U.S. patent application number 10/619485 was filed with the patent office on 2004-08-12 for human amine transporter.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Cao, Liang, Li, Yi, Rosen, Craig A..
Application Number | 20040156841 10/619485 |
Document ID | / |
Family ID | 26789536 |
Filed Date | 2004-08-12 |
United States Patent
Application |
20040156841 |
Kind Code |
A1 |
Li, Yi ; et al. |
August 12, 2004 |
Human amine transporter
Abstract
A Human amine transporter polypeptide and DNA (RNA) encoding
such polypeptide and a procedure for producing such polypeptide by
recombinant techniques is disclosed. Also provided are methods for
detecting agonists and antagonists to such polypeptide and the use
of agonists and antagonists for treating diseases related to the
underexpression and over-expression of the Human amine transporter
of the present invention. Also disclosed are methods for detecting
mutations in the nucleic acid sequence encoding the polypeptide and
for detecting altered levels of the soluble form of the
polypeptide.
Inventors: |
Li, Yi; (Sunnyvale, CA)
; Rosen, Craig A.; (Laytonsville, MD) ; Cao,
Liang; (Bethesda, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
26789536 |
Appl. No.: |
10/619485 |
Filed: |
July 16, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10619485 |
Jul 16, 2003 |
|
|
|
09502018 |
Feb 11, 2000 |
|
|
|
6630443 |
|
|
|
|
09502018 |
Feb 11, 2000 |
|
|
|
09139675 |
Aug 25, 1998 |
|
|
|
6117426 |
|
|
|
|
09139675 |
Aug 25, 1998 |
|
|
|
08471496 |
Jun 6, 1995 |
|
|
|
5798223 |
|
|
|
|
08471496 |
Jun 6, 1995 |
|
|
|
PCT/US95/02645 |
Mar 1, 1995 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
435/320.1; 435/325; 435/69.1; 530/350; 530/388.1; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 14/47 20130101 |
Class at
Publication: |
424/130.1 ;
530/350; 530/388.1; 435/069.1; 435/320.1; 435/325; 536/023.5 |
International
Class: |
A61K 039/395; C07H
021/04; C07K 014/705; C07K 016/18 |
Claims
What is claimed is:
1. An isolated polynucleotide selected from the group consisting
of: (a) a polynucleotide encoding a polypeptide having the deduced
amino acid sequence of SEQ ID No. 2 and fragments, analogs or
derivatives of said polypeptide; and (b) a polynucleotide encoding
a polypeptide having the amino acid sequence encoded by the cDNA
contained in ATCC Deposit No. 75980 and fragments, analogs or
derivatives of said polypeptide.
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 2 wherein said polynucleotide
encodes a polypeptide having the deduced amino acid sequence of SEQ
ID No. 2.
4. The polynucleotide of claim 2 comprising the nucleotide sequence
from nucleotide 1 to nucleotide 2885 of SEQ ID No. 1.
5. A vector containing the DNA of claim 2.
6. A host cell genetically engineered with the vector of claim
5.
7. A process for producing a polypeptide comprising: expressing
from the host cell of claim 6 the polypeptide encoded by said
DNA.
8. A process for producing cells capable of expressing a
polypeptide comprising genetically engineering cells with the
vector of claim 5.
9. A polypeptide selected from the group consisting of (i) a
polypeptide having the deduced amino acid sequence of SEQ ID No. 2
and fragments, analogs or derivatives thereof and (ii) a
polypeptide encoded by the cDNA of ATCC Deposit No. 75980 and
fragments, analog or derivatives of said polypeptide.
10. An antibody against the polypeptide of claim 9.
11. A compound effective as an agonist to the polypeptide of claim
9.
12. A compound effective as an antagonist against the polypeptide
of claim 9.
13. A method for the treatment of a patient having need of human
amine transporter activity comprising: administering to the patient
a therapeutically effective amount of the compound of claim 11.
14. A method for the treatment of a patient having need of human
amine transporter activity comprising: administering to the patient
a therapeutically effective amount of the polypeptide of claim 9,
wherein said therapeutically effective amount of the polypeptide is
administered by providing to the patient DNA encoding said
polypeptide and expressing said polypeptide in vivo.
15. A method for the treatment of a patient having need to inhibit
human amine transporter activity comprising: administering to the
patient a therapeutically effective amount of the compound of claim
12.
16. A soluble fragment of the polypeptide of claim 9 wherein the
polypeptide binds a ligand for the receptor.
17. A process for identifying compounds effective as antagonists or
agonists to the a polypeptide of claim 9 comprising: expressing the
polypeptide on the surface of a cell; contacting the cell with a
ligand known to be transported by the polypeptide and a compound to
be screened; determining the extent of ligand transported by the
polypeptide; and identifying if the compound to be screened is an
agonist or antagonist.
18. A process for determining whether a ligand not known to be
capable of binding to the polypeptide of claim 9 can bind thereto
comprising: contacting a mammalian cell which expresses the human
amine transporter with a potential ligand; detecting the presence
of the ligand which binds to the transporter; and determining
whether the ligand binds to the transporter.
19. A method for diagnosing a disease or a susceptibility to a
disease related to under-expression of the polypeptide of claim 9
comprising: detecting mutations in the nucleic acid sequence
encoding the polypeptide of claim 14 in a sample derived from a
host.
20. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 22 in a sample derived from a host.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 09/502,018, filed Feb. 11, 2000; which is a divisional of U.S.
application Ser. No. 09/139,675, filed Aug. 25, 1998, now U.S. Pat.
No. 6,117,426; which is a divisional of U.S. application Ser. No.
08/471,496, filed Jun. 6, 1995, now U.S. Pat. No. 5,798,223; which
is a Continuation-in-Part of PCT/US95/02645, filed Mar. 1, 1995.
The full disclosures of each of these is herein incorporated by
reference.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is a human amine transporter.
The invention also relates to inhibiting the action of such
polypeptides.
BACKGROUND OF THE INVENTION
[0003] Neurosensory and neuromotor functions are carried out by
neurotransmission. Neurotransmission is the conductance of a nerve
impulse from one neuron, called the presynaptic neuron, to another
neuron, called the postsynaptic neuron, across the synaptic cleft.
Transmission of the nerve impulse across the synaptic cleft
involves the secretion of neurotransmitter substances. The
neurotransmitter is packaged into vesicles in the presynaptic
neuron and released into the synaptic cleft to find its receptor at
the postsynaptic neuron. Transmission of the nerve impulse is
normally transient.
[0004] An essential property of synaptic transmission is the rapid
termination of action following neurotransmitter release. For many
neurotransmitters, including catecholamine, serotonin, and certain
amino acids (e.g., gamma-aminobutyric acid (GABA), glutamate and
glycine), rapid termination of synaptic action is achieved by the
uptake of the neurotransmitter into the presynaptic terminal and
surrounding glial cells. This rapid re-accumulation of a
neurotransmitter is the result of re-uptake by the presynaptic
terminals.
[0005] At presynaptic terminals, the various molecular structures
for re-uptake are highly specific for such neurotransmitters as
choline and the biogenic amines (low molecular weight
neurotransmitter substances such as dopamine, norepinephrine,
epinephrine, serotonin and histamine). These molecular apparatuses
are termed transporters. These transporters move neurotransmitter
substances from the synaptic cleft back across the cell membrane of
the presynaptic neuron into the cytoplasm of the presynaptic
terminus and therefore terminate the function of these substances.
Inhibition or stimulation of neurotransmitter uptake provides a
means for modulating the effects of the endogenous
neurotransmitters.
[0006] Re-uptake of neurotransmitter substances by the transporters
may be sodium-dependent. For instance, the GABA transporter is a
member of the recently described sodium-dependent neurotransmitter
transporter gene family. These transporters are transmembrane
receptor complexes having an extracellular portion, a transmembrane
portion and an intracellular portion. A significant degree of
homology exists in the transmembrane domains of the entire family
of sodium-dependent neurotransmitter transporter proteins, with
considerable stretches of identical amino acids, while much less
homology is apparent in the intracellular and extracellular loops
connecting these domains. The extracellular loop in particular
seems to be unique for each transporter. This region may contribute
to substrate and/or inhibitor specificities.
[0007] Identifying the novel amine transporter of the present
invention and elucidating the structural and functional
distinctions between different types of transporters is important
in understanding the cellular and molecular bases of behavior and
disease.
SUMMARY OF THE INVENTION
[0008] The polypeptide of the present invention has been putatively
identified as an amine transporter. This identification has been
made as a result of amino acid sequence homology to the rat amine
transporter.
[0009] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide which is a human amine
transporter, as well as biologically active and diagnostically or
therapeutically useful fragments, analogs and derivatives
thereof.
[0010] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding a human
amine transporter, including mRNAs, DNAs, cDNAs, genomic DNAs as
well as analogs and biologically active and diagnostically or
therapeutically useful fragments and derivatives thereof.
[0011] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
human amine transporter nucleic acid sequence, under conditions
promoting expression of said protein and subsequent recovery of
said protein.
[0012] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
screening for agonists and antagonists and ligands to such
polypeptide.
[0013] In accordance with yet a further aspect of the present
invention, there is provided a method for utilizing such agonists
for stimulating the amine transporter uptake of neurotransmitter
ligands for the treatment of diseases related to under-expression
of the amine transporter or over-expression of the ligand.
[0014] In accordance with yet another aspect of the present
invention, there is also provided a process for using antagonists
for inhibiting the amine transporter uptake of neurotransmitter
ligands for the treatment of diseases related to over-expression of
the amine transporter or under-expression of the ligand.
[0015] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0016] In accordance with yet a further aspect of the present
invention, there are also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to human amine transporter sequences.
[0017] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to the under-expression and over-expression of the
amine transporter polypeptide and mutations in the nucleic acid
sequences encoding such polypeptide.
[0018] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0019] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE FIGURES
[0020] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0021] FIGS. 1A-1E illustrate the cDNA sequence (SEQ ID NO:1) and
corresponding deduced amino acid sequence (SEQ ID NO:2) of the
human amine transporter of the present invention. The standard
one-letter abbreviations for amino acids are used. Sequencing was
performed using a 373 Automated DNA sequencer (Applied Biosystems,
Inc.). Sequencing accuracy is predicted to be greater than 97%
accurate.
[0022] FIGS. 2A-2B illustrate an amino acid homology alignment
between the amine transporter (SEQ ID NO:2) and a rat amine
transporter (SEQ ID NO:9) (retrieved from Genbank public
database).
DETAILED DESCRIPTION OF THE INVENTION
[0023] The amine transporter of the present invention may be
responsible for re-uptake of one or any of the amine
neurotransmitters present in mammalian cells. Examples of such
amine transporters include dopamine, norepinephrine, epinephrine,
serotonin and histamine, and other amino acid transmitters,
including GABA, glycine and glutamate.
[0024] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 1A-1E (SEQ ID No. 2) or for the mature polypeptide encoded
by the cDNA of the clone deposited as ATCC Deposit No. 75980 on
Dec. 16, 1994 at the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209.
[0025] A polynucleotide encoding a polypeptide of the present
invention may be obtained from a variety of human tissues. The
polynucleotide of this invention was discovered in a cDNA library
derived from a human adrenal gland tumor. It is structurally
related to the amine transporter family. It contains an open
reading frame encoding a protein of 470 amino acid residues. The
protein exhibits the highest degree of homology to the rat amine
transporter with 80% identity and 86% similarity over a 468 amino
acid stretch.
[0026] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIGS. 1A-1E (SEQ ID No. 2) or that of the deposited clone
or may be a different coding sequence which coding sequence, as a
result of the redundancy or degeneracy of the genetic code, encodes
the same mature polypeptide as the DNA of FIGS. 1A-1E (SEQ ID No.
2) or the deposited cDNA.
[0027] The polynucleotide which encodes for the mature polypeptide
of FIGS. 1A-1E (SEQ ID No. 2) or for the mature polypeptide encoded
by the deposited cDNA may include only the coding sequence for the
mature polypeptide or the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0028] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0029] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1A-1E (SEQ ID No. 2) or the polypeptide
encoded by the cDNA of the deposited clone. The variant of the
polynucleotide may be a naturally occurring allelic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0030] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1E (SEQ
ID No. 2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1E (SEQ ID No. 2) or the polypeptide
encoded by the cDNA of the deposited clone. Such nucleotide
variants include deletion variants, substitution variants and
addition or insertion variants.
[0031] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1E (SEQ ID No. 1) or of the
coding sequence of the deposited clone. As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0032] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexahistidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0033] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0034] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0035] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 85%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A-1E (SEQ ID
NO:1) or the deposited cDNA(s).
[0036] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO: 1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0037] Thus, the present invention is directed to polynucleotides
having at least a 85% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0038] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn. 112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0039] The present invention further relates to a human amine
transporter polypeptide which has the deduced amino acid sequence
of FIGS. 1A-1E (SEQ ID No. 2) or which has the amino acid sequence
encoded by the deposited cDNA, as well as fragments, analogs and
derivatives of such polypeptide.
[0040] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A-1E (SEQ ID No. 2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0041] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0042] The fragment, derivative or analog of the polypeptide of
FIGS. 1A-E (SEQ ID No. 2) or that encoded by the deposited cDNA may
be (i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol). Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0043] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0044] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0045] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 80% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 90% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0046] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0047] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0048] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0049] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
human amine transporter genes. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0050] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0051] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0052] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0053] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0054] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0055] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera SJ9; animal cells such as CHO,
HEK, COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0056] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0057] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacd, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0058] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0059] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0060] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0061] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0062] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), alpha-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0063] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0064] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0065] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0066] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0067] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0068] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HEK, HeLa and BHK cell lines. Mammalian expression
vectors will comprise an origin of replication, a suitable promoter
and enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0069] The human amine transporter polypeptide can be recovered and
purified from recombinant cell cultures by methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0070] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0071] Fragments of the full length human amine transporter gene
may be used as a hybridization probe for a cDNA library to isolate
the full length gene and to isolate other genes which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type generally have at least 20 bases. Preferably,
however, the probes have at least 30 bases and generally do not
exceed 50 bases, although they may have a greater number of bases.
The probe may also be used to identify a cDNA clone corresponding
to a full length transcript and a genomic clone or clones that
contain the complete human amine transporter gene including
regulatory and promotor regions, exons, and introns. As an example
of a screen comprises isolating the coding region of the human
amine transporter gene by using the known DNA sequence to
synthesize an oligonucleotide probe. Labeled oligonucleotides
having a sequence complementary to that of the gene of the present
invention are used to screen a library of human cDNA, genomic DNA
or mRNA to determine which members of the library the probe
hybridizes to.
[0072] This invention provides a method for determining amine
neurotransmitters which are transported by the human amine
transporter of the present invention. An example of an assay which
will identify these neurotransmitters comprises infecting mammalian
cells with recombinant vaccinia virus strain VTF-7 encoding a T7
RNA polymerase and following such infection with liposome-mediated
transfection with the amine transporter gene through the use of a
vector, for example, pBSSKII(-). Controlled transfections are also
done with equivalent amounts of vector alone. Assays are performed
eight hours following transfection in modified Krebs-Ringer-HEPES
buffer. Cells are then incubated with [.sup.3H] neurotransmitter
(for example, GABA, dopamine, serotonin, etc.). Uptake is stopped
by placing the cells on ice. Cells are solubilized in one percent
SDS, and the amount of radioactivity accumulated is determined by
liquid scintillation counting. A significant amount of uptake
determines that the particular neurotransmitter is taken up by the
human amine transporter of the present invention by determining
background using control transfections with pBSSKII for each assay
and subtracting the values obtained from the signals determined for
the specific amine neurotransmitters.
[0073] This invention also provides a method of detecting
expression of an amine transporter on the surface of a cell by
detecting the presence of mRNA coding for an amine transporter.
This method comprises obtaining total mRNA from the cell using
methods well-known in the art and contacting the mRNA so obtained
with a nucleic acid probe of at least 15 nucleotides and which is
capable of specifically hybridizing with a sequence included within
the sequence of a nucleic acid molecule encoding a human amine
transporter, under hybridizing conditions, detecting the presence
of mRNA hybridized to the probe, and thereby detecting the
expression of the amine transporter by the cell. Hybridization of
probes to target nucleic acid molecules such as mRNA molecules
employs techniques well known in the art. However, in one
embodiment of this invention, nucleic acids are extracted by
precipitation from lysed cells and the mRNA is isolated from the
extract using a column which binds the poly-A tails of the mRNA
molecules. The mRNA is then exposed to radioactively labelled probe
on a nitrocellulose membrane, and the probe hybridizes to and
thereby labels complementary mRNA sequences. Binding may be
detected by autoradiography or scintillation counting. However,
other methods for performing these steps are well known to those of
skill in the art.
[0074] Alternatively, an antibody directed to the human amine
transporter may be employed under conditions permitting binding of
the antibody to the transporter, and detecting the presence of the
transporter on the surface of the cell. Such a method may be
employed for determining whether a given cell is defective in
expression of the amine transporter. Detection methods include
fluorescent markers bound to the antibodies.
[0075] The invention also provides a method for determining whether
a compound not known to be capable of specifically binding to a
human amine transporter can specifically bind to the human amine
transporter, which comprises contacting a mammalian cell comprising
a plasmid adapted for expression in a mammalian cell which plasmid
further comprises a DNA which expresses the amine transporter on
the cell surface with the compound under conditions permitting
binding of ligands known to bind to the amine transporter,
detecting the presence of any compound bound to the mammalian amine
transporter, the presence of bound compound indicating that the
compound is capable of specifically binding to the human amine
transporter.
[0076] This invention also provides a method of screening drugs to
identify drugs which specifically interact with, and bind to a
human amine transporter on the surface of a cell which comprises
contacting a mammalian cell which expresses the human amine
transporter on the surface of a cell with a plurality of drugs,
detecting those drugs which bind to the cell, and thereby
identifying drugs which specifically interact with, and bind to,
the human amine transporter.
[0077] The present invention further provides a method for
identifying agonist or antagonist compounds to the human amine
transporter of the present invention by the employment of
competition assays. An example of such an assay for identifying
antagonists comprises contacting a neuronal cell which expresses
the human amine transporter on the surface thereof with a known
neurotransmitter, in the presence of a potential compound to
determine the amount of neurotransmitter transported. Controls may
also be prepared in the absence of the potential compound and the
amount of amine neurotransmitter transported by the cell upon
comparison to the control cell indicates if the potential compound
stimulated transport or inhibited transport of the labeled amine
neurotransmitter by the transfected mammalian cell.
[0078] Examples of human amine transporter antagonists include an
antibody directed to the human amine transporter which comprises,
for example, a monoclonal antibody directed to an epitope of a
human amine transporter present on the surface of the cell. These
antibodies are useful to detect the presence of human amine
transporters or to inhibit the function of the transporters in
humans.
[0079] Another potential antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of human amine
transporter. The antisense RNA oligonucleotide hybridizes to the
mRNA in vivo and blocks translation of the mRNA molecule into the
human amine transporter polypeptide (antisense-Okano, J.
Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
The oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of human amine transporter.
[0080] Potential antagonists also include a soluble form of a human
amine transporter, e.g. a fragment of the transporter, which binds
to the neurotransmitter and prevents it from interacting with the
human amine transporter.
[0081] Potential antagonists further include a small molecule which
binds to and occupies the extracellular portion of the human amine
transporter thereby making the human amine transporter inaccessible
to the neurotransmitter such that transport is inhibited. Examples
of small molecules include but are not limited to small peptides or
peptide-like molecules.
[0082] This invention additionally provides a method of treating an
abnormal condition related to an excess of amine transporter
activity which comprises administering to a subject the antagonist
as hereinabove described along with a pharmaceutically acceptable
carrier in an amount effective to block binding of naturally
occurring substrates to the amine transporters and thereby
alleviate the abnormal condition. Examples of abnormal conditions
include epilepsy, schizophrenia, depression, cognitive impairment,
anxiety and migraine headaches.
[0083] The invention also provides a method of treating abnormal
conditions related to an under-expression of amine transporter
activity which comprises administering to a subject an amount of
the agonist described above in combination with a pharmaceutically
acceptable carrier, in an amount effective to enhance binding of
naturally occurring substrates to the amine transporter and thereby
alleviate the abnormal conditions. Some examples of abnormal
conditions are Parkinson's disease and Alzheimer's disease.
[0084] The soluble form of the human amine transporter, and
agonists and antagonists may be employed in combination with a
suitable pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the transporter, agonist or
antagonist and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
administration.
[0085] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such containers can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
may be employed in conjunction with other therapeutic
compounds.
[0086] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0087] The human amine transporter and agonists and antagonists
which are polypeptides may also be employed in accordance with the
present invention by expression of such polypeptides in vivo, which
is often referred to as "gene therapy."
[0088] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0089] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0090] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0091] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and beta-actin
promoters). Other viral promoters which may be employed include,
but are not limited to, adenovirus promoters, thymidine kinase (TK)
promoters, and B19 parvovirus promoters. The selection of a
suitable promoter will be apparent to those skilled in the art from
the teachings contained herein.
[0092] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the beta-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0093] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, psi-2, psi-AM, PA12, T19-14X,
VT-19-17-H2, psiCRE, psiCRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0094] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0095] This invention is also related to the use of the human amine
transporter gene as part of a diagnostic assay for detecting
diseases or susceptibility to diseases related to the presence of
mutations in the human amine transporter genes. Such diseases are
related to under-expression of the human amine transporter.
[0096] Individuals carrying mutations in the human amine
transporter gene may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding the human amine
transporter protein can be used to identify and analyze human amine
transporter mutations. For example, deletions and insertions can be
detected by a change in size of the amplified product in comparison
to the normal genotype. Point mutations can be identified by
hybridizing amplified DNA to radiolabeled human amine transporter
RNA or alternatively, radiolabeled human amine transporter
antisense DNA sequences. Perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
[0097] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments' are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0098] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0099] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0100] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0101] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0102] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0103] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0104] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0105] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0106] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0107] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0108] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0109] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0110] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0111] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0112] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0113] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0114] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0115] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37 degree C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0116] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0117] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in,
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0118] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0119] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLES
Example 1
Bacterial Expression and Purification of Human Amine
Transporter
[0120] The DNA sequence encoding human amine transporter, ATCC
#75980, is initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed amine
transporter nucleic acid sequence (minus the signal peptide
sequence). Additional nucleotides corresponding to amine
transporter gene are added to the 5' and 3' sequences respectively.
The 5' oligonucleotide primer has the sequence 5'
GACTAAAGCTTAATGCTCCGGCCCATTCTG 3' (SEQ ID No. 3) contains a HindIII
restriction enzyme site followed by 18 nucleotides of human amine
transporter coding sequence starting from the presumed terminal
amino acid of the processed protein. The 3' sequence 5'
GAACTTCTAGACGGTCAGCCATG- GTGACTGG 3' (SEQ ID No. 4) contains
complementary sequences to an XbaI site and is followed by 20
nucleotides of the human amine transporter gene. The restriction
enzyme sites correspond to the restriction enzyme sites on the
bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 encodes antibiotic resistance (Ampr), a bacterial
origin of replication (ori), an IPTG-regulatable promoter operator
(P/O), a ribosome binding site (RBS), a 6-His tag and restriction
enzyme sites. pQE-9 is then digested with HindIII and XbaI. The
amplified sequences are ligated into pQE-9 and are inserted in
frame with the sequence encoding for the histidine tag and the RBS.
The ligation mixture is then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989). M15/rep4 contains multiple copies of the
plasmid pREP4, which expresses the lacd repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants are identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies are selected. Plasmid DNA is isolated and
confirmed by restriction analysis. Clones containing the desired
constructs are grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (100 .mu.g/ml) and Kan (25 .mu.g/ml).
The O/N culture is used to inoculate a large culture at a ratio of
1:100 to 1:250. The cells are grown to an optical density 600
(O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacd
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl. After clarification, solubilized human
amine transporter is purified from this solution by chromatography
on a Nickel-Chelate column under conditions that allow for tight
binding by proteins containing the 6-His tag (Hochuli, E. et al.,
J. Chromatography 411:177-184 (1984)). Human amine transporter
protein is eluted from the column in 6 molar guanidine HCl pH 5.0.
and for the purpose of renaturation adjusted to 3 molar guanidine
HCl, 100 mM sodium phosphate, 10 mmolar glutathione (reduced) and 2
mmolar glutathione (oxidized). After incubation in this solution
for 12 hours the protein is dialyzed to 10 mmolar sodium
phosphate.
Example 2
Cloning and Expression of Human Amine Transporter Using the
Baculovirus Expression System
[0121] The DNA sequence encoding the full length human amine
transporter protein, ATCC #75980, is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0122] The 5' primer has the sequence 5.degree. CGGGATCCCTCCATGGCT
CCGGCCCATTCTG 3' (SEQ ID No. 5) and contains a BamHI restriction
enzyme site (in bold) followed by 4 nucleotides resembling an
efficient signal for the initiation of translation in eukaryotic
cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) which is just
behind the first 18 nucleotides of the human amine transporter gene
(the initiation codon for translation "ATG" is underlined).
[0123] The 3' primer has the sequence 5' CGGGATCCCGCT
CAGCCATGGTGACTGGT 3' (SEQ ID No. 6) and contains the cleavage site
for the restriction endonuclease BamHI and 18 nucleotides
complementary to the 3' non-translated sequence of the human amine
transporter gene. The amplified sequences are isolated from a 1%
agarose gel using a commercially available kit ("Geneclean," BIO
101 Inc., La Jolla, Calif.). The fragment is then digested with the
endonucleases BamHI and then purified again on a it agarose gel.
This fragment is designated F2.
[0124] The vector pRG1 (modification of pVL941 vector, discussed
below) is used for the expression of the human amine transporter
protein using the baculovirus expression system (for review see:
Summers, M. D. and Smith, G. E. 1987, A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555). This
expression vector contains the strong polyhedrin promoter of the
Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed
by the recognition sites for the restriction endonucleases BamHI.
The polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0125] The plasmid is digested with the restriction enzymes BamHI
and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The DNA is then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.). This vector DNA is designated V2.
[0126] Fragment F2 and the dephosphorylated plasmid V2 are ligated
with T4 DNA ligase. E. coli HB101 cells are then transformed and
bacteria identified that contained the plasmid (pBac-Human amine
transporter) with the human amine transporter gene using the enzyme
BamHI. The sequence of the cloned fragment is confirmed by DNA
sequencing.
[0127] 5 .mu.g of the plasmid pBac-Human amine transporter is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.) using the lipofection method
(Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417
(1987)).
[0128] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac-Human amine transporter are mixed in a sterile well of
a microtiter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added dropwise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is rocked back and forth to mix the newly
added solution. The plate is then incubated for 5 hours at 27
degree C. After 5 hours the transfection solution is removed from
the plate and 1 ml of Grace's insect medium supplemented with 10%
fetal calf serum is added. The plate is put back into an incubator
and cultivation continued at 27 degree C. for four days.
[0129] After four days the supernatant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0130] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4 degree C.
[0131] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-Human amine transporter at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed and
replaced with SF900 II medium minus methionine and cysteine (Life
Technologies Inc., Gaithersburg). 42 hours later 5 .mu.Ci of
.sup.35S-methionine and 5 .mu.Ci .sup.35S cysteine (Amersham) are
added. The cells are further incubated for 16 hours before they are
harvested by centrifugation and the labelled proteins visualized by
SDS-PAGE and autoradiography.
Example 3
Expression of Recombinant Human Amine Transporter in COS Cells
[0132] The expression of plasmid, Human amine transporter HA is
derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40
origin of replication, 2) ampicillin resistance gene, 3) E. coli
replication origin, 4) CMV promoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA fragment
encoding the entire Human amine transporter precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker region
of the vector, therefore, the recombinant protein expression is
directed under the CMV promoter. The HA tag correspond to an
epitope derived from the influenza hemagglutinin protein as
previously described (I. Wilson, et al., Cell, 37:767, (1984)). The
infusion of HA tag to the target protein allows easy detection of
the recombinant protein with an antibody that recognizes the HA
epitope.
[0133] The plasmid construction strategy is described as follows:
The DNA sequence encoding Human amine transporter, ATCC #75980, is
constructed by PCR using two primers: the 5' primer 5'
GTCCAAGCTTGCCACCATGCTGCGGCCCATTCT- G 3' (SEQ ID No. 7) contains a
HindIII site followed by 18 nucleotides of Human amine transporter
coding sequence starting from the initiation codon; the 3' sequence
5' CTAGCTCGAGTCAGCCATGGTGACTGGTAGCGTAGTCTGGGACGTCG- TATGGGT AGCA 3'
(SEQ ID No. 8) contains complementary sequences to an XhoI site,
translation stop codon, HA tag and the last 18 nucleotides of the
Human amine transporter coding sequence (not including the stop
codon). Therefore, the PCR product contains a HindIII site, human
amine transporter coding sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA tag, and
an HindIII site. The PCR amplified DNA fragment and the vector,
pcDNAI/Amp, are digested with HindIII and XhoI restriction enzyme
and ligated. The ligation mixture is transformed into E. coli
strain SURE (Stratagene Cloning Systems, La Jolla, Calif.) the
transformed culture is plated on ampicillin media plates and
resistant colonies are selected. Plasmid DNA is isolated from
transformants and examined by restriction analysis for the presence
of the correct fragment. For expression of the recombinant amine
transporter, COS cells are transfected with the expression vector
by DRAB-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989)). The expression of the Human amine transporter HA
protein is detected by radiolabelling and immunoprecipitation
method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8
hours with .sup.35S-cysteine two days post transfection. Culture
media is then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and culture media are precipitated with a HA specific
monoclonal antibody. Proteins precipitated are analyzed on 15%
SDS-PAGE gels.
Example 4
Expression Pattern of Human Amine Transporter in Human Tissue
[0134] Northern blot analysis is carried out to examine the levels
of expression of Human amine transporter in human tissues. Total
cellular RNA samples are isolated with RNAzol.TM. B system (Biotecx
Laboratories, Inc. Houston, Tex.). About 10 =82 g of total RNA
isolated from each human tissue specified is separated on 1%
agarose gel and blotted onto a nylon filter (Sambrook, Fritsch, and
Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The
labeling reaction is done according to the Stratagene Prime-It kit
with 50 ng DNA fragment. The labeled DNA is purified with a
Select-G-50 column (5 Prime-3 Prime, Inc. Boulder, Colo.). The
filter is then hybridized with radioactive labeled full length
Human amine transporter gene at 1,000,000 cpm/ml in 0.5 M
NaPO.sub.4, pH 7.4 and 7% SDS overnight at 65 degree C. After wash
twice at room temperature and twice at 60 degree C. with
0.5.times.SSC, 0.1% SDS, the filter is then exposed at -70 degree
C. overnight with an intensifying screen.
Example 5
Expression Via Gene Therapy
[0135] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37 degree C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0136] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0137] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer $further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
$EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0138] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0139] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0140] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0141] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
9 1 2885 DNA Homo sapiens CDS (719)..(2128) UNSURE (39) May be any
nucleic acid 1 tcctgcgtta tccccctgat tctgtggata accgtattnc
cgcctttgag tgagctgata 60 ccgctcnccn cagccgaacg accgagcgca
gcgagtcagt gagcgaggaa gcggaagagc 120 gcccaatacg caaaccgcct
ctccccgcgc gttggccgat tcattaatgc agctggcacg 180 acaggtttcc
cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 240
ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg
300 tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgcc
aagctcgaaa 360 ttaaccctca ctaaagggaa caaaagctgg agctccaccg
cggtggcgnc cgctctagaa 420 ctagtggatc ccccggnctg caggggcaca
cacacgcaca catacacaga atcctcagat 480 aacaggaggc aataaatcca
acagcacatc cacgttcaga gaacagtgtc cctgctgtct 540 tgctaacagc
tgccaatacc tcactgagtg cctcacacca acatgggctc caagtgagtt 600
tcattcgtct gggcagactc cctcccctct tccataaagg ctgcaggaga cctgtagctg
660 tcacaggacc ttccctaaga gcccgcaggg ggaagactgc cccagtccgg ccatcacc
718 atg ctc cgg ccc att ctg gat gct ccc cag cgg ttg ctg aag gag ggg
766 Met Leu Arg Pro Ile Leu Asp Ala Pro Gln Arg Leu Leu Lys Glu Gly
1 5 10 15 aga gcg tcc cgg cag ctg gtg ctg gtg gtg gta ttc gtc gct
ttg ctc 814 Arg Ala Ser Arg Gln Leu Val Leu Val Val Val Phe Val Ala
Leu Leu 20 25 30 ctg gac aac atg ctg ttt act gtg gtg gtg cca att
gtg ccc acc ttc 862 Leu Asp Asn Met Leu Phe Thr Val Val Val Pro Ile
Val Pro Thr Phe 35 40 45 cta tat gac atg gag ttc aaa gaa gtc atc
tct tct ctg cac ctc ggg 910 Leu Tyr Asp Met Glu Phe Lys Glu Val Ile
Ser Ser Leu His Leu Gly 50 55 60 cat gcc gga agt tcc cca cat gcc
ctc gcc tct cct gcc ttt tcc acc 958 His Ala Gly Ser Ser Pro His Ala
Leu Ala Ser Pro Ala Phe Ser Thr 65 70 75 80 atc ttc tcc ttc ttc aac
aac aac acc gtg gct gtt gaa gaa agc gta 1006 Ile Phe Ser Phe Phe
Asn Asn Asn Thr Val Ala Val Glu Glu Ser Val 85 90 95 cct agt gga
ata gca tgg atg aat gac act gcc agc acc atc cca cct 1054 Pro Ser
Gly Ile Ala Trp Met Asn Asp Thr Ala Ser Thr Ile Pro Pro 100 105 110
cca gcc act gaa gcc atc tca gct cat aaa aac aac tgc ttg caa ggc
1102 Pro Ala Thr Glu Ala Ile Ser Ala His Lys Asn Asn Cys Leu Gln
Gly 115 120 125 aca ggt ttc ttg gag gaa gag act acc cgg gtc ggg gtt
ctg ttt gct 1150 Thr Gly Phe Leu Glu Glu Glu Thr Thr Arg Val Gly
Val Leu Phe Ala 130 135 140 tca aag gct gtg atg caa ctt ctg gtc aac
cca ttc gtg ggc cct ctc 1198 Ser Lys Ala Val Met Gln Leu Leu Val
Asn Pro Phe Val Gly Pro Leu 145 150 155 160 acc aac agg att gga tat
cat atc ccc atg ttt gct ggc ttt gtt atc 1246 Thr Asn Arg Ile Gly
Tyr His Ile Pro Met Phe Ala Gly Phe Val Ile 165 170 175 atg ttt ctc
tcc aca gtt atg ttt gct ttt tct ggg acc tat act cta 1294 Met Phe
Leu Ser Thr Val Met Phe Ala Phe Ser Gly Thr Tyr Thr Leu 180 185 190
ctc ttt gtg gcc cga acc ctt caa ggc att gga tct tca ttt tca tct
1342 Leu Phe Val Ala Arg Thr Leu Gln Gly Ile Gly Ser Ser Phe Ser
Ser 195 200 205 gtt gca ggt ctt gga atg ctg gcc agt gtc tac act gat
gac cat gag 1390 Val Ala Gly Leu Gly Met Leu Ala Ser Val Tyr Thr
Asp Asp His Glu 210 215 220 aga gga cga gcc atg gga act gct ctg ggg
ggc ctg gcc ttg ggg ttg 1438 Arg Gly Arg Ala Met Gly Thr Ala Leu
Gly Gly Leu Ala Leu Gly Leu 225 230 235 240 ctg gtg gga gct ccc ttt
gga agt gta atg tac gag ttt gtt ggg aag 1486 Leu Val Gly Ala Pro
Phe Gly Ser Val Met Tyr Glu Phe Val Gly Lys 245 250 255 tct gca ccc
ttc ctc atc ctg gcc ttc ctg gca cta ctg gat gga gca 1534 Ser Ala
Pro Phe Leu Ile Leu Ala Phe Leu Ala Leu Leu Asp Gly Ala 260 265 270
ctc cag ctt tgc atc cta cag cct tcc aaa gtc tct cct gag agt gcc
1582 Leu Gln Leu Cys Ile Leu Gln Pro Ser Lys Val Ser Pro Glu Ser
Ala 275 280 285 aag ggg act ccc ctc ttt atg ctt ctc aaa gac cct tac
atc ctg gtg 1630 Lys Gly Thr Pro Leu Phe Met Leu Leu Lys Asp Pro
Tyr Ile Leu Val 290 295 300 gct gca ggg tcc atc tgc ttt gcc aac atg
ggg gtg gcc atc ctg gag 1678 Ala Ala Gly Ser Ile Cys Phe Ala Asn
Met Gly Val Ala Ile Leu Glu 305 310 315 320 ccc aca ctg ccc atc tgg
atg atg cag acc atg tgc tcc ccc aag tgg 1726 Pro Thr Leu Pro Ile
Trp Met Met Gln Thr Met Cys Ser Pro Lys Trp 325 330 335 cag ctg ggt
cta gct ttc ttg cct gcc agt gtg tcc tac ctc att ggc 1774 Gln Leu
Gly Leu Ala Phe Leu Pro Ala Ser Val Ser Tyr Leu Ile Gly 340 345 350
acc aac ctc ttt ggt gtg ttg gcc aac aag atg ggt cgg tgg ctg tgt
1822 Thr Asn Leu Phe Gly Val Leu Ala Asn Lys Met Gly Arg Trp Leu
Cys 355 360 365 tcc cta atc ggg atg ctg gta gta ggt acc agc ttg ctc
tgt gtt cct 1870 Ser Leu Ile Gly Met Leu Val Val Gly Thr Ser Leu
Leu Cys Val Pro 370 375 380 ctg gct cac aaa aat ttt ggt ctc att ggc
ccc aat gca ggg ctt ggc 1918 Leu Ala His Lys Asn Phe Gly Leu Ile
Gly Pro Asn Ala Gly Leu Gly 385 390 395 400 ctt ncc ata ggc atg gtg
gaa tct tct atg atg ccc atc atg ggg cac 1966 Leu Xaa Ile Gly Met
Val Glu Ser Ser Met Met Pro Ile Met Gly His 405 410 415 ctg gtg gat
cca cgc cac acc tcg gtg tat ggg agt gtc cac gcc atc 2014 Leu Val
Asp Pro Arg His Thr Ser Val Tyr Gly Ser Val His Ala Ile 420 425 430
gct gat gtg gct ttt tgc atg ggc ttt gct ata ggc tat tct gag tca
2062 Ala Asp Val Ala Phe Cys Met Gly Phe Ala Ile Gly Tyr Ser Glu
Ser 435 440 445 gga ctg ccc cat gga gac ccg gat gta tca acc cag aaa
cct ctt ccc 2110 Gly Leu Pro His Gly Asp Pro Asp Val Ser Thr Gln
Lys Pro Leu Pro 450 455 460 tgg acc agt cac cat ggc tgacccacgg
ctcagtggcc tcaaaacctc 2158 Trp Thr Ser His His Gly 465 470
tgcctgggat cttcttcctc ccctcccatg gagactgtcc ctcatactct tctcacctgt
2218 gtaacttgta gctcttcmtc tatgccttgg tgccgcagtg gcccatcttt
tatgggaaga 2278 cagagtgatg caccyycccg ctgctgtgag gttgattaaa
cttgagctgt gacggggttc 2338 tgcaaggggt gactcattgy atagaggtgg
tagtgagtaa tgtgcccctg aaaccagtgg 2398 ggtgactgac aagcctcttt
aatctgttgc ctgattttct ctggcatagc cccaacagat 2458 cggaagagtg
ttaccctctt twccctcaac gtgttctttc ccgggttttc cccagccgag 2518
ttgagaaaat gttctcagca ttgtcttgct gccaaatgcc agcktgaaga gttwggtatg
2578 ktttttctnc catttatttt atttattwac taaagtgaat gattttactg
tggytaaatc 2638 tagagctgct aaaagggctt taccctcagt gaaaagtgtc
ttctatttnc atwatctttc 2698 agaaacwgga gcccatttct cttctggtgg
agttatngac atcctcctga ccncccctgt 2758 gtntncctac ctntactgaa
cctcttagac tctnagaaat aaaagtagaa gaaagacaga 2818 aaaattaact
gattagaccc aagatttcat gggaagaagt taaaagaaac tgccttggaa 2878 atccctc
2885 2 470 PRT Homo sapiens UNSURE (402) May be any amino acid 2
Met Leu Arg Pro Ile Leu Asp Ala Pro Gln Arg Leu Leu Lys Glu Gly 1 5
10 15 Arg Ala Ser Arg Gln Leu Val Leu Val Val Val Phe Val Ala Leu
Leu 20 25 30 Leu Asp Asn Met Leu Phe Thr Val Val Val Pro Ile Val
Pro Thr Phe 35 40 45 Leu Tyr Asp Met Glu Phe Lys Glu Val Ile Ser
Ser Leu His Leu Gly 50 55 60 His Ala Gly Ser Ser Pro His Ala Leu
Ala Ser Pro Ala Phe Ser Thr 65 70 75 80 Ile Phe Ser Phe Phe Asn Asn
Asn Thr Val Ala Val Glu Glu Ser Val 85 90 95 Pro Ser Gly Ile Ala
Trp Met Asn Asp Thr Ala Ser Thr Ile Pro Pro 100 105 110 Pro Ala Thr
Glu Ala Ile Ser Ala His Lys Asn Asn Cys Leu Gln Gly 115 120 125 Thr
Gly Phe Leu Glu Glu Glu Thr Thr Arg Val Gly Val Leu Phe Ala 130 135
140 Ser Lys Ala Val Met Gln Leu Leu Val Asn Pro Phe Val Gly Pro Leu
145 150 155 160 Thr Asn Arg Ile Gly Tyr His Ile Pro Met Phe Ala Gly
Phe Val Ile 165 170 175 Met Phe Leu Ser Thr Val Met Phe Ala Phe Ser
Gly Thr Tyr Thr Leu 180 185 190 Leu Phe Val Ala Arg Thr Leu Gln Gly
Ile Gly Ser Ser Phe Ser Ser 195 200 205 Val Ala Gly Leu Gly Met Leu
Ala Ser Val Tyr Thr Asp Asp His Glu 210 215 220 Arg Gly Arg Ala Met
Gly Thr Ala Leu Gly Gly Leu Ala Leu Gly Leu 225 230 235 240 Leu Val
Gly Ala Pro Phe Gly Ser Val Met Tyr Glu Phe Val Gly Lys 245 250 255
Ser Ala Pro Phe Leu Ile Leu Ala Phe Leu Ala Leu Leu Asp Gly Ala 260
265 270 Leu Gln Leu Cys Ile Leu Gln Pro Ser Lys Val Ser Pro Glu Ser
Ala 275 280 285 Lys Gly Thr Pro Leu Phe Met Leu Leu Lys Asp Pro Tyr
Ile Leu Val 290 295 300 Ala Ala Gly Ser Ile Cys Phe Ala Asn Met Gly
Val Ala Ile Leu Glu 305 310 315 320 Pro Thr Leu Pro Ile Trp Met Met
Gln Thr Met Cys Ser Pro Lys Trp 325 330 335 Gln Leu Gly Leu Ala Phe
Leu Pro Ala Ser Val Ser Tyr Leu Ile Gly 340 345 350 Thr Asn Leu Phe
Gly Val Leu Ala Asn Lys Met Gly Arg Trp Leu Cys 355 360 365 Ser Leu
Ile Gly Met Leu Val Val Gly Thr Ser Leu Leu Cys Val Pro 370 375 380
Leu Ala His Lys Asn Phe Gly Leu Ile Gly Pro Asn Ala Gly Leu Gly 385
390 395 400 Leu Xaa Ile Gly Met Val Glu Ser Ser Met Met Pro Ile Met
Gly His 405 410 415 Leu Val Asp Pro Arg His Thr Ser Val Tyr Gly Ser
Val His Ala Ile 420 425 430 Ala Asp Val Ala Phe Cys Met Gly Phe Ala
Ile Gly Tyr Ser Glu Ser 435 440 445 Gly Leu Pro His Gly Asp Pro Asp
Val Ser Thr Gln Lys Pro Leu Pro 450 455 460 Trp Thr Ser His His Gly
465 470 3 30 DNA Homo sapiens 3 gactaaagct taatgctccg gcccattctg 30
4 31 DNA Homo sapiens 4 gaacttctag acggtcagcc atggtgactg g 31 5 31
DNA Homo sapiens 5 cgggatccct ccatggctcc ggcccattct g 31 6 29 DNA
Homo sapiens 6 cgggatcccg ctcagccatg gtgactggt 29 7 34 DNA Homo
sapiens 7 gtccaagctt gccaccatgc tgcggcccat tctg 34 8 58 DNA Homo
sapiens 8 ctagctcgag tcagccatgg tgactggtag cgtagtctgg gacgtcgtat
gggtagca 58 9 465 PRT Rattus sp. 9 Met Leu Gln Val Val Leu Gly Ala
Pro Gln Arg Leu Leu Lys Glu Gly 1 5 10 15 Arg Gln Ser Arg Lys Leu
Val Leu Val Val Val Phe Val Ala Leu Leu 20 25 30 Leu Asp Asn Met
Leu Leu Thr Val Val Val Pro Ile Val Pro Thr Phe 35 40 45 Leu Tyr
Ala Thr Glu Phe Lys Asp Ser Asn Ser Ser Leu His Arg Gly 50 55 60
Pro Ser Val Ser Ser Gln Gln Ala Leu Thr Ser Pro Ala Phe Ser Thr 65
70 75 80 Ile Phe Ser Phe Phe Asp Asn Thr Thr Thr Thr Val Glu Glu
His Val 85 90 95 Pro Phe Arg Val Thr Trp Thr Asn Gly Thr Ile Pro
Pro Pro Val Thr 100 105 110 Glu Ala Ser Ser Val Pro Lys Asn Asn Cys
Leu Gln Gly Ile Glu Phe 115 120 125 Leu Glu Glu Glu Asn Val Arg Ile
Gly Ile Leu Phe Ala Ser Lys Ala 130 135 140 Leu Met Gln Leu Leu Val
Asn Pro Phe Val Gly Pro Leu Thr Asn Arg 145 150 155 160 Ile Gly Tyr
His Ile Pro Met Phe Val Gly Phe Met Ile Met Phe Leu 165 170 175 Ser
Thr Leu Met Phe Ala Phe Ser Gly Thr Tyr Ala Leu Leu Phe Val 180 185
190 Ala Arg Thr Leu Gln Gly Ile Gly Ser Ser Phe Ser Ser Val Ala Gly
195 200 205 Leu Gly Met Leu Ala Ser Val Tyr Thr Asp Asn Tyr Glu Arg
Gly Arg 210 215 220 Ala Met Gly Ile Ala Leu Gly Gly Leu Ala Leu Gly
Leu Leu Val Gly 225 230 235 240 Ala Pro Phe Gly Ser Val Met Tyr Glu
Phe Val Gly Lys Ser Ser Pro 245 250 255 Phe Leu Ile Leu Ala Phe Leu
Ala Leu Leu Asp Gly Ala Leu Gln Leu 260 265 270 Cys Ile Leu Trp Pro
Ser Lys Val Ser Pro Glu Ser Ala Met Gly Thr 275 280 285 Ser Leu Leu
Thr Leu Leu Lys Asp Pro Tyr Ile Leu Val Ala Ala Gly 290 295 300 Ser
Ile Cys Leu Ala Asn Met Gly Val Ala Ile Leu Glu Pro Thr Leu 305 310
315 320 Pro Ile Trp Met Met Gln Thr Met Cys Ser Pro Glu Trp Gln Leu
Gly 325 330 335 Leu Ala Phe Leu Pro Ala Ser Val Ala Tyr Leu Ile Gly
Thr Asn Leu 340 345 350 Phe Gly Val Leu Ala Asn Lys Met Gly Arg Trp
Leu Cys Ser Leu Val 355 360 365 Gly Met Val Ala Val Gly Ile Ser Leu
Leu Cys Val Pro Leu Ala His 370 375 380 Asn Ile Phe Gly Leu Ile Gly
Pro Asn Ala Gly Leu Gly Phe Ala Ile 385 390 395 400 Gly Met Val Asp
Ser Ser Leu Met Pro Ile Met Gly Tyr Leu Val Asp 405 410 415 Leu Arg
His Thr Ser Val Tyr Gly Ser Val Tyr Ala Ile Ala Asp Val 420 425 430
Ala Phe Cys Val Gly Phe Ala Ile Gly Pro Ser Thr Gly Gly Val Ile 435
440 445 Val Gln Val Ile Gly Phe Pro Trp Leu Met Val Ile Ile Gly Thr
Ile 450 455 460 Asn 465
* * * * *