U.S. patent application number 10/360854 was filed with the patent office on 2004-08-12 for methods and apparatus for sample tracking.
Invention is credited to Banks, Peter, Kurnool, Purnima, Wu, Betty.
Application Number | 20040157220 10/360854 |
Document ID | / |
Family ID | 32824074 |
Filed Date | 2004-08-12 |
United States Patent
Application |
20040157220 |
Kind Code |
A1 |
Kurnool, Purnima ; et
al. |
August 12, 2004 |
Methods and apparatus for sample tracking
Abstract
A method and apparatus are provided for identifying a biological
sample obtained during either paternity screening, genetic
screening, prenatal diagnosis, presymptomatic diagnosis, diagnosis
to detect the presence of a target microorganism carrier detection
analysis, forensic chemical analysis, or diagnosis of a subject to
determine whether a subject is afflicted with a particular disease
or disorder, or is at risk of developing a particular disorder,
wherein the result obtained from the analysis is associated with
the unique DNA fingerprint biological barcode of the genotype of
the subject being analyzed. The methods and apparatus of the
invention have application in the fields of diagnostic medicine,
disease diagnosis in animals and plants, identification of
genetically inherited diseases in humans, family relationship
analysis, forensic analysis, and microbial typing.
Inventors: |
Kurnool, Purnima; (Ann
Arbor, MI) ; Wu, Betty; (Ann Arbor, MI) ;
Banks, Peter; (Ann Arbor, MI) |
Correspondence
Address: |
JONES DAY
51 Louisiana Aveue, N.W
WASHINGTON
DC
20001-2113
US
|
Family ID: |
32824074 |
Appl. No.: |
10/360854 |
Filed: |
February 10, 2003 |
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6876 20130101;
Y02A 50/30 20180101; C12Q 2600/158 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method for identifying a biological sample comprising
biological material of a mammal, which comprises the steps of: a)
obtaining amplification data indicative of amplification of at
least two DNA markers of genomic DNA of the mammal; b) generating
indicia indicative of the amplification data; and c) associating
the indicia with the biological sample, whereby the indicia may be
used to identify the biological sample.
2. The method of claim 1, comprising obtaining amplification data
indicative of amplification of at least three DNA markers of
genomic DNA of the mammal.
3. The method of claim 2, comprising obtaining amplification data
indicative of amplification of at least five DNA markers of genomic
DNA of the mammal.
4. The method of claim 1, where said DNA markers are amplification
primers selected from the group consisting of the following primer
pairs:
27 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto.
5. The method of claim 1, further comprising: diagnosing the DNA
sample to obtain a result indicative of whether the mammal is
afflicted with a particular disease or disorder, or is at risk of
developing a particular disease or disorder; and associating the
result obtained from said diagnosis step with at least one of the
amplification data or indicia.
6. The method of claim 5, wherein associating the result obtained
from said diagnosis step with the amplification data comprises
saving the amplification data to a computer readable medium.
7. The method of claim 1, further comprising: obtaining data
indicative of the presence of a pathogen in the biological sample;
and associating the data indicative of the presence of the pathogen
with at least one of the amplification data or indicia, whereby the
amplification data or indicia are indicative of the presence of the
pathogen.
8. The method of claim 7, wherein the data indicative of the
presence of the pathogen are indicative of the type of
pathogen.
9. The method of claim 1, wherein generating the indicia further
comprises printing a label comprising the indicia.
10. The method of claim 9, comprising securing the label to a
container comprising at least a portion of the sample.
11. The method of claim 1, wherein the indicia are readable using
an automated reader.
12. A method for creating a database, the database comprising a
plurality of locations, the method comprising: for each of a
plurality of mammals: a) obtaining amplification data indicative of
amplification of at least two DNA markers of genomic DNA of the
mammal; b) entering the amplification data in a first location of
the database; and c) entering first indicia in a second location of
the database, the first indicia indicative of an identity of the
mammal, wherein the first and second locations are related, whereby
the database may be searched using one of the amplification data or
first indicia to determine the other of the amplification data or
first indicia.
13. The method of claim 12, further comprising; d) generating
second indicia indicative of at least the amplification data; and
e) associating the second indicia with a biological sample obtained
from the mammal, wherein the second indicia and the database may be
used to determine the identity of the mammal from which the
biological sample was obtained.
14. The method of claim 12, wherein the step of obtaining comprises
obtaining amplification data indicative of amplification of at
least three DNA markers of genomic DNA of the mammal.
15. The method of claim 14, wherein the step of obtaining comprises
obtaining amplification data indicative of amplification of at
least five DNA markers of genomic DNA of the mammal.
16. The method of claim 12, where said DNA markers are
amplification primers selected from the group consisting of the
following primer pairs:
28 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto.
17. The method of claim 12, further comprising for each mammal:
diagnosing a DNA sample obtained from the mammal to obtain a result
indicative of whether the mammal is afflicted with a particular
disease or disorder, or is at risk of developing a particular
disease or disorder; and entering the result in a third location of
the database, wherein the database may be searched using one of the
amplification data or first indicia to determine the result.
18. A sample tracking system, comprising: a) a device configured to
at least: obtain amplification data indicative of amplification of
at least two DNA markers of genomic DNA of a mammal; b) a processor
configured to at least: generate indicia indicative of the
amplification data; and associate the indicia with the biological
sample, whereby the indicia may be used to identify the biological
sample.
19. The method of claim 18, wherein the device is configured to
obtain amplification data indicative of amplification of at least
three DNA markers of genomic DNA of the mammal.
20. The method of claim 18, wherein the device is configured to
obtain amplification data indicative of amplification of at least
five DNA markers of genomic DNA of the mammal.
21. The method of claim 18, where said DNA markers are
amplification primers selected from the group consisting of the
following primer pairs:
29 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto.
22. The device of claim 18, wherein the device is further
configured to obtain data indicative of the presence of a
pathogen.
23. The device of claim 18, wherein the device is microfluidic
device comprising at least one substrate defining a microfluidic
network.
24. The system of claim 18, wherein the system is configured to
provide a label comprising the indicia.
25. A method for identifying a biological sample of a mammal, which
comprises the steps of: a) obtaining a genomic DNA sample from said
mammal; b) amplifying the genomic DNA sample using at least two
primers for amplification of at least two DNA markers; and c)
identifying the amplified DNA markers from step b), wherein the
genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample.
26. A method for identification of a biological sample of a mammal,
which comprises the steps of: a) obtaining a genomic DNA sample
from said mammal; b) performing DNA amplification of the genomic
DNA sample using at least two primers for amplification of at least
two DNA markers, wherein said DNA marker amplification primers are
selected from the group consisting of the following primer
pairs:
30 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto; and
c) identifying the amplified DNA markers from step b), wherein the
genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample.
27. A method for identification of a biological sample of a subject
undergoing diagnosis to determine whether the subject is afflicted
with a particular disease or disorder, or is at risk of developing
a particular disorder comprising a) obtaining a genomic DNA sample
from a subject; b) performing DNA amplification of the genomic DNA
sample using at least two primers for amplification of at least two
DNA markers; c) identifying the amplified DNA markers of step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample; and d) performing diagnosis of the subject's
genomic DNA sample to determine whether the subject is afflicted
with a particular disease or disorder, or is at risk of developing
a particular disease or disorder, wherein the result obtained from
said diagnosis step is thereby intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
28. A method for identification of a biological sample of a subject
undergoing screening for genetic lesions or mutations to determine
if the subject with a lesioned gene is at risk for a disease or
disorder characterized by aberrant expression or activity of a
given polypeptide comprising a) obtaining a genomic DNA sample from
a subject; b) performing DNA amplification of the genomic DNA
sample using at least two primers for amplification of at least two
DNA markers; c) identifying the amplified DNA markers of step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample; d) performing screening of the subject's genomic
DNA sample for detection of genetic lesions or mutations in said
genomic DNA sample to determine if a subject with a lesioned gene
is at risk for a disease or disorder characterized by aberrant
expression or activity of a given polypeptide; wherein the result
obtained from said screening step is thereby intimately associated
with the molecular barcode of the sample of the subject being
screened.
29. A method for identification of a biological sample of a subject
being diagnosed for the presence of a target microorganism
comprising a) obtaining a genomic DNA sample from a subject; b)
performing DNA amplification of the genomic DNA sample using at
least two primers for amplification of at least two DNA markers;
and c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and d) performing diagnosis of said subject to
detect the presence of a target microorganism; wherein the result
obtained from said diagnosis step is thereby intimately associated
with the molecular barcode of the sample of the subject being
diagnosed.
30. A method for identification of a biological sample of a subject
undergoing paternity screening, genetic screening, prenatal
diagnosis, presymptomatic diagnosis, disease carrier detection, or
forensic chemical analysis comprising a) obtaining a genomic DNA
sample from a subject; b) performing DNA amplification of the
genomic DNA sample using at least two primers for amplification of
at least two DNA markers; c) identifying the amplified DNA markers
of step b), wherein the genomic DNA sample's unique combination of
amplified markers represents the molecular barcode for
identification of the biological sample; and d) performing
paternity screening, genetic screening, prenatal diagnosis,
presymptomatic diagnosis, disease carrier detection, forensic
chemical analysis, or any combination thereof, of the subject's
genomic DNA sample, wherein the result obtained from said paternity
screening, genetic screening, prenatal diagnosis, presymptomatic
diagnosis, disease carrier detection, or forensic chemical analysis
step is thereby intimately associated with the molecular barcode of
the sample of the subject being screened or diagnosed.
31. The method according to claim 29, wherein the target
microorganism is selected from the group consisting of virus,
bacteria, fungi or protozoa.
32. The method according to claim 31, wherein the virus is selected
from the group consisting of Human Immunodeficiency Virus Type 1
(HIV-1), Human T-Cell Lymphotrophic Virus Type 1 (HTLV-1),
Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Herpes Simplex,
Herpesvirus 6, Herpesvirus 7, Epstein-Barr Virus, Cytomegalo-virus,
Varicella-Zoster Virus, JC Virus, Parvovirus B19, Influenza A, B
and C, Rotavirus, Human Adenovirus, Rubella Virus, Human
Enteroviruses, Genital Human Papillomavirus (HPV), and
Hantavirus.
33. The method according to claim 31, wherein the bacteria is
selected from the group consisting of Mycobacteria tuberculosis,
Rickettsia rickettsii, Ehrlichia chaffeensis, Borrelia burgdorferi,
Yersinia pestis, Treponema pallidum, Chlamydia trachomatis,
Chlamydia pneumoniae, Mycoplasma pneumoniae, Mycoplasma sp.,
Legionella pneumophila, Legionella dumoffii, Mycoplasma fermentans,
Ehrlichia sp., Haemophilus influenzae, Neisseria meningitidis,
Streptococcus pneumonia, S. agalactiae, and Listeria
monocytogenes.
34. The method according to claim 31, wherein the fungi is selected
from the group consisting of Cryptococcus neoformans, Pneumocystis
carinii, Histoplasma capsulatum, Blastomyces dermatitidis,
Coccidioides immitis, and Trichophyton rubrum.
35. The method according to claim 31, wherein the protozoa is
selected from the group consisting of Trypanosoma cruzi, Leishmania
sp., Plasmodium, Entamoeba histolytica, Babesia microti, Giardia
lamblia, Cyclospora sp. and Eimeria sp.
36. A method for unequivocally identifying a biological sample
obtained during the screening of a plant to detect the presence of
a target microorganism comprising the steps of a) obtaining a
biological sample from a plant; b) detecting the presence of a
target microorganism in said biological sample; and c)
simultaneously identifying the DNA fingerprint of the biological
sample, wherein the result obtained from the screening is
associated with the unique DNA fingerprint biological barcode of
the genotype of the plant being screened.
37. A method for unequivocally identifying a biological sample
obtained during carrier detection analysis or forensic chemical
analysis of a plant comprising the steps of a) obtaining a
biological sample from a plant; b) performing carrier detection
analysis or forensic chemical analysis on said biological sample;
and c) simultaneously identifying the DNA fingerprint of the
biological sample, wherein the result obtained from said analysis
is associated with the unique DNA fingerprint biological barcode of
the genotype of the plant being analyzed.
38. A method for unequivocally identifying a biological sample
obtained during the testing of a plant to determine whether a plant
is afflicted with a particular disease or condition, or is at risk
of developing a particular disease or condition comprising the
steps of a) obtaining a biological sample from a plant; b) testing
a plant to determine whether a plant is afflicted with a particular
disease or condition, or is at risk of developing a particular
disease or condition; and c) simultaneously identifying the DNA
fingerprint of the biological sample, wherein the result obtained
from the testing is associated with the unique DNA fingerprint
biological barcode of the genotype of the plant being tested.
Description
1. INTRODUCTION
[0001] The present invention relates generally to the emerging
field of human, animal or plant DNA fingerprinting. The methods and
apparatus of the invention have application in the fields of
diagnostic medicine, disease diagnosis in animals and plants,
identification of genetically inherited diseases in humans, family
relationship analysis, forensic analysis, and microbial typing. In
a preferred embodiment, the invention relates to methods and
apparatus for the simultaneous analysis and tracking of biological
samples.
2. BACKGROUND OF THE INVENTION
[0002] It is known that there are simple nucleotide sequences in
the human genome that can occur in different numbers of repeats in
different individuals, giving rise to a range of different alleles
or variants of different length that can be used as genetic markers
to typify the DNA of an individual. It is these genetic markers
that DNA diagnostic laboratories use in molecular diagnostics
procedures for the identification and characterization of diseased
genes. Such genetic markers are also use for precision of DNA
typing of individuals in the field of forensic science.
[0003] In general, tandem repeat minisatellite and microsatellite
regions in vertebrate DNA frequently show high levels of allelic
variability in the number of repeat units. These highly informative
genetic markers have found widespread applications in population
genetics, forensic science, medicine and other natural scientific
studies. For example, these markers can be used for linkage
analysis, determination of kinship in paternity and immigration
disputes and for individual identification in forensic medicine. In
a minisatellite system, a core DNA sequence unit is usually 15 or
more base pairs. To date most studies and applications of such
systems have relied on Southern blot estimation of allele length,
which requires at least 50 ng of relatively undegraded DNA. It is
often very difficult to extract such large amounts of DNA from many
forensic samples such as blood and semen stains.
[0004] In recent years, the discovery and development of
polymorphic short tandem repeats (STRs) and Variable Number Tandem
Repeats (VNTRs) as genetic markers have stimulated progress in the
development of linkage maps, the identification and
characterization of diseased genes, and the simplification and
precision of DNA typing of individuals.
[0005] Many loci in the human genome contain a polymorphic STR
region. STR loci consist of short, repetitive sequence elements on
the order of 3 to 7 base pairs in length. It is estimated that
there are roughly 2,000,000 expected trimeric and tetrameric STRs
present as frequently as once every 15 kilobases (kb) in the human
genome (Edwards et al. 1991 (Am J Hum Genet 49:746-756); Beckmann
and Weber 1992 (Genomics 12:627-631)). Nearly half of the STR loci
studied by Edwards et al. (1991) are polymorphic, which provides a
rich source of genetic markers. Variation in the number of repeat
units at a particular locus is responsible for the observed
polymorphism reminiscent of VNTR loci (Nakamura et al. 1987
(Science 235:1616-1622) and minisatellite loci (Jeffreys et al.
1985 (Nature 316:76-79)), which contain longer repeat units, and
microsatellite or dinucleotide repeat loci (Litt and Luty 1989 (Am
J Hum Genet 44:397-401), Tautz 1989 (Nucleic Acids Res.
17:6463-6471), Weber and May 1989 (Am J Hum Genet 44:388-396),
Beckmann and Weber 1992 (Genomics 12:627-631)).
[0006] Such polymorphic STR loci are extremely useful markers for
human identification, paternity testing and genetic mapping. STR
loci may be amplified via the polymerase chain reaction (PCR) by
employing specific primer sequences identified in the regions
flanking the tandem repeat. Alleles of these loci can be
differentiated by the number of copies of the repeat sequence
contained within the amplified region and are distinguished from
one another following electrophoretic separation by any suitable
detection method including, for example, radioactivity,
fluorescence, silver stain, and color. To minimize labor, materials
and analysis time, it is desirable to analyze multiple loci and/or
more samples simultaneously. One approach involves amplification of
multiple loci simultaneously in a single reaction. Such "multiplex"
amplifications have been described extensively in the literature,
for example, in the analysis of genes related to human genetic
diseases such as Duchenne Muscular Dystrophy (Chamberlain et al.
1988 (Nucleic Acid Res. 16: 11141-11156), Chamberlain et al. 1989
("Multiple PCR for the diagnosis of Duchenne muscular dystrophy,"
In PCR Protocols, A Guide to Methods and Application (ed. Gelfand,
D. H., et al.) pp.272-281. Academic Press, San Diego, Calif.),
Beggs et al. 1990 (Hum. Genet. 86: 45-48), Clemens et al. 1991 (Am
J. Hum. Genet. 49: 951-960), Schwartz et al. 1992 (Am J. Hum.
Genet. 51: 721-729), Covone et al. 1992 (Am. J. Hum. Genet. 51:
675-677)), Lesch-Nyhan Syndrome (Gibbs et al. 1990), Cystic
Fibrosis (Estivill et al. 1991 (Lancet 338: 458), Fortina et al.
1992 (Hum Genet. 90: 375-378), Ferrie et al. 1992 (Am. J. Hum.
Genet. 51: 251-262), Morral and Estivill, 1992 (Genomics
51:1362-1364), and Retinoblasma (Lohmann et al. 1992 (Hum. Genet.
89: 49-53)). Multiplex amplification of polymorphic microsatellite
markers and STR markers have been described previously in the
literature (Clemens et al. 1991 (Am J. Hum. Genet. 49: 951-960),
Schwartz et al. 1992, Huang et al. 1992 (Genomics 13: 375-380),
Edwards et al. 1992 (Genomics 12:241-253), Kimpton et al. 1993 (PCR
Methods and Applications 3: 13-22), Hammond et al. 1994 (Am. J.
Hum. Genet. 55: 175-189)).
[0007] Recently, RFLPs that have Variable Number Tandem Repeats
(VNTRs) have become a method of choice for human mapping because
such VNTRs tend to have multiple alleles and are genetically
informative because polymorphisms are more likely to be segregating
within a family. The production of fingerprints by Southern
blotting with VNTRs (Jeffreys et al., Nature 316:76-79 (1985)) has
proven useful in the field of forensics. There are two classes of
VNTRs; one having repeat units of 9 to 40 base pairs, and the other
consisting of minisatellite DNA with repeats of two or three base
pairs. The longer VNTRs have tended to be in the proterminal
regions of autosomes. VNTR consensus sequences may be also used to
display a DNA fingerprint.
[0008] Thus, while molecular diagnostics procedures, which rely on
the use of such markers as, inter alia, STRs and VNTRs, are
particularly well-suited to the application of prenatal diagnosis,
presymptomatic diagnosis, carrier detection, and genetic screening,
there still remain major bottlenecks in molecular diagnostic
laboratories including front-end tasks such as sample purification
and reaction setup. To date, the major sources for concern in
clinical molecular laboratories are the safety, costs and
efficiency of the normal procedures for preparation of specimens,
such as blood, prior to analysis. Blood specimens for clinical
analyses are commonly collected in evacuated blood collection
tubes. Serum or plasma may be isolated from the cellular material
by centrifugation and transferred to one or more specialized sample
vessels. These sample vessels are used to introduce a portion of
the specimen to chemical analyzers. However, the large numbers of
samples involved often presents significant problems with sample
tracking and data exchange between different laboratory instruments
and information management systems. A certified DNA Diagnostics
Laboratory provides a chain of custody report for each sample that
is to be tested. The report traces the history of each sample from
the time it was collected by one of their representatives until the
results are released. The DNA Diagnostics Laboratory usually relies
on a computerized sample tracking system that assigns a number for
each sample to ensure confidentiality and chain of custody.
[0009] To provide for proper biological sample identification, a
computer readable bar code label is usually affixed to the tube
containing the biological sample. The bar code label allows for
electronic processing of the sample and also helps to eliminate
misidentification or confusion of samples. While the use of
computer-based barcodes can provide a high level of sample
tracking, such barcode labels still suffer from some significant
drawbacks. For example, they are susceptible to manipulation, they
typically involve an additional step, they can be lost, and
barcodes are not unique to the individual, etc. In addition, the
time and technical constraints associated with most sample
preparation protocols have heretofore impeded the rapid,
cost-effective, reproducible, systematic and unequivocal
identification of biological samples.
[0010] For these aforementioned reasons, what is needed in the
field of diagnostic medicine and disease diagnosis is a system and
method suitable for biological sample tracking without the prior
possibilities of accidental misidentification of the source of the
sample and any diagnostic data derived from such a sample. This
application addresses these and other needs by providing a method
for analyzing a biological sample to detect the presence of an
infectious agent, a disease condition and/or disease predisposition
while simultaneously determining the molecular barcode of the
sample so as to uniquely identify the biological sample without the
chance of any mishandling or misidentification. The invention also
includes a microfluidic processor apparatus for use in such a
method.
[0011] Citation or discussion of a reference herein shall not be
construed as an admission that such is prior art to the present
invention.
3. SUMMARY OF THE INVENTION
[0012] The present invention relates to methods and an apparatus
for providing identification of biological samples used in
diagnostic laboratories. In particular, the invention relates to
methods and an apparatus for analyzing a biological sample to
detect the presence of an infectious agent or disease condition
and/or disease predisposition and determining the unique molecular
barcode of the sample so as to uniquely identify the biological
sample, thereby greatly reducing the chance of errors associated
with misidentification of the biological sample or a patient record
associated with the molecular barcode. In a preferred embodiment,
the unique molecular barcode of the sample is determined
simultaneously with the detection of the presence of an infectious
agent or disease condition and/or disease predisposition. It is the
particular unique combination of genetic markers associated with
each individual that provides the biological sample with its unique
identification and is termed its molecular barcode. The combination
of amplified markers (and hence the molecular barcode) is
preferably unique to the extent that the chance of another mammal
exhibiting an indistinguishable combination of amplified markers is
less than 1 in 10,000, for example, less than 1 in 100,000, for
example, less than 1 in 1,000,000. The chance that a given
population of mammals will include at least two individuals having
an indistinguishable combination of amplified markers may be
determined using the Hardy-Weinberg principle.
[0013] One aspect of the invention relates to a method for
identifying a biological sample comprising biological material of a
mammal. The method may comprise the steps of: obtaining
amplification data indicative of amplification of at least two DNA
markers of genomic DNA of the mammal, generating indicia indicative
of the amplification data, and associating the indicia with the
biological sample, whereby the indicia may be used to identify the
biological sample.
[0014] The amplification data may be indicative of amplification of
at least three, for example, at least five DNA markers of genomic
DNA of the mammal. The DNA markers may be selected from the group
consisting of the following primer pairs:
1 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto.
[0015] The method may comprise the further steps of diagnosing the
DNA sample to obtain a result indicative of whether the mammal is
afflicted with a particular disease or disorder, or is at risk of
developing a particular disease or disorder and associating the
result obtained from said diagnosis step with at least one of the
amplification data or indicia. Associating the result obtained from
said diagnosis step with the amplification data comprises saving
the amplification data to a computer readable medium, such as a
computer memory or storage medium. The step of diagnosing may be
performed essentially simultaneously with the step of
amplification. For example, the sample may be divided into at least
two portions. One of the portions is subjected to the obtaining
amplification data step; the other portion is subjected to the
diagnosing step. In a preferred embodiment, the steps of obtaining
amplification data and diagnosing are performed using a
microfluidic device. Preferably, a single microfluidic device, for
example the same microfluidic chip, is used to perform the steps of
dividing the sample, obtaining amplification data, and
diagnosing.
[0016] The method may further comprise obtaining data indicative of
the presence of a pathogen in the biological sample and associating
the data indicative of the presence of the pathogen with at least
one of the amplification data or indicia, whereby the indicia are
indicative of the presence of the pathogen. The data indicative of
the presence of the pathogen may be indicative of the type of
pathogen, such as for example, whether the pathogen is a bacteria
or virus. The data may also indicate further information about the
pathogen, such as the type of bacteria and/or strain of
bacteria.
[0017] The step of obtaining data indicative of the presence of the
pathogen may be performed essentially simultaneously with the step
of amplification. For example, the sample may be divided into at
least two portions. One of the portions is subjected to the
obtaining amplification data step; the other portion is subjected
to the obtaining data indicative of the pathogen step. In a
preferred embodiment, the steps of obtaining amplification data and
obtaining data indicative of the pathogen are performed using a
microfluidic device. Preferably, a single microfluidic device, for
example the same microfluidic chip, is used to perform the steps of
dividing the sample, obtaining amplification data, and obtaining
data indicative of the pathogen.
[0018] Generating the indicia further may comprise printing a label
comprising the indicia. The label may be secured to a container
comprising at least a portion of the sample. The label may be
secured to a record comprising other data related to the mammal,
such as other treatments the mammal may have been or will be
subjected to. Preferably, the indicia may be read using an
automated reader, such as an optical bar code reader.
[0019] Another aspect of the invention relates to a method for
creating a database. The database is preferably configured to allow
storage and retrieval of a plurality of data records. The database
may comprise a plurality of locations. For each of a plurality of
mammals the method may comprise: obtaining amplification data
indicative of amplification of at least two DNA markers of genomic
DNA of the mammal, entering the amplification data in a first
location of the database, and entering first indicia in a second
location of the database, the first indicia indicative of an
identity of the mammal, wherein the first and second locations are
related, whereby the database may be searched using one of the
amplification data or first indicia to determine the other of the
amplification data or first indicia.
[0020] The method may further comprise generating second indicia
indicative of at least the amplification data and associating the
second indicia with a biological sample obtained from the mammal,
wherein the second indicia and the database may be used to
determine the identity of the mammal from which the biological
sample was obtained.
[0021] In one embodiment, the method comprises, preferably for each
mammal, diagnosing a DNA sample obtained from the mammal to obtain
a result indicative of whether the mammal is afflicted with a
particular disease or disorder, or is at risk of developing a
particular disease or disorder and entering the result in a third
location of the database, wherein the database may be searched
using one of the amplification data or first indicia to determine
the result.
[0022] Another aspect of the invention relates to a sample tracking
system, comprising a device configured to at least: obtain
amplification data indicative of amplification of at least two DNA
markers of genomic DNA of a mammal, a processor configured to at
least: generate indicia indicative of the amplification data and
associate the indicia with the biological sample, whereby the
indicia may be used to identify the biological sample. The device
may be configured to obtain amplification data indicative of
amplification of at least three DNA markers of genomic DNA of the
mammal. The device may be configured to obtain amplification data
indicative of amplification of at least five DNA markers of genomic
DNA of the mammal.
[0023] The device may be configured to obtain data indicative of
the presence of a pathogen. For example, the device may be a
microfluidic device comprising at least one substrate defining a
microfluidic network.
[0024] The system may be configured to provide a label comprising
the indicia.
[0025] The methods and apparatus of the invention are particularly
applicable to biological samples being subjected to complex
multistep assays, where there exists numerous sample transfers, and
where the risk for improper handling and/or labeling is
considerably increased.
[0026] In accordance with the present invention there is provided a
method for identification of a biological sample of a mammal, which
comprises the steps of:
[0027] a) obtaining a genomic DNA sample from said mammal;
[0028] b) performing amplification of the genomic DNA sample using
at least two primers for amplification of at least two DNA markers;
and
[0029] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0030] In accordance with a preferred aspect of the present
invention there is provided a method for identification of a
biological sample of a mammal, which comprises the steps of:
[0031] a) obtaining a genomic DNA sample from said mammal;
[0032] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers, wherein said primers are selected from the group
consisting of SEQ ID NOS:1 to 10 and complementary sequences
thereto; and
[0033] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0034] In yet another aspect of the present invention, a method is
provided for identification of a biological sample of a subject
undergoing diagnosis to determine whether the subject is afflicted
with a particular disease or disorder, or is at risk of developing
a particular disorder comprising
[0035] a) obtaining a genomic DNA sample from a subject;
[0036] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0037] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0038] d) performing diagnosis of the subject's genomic DNA sample
to determine whether the subject is afflicted with a particular
disease or disorder, or is at risk of developing a particular
disease or disorder, wherein the result obtained from said
diagnosis step is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0039] In yet another aspect of the present invention, a method is
provided for identification of a biological sample of a subject
undergoing screening for genetic lesions or mutations to determine
if the subject with a lesioned gene is at risk for a disease or
disorder characterized by aberrant expression or activity of a
given polypeptide comprising
[0040] a) obtaining a genomic DNA sample from a subject;
[0041] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0042] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample;
[0043] d) performing screening of the subject's genomic DNA sample
for detection of genetic lesions or mutations in said genomic DNA
sample to determine if a subject with a lesioned gene is at risk
for a disease or disorder characterized by aberrant expression or
activity of a given polypeptide; wherein the result obtained from
said screening step is thereby intimately associated with the
molecular barcode of the sample of the subject being screened.
[0044] In yet another aspect of the present invention, a method is
provided for identification of a biological sample of a subject
being diagnosed for the presence of a target microorganism
comprising
[0045] a) obtaining a genomic DNA sample from a subject;
[0046] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers; and
[0047] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0048] d) performing diagnosis of said subject to detect the
presence of a target microorganism; wherein the result obtained
from said diagnosis step is thereby intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
[0049] In yet another aspect of the present invention, a method is
provided for identification of a biological sample of a subject
undergoing paternity screening, genetic screening, prenatal
diagnosis, presymptomatic diagnosis, disease carrier detection, or
forensic chemical analysis comprising
[0050] a) obtaining a genomic DNA sample from a subject;
[0051] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0052] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0053] d) performing paternity screening, genetic screening,
prenatal diagnosis, presymptomatic diagnosis, disease carrier
detection, forensic chemical analysis, or any combination thereof,
of the subject's genomic DNA sample, wherein the result obtained
from said paternity screening, genetic screening, prenatal
diagnosis, presymptomatic diagnosis, disease carrier detection, or
forensic chemical analysis step is thereby intimately associated
with the molecular barcode of the sample of the subject being
screened or diagnosed.
[0054] In a preferred embodiment of the invention, the at least two
primers for the amplification of at least two markers are selected
from the group consisting of
2 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT.
(SEQ ID NO:10)
[0055] In yet another aspect of the present invention, methods are
provided for identification of a biological sample of a subject
wherein the DNA amplification of the genomic DNA sample using at
least two primers results in simultaneous amplification of at least
two DNA markers.
[0056] In preferred embodiments of the invention, the DNA
amplification of the genomic DNA sample employs VNTR analysis, STR
analysis, CTR analysis, Restriction Fragment Length Polymorphism
(RFLP) analysis, allele specific oligonucleotide (ASO) analysis,
denaturation temperature analysis, single strand conformation
polymorphism (SSCP) analysis, amplified fragment-length
polymorphism (AFLP) analysis, microsatellite or single-sequence
repeat (SSR) analysis, rapid-amplified polymorphic DNA (RAPD)
analysis, sequence tagged site (STS) analysis or a combination
thereof.
[0057] In another aspect of the present invention, an apparatus is
provided for use in the methods of the present invention.
[0058] In another aspect of the present invention a kit is provided
which contains the apparatus of the present invention, at least two
primers for the amplification of at least one marker, and
instructions for use.
[0059] In any embodiment of the present invention, the biological
sample may be selected from the group consisting of a tissue
homogenate, hair, blood, semen, vaginal swabs, plasma, serum,
ascites, pleural effusion, thoracentesis sample, spinal fluid,
lymph fluid, bone marrow, the external sections of the skin,
respiratory, intestinal, and genito-urinary tracts, stool, urine,
sputum, tears, saliva, fetal cells, placental cells, amniotic
cells, mixtures of body fluids, vitreous humor, amniotic fluid,
chorionic villus samples, blood cells, tumors, organs, tissue, and
samples of in vitro cell culture constituents, a transudate, an
exudate, or fluid obtained from a joint.
[0060] In any embodiment of the present invention, the DNA
fingerprint may be performed by VNTR analysis, by STR analysis, by
CTR analysis, by Restriction Fragment Length Polymorphism (RFLP)
analysis, by allele specific oligonucleotide (ASO) analysis, by
denaturation temperature analysis, by mass spectrometry analysis,
by single strand conformation polymorphism (SSCP) analysis, by
amplified fragment-length polymorphism (AFLP) analysis, by
microsatellite or single-sequence repeat (SSR) analysis, by
rapid-amplified polymorphic DNA (RAPD) analysis, by sequence tagged
site (STS) analysis, by allele-specific polymerase chain reaction
(ASPCR) analysis, by dynamic allele specific hybridization (DASH)
analysis, or combination thereof.
[0061] The subject from which the sample is obtained may be a
mammal, for example, a human, or a farm animal of agricultural
importance.
[0062] For embodiments of the invention relating to plants, the
biological sample may be selected from the group consisting of
genomic DNA isolated from a plant, genomic DNA isolated from a
plant extract, genomic DNA isolated from an isolated plant tissue,
genomic DNA isolated from an isolated plant tissue extract, genomic
DNA isolated from a plant cell culture, genomic DNA isolated from a
plant cell culture extract, genomic DNA isolated from a recombinant
cell comprising a nucleic acid derived from a plant, genomic DNA
isolated from a plant seed, genomic DNA isolated from an extract of
a recombinant plant cell comprising a nucleic acid derived from a
plant, and DNA isolated from a chloroplast.
[0063] The pre-packaged diagnostic kits of the invention may
comprise at least one nucleic acid probe or primer in one vial and
reagents for diagnosis, screening or testing in another vial. The
diagnostic kit may comprise at least one nucleic acid probe or
primer in one vial and reagents for diagnosis, screening or testing
in another vial, and a microfluidic chip for performing all or a
portion of the analysis.
4. BRIEF DESCRIPTION OF THE FIGURES
[0064] FIG. 1 depicts a flow diagram depicting the steps involved
in a typical DNA fingerprint analysis.
[0065] FIG. 2 depicts a chromosome diagram depicting STR
variability in D7S820 from grandparents to parents to
grandchildren.
[0066] FIG. 3 depicts an illustration of the preparation and
analysis of biological samples.
[0067] FIG. 4 depicts a photograph of an FYBR green stained
polyacrylamide gel of the respective STR markers. A, B, C and D are
the four buccal samples. A 25 bp ladder and Ffv, the allelic ladder
were used as the reference standards to determine the sizes of the
alleles.
[0068] FIG. 5 depicts the genomic DNA of two samples were used to
detect mutations with the Factor V Leiden mutation kit. The letter
A designation represents the positive control, which is a
heterozygous mutant. The letter designations B and C represent the
buccal samples, which are wildtype without the mutation. The letter
D designation represents the negative control without the
template.
[0069] FIG. 6 depicts the same genomic DNA used in fingerprinting
and in detecting the mutations in Factor V Leiden kit, was used to
detect the Apo B mutations also. The letter A designation
represents the heterozygous positive control with 9775 point
mutation. The letter B designation represents the heterozygous
positive control with 9774 mutation. The letter designations C and
D represent the buccal samples used that are wildtype without any
mutations; The letter E designation represents the negative control
without any template.
[0070] FIG. 7 depicts the FYBR green stained gels of the respective
STR markers in the blind sample identification experiment conducted
with the Factor V genomic DNA. Sample 1 is the heterozygous major
(heterozygous mutant) individual for the Factor V mutation; sample
2 is the homozygous major (wildtype genotype) individual for the
Factor V mutation; and sample 3 is the homozygous minor (homozygous
mutant) individual for the Factor V mutation. 25 bp ladder and Ffv,
the allelic ladder were used as the reference standards to
determine the sizes of the alleles.
[0071] FIG. 8 depicts the analysis of the genomic DNA from the
three samples (heterozygous major, homozygous major, and homozygous
minor, respectively) that were used to detect mutations the Factor
V genomic DNA with the Factor V Leiden mutation kit in the blind
sample identification experiment.
[0072] FIG. 9 depicts the analysis of the blind sample
identification experiment in which samples 1-3 were masked to hide
their identities and labeled arbitrarily as samples a-c.
5. DETAILED DESCRIPTION OF THE INVENTION
[0073] A major aspect of the present invention is to provide for a
biological sample tracking system for use in paternity screening,
genetic screening, prenatal diagnosis, presymptomatic diagnosis,
carrier detection, and forensic chemical analysis laboratories. In
paternity, genetic screening, prenatal diagnosis, presymptomatic
diagnosis, carrier detection and forensic analysis, it is necessary
that the sample and result obtained be uniquely identifiable, often
even years after the analysis has been completed.
[0074] A prevalent concern of diagnostic laboratories is the
considerable amount of paperwork required to track a sample through
various stages of collection, preparation and analysis. In a
typical study, there is about a 60% to 70% chance of clerical error
on behalf of laboratory personnel, and a significant proportion of
these errors result in misidentification of a sample. The
collection and subsequent testing of biological samples can involve
many sequential steps. Inevitably, biological samples will be
stored among many similar biological samples. It is therefore
important that the biological samples be uniquely identified so
that information such as the time, date and place of collection and
subsequent testing be determinable at all times. The identification
data may be handwritten on a label, either before or after
application to the sample vial containing the biological
sample.
[0075] Opportunity for error exists in application of the
identification labels prepared for the biological sample or, at a
later stage, during the reading of handwritten labels. While
printers and computer-based barcodes can theoretically be used to
overcome legibility problems, there is always the chance of a
typographical input error or even tampering with the printed label
or barcode itself.
[0076] The heretofore unappreciated solution to this problem is to
perform a DNA fingerprint or genotyping analysis at the same time
as the diagnostic or prognostic analysis thereby uniquely linking
the results of the diagnosis to the particular individual being
diagnosed. This simultaneous genotyping step for sample
identification purposes should tremendously simplify sample
tracking in diagnostic laboratories.
[0077] One of the advantages of the method of the present invention
is that the molecular barcode of the genomic DNA of the sample can
be determined at any time during the collection or processing of a
biological sample. In one embodiment, the unique molecular barcode
is determined at the time of sample collection, prior to any
further diagnostic, prognostic and/or target organism detection. In
this way, the opportunities for misidentification and/or handling
errors are considerably decreased. Once the molecular barcode of
the sample is determined, a record is kept of the molecular barcode
that corresponds to each sample for later sample identity
verification.
[0078] In another embodiment, the unique molecular barcode of the
genomic DNA sample is determined simultaneously during processing
of the genomic DNA sample for diagnostic, prognostic and/or target
organism detection. In this instance, because the unique molecular
barcode is determined during processing of the genomic DNA sample
for diagnostic, prognostic and/or target organism detection, the
only requirement is that the particular tests employed must be
compatible.
[0079] This completely automatable technology for screening
biological samples and comparing their unique DNA marker profiles
permits rapid and efficient identification of individual
biomolecules whose presence, absence or altered expression can be
or is associated with a disease or condition of interest. Thus, in
its simplest form, the present invention provides a method and an
apparatus for analyzing a biological sample for the presence of a
disease condition and/or disease predisposition and/or infectious
agent and simultaneously determining the DNA fingerprint or
genotype of the biological sample so as to provide internal
identification of the biological sample.
[0080] 5.1. Methods of Determining the Molecular Barcode of a
Subject
[0081] In general, DNA fingerprinting or DNA typing for the
determination of one's molecular barcode, as well as other methods
of genotyping, profiling and DNA identification analysis, refer to
the characterization of either similarities or one or more
distinctive features in the genetic make up or genome of an
individual, a variety or race, or a species. The general rule is
that the closer the genetic relationship is, the greater the
identity or more appropriate the similarity of genomes, and
consequently distinctive features in the genome will be rarer.
These similar or distinctive features can be revealed by analyzing
the DNA of an organism after cleaving the DNA with a restriction
endonuclease. Because of their high degree of sequence specificity,
restriction endonucleases will cleave DNA molecules in a very
specific fashion. The result is that a reproducible set of DNA
fragments will be produced. DNA fragments can be fractionated
according to their length on porous matrices, or gels, yielding
typical banding patterns, which constitutes a DNA fingerprint or
molecular barcode of the organism's genetic makeup.
[0082] When the fingerprints of very closely related species,
varieties or races are compared, the DNA fingerprints can be
identical or very similar. When differences are observed within
otherwise identical DNA fingerprints, such differences are referred
to as DNA polymorphisms: these are new DNA fragments which appear
in a DNA fingerprint. The DNA is said to be polymorphic at that
position and the novel DNA fragment can be used as a DNA marker.
DNA polymorphisms detected in DNA fingerprints obtained by
restriction enzyme cleavage can result from any of the following
alterations in the DNA sequence: mutations abolishing the
restriction endonuclease target site, mutations creating new target
sites, insertions, deletions or inversions between the two
restriction sites.
[0083] Such DNA polymorphisms are generally referred to as
Restriction Fragment Length Polymorphisms or RFLPs. Such mutational
changes will behave as bona fide genetic markers when they are
inherited in a mendelian fashion. Consequently, DNA polymorphisms
can be used as genetic markers in much the same way as other
genetic markers: in parentage analysis, in genetic studies on the
inheritance of traits, or in the identification of individuals.
[0084] In accordance with the present invention, the terms
genotyping, fingerprinting, and DNA typing are meant to include the
use of any means known to those skilled in the art for determining
an individual's genotype molecular barcode. For example, and
without limitation, and as will be explained in more detail below,
techniques for genotyping can be nucleic acid based including size
fractionation, allele specific oligonucleotide (ASO) hybridization,
sequencing, restriction fragment length polymorphism (RFLP)
analysis, denaturation temperature analysis, mass spectrometry
analysis, etc. The genetic typing may be performed on genomic DNA,
mitochondrial DNA or may be based on typing the RNA present in a
cell. See e.g., Zang Y. H. & McCabe E. R., RNA Analysis from
Newborn Screening Dried Blood Specimens, Hum. Genet. (1992) 89(3):
311-4. Further, the typing methodology may be any that is currently
used in the art, including techniques that are sequence based, size
analysis based, hybridization based or a combination thereof.
Generally, DNA samples may be amplified before analysis in a PCR or
PCR-like reaction. Genetic typing methodologies are well known to
those of ordinary skill in the art.
[0085] DNA fingerprinting to determine one's molecular barcode as
used in the context of the present invention is therefore a broad
term used to designate methods for assessing sequence differences
in DNA isolated from various sources, e.g., by comparing the
presence of marker DNA in samples of isolated DNA. Typically, DNA
fingerprinting is used to analyze and compare DNA from different
species of organisms or DNA from different individuals of the same
species. DNA sequence differences detected by fingerprinting are
referred to as DNA polymorphisms. The presence of a DNA
polymorphism in an organism's DNA can serve to indicate that the
genetic origin of such an organism is different from the genetic
origin of organisms whose DNA does not have the polymorphism. Such
DNA polymorphisms can result, e.g., from insertion, deletion,
and/or mutation events in the genome.
[0086] Thus, in accordance with one embodiment of the present
invention there is provided a method for identification of a
biological sample of a mammal, which comprises the steps of:
[0087] a) obtaining a genomic DNA sample from said mammal;
[0088] b) performing amplification of the genomic DNA sample using
at least two primers for amplification of at least two DNA markers;
and
[0089] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0090] In accordance with a preferred embodiment of the present
invention there is provided a method for identification of a
biological sample of a mammal, which comprises the steps of:
[0091] a) obtaining a genomic DNA sample from said mammal;
[0092] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers, wherein said DNA marker amplification primers are selected
from the group consisting of the following primer pairs:
3 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto; and
[0093] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0094] In accordance with the present invention, any genetic-marker
technologies are adaptable to the determination of one's molecular
barcode, including restriction-fragment-length polymorphism (RFLP)
Bostein et al (1980) Am J Hum Genet 32:314-331; single strand
conformation polymorphism (SSCP) Fischer et al. (1983) Proc Natl
Acad Sci USA 80:1579-1583; Orita et al. (1989) Genomics 5:874-879;
amplified fragment-length polymorphism (AFLP) Vos et al. (1995)
Nucleic Acids Res 23:4407-4414; microsatillite or single-sequence
repeat (SSR) Weber J L and May P E (1989) Am J Hum Genet
44:388-396; rapid-amplified polymorphic DNA (RAPD) Williams et al
(1990) Nucleic Acids Res 18:6531-6535; sequence tagged site (STS)
Olson et al. (1989) Science 245:1434-1435; genetic-bit analysis
(GBA) Nikiforov et al (1994) Nucleic Acids Res 22:4167-4175 (the
entire contents of which are incorporated by referemnce in its
entirety); allele-specific polymerase chain reaction (ASPCR) Gibbs
et al. (1989) Nucleic Acids Res 17:2437-2448, Newton et al. (1989)
Nucleic Acids Res 17:2503-2516; nick-translation PCR (e.g.,
TaqMan.TM.) Lee et al. (1993) Nucleic Acids Res 21:3761-3766; and
allele-specific hybridization (ASH) Wallace et al. (1979) Nucleic
Acids Res 6:3543-3557, Sheldon et al. (1993) Clinical Chemistry
39(4):718-719 (the entire contents of each of which are hereby
incorporated by reference in their entirety). Kits for RAPD and
AFLP analyses are commercially available, e.g., from Perkin Elmer
Applied Biosystems (Foster City, Calif.). For example, the
restriction fragment length polymorphism (RFLP) technique employs
restriction enzyme digestion of DNA, followed by size separation of
the digested DNA by gel electrophoresis, and hybridization of the
size-separated DNA with a specific polynucleotide fragment.
Differences in the size of the restriction fragments to which the
polynucleotide probe binds reflect sequence differences in DNA
samples, or DNA polymorphisms. See Tanksley, Biotechnology
7:257-264 (1988).
[0095] 5.2. Methods of Diagnosis of a Subject
[0096] In accordance with the present invention, the particular
methods that can be employed for the diagnosis of a subject to
determine whether a subject is afflicted with a particular disease
or disorder, or is at risk of developing a particular disorder, the
existence of genetic lesions or mutations can be detected by, for
example, but not limited to, ascertaining the existence of at least
one of: 1) a deletion of one or more nucleotides from a given gene;
2) an addition of one or more nucleotides to a given gene; 3) a
substitution of one or more nucleotides of a given gene; 4) a
chromosomal rearrangement of a given gene; 5) an alteration in the
level of a messenger RNA transcript of a given gene; 6) an aberrant
modification of a given gene, such as of the methylation pattern of
the genomic DNA; 7) the presence of a non-wild type splicing
pattern of a messenger RNA transcript of a given gene; 8) a
non-wild type level of a the protein encoded by a given gene; 9) an
allelic loss of a given gene; and 10) an inappropriate
post-translational modification of the protein encoded by a given
gene. As described herein, there are a large number of assay
techniques known in the art which can be used for detecting lesions
in a given gene.
[0097] For example, in certain embodiments of the invention,
detection of a genetic lesion involves the use of a probe/primer in
a polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos.
4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or,
alternatively, in a ligation chain reaction (LCR) (see, e.g.,
Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al.
(1994) Proc. Natl. Acad. Sci. USA 91:360-364), the latter of which
can be particularly useful for detecting point mutations in a given
gene (see, e.g., Abravaya et al. (1995) Nucleic Acids Res.
23:675-682)(the entire contents of each of which are hereby
incorporated by reference in their entirety). This method can
include the steps of collecting a sample of cells from a patient,
isolating nucleic acid (e.g., genomic, mRNA or both) from the cells
of the sample, contacting the nucleic acid sample with one or more
primers which specifically hybridize to the selected gene under
conditions such that hybridization and amplification of the gene
(if present) occurs, and detecting the presence or absence of an
amplification product, or detecting the size of the amplification
product and comparing the length to a control sample. It is
anticipated that PCR and/or LCR may be desirable to use as a
preliminary amplification step in conjunction with any of the
techniques used for detecting mutations described herein.
[0098] In certain embodiments of the invention, alternative
amplification methods include, but are not limited to, self
sustained sequence replication (Guatelli et al. (1990) Proc. Natl.
Acad. Sci. USA 87:1874-1878), transcriptional amplification system
(Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177),
Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197)(the
entire contents of each of which are hereby incorporated by
reference in their entirety), or any other nucleic acid
amplification method, followed by the detection of the amplified
molecules using techniques well known to those of skill in the art.
These detection schemes are especially useful for the detection of
nucleic acid molecules if such molecules are present in very low
copy numbers.
[0099] In another embodiment of the present invention, mutations in
a selected gene from a sample cell can be identified by alterations
in restriction enzyme cleavage patterns. For example, sample and
control DNA is isolated, amplified (optionally), digested with one
or more restriction endonucleases, and fragment length sizes are
determined by gel electrophoresis and compared. Differences in
fragment length sizes between sample and control DNA indicates
mutations in the sample DNA. Moreover, the use of sequence specific
ribozymes (see, e.g., U.S. Pat. No. 5,498,531) can be used to score
for the presence of specific mutations by development or loss of a
ribozyme cleavage site.
[0100] In other embodiments of the present invention, genetic
mutations can be identified by hybridizing a sample and control
nucleic acids, e.g., DNA or RNA, to high density arrays containing
hundreds or thousands of oligonucleotides probes (Cronin et al.
(1996) Human Mutation 7:244-255; Kozal et al. (1996) Nature
Medicine 2:753-759)(the entire contents of each of which are hereby
incorporated by reference in their entirety). The use of automated
scoring techniques and sophisticated data analysis software permits
the collection of large amounts of data very quickly. (see e.g.,
U.S. Pat. No. 5,827,482; U.S. Pat. No. 5,821,060; U.S. Pat. No.
5,795,716; U.S. Pat. No. 5,763,599; U.S. Pat. No. 5,741,644; U.S.
Pat. No. 5,733,729; U.S. Pat. No. 5,733,509; U.S. Pat. No.
5,731,152; U.S. Pat. No. 5,728,532; U.S. Pat. No. 5,671,303; U.S.
Pat. No. 5,632,957; U.S. Pat. No. 5,605,662; U.S. Pat. No.
5,599,668; U.S. Pat. No. 5,593,839; U.S. Pat. No. 5,571,639; U.S.
Pat. No. 5,561,071; and U.S. Pat. No. 5,445,934 (the entire
contents of each of which are herein incorporated by reference in
their entirety). See also; Wang D. G., et al., Large-scale
identification, mapping, and genotyping of single-nucleotide
polymorphisms in the human genome, Science (1998) 280 (5366):
1077-82; Hacia J. G., et al., Evolutionary sequence comparisons
using high-density oligonucleotide arrays, Nat. Genet. (1998)18(2):
155-8; Livache T., et al., Polypyrrole DNA chip on a silicon
device: example of hepatitis C virus genotyping, Anal. Biochem.
(1998) 255 (2): 188-94; Pastinen T., et al., Minisequencing: a
specific tool for DNA analysis and diagnostics on oligonucleotide
arrays, Genome Res. (1997) 7(6): 606-14; Wang J., et al.,
Nucleic-acid immobilization, recognition and detection at
chronopotentiometric DNA chips, Biosens. Bioelectron. (1997) 12
(7): 587-99; Hacia J. G., et al., Detection of heterozygous
mutations in BRCA1 using high density oligonucleotide arrays and
two-colour fluorescence analysis, Nat. Genet. (1996) 14(4): 441-7;
Schena M., et al., Parallel human genome analysis: microarray-based
expression monitoring of 1000 genes, Proc. Natl. Acad. Sci. Usa
(1996) 93(20): 10614-9; Southern E. M., DNA chips: analysing
sequence by hybridization to oligonucleotides on a large scale,
Trends Genet. (1996) 12(3): 110-5; Stimpson D. I., et al.,
Real-time detection of DNA hybridization and melting on
oligonucleotide arrays by using optical wave guides, Proc. Natl.
Acad. Sci. Usa (1995) 92(14): 6379-83; Pease A. C., et al.,
Light-generated oligonucleotide arrays for rapid DNA sequence
analysis, Proc. Natl. Acad. Sci. Usa (1994) 91(11): 5022-6);
Shumaker et al., Mutation Detection by Solid Phase Primer
Extension, Hum. Mutation (1996) 7:346-54 (the entire contents of
each of which are hereby incorporated by reference in their
entirety).
[0101] For example, and not by way of limitation, genetic mutations
can be identified in two-dimensional arrays containing
light-generated DNA probes as described in Cronin et al., supra.
Briefly, a first hybridization array of probes can be used to scan
through long stretches of DNA in a sample and control to identify
base changes between the sequences by making linear arrays of
sequential overlapping probes. This step allows the identification
of point mutations. This step is followed by a second hybridization
array that allows the characterization of specific mutations by
using smaller, specialized probe arrays complementary to all
variants or mutations detected. Each mutation array is composed of
parallel probe sets, one complementary to the wild-type gene and
the other complementary to the mutant gene.
[0102] In yet another embodiment of the present invention, any of a
variety of sequencing reactions known in the art can be used to
directly sequence a given gene and detect mutations by comparing
the sequence of the sample nucleic acids with the corresponding
wild-type (control) sequence. Examples of sequencing reactions
include those based on techniques developed by Maxim and Gilbert
((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc.
Natl. Acad. Sci. USA 74:5463). It is also contemplated that any of
a variety of automated sequencing procedures can be utilized when
performing the diagnostic assays ((1995) Bio/Techniques 19:448),
including sequencing by mass spectrometry (see, e.g., PCT
Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr.
36:127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol.
38:147-159)(the entire contents of each of which are hereby
incorporated by reference in their entirety).
[0103] Other methods encompassed within the present invention for
detecting mutations in a selected gene include those methods in
which protection from cleavage agents is used to detect mismatched
bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. (1985)
Science 230:1242). In general, the technique of mismatch cleavage
entails providing heteroduplexes formed by hybridizing (labeled)
RNA or DNA containing the wild-type sequence with potentially
mutant RNA or DNA obtained from a tissue sample. The
double-stranded duplexes are treated with an agent which cleaves
single-stranded regions of the duplex such as which will exist due
to base pair mismatches between the control and sample strands.
RNA/DNA duplexes can be treated with RNase to digest mismatched
regions, and DNA/DNA hybrids can be treated with S1 nuclease to
digest mismatched regions.
[0104] In other embodiments of the present invention, either
DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or
osmium tetroxide and with piperidine in order to digest mismatched
regions. After digestion of the mismatched regions, the resulting
material is then separated by size on denaturing polyacrylamide
gels to determine the site of mutation. See, e.g., Cotton et al.
(1988) Proc. Natl. Acad. Sci. USA 85:4397; Saleeba et al. (1992)
Methods Enzymol. 217:286-295 (the entire contents of each of which
are hereby incorporated by reference in their entirety). In a
preferred embodiment, the control DNA or RNA can be labeled for
detection.
[0105] In still another embodiment of the present invention, the
mismatch cleavage reaction employs one or more proteins that
recognize mismatched base pairs in double-stranded DNA (so called
DNA mismatch repair enzymes) in defined systems for detecting and
mapping point mutations in cDNAs obtained from samples of cells.
For example, the mutY enzyme of E. coli cleaves A at G/A mismatches
and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T
mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662)(the
entire contents of which are hereby incorporated by reference in
their entirety). According to an exemplary embodiment, a probe
based on a selected sequence, e.g., a wild-type sequence, is
hybridized to a cDNA or other DNA product from a test cell(s). The
duplex is treated with a DNA mismatch repair enzyme, and the
cleavage products, if any, can be detected from electrophoresis
protocols or the like. See, e.g., U.S. Pat. No. 5,459,039.
[0106] In other embodiments of the present invention, alterations
in electrophoretic mobility will be used to identify mutations in
genes. For example, single strand conformation polymorphism (SSCP)
may be used to detect differences in electrophoretic mobility
between mutant and wild type nucleic acids (Orita et al. (1989)
Proc. Natl. Acad. Sci. USA 86:2766; see also Cotton (1993) Mutat.
Res. 285:125-144; Hayashi (1992) Genet. Anal. Tech. Appl.
9:73-79)(the entire contents of each of which are hereby
incorporated by reference in their entirety). Single-stranded DNA
fragments of sample and control nucleic acids will be denatured and
allowed to renature. The secondary structure of single-stranded
nucleic acids varies according to sequence, and the resulting
alteration in electrophoretic mobility enables the detection of
even a single base change. The DNA fragments may be labeled or
detected with labeled probes. The sensitivity of the assay may be
enhanced by using RNA (rather than DNA), in which the secondary
structure is more sensitive to a change in sequence. In a preferred
embodiment, the subject method utilizes heteroduplex analysis to
separate double stranded heteroduplex molecules on the basis of
changes in electrophoretic mobility (Keen et al. (1991) Trends
Genet. 7:5)(the entire contents of which are hereby incorporated by
reference in their entirety).
[0107] In yet another embodiment of the method of the present
invention, the movement of mutant or wild-type fragments in
polyacrylamide gels containing a gradient of denaturant is assayed
using denaturing gradient gel electrophoresis (DGGE) (Myers et al.
(1985) Nature 313:495)(the entire contents of which are hereby
incorporated by reference in their entirety). When DGGE is used as
the method of analysis, DNA will be modified to insure that it does
not completely denature, for example by adding a GC clamp of
approximately 40 bp of high-melting GC-rich DNA by PCR. In a
further embodiment of the present invention, a temperature gradient
is used in place of a denaturing gradient to identify differences
in the mobility of control and sample DNA (Rosenbaum and Reissner
(1987) Biophys. Chem. 265:12753)(the entire contents of which are
hereby incorporated by reference in their entirety).
[0108] Examples of other techniques for detecting point mutations
include, but are not limited to, selective oligonucleotide
hybridization, selective amplification, or selective primer
extension. For example, oligonucleotide primers may be prepared in
which the known mutation is placed centrally and then hybridized to
target DNA under conditions which permit hybridization only if a
perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki
et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230)(the entire
contents of each of which are hereby incorporated by reference in
their entirety). Such allele specific oligonucleotides are
hybridized to PCR amplified target DNA or a number of different
mutations when the oligonucleotides are attached to the hybridizing
membrane and hybridized with labeled target DNA.
[0109] Alternatively, allele specific amplification technology
which depends on selective PCR amplification may be used in
conjunction with the method of the instant invention.
Oligonucleotides used as primers for specific amplification may
carry the mutation of interest in the center of the molecule (so
that amplification depends on differential hybridization) (Gibbs et
al. (1989) Nucleic Acids Res. 17:2437-2448)(the entire contents of
which are hereby incorporated by reference in their entirety) or at
the extreme 3' end of one primer where, under appropriate
conditions, mismatch can prevent or reduce polymerase extension
(Prossner (1993) Tibtech 11:238)(the entire contents of which are
hereby incorporated by reference in their entirety). In addition,
it may be desirable to introduce a novel restriction site in the
region of the mutation to create cleavage-based detection
(Gasparini et al. (1992) Mol. Cell Probes 6:1)(the entire contents
of which are hereby incorporated by reference in their entirety).
It is anticipated that in certain embodiments of the present
invention amplification may also be performed using Taq ligase for
amplification (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189)(the
entire contents of which are hereby incorporated by reference in
their entirety). In such cases, ligation will occur only if there
is a perfect match at the 3' end of the 5' sequence making it
possible to detect the presence of a known mutation at a specific
site by looking for the presence or absence of amplification.
[0110] Yet another means of analyzing genetic information is
"dynamic allele specific hybridization" (DASH). This technique uses
labeled oligonucleotides in a multiwell format that will fluoresce
when the oligonucleotide exists in a double-stranded form, but not
when it is single-stranded. Adding a single strand of the DNA to be
tested allows the strands to hybridize. The temperature at which
the strands again denature will allow identification of the base at
the SNP. This technique has the advantage that it is technically
simple, not requiring expensive detection devices, such as mass
spectrometers. Furthermore, it is expected that DNA sequencing and
genotyping methodology will continue to evolve and will present
additional viable means of quickly genotyping an individual. See
e.g., Xu L., et al., Electrophore mass tag dideoxy DNA sequencing,
Anal. Chem. (1997) 69(17): 3595-602, Haff L. A., Smirnov I. P.,
Single-nucleotide polymorphism identification assays using a
thermostable DNA polymerase and delayed extraction MALDI-TOF mass
spectrometry, Genome Res. (1997) 7(4): 378-88; Taranenko N. I., et
al., Laser desorption mass spectrometry for point mutation
detection, Genet. Anal. (1996) 13(4): 87-94; Tang K., et al.,
Matrix-assisted laser desorption/ionization mass spectrometry of
immobilized duplex DNA probes, Nucleic Acids Res. (1995) 23(16):
3126-31; Griffin H. G. & Griffin A. M., DNA sequencing. Recent
innovations and future trends, Appl. Biochem. Biotechnol. (1993)
38(1-2): 147-59; Fauser S. & Wissinger B., Simultaneous
detection of multiple point mutations using fluorescence-coupled
competitive primer extension, Biotechniques (1997) 22(5): 964-8;
Fox S. A., et al., Rapid genotyping of hepatitis C virus isolates
by dideoxy fingerprinting, J. Virol. Methods (1995) 53(1): 1-9 (the
entire contents of each of which are hereby incorporated by
reference in their entirety).
[0111] In certain embodiments of the method of the present
invention, any array of markers with a reasonably high probability
of individualization is sufficient for these purposes. The markers
can be Variable Number Tandem Repeats (VNTRs), short tandem repeats
(STRs), CTRs, SNPs, microsatellites, etc. The number of markers
that can be used herein is virtually limitless and the reader is
referred to GENBANK and the literature for identification of
markers which have been successfully used in genotyping
methodologies. In the case of STRs, variable numbers of STRs may be
used in the methods of the invention. For example, from two to
thirteen different STR markers may be employed. A more preferred
range of STR markers would be from about five to about ten STR
markers. The most preferred would be at least five STR markers
[0112] By way of example, and not by way of limitation,
representative examples of STRs that may be used in the methods of
the present invention include those which the Federal Bureau of
Investigation (FBI) use in the identification of perpetrators of
violent crime. For example, In 1997, the FBI announced the
selection of 13 STR loci to constitute the core of the United
States national database, CODIS. All CODIS STRs are tetrameric
repeat sequences.
4 Locus D3S1358 vWA FGA D8S1179 D21S11 D18S51 D5S818 Genotype 15,
18 16, 16 19, 24 12, 13 29, 31 12, 13 11, 13 Frequency 8.2% 4.4%
1.7% 9.9% 2.3% 4.3% 13% Locus D13S317 D7S820 D16S539 THO1 TPOX
CSF1PO AMEL Genotype 11, 11 10, 10 11, 11 9, 9.3 8, 8 11, 11 X Y
Frequency 1.2% 6.3% 9.5% 9.6% 3.52% 7.2% (Male)
[0113] The primers and oligonucleotides contemplated for use in the
methods of the present invention are preferably DNA, and can be
synthesized using standard techniques and, when appropriate,
detectably labeled using standard methods (Ausubel et al., supra).
Detectable labels that can be used to tag the primers and
oligonucleotides used in the methods of the invention include, but
are not limited to, digoxigenin, fluorescent labels (e.g.,
fluorescein and rhodamine), enzymes (e.g., horseradish peroxidase
and alkaline phosphatase), biotin (which can be detected by
anti-biotin specific antibodies or enzyme-conjugated avidin
derivatives), radioactive labels (e.g., .sup.32P and .sup.125I),
calorimetric reagents, and chemiluminescent reagents. The labels
used in the methods of the invention are detected using standard
methods.
[0114] The specific binding pairs useful in the methods of the
invention include, but are not limited to, avidin-biotin,
streptavidin-biotin, hybridizing nucleic acid pairs, interacting
protein pairs, antibody-antigen pairs, reagents containing
chemically reactive groups (e.g., reactive amino groups), and
nucleic acid sequence-nucleic acid binding protein pairs.
[0115] The solid supports useful in the methods of the invention
include, but are not limited to, agarose, acrylamide, and
polystyrene beads; polystyrene microtiter plates (for use in, e.g.,
ELISA); and nylon and nitrocellulose membranes (for use in, e.g.,
dot or slot blot assays).
[0116] Some methods of the invention employ solid supports
containing arrays of nucleic acid probes. In these cases, solid
supports made of materials such as glass (e.g., glass plates),
silicon or silicon-glass (e.g., microchips), or gold (e.g., gold
plates) can be used. Methods for attaching nucleic acid probes to
precise regions on such solid surfaces, e.g., photolithographic
methods, are well known in the art, and can be used to make solid
supports for use in the invention. (For example, see, Schena et
al., Science 270:467-470, 1995; Kozal et al., Nature Medicine
2(7):753-759, 1996; Cheng et al., Nucleic Acids Research
24(2):380-385, 1996; Lipshutz et al., BioTechniques 19(3):442-447,
1995; Pease et al., Proc. Natl. Acad. Sci. USA 91:5022-5026, 1994;
Fodor et al., Nature 364:555-556, 1993; Pirrung et al., U.S. Pat.
No. 5,143,854; and Fodor et al., WO 92/10092.)(the entire contents
of each of which are hereby incorporated by reference in their
entirety).
[0117] Thus, in accordance with one aspect of the present invention
a method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample, wherein the result obtained from the diagnosis
is thereby intimately associated with the unique molecular barcode
of the sample of the subject being diagnosed.
[0118] Thus, in accordance with yet another preferred embodiment, a
method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample by VNTR analysis, wherein the result obtained
from the diagnosis is thereby intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
[0119] In accordance with yet another preferred embodiment, a
method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample by STR analysis, wherein the result obtained from
the diagnosis is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0120] In accordance with yet another preferred embodiment, a
method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample by CTR analysis, wherein the result obtained from
the diagnosis is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0121] In accordance with yet another preferred embodiment, a
method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample by SNP analysis, wherein the result obtained from
the diagnosis is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0122] In accordance with yet another preferred embodiment, a
method is provided for the diagnosis of a subject to determine
whether a subject is afflicted with a particular disease or
disorder, or is at risk of developing a particular disorder,
coupled with the identification of the molecular barcode of the
biological sample by microsatellite analysis, wherein the result
obtained from the diagnosis is thereby intimately associated with
the molecular barcode of the sample of the subject being
diagnosed.
[0123] In certain preferred embodiments, the diagnosis is for the
purposes of, but not limited to, paternity, genetic screening,
prenatal diagnosis, presymptomatic diagnosis, carrier detection,
and/or forensic chemical analysis.
[0124] Thus, in one embodiment of the present invention, a method
is provided for identification of a biological sample of a subject
undergoing diagnosis to determine whether the subject is afflicted
with a particular disease or disorder, or is at risk of developing
a particular disorder comprising
[0125] a) obtaining a genomic DNA sample from a subject;
[0126] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0127] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0128] d) performing diagnosis of the subject's genomic DNA sample
to determine whether the subject is afflicted with a particular
disease or disorder, or is at risk of developing a particular
disease or disorder, wherein the result obtained from said
diagnosis step is intimately associated with the molecular barcode
of the sample of the subject being diagnosed.
[0129] In yet another preferred embodiment of the present
invention, a method is provided for identification of a biological
sample of a subject undergoing diagnosis to determine whether the
subject is afflicted with a particular disease or disorder, or is
at risk of developing a particular disorder comprising
[0130] a) obtaining a genomic DNA sample from a subject;
[0131] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers wherein said DNA marker amplification primers are selected
from the group consisting of the following primer pairs:
5 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto;
[0132] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0133] d) performing diagnosis of the subject's genomic DNA sample
to determine whether the subject is afflicted with a particular
disease or disorder, or is at risk of developing a particular
disease or disorder, wherein the result obtained from said
diagnosis step is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0134] In accordance with yet another embodiment of the present
invention, the method of the invention can also be used to detect
genetic lesions or mutations, thereby determining if a subject with
the lesioned gene is at risk for a disorder characterized aberrant
expression or activity of a given polypeptide, coupled with the
identification of the molecular barcode of the biological sample,
wherein the result obtained from the diagnosis is thereby
intimately associated with the molecular barcode of the sample of
the subject being diagnosed.
[0135] In yet another embodiment of the present invention, a method
is provided for identification of a biological sample of a subject
undergoing screening for genetic lesions or mutations to determine
if the subject with a lesioned gene is at risk for a disease or
disorder characterized by aberrant expression or activity of a
given polypeptide comprising
[0136] a) obtaining a genomic DNA sample from a subject;
[0137] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0138] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0139] d) performing screening of the subject's genomic DNA sample
for detection of genetic lesions or mutations in said genomic DNA
sample to determine if a subject with a lesioned gene is at risk
for a disease or disorder characterized by aberrant expression or
activity of a given polypeptide; wherein the result obtained from
said screening step is thereby intimately associated with the
molecular barcode of the sample of the subject being screened.
[0140] In yet another embodiment of the present invention, a method
is provided for identification of a biological sample of a subject
undergoing screening for genetic lesions or mutations to determine
if the subject with a lesioned gene is at risk for a disease or
disorder characterized by aberrant expression or activity of a
given polypeptide comprising
[0141] a) obtaining a genomic DNA sample from a subject;
[0142] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers wherein said DNA marker amplification primers are selected
from the group consisting of the following primer pairs:
6 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto;
[0143] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample;
[0144] d) performing screening of the subject's genomic DNA sample
for detection of genetic lesions or mutations in said genomic DNA
sample to determine if a subject with a lesioned gene is at risk
for a disease or disorder characterized by aberrant expression or
activity of a given polypeptide; wherein the result obtained from
said screening step is intimately associated with the molecular
barcode of the sample of the subject being screened.
[0145] In accordance with yet another preferred embodiment, the
method of the present invention includes diagnosing, in a sample of
cells from a subject, the presence or absence of a genetic lesion
or mutation characterized by at least one of an alteration
affecting the integrity of a gene encoding a given polypeptide, or
the mis-expression of a gene encoding a given polypeptide, coupled
with the simultaneous identification of the molecular barcode of
the sample, wherein the result obtained from said diagnosis is
intimately associated with the molecular barcode of the sample of
the subject being diagnosed.
[0146] 5.3. Methods of Diagnosis of a Subject to Detect the
Presence of a Target Microorganism
[0147] In addition to the identification of samples of subjects
undergoing paternity screening, genetic screening, prenatal
diagnosis, presymptomatic diagnosis, disease carrier detection, or
forensic chemical analysis, the methods of the present invention
also have application in methods of identifying samples of subjects
undergoing diagnosis to determine the presence or absence of
microorganisms.
[0148] In this aspect of the present invention, the target
microorganism may include, for example, without limitation, virus,
bacteria, fungi or protozoa or any combination thereof. Specific
examples of bacteria to which the methods of the invention can be
suitably applied include bacteria such as, for example, without
limitation, Mycobacteria tuberculosis, Rickettsia rickettsii,
Ehrlichia chaffeensis, Borrelia burgdorferi, Yersinia pestis,
Treponema pallidum, Chlamydia trachomatis, Chlamydia pneumoniae,
Mycoplasma pneumoniae, Mycoplasma sp., Legionella pneumophila,
Legionella dumoffii, Mycoplasma fermentans, Ehrlichia sp.,
Haemophilus influenzae, Neisseria meningitidis, Streptococcus
pneumonia, S. agalactiae, and Listeria monocytogenes. Specific
examples of viruses to which the methods of the invention can be
suitably applied include viruses such as, for example, without
limitation, Human Immunodeficiency Virus Type 1 (HIV-1), Human
T-Cell Lymphotrophic Virus Type 1 (HTLV-1), Hepatitis B Virus
(HBV), Hepatitis C Virus (HCV), Herpes Simplex, Herpesvirus 6,
Herpesvirus 7, Epstein-Barr Virus, Cytomegalovirus,
Varicella-Zoster Virus, JC Virus, Parvovirus B 19, Influenza A, B
and C, Rotavirus, Human Adenovirus, Rubella Virus, Human
Enteroviruses, Genital Human Papillomavirus (HPV), and Hantavirus.
Specific examples of fungi to which the methods of the invention
can be suitably applied include fungi such as, for example, without
limitation, Cryptococcus neoformans, Pneumocystis carinii,
Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides
immitis, and Trichophyton rubrum. Specific examples of protozoa to
which the methods of the invention can be suitably applied include
protozoa such as, for example, without limitation, Trypanosoma
cruzi, Leishmania sp., Plasmodium, Entamoeba histolytica, Babesia
microti, Giardia lamblia, Cyclospora sp. and Eimeria sp.
[0149] Thus, in accordance with one embodiment of the present
invention, a method is provided for the diagnosis of a subject to
detect the presence of a target microorganism, coupled with the
simultaneous identification of the molecular barcode of a
biological sample, wherein the result obtained from the diagnosis
is intimately associated with the molecular barcode of the sample
of the subject being diagnosed.
[0150] In yet another embodiment of the present invention, a method
is provided for identification of a biological sample of a subject
being diagnosed for the presence of a target microorganism
comprising the steps of
[0151] a) obtaining a genomic DNA sample from a subject;
[0152] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers; and
[0153] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0154] d) performing diagnosis of said subject to detect the
presence of a target microorganism; wherein the result obtained
from said diagnosis step is intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
[0155] In yet another preferred embodiment of the present
invention, a method is provided for identification of a biological
sample of a subject being diagnosed for the presence of a target
microorganism comprising the steps of
[0156] a) obtaining a genomic DNA sample from a subject;
[0157] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers wherein said DNA marker amplification primers are selected
from the group consisting of the following primer pairs:
7 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT;
(SEQ ID NO:10) and complementary sequences thereto; and
[0158] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0159] d) performing diagnosis of said subject to detect the
presence of a target microorganism; wherein the result obtained
from said diagnosis step is intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
[0160] 5.4. Biological Samples
[0161] As used herein, it is intended that the term "patient
sample" or "biological sample" refers to any solid or fluid sample
obtained from, excreted by or secreted by any living organism,
including single-celled microorganisms (such as bacteria and
yeasts) and multicellular organisms (such as plants and animals,
for instance a vertebrate or a mammal, and in particular a healthy
or apparently healthy human subject or a human patient affected by
a condition or disease to be diagnosed or investigated).
[0162] A biological sample may be from a biological fluid obtained
from any site (e.g. a tissue homogenate, hair, blood, semen,
vaginal swab, plasma, serum, ascites, pleural effusion,
thoracentesis sample, spinal fluid, lymph fluid, bone marrow, the
external sections of the skin, respiratory, intestinal, and
genito-urinary tracts, stool, urine, sputum, tears, saliva,
mixtures of body fluids, vitreous humor, amniotic fluid, chorionic
villus samples, blood cells, tumors, organs, tissue, and samples of
in vitro cell culture constituents), a transudate, an exudate (e.g.
fluid obtained from an abscess or any other site of infection or
inflammation), or fluid obtained from a joint (e.g. a normal joint
or a joint affected by disease such as for example, without
limitation, rheumatoid arthritis, osteoarthritis, gout or septic
arthritis).
[0163] Alternatively, a biological sample can be obtained from any
organ or tissue (including a biopsy or autopsy specimen) or may
comprise cells (whether primary cells or cultured cells) or medium
conditioned by any cell, tissue or organ. If desired, the
biological sample may be subjected to preliminary processing,
including preliminary separation techniques. For example, cells or
tissues can be extracted and subjected to subcellular fractionation
for separate analysis of biomolecules in distinct subcellular
fractions, e.g. proteins or drugs found in different parts of the
cell. See Deutscher (ed.), 1990, Methods In Enzymology vol. 182,
pp. 147-238 (incorporated herein by reference in its entirety).
[0164] By way of example, and not by way of limitation, in the
analysis of whether a particular gene contains a mutation, most
simply, blood can be drawn and DNA extracted from the cells of the
blood. In addition, prenatal diagnosis can be accomplished by
testing fetal cells, placental cells or amniotic cells for
mutations of a given gene. Alteration of a wild-type gene allele,
whether, for example, by point mutation or deletion, can be
detected by any of the means discussed above. When the probes are
used to detect the presence of the target sequences (for example,
in screening for the presence of a particular disease, or
susceptibility to a particular disorder, the biological sample to
be analyzed, such as, for example, without limitation, blood,
plasma, serum, ascites, pleural effusion, thoracentesis sample,
spinal fluid, lymph fluid, bone marrow, the external sections of
the skin, respiratory, intestinal, and genito-urinary tracts,
stool, urine, sputum, tears, saliva, blood cells, tumors, organs,
tissue and samples of in vitro cell culture constituents, may be
treated, if desired, to extract the nucleic acids. Only a minute
quantity of nucleic acid is required, and the nucleic acid can be
either DNA or RNA (in the case of RNA, a reverse transcription step
is required before the PCR step).
[0165] Thus, in accordance with the present invention, a
"biological nucleic acid" is a nucleic acid (DNA, RNA, a
combination thereof or an analogue thereof) which is isolated from
a biological source or which is synthesized to have a nucleotide
sequence which includes a region of sequence identity to a nucleic
acid isolated from a biological source. Examples of biological
nucleic acids are derived, e.g., from cDNA, genomic DNA isolated
from an animal, genomic DNA isolated from an animal extract,
genomic DNA isolated from an isolated animal tissue, genomic DNA
isolated from an isolated animal tissue extract, genomic DNA
isolated from an animal cell culture, genomic DNA isolated from an
animal cell culture extract, genomic DNA isolated from a
recombinant animal cell comprising a nucleic acid derived from an
animal, genomic DNA isolated from an animal egg, genomic DNA
isolated from an extract of a recombinant animal cell, and/or DNA
isolated from a mitochondria.
[0166] Other examples of biological nucleic acids suitable for use
in the methods of the present invention which involve the analysis
of plant materials for the diagnosis of disease traits and/or for
the detection of infectious agents are those biological nucleic
acids derived, e.g., from genomic DNA isolated from a plant,
genomic DNA isolated from a plant extract, genomic DNA isolated
from an isolated plant tissue, genomic DNA isolated from an
isolated plant tissue extract, genomic DNA isolated from a plant
cell culture, genomic DNA isolated from a plant cell culture
extract, genomic DNA isolated from a recombinant cell comprising a
nucleic acid derived from a plant, genomic DNA isolated from a
plant seed, genomic DNA isolated from an extract of a recombinant
plant cell comprising a nucleic acid derived from a plant, and DNA
isolated from a chloroplast. Certain types of sources are
preferred, depending on the application. For example, plant tissues
or seeds are preferred for performing selection of crops. Animal
tissues are preferred for performing selection of animals. Methods
of isolating DNAs from cells, organelles, tissues, homogenates and
the like are well known in the art, as are methods of making cDNAs
from isolated RNAs or cloned libraries.
[0167] 5.5. Labeling and Detecting Probes
[0168] DNAs from biological samples for use in the methods of the
present invention can be amplified and labeled in several ways,
including, for example, and not by way of limitation, 1)
Chemiluminescence [using both Horseradish Peroxidase and/or
Alkaline Phosphatase with substrates that produce photons as
breakdown products] [kits available from Amersham,
Boehringer-Mannheim, and Life Technologies/Gibco BRL], 2) Color
production [using both Horseradish Peroxidase and/or Alkaline
Phosphatase with substrates that produce a colored precipitate]
[kits available from Life Technologies/Gibco BRL, and
Boehringer-Mannheim], 3) Chemifluorescence using Alkaline
Phosphatase and the substrate AttoPhos [Amersham] or other
substrates that produce fluorescent products, 4) Fluorescence
[using Cy-5 [Amersham], fluorescein, and other fluorescent tags],
5) Radioactivity using end-labeling, nick translation, random
priming, or PCR to incorporate radioactive molecules into the probe
DNA/oligonucleotide. Other methods for labeling and detection will
be readily apparent to one skilled in the art.
[0169] More generally, a probe for use in an in situ detection
procedure, an in vitro amplification procedure (PCR, LCR, etc.),
hybridization techniques (allele-specific hybridization, in situ
analysis, Southern analysis, northern analysis, etc.) or any other
detection procedure herein, can be labeled with any composition
detectable by spectroscopic, photochemical, biochemical,
immunochemical, electrical, optical or chemical means. Useful
labels in the present invention include spectral labels such as
fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red,
rhodamine, dixogenin, biotin, and the like), radiolabels (e.g.,
.sup.3H, .sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.),
enzymes (e.g., horse-radish peroxidase, alkaline phosphatase etc.)
spectral calorimetric labels such as colloidal gold or colored
glass or plastic (e.g. polystyrene, polypropylene, latex, etc.)
beads. The label may be coupled directly or indirectly to a
component of the detection assay employed in the methods (e.g., a
probe, primer, isolated DNA, amplicon, YAC, BAC or the like)
according to methods well known in the art. As indicated above, a
wide variety of labels may be used, with the choice of label
depending on sensitivity required, ease of conjugation with the
compound, stability requirements, available instrumentation, and
disposal provisions. In general, a detector which monitors a
probe-target nucleic acid hybridization is adapted to the
particular label which is used. Typical detectors include
spectrophotometers, phototubes and photodiodes, microscopes,
scintillation counters, cameras, film and the like, as well as
combinations thereof. Examples of suitable detectors are widely
available from a variety of commercial sources known to persons of
skill. Commonly, an optical image of a substrate comprising a
nucleic acid array with particular set of probes bound to the array
is digitized for subsequent computer analysis.
[0170] Because incorporation of radiolabeled nucleotides into
nucleic acids is straightforward, this detection represents a
preferred labeling strategy. Exemplar technologies for
incorporating radiolabels include end-labeling with a kinase or
phoshpatase enzyme, nick translation, incorporation of radio-active
nucleotides with a polymerase and many other well known
strategies.
[0171] Fluorescent labels are also preferred labels, having the
advantage of requiring fewer precautions in handling, and being
amendable to high-throughput visualization techniques. Preferred
labels are typically characterized by one or more of the following:
high sensitivity, high stability, low background, low environmental
sensitivity and high specificity in labeling. Fluorescent moieties,
which are incorporated into the labels of the invention, are
generally are known, including Texas red, dixogenin, biotin, 1- and
2-aminonaphthalene, p,p'-diaminostilbenes, pyrenes, quaternary
phenanthridine salts, 9-aminoacridines, p,p'-diaminobenzophenone
imines, anthracenes, oxacarbocyanine, merocyanine,
3-aminoequilenin, perylene, bis-benzoxazole, bis-p-oxazolyl
benzene, 1,2-benzophenazin, retinol, bis-3-aminopyridinium salts,
hellebrigenin, tetracycline, sterophenol,
benzimidazolylphenylamine, 2-oxo-3-chromen, indole, xanthen,
7-hydroxycoumarin, phenoxazine, calicylate, strophanthidin,
porphyrins, triarylmethanes and flavin. Individual fluorescent
compounds which have functionalities for linking to an element
desirably detected in an apparatus or assay of the invention, or
which can be modified to incorporate such functionalities include,
e.g., dansyl chloride; fluoresceins such as
3,6-dihydroxy-9-phenylxanthydrol; rhodamineisothiocyanate; N-phenyl
1-amino-8-sulfonatonaphthalene; N-phenyl
2-amino-6-sulfonatonaphthalene; 4-acetamido-4-isothiocyanato-sti-
lbene-2,2'-disulfonic acid; pyrene-3-sulfonic acid;
2-toluidinonaphthalene-6-sulfonate;
N-phenyl-N-methyl-2-aminoaphthalene-6- -sulfonate; ethidium
bromide; stebrine; auromine-0,2-(9'-anthroyl)palmitat- e; dansyl
phosphatidylethanolamine; N,N'-dioctadecyl oxacarbocyanine:
N,N'-dihexyl oxacarbocyanine; merocyanine, 4-(3'-pyrenyl)stearate;
d-3-aminodesoxy-equilenin; 12-(9'-anthroyl)stearate;
2-methylanthracene; 9-vinylanthracene;
2,2'(vinylene-p-phenylene)bisbenzoxazole;
p-bis(2-(4-methyl-5-phenyl-oxazolyl))benzene;
6-dimethylamino-1,2-benzoph- enazin; retinol;
bis(3'-aminopyridinium) 1,10-decandiyl diiodide;
sulfonaphthylhydrazone of hellibrienin; chlorotetracycline;
N-(7-dimethylamino-4-methyl-2-oxo-3-chromenyl)maleimide;
N-(p-(2benzimidazolyl)-phenyl)maleimide;
N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin;
4-chloro-7-nitro-2,1,3-benzooxadiazole- ; merocyanine 540;
resorufin; rose bengal; and 2,4-diphenyl-3(2H)-furanone- . Many
fluorescent tags are commercially available from SIGMA chemical
company (Saint Louis, Mo.), Molecular Probes, R&D systems
(Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway,
N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes
Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research,
Inc., GIBCO BRL Life Technologies, Inc. (Gaithersberg, Md.), Fluka
Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland),
and Applied Biosystems (Foster City, Calif.) as well as other
commercial sources known to one of skill.
[0172] 5.6. Apparatus for Use in Method of Determination of the
Molecular Barcode of a Biological Sample
[0173] The methods of the present invention are advantageously
applied to control microfluidic processors to perform
pre-determined analyses of biological and medical samples.
Exemplary analyses include determining the presence of certain
nucleic acids or proteins that may indicate a disease state of an
organism and help in diagnosing the disease state.
[0174] Accordingly, FIG. 3 illustrates the preparation and analysis
of such samples. First, a biological or medical specimen is
obtained, such as samples obtained from the exterior of an
organism, for example, by scraping or swabbing, or from the
interior of an organism, for example, by biopsy or surgical
specimen. Next a sample is prepared from the specimen. This may
include the steps of purifying the specimen from extraneous
material (removing cells where extracellular material is to be
analyzed), lysing cell (where intracellular materials are to be
analyzed), separating the type of material to be analyzed from
other types (for example, nucleic acids from proteins). Finally,
the prepared sample is loaded into a microfluidic processor for
analysis by the systems and methods of this invention.
[0175] The present invention provides control methods, control
systems, and control software for microfluidic devices that operate
by moving discrete micro-droplets through a sequence of determined
configurations. Such microfluidic devices are preferably
constructed in a hierarchical and modular fashion which is
reflected in the preferred structure of the provided methods and
systems. In particular, the methods are structured into low-level
device component control functions, middle-level actuator control
functions, and high-level micro-droplet control functions.
Advantageously, a microfluidic device may thereby be instructed to
perform an intended reaction or analysis by invoking micro-droplet
control function that perform intuitive tasks like measuring,
mixing, heating, and so forth. The systems are preferably
programmable and capable of accommodating microfluidic devices
controlled by low voltages and constructed in standardized
configurations. Advantageously, a single control system can thereby
control numerous different reactions in numerous different
microfluidic devices simply by loading different easily understood
micro-droplet programs. Suitable microfluidic systems are described
in copending application Ser. No. 09/819,105, filed Mar. 28, 2001,
Ser. No. 09/953,921, filed Sep. 18, 2001, and Ser. No. 10/014,519,
filed Dec. 14, 2001, each of which applications is incorporated
herein by reference.
[0176] In accordance with one aspect of the present invention, the
microfluidic processor device apparatus may be used in accordance
with the method of the present invention for identification of a
biological sample of a mammal, which comprises the steps of:
[0177] a) obtaining a genomic DNA sample from said mammal;
[0178] b) performing amplification of the genomic DNA sample using
at least two primers for amplification of at least two DNA markers;
and
[0179] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0180] In accordance with a preferred aspect of the present
invention, the microfluidic processor device apparatus may be used
in accordance with the method of the present invention for
identification of a biological sample of a mammal, which comprises
the steps of:
[0181] a) obtaining a genomic DNA sample from said mammal;
[0182] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers, wherein said primers are selected from the group
consisting of SEQ ID NOS:1 to 10 and complementary sequences
thereto; and
[0183] c) identifying the amplified DNA markers from step b),
wherein the genomic DNA sample's unique combination of amplified
markers represents the molecular barcode for identification of the
biological sample.
[0184] In accordance with yet another aspect of the present
invention, the microfluidic processor device apparatus may be used
in accordance with the method of the present invention for
identification of a biological sample of a subject undergoing
diagnosis to determine whether the subject is afflicted with a
particular disease or disorder, or is at risk of developing a
particular disorder comprising
[0185] a) obtaining a genomic DNA sample from a subject;
[0186] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0187] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0188] d) performing diagnosis of the subject's genomic DNA sample
to determine whether the subject is afflicted with a particular
disease or disorder, or is at risk of developing a particular
disease or disorder, wherein the result obtained from said
diagnosis step is thereby intimately associated with the molecular
barcode of the sample of the subject being diagnosed.
[0189] In accordance with yet another aspect of the present
invention, the microfluidic processor device apparatus may be used
in accordance with the method of the present invention for
identification of a biological sample of a subject undergoing
screening for genetic lesions or mutations to determine if the
subject with a lesioned gene is at risk for a disease or disorder
characterized by aberrant expression or activity of a given
polypeptide comprising
[0190] a) obtaining a genomic DNA sample from a subject;
[0191] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0192] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample;
[0193] d) performing screening of the subject's genomic DNA sample
for detection of genetic lesions or mutations in said genomic DNA
sample to determine if a subject with a lesioned gene is at risk
for a disease or disorder characterized by aberrant expression or
activity of a given polypeptide; wherein the result obtained from
said screening step is thereby intimately associated with the
molecular barcode of the sample of the subject being screened.
[0194] In accordance with yet another aspect of the present
invention, the microfluidic processor device apparatus may be used
in accordance with the method of the present invention for
identification of a biological sample of a subject being diagnosed
for the presence of a target microorganism comprising
[0195] a) obtaining a genomic DNA sample from a subject;
[0196] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers; and
[0197] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0198] d) performing diagnosis of said subject to detect the
presence of a target microorganism; wherein the result obtained
from said diagnosis step is thereby intimately associated with the
molecular barcode of the sample of the subject being diagnosed.
[0199] In accordance with yet another aspect of the present
invention, the microfluidic processor device apparatus may be used
in accordance with the method of the present invention for
identification of a biological sample of a subject undergoing
paternity screening, genetic screening, prenatal diagnosis,
presymptomatic diagnosis, disease carrier detection, or forensic
chemical analysis comprising
[0200] a) obtaining a genomic DNA sample from a subject;
[0201] b) performing DNA amplification of the genomic DNA sample
using at least two primers for amplification of at least two DNA
markers;
[0202] c) identifying the amplified DNA markers of step b), wherein
the genomic DNA sample's unique combination of amplified markers
represents the molecular barcode for identification of the
biological sample; and
[0203] d) performing paternity screening, genetic screening,
prenatal diagnosis, presymptomatic diagnosis, disease carrier
detection, forensic chemical analysis, or any combination thereof,
of the subject's genomic DNA sample, wherein the result obtained
from said paternity screening, genetic screening, prenatal
diagnosis, presymptomatic diagnosis, disease carrier detection, or
forensic chemical analysis step is thereby intimately associated
with the molecular barcode of the sample of the subject being
screened or diagnosed.
[0204] 5.7. Kits for Use in the Methods of the Invention
[0205] The methods of the present invention can be facilitated by
the use of kits which contain the reagents required for carrying
out the genotyping, diagnostic and/or prognostic methods of the
present invention. The kits can contain reagents for carrying out
the analysis of a single polymorphic restriction site (for use in,
e.g., diagnostic methods) or multiple polymorphic restriction sites
(for use in, e.g., genomic mapping). When multiple samples are
analyzed, multiple sets of the appropriate primers and
oligonucleotides are provided in the kit. In addition to the
primers and oligonucleotides required for carrying out the various
methods, the kits may contain the enzymes used in the methods, and
the reagents for detecting the labels, e.g., the substrates for
enzyme labels, etc. The kits can also contain solid substrates for
used in carrying out the method of the invention. For example, the
kits can contain solid substrates, such as glass plates or silicon
or glass microchips, containing arrays of nucleic acid probes.
[0206] Thus, in accordance with the present invention, the methods
of the invention can be facilitated by utilizing pre-packaged
diagnostic kits comprising at least one probe nucleic acid or
antibody reagent described herein, which may be conveniently used,
e.g., in clinical settings to diagnose patients exhibiting symptoms
or family history of a disease or illness involving a particular
gene encoding a polypeptide, coupled with the identification of the
molecular barcode of the biological sample, wherein the result
obtained from the diagnosis is associated with the unique molecular
barcode of the genotype of the subject being diagnosed.
[0207] In accordance with another aspect of the present invention,
a kit is provided which contains the microfluidic device apparatus
of the present invention, primers for a diagnosing the presence of
a particular infectious agent or disease, and instructions for
use.
[0208] The present invention also encompasses kits for use in
sample tracking or quality control during sample processing. In one
embodiment, the kit comprises a plurality of separate containers,
each container containing one or more reagents for determining the
unique molecular barcode of a biological sample, and instructions
for use.
[0209] In yet another embodiment, the kit comprises a plurality of
separate containers, each container containing one or more
amplification primer reagents for determining the unique molecular
barcode of a biological sample, and wherein said amplification
primers are selected from the group consisting of the following
primer pairs:
8 D3S1358 5' Primer ACTGCAGTCCAATCTGGGT (SEQ ID NO:1) 3' primer
ATGAAATCAACAGAGGCTTG; (SEQ ID NO:2) D5S818 5' Primer
GGGTGATTTTCCTCTTTGGT (SEQ ID NO:3) 3' primer TGATTCCAATCATAGCCACA;
(SEQ ID NO:4) D7S820 5' Primer TGTCATAGTTTAGAACGAACTAACG (SEQ ID
NO:5) 3' primer CTGAGGTATCAAAAACTCAGAGG; (SEQ ID NO:6) D13S317 5'
Primer ACAGAAGTCTGGGATGTGGA (SEQ ID NO:7) 3' primer
GCCCAAAAAGACAGACAGAA; (SEQ ID NO:8) and D16S539 5' Primer
GATCCCAAGCTCTTCCTCTT (SEQ ID NO:9) 3' primer ACGTTTGTGTGTGCATCTGT,
(SEQ ID NO:10) and instructions for use.
6. EXAMPLES
6.1. STR Analysis
[0210] As noted above, there are three types of DNA variability
that are commonly used in DNA fingerprinting: restriction fragment
length polymorphism (RFLPs), variable number of tandem repeats
(VNTRs), and short tandem repeats (STRs). STR analysis is a popular
method of DNA fingerprinting, and is one of the techniques employed
for use in conjunction with the HandyLab micropfluidic device
apparatus of the present invention.
[0211] STRs, also known as microsatellite repeats, consist of
repeated sequences of two to seven bases. For example, the
[GT].sub.4 repeat is GTGTGTGT and [GAG].sub.6 is
CAGCAGCAGCAGCAGCAG. The human genome contains hundreds of thousands
of these STRs evenly distributed on all chromosomes. Consequently,
there are thousands of each kind of repeat; that is, thousands of
[GT].about., [CAG].about., [CTG].about., [GATA].about., etc. As a
result, unequivocal determination of the molecular barcode of a
sample depends upon the unique DNA flanking sequences on each side
of a repeat. These flanking sequences allow the analyst to zero in
on a defined area of a hundred or so bases in a human genome that
contains three billion bases.
[0212] By way of illustration, the STR designated D7S820 (GenBank
number G086 16), located on human chromosome 7, contains a
[GATA].about. repeat, where n can range from 6 to 14. The DNA
sequence of a D7S820 STR with twelve GATA repeats is reproduced
below with the [GATA] .sub.12 region capitalized and the unique
flanking regions underlined:
[0213] aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggctg
actatggagt tattttaagg ttaatatata taaagggtat gatagaacac
ttgtcata.about.t ttagaacgaa ctaacGATAG ATAGATAGAT AGATAGATAG
ATAGATAGAT AGATAGATAG ATAgacagat tgatagtttt tttttatctc actaaatagt
ctatagtaaa catttaatta ccaatatttg gtgcaattct gtcaatgagg ataaatgtgg
aatcgttata attcttaaga atatatattc cctct.about.aatt tttatacct
.about.gattttaa ggcc
[0214] It is these flanking sequences that are used to amplify the
region between them. The amplification procedure, known as the
polymerase chain reaction (PCR), enzymatically synthesizes
thousands of copies of the intervening DNA region. This
amplification enables forensic laboratories to generate enough DNA
for analysis from hair roots and blood samples. Only one nanogram
of DNA is required for a successful PCR. In a separate reaction,
the PCR products have their DNA sequence determined. This sequence
reveals the number of repetitive units in the sample. A flow
diagram depicting the steps involved in a typical DNA fingerprint
analysis as conducted in most forensic laboratories is depicted in
FIG. 1.
[0215] A person inherits an equal amount of nuclear DNA from each
parent. Therefore, among all the other DNA passed down from one's
father and mother, one inherits one maternal copy of D7S 820, and
one paternal copy of D7S820. The chromosome diagram depicted in
FIG. 2 tracks STR variability in D7S820 from grandparents to
parents to grandchildren. For ease in following the example, each
copy of D7S820 has a different number of [GATA] repeat units. For
example, the maternal grandfather has one chromosome 7 with
[GATA].sub.7 in its D7S820 STR, and another chromosome 7 with
[GATAJ.sub.8 in its D7S 820 STR. His daughter inherited his [GATAb
STR and his wife's [GATA].sub.9 STR. The relationship of child to
parent can therefore be followed using this one marker.
[0216] 6.2. Determination of the Molecular Barcode of a Biological
Sample Using Short Tandem Repeat Sequences
[0217] Short Tandem Repeat (STR) loci consist of 3-7 nucleotide
repetitive elements. They are highly polymorphic in both length and
the sequences of the repeats, which makes them important genetic
markers for mapping studies, disease diagnosis and human identity
testing. The Polymerase Chain Reaction (PCR) makes it possible to
analyze very small amounts of DNA much faster. In fingerprinting
work mostly STRs with four or five base pair repeats are used. The
detection of the polymorphisms of STR loci is based primarily on
the analysis of the length by means of electrophoresis in
polyacrylamide gels.
[0218] Materials and Methods:
[0219] The buccal epithelial cells of four healthy volunteers were
collected with buccal swabs. The genomic DNA was extracted from
them using standard procedures (Puregene, Gentra Systems). The DNA
was amplified using five specific STR markers from the Combined DNA
Index System (CODIS). The five different STR markers used were
D3S1358, D5S818, D7S820, D13S317, and D16S539. The primer sequences
of these markers were obtained from the GenBank public database as
shown in Table 1. The primers were synthesized by Invitrogen
Technologies. The real time PCR was carried out in a Light Cycler
(Roche Molecular Biochemicals). Each PCR reaction contained 20 ng
of genomic DNA, 1.51 .mu.l of 10.times..times.SYBR PCR reaction mix
(Roche Molecular Biochemicals), 0.9 .mu.l of 25 mM Magnesium
chloride (final concentration of 1.5 mM), 0.125 .mu.l of 60 .mu.M
forward and reverse primer each (final concentration of 7.5 .mu.M)
in a final volume of 15 .mu.l reaction. Conditions used for the PCR
was 94.degree. C. for 2 mm, then 50 cycles of 94.degree. C. for 5
sec, 60.degree. C. for 5 sec, 72.degree. C. for 10 sec. After the
PCR was carried out, 5 .mu.l of 2.times. loading buffer (Invitrogen
Technologies) was added. The reactions were denatured at 95.degree.
C. for 2 mm and immediately placed them on ice. Then 3 .mu.l of the
samples were loaded on a 10% denaturing TBE-Urea polyactylamide gel
(BioRad). Along with the samples, loaded 6 .mu.l of 25 bp ladder
(Invitrogen Technologies) and Ffv allelic ladder mix (Promega). As
used herein, the first F refers to F13A01, the second F refers
FESFPS, and the v refers to WA. The size of the FFv allelic ladder
ranges from 120 bp to 330 bp. Electrophoresis was carried out at
200V for 2 hours with 1.times.TBE buffer. The gels were post
stained with 1.times.SYBR green dye (BMA) for 10 min and the gels
photographed. The above procedure was repeated twice with
additional DNA standards such as 10 bp, 8 bp and 20 bp DNA
standards. Simultaneously, the same genomic DNA used in amplifying
the above markers was used to detect mutations in Factor V Leiden
Kit and Apo B Mutation detection Kit (Roche Molecular Biochemicals)
as a model system for the methods of the present invention. The
respective reactions were carried out and the results were
interpreted according to the manufacturer's protocol.
[0220] Table 1: The STR markers with the forward and reverse primer
sequences that were used for determination of the molecular barcode
of the sample..sup.1 1 Appendix A provides the STR fact sheets
(http://www.cstl.nist.gov/biotech/strbase/str_d3shtm) for each of
the STR markers used in the method of the present invention. Each
STR marker fact sheet provides the chromosomal location, the
GenBank Accession Number, the reported primers and the PCR product
sizes of the observed alleles.
9 STR Marker Forward Primer sequence Reverse Primer sequence
D3S1358 ACTGCAGTCCAATCTGGGT ATGAAATCAACAGAGGCTTG D5S818
GGGTGATTTTCCTCTTTGGT TGATTCCAATCATAGCCACA D7S820
TGTCATAGTTTAGAACGAACTAACG CTGAGGTATCAAAAACTCAGAGG D13S317
ACAGAAGTCTGGGATGTGGA GCCCAAAAAGACAGACAGAA D16S539
GATCCCAAGCTCTTCCTCTT ACGTTTGTGTGTGCATCTGT
[0221] Results:
[0222] FIG. 4 depicts the FYBR green dye stained polyacrylamide gel
of the amplified DNAs of the respective STR markers. The letters A,
B, C and D represent the particular genomic DNA samples. 25 bp
ladder and Ffv, the allelic ladder were used as the reference
standards to determine the sizes of the alleles.
[0223] The polyacrylamide gels were read based on the size of the
FFv allelic ladder sized by the 25 bp ladder. The sizes of the
alleles correspond to the number of repeat sequences in each of the
allele. Since the STRs employed are tetranucleotide markers, the
alleles vary by 4 base pairs each. The size of the alleles and the
number of repeats was referred from the STRBase
(http://www.cstl.nist.gov/biotech/strbase) for all the CODIS
markers. The allele sizes and the corresponding number of repeat
units interpreted from the gels are as shown in Table 2. The
results of the repeated gels were identical, thus confirming the
reproducibility of the reading of the gel (data not shown). The
genotype frequency of each individual's combined profile for all
the five markers typed can be calculated using
http://www.csfs.ca/pplus/profiler.htm. The calculations are shown
in Appendix A
10TABLE 2 Allele sizes and the corresponding number of repeat units
as interpreted from the gels. A B C D STR Allele Allele Allele
Allele Marker Sizes Sizes Sizes Sizes Sizes Repeats Sizes Repeats
D3S1358 127/123 15/14 135/123 17/14 135/131 17/16 127/123 15/14
D5S818 161/149 12/9 149/145 9/8 153/145 10/8 157/145 11/8 D7S820
206/206 8/8 206/194 8/5 201/194 6/5 202/198 7/6 D13S317 185/185
12/12 185/181 12/11 193/169 14/8 193/173 14/9 D16S539 157/153 11/10
141/141 5/5 153/141 10/5 161/149 12/9
[0224] The Factor V Leiden Mutation Detection Kit permits the
detection of a single point mutation of the human Factor V gene.
The wildtype genotype results in a higher melting temperature
(T.sub.M) at about 65.degree. C. The mutant genotype produces one
mismatch and results in a lower T.sub.M of 57.degree. C.
Heterozygous genotypes show both the melting peaks. FIG. 5 depicts
the analysis of the genomic DNA from two buccal epithelial cell
samples that were used to detect mutations with the Factor V Leiden
mutation kit. A is the positive control, which is a heterozygous
mutant. B and C are the two buccal epithelial cell samples. D is
the negative control without the template. From this result, it is
clear that the two buccal samples B and C are wildtype, without the
human Factor V gene point mutation.
[0225] The Apo B mutation Detection Kit permits the detection of
two point mutations at nucleotide position 9774 and 9775 of the
human Apolipoprotein B gene. The wildtype genotype results in a
T.sub.M of about 62.5.degree. C. The C9774T or G9775A point
mutation results in a TM of 57.degree. C. and 53.degree. C.
respectively. The heterozygous genotypes show the melting peaks at
57.degree. C. and 62.5.degree. C. or 53.degree. C. and 62.5.degree.
C. respectively. FIG. 6 depicts the Apo B mutation analysis of the
genomic DNA that was used for determination of the molecular
barcode of the genomic DNA of the buccal epithelial cell samples,
and that was also used in detecting the point mutation in the
Factor V Leiden kit. A--Heterozygous positive control with 9775
point mutation; B--heterozygous positive control with 9774
mutation; C and D are the two buccal epithelial cell samples are
wildtype; E--negative control without any template. From this
result, it is clear that the two C and D samples are wildtype,
without the Apo B point mutation.
[0226] Thus, this experiment demonstrates the applicability of the
method to identify a given mutation in the genomic DNA sample of an
individual, as well as determine the unique molecular barcode of
the genotype of the subject being diagnosed using the individual's
unique combination of amplified markers.
[0227] 6.3. Determination of the Molecular Barcode of a Biological
Sample Using Short Tandem Repeat Sequences: Blind Sample
Identification Experiment:
[0228] Materials and Methods:
[0229] The genomic DNA from heterozygous major (heterozygous
mutant), homozygous major (wildtype genotype) and homozygous minor
(homozygous mutant) individuals for the Factor V mutation was
obtained from Stratagene, Inc. PCR was conducted using the primers
and probe from Factor V Leiden mutation detection kit (Roche
Molecular Biochemicals) and the respective mutations confirmed as
described above. The DNA of these individuals was also genotyped
with the five STR markers--D3S1358, D5S818, D7S820, D13S317 and
D16S539. The PCR was carried out realtime in the Light cycler
(Roche Molecular Biochemicals). Each PCR reaction of the five STRs
contained 5 ng of genomic DNA, 1.5 .mu.l of 10.times.SYBR PCR
reaction mix (Roche Molecular Biochemicals), 0.9 .mu.l of 25 mM
magnesium chloride (final concentration of 1.5 mM), 0.125 .mu.l of
60 .mu.M forward and reverse primer each (final concentration of
7.5 .mu.M) in a final volume of 15 pl reaction. Conditions used for
the PCR were 94.degree. C. for 2 min, then 50 cycles of 94.degree.
C. for 5 sec, 60.degree. C. for 5 sec, 72.degree. C. for 10
sec.
[0230] The blind sample identification experiment was conducted as
follows. The three genomic DNA samples from the heterozygous major,
homozygous major and homozygous minor individuals for the Factor V
mutation were randomly blind masked to hide the true identity of
the individuals' DNA. The masked tubes were then labeled as (a),
(b) and (c). The PCR reaction for the mutation detection was
carried out according to the manufacturers' protocol. Each reaction
had 1.5 .mu.l of 10.times. mutation detection mix containing the
primers, probe, the PCR buffer, magnesium chloride, dNTPs,
polymerase enzyme to which was added 5 ng of DNA from the masked
tube samples. The PCR was performed using the conditions 95.degree.
C. for 30 sec, 45 cycles of 55.degree. C. for 10 sec and 72.degree.
C. for 10 sec, a melting step of 95.degree. C. for 0 sec,
45.degree. C. for 60 sec and 75.degree. C. for 10 sec.
[0231] Results:
[0232] The resultant DNA bands were separated using 10%
polyacrylamide gels (BioRad) by electrophoresis at 190V for 1.5
hrs. FIG. 7 shows the FYBR green stained gels of the blind sample
identification experiment conducted with the Factor V genomic DNA.
Sample 1 is the heterozygous major (heterozygous mutant) individual
for the Factor V mutation; sample 2 is the homozygous major
(wildtype genotype) individual for the Factor V mutation; and
sample 3 is the homozygous minor (homozygous mutant) individual for
the Factor V mutation. Based on the size of the FYBR green stained
DNA bands and their pattern of migration, sample individual (a) was
identified as homozygous major, sample individual (b) was
identified as homozygous minor and sample individual (c) was
identified as heterozygous major. The allele sizes and the
corresponding number of repeats are given in Table #3 below.
11TABLE 3 Allele sizes and the corresponding number of repeat units
as interpreted from the gels: Sample 1/c = heterozygous major.
Sample 2/a = homozygous major. Sample 3/b = homozygous minor.
Sample 1/c Sample 2/a Sample 3/b STR Allele Allele Allele Marker
Sizes Repeats Sizes Sizes Sizes Repeats D3S1358 135/127 17/15
131/123 16/14 127/127 15/15 D5S818 149/145 9/8 149/145 9/8 145/145
8/8 D7S820 206/198 8/6 202/198 7/6 206/202 8/7 D13S317 173/169 9/8
177/173 10/9 177/173 10/9 D16S539 153/145 10/8 153/149 10/9 153/140
10/9
[0233] FIG. 8 depicts the analysis of the genomic DNA from the
three individual samples (heterozygous major (1), homozygous major
(2), and homozygous minor (3), respectively) that were used to
detect mutations the Factor V genomic DNA with the Factor V Leiden
mutation kit in the blind sample identification experiment. From
FIG. 9, it is clear that homozygous major (wildtype genotype)
Factor V mutation has a melting temperature of 65.degree. C., the
heterozygous major (heterozygous mutant) Factor V mutation has a
melting temperature of 57.degree. C. and 65.degree. C., whereas the
homozygous minor (homozygous mutant) Factor V mutation has a
melting temperature of 57.degree. C.
[0234] FIG. 9 depicts the analysis of the blind sample
identification experiment in which individual samples 1-3 were also
masked to hide their identities and subsequently labeled
arbitrarily as individual samples a-c. From FIG. 10, it is clear
that individual sample a represents the homozygous major (wildtype
genotype) Factor V mutation as it has a melting temperature of
65.degree. C., individual sample b represents the homozygous minor
(homozygous mutant) Factor V mutation as it has a melting
temperature of 57.degree. C., and individual sample c represents
the heterozygous major (heterozygous mutant) Factor V mutation as
it has a melting temperature of 57.degree. C. and 65.degree. C.
[0235] Thus, the results show in FIGS. 9 and 10 confirm that
individual sample a is the homozygous major Factor V individual,
individual sample b is the homozygous minor Factor V individual and
individual sample c is the heterozygous major Factor V individual,
thereby confirming the original identity of the masked individual
samples without any error. This blind sample identification
experiment also demonstrates the applicability of the method to
unequivocally identify the molecular barcode for identification of
a biological sample using the genomic DNA sample's unique
combination of amplified markers.
[0236] 6.4. Working or Prophetic Example of HandyLab Apparatus with
STR Analysis
[0237] In this example, the preparation and analysis of biological
samples using the HandyLab apparatus and methods of the invention
are illustrated. First, a biological or medical specimen is
obtained, such as samples obtained from the exterior of an
organism, for example, by scraping or swabbing, or from the
interior of an organism, for example, by biopsy or surgical
specimen. Next a sample is prepared from the specimen. This may
include the steps of purifying the specimen from extraneous
material (removing cells where extracellular material is to be
analyzed), lysing cell (where intracellular materials are to be
analyzed), separating the type of material to be analyzed from
other types (for example, nucleic acids from proteins). Finally,
the prepared sample is loaded into a microfluidic processor for
analysis by the methods of this invention.
[0238] In particular, the microfluidic processor HandyLab apparatus
may be used in accordance with the methods of the present invention
to unequivocally identify a biological sample obtained during
paternity screening or genetic screening of a subject using the
following steps: a) obtaining a biological sample from a subject;
b) performing paternity screening or genetic screening on said
biological sample; and c) simultaneously identifying the DNA
fingerprint of the biological sample, wherein the result obtained
from said screening is associated with the unique DNA fingerprint
biological barcode of the genotype of the subject being
screened.
[0239] The microfluidic processor HandyLab apparatus may also be
used to unequivocally identify a biological sample obtained during
prenatal diagnosis or presymptomatic diagnosis of a subject using
the following steps: a) obtaining a biological sample from a
subject; b) performing prenatal diagnosis or presymptomatic
diagnosis on said biological sample; and c) simultaneously
identifying the DNA fingerprint of the biological sample, wherein
the result obtained from the diagnosis is associated with the
unique DNA fingerprint biological barcode of the genotype of the
subject being diagnosed.
[0240] The microfluidic processor HandyLab apparatus may
additionally be used to unequivocally identify a biological sample
obtained during carrier detection analysis or forensic chemical
analysis of a subject using the following steps: a) obtaining a
biological sample from a subject; b) performing carrier detection
analysis or forensic chemical analysis on said biological sample;
and c) simultaneously identifying the DNA fingerprint of the
biological sample, wherein the result obtained from said analysis
is associated with the unique DNA fingerprint biological barcode of
the genotype of the subject being analyzed.
[0241] The microfluidic processor HandyLab apparatus may also be
used to unequivocally identify a biological sample obtained during
the diagnosis of a subject to determine whether a subject is
afflicted with a particular disease or disorder, or is at risk of
developing a particular disorder using the following steps: a)
obtaining a biological sample from a subject; b) diagnosing a
subject to determine whether a subject is afflicted with a
particular disease or disorder, or is at risk of developing a
particular disorder; and c) simultaneously identifying the DNA
fingerprint of the biological sample, wherein the result obtained
from the diagnosis is associated with the unique DNA fingerprint
biological barcode of the genotype of the subject being
diagnosed.
[0242] The microfluidic processor HandyLab apparatus may also be
used to unequivocally identify a biological sample obtained during
the diagnosis of a subject to detect the presence of a target
microorganism using the following steps: a) obtaining a biological
sample from a subject; b) diagnosing a subject to detect the
presence of a target microorganism in said biological sample; and
c) simultaneously identifying the DNA fingerprint of the biological
sample, wherein the result obtained from the diagnosis is
associated with the unique DNA fingerprint biological barcode of
the genotype of the subject being diagnosed.
[0243] All references cited herein are incorporated herein by
reference in their entirety and for all purposes to the same extent
as if each individual publication or patent or patent application
was specifically and individually indicated to be incorporated by
reference in its entirety for all purposes.
[0244] Many modifications and variations of the present invention
can be made without departing from its spirit and scope, as will be
apparent to those skilled in the art. The specific embodiments
described herein are offered by way of example only, and the
invention is to be limited only by the terms of the appended claims
along with the full scope of equivalents to which such claims are
entitled.
Appendix A
[0245] D3S1358
12 Other Names Chromosomal Location GenBank Accession 3p 11449919;
has 12 repeats
[0246] Repeat: [AGAT], [TCTA]=bottom strand
13 Reported Primers Ref. PCR Primer Sequences Set 1 148, 5'-ACT GCA
GTC CAA TCT GGG T-3' (AGAT strand) 502 5'-ATG AAA TCA ACA GAG GCT
TG-3' (TCTA strand) Set 2 ABI AmpFlSTR .RTM. .RTM. Profiler Plus
.TM. .TM. Set 3 Promega GenePrint .RTM. .RTM. PowerPlex .TM. .TM.
2.1
[0247] PCR Product Sizes of Observed Alleles
14 Allele (Re- peat #) Set 1,3 Set 2 Repeat Structure Ref. 8 99 bp
97 bp variant allele 9 103 bp 101 bp SGM Plus 10 107 bp 105 bp SGM
Plus 11 111 bp 109 bp SGM Plus 12 115 bp 113 bp SGM Plus 13 119 bp
117 bp TCTA[TCTG].sub.2[TCTA].sub.10 729 14 123 bp 121 bp
TCTA[TCTG].sub.2[TCTA].sub.11 668 15 127 bp 125 bp
TCTA[TCTG].sub.3[TCTA].sub.11 668 15' 127 bp 125 bp
TCTA[TCTG].sub.2[TCTA].sub.12 15.2 129 bp 127 bp SGM Plus 16 131 bp
129 bp TCTA[TCTG].sub.3[TCTA].sub.12 668 16' 131 bp 129 bp
TCTA[TCTG].sub.2[TCTA].sub.13 729 16.2 133 bp 131 bp 642 17 135 bp
133 bp TCTA[TCTG].sub.3[TCTA].sub.13 668 17' 135 bp 133 bp
TCTA[TCTG].sub.2[TCTA].sub.14 729 17.1 136 bp 134 bp SGM Plus 18
139 bp 137 bp TCTA[TCTG].sub.3[TCTA].sub.14 668 18.3 142 bp 140 bp
variant allele 19 143 bp 141 bp TCTA[TCTG].sub.3[TCTA].sub.15 729
20 147 bp 145 bp 729
[0248] Allelic Ladders: Commercially available from Applied
Biosystems (ladder allele range: 12-19)
[0249] Common Multiplexes: AmpF1STR Blue, PwerPlex 1.1, Profiler,
Profiler Plus, and COfiler
[0250] D5S818
15 Other Names Chromosomal Location GenBank Accession D5 5q21-q31
G08446; has 11 repeat units AC008512; has 9 repeat units
[0251] Repeat: [AGAT]=GenBank top strand
16 Reported Primers Ref. PCR Primer Sequences Set 1 Promega
GenePrint .RTM..RTM. PowerPlex .TM..TM. 2.1 Set 2 453
5'-GGGTGATTTTCCTCTTTGGT-3' 5'-TGATTCCAATCATAGCCACA-3' Set 3 ABI
AmpFlSTR .RTM..RTM. Profiler Plus .TM..TM.
[0252] PCR Product Sizes of Observed Alleles
17 Allele (Repeat #) Set 1 Set 2 Set 3 Repeat Structure Ref. 7 119
bp 141 bp 134 bp [AGAT].sub.7 721 8 123 bp 145 bp 138 bp
[AGAT].sub.8 721 9 127 bp 149 bp 142 bp [AGAT].sub.9 721 10 131 bp
153 bp 146 bp [AGAT].sub.10 721 11 135 bp 157 bp 150 bp
[AGAT].sub.11 721 12 139 bp 161 bp 154 bp [AGAT].sub.12 721 13 143
bp 165 bp 158 bp [AGAT].sub.13 721 14 147 bp 169 bp 162 bp
[AGAT].sub.14 721 15 151 bp 173 bp 166 bp [AGAT].sub.15 721 16 155
bp 171 bp 170 bp Profiler Plus
[0253] D7S820
18 Other Names Chromosomal Location GenBank Accession D7 7q G08616;
has 12 repeat units AC004848; has 13 repeat units
[0254] Repeat: [GATA]=GenBank top strand
19 Reported Primers Ref. PCR Primer Sequences Set 1 Promega
GenePrint .RTM..RTM. PowerPlex .TM..TM. 1.1 Set 2 ABI AmpFlSTR
.RTM..RTM. Profiler Plus .TM..TM. Set 3 453
5'-TGTCATAGTTTAGAACGAACTAACG-3' 5'-CTGAGGTATCAAAAACTCAGAGG-3'
[0255] PCR Product Sizes of Observed Alleles
20 Allele (Repeat #) Set 1 Set 2 Set 3 Repeat Structure Ref. 5 211
bp 253 bp 194 bp variant allele 6 215 bp 257 bp 198 bp [GATA].sub.6
721 6.3 218 bp 260 bp 201 bp Profiler Plus 7 219 bp 261 bp 202 bp
[GATA].sub.7 721 7.3 222 bp 264 bp 205 bp variant allele 8 223 bp
265 bp 206 bp [GATA].sub.8 721 8.1 224 bp 266 bp 207 bp variant
allele 8.2 225 bp 267 bp 208 bp variant allele 9 227 bp 269 bp 210
bp [GATA].sub.9 721 9.1 228 bp 270 bp 211 bp variant allele 9.3 230
bp 272 bp 213 bp variant allele 10 231 bp 273 bp 214 bp .sup.
[GATA].sub.10 721 10.1 232 bp 274 bp 215 bp variant allele 10.3 234
bp 276 bp 217 bp variant allele 11 235 bp 277 bp 218 bp .sup.
[GATA].sub.11 721 11.1 236 bp 278 bp 219 bp variant allele 12 239
bp 281 bp 222 bp .sup. [GATA].sub.12 721 12.1 240 bp 282 bp 223 bp
variant allele 13 243 bp 285 bp 226 bp .sup. [GATA].sub.13 721 13.1
244 bp 286 bp 227 bp variant allele 14 247 bp 289 bp 230 bp .sup.
[GATA].sub.14 721 15 251 bp 293 bp 234 bp Profiler Plus Allelic
Ladders: Commercially available from Promega and Applied
Biosystems
[0256] Common Multiplexes: PowerPlex, Profiler, COfiler
[0257] D13S317
21 Other Names Chromosomal Location GenBank Accession D13 13q22-q31
G09017; has 13 repeat units AL353628.2
[0258] Repeat: [GATA]=bottom strand (commonly used); [TATC]=GenBank
top strand
22 Reported Primers Ref. PCR Primer Sequences Set 1 Promega
GenePrint .RTM..RTM. PowerPlex .TM..TM. 1.1 Set 2 453
5'-ACAGAAGTCTGGGATGTGGA-3' 5'-GCCCAAAAAGACAGACAGAA-3' Set 3 ABI
AmpFlSTR .RTM..RTM. Profiler Plus .TM..TM.
[0259] PCR Product Sizes of Observed Alleles
23 Allele (Repeat #) Set 1, 2 Set 3 Repeat Structure Ref. 5 157 193
Profiler Plus 7 165 bp 201 [TATC].sub.7 721 7.1 166 202 variant
allele 8 169 bp 205 [TATC].sub.8 721 8.1 170 206 variant allele 9
173 bp 209 [TATC].sub.9 721 10 177 bp 213 [TATC].sub.10 721 10' 177
213 [TATC].sub.10 AATC 721 11 181 bp 217 [TATC].sub.11 721 12 185
bp 221 [TATC].sub.12 721 13 189 bp 225 [TATC].sub.13 721 14 193 bp
229 [TATC].sub.14 721 15 197 bp 233 [TATC].sub.15 721 16 201 237
variant allele
[0260] Allelic Ladders: Commercially available from Promega and
Applied Biosystems
[0261] Common Multiplexes: PowerPlex, Profiler, Profiler Plus
[0262] D16S539
24 Other Names Chromosomal Location GenBank Accession D16 16q22-24
G07925; has 11 repeat units AC024591.3
[0263] Repeat: [GATA]=GenBank top strand
25 Reported Primers Ref. PCR Primer Sequences Set 1 Promega
GenePrint .RTM..RTM. PowerPlex .TM..TM. 1.1 Set 2 CHLC Web
5'-GATCCCAAGCTCTTCCTCTT-3' Site 5'-ACGTTTGTGTGTGCATCTGT-3' Set 3
ABI AmpFlSTR .RTM..RTM. Profiler Plus .TM..TM.
[0264] PCR Product Sizes of Observed Alleles
26 Allele (Repeat #) Set 1 Set 2 Set 3 Repeat Structure Ref. 5 264
bp 141 bp 233 bp [GATA].sub.5 .sub.721 8 276 bp 145 bp 245 bp
[GATA].sub.8 .sub.721 9 280 bp 149 bp 249 bp [GATA].sub.9 .sub.721
10 284 bp 153 bp 253 bp [GATA].sub.10 .sub.721 11 288 bp 157 bp 257
bp [GATA].sub.11 .sub.721 12 292 bp 161 bp 261 bp [GATA].sub.12
.sub.721 13 296 bp 165 bp 265 bp [GATA].sub.13 .sub.721 13.3 299 bp
168 bp 268 bp .sub.variant allele 14 300 bp 169 bp 269 bp
[GATA].sub.14 .sub.721 15 304 bp 173 bp 273 bp [GATA].sub.15
.sub.721 Allelic Ladders: Commercially available from Promega,
Applied Biosystems
[0265] Common Multiplexes: PowerPlex, COfiler
* * * * *
References