U.S. patent application number 10/793094 was filed with the patent office on 2004-08-05 for variants of vascular endothelial cell growth factors having antagonistic properties, nucleic acids encoding the same and host cells comprising those nucleic acids.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Ferrara, Napoleone, Keyt, Bruce A., Nguyen, Francis Hung.
Application Number | 20040152636 10/793094 |
Document ID | / |
Family ID | 24951725 |
Filed Date | 2004-08-05 |
United States Patent
Application |
20040152636 |
Kind Code |
A1 |
Keyt, Bruce A. ; et
al. |
August 5, 2004 |
Variants of vascular endothelial cell growth factors having
antagonistic properties, nucleic acids encoding the same and host
cells comprising those nucleic acids
Abstract
The present invention involves the preparation of vascular
endothelial growth factor (VEGF) antagonist molecules comprising
variant VEGF polypeptides which are capable of binding to and
occupying cell surface VEGF receptors without inducing a VEGF
response, thereby antagonizing the biological activity of the
native VEGF protein. Specifically, the variant VEGF polypeptides of
the present invention comprise modifications of at least one
cysteine residue in the native VEGF sequence, thereby inhibiting
the ability of the variant polypeptide to dimerize through the
formation of disulfide bonds. The present invention is further
directed to methods for preparing such variant VEGF antagonists and
to methods, compositions and assays utilizing such variants for
producing pharmaceutically active materials having therapeutic and
pharmacologic properties that differ from the native VEGF
protein.
Inventors: |
Keyt, Bruce A.; (Pacifica,
CA) ; Nguyen, Francis Hung; (Daly City, CA) ;
Ferrara, Napoleone; (San Francsico, CA) |
Correspondence
Address: |
MERCHANT & GOULD PC
P.O. BOX 2903
MINNEAPOLIS
MN
55402-0903
US
|
Assignee: |
Genentech, Inc.
460 Point San Bruno Boulevard
South San Francisco
CA
94080
|
Family ID: |
24951725 |
Appl. No.: |
10/793094 |
Filed: |
March 3, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10793094 |
Mar 3, 2004 |
|
|
|
08734443 |
Oct 17, 1996 |
|
|
|
6750044 |
|
|
|
|
Current U.S.
Class: |
514/8.1 ;
514/13.3; 514/19.8; 530/399 |
Current CPC
Class: |
C07K 14/52 20130101;
A61P 17/06 20180101; A61P 35/00 20180101; A61P 9/10 20180101; A61K
38/1866 20130101; A61P 43/00 20180101; A61P 27/02 20180101; A61P
29/00 20180101 |
Class at
Publication: |
514/012 ;
530/399 |
International
Class: |
A61K 038/18; C07K
014/475 |
Claims
What is claimed is:
1. A VEGF antagonist molecule comprising a variant vascular
endothelial growth factor polypeptide, said variant polypeptide
comprising an amino acid modification of at least one cysteine
residue, wherein said amino acid modification inhibits the ability
of said variant polypeptide to properly dimerize with another
vascular endothelial growth factor polypeptide monomer, wherein
said antagonist molecule is capable of binding to vascular
endothelial growth factor receptors without significantly inducing
a vascular endothelial growth factor response, and functional
derivatives of said antagonist molecule.
2. The antagonist molecule according to claim 1 wherein said amino
acid modification is a substitution of said at least one cysteine
residue with a different amino acid which is incapable of
participating in a disulfide bond.
3. The antagonist molecule according to claim 2 wherein said
substitution is of the cysteine residue at amino acid position 51
and/or 60 of the native VEGF amino acid sequence.
4. The antagonist molecule according to claim 3 wherein aspartic
acid is substituted for cysteine.
5. The antagonist molecule according to claim 4 comprising the
substitution C51D.
6. The antagonist molecule according to claim 4 comprising the
substitution C60D.
7. The antagonist molecule according to claim 1 wherein said amino
acid modification is a chemical modification of said at least one
cysteine residue which renders said cysteine residue incapable of
participating in a disulfide bond.
8. The antagonist molecule according to claim 7 wherein said
chemical modification is of the cysteine residue at amino acid
position 51 and/or 60 of the native VEGF amino acid sequence.
9. The antagonist molecule according to claim 1 containing further
amino acid modifications that do not otherwise affect the essential
biological characteristics.
10. An isolated nucleic acid sequence comprising a sequence that
encodes the VEGF antagonist molecule of claim 1.
11. A replicable expression vector capable in a transformant host
cell of expressing the nucleic acid of claim 10.
12. Host cells transformed with the vector according to claim
11.
13. Host cells according to claim 12 which are Chinese hamster
ovary cells.
14. A composition of matter comprising the VEGF antagonist molecule
according to claim 1 compounded with a pharmaceutically acceptable
carrier.
15. A method of treatment which comprises administering a
composition according to claim 14.
Description
FIELD OF THE INVENTION
[0001] The present invention is directed to particular variants of
vascular endothelial cell growth factor (hereinafter sometimes
referred to as VEGF) which bind to and occupy cell surface VEGF
receptors without inducing a VEGF response, thereby antagonizing
the biological activity of the native VEGF protein. The present
invention is further directed to methods for preparing such variant
VEGF antagonists and to methods, compositions and assays utilizing
such variants for producing pharmaceutically active materials
having therapeutic and pharmacologic properties that differ from
the native VEGF protein.
BACKGROUND OF THE INVENTION
[0002] The two major cellular components of the mammalian vascular
system are the endothelial and smooth muscle cells. Endothelial
cells form the lining of the inner surface of all blood vessels in
the mammal and constitute a non-thrombogenic interface between
blood and tissue. Therefore, the proliferation of endothelial cells
is an important component for the development of new capillaries
and blood vessels which, in turn, is a necessary process for the
growth and/or regeneration of mammalian tissues.
[0003] One protein that has been shown to play an extremely
important role in promoting endothelial cell proliferation and
angiogenesis is vascular endothelial cell growth factor (VEGF).
VEGF is a heparin-binding endothelial cell-specific growth factor
which was originally identified and purified from media conditioned
by bovine pituitary follicular or folliculostellate (FS) cells.
Ferrara and Henzel, Biochem. Biophys. Res. Comm. 161:851-858
(1989). Naturally-occurring VEGF is a dimeric protein having an
apparent molecular mass of about 46 kDa with each subunit having an
apparent molecular mass of about 23 kDa. Normal dimerization
between individual native VEGF monomers occurs through the
formation of disulfide bonds between the cysteine residues located
at amino acid position 51 of one monomeric unit bonding to the
cysteine residue at amino acid position 60 of another monomeric
unit and vice versa. Human VEGF is expressed in a variety of
tissues as multiple homodimeric forms (121, 165, 189 and 206 amino
acids per monomer), wherein each form arises as a result of
alternative splicing of a single RNA transcript. For example,
VEGF.sub.121 is a soluble mitogen that does not bind heparin
whereas the longer forms of VEGF bind heparin with progressively
higher affinity.
[0004] Biochemical analyses have shown that the native VEGF dimer
exhibits a strong mitogenic specificity for vascular endothelial
cells. For example, media conditioned by cells transfected by human
VEGF cDNA promoted the proliferation of capillary endothelial
cells, whereas medium conditioned by control cells did not. Leung
et al., Science 246:1306 (1989). Thus, the native VEGF dimer is
known to promote vascular endothelial cell proliferation and
angiogenesis, a process which involves the formation of new blood
vessels from preexisting endothelium. As such, the native VEGF may
be useful for the therapeutic treatment of numerous conditions in
which a growth-promoting activity on the vascular endothelial cells
is important, for example, in ulcers, vascular injuries and
myocardial infarction.
[0005] The endothelial cell proliferative activity of the VEGF
dimer is known to be mediated by two high affinity tyrosine kinase
receptors, fit-1 (FMS-like tyrosine kinase) and KDR (kinase domain
region), which exist only on the surface of vascular endothelial
cells. DeVries, et al., Science 225:989-991 (1992) and Terman, et
al., Oncogene 6:1677-1683 (1991). As cells become depleted in
oxygen, because of trauma and the like, VEGF production increases
in such cells, wherein the generated VEGF protein subsequently
binds to its respective cell surface receptors in order to signal
ultimate biological effect. The signal then increases vascular
permeability and the cells divide and expand to form new vascular
pathways. Thus, native VEGF functions to induce vascular
proliferation through the binding to endothelial cell-specific
receptors.
[0006] While VEGF-induced vascular endothelial cell proliferation
is desirable under certain circumstances, vascular endothelial cell
proliferation and angiogenesis are also important components of a
variety of diseases and disorders. Such diseases and disorders
include tumor growth and metastasis, rheumatoid arthritis,
psoriasis, atherosclerosis, diabetic retinopathy, retrolental
fibroplasia, neovascular glaucoma, age-related macular
degeneration, hemangiomas, immune rejection of transplanted corneal
tissue and other tissues, and chronic inflammation. Obviously, in
individuals suffering from any of these disorders, one would want
to have a means for inhibiting, or at least substantially reducing,
the endothelial cell proliferating activity of the native VEGF
dimeric protein.
[0007] Having an available means for inhibiting native VEGF
activity is important for a number of reasons. For example, in the
specific case of tumor cell growth, angiogenesis appears to be
crucial for the transition from hyperplasia to neoplasia and for
providing nourishment to the growing solid tumor. Folkman, et al.,
Nature 339:58 (1989). Angiogenesis also allows tumors to be in
contact with the vascular bed of the host, which may provide a
route for metastasis of tumor cells. Evidence for the role of
angiogenesis in tumor metastasis is provided, for example, by
studies -showing a correlation between the number and density of
microvessels in histologic sections of invasive human breast
carcinoma and actual presence of distant metastasis. Weidner et
al., New Engl. J. Med. 324:1 (1991). Thus, one possible mechanism
for the effective treatment of neoplastic tumors is to inhibit or
substantially reduce the endothelial cell proliferative and
angiogenic activity of the native dimeric VEGF protein.
[0008] Therefore, in view of the role that VEGF-induced vascular
endothelial cell growth and angiogenesis play in many diseases and
disorders, it is desirable to have a means for reducing or
substantially inhibiting one or more of the biological effects of
the native VEGF protein, for example, the mitogenic or angiogenic
effect thereof. Thus, the present invention is predicated upon
research intended to identify novel VEGF variant polypeptides which
are capable of inhibiting one or more of the biological activities
of native VEGF. Specifically, the present invention is predicated
upon the identification of VEGF variants which are capable of
binding to and occupying cell-surface VEGF receptors without
inducing a typical VEGF response, thereby effectively reducing or
substantially inhibiting the effects of native VEGF. It was
postulated that if one could prepare such VEGF variants, one could
use such variants in instances of tumor treatment in order to
starve the tumors for intended regression.
[0009] It was a further object of this research to produce VEGF
variants which lose the ability to properly dimerize through the
formation of covalent cysteine-cysteine disulfide bonds. Such
variants include variant VEGF monomers which lack the ability to
dimerize through the formation of cysteine-cysteine disulfide bonds
and variant VEGF monomers which may dimerize through the formation
of at least one cysteine-cysteine disulfide bond, however, wherein
at least one disulfide bond differs from that existing in the
native VEGF dimer. Such variants possess the ability to bind to and
occupy cell surface VEGF receptors without inducing a VEGF
response, thereby competing with native VEGF for binding to the
receptors and antagonistically inhibiting the biological activity
of the native VEGF dimer.
[0010] As further objects, the VEGF variants of the present
invention can be employed in assays systems to discover small
molecule agonists and antagonists for intended therapeutic use.
[0011] The results of the above described research is the subject
of the present invention. We herein demonstrate that mutation or
modification of the cysteine residues at amino acid positions 51
and/or 60 of the native VEGF amino acid sequence functions to
produce VEGF variants which lose the ability to properly dimerize.
Specifically, substitution of cysteine at positions 51 and/or 60
with another amino acid or modification of the cysteine at that
site prevents the ability of that amino acid to participate in the
formation of a disulfide bond. These variants, however, retain the
ability to bind to and occupy cell surface VEGF receptors without
inducing a VEGF response, thereby effectively inhibiting the
biological activity of the native VEGF dimer.
SUMMARY OF THE INVENTION
[0012] The present invention provides variants of the native VEGF
protein which are capable of binding to a VEGF receptor on the
surface of vascular endothelial cells, thereby occupying those
binding sites and inhibiting the mitogenic, angiogenic or other
biological activities of the native VEGF protein. The novel
antagonist molecules of the present invention, therefore, are
useful for the treatment of diseases or disorders characterized by
undesirable excessive vascularization, including by way of example,
tumors, and especially solid malignant tumors, rheumatoid
arthritis, psoriasis, atherosclerosis, diabetic and other
retinopathies, retrolental fibroplasia, age-related macular
degeneration, neovascular glaucoma, hemangiomas, thyroid
hyperplasias (including Grave's disease), corneal and other tissue
transplantation, and chronic inflammation. The antagonists of the
present invention are also useful for the treatment of diseases or
disorders characterized by undesirable vascular permeability, such
as edema associated with brain tumors, ascites associated with
malignancies, Meigs' syndrome, lung inflammation, nephrotic
syndrome, pericardial effusion (such as that associated with
pericarditis) and pleural effusion.
[0013] In a preferred embodiment, the variant VEGF polypeptides of
the antagonist molecules of the present invention comprise amino
acid modifications of at least one cysteine residue present in the
native VEGF amino acid sequence wherein modification of that
cysteine residue(s) results in the polypeptide being incapable of
properly dimerizing with another VEGF polypeptide.
[0014] In a particularly preferred embodiment, the cysteine
residues of the native VEGF amino acid sequence that are modified
are at amino acid positions 51 and/or 60 of the native VEGF amino
acid sequence.
[0015] The novel VEGF variant polypeptides of the present invention
may be recombinantly generated by creating at least one amino acid
mutation at a cysteine residue in the native VEGF amino acid
sequence such that the variant is incapable of properly dimerizing.
Typical mutations include, for example, substitutions, insertions
and/or deletions. The cysteine residue(s) of interest may also be
chemically modified so as to be incapable of participating in a
disulfide bond.
[0016] In other embodiments, the present invention is directed to
isolated nucleic acid sequences encoding the novel VEGF antagonist
molecules of the present invention and replicable expression
vectors comprising those nucleic acid sequences.
[0017] In still other embodiments, the present invention is
directed to host cells which are transfected with the replicable
expression vectors of the present invention and are capable of
expressing those vectors.
[0018] In yet another embodiment, the present invention is directed
to a composition for treating indications wherein anti-angiogenesis
is desired, such as in arresting tumor growth, comprising a
therapeutically effective amount of the antagonist molecule of the
present invention compounded with a pharmaceutically acceptable
carrier. Another embodiment of the present invention is directed to
a method of treating comprising administering a therapeutically
effective amount of the above described composition.
[0019] Expanding on the basic premise hereof of the discovery and
mutagenesis of the native VEGF polypeptide to produce variant VEGF
polypeptides, the present invention is directed to all associated
embodiments deriving therefrom, including recombinant DNA materials
and processes for preparing such variants, materials and
information for compounding such variants into pharmaceutically
finished form and assays using such variants to screen for
candidates that have agonistic or antagonistic properties with
respect to the native VEGF polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIGS. 1A and 1B depict both the amino acid and DNA sequence
for a native VEGF protein having 165 amino acids. Predicted amino
acids of the protein are shown below the DNA sequence and are
numbered from the first residue of the N-terminus of the protein
sequence. Negative amino acid numbers refer to the presumed leader
signal sequence or pre-protein, while positive numbers refer to the
putative mature protein.
[0021] FIG. 2 is a schematic diagram showing the native VEGF dimer
molecule having disulfide bonds between cysteine residues at amino
acid positions 51 and 60 and 60 and 51, respectively, of the
monomeric units, variant polypeptide C51D, wherein the cysteine
residue at amino acid position 51 has been substituted by an
aspartic acid residue resulting in the formation of a staggered
dimer, variant polypeptide C60D, wherein the cysteine residue at
amino acid position 60 has been substituted by an aspartic acid
residue resulting in the formation of a staggered dimer and variant
polypeptide C51D, C60D, wherein the cysteine residues at both amino
acid positions 51 and 60 have been substituted by aspartic acid
residues, thereby preventing disulfide bond formation and
dimerization.
[0022] FIG. 3 is a graph showing the binding profiles of native
VEGF dimer (".cndot."), the staggered dimer formed from the C60D
variant VEGF polypeptide (".quadrature."), the staggered dimer
formed from the C51D variant VEGF polypeptide (".smallcircle.") and
the monomeric VEGF variant polypeptide C51D, C60D (".DELTA.") to
the KDR receptor. Data is presented as the ratio of bound
polypeptide to free versus the picomolar (pM) concentration of
unlabeled competitor.
[0023] FIG. 4 is a graph showing the binding profiles of native
VEGF dimer (".cndot.") and the monomeric VEGF variant polypeptide
C51D, C60D (".tangle-solidup.") to the KDR receptor. Data is
presented as the ratio of bound polypeptide to free versus the
nanomolar (nM) concentration of unlabeled VEGF competitor.
[0024] FIG. 5 is a graph showing the binding profiles of native
VEGF dimer (".cndot."), the staggered dimer formed from the C60D
variant VEGF polypeptide (".box-solid."), the staggered dimer
formed from the C51D variant VEGF polypeptide (".smallcircle.") and
the monomeric VEGF variant polypeptide C51D, C60D
(".tangle-solidup.") to the FLT-1 receptor. Data is presented as
the ratio of bound polypeptide to free versus the nanomolar (nM)
concentration of unlabeled VEGF competitor.
[0025] FIG. 6 is a graph showing the binding profiles of native
VEGF dimer (".cndot.") and the monomeric VEGF variant polypeptide
C51D, C60D (".box-solid.") to the FLT-1 receptor. Data is presented
as the ratio of bound polypeptide to free versus the nanomolar (nM)
concentration of unlabeled VEGF competitor.
[0026] FIG. 7 is a graph demonstrating the ability of the native
VEGF dimer (".cndot.") the staggered dimer formed from the C60D
variant VEGF polypeptide (".smallcircle."), the staggered dimer
formed from the C51D variant VEGF polypeptide (".DELTA.") and the
monomeric VEGF variant polypeptide C51D, C60D (".quadrature.") to
stimulate mitogenesis in endothelial cells. Data is presented as
the total number of endothelial cells versus the picomolar (pM)
concentration of polypeptide employed.
[0027] FIG. 8 is a graph demonstrating the ability of the anti-VEGF
monoclonal antibody A461 (".box-solid.") and the monomeric VEGF
variant polypeptide C51D, C60D (".cndot.") to inhibit VEGF-induced
growth of endothelial cells. Data is presented as the total number
of endothelial cells versus the ratio of antibody or monomer
inhibitor to VEGF employed.
DETAILED DESCRIPTION OF THE INVENTION
[0028] As used herein, "vascular endothelial cell growth factor,"
or "VEGF," refers to a native mammalian growth factor as defined in
U.S. Pat. No. 5,332,671, including the human amino acid sequence
shown in FIG. 1 and naturally occurring allelic and processed forms
of such growth factors. VEGF proteins can exist in either monomeric
or multimeric (for example, dimeric) form. "Proper dimerization" is
the dimerization which normally occurs between native VEGF
monomers.
[0029] The term "native" with regard to a VEGF protein refers to a
naturally occurring VEGF protein of any human or non-human animal
species, with or without the initiating methionine, whether
purified from the native source, synthesized, produced by
recombinant DNA technology or by any combination of these and/or
other methods. Native VEGF proteins naturally exist as dimeric
molecules, wherein the monomeric units thereof are covalently
connected through the formation of cysteine-cysteine disulfide
bonds. Native VEGF specifically includes the native human VEGF
protein having the amino acid sequence shown in FIG. 1 and
possesses the ability to induce the proliferation of vascular
endothelial cells in vivo.
[0030] The term "variant" with respect to a VEGF protein refers to
a VEGF protein that possesses at least one amino acid mutation or
modification (i.e., alteration) as compared to a native VEGF
protein and which may or may not lack one or more of the biological
activities of a native VEGF protein. Variant VEGF proteins
generated by "amino acid modifications" can be produced, for
example, by substituting, deleting, inserting and/or chemically
modifying at least one amino acid in the native VEGF amino acid
sequence. Methods for creating such VEGF variants are described
below.
[0031] The term "monomeric variant", "monomeric antagonist" or
grammatical equivalents thereof refers to a variant VEGF protein
having at least one amino acid alteration as compared to a native
VEGF monomer, wherein said amino acid alteration acts to prevent
dimer formation between the monomeric units. Thus, the "monomeric
variants" or "monomeric antagonists" of the present invention are
those VEGF variants which are incapable of dimerizing through the
formation of cysteine-cysteine disulfide bonds. Monomeric variants
of the native VEGF protein, however, will possess the ability to
bind to and occupy cell-surface VEGF receptors without inducing a
mitogenic and/or angiogenic VEGF response, although the binding
affinity of the monomeric variant at those receptors may differ
from that of a native VEGF protein.
[0032] The term "staggered dimer", "staggered antagonist" or
grammatical equivalents thereof refers to a variant VEGF protein
having at least one amino acid alteration as compared to a native
VEGF protein and which retains the ability to dimerize through the
formation of at least one cysteine-cysteine disulfide bond,
however, where at least one of the disulfide bonds formed is
different from that which exists in the native VEGF dimeric
protein.
[0033] A "functional derivative" of a polypeptide is a compound
having a qualitative biological activity, or lack thereof, in
common with the another polypeptide. Thus, for example, a
functional derivative of a VEGF antagonist compound of the present
invention is a compound that has a qualitative biological activity
in common with an original polypeptide antagonist, for example, as
being capable of binding to cell surface VEGF receptors without
inducing a VEGF response, thereby occupying those receptors and
inhibiting native VEGF activity. "Functional derivatives" include,
but are not limited to, amino acid sequence variants of the variant
VEGF proteins of the present invention, fragments of polypeptides
from any animal species (including humans), derivatives of human
and non-human polypeptides and their fragments, and peptide analogs
of native polypeptides, provided that they have a biological
activity, or lack thereof, in common with a respective variant VEGF
protein. "Fragments" comprise regions within the sequence of a
mature polypeptide. The term "derivative" is used to define amino
acid sequence variants, and covalent modifications of a
polypeptide.
[0034] "Identity" or "homology" with respect to a polypeptide
and/or its functional derivatives is defined herein as the
percentage of amino acid residues in the candidate sequence that
are identical with the residues of a corresponding polypeptide,
after aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent homology, and not considering any
conservative substitutions as part of the sequence identity.
Neither N- or C-terminal extensions nor insertions shall be
construed as reducing identity or homology. Methods and computer
programs for the alignment are well known in the art.
[0035] The term "biological activity" in the context of the
definition of functional derivatives is defined as the possession
of at least one function qualitatively in common with another
polypeptide. The functional derivatives of the polypeptide
antagonists of the present invention are unified by their
qualitative ability to bind to a VEGF receptor without inducing a
VEGF response, thereby preventing native VEGF from binding at that
site and, in turn, inhibiting the biological activity of the native
VEGF protein.
[0036] The term "antagonist" is used to refer to a molecule
inhibiting a biological activity of a native VEGF protein.
Preferably, the VEGF antagonist compounds herein inhibit the
ability of VEGF to induce vascular endothelial cell proliferation.
Preferred antagonists essentially completely inhibit vascular
endothelial cell proliferation.
[0037] Ordinarily, the terms "amino acid" and "amino acids" refer
to all naturally occurring L-.alpha.-amino acids. In some
embodiments, however, either D-amino acids or non-natural
substituted amino acids may be present in the polypeptides or
peptides of the present invention in order to facilitate
conformational restriction. For example, in order to facilitate
disulfide bond formation and stability, a D-amino acid cysteine may
be provided at one or both termini of a peptide functional
derivative or peptide antagonist of the native VEGF protein. The
amino acids are identified by either the single-letter or
three-letter designations:
1 Asp D aspartic acid Ile l isoleucine Thr T threonine Leu L
leucine Ser S serine Tyr Y tyrosine Glu E glutamic acid Phe F
phenylalanine Pro P proline His H histidine Gly G glycine Lys K
lysine Ala A alanine Arg R arginine Cys C cysteine Trp W tryptophan
Val V valine Gln Q glutamine Met M methionine Asn N asparagine
[0038] These amino acids may be classified according to the
chemical composition and properties of their side chains. They are
broadly classified into two groups, charged and uncharged. Each of
these groups is divided into subgroups to classify the amino acids
more accurately:
[0039] I. Charged Amino Acids
[0040] Acidic Residues: aspartic acid, glutamic acid
[0041] Basic Residues: lysine, arginine, histidine
[0042] II. Uncharged Amino Acids
[0043] Hydrophilic Residues: serine, threonine, asparagine,
glutamine
[0044] Aliphatic Residues: glycine, alanine, valine, leucine,
isoleucine
[0045] Non-polar Residues: cysteine, methionine, proline
[0046] Aromatic Residues: phenylalanine, tyrosine, tryptophan
[0047] The term "amino acid sequence variant" or "amino acid
alteration" refers to molecules having at least one differences in
their amino acid sequence as compared to another amino acid
sequence, usually the native amino acid sequence.
[0048] "Substitutional" variants are those that have at least one
amino acid residue in a corresponding sequence removed and a
different amino acid inserted in its place at the same position.
The substitutions may be single, where only one amino acid in the
molecule has been substituted, or they may be multiple, where two
or more amino acids have been substituted in the same molecule.
[0049] "Insertional" variants are those with one or more amino
acids inserted immediately adjacent to an amino acid at a
particular position in a corresponding sequence. Immediately
adjacent to an amino acid means connected to either the
.alpha.-carboxy or .alpha.-amino functional group of the amino
acid.
[0050] "Deletional" variants are those with one or more amino acids
in a corresponding amino acid sequence removed. Ordinarily,
deletional variants will have one or two amino acids deleted in a
particular region of the molecule.
[0051] The term "isolated" means that a nucleic acid or polypeptide
is identified and separated from contaminant nucleic acids or
polypeptides present in the animal or human source of the nucleic
acid or polypeptide.
[0052] Hybridization is preferably performed under "stringent
conditions" which means (1) employing low ionic strength and high
temperature for washing, for example, 0.015 sodium chloride/0.0015
M sodium citrate/0.1% sodium dodecyl sulfate at 50.degree. C., or
(2) employing during hybridization a denaturing agent, such as
formamide, for example, 50% (vol/vol) formamide with 0.1% bovine
serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 nM sodium
phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM
sodium citrate at 42.degree. C. Another example is use of 50%
formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM
sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5.times.
Denhardt's solution, sonicated salmon sperm DNA (50 .mu.g/ml), 0.1%
SDS, and 10% dextran sulfate at 42.degree. C., with washes at
42.degree. C. in 0.2.times.SSC and 0.1% SDS. Yet another example is
hybridization using a buffer of 10% dextran sulfate, 2.times.SSC
(sodium chloride/sodium citrate) and 50% formamide at 55.degree.
C., followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0053] "Transfection" refers to the taking up of an expression
vector by a host cell whether or not any coding sequences are in
fact expressed.
[0054] Numerous methods of transfection are known to the ordinarily
skilled artisan, for example, CaPO.sub.4 and electroporation.
Successful transfection is generally recognized when any indication
of the operation of this vector occurs within the host cell.
[0055] "Transformation" means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or by chromosomal integrant. Depending on the host cell used,
transformation is done using standard techniques appropriate to
such cells. The calcium treatment employing calcium chloride, as
described by Cohen, S. N. Proc. Natl. Acad. Sci. (USA), 69, 2110
(1972) and Mandel et al. J. Mol. Biol. 53, 154 (1970), is generally
used for prokaryotes or other cells that contain substantial
cell-wall barriers. For mammalian cells without such cell walls,
the calcium phosphate precipitation method of Graham, F. and van
der Eb, A., Virology, 52, 456-457 (1978) is preferred. General
aspects of mammalian cell host system transformations have been
described by Axel in U.S. Pat. No. 4,399,216 issued Aug. 16, 1983.
Transformations into yeast are typically carried out according to
the method of Van Solingen, P., et al. J. Bact., 130, 946 (1977)
and Hsiao, C. L., et al. Proc. Natl. Acad. Sci. (USA) 76, 3829
(1979). However, other methods for introducing DNA into cells such
as by nuclear injection or by protoplast fusion may also be
used.
[0056] "Site-directed mutagenesis" is a technique standard in the
art, and is conducted using a synthetic oligonucleotide primer
complementary to a single-stranded phage DNA to be mutagenized
except for limited mismatching, representing the desired mutation.
Briefly, the synthetic oligonucleotide is used as a primer to
direct synthesis of a strand complementary to the single-stranded
phage DNA, and the resulting double-stranded DNA is transformed
into a phage-supporting host bacterium. Cultures of the transformed
bacteria are plated in top agar, permitting plaque formation from
single cells that harbor the phage. Theoretically, 50% of the new
plaques will contain the phage having, as a single strand, the
mutated form; 50% will have the original sequence. Plaques of
interest are selected by hybridizing with kinased synthetic primer
at a temperature that permits hybridization of an exact match, but
at which the mismatches with the original strand are sufficient to
prevent hybridization. Plaques that hybridize with the probe are
then selected, sequenced and cultured, and the DNA is
recovered.
[0057] "Operably linked" refers to juxtaposition such that the
normal function of the components can be performed. Thus, a coding
sequence "operably linked" to control sequences refers to a
configuration wherein the coding sequence can be expressed under
the control of these sequences and wherein the DNA sequences being
linked are contiguous and, in the case of a secretory leader,
contiguous and in reading phase. For example, DNA for a presequence
or secretory leader is operably linked to DNA for a polypeptide if
it is expressed as a preprotein that participates in the secretion
of the polypeptide; a promoter or enhancer is operably linked to a
coding sequence if it affects the transcription of the sequence; or
a ribosome binding site is operably linked to a coding sequence if
it is positioned so as to facilitate translation. Linking is
accomplished by ligation at convenient restriction sites. If such
sites do not exist, then synthetic oligonucleotide adaptors or
linkers are used in accord with conventional practice.
[0058] "Control sequences" refers to DNA sequences necessary for
the expression of an operably linked coding sequence in a
particular host organism. The control sequences that are suitable
for prokaryotes, for example, include a promoter, optionally an
operator sequence, a ribosome binding site, and possibly, other as
yet poorly understood sequences. Eukaryotic cells are known to
utilize promoters, polyadenylation signals, and enhancers.
[0059] "Expression system" refers to DNA sequences containing a
desired coding sequence and control sequences in operable linkage,
so that hosts transformed with these sequences are capable of
producing the encoded proteins. To effect transformation, the
expression system may be included on a vector; however, the
relevant DNA may then also be integrated into the host
chromosome.
[0060] As used herein, "cell," "cell line," and "cell culture" are
used interchangeably and all such designations include progeny.
Thus, "transformants" or "transformed cells" includes the primary
subject cell and cultures derived therefrom without regard for the
number of transfers. It is also understood that all progeny may not
be precisely identical in DNA content, due to deliberate or
inadvertent mutations. Mutant progeny that have the same
functionality as screened for in the originally transformed cell
are included. Where distinct designations are intended, it will be
clear from the context.
[0061] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are commercially available, are publicly available on an
unrestricted basis, or can be constructed from such available
plasmids in accord with published procedures. In addition, other
equivalent plasmids are known in the art and will be apparent to
the ordinary artisan.
[0062] "Digestion" of DNA refers to catalytic cleavage of the DNA
with an enzyme that acts only at certain locations in the DNA. Such
enzymes are called restriction enzymes, and the sites for which
each is specific is called a restriction site. The various
restriction enzymes used herein are commercially available and
their reaction conditions, cofactors, and other requirements as
established by the enzyme suppliers are used. Restriction enzymes
commonly are designated by abbreviations composed of a capital
letter followed by other letters representing the microorganism
from which each restriction enzyme originally was obtained and then
a number designating the particular enzyme. In general, about 1 mg
of plasmid or DNA fragment is used with about 1-2 units of enzyme
in about 20 .mu.l of buffer solution. Appropriate buffers and
substrate amounts for particular restriction enzymes are specified
by the manufacturer. Incubation of about 1 hour at 37.degree. C. is
ordinarily used, but may vary in accordance with the supplier's
instructions. After incubation, protein is removed by extraction
with phenol and chloroform, and the digested nucleic acid is
recovered from the aqueous fraction by precipitation with ethanol.
Digestion with a restriction enzyme infrequently is followed with
bacterial alkaline phosphatase hydrolysis of the terminal 5'
phosphates to prevent the two restriction cleaved ends of a DNA
fragment from "circularizing" or forming a closed loop that would
impede insertion of another DNA fragment at the restriction site.
Unless otherwise stated, digestion of plasmids is not followed by
5' terminal dephosphorylation. Procedures and reagents for
dephosphorylation are conventional (T. Maniatis et al. 1982,
Molecular Cloning: A Laboratory Manual (New York: Cold Spring
Harbor Laboratory, 1982) pp. 133-134).
[0063] "Recovery" or "isolation" of a given fragment of DNA from a
restriction digest means separation of the digest on polyacrylamide
or agarose gel by electrophoresis, identification of the fragment
of interest by comparison of its mobility versus that of marker DNA
fragments of known molecular weight, removal of the gel section
containing the desired fragment, and separation of the gel from
DNA. This procedure is known generally. For example, see R. Lawn et
al., Nucleic Acids Res. 9, 6103-6114 (1981), and D. Goeddel et al.,
Nucleic Acids Res. 8, 4057 (1980).
[0064] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (T.
Maniatis et al. 1982, supra, p. 146). Unless otherwise provided,
ligation may be accomplished using known buffers and conditions
with 10 units of T4 DNA ligase ("ligase") per 0.5 mg of
approximately equimolar amounts of the DNA fragments to be
ligated.
[0065] "Preparation" of DNA from transformants means isolating
plasmid DNA from microbial culture. Unless otherwise provided, the
alkaline/SDS method of Maniatis et al. 1982, supra, p. 90, may be
used.
[0066] "Oligonucleotides" are short-length, single- or
double-stranded polydeoxynucleotides that are chemically
synthesized by known methods (such as phosphotriester, phosphite,
or phosphoramidite chemistry, using solid phase techniques such as
described in EP Pat. Pub. No. 266,032 published May 4, 1988, or via
deoxynucleoside H-phosphonate intermediates as described by
Froehler et al., Nucl. Acids Res. 14, 5399-5407 [1986]). They are
then purified on polyacrylamide gels.
[0067] The abbreviation "KDR" refers to the kinase domain region of
the VEGF molecule, whether a native VEGF molecule or a variant
thereof. It is this region which is known to bind to the kinase
domain region receptor.
[0068] The abbreviation "FLT-1" refers to the FMS-like tyrosine
kinase binding domain which is known to bind to the corresponding
flt-1 receptor. These receptors exist on the surfaces of
endothelial cells.
[0069] B. General Methodology
[0070] 1. Glycosylation
[0071] The VEGF variants of the present invention may contain at
least one amino acid sequence that has the potential to be
glycosylated through an N-linkage and that is not normally
glycosylated in the native VEGF molecule.
[0072] Introduction of an N-linked glycosylation site in the
variant requires a tripeptidyl sequence of the formula:
asparagine-X-serine or asparagine-X-threonine, wherein asparagine
is the acceptor and X is any of the twenty genetically encoded
amino acids except proline, which prevents glycosylation. See D. K.
Struck and W. J. Lennarz, in The Biochemistry of Glycoproteins and
Proteoglycans, ed. W. J. Lennarz, Plenum Press, 1980, p. 35; R. D.
Marshall, Biochem. Soc. Symp., 40, 17 (1974), and Winzler, R. J.,
in Hormonal Proteins and Peptides (ed. Li, C. I.) p. 1-15 (Academic
Press, New York, 1973). The amino acid sequence variant herein is
modified by substituting for the amino acid(s) at the appropriate
site(s) the appropriate amino acids to effect glycosylation.
[0073] If O-linked glycosylation is to be employed, O-glycosidic
linkage occurs in animal cells between N-acetylgalactosamine,
galactose, or xylose and one of several hydroxyamino acids, most
commonly serine or threonine, but also in some cases a
5-hydroxyproline or 5-hydroxylysine residue placed in the
appropriate region of the molecule.
[0074] Glycosylation patterns for proteins produced by mammals are
described in detail in The Plasma Proteins: Structure, Function and
Genetic Control, F. W. Putnam, ed., 2nd edition, volume 4 (Academic
Press, New York, 1984), p. 271-315, the entire disclosure of which
is incorporated herein by reference. In this chapter,
asparagine-linked oligosaccharides are discussed, including their
subdivision into at least three groups referred to as complex, high
mannose, and hybrid structures, as well as O-glucosidically linked
oligosaccharides.
[0075] Chemical and/or enzymatic coupling of glycosides to proteins
can be accomplished using a variety of activated groups, for
example, as described by Aplin and Wriston in CRC Crit. Rev.
Biochem., pp. 259-306 (1981), the disclosure of which is
incorporated herein by reference. The advantages of the chemical
coupling techniques are that they are relatively simple and do not
need the complicated enzymatic machinery required for natural o-
and N-linked glycosylation. Depending on the coupling mode used,
the sugar(s) may be attached to (a) arginine or histidine, (b) free
carboxyl groups such as those of glutamic acid or aspartic acid,
(c) free sulfhydryl groups such as those of cysteine, (d) free
hydroxyl groups such as those of serine, threonine, or
hydroxyproline, (e) aromatic residues such as those of
phenylalanine, tyrosine, or tryptophan, or (f) the amide group of
glutamine. These methods are described more fully in PCT WO
87/05330 published Sep. 11, 1987, the disclosure of which is
incorporated herein by reference.
[0076] Glycosylation patterns for proteins produced by yeast are
described in detail by Tanner and Lehle, Biochim. Biophys. Acta,
906(1), 81-99 (1987) and by Kukuruzinska et al., Annu. Rev.
Biochem., 56, 915-944 (1987), the disclosures of which are
incorporated herein by reference.
[0077] 2. Amino Acid Sequence Variants
[0078] a. Additional Mutations
[0079] For purposes of shorthand designation of the VEGF variants
described herein, it is noted that numbers refer to the amino acid
residue/position along the amino acid sequences of the putative
mature VEGF protein shown in FIGS. 1A and 1B.
[0080] The present invention is directed to variants of VEGF where
such variants have modifications in the amino acid sequence that
affect the ability of the VEGF monomeric units to properly
dimerize. These variants have the ability to bind to and occupy
cell-surface VEGF receptors without substantially activating
vascular endothelial proliferation and angiogenesis, thereby
inhibiting the biological activity of native VEGF. Specifically,
amino acid modifications can be made at amino acid positions 51
and/or 60, each of which affect the ability of the variant VEGF
monomers to properly dimerize. Moreover, additional variants based
upon these original variants can be made by means generally known
well in the art and without departing from the spirit of the
present invention.
[0081] With regard to the VEGF variants of the present invention,
for example, covalent modifications can be made to various of the
amino acid residues.
[0082] b. DNA Mutations
[0083] Amino acid sequence variants of VEGF and variants thereof
can also be prepared by mutations in the DNA. Such variants
include, for example, deletions from, or insertions or
substitutions of, residues within the amino acid sequence shown in
FIG. 1. Any combination of deletion, insertion, and substitution
may also be made to arrive at the final construct, provided that
the final construct possesses the desired activity. Obviously, the
mutations that will be made in the DNA encoding the variant must
not place the sequence out of reading frame and preferably will not
create complementary regions that could produce secondary mRNA
structure (see EP 75,444A).
[0084] At the genetic level, these variants ordinarily are prepared
by site-directed mutagenesis of nucleotides in the DNA encoding the
VEGF, thereby producing DNA encoding the variant, and thereafter
expressing the DNA in recombinant cell culture.
[0085] While the site for introducing an amino acid sequence
variation is predetermined, the mutation per se need not be
predetermined. For example, to optimize the performance of a
mutation at a given site, random mutagenesis may be conducted at
the target codon or region and the expressed VEGF variants screened
for the optimal combination of desired activity. Techniques for
making substitution mutations at predetermined sites in DNA having
a known sequence are well known, for example, site-specific
mutagenesis.
[0086] Preparation of VEGF variants in accordance herewith is
preferably achieved by site-specific mutagenesis of DNA that
encodes an earlier prepared variant or a nonvariant version of the
protein. Site-specific mutagenesis allows the production of VEGF
variants through the use of specific oligonucleotide sequences that
encode the DNA sequence of the desired mutation, as well as a
sufficient number of adjacent nucleotides, to provide a primer
sequence of sufficient size and sequence complexity to form a
stable duplex on both sides of the deletion junction being
traversed. Typically, a primer of about 20 to 25 nucleotides in
length is preferred, with about 5 to 10 residues on both sides of
the junction of the sequence being altered. In general, the
technique of site-specific mutagenesis is well known in the art, as
exemplified by publications such as Adelman et al., DNA 2, 183
(1983), the disclosure of which is incorporated herein by
reference.
[0087] As will be appreciated, the site-specific mutagenesis
technique typically employs a phage vector that exists in both a
single-stranded and double-stranded form. Typical vectors useful in
site-directed mutagenesis include vectors such as the M13 phage,
for example, as disclosed by Messing et al., Third Cleveland
Symposium on Macromolecules and Recombinant DNA, Editor A. Walton,
Elsevier, Amsterdam (1981), the disclosure of which is incorporated
herein by reference. These phage are readily commercially available
and their use is generally well known to those skilled in the art.
Alternatively, plasmid vectors that contain a single-stranded phage
origin of replication (Veira et al., Meth. Enzymol., 153, 3 [1987])
may be employed to obtain single-stranded DNA.
[0088] In general, site-directed mutagenesis in accordance herewith
is performed by first obtaining a single-stranded vector that
includes within its sequence a DNA sequence that encodes the
relevant protein. An oligonucleotide primer bearing the desired
mutated sequence is prepared, generally synthetically, for example,
by the method of Crea et al., Proc.
[0089] Natl. Acad. Sci. (USA), 75, 5765 (1978). This primer is then
annealed with the single-stranded protein-sequence-containing
vector, and subjected to DNA-polymerizing enzymes such as E. coli
polymerase I Klenow fragment, to complete the synthesis of the
mutation-bearing strand. Thus, a heteroduplex is formed wherein one
strand encodes the original non-mutated sequence and the second
strand bears the desired mutation. This heteroduplex vector is then
used to transform appropriate cells such as JM101 cells and clones
are selected that include recombinant vectors bearing the mutated
sequence arrangement.
[0090] After such a clone is selected, the mutated protein region
may be removed and placed in an appropriate vector for protein
production, generally an expression vector of the type that may be
employed for transformation of an appropriate host.
[0091] c. Types of Mutations
[0092] Amino acid sequence deletions generally range from about 1
to 30 residues, more preferably 1 to 10 residues, and typically are
contiguous.
[0093] Amino acid sequence insertions include amino- and/or
carboxyl-terminal fusions of from one residue to polypeptides of
essentially unrestricted length, as well as intrasequence
insertions of single or multiple amino acid residues. Intrasequence
insertions (i.e., insertions within the mature VEGF sequence) may
range generally from about 1 to 10 residues, more preferably 1 to
5. An example of a terminal insertion includes a fusion of a signal
sequence, whether heterologous or homologous to the host cell, to
the N-terminus of the variant VEGF molecule to facilitate the
secretion of variant VEGF from recombinant hosts.
[0094] The third group of variants are those in which at least one
amino acid residue in the VEGF molecule, and preferably only one,
has been removed and a different residue inserted in its place.
Such substitutions preferably are made in accordance with the
following Table 1 when it is desired to modulate finely the
characteristics of a VEGF molecule or variant thereof.
2 TABLE 1 Original Residue Exemplary Substitutions Ala (A) gly; ser
Arg (R) lys Asn (N) gln; his Asp (D) glu Cys (C) ser Gln (Q) asn
Glu (E) asp Gly (G) ala; pro His (H) asn; gln Ile (I) leu; val Leu
(L) ile; val Lys (K) arg; gln; glu Met (M) leu; tyr; ile Phe (F)
met; leu; tyr Ser (S) thr Thr (T) ser Trp (W) tyr Tyr (Y) trp; phe
Val (V) ile; leu
[0095] Substantial changes in function or immunological identity
are made by selecting substitutions that are less conservative than
those in Table I, i.e., selecting residues that differ more
significantly in their effect on maintaining (a) the structure of
the polypeptide backbone in the area of the substitution, for
example, as a sheet or helical conformation, (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk
of the side chain. The substitutions that in general are expected
to produce the greatest changes in biological properties will be
those in which (a) glycine and/or proline is substituted by another
amino acid or is deleted or inserted; (b) a hydrophilic residue,
e.g., seryl or threonyl, is substituted for (or by) a hydrophobic
residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl;
(c) a cysteine residue is substituted for (or by) any other
residue; (d) a residue having an electropositive side chain, e.g.,
lysyl, arginyl, or histidyl, is substituted for (or by) a residue
having an electronegative charge, e.g., glutamyl or aspartyl; (e) a
residue having an electronegative side chain is substituted for (or
by) a residue having an electropositive charge; or (f) a residue
having a bulky side chain, e.g., phenylalanine, is substituted for
(or by) one not having such a side chain, e.g., glycine.
[0096] Most deletions and insertions, and substitutions in
particular, are not expected to produce radical changes in the
characteristics of the VEGF molecule or variant thereof. However,
when it is difficult to predict the exact effect of the
substitution, deletion, or insertion in advance of doing so, one
skilled in the art will appreciate that the effect will be
evaluated by routine screening assays. For example, a variant
typically is made by site-specific mutagenesis of the native
VEGF-encoding nucleic acid, expression of the variant nucleic acid
in recombinant cell culture, and, optionally, purification from the
cell culture, for example, by immunoaffinity adsorption on a rabbit
polyclonal anti-VEGF column (to absorb the variant by binding it to
at least one remaining immune epitope).
[0097] Since VEGF tends to aggregate into dimers, it is within the
scope hereof to provide hetero- and homodimers, wherein one or both
subunits are variants. Where both subunits are variants, the
changes in amino acid sequence can be the same or different for
each subunit chain. Heterodimers are readily produced by
cotransforming host cells with DNA encoding both subunits and, if
necessary, purifying the desired heterodimer, or by separately
synthesizing the subunits, dissociating the subunits (e.g., by
treatment with a chaotropic agent such as urea, guanidine
hydrochloride, or the like), mixing the dissociated subunits, and
then reassociating the subunits by dialyzing away the chaotropic
agent.
[0098] Also included within the scope of mutants herein are
so-called glyco-scan mutants. This embodiment takes advantage of
the knowledge of so-called glycosylation sites which are identified
by the sequence--NX(S/T) wherein N represents the amino acid
asparagine, X represents any amino acid except proline and probably
glycine and the third position can be occupied by either amino acid
serine or threonine. Thus, where appropriate, such a glycosylation
site can be introduced so as to produce a species containing
glycosylation moieties at that position. Similarly, an existing
glycosylation site can be removed by mutation so as to produce a
species that is devoid of glycosylation at that site. It will be
understood, again, as with the other mutations contemplated by the
present invention, that they are introduced at amino acid
position(s) 51 and/or 60 of the native VEGF amino acid sequence in
accord with the basic premise of the present invention, and they
can be introduced at other locations outside of these amino acid
positions within the overall molecule so long as the final product
does not differ in overall kind from the properties of the original
VEGF variant.
[0099] The activity of the cell lysate or purified VEGF variant is
then screened in a suitable screening assay for the desired
characteristic. For example, binding to the cell-surface VEGF
receptor can be routinely assayed by employing well known VEGF
binding assays such as those described in the Examples below. A
change in the immunological character of the VEGF molecule, such as
affinity for a given antibody, is measured by a competitive-type
immunoassay. Changes in the enhancement or suppression of vascular
endothelium growth by the candidate variants are measured by the
appropriate assay (see Examples below). Modifications of such
protein properties as redox or thermal stability, hydrophobicity,
susceptibility to proteolytic degradation, or the tendency to
aggregate with carriers or into multimers are assayed by methods
well known to the ordinarily skilled artisan.
[0100] 3. Recombinant Expression
[0101] The variant VEGF molecule desired may be prepared by any
technique, including by recombinant methods. Likewise, an isolated
DNA is understood herein to mean chemically synthesized DNA, cDNA,
chromosomal, or extrachromosomal DNA with or without the 3'- and/or
5'-flanking regions. Preferably, the desired VEGF variant herein is
made by synthesis in recombinant cell culture.
[0102] For such synthesis, it is first necessary to secure nucleic
acid that encodes a VEGF molecule. DNA encoding a VEGF molecule may
be obtained from bovine pituitary follicular cells by (a) preparing
a cDNA library from these cells, (b) conducting hybridization
analysis with labeled DNA encoding the VEGF or fragments thereof
(up to or more than 100 base pairs in length) to detect clones in
the library containing homologous sequences, and (c) analyzing the
clones by restriction enzyme analysis and nucleic acid sequencing
to identify full-length clones. DNA encoding a VEGF molecule from a
mammal other than bovine can also be obtained in a similar fashion
by screening endothelial or leukemia cell libraries. DNA that is
capable of hybridizing to a VEGF-encoding DNA under low stringency
conditions is useful for identifying DNA encoding VEGF. Both high
and low stringency conditions are defined further below. If
full-length clones are not present in a cDNA library, then
appropriate fragments may be recovered from the various clones
using the nucleic acid sequence information disclosed herein for
the first time and ligated at restriction sites common to the
clones to assemble a full-length clone encoding the VEGF molecule.
Alternatively, genomic libraries will provide the desired DNA.
[0103] Once this DNA has been identified and isolated from the
library it is ligated into a replicable vector for further cloning
or for expression.
[0104] In one example of a recombinant expression system a
VEGF-encoding gene is expressed in mammalian cells by
transformation with an expression vector comprising DNA encoding
the VEGF. It is preferable to transform host cells capable of
accomplishing such processing so as to obtain the VEGF in the
culture medium or periplasm of the host cell, i.e., obtain a
secreted molecule.
[0105] a. Useful Host Cells and Vectors
[0106] The vectors and methods disclosed herein are suitable for
use in host cells over a wide range of prokaryotic and eukaryotic
organisms.
[0107] In general, of course, prokaryotes are preferred for the
initial cloning of DNA sequences and construction of the vectors
useful in the invention. For example, E. coli K12 strain MM 294
(ATCC No. 31,446) is particularly useful. Other microbial strains
that may be used include E. coli strains such as E. coli B and E.
coli X1776 (ATCC No. 31,537). These examples are, of course,
intended to be illustrative rather than limiting.
[0108] Prokaryotes may also be used for expression. The
aforementioned strains, as well as E. coli strains W3110 (F-,
lambda-, prototrophic, ATCC No. 27,325), K5772 (ATCC No. 53,635),
and SR101, bacilli such as Bacillus subtilis, and other
enterobacteriaceae such as Salmonella typhimurium or Serratia
marcesans, and various pseudomonas species, may be used.
[0109] In general, plasmid vectors containing replicon and control
sequences that are derived from species compatible with the host
cell are used in connection with these hosts. The vector ordinarily
carries a replication site, as well as marking sequences that are
capable of providing phenotypic selection in transformed cells. For
example, E. coli is typically transformed using pBR322, a plasmid
derived from an E. coli species (see, e.g., Bolivar et al., Gene 2,
95 [1977]). pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides easy means for identifying transformed
cells. The pBR322 plasmid, or other microbial plasmid or phage,
must also contain, or be modified to contain, promoters that can be
used by the microbial organism for expression of its own
proteins.
[0110] Those promoters most commonly used in recombinant DNA
construction include the .beta.-lactamase (penicillinase) and
lactose promoter systems (Chang et al., Nature, 375, 615 [1978];
Itakura et al., Science, 198, 1056 [1977]; Goeddel et al., Nature,
281, 544 [1979]) and a tryptophan (trp) promoter system (Goeddel et
al., Nucleic Acids Res., 8, 4057 [1980]; EPO Appl. Publ. No.
0036,776). While these are the most commonly used, other microbial
promoters have been discovered and utilized, and details concerning
their nucleotide sequences have been published, enabling a skilled
worker to ligate them functionally with plasmid vectors (see, e.g.,
Siebenlist et al., Cell, 20, 269 [1980]).
[0111] In addition to prokaryotes, eukaryotic microbes, such as
yeast cultures, may also be used. Saccharomyces cerevisiae, or
common baker's yeast, is the most commonly used among eukaryotic
microorganisms, although a number of other strains are commonly
available. For expression in Saccharomyces, the plasmid YRp7, for
example (Stinchcomb et al., Nature 282, 39 [1979]; Kingsman et al.,
Gene 7, 141 [1979]; Tschemper et al., Gene 10, 157 [1980]), is
commonly used. This plasmid already contains the trp1 gene that
provides a selection marker for a mutant strain of yeast lacking
the ability to grow in tryptophan, for example, ATCC No. 44,076 or
PEP4-1 (Jones, Genetics, 85, 12 [1977]). The presence of the trp1
lesion as a characteristic of the yeast host cell genome then
provides an effective environment for detecting transformation by
growth in the absence of tryptophan.
[0112] Suitable promoting sequences in yeast vectors include the
promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol.
Chem. 255, 2073 [1980]) or other glycolytic enzymes (Hess et al.,
J. Adv. Enzyme Reg. 7, 149 [1968]; Holland et al., Biochemistry 17,
4900 [1978]), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. In
constructing suitable expression plasmids, the termination
sequences associated with these genes are also ligated into the
expression vector 3' of the sequence desired to be expressed to
provide polyadenylation of the mRNA and termination. Other
promoters, which have the additional advantage of transcription
controlled by growth conditions, are the promoter region for
alcohol dehydrogenase 2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism, and the
aforementioned glyceraldehyde-3-phosphate dehydrogenase, and
enzymes responsible for maltose and galactose utilization. Any
plasmid vector containing yeast-compatible promoter, origin of
replication and termination sequences is suitable.
[0113] In addition to microorganisms, cultures of cells derived
from multicellular organisms may also be used as hosts. In
principle, any such cell culture is workable, whether from
vertebrate or invertebrate culture. However, interest has been
greatest in vertebrate cells, and propagation of vertebrate cells
in culture (tissue culture) has become a routine procedure in
recent years [Tissue Culture, Academic Press, Kruse and Patterson,
editors (1973)]. Examples of such useful host cell lines are VERO
and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138,
BHK, COS-7, 293, and MDCK cell lines. Expression vectors for such
cells ordinarily include (if necessary) an origin of replication, a
promoter located in front of the gene to be expressed, along with
any necessary ribosome binding sites, RNA splice sites,
polyadenylation sites, and transcriptional terminator
sequences.
[0114] For use in mammalian cells, the control functions on the
expression vectors are often provided by viral material. For
example, commonly used promoters are derived from polyoma,
Adenovirus2, and most frequently Simian Virus 40 (SV40). The early
and late promoters of SV40 virus are particularly useful because
both are obtained easily from the virus as a fragment that also
contains the SV40 viral origin of replication [Fiers et al.,
Nature, 273, 113 (1978)]. Smaller or larger SV40 fragments may also
be used, provided there is included the approximately 250-bp
sequence extending from the HindIII site toward the BglI site
located in the viral origin of replication. Further, it is also
possible, and often desirable, to utilize promoter or control
sequences normally associated with the desired gene sequence,
provided such control sequences are compatible with the host cell
systems.
[0115] An origin of replication may be provided either by
construction of the vector to include an exogenous origin, such as
may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV,
BPV) source, or may be provided by the host cell chromosomal
replication mechanism. If the vector is integrated into the host
cell chromosome, the latter is often sufficient.
[0116] Satisfactory amounts of protein are produced by cell
cultures; however, refinements, using a secondary coding sequence,
serve to enhance production levels even further. One secondary
coding sequence comprises dihydrofolate reductase (DHFR) that is
affected by an externally controlled parameter, such as
methotrexate (MTX), thus permitting control of expression by
control of the methotrexate concentration.
[0117] In selecting a preferred host cell for transfection by the
vectors of the invention that comprise DNA sequences encoding both
VEGF and DHFR protein, it is appropriate to select the host
according to the type of DHFR protein employed. If wild-type DHFR
protein is employed, it is preferable to select a host cell that is
deficient in DHFR, thus permitting the use of the DHFR coding
sequence as a marker for successful transfection in selective
medium that lacks hypoxanthine, glycine, and thymidine. An
appropriate host cell in this case is the Chinese hamster ovary
(CHO) cell line deficient in DHFR activity, prepared and propagated
as described by Urlaub and Chasin, Proc. Natl. Acad. Sci. (USA) 77,
4216 (1980).
[0118] On the other hand, if DHFR protein with low binding affinity
for MTX is used as the controlling sequence, it is not necessary to
use DHFR-deficient cells. Because the mutant DHFR is resistant to
methotrexate, MTX-containing media can be used as a means of
selection provided that the host cells are themselves methotrexate
sensitive. Most eukaryotic cells that are capable of absorbing MTX
appear to be methotrexate sensitive. One such useful cell line is a
CHO line, CHO-K1 (ATCC No. CCL 61).
[0119] b. Typical Methodology Employable
[0120] Construction of suitable vectors containing the desired
coding and control sequences employs standard ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and
religated in the form desired to prepare the plasmids required.
[0121] If blunt ends are required, the preparation may be treated
for 15 minutes at 15.degree. C. with 10 units of Polymerase I
(Klenow), phenol-chloroform extracted, and ethanol
precipitated.
[0122] Size separation of the cleaved fragments may be performed
using 6 percent polyacrylamide gel described by Goeddel et al.,
Nucleic Acids Res. 8, 4057 (1980).
[0123] For analysis to confirm correct sequences in plasmids
constructed, the ligation mixtures are typically used to transform
E. coli K12 strain 294 (ATCC 31,446) or other suitable E. coli
strains, and successful transformants selected by ampicillin or
tetracycline resistance where appropriate. Plasmids from the
transformants are prepared and analyzed by restriction mapping
and/or DNA sequencing by the method of Messing et al., Nucleic
Acids Res. 9, 309 (1981) or by the method of Maxam et al., Methods
of Enzymology 65, 499 (1980).
[0124] After introduction of the DNA into the mammalian cell host
and selection in medium for stable transfectants, amplification of
DHFR-protein-coding sequences is effected by growing host cell
cultures in the presence of approximately 20,000-500,000 nM
concentrations of methotrexate, a competitive inhibitor of DHFR
activity. The effective range of concentration is highly dependent,
of course, upon the nature of the DHFR gene and the characteristics
of the host. Clearly, generally defined upper and lower limits
cannot be ascertained. Suitable concentrations of other folic acid
analogs or other compounds that inhibit DHFR could also be used.
MTX itself is, however, convenient, readily available, and
effective.
[0125] Other techniques employable are described in a section just
prior to the examples.
[0126] 4. Utilities and Formulation
[0127] The variant VEGF antagonists of the present invention have a
number of therapeutic uses associated with the vascular
endothelium. Such uses include, for example, incorporation into
formed articles which can be used in modulating endothelial cell
growth and angiogenesis. In addition, tumor invasion and metastasis
may be modulated with these articles. Other disorders for which the
polypeptides of the present invention may find use are discussed
supra.
[0128] For the indications referred to above, the variant VEGF
antagonist molecule will be formulated and dosed in a fashion
consistent with good medical practice taking into account the
specific disease or disorder to be treated, the condition of the
individual patient, the site of delivery of the VEGF antagonist,
the method of administration, and other factors known to
practitioners. Thus, for purposes herein, the "therapeutically
effective amount" of the VEGF is an amount that is effective either
to prevent, lessen the worsening of, alleviate, or cure the treated
condition, in particular that amount which is sufficient to
substantially inhibit the growth of vascular endothelium in
vivo.
[0129] VEGF amino acid sequence variants and derivatives that are
immunologically crossreactive with antibodies raised against native
VEGF are useful in immunoassays for VEGF as standards, or, when
labeled, as competitive reagents.
[0130] The VEGF antagonist is prepared for storage or
administration by mixing VEGF antagonist having the desired degree
of purity with physiologically acceptable carriers, excipients, or
stabilizers. Such materials are non-toxic to recipients at the
dosages and concentrations employed. If the VEGF antagonist is
water soluble, it may be formulated in a buffer such as phosphate
or other organic acid salt preferably at a pH of about 7 to 8. If a
VEGF variant is only partially soluble in water, it may be prepared
as a microemulsion by formulating it with a nonionic surfactant
such as Tween, Pluronics, or PEG, e.g., Tween 80, in an amount of
0.04-0.05% (w/v), to increase its solubility.
[0131] Optionally other ingredients may be added such as
antioxidants, e.g., ascorbic acid; low molecular weight (less than
about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, mannose, or
dextrins; chelating agents such as EDTA; and sugar alcohols such as
mannitol or sorbitol.
[0132] The VEGF antagonist to be used for therapeutic
administration must be sterile. Sterility is readily accomplished
by filtration through sterile filtration membranes (e.g., 0.2
micron membranes). The VEGF ordinarily will be stored in
lyophilized form or as an aqueous solution if it is highly stable
to thermal and oxidative denaturation. The pH of the VEGF
antagonist preparations typically will be about from 6 to 8,
although higher or lower pH values may also be appropriate in
certain instances. It will be understood that use of certain of the
foregoing excipients, carriers, or stabilizers will result in the
formation of salts of the VEGF antagonist.
[0133] If the VEGF antagonist is to be used parenterally,
therapeutic compositions containing the VEGF antagonist generally
are placed into a container having a sterile access port, for
example, an intravenous solution bag or vial having a stopper
pierceable by a hypodermic injection needle.
[0134] Generally, where the disorder permits, one should formulate
and dose the VEGF for site-specific delivery. This is convenient in
the case of site-specific solid tumors.
[0135] Sustained release formulations may also be prepared, and
include the formation of microcapsular particles and implantable
articles. For preparing sustained-release VEGF antagonist
compositions, the VEGF antagonist is preferably incorporated into a
biodegradable matrix or microcapsule. A suitable material for this
purpose is a polylactide, although other polymers of
poly-(a-hydroxycarboxylic acids), such as
poly-D-(-)-3-hydroxybutyric acid (EP 133,988A), can be used. Other
biodegradable polymers include poly(lactones), poly(acetals),
poly(orthoesters), or poly(orthocarbonates). The initial
consideration here must be that the carrier itself, or its
degradation products, is nontoxic in the target tissue and will not
further aggravate the condition. This can be determined by routine
screening in animal models of the target disorder or, if such
models are unavailable, in normal animals. Numerous scientific
publications document such animal models.
[0136] For examples of sustained release compositions, see U.S.
Pat. No. 3,773,919, EP 58,481 A, U.S. Pat. No. 3,887,699, EP
158,277A, Canadian Patent No. 1176565, U. Sidman et al.,
Biopolymers 22, 547 [1983], and R. Langer et al., Chem. Tech. 12,
98 [1982].
[0137] When applied topically, the VEGF antagonist is suitably
combined with other ingredients, such as carriers and/or adjuvants.
There are no limitations on the nature of such other ingredients,
except that they must be pharmaceutically acceptable and
efficacious for their intended administration, and cannot degrade
the activity of the active ingredients of the composition. Examples
of suitable vehicles include ointments, creams, gels, or
suspensions, with or without purified collagen. The compositions
also may be impregnated into transdermal patches, plasters, and
bandages, preferably in liquid or semi-liquid form.
[0138] For obtaining a gel formulation, the VEGF antagonist
formulated in a liquid composition may be mixed with an effective
amount of a water-soluble polysaccharide or synthetic polymer such
as polyethylene glycol to form a gel of the proper viscosity to be
applied topically. The polysaccharide that may be used includes,
for example, cellulose derivatives such as etherified cellulose
derivatives, including alkyl celluloses, hydroxyalkyl celluloses,
and alkylhydroxyalkyl celluloses, for example, methylcellulose,
hydroxyethyl cellulose, carboxymethyl cellulose, hydroxypropyl
methylcellulose, and hydroxypropyl cellulose; starch and
fractionated starch; agar; alginic acid and alginates; gum arabic;
pullullan; agarose; carrageenan; dextrans; dextrins; fructans;
inulin; mannans; xylans; arabinans; chitosans; glycogens; glucans;
and synthetic biopolymers; as well as gums such as xanthan gum;
guar gum; locust bean gum; gum arabic; tragacanth gum; and karaya
gum; and derivatives and mixtures thereof. The preferred gelling
agent herein is one that is inert to biological systems, nontoxic,
simple to prepare, and not too runny or viscous, and will not
destabilize the VEGF antagonist held within it.
[0139] Preferably the polysaccharide is an etherified cellulose
derivative, more preferably one that is well defined, purified, and
listed in USP, e.g., methylcellulose and the hydroxyalkyl cellulose
derivatives, such as hydroxypropyl cellulose, hydroxyethyl
cellulose, and hydroxypropyl methylcellulose. Most preferred herein
is methylcellulose.
[0140] The polyethylene glycol useful for gelling is typically a
mixture of low and high molecular weight polyethylene glycols to
obtain the proper viscosity. For example, a mixture of a
polyethylene glycol of molecular weight 400-600 with one of
molecular weight 1500 would be effective for this purpose when
mixed in the proper ratio to obtain a paste.
[0141] The term "water soluble" as applied to the polysaccharides
and polyethylene glycols is meant to include colloidal solutions
and dispersions. In general, the solubility of the cellulose
derivatives is determined by the degree of substitution of ether
groups, and the stabilizing derivatives useful herein should have a
sufficient quantity of such ether groups per anhydroglucose unit in
the cellulose chain to render the derivatives water soluble. A
degree of ether substitution of at least 0.35 ether groups per
anhydroglucose unit is generally sufficient. Additionally, the
cellulose derivatives may be in the form of alkali metal salts, for
example, the Li, Na, K, or Cs salts.
[0142] If methylcellulose is employed in the gel, preferably it
comprises about 2-5%, more preferably about 3%, of the gel and the
VEGF antagonist is present in an amount of about 300-1000 mg per ml
of gel.
[0143] The dosage to be employed is dependent upon the factors
described above. As a general proposition, the VEGF antagonist is
formulated and delivered to the target site or tissue at a dosage
capable of establishing in the tissue a VEGF antagonist level
greater than about 0.1 ng/cc up to a maximum dose that is
efficacious but not unduly toxic. This intra-tissue concentration
should be maintained if possible by continuous infusion, sustained
release, topical application, or injection at empirically
determined frequencies.
[0144] 5. Pharmaceutical Compositions
[0145] The compounds of the present invention can be formulated
according to known methods to prepare pharmaceutically useful
compositions, whereby the VEGF antagonists hereof are combined in
admixture with a pharmaceutically acceptable carrier vehicle.
Suitable carrier vehicles and their formulation, inclusive of other
human proteins, e.g., human serum albumin, are described, for
example, in Remington's Pharmaceutical Sciences, 16th ed., 1980,
Mack Publishing Co., edited by Oslo et al. the disclosure of which
is hereby incorporated by reference. The VEGF variants herein may
be administered parenterally, or by other methods that ensure its
delivery to the bloodstream in an effective form.
[0146] Compositions particularly well suited for the clinical
administration of the VEGF antagonists hereof employed in the
practice of the present invention include, for example, sterile
aqueous solutions, or sterile hydratable powders such as
lyophilized protein. It is generally desirable to include further
in the formulation an appropriate amount of a pharmaceutically
acceptable salt, generally in an amount sufficient to render the
formulation isotonic. A pH regulator such as arginine base, and
phosphoric acid, are also typically included in sufficient
quantities to maintain an appropriate pH, generally from 5.5 to
7.5. Moreover, for improvement of shelf-life or stability of
aqueous formulations, it may also be desirable to include further
agents such as glycerol. In this manner, variant t-PA formulations
are rendered appropriate for parenteral administration, and, in
particular, intravenous administration.
[0147] Dosages and desired drug concentrations of pharmaceutical
compositions of the present invention may vary depending on the
particular use envisioned. For example, "bolus" doses may typically
be employed with subsequent administrations being given to maintain
an approximately constant blood level, preferably on the order of
about 3 .mu.g/ml.
[0148] However, for use in connection with emergency medical care
facilities where infusion capability is generally not available and
due to the generally critical nature of the underlying disease, it
will generally be desirable to provide somewhat larger initial
doses, such as an intravenous bolus.
[0149] For the various therapeutic indications referred to for the
compounds hereof, the VEGF antagonists will be formulated and dosed
in a fashion consistent with good medical practice taking into
account the specific disorder to be treated, the condition of the
individual patient, the site of delivery, the method of
administration and other factors known to practitioners in the
respective art. Thus, for purposes herein, the "therapeutically
effective amount" of the VEGF molecules hereof is an amount that is
effective either to prevent, lessen the worsening of, alleviate, or
cure the treated condition, in particular that amount which is
sufficient to substantially reduce or inhibit the growth of
vascular endothelium in vivo. In general a dosage is employed
capable of establishing in the tissue that is the target for the
therapeutic indication being treated a level of a VEGF antagonist
hereof greater than about 0.1 ng/cm.sup.3 up to a maximum dose that
is efficacious but not unduly toxic. It is contemplated that
intra-tissue administration may be the choice for certain of the
therapeutic indications for the compounds hereof.
[0150] The following examples are intended merely to illustrate the
best mode now known for practicing the invention but the invention
is not to be considered as limited to the details of such
examples.
EXAMPLE I
[0151] Materials--Muta-gene phagemid in vitro mutagenesis kit,
horse-radish peroxidase conjugated goat IgG specific for murine
IgG, pre-stained low-range MW standards and Trans-Blot Transfer
Medium (pure nitrocellulose membrane) were purchased from BioRad
Laboratories (Richmond, Calif.). Qiagen plasmid Tip 100 kit and
Sequenase version 2.0 were from Qiagen (Chatsworth, Calif.) and
United States Biochemical (Cleveland, Ohio), respectively. SDS gels
(4-20% gradient polyacrylamide) and pre-cut blotting paper were
from Integrated Separations Systems (Natick, Mass.). SDS sample
buffer (x concentrate) and various restriction enzymes were from
New England Biolabs (Beverly, Mass.). O-phenylenediamine, citrate
phosphate buffers, sodium dodecyl sulfate, and H.sub.2O.sub.2
substrate tablets were purchased from Sigma (St. Louis, Mo.).
BufferEZE formula 1 (transfer buffer) and X-OMat AR X-ray film were
from Eastman Kodak Co. (Rochester, N.Y.). Maxosorb and Immunlon-1
microtiter plates were purchased from Nunc (Kamstrup, Denmark) and
Dynatech (Chantilly, Va.), respectively. Cell culture plates
(12-well) and culture media (with calf serum) were from Costar
(Cambridge, Mass.) and Gibco (Grand Island, N.Y.), respectively.
Polyethylene-20-sorbitan monolaurate (Tween-20) was from Fisher
Biotech (Fair Lawn, N.J.). G25 Sephadex columns (PD-10) and
.sup.125I labeled Protein A were from Pharmacia (Piscataway, N.J.)
and Amersham (Arlington Heights, Ill.), respectively. Bovine serum
albumin (BSA) and rabbit IgG anti-human IgG (Fc-specific) were
purchased from Cappel (Durham, N.C.) and Calbiochem (La Jolla,
Calif.), respectively. Plasmid vector (pRK5), competent E. coli
cells (DH5a and CJ236), synthetic oligonucleotides, cell culture
medium, purified CHO-derived VEGF.sub.165, monoclonal (Mates
A4.6.1, 2E3, 4D7, SC3, and SF8) and polyclonal antibodies to
VEGF.sub.165 were prepared at Genentech, Inc. (South San Francisco,
Calif.). Construction, expression and purification of FLT-1, flkI
and KDR receptor-IgG chimeras was as described by Park, et al. J.
Biol. Chem. 269, 25646-25654 (1994).
[0152] Site-directed Mutagenesis and Expression of VEGF
Variants--Site-directed mutagenesis was performed using the
Muta-Gene Phagemid in vitro mutagenesis kit according to the method
of Kunkel Proc. Natl. Acad. Sci. 82, 488-492 (1985) and Kunkel et
al., Methods Enzymol. 154, 367-382 (1987). A plasmid vector pRK5
containing cDNA for VEGF.sub.165 isoform was used for mutagenesis
and transient expression. The pRK5 vector is a modified pUC118
vector and contains a CMV enhancer and promoter [Nakamaye et al.,
Nucleic Acids Res. 14, 9679-9698 (1986) and Vieira et al., Methods
Enzymol. 155, 3-11 (1987)]. The mutagenized DNA was purified using
the Qiagen Plasmid Midi Kit Tip 100 and the sequence of the
mutations was verified using Sequenase Version 2.0 Kit. The mutated
DNA was analyzed by restriction enzyme digestion as described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual part I,
C5.28-5.32, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989).
[0153] Transient transfection of human fetal kidney "293 cells" was
performed in 6-well plates using the modified calcium phosphate
precipitate method as previously described [Jordan et al.,
Bio/Technology (manuscript in preparation) (1994); Chen et al.,
Mol. Cell. Biol. 7, 2745-2752 (1987); Gorman et al., DNA and
Protein Engineering Techniques 2, 3-10 (1990); Graham et al.,
Virology 52, 456-467 (1973)]. Briefly, approximately
1.2.times.10.sup.6 cells were incubated overnight at 37.degree. C.
in the presence of 15 .mu.g of precipitated DNA. Cell culture
supernatant was replaced with serum free medium, and cell
monolayers were incubated for 72 hours at 37.degree. C. Conditioned
media (3 ml) was harvested, centrifuged, aliquoted and stored at
-70.degree. C. until use.
[0154] Quantitation of VEGF.sub.165 Variants by ELISA--A
radioimmunometric assay previously described [Aiello et al., N.
Engl. J. Med. 331, 1480-1487 (1994)], was adapted for the
quantitation of VEGF mutants by the following procedure. Individual
wells of a 96-well microtiter plate were coated with 100 .mu.l of a
3 .mu.g/ml solution of an anti-VEGF.sub.165 polyclonal antibody in
50 mM sodium carbonate buffer pH 9.6 overnight at 4.degree. C. The
supernatant was discarded, and the wells were washed 4 times with
PBS containing 0.03% Tween 80. The plate was blocked in assay
buffer (0.5% BSA, 0.03% Tween 80, 0.01% Thimerosal in PBS) for one
hr (300 .mu.l/well) at ambient temperature, then the wells were
washed. Diluted samples (100 .mu.l) and VEGF.sub.165 standard
(ranging from 0.1 to 10 ng/ml) were added to each well and
incubated for one hr at ambient temperature with gentle agitation.
The supernatant was discarded, and the wells were washed. Anti-VEGF
murine monoclonal antibody 5F8 solution (100 .mu.l at 1 .mu.g/ml)
was added, and the microtiter plate was incubated at ambient
temperature for one hr with gentle agitation. After the supernatant
was discarded, the plate was washed and horseradish peroxidase
conjugated goat IgG specific for murine IgG (100 .mu.l) at a
dilution of 1:25000 was immediately added to each well. The plate
was incubated for one hr at ambient temperature with gentle
agitation after which the supernatant discarded, the wells washed,
and developed by addition of ortho-phenylenediamine (0-04%),
H.sub.2O.sub.2 (0.012%) in 50 mM citrate phosphate buffer pH 5 (100
.mu.l), then incubated in the dark at ambient temperature for 10
min. The reaction was stopped by adding 50 .mu.l of 4.5 N
H.sub.2SO.sub.4 to each well and the absorbance was measured at 492
nm on a microplate reader (SLT Labs). The concentrations of
VEGF.sub.165 variants were quantitated by interpolation of a
standard curve using non-linear regression analysis. For purposes
of comparison, a second ELISA was developed that utilized a dual
monoclonal format. The assay was similar to the above described
ELISA, except a neutralizing monoclonal antibody (Mab A4.6.1) was
used to coat the microtiter plates [Kim et al., Growth Factors 7,
53-64 (1992)].
[0155] Immunoblotting of VEGF mutants--Aliquots of conditioned cell
media (16 .mu.l) containing VEGF or VEGF mutant (approx. 10 ng)
were added to .times.SDS sample buffer (4 .mu.l) and heated at
90.degree. C. for 3 min prior to loading on SDS polyacrylamide (4
to 20% acrylamide) gels. Pre-stained MW standards (10 .mu.l) were
loaded in the outer lanes of the SDS gels. Gels were run at 25 mA
for 90 min at 4.degree. C. Gels were transferred to nitrocellulose
paper in a Bio-Rad tank blotter containing BufferEZE with 0.1% SDS
for 90 min at 250 mA at 25.degree. C. Nitrocellulose was pre-wetted
in transfer buffer with 0.1% SDS for 10 min prior to use.
Transferred immunoblots were blocked in PBS overnight with 1.0% BSA
and 0.1% Tween 20 (blocking buffer) at 4.degree. C. A solution
containing 5 murine anti-VEGF Mabs (A.4.6.1, 5C3, 5F8, 4D7, and
2E3) was prepared with 2 .mu.g/ml of each Mab in blocking buffer
and used as primary antibody. The primary antibody solution was
incubated with the immunoblots for 4 hr at 25.degree. C. with
gentle agitation, then washed 3.times. for 10 min in blocking
buffer at 25.degree. C. .sup.125I labeled Protein A was diluted to
10.sup.4 cpm/ml (final concentration) in blocking buffer and
incubated with the immunoblots for 60 min with gentle agitation at
25.degree. C. Immunoblots were washed 3.times. for 10 min in
blocking buffer at 25.degree. C., then dried on filter paper and
placed on Kodak X-Omat film with two intensifying screens at
-70.degree. C. for 3 days.
[0156] Preparation of .sup.125I labeled VEGF.sub.165--Radiolabeling
of CHO-derived VEGF.sub.165 was prepared using a modification of
the chloramine T catalyzed iodination method [Hunter et al., Nature
194, 495-496 (1962)]. In a typical reaction, 10 .mu.l of 1 M
Tris-HCl, 0.01% Tween 20 at pH 7.5 was added to 5 .mu.l of sodium
iodide-125 (0.5 milliCuries, 0.24 nmol) in a capped reaction
vessel. To this reaction, 10 .mu.l of CHO-derived VEGF.sub.165 (10
.mu.g, 0.26 nmol) was added. The iodination was initiated by
addition of 10 .mu.l of 1 mg/ml chloramine T in 0.1 M sodium
phosphate, pH 7.4. After 60 sec, iodination was terminated by
addition of sodium metabisulfite (20 .mu.l, 1 mg/ml) in 0.1 M
sodium phosphate, pH 7.5. The reaction vessel was vortexed after
each addition. The reaction mixture was applied to a PD-10 column
(G25 Sephadex) that was pre-equilibrated with 0.5% BSA, 0.01% Tween
20 in PBS. Fractions were collected and counted for radioactivity
with a gamma scintillation counter (LKB model 1277). Typically, the
specific radioactivity of the iodinated VEGF was 26.+-.2.5
.mu.Ci/.mu.g, which corresponded to one .sup.125I per two molecules
of VEGF.sub.165 dimer.
[0157] VEGF.sub.165 Receptor Binding Assay--The assay was performed
in 96-well immunoplates (Immulon-1); each well was coated with 100
.mu.l of a solution containing 10 .mu.g/ml of rabbit IgG anti-human
IgG (Fc-specific) in 50 mM sodium carbonate buffer pH 9.6 overnight
at 4.degree. C. After the supernatant was discarded, the wells were
washed three times in washing buffer (0.01% Tween 80 in PBS). The
plate was blocked (300 .mu.l/well) for one hr in assay buffer (0.5%
BSA, 0.03% Tween 80, 0.01% Thimerosal in PBS). The supernatant was
discarded and the wells were washed. A cocktail was prepared with
conditioned cell media containing VEGF.sub.165 mutants at varying
concentrations (100 .mu.l), .sup.125I radiolabeled VEGF.sub.165
(approx. 5.times.10.sub.3 cpm in 50 .mu.l) which was mixed with
VEGF receptor-IgG chimeric protein, FLT-1 IgG, flk-1 IgG or KDR-IgG
(3-15 ng/ml, final concentration, 50 .mu.l) in micronic tubes.
Aliquots of this solution (100 .mu.l) were added to pre-coated
microtiter plates and incubated for 4 hr at ambient temperature
with gentle agitation. The supernatant was discarded, the plate
washed, and individual microtiter wells were counted by gamma
scintigraphy (LKB model 1277). The competitive binding between
unlabeled VEGF.sub.165 (or VEGF.sub.165 mutants) and .sup.125I
radiolabeled VEGF.sub.165 to the FLT-1, Flk-1, or KDR receptors
were plotted, and analyzed using a four parameter fitting program
(Kaleidagraph, Adelbeck Software).
[0158] The apparent dissociation constant for each VEGF mutant was
estimated from the concentration required to achieve 50% inhibition
(IC.sub.50).
[0159] Assay for Vascular Endothelial Cell Growth--The mitogenic
activity of VEGF variants was determined by using bovine adrenal
cortical endothelial (ACE) cells as target cells as previously
described [Ferrara et al., Biochem. Biophys. Res. Comm. 161,
851-859 (1989)]. Briefly, cells were plated sparsely (7000
cells/well) in 12 well plates and incubated overnight in Dulbecco's
modified Eagle's medium supplemented with 10% calf serum, 2 mM
glutamine, and antibiotics. The medium was exchanged the next day,
and VEGF or VEGF mutants, diluted in culture media at
concentrations ranging from 100 ng/ml to 10 pg/ml, were layered in
duplicate onto the seeded cells. After incubation for 5 days at
37.degree. C., the cells were dissociated with trypsin, and
quantified using a Coulter counter.
Isolation of VEGF cDNA
[0160] Total RNA was extracted [Ullrich et al., Science 196,
1313-1317 (1977)] from bovine pituitary follicular cells [obtained
as described by Ferrara et al., Meth. Enzymol. supra, and Ferrara
et al., Am. J. Physiol., supra] and the polyadenylated mRNA
fraction was isolated by oligo(dT)-cellulose chromatography. Aviv
et al., Proc. Natl. Acad. Sci. USA 69, 1408-1412 (1972). The cDNA
was prepared [Wickens et al., J. Biol. Chem. 253, 2483-2495 (1978)]
by priming with dT.sub.12-.sub.18 or a random hexamer dN.sub.6.
[0161] The double-stranded cDNA was synthesized using a cDNA kit
from Amersham, and the resulting cDNA was subcloned into
EcoRI-cleaved Igt10 as described [Huynh et al., DNA Cloning
Techniques, A Practical Approach, Glover ed. (IRL, Oxford, 1985)],
except that asymmetric EcoRI linkers [Norris et al., Gene 7,
355-362 (1979)] were used, thus avoiding the need for the EcoRI
methylase treatment.
[0162] The recombinant phage were plated on E. coli C600 Hfl [Huynh
et al. supra] and replica plated onto nitrocellulose filters.
Benton et al., Science 196, 180-182 (1977). These replica were
hybridized with a .sup.32P-labeled [Taylor et al., Biochim.
Biophys. Acta, 442, 324-330 (1976)] synthetic oligonucleotide probe
of the sequence:
5'-CCTATGGCTGAAGGCGGCCAGAAGCCTCACGAAGTGGTGAAGTTCATGGACGTGTATCA-3'
at 42.degree. C. in 20% formamide, 5.times.SSC, 50 mM sodium
phosphate pH 6.8, 0.1% sodium pyrophosphate, 5.times. Denhardt's
solution, and 50 mg/ml salmon sperm DNA, and washed in 2.times.SSC,
0.1% SDS at 42.degree. C.
[0163] One positive clone, designated I.vegf.6, was identified.
This clone, labeled with .sup.32P, was used as a probe to screen an
oligo-dT-primed human placenta cDNA library, and positive clones
were observed. When a human pituitary cDNA library was screened
with the same labeled clone, no positive clones were detected.
[0164] The complete nucleotide sequence of the clone I.vegf.6 was
determined by the dideoxyoligonucleotide chain termination method
[Sanger et al., Proc. Natl. Acad. Sci. USA 74, 5463-5467 (1977)]
after subcloning into the pRK5 vector. The sequence obtained, along
with the imputed amino acid sequence, including the signal
sequence.
Expression of VEGF-Encoding Gene in Mammalian Cells
[0165] The final expression vector, pRK5.vegf.6, was constructed
from I.vegf.6 and pRK5. The construction of pRK5 and pRK5.vegf.6 is
described below in detail.
A. Construction of pRK5
A.1. Construction of pF8CIS
[0166] The initial three-part construction of the starting plasmid
pF8CIS is described below.
[0167] 1) The ampicillin resistance marker and replication origin
of the final vector was derived from the starting plasmid pUC13pML,
a variant of the plasmid pML (Lusky, M. and Botchen, M., Nature,
293, 79 [1981]). pUC13pML was constructed by transferring the
polylinker of pUC13 (Vieira, J. and Messing, J., Gene, 19, 259
(1982)) to the EcoRI and HindIII sites of pML. A second starting
plasmid pUC8-CMV was the source of the CMV enhancer, promoter and
splice donor sequence. pUC8-CMV was constructed by inserting
approximately 800 nucleotides for the CMV enhancer, promoter and
splice donor sequence into the blunted PstI and SphI sites of pUC8.
Vieira, J. and Messing, J., op. cit. Synthetic BamHI-HindIII
linkers (commercially available from New England Biolabs) were
ligated to the cohesive BamHI end creating a HindIII site.
Following this ligation a HindIII-HincII digest was performed. This
digest yielded a fragment of approximately 800 bp that contained
the CMV enhancer, promoter and splice donor site. Following gel
isolation, this 800 bp fragment was ligated to a 2900 bp piece of
pUC13pML. The fragment required for the construction of pF8CIS was
obtained by digestion of the above intermediate plasmid with SalI
and HindIII. This 3123 bp piece contained the resistance marker for
ampicillin, the origin of replication from pUC13pML, and the
control sequences for the CMV, including the enhancer, promoter,
and splice donor site.
[0168] 2) The Ig variable region intron and splice acceptor
sequence was constructed using a synthetic oligomer. A 99 mer and a
30 mer were chemically synthesized having the following sequence
for the IgG intron and splice acceptor site (Bothwell et al.,
Nature, 290, 65-67 [1981]):
3 1 5' AGTAGCAAGCTTGACGTGTGGCAGGCTTGA... 31
GATCTGGCCATACACTTGAGTGACAATGA... 60 CATCCACTTTGCCTTTCTCTCCACAGGT...
88 GTCCACTCCCAG 3' 1 3' CAGGTGAGGGTGCAGCTTGACGTCGTCGGA 5'
[0169] DNA polymerase I (Klenow fragment) filled in the synthetic
piece and created a double-stranded fragment. Wartell, R. M. and W.
S. Reznikoff, Gene, 9, 307 (1980). This was followed by a double
digest of PstI and HindIII. This synthetic linker was cloned into
pUC13 (Veira and Messing, op. cit.) at the PstI and HindIII sites.
The clones containing the synthetic oligonucleotide, labeled
pUCIg.10, was digested with PstI. A ClaI site was added to this
fragment by use of a PstI-ClaI linker. Following digestion with
HindIII a 118-bp piece containing part of the Ig intron and the Ig
variable region splice acceptor was gel isolated.
[0170] 3) The third part of the construction scheme replaced the
hepatitis surface antigen 3' end with the polyadenylation site and
transcription termination site of the early region of SV40. A
vector, pUC.SV40, containing the SV40 sequences was inserted into
pUC8 at the BamHI site described by Vieira and Messing, op. cit.
pUC.SV40 was then digested with EcoRI and HpaI. A 143 bp fragment
containing the SV40 polyadenylation sequence was gel isolated from
this digest. Two additional fragments were gel isolated following
digestion of pSVE.8c1D. (European Pat. Pub. No. 160,457). The 4.8
kb fragment generated by EcoRI and Cla1 digestion contains the
SV40-DHFR transcription unit, the origin of replication of pML and
the ampicillin resistance marker. The 7.5-kb fragment produced
following digestion with ClaI and HpaI contains the cDNA for Factor
VIII. A three-part ligation yielded pSVE.8c24D. This intermediate
plasmid was digested by ClaI and SalI to give a 9611 bp fragment
containing the cDNA for Factor VIII with an SV40 poly A site
followed by the SV40 DHFR transcription unit.
[0171] The final three-part ligation to yield pF8CIS used: a) the
3123 bp SalI-HindIII fragment containing the origin of replication,
the ampicillin resistance marker, and the CMV enhancer, promoter,
and splice donor site; b) the 118 bp HindIII-ClaI fragment
containing the Ig intron and splice acceptor site; and c) a 9611 bp
ClaI-SalI fragment containing the cDNA for Factor VIII, the SV40
polyadenylation site, and the SV40 DHFR transcription unit.
[0172] A.2. Construction of pCIS2.8c28D
[0173] pCIS2.8c28D comprises a 90 kd subunit of Factor VIII joined
to a 73 kd subunit of Factor VIII. The 90 kd comprises amino acids
1 through 740 and the 73 kd subunit amino acids 1690 through 2332.
This construct was prepared by a three-part ligation of the
following fragments: a) the 12617-bp ClaI-SstII fragment of pF8CIS
(isolated from a dam-strain and BAP treated); b) the 216-bp
SstII-PstI fragment of pF8CIS; and c) a short PstI-ClaI synthetic
oligonucleotide that was kinased.
[0174] Two different fragments, A and B, were cloned into the same
pUC118 BamHI-PstI BAP vector. The A fragment was the 408 bp
BamHI-HindIII fragment of pUC408BH and the B fragment was a
HindIII-PstI oligonucleotide. This oligonucleotide was used without
kinasing to prevent its polymerization during ligation.
[0175] After ligation of the A and B fragments into the vector, the
expected junction sequences were confirmed by DNA sequencing of the
regions encompassed by the nucleotides.
[0176] The resulting plasmid, pCIS2.8c28D, was constructed with a
four-part ligation. The fusion plasmid was cut with BamHI and PstI
and the 443 bp fragment isolated. The remaining three fragments of
the four-part ligation were: 1) 1944 bp ClaI-BamHI of pSVEFVIII
(European Pat. Publ. No. 160,457); 2) a 2202 bp BamHI-XbaI fragment
of pSVEFVIII, which was further partially digested with PstI and
the 1786 bp PstI-XbaI fragment was isolated, and 3) the 5828 bp
XbaI-ClaI BAP fragment of pCIS2.8c24D. The translated DNA sequence
of the resultant variant in the exact fusion junction region of
pCIS2.8c28D was determined and correlates.
[0177] A.3. Construction of pRK5
[0178] The starting plasmid for construction of pRK5 was
pCIS2.8c28D. The base numbers in paragraphs 1 through 6 refer to
pCIS2.8c28D with base one of the first T of the EcoRI site
preceding the CMV promoter. The cytomegalovirus early promoter and
intron and the SV40 origin and polyA signal were placed on separate
plasmids.
[0179] 1. The cytomegalovirus early promoter was cloned as an EcoRI
fragment from pCIS2.8c28D (9999-1201) into the EcoRI site of pUC118
described above. Twelve colonies were picked and screened for the
orientation in which single-stranded DNA made from pUC118 would
allow for the sequencing from the EcoRI site at 1201 to the EcoRI
site at 9999. This clone was named pCMVE/P.
[0180] 2. Single-stranded DNA was made from pCMVE/P in order to
insert an SP6 (Green, M R et al., Cell 32, 681-694 [1983]) promoter
by site-directed mutagenesis. A synthetic 110 mer that contained
the sequences from -69 to +5 of SP6 promoter (see Nucleic Acids
Res., 12, 7041 [1984]) were used along with 18-bp fragments on
either end of the oligomer corresponding to the CMVE/P sequences.
Mutagenesis was done by standard techniques and screened using a
labeled 110 mer at high and low stringency. Six potential clones
were selected and sequenced. A positive clone was identified and
labeled pCMVE/PSP6.
[0181] 3. The SP6 promoter was checked and shown to be active, for
example, by adding SP6 RNA polymerase and checking for RNA of the
appropriate size.
[0182] 4. A Cla-NotI-Sma adapter was synthesized to encompass the
location from the ClaI site (912) to the SmaI site of pUC118 in
pCMVE/P (step 1) and pCMVE/PSP6 (step 2). This adapter was ligated
into the ClaI-SmaI site of pUC118 and screened for the correct
clones. The linker was sequenced in both and clones were labeled
pCMVE/PSP6-L and pCMVE/P-L.
[0183] 5. pCMVE/PSP6-L was cut with SmaI (at linker/pUC118
junction) and HindIII (in pUC118). A HpaI (5573)-to-HindIII (6136)
fragment from pSVORAADRI 11, described below, was inserted into
SmaI-HindIII of pCMVE/PSP6-L. This ligation was screened and a
clone was isolated and named pCMVE/PSP6-L-SVORAADRI.
[0184] a) The SV40 origin and polyA signal was isolated as the XmnI
(5475)-HindIII (6136) fragment from pCIS2.8c28D and cloned into the
HindIII to SmaI sites of pUC119 (described in Vieira and Messing,
op. cit.). This clone was named pSVORAA.
[0185] b) The EcoRI site at 5716 was removed by partial digestion
with EcoRI and filling in with Klenow. The colonies obtained from
self-ligation after fill-in were screened and the correct clone was
isolated and named pSVORAADRI 11. The deleted EcoRI site was
checked by sequencing and shown to be correct.
[0186] c) The HpaI (5573) to HindIII (6136) fragment of pSVORAADRI
11 was isolated and inserted into pCMVE/PSP6-L (see 4 above).
[0187] 6. pCMVE/PSP6-L-SVOrAADRI (step 5) was cut with EcoRI at
9999, blunted and self-ligated. A clone without an EcoRI site was
identified and named pRK.
[0188] 7. pRK was cut with SmaI and BamHI. This was filled in with
Klenow and relegated. The colonies were screened. A positive clone
was identified and named pRKDBam/Sma3.
[0189] 8. The HindIII site of pRKDBam/Sma3 was converted to a HpaI
site using a converter. (A converter is a piece of DNA used to
change one restriction site to another. In this case one end would
be complementary to a HindIII sticky end and the other end would
have a recognition site for HpaI.) A positive clone was identified
and named pRKDBam/Sma, HIII-HpaI 1.
[0190] 9. pRKDBam/Sma, Hil-HpaI 1 was cut with PstI and NotI and an
EcoRI-HindIII linker and HindIII-EcoRI linker were ligated in.
Clones for each linker were found. However, it was also determined
that too many of the HpaI converters had gone in (two or more
converters generate a PvuII site). Therefore, these clones had to
be cut with HpaI and self-ligated.
[0191] 10. RI-HIII clone 3 and HIII-RI clone 5 were cut with HpaI,
diluted, and self-ligated. Positives were identified. The RI-HIII
clone was named pRK5.
[0192] B. Construction of pRK5.vegf.6
[0193] The clone I.vegf.6 was treated with EcoRI and the EcoRI
insert was isolated and ligated into the vector fragment of pRK5
obtained by digestion of pRK5 with EcoRI and isolation of the large
fragment. The two-part ligation of these fragments yielded the
expression vector, pRK5.vegf.6, which was screened for the correct
orientation of the VEGF-encoding sequence with respect to the
promoter.
[0194] Further details concerning the construction of the basic
pRK5 vector can be taken from U.S. Pat. No. 5,332,671 that issued
on 26 Jul. 1994, said patent being expressly incorporated herein by
reference.
EXAMPLE 2
[0195] The following example details the methodology generally
employed to prepare the various VEGF mutants covered by the present
invention. The basic expression vector was prepared as follows:
[0196] Vector SDVF.sub.165 containing the cDNA of VEGF.sub.165 was
obtained. The cDNA for VEGF.sub.165 was isolated from SDVF.sub.165
by restriction digestion with Hind III and Eco RI. This isolated
insert was ligated into the pRK5 plasmid taking advantage to the
existence therein of Eco RI and Hind III sites. The resultant
plasmid was transformed into competent CJ236 E. coli cells to make
a template for site-directed mutagenesis. The corresponding
oligonucleotide containing the mutated site was then prepared--see
infra--and the in vitro site-directed mutagenesis step was
conducted in accordance with known procedures using the BioRad
Muta-Gene mutagenesis kit. After sequencing to determine that the
mutagenized site was incorporated into the final expression vector,
the resultant vector was transfected into 293 human kidney cells
for transient expression.
[0197] The following oligonucleotides were prepared in order to
make the final mutated product.
4 TABLE 1 Mutation 5' to 3' Sequence C51D CAGGGGCACATCGGATGGCTTGAA
C51A CAGGGGCACGGCGGATGGCTTGAA C60D GTCATTGCAATCGCCCCCGCATCG C60A
GTCATTGCAGGCGCCCCCGCATCG C51A, C60A GTCATTGCAGGCGCCCCCGCATCGCATCAGG
GGCACGGCGGATGGCTTGAA C51D, C60D GTCATTGCAATCGCCCCCGCATCGCATCAGGG
GCACATCGGATGGCTTGAA
[0198] Thus prepared in accordance with the insertion of the
oligonucleotides set forth in Table 1 above, left column there are
prepared at the corresponding mutation in the VEGF molecule in
accordance with the notation given under the left hand column
entitled "Mutation". The naming of the compound is in accord with
naming convention. Thus, for the first entry the mutation is
referred to as "C51D". This means that at the 51 amino acid
position of the VEGF molecule the cysteine (C) residue was mutated
so as to insert an aspartic acid (D) at that 51 position.
[0199] FIG. 2 is a diagram showing the native VEGF dimer and
certain of the variant VEGF polypeptides of the present invention.
As shown in FIG. 2, the native VEGF molecule dimerizes through the
formation of disulfide bonds between the cysteine at amino acid
position 51 on one monomer and the cysteine at amino acid position
60 on the other monomer and vice versa. Changing the cysteine
residue at amino acid position 51 or 60 to aspartic acid (C51D or
C60D, respectively) prevents proper dimerization and the formation
of staggered dimer molecules. Changing both cysteine residues at
amino acid positions 51 and 60 (C51D, C60D) prevents dimer
formation altogether.
[0200] Binding of VEGF Variants to VEGF Receptors--Native VEGF
dimer and the VEGF variant polypeptides shown in FIG. 2 were tested
for the ability to bind to the KDR and FLT-1 receptors. Receptor
binding assays were performed as described above. The results
obtained for binding to the KDR receptor are presented in FIGS. 3
and 4.
[0201] As shown in FIG. 3, all of the three VEGF variant
polypeptides tested retained the ability to bind to the KDR
receptor, although none exhibited a binding affinity as great as
the native VEGF dimer protein. The results presented in FIG. 3 also
demonstrate that the monomeric variant polypeptide C51D, C60D
retains the ability to bind to the KDR receptor, however, it does
so with a reduced binding affinity as compared to the native dimer
or two staggered dimers tested. FIG. 4 demonstrates that the
binding affinity of the C51D, C60D monomeric variant for the KDR
receptor is approximately 500-fold less than the native dimeric
VEGF protein. Thus, these results demonstrate that each of the VEGF
variant polypeptides tested retain the ability to bind to the KDR
receptor, although at a lower binding affinity.
[0202] FIGS. 5 and 6 show the results obtained when measuring the
binding of the polypeptides of FIG. 2 to the FLT-1 receptor. The
results presented in FIG. 5 demonstrate that all of the variants
tested retain the ability to bind to the FLT-1 receptor, although
at reduced binding affinities as compared to the native VEGF dimer.
FIG. 6 demonstrates that the binding affinity of the C51D, C60D
monomeric variant is approximately 140-less for the FLT-1 receptor
than exhibited by the native VEGF dimer. Thus, these results
demonstrate that each of the VEGF variant polypeptides tested
retain the ability to bind to the FLT-1 receptor, although at a
lower binding affinity.
[0203] Stimulation of Mitogenesis by VEGF and Variants
Thereof--Because the VEGF variants shown in FIG. 2 were shown above
to be capable of binding to both the KDR and FLT-1 receptors, these
variants were also tested for their ability to stimulate
mitogenesis in endothelial cells. The mitogenic stimulation assays
were performed as described above. The results from these assays
are presented in FIG. 7.
[0204] As is shown in FIG. 7, while the native VEGF dimer molecule
is capable of efficiently stimulating mitogenesis in endothelial
cells, the VEGF variants tested (staggered dimers C51D and C60D as
well as the monomeric variant C51D, C60D) exhibit an inhibitory
effect on the mitogenic stimulation of endothelial cells. These
results demonstrate that proper dimerization between the cysteine
residues at amino acid positions 51 and 60 of the native VEGF
polypeptide is essential for efficient mitogenic stimulation of
endothelial cells. As such, these data demonstrate that amino acid
modifications which disrupt the ability of VEGF monomeric units to
properly dimerize function to inhibit the mitogenic activity of the
molecule. Given that these variant molecule are capable of binding
to and occupying the VEGF receptors without inducing a
"native-VEGF-like" mitogenic response, such variant molecules may
serve as effective antagonists of VEGF activity.
[0205] Ability of the C51D, C60D Monomer to Inhibit VEGF-Induced
Endothelial Cell Growth--The C51D, C60D monomer polypeptide was
employed in assays designed to measure the ability of the monomer
to inhibit the VEGF-induced growth of endothelial cells. Briefly,
endothelial cells were cultured in the presence of 3 ng/ml VEGF and
varying amounts of either the A461 anti-VEGF monoclonal antibody or
the C51D, C60D monomer polypeptide. The results demonstrating the
inhibitory effects of each inhibitor on endothelial cell growth are
presented in FIG. 8.
[0206] The results presented in FIG. 8 demonstrate that both the
A461 anti-VEGF monoclonal antibody and the C51D, C60D monomer
polypeptide exhibit substantial inhibitory effects on VEGF-induced
endothelial cell growth. These inhibitory effects increase as the
ratio of inhibitor to VEGF increases. As such, the C51D, C60D
monomer polypeptide functions to inhibit the endothelial growth
activating effect of VEGF.
[0207] Concluding Remarks:
[0208] The foregoing description details specific methods which can
be employed to practice the present invention. Having detailed such
specific methods, those skilled in the art will well enough know
how to devise alternative reliable methods at arriving at the same
information in using the fruits of the present invention. Thus,
however detailed the foregoing may appear in text, it should not be
construed as limiting the overall scope thereof; rather, the ambit
of the present invention is to be determined only by the lawful
construction of the appended claims. All documents cited herein are
hereby expressly incorporated by reference.
Sequence CWU 1
1
* * * * *