4) the continuation of extension
after a misincorporation; and (5) the ability of the enzyme to
adjust to a misincorporated base by providing 3'-to-5' exonuclease
`proofreading` activity. Misincorporation rates for different
polymerases are described in terms of errors per nucleotide
polymerized, and the rate can be greatly affected by many
parameters. Several studies have concluded that different
thermostable DNA polymerases have error rates as high as
2.1.times.10.sup.-4 to 1.6.times.10.sup.-6 errors per nucleotide
per extension (Table 2).
[0009] Another major drawback is that standard PCR protocols can
amplify DNA sequences of 3000 base pairs (3 kb) or less. Efficient
long PCR requires the use of two polymerases: a non-proofreading
polymerase is the main polymerase in the reaction, and a
proofreading polymerase (3' to 5' exo) is present at a lower
concentration. Following the results of Cheng et al. [Cheng, S.,
Fockler, C., Barnes, W., Higuchi, R. Effective amplification of
long targets from cloned inserts and human genomic DNA. Proc. Natl.
Acad. Sci. 91, 5695-5699 (1994)] the Tth enzyme (ABI/Perkin-Elmer)
enzyme has been used as the main-component polymerase and Vent (New
England Biolabs) as the fractional-component polymerase. Other
combinations of proofreading and non-proofreading polymerases are
difficult to employ because different activities in specific buffer
systems limits which combinations of polymerases can be used.
Moreover, all of the problems associated with standard PCR
reactions become even more critical when attempting to amplify
regions of DNA 3 kb or longer.
[0010] The current invention eliminates these problems with
traditional PCR by eliminating the need for a thermal cycle and a
thermostable polymerase in the amplification of a sequence of DNA
embedded within a longer target DNA. The current invention replaces
the thermal cycle required to anneal the primers to the flanking
ends of a target template by utilizing the enzymes active during
homologous recombination, more specifically during homologous
pairing or D-loop formation.
[0011] In bacteriophage T4, DNA replication, as well as being
initiated from specific origins of replication, is also very
efficiently initiated from recombination intermediates. Therefore,
the current invention is directed at a system that primes DNA
replication, in a specific manner, via recombination intermediates
formed at opposite ends of a target sequence embedded within a much
larger sequence. This permits the reaction to be run at room
temperature and therefore permits the use of a non-thermal stable
polymerase. The primary advantage of employing a non-thermostable
polymerase is that several polymerases have been characterized
which have far superior fidelity. Moreover, the characterization of
accessory factors, such as sliding clamp proteins, are known to
increase the length of DNA which can be amplified to entire
genomes. In addition, the utilization of enzymes to deliver the
primers eliminates all of the problems associated with annealing
primers within the context of a thermal cycle mentioned above.
Moreover, the homologous pairing reaction catalyzed by the
bacteriophage T4 proteins is extremely efficient and would
eliminate the problem of mis-priming.
1TABLE 1 Thermostable DNA polymerases and their sources DNA
Polymerase Natural or recombinant Source Taq Natural Thermus
aquaticus Amplitaq .RTM. Recombinant T. aquaticus Amplitaq (Stoffel
Recombinant T. aquaticus fragment) .RTM. Hot Tub .TM. Natural
Thermus flavis Pyrostase .TM. Natural T. flavis Vent .TM.
Recombinant Thermococcus litoralis Deep Vent .TM. Recombinant
Pyrococcus GB-D Tth Recombinant Thermus thermophilus Pfu Natural
Pyrococcus furiosus ULTma .TM. Recombinant Thermotoga maritima
[0012]
2TABLE 2 Properties of DNA polymerases used in PCR Stoffel Deep
Taq/Amplitaq .RTM. fragment Vent .TM. Vent .TM. Pfu Tth ULTma .TM.
95.degree. C. half- 40 min 80 min 400 min 1380 min >120 min 20
min >50 min life 5'3'exo + - - - - + - 3'5'exo - - + + + - +
Extension 75 >50 >80 ? 60 >33 ? rate (nt/sec) RT activity
Weak Weak ? ? ? Yes ? Resulting 3' A 3' A >95% blunt >95%
blunt blunt 3' A blunt Strand - - + + - - - displacement M.W. (kDa)
94 61 ? ? 92 94 70
[0013] Error Rates
[0014] 1. Taq (Thermus aquaticus)
[0015] 1.1.times.10.sup.-4 base substitutions/bp [Tindall, K. R.,
and Kunkel, T. A. (1988) Biochemistry 27, p6008-6013, "Fidelity of
DNA synthesis by the Thermus aquaticus DNA polymerase."]
[0016] 2.4.times.10.sup.-5 frameshift mutations/bp [Tindall and
Kunkel, Id.]
[0017] 2.1.times.10.sup.-4 errors/bp [Keohavong, P., and Thilly, W.
G. (1989) Proc Natl Acad Sci USA 86(23), p9253-9257, "Fidelity of
DNA polymerases in DNA amplification."]
[0018] 7.2.times.10.sup.-5 errors/bp [Ling, L. L., Keohavong, P.,
Dias, C., and Thilly, W. G. (1991) PCR Methods Appl 1(1) p63-69,
"Optimization of the polymerase chain reaction with regard to
fidelity: modified T7, Taq, and Vent DNA polymerases."]
[0019] 8.9.times.10.sup.-5 errors/bp [Cariello, N. F., Swenberg, J.
A., and Skopek, T. R. (1991) Nucleic Acids Res 19(15), p4193-4198,
"Fidelity of Thermococcus Litoralis DNA Polymerase (Vent) in PCR
determined by denaturing gradient gel electrophoresis."]
[0020] 2.0.times.10.sup.-5 errors/bp [Lundberg, K. S., Shoemaker,
D. D., Adams, M. W., Short, J. M., Sorge, J. A., and Mathur, E. J.
(1991) Gene 108(1), p1-6, "High-fidelity amplification using a
thermostable DNA polymerase isolated from Pyrococcus
furiosus."]
[0021] 1.1.times.10.sup.-4 errors/bp [Barnes, W. M. (1992) Gene
112(1), p29-35, "The Fidelity of Taq polymerase catalyzing PCR is
improved by an N-terminal deletion."]
[0022] 2. KlenTaq (Thermus aquaticus, N-terminal deletion
mutant)
[0023] 5.1.times.10.sup.-5 errors/bp [Barnes, W. M. (1992) Gene
112(1), p29-35, "The Fidelity of Taq polymerase catalyzing PCR is
improved by an N-terminal deletion."]
[0024] 3. Vent (Thermococcus litoralis)
[0025] 2.4.times.10.sup.-5 errors/bp [Cariello, N. F., Swenberg, J.
A., and Skopek, T. R. (1991) Nucleic Acids Res 19(15), p4193-4198,
"Fidelity of Thermococcus Litoralis DNA Polymerase (Vent) in PCR
determined by denaturing gradient gel electrophoresis."]
[0026] 4.5.times.10.sup.-5 errors/bp [Ling, L. L., Keohavong, P.,
Dias, C., and Thilly, W. G. (1991) PCR Methods Appl 1(1) p63-69,
"Optimization of the polymerase chain reaction with regard to
fidelity: modified T7, Taq, and Vent DNA polymerases."]
[0027] 5.7.times.10-5 errors/bp [Matilla, P., Korpela, J.,
Tenkanen, T., and Pitkanen, K. (1991) Nucleic Acids Res 19(18),
p4967-4973, "Fidelity of DNA synthesis by the Thermococcus
litoralis DNA polymerase--an extremely heat stable enzyme with
proofreading activity."]
[0028] 4. Vent(exo-) (Thermococcus litoralis)
[0029] 1.9.times.10.sup.-4 errors/bp [Matilla et Id.]
[0030] 5. Deep Vent (Pyrococcus species GB-D)
[0031] No published literature. New England Biolabs claims fidelity
is equal to or greater than that of Vent.
[0032] 6. Deep Vent(exo-)
[0033] No published literature.
[0034] 7. Pfu (Pyrococcus furiosus)
[0035] 1.6.times.10.sup.-6 errors/base [Lundberg, K. S., Shoemaker,
D. D., Adams, M. W., Short, J. M., Sorge, J. A., and Mathur, E. J.
(1991) Gene 108(1), p1-6, "High-fidelity amplification using a
thermostable DNA polymerase isolated from Pyrococcus
furiosus."]
[0036] 8. Replinase (Thermus flavis)
[0037] 1.03.times.10.sup.-4 errors/base [Matilla, P., Korpela, J.,
Tenkanen, T., and Pitkanen, K (1991) Nucleic Acids Res 19(18),
p4967-4973, "Fidelity of DNA synthesis by the Thermococcus
litoralis DNA polymerase--an extremely heat stable enzyme with
proofreading activity."]
BRIEF SUMMARY OF THE INVENTION
[0038] In one aspect, the present invention contemplates a method
for replicating and amplifying a target nucleic acid sequence
comprising reacting a primer that is complementary to a target
sequence within a nucleic acid duplex with the nucleic acid duplex
in the presence of a recombination factor to form a recombination
intermediate, without previously denaturing the nucleic acid
duplex. The recombination intermediate so formed is then admixed
with a polymerase to form a polymerase complex, whereby the
polymerase replicates the target sequence. Preferably, the
polymerase is a polymerase holoenzyme. More preferably, the
polymerase holoenzyme comprises a polymerase enzyme, a clamp
protein, and a clamp loader protein. Although other sources and
materials can be used, it is preferred that the recombination
factor, the polymerase, the clamp protein and clamp loader be
obtained from bacteriophage T4. Thus, the recombination factor is
preferably bacteriophage T4 UvsX protein, the polymerase is
preferably bacteriophage T4 gene product (gp) 43 polymerase, the
clamp protein is preferably bacteriophage T4 gp 45 clamp protein
and the clamp loader is preferably bacteriophage T4 gp44/gp 62
clamp loader complex.
[0039] In one preferred embodiment, the primer is designed to
anneal at complimentary sites flanking the target nucleic acid
sequence. In a further preferred embodiment, the polymerase
holoenzyme complex comprises a viral, bacteriophage, eukaryotic,
archaebacterial, or prokaryotic polymerase holoenzyme complex.
Preferably, the bacteriophage is T4, and the holoenzyme complex
includes the gene product 43 polymerase. Preferably, the
bacteriophage is T4, and the holoenzyme complex includes the gene
product 45 clamp protein.
[0040] In a further aspect, a contemplated method uses a single
stranded binding protein to facilitate downstream strand
displacement synthesis by the polymerase holoenzyme complex. The
single stranded protein is preferably gene product 32 from the T4
bacteriophage system.
[0041] In yet another aspect, a contemplated method uses a single
stranded binding protein to destabilize the helix at or near the
point of the primer template junction.
[0042] In a still further aspect, the present invention
contemplates a method for reproducing and amplifying a target
nucleic acid sequence at a temperature below about 45.degree.
Celsius and comprises catalytically inserting a primer into the
target nucleic acid sequence without previously denaturing the
duplex in whole or in part to form a recombination intermediate.
The recombination intermediate so formed is then admixed with a
polymerase to form a polymerase complex, whereby the polymerase
replicates the target nucleic acid sequence. The primer is
preferably pretreated with single stranded nucleic acid binding
protein. It is also preferred that the primer be pretreated with a
recombination-factor. A preferred recombination factor is
bacteriophage T4 UvsX. A preferred polymerase is gene product 43
DNA polymerase from the bacteriophage T4.
[0043] In a further aspect, an above-contemplated method uses a
helicase to facilitate replication by the polymerase. A preferred
helicase is bacteriophage T4 gene product 41 DNA helicase. A
further preferred helicase is bacteriophage T4 replicative helicase
complex, comprising bacteriophage T4 gp 41 and gp 59.
[0044] In another aspect, a contemplated method uses an accessory
factor to stabilize the recombination factor. A preferred accessory
factor is bacteriophage T4 UvsY. In a still further aspect, a
contemplated method uses a combination of a helicase and an
accessory factor. A preferred helicase is bacteriophage T4 gp41. A
preferred accessory factor is bacteriophage T4 UvsY.
[0045] In yet another aspect, the present invention contemplates a
method of creating a library of nucleic acid sequences. This method
comprises incubating a first double-stranded nucleic acid with an
enzyme with exonuclease activity to form a plurality of single
stranded DNA regions having random sizes. This plurality of single
stranded DNA regions is treated with a recombination factor to form
a plurality of pretreated single stranded DNA regions. A second
double-stranded nucleic acid is then added to the plurality of
pretreated single stranded DNA regions to form a plurality of three
stranded crossover junctions. The plurality of three stranded
crossover junctions is incubated with a helicase to form a
plurality of Holliday junctions. The plurality of Holliday
junctions so formed is resolved by incubation with an endonuclease.
Preferably, the recombination factor is bacteriophage T4 UvsX.
Preferably, the helicase is bacteriophage T4 gene products 41 and
59. A further preferred helicase is bacteriophage T4 UvsW. A
preferred endonuclease is bacteriophage T4 gp 49.
BRIEF DESCRIPTION OF THE DRAWINGS
[0046] In the drawings forming a portion of this disclosure:
[0047] FIG. 1 depicts polymerase holoenzyme complex formation at a
recombination D-loop.
[0048] FIG. 2 depicts a gene amplification system using a method of
the invention.
[0049] FIG. 3 depicts creation of a library of novel recombinant
nucleic acid sequences using a method of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0050] A. Basic Replication and Amplification Process
[0051] In one aspect, a process of the invention comprises treating
a nucleic acid, such as RNA or DNA, with an oligonucleotide primer,
which primer is complementary to a predetermined target sequence
within that nucleic acid. Preferably, the nucleic acid is double
stranded, such as in the form of a DNA heteroduplex. A process of
the invention contemplates reacting separate complementary strands
of a nucleic acid heteroduplex with a molar excess of two
oligonucleotide primers. Significantly, this treatment does not
require the prior denaturation of the complementary strands of the
nucleic acid heteroduplex. Rather, the hybridization of the primer
with its target sequence is mediated by a recombination factor. The
recombination factor functions to form a recombination
intermediate. An exemplary recombination intermediate is a D-loop
structure between the primer and the complementary strands of the
nucleic acid heteroduplex. The recombination factor can be used to
pre-treat the primer at temperatures below 90.degree. C., more
preferably below 45.degree. C., and most preferably at 37.degree.
C.
[0052] A preferred recombination factor is the bacteriophage T4
UvsX gene product. A recombination factors, such as UvsX, can
require additional components, such as ATP, in order to optimally
function. The bacteriophage T4 UvsX protein functions to facilitate
formation of a presynaptic filament capable of undergoing
homologous pairing (See FIG. 1). When mixed with the target nucleic
acid, the resultant recombination intermediates, positioned at
opposite ends of the target nucleic acid, can serve as sites for
attachment of a polymerase. A preferred polymerase is a polymerase
holoenzyme. Preferably, the polymerase holoenzyme is the polymerase
holoenzyme of bacteriophage T4.
[0053] The formation of the bacteriophage T4 polymerase holoenzyme
complex is shown in FIG. 2. This polymerase holoenzyme complex
includes the gene product (gp) 43 DNA polymerase, the gene product
45 clamp protein, and the gene products 44 and 62, which together
facilitate association of the gene 45 clamp with the gene product
43 polymerase explicitly at the recombination intermediate
primer/template junction (See FIG. 2).
[0054] The gene product 32 single-stranded binding protein is added
to facilitate strand displacement synthesis by the polymerase
holoenzyme complex (See FIG. 2). The addition of accessory factors
to stabilize the recombination factor is also contemplated. For
example, the bacteriophage UvsY protein, a UvsX protein accessory
factor, serves to stabilize the initial presynaptic filament
permitting the introduction of the bacteriophage T4 replicative
helicase complex, the products of the genes 41 and 59. An intact
replication fork is thus assembled which can extend the range of
site specific nucleic acid amplification beyond what can be
expected using available thermostable polymerases alone during a
thermocycle.
[0055] In some embodiments of a method of the invention, a
polymerase with high fidelity and high processivity is used, namely
bacteriophage T4 gp 43 DNA polymerase. This polymerase has been
shown to have an accuracy in replication that is orders of
magnitude greater than those polymerases commonly associated with
PCR, and with the PCR technique. This polymerase has a built in
proofreading/editing function which, when used in connection with a
self contained DNA duplication process, significantly increases the
accuracy of that duplication process.
[0056] Not only does this increase in processivity produce a more
accurate duplicate, it enhances the ability of the technique to
accurately replicate target nucleic acids with many thousands of
base pairs. Homologous polymerase holoenzymes are found in other
species, such as the DNA polymerase III found in prokaryotic
systems, and DNA polymerase delta and epsilon holoenzymes in
eukaryotic systems.
[0057] In other embodiments of a method of the invention, use of a
holoenzyme complex, a gene clamp, and a helicase complex, enables
polymerase to efficiently operate along much longer nucleic acid
sequences than can predictably be duplicated with existing PCR
technologies. In a further aspect, the present invention
contemplates a method for reproducing and amplifying a target
nucleic acid sequence at a temperature below about 45.degree.
Celsius and comprises catalytically inserting a primer into the
target nucleic acid sequence without previously denaturing the
duplex in whole or in part to form a recombination intermediate.
The entire duplication and amplification process can occur at
temperatures below about 90.degree. C., more preferably below about
45.degree. C., and most preferably at about 37.degree. C., due to
the catalytic nature of the involved processes. Because no
thermostable enzymes are required, the problems associated with
magnesium chloride solutions and their concentrations are avoided.
Similarly, the use of mineral oil is eliminated.
[0058] Because the present invention is based upon the creation of
a recombination intermediate, such as a D-loop, without previously
denaturing the duplex, and can be conducted at temperatures of
about 37.degree. C., it eliminates the extraneous and
undesirable/nonspecific annealing that occurs along the length of
the denatured duplex, and eliminates issues of having the wrong
primer concentrations, programming difficulties with PCR machines,
and having excessive or insufficient templates.
[0059] Avoiding these problems commonly associated with PCR further
augments the capability of a process of the invention to replicate
and amplify with greater fidelity and processivity.
[0060] The recombination intermediate so formed is then admixed
with a polymerase to form a polymerase complex, whereby the
polymerase replicates the target nucleic acid sequence. The primer
is preferably pretreated with single stranded nucleic acid binding
protein. It is also preferred that the primer be pretreated with a
recombination factor. A preferred recombination factor is
bacteriophage T4 UvsX. A preferred polymerase is gene product 43
DNA polymerase from the bacteriophage T4.
[0061] As is understood by one of ordinary skill in the art, the
replication and amplification of a target nucleic acid sequence by
a polymerase requires the presence of nucleotide triphosphates in
concentrations sufficient to permit elongation of the nascent
copies. In addition, the concentrations of the other components of
a method of the invention can readily be determined by one of
ordinary skill in the art, based upon empirical determinations as
well as the examples that follow.
[0062] Moreover, as is well understood by one of ordinary skill in
the art, a method of the present invention permits additional
rounds, or cycles, of replication of a target nucleic acid
sequence, by virtue of the re-initiation of a method of the
invention. As such, not only is a target nucleic acid sequence
copied or replicated, it is amplified as a result of the repetition
of a method of the invention. While not wishing to be bound by
theory, it is believed that the presence of a molar excess of a
primer in embodiments of the invention permits the repeated
formation of a recombination intermediate and subsequent
replication of a nucleic acid target. In this sense, the present
invention provides an alternative to the target amplification of
PCR.
[0063] B. Use of Process to Create Libraries
[0064] In addition to specific nucleic acid amplification, a
process of the invention contemplates the use of the bacteriophage
T4 presynaptic filament (gene products of the UvsX, UvsY, and gp32
genes) to promote the recombination of different nucleic acid
sequences to produce a protein with desired novel functional
characteristics. This method comprises incubating a first
double-stranded nucleic acid with an enzyme having exonuclease
activity to form a plurality of single stranded DNA regions having
random sizes. The exonuclease treatment is performed under
conditions that would randomize the size and distribution of the
resultant single stranded DNA region.
[0065] This plurality of single stranded DNA regions is treated
with a recombination factor to form a plurality of pretreated
single stranded DNA regions. For example, in a preferred
embodiment, in the presence of the bacteriophage T4 UvsX and UvsY
gene products and a second undigested target nucleic acid sequence,
an initial three stranded crossover reaction occurs in a random
manner as dictated by the distribution of the exonuclease digestion
of the first nucleic acid upon which the presynaptic filament is
formed.
[0066] A second double-stranded nucleic acid is then added to the
plurality of pretreated single stranded DNA regions to form a
plurality of three stranded crossover junctions. The plurality of
three stranded crossover junctions is incubated with a helicase to
form a plurality of Holliday junctions. The plurality of Holliday
junctions so formed is resolved by incubation with an endonuclease.
Preferably, the recombination factor is bacteriophage T4 UvsX.
Preferably, the helicase is bacteriophage T4 gene products 41 and
59. A further preferred helicase is bacteriophage T4 UvsW. A
preferred endonuclease is bacteriophage T4 gp 49.
[0067] Upon addition of helicase activity derived from the products
of genes 41 and 59, branch migration extends regions of
heteroduplex DNA beyond regions of non- or partial homology. The
final products of the reaction can be resolved with the
bacteriophage gene product 49 protein, an endonuclease that will
specifically recognize and cleave recombination crossover junctions
(Holliday junctions) (See FIG. 3).
[0068] Enzymes from other species can be used in a contemplated
method of the invention, in addition to enzymes from the
bacteriophage T4 system. For example, enzymes from E. coli,
including RecA, RecF, RecO, RecR, RuvA, RuvB, RecG, and RuvC, can
be used. A recombination factor useful in some embodiments of a
method of the invention includes the UvsX protein from
bacteriophage T4, the RecA protein from E. coli, and the Rad51
protein from yeast, as well as Rad51 homologs from other eukaryotic
species. An accessory factor useful in some embodiments of a method
of the invention includes the UvsY protein from bacteriophage T4,
the Rec F, O and R proteins from E. coli, and the Rad52 protein
from yeast, as well as Rad52 homologs from other eukaryotic
species.
[0069] In addition to the bacteriophage T4 polymerase, clamp and
clamp loading complex, the DNA polymerase III holoenzyme, the
beta-clamp clamp and the gamma-complex clamp loading complex from
prokaryotic species can be used in a method of the invention. Still
further, the DNA polymerase delta and epsilon holoenzymes, the PCNA
clamp, and the replication factor C complex clamp loading complex
from eukaryotic species can be used in a method of the
invention.
EXAMPLES
Example 1
[0070] Homologous recombination directed nucleic acid amplification
of closed circular plasmid DNA using the T4 holoenzyme complex and
the T4 homologous recombination proteins UvsX and gene product 32
were performed as follows. Oligonucleotide primers were designed to
amplify a 3220 base pair fragment from M13 mp18 plasmid DNA as
follows:
3 1940- 5'TGATACACCTATTCCGGGCTATACTTATAT- (SEQ ID. NO. 1) 3' and
5160 5'CGCTCAATCGTCTGAAATGGATTATTTACAT (SEQ ID. NO. 2)
TGGCAGATT-3'.
[0071] These primers were used for the amplification of a 3220 base
pair fragment from closed circular M13 mp18 plasmid DNA. Reaction
conditions were set up to facilitate the assembly of the polymerase
holoenzyme, including bacteriophage T4 gene products 43, 45, and
44/62, on recombination intermediates formed by the action of
bacteriophage T4 UvsX protein. The concentration of double stranded
closed circular M13 mp18 plasmid DNA was set at 10 micrograms per
milliliter (2.1 nanomolar as nucleotides). Both oligonucleotides,
1940 (SEQ ID NO. 1) and 5160 (SEQ ID NO. 2), were used at a
concentration of 210 nanomolar (as molecules). The concentration of
UvsX was present to ensure about 50% coverage of the 40mer
oligonucleotide primers (UvsX monomer/4 base site size). The
concentration of ATP was set at 2 millimolar during the D-loop
reaction, and an ATP regeneration system was employed consisting of
phosphocreatine kinase and phosphoenol pyruvate. The gene product
(gp) 32 single stranded protein was present at 25 micromolar. The
holoenzyme was constructed using 1 micromolar gp43 (polymerase), 1
micromolar gp45 (as trimers, sliding clamp) and 500 nanomolar
gp44/62 complex (ATP dependent clamp loader). The
deoxyribonucleotides were present at 3 millimolar.
[0072] The reaction order was designed to allow for the initial
formation of a recombination intermediate, or D-loop, followed by
the formation of a polymerase holoenzyme complex. The M13 mp18
closed circular double stranded DNA template was first incubated in
holoenzyme complex formation buffer (20 millimolar Tris (pH7.5),
150 millimolar KOAc, 10 millimolar Mg(OAc).sub.2) in the presence
of the primers, 2 millimolar ATP, phosphoenol pyruvate and pyruvate
kinase.
[0073] Homologous pairing, or D-loop formation, was then initiated
by the addition of the T4 UvsX strand tranferase protein. After 2
minutes at 37.degree. C., an additional 1 millimolar ATP, 3
millimolar deoxyribonucleotide mix, gp 32 single stranded binding
protein and the gp43 polymerase and the gp45 and gp44/62 accessory
factors were added to initiate polymerase holoenzyme formation at
recombination intermediates and initiate strand displacement DNA
synthesis. At 10, 20 and 30 minutes aliquots of the reaction mix
were removed and quenched with SDS and EDTA followed by heating to
60.degree. C. for 10 minutes. The reactions were then loaded onto a
1.0% TBE agarose gel and visualized using ethidium bromide.
[0074] The gels show that the 3220 base pair fragment from M13 mp18
plasmid DNA is replicated and amplified.
Example 2
[0075] Homologous recombination directed nucleic acid amplification
of linear plasmid DNA using the T4 holoenzyme complex and the T4
homologous recombination proteins UvsX and gene product 32. M13
mp18 double stranded closed circular plasmid DNA was made linear by
digestion with the BamH1 restriction endonuclease. 10 micrograms
M13 mp18 and the BamH1 restriction endonuclease were incubated at
37.degree. C. using standard buffer conditions for 2 hours followed
by phenol/chloroform extraction and passage through two G-25 spin
columns. Reaction conditions were as described for Example 1. The
results show that the nucleic acid target fragment from M13 mp18
plasmid DNA is replicated and amplified.
[0076] Each of the patents and articles cited herein is
incorporated by reference. The use of the article "a" or "an" is
intended to include one or more.
[0077] The foregoing description and the examples are intended as
illustrative and are not to be taken as limiting. Still other
variations within the spirit and scope of this invention are
possible and will readily present themselves to those skilled in
the art.
Sequence CWU 1
1
2 1 30 DNA unknown M13mp18 plasmid DNA - primer designed to amplify
a 3220 base pair fragment. 1 tgatacacct attccgggct atacttatat 30 2
40 DNA unknown M13mp18 plasmid DNA - primer designed to amplify a
3220 base pair fragment. 2 cgctcaatcg tctgaaatgg attatttaca
ttggcagatt 40
* * * * *