U.S. patent application number 10/767294 was filed with the patent office on 2004-08-05 for polypeptides capable of interacting with human topoisomerase iii alpha.
This patent application is currently assigned to Aventis Pharma S.A.. Invention is credited to Fournier, Alain, Goulaouic, Helene, Riou, Jean-Francois.
Application Number | 20040152162 10/767294 |
Document ID | / |
Family ID | 9533377 |
Filed Date | 2004-08-05 |
United States Patent
Application |
20040152162 |
Kind Code |
A1 |
Fournier, Alain ; et
al. |
August 5, 2004 |
Polypeptides capable of interacting with human topoisomerase III
alpha
Abstract
The invention concerns novel peptides capable of interacting
with the human topoisomerase III.alpha. and the nucleic acid
sequences coding for said polypeptides. The invention also concerns
a method for identifying compounds capable of interacting with said
polypeptides and a method for identifying molecules capable of
modulating the interaction of the topoisomerase III.alpha. with
said polypeptides.
Inventors: |
Fournier, Alain;
(Chatenay-Malabry, FR) ; Goulaouic, Helene;
(Paris, FR) ; Riou, Jean-Francois; (Paris,
FR) |
Correspondence
Address: |
ROSS J. OEHLER
AVENTIS PHARMACEUTICALS INC.
ROUTE 202-206
MAIL CODE: D303A
BRIDGEWATER
NJ
08807
US
|
Assignee: |
Aventis Pharma S.A.
20 Avenue Raymond Aron
Antony
FR
92165
|
Family ID: |
9533377 |
Appl. No.: |
10/767294 |
Filed: |
January 29, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10767294 |
Jan 29, 2004 |
|
|
|
09856930 |
Jun 25, 2001 |
|
|
|
6706514 |
|
|
|
|
09856930 |
Jun 25, 2001 |
|
|
|
PCT/FR99/02952 |
Nov 29, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/199; 435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
A61P 43/00 20180101;
C12N 9/90 20130101; A61K 38/00 20130101 |
Class at
Publication: |
435/069.1 ;
435/199; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12N 009/22; C07H
021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 30, 1998 |
FR |
98/15,081 |
Claims
1. Nucleotide sequence encoding a polypeptide capable of
interacting with topoisomerase III.alpha..
2. Nucleotide sequence according to claim 1, characterized in that
it encodes a polypeptide comprising all or part of the polypeptide
sequence SEQ ID No. 4 or of its derivatives.
3. Nucleotide sequence according to either of claims 1 and 2,
characterized in that it comprises all or part of the nucleotide
sequence SEQ ID No. 3 or of its derivatives.
4. Polypeptide, characterized in that it is capable of interacting
with topoisomerase III.alpha..
5. Polypeptide according to claim 4, characterized in that it
comprises all or part of the polypeptide sequence SEQ ID No. 4 or
of a sequence derived therefrom.
6. Polypeptide according to claim 4, characterized in that it
consists of the polypeptide sequence corresponding to residues
318-662 of the sequence SEQ ID No. 5 or of a sequence derived
therefrom.
7. Use of a polypeptide or of a polypeptide fragment according to
claims 4 to 6, for slowing down, inhibiting, stimulating or
modulating the activity of topoisomerase III.alpha..
8. Antibody or antibody fragment directed against a polypeptide
according to one of claims 4 to 6.
9. Method for detecting or identifying compounds capable of binding
to a polypeptide as defined according to one of claims 4 to 6,
characterized in that the following steps are carried out: a--a
molecule or a mixture containing various molecules, optionally
unidentified, is brought into contact with a polypeptide as defined
according to one of claims 4 to 6 under conditions allowing the
interaction between said polypeptide and said molecule in the case
where the latter might possess affinity for said polypeptide, and,
b--the molecules bound to said polypeptide are detected and/or
isolated.
10. Method for detecting or identifying compounds capable of
modulating or inhibiting the interaction between topoisomerase
III-.alpha. and a polypeptide as defined according to claims 4 to
6, characterized in that the following steps are carried out:
a--the binding of topoisomerase III.alpha. or of a fragment thereof
to said polypeptide is carried out; b--a compound to be tested for
its capacity to inhibit the binding between topoisomerase
III.alpha. and said polypeptide is added; c--the displacement or
inhibition of the binding of topoisomerase III.alpha. to said
polypeptide is determined; d--the compounds which prevent or which
impede the binding between topoisomerase IlI.alpha. and said
polypeptide are detected and/or isolated.
11. Ligand for a polypeptide as defined according to claims 4 to 6,
capable of being obtained according to the method of claim 9.
12. Ligand capable of modulating or inhibiting the interaction
between topoisomerase III.alpha. and a polypeptide as defined
according to claims 4 to 6, capable of being obtained according to
the method of claim 10.
13. Use of a ligand according to claim 11 or 12 for the preparation
of a medicament intended for the prevention, improvement or
treatment of diseases involving a cell cycle dysfunction.
14. Pharmaceutical composition comprising, as active ingredient, at
least ligand according to either of claims 11 and 12 or an antibody
according to claim 8.
15. Composition according to claim 14, intended for modulating
slowing down or inhibiting the activity of topoisomerase
III.alpha..
16. Composition according to either of claims 14 and 15, intended
for the prevention, improvement or treatment of diseases involving
a cell cycle dysfunction.
Description
[0001] The present invention relates to novel polypeptides capable
of interacting with human topoisomerase III.alpha. and to the
nucleic acid sequences encoding these polypeptides. It also
relates, in addition, to a method for identifying compounds capable
of interacting with said polypeptides and to a method for
identifying molecules capable of modulating the interaction of
topoisomerase III.alpha. with said polypeptides.
[0002] The replication of DNA is a complex mechanism which involves
a large number of factors. DNA exists in the physiological state in
a supercoiled form and access to the information which it contains
requires substantial modification of the degree of coiling.
Replication requires the suppression of the supercoils, the
separation of the two strands of the DNA double helix and the
maintaining of DNA in single-stranded form.
[0003] The modification of the degree of coiling is brought about
in vivo by topoisomerases which are enzymes capable of modifying
the DNA superstructures. It is possible to distinguish type I
topoisomerases which cut only one of the two DNA strands and which
eliminate the supercoils, and type II topoisomerases which act by
cutting the two DNA strands and which are capable of eliminating or
creating the supercoils. Eukaryotic topoisomerases are less well
known than their prokaryotic homologs and their mechanism of action
has still not yet been elucidated to date.
[0004] The separation of the two strands of a DNA duplex is
catalyzed by a group of enzymes, called DNA helicases, which act in
an ATP-dependent manner so as to produce the single-stranded DNA
used as template for the DNA replication and transcription
processes. Generally, the helicases bind to the single-stranded DNA
or to the junctions between the single- and double-stranded DNA,
and move in a single direction along the DNA in the double-stranded
region, destroying the hydrogen bonds joining the two strands. All
helicases exhibit a DNA-dependent ATPase (or NTPase) activity which
hydrolyzes the gamma phosphate of the ribonucleoside or
deoxyribonucleoside 5'-triphosphate and provides the energy
necessary for the reaction. The first helicase was discovered in E.
coli in 1976. Since then, more than 60 helicases have been isolated
in prokaryotes and eukaryotes. The role of human helicases has
still not been elucidated in most cases, with the exception of
HDHII (repair of the lesions induced by X-rays), HDHIV (assembly of
preribosomes), ERCC2 and ERCC3, which are involved in repair
through excision and cell viability. Little is known on the
structure of these helicases. A large portion of the information
available on the structures and functions of helicases has been
obtained by comparative analysis of the amino acid sequences. In
particular, conserved motifs have made it possible to group
helicases into subfamilies based on the sequence homologies.
[0005] Human Topoisomerase III belongs to the family of type IA
topoisomerases and therefore exhibits sequence homologies with E.
coli topoisomerases I and III, yeast Topoisomerase III as well as
reverse gyrase from archaebacteria. Human Topoisomerase III is now
called Topoisomerase III.alpha. so as to differentiate it from
human topoisomerase III.beta. which was recently discovered during
the sequencing of the human immunoglobulin .lambda. gene locus
(Kawasaki, K., Minoshima, S., Nakato, E., Shibuya, K., Shintani,
A., Schmeits, J. L., Wang, J. and Shimizu, N. 1997, Genome Research
7: 250-261), and for which no functional activity has been shown.
Yeast-expressed and unpurified topoisomerase III.alpha. exhibits an
activity of partial relaxation of a highly negatively supercoiled
DNA (Hanai, R., Caron, P. R. and Wang, J. C. 1993. Proc. Natl.
Acad. Sci. USA 93: 3653-3657).
[0006] Topoisomerase III.alpha. is a protein of 976 amino acids and
with a molecular weight of about 110 kDa. The gene encoding human
Topoisomerase III.alpha. is present in a single copy on chromosome
17p11.2-12 (Hanai, R., Caron, P. R. and Wang, J. C. 1996. Proc.
Natl. Acad. Sci. USA 93: 3653-3657). A murine homolog of
Topoisomerase III was recently cloned (Seki, T., Deki, M., Katada,
T. and Enomoto, T. 1998. Biochim Biophys Acta 1396: 127-131).
[0007] Topoisomerase III.alpha. exhibits a strong sequence homology
with yeast Topoisomerase III, namely 44% sequence identity and 61%
similarity. The homology which it exhibits with bacterial
topoisomerases I and III is less strong, namely 24% identity and
44% similarity. However, Topoisomerase III.alpha. resembles E. coli
Topoisomerase I more than it resembles the other members of the
group of type IA topoisomerases from the point of view of the
organization of the protein into domains. Indeed, these two
polypeptides contain a C-terminal domain which has no equivalent in
E. coli or yeast Topoisomerase III. This C-terminal domain contains
motifs with 4 cysteines (3 motifs for E. coli Topoisomerase I and
1.5 motif for human Topoisomerase III.alpha.), as well as an
extreme C-terminal domain for which a DNA-binding role has been
demonstrated for E. coli Topoisomerase I.
[0008] The role of human topoisomerase III.alpha. in the cell has
not yet been identified.
[0009] Human Topoisomerase III.alpha. appears to be essential, at
least during embryogenesis, since the knock-out of the murine
homolog of Topoisomerase III.alpha. is lethal (Li, W. and Wang, J.
C. 1998 Proc. Natl. Acad. Sci. USA 95: 1010-1013). The messenger
RNAs for Topoisomerase III.alpha. are present in numerous tissues
(heart, brain, placenta, lung, liver, skeletal muscle, kidney,
pancreas) in the form of three transcripts of 7.2, 6 and 4
kilobases in size (Fritz, E., Elsea, S. H., Patel, P. I. and Meyn,
M. S. 1997 Proc. Natl. Acad. Sci. USA 94: 4538-4542).
[0010] Moreover, it has been assumed that Topoisomerase III.alpha.
plays a role in maintaining the stability of the genome. Indeed,
the cDNA CAT4.5, encoding a truncated human Topoisomerase
III.alpha. of 141 N-terminal amino acids, is capable of
complementing the phenotype for hypersensitivity to ionizing
radiation in AT (Ataxia-Telangectasia) cells exhibiting a mutation
in the ATM gene (Fritz, E., Elsea, S. H., Patel, P. I. and Meyn, M.
S. 1997 Proc. Natl. Acad. Sci. USA 94: 4538-4542).
[0011] In yeast, two independent studies have shown the existence
of an interaction between the helicase SGS1 and yeast Topoisomerase
III. On the one hand, the sgs1- mutants are suppressers of the
top3- phenotype (slow growth, hyperrecombination) in the yeast S.
cerevisiae (Qangloff, S., McDonald, J. P., Bendixen, C., Arthur, L.
and Rothstein, R. 1994. Mol. Cell. Biol. 14: 8391-8398). On the
other hand, it has been shown that the first 500 amino acids of
SGS1 interact with yeast Topoisomerase III (Gangloff, S., McDonald,
J. P., Bendixen, C., Arthur, L. and Rothstein, R. 1994. Mol. Cell.
Biol. 14: 8391-8398, Lu, J., Mullen, J. R., Brill, S. J., Kleff,
S., Romeo, A. M. and Sternglanz, R. 1996. Nature 383: 678-679).
However, to date, no interaction between a helicase and human
Topoisomerase III.alpha. has been identified.
[0012] The identification of partners of human topoisomerase
III.alpha. therefore constitutes a major challenge for the
understanding of the role of human topoisomerase III.alpha., and of
its mechanism of action.
[0013] The present invention results from the demonstration of
novel polypeptides capable of interacting with topoisomerase
III.alpha. (called hereinafter polypeptide partners of
topoisomerase III.alpha.). It also results from the discovery that
these polypeptides show a strong homology with proteins which
exhibit structural characteristics common to RNA helicases and for
which no function had so far been described. The demonstration of
this interaction and of these homologies designate these proteins
as DNA helicase partners of topoisomerase III.alpha.. The
identification of these partners makes it possible to envisage
numerous applications based on the combined action of these partner
proteins and of topoisomerase III.alpha.; these applications relate
in particular to:
[0014] 1) The destruction of the nucleosomal structure: to undergo
some processes such as replication, transcription, repair or
recombination, DNA should be accessible to the corresponding
enzymatic machineries and, to do this, the nucleosomal structure
should be transiently destroyed. It is thus possible to envisage
that helicase locally separates the DNA strands and creates
positive supercoils ahead of it and negative supercoils behind it.
The positive twist is absorbed by the disruption of the
nucleosomes, while the negative twist is selectively relaxed by
type IA topoisomerase.
[0015] 2) The positive supercoiling of DNA: the interaction between
helicase and type IA topoisomerase is likely to reconstitute in a
eukaryotic organism the reverse gyrase activity of thermophilic
archaebacteria. Indeed, it has been shown that Sulfolobus
acidocaldarius reverse gyrase possesses at the N terminus a
helicase domain containing the 8 motifs of helicases with a "DEAD"
motif, and at the C terminus a topoisomerase domain homologous to
the type IA topoisomerases (Confalonieri, F., Edie, C., Nadal, M.,
Bouthier de la Tour, C., Forterre, P. and Duguet, M. 1993. Proc.
Natl. Acad. Sci. USA 90: 4753-4757); this enzyme relaxes the
negatively supercoiled DNA and introduces positive supercoils into
the circular DNA in an ATP-dependent manner (Forterre, P.,
Mirambeau, G., Jaxel, C., Nadal, M. and Duguet, M. 1985. EMBO J. 4:
2123-2128). This eukaryotic reverse gyrase activity can serve to
eliminate particular DNA structures such as the cruciform DNA, the
Z DNA, mismatches, recombination intermediates, and the like. From
these observations and from the demonstration that topoisomerase
III.alpha. is capable of interacting with a protein possessing the
properties of a DNA helicase, it is possible to envisage the
production in vivo or in vitro of a topoisomerase
III.alpha./protein partner complex constituting an enzymatic
complex having reverse gyrase type functions. It should be noted
that such a function of positive supercoiling of DNA has still
never been described in eukaryotes.
[0016] 3) The segregation of newly replicated chromosomes: at the
end of the replication of DNA, topological problems appear at the
level of the point of convergence of two replication forks. A
mechanism which makes it possible to solve this topological problem
involves the concerted action of a helicase and a type IA
topoisomerase, capable of decatenating two single-stranded DNA
molecules. This model (Wang, J. C. 1991. J. Biol. Chem. 266:
6659-6662; Rothstein, R. and Gangloff, S. 1995. Genome Research 5:
421-426) proposes that at the point where two replication forks
meet, replication is stopped, leaving portions of entangled
single-stranded DNAs. These are then separated by means of the
concerted action of helicase and topoisomerase. The synthesis of
DNA is then completed at the level of the single-stranded
regions.
[0017] 4) The recombination and the stability of the genome: it has
been shown that mutants of Top3- yeast or Sgs1- mutants both
exhibit a hyperrecombination phenotype while Top3-/Sgs1- double
mutants recover a normal phenotype. This shows that yeast
Topoisomerase III and helicase SGS1 probably act in a concerted
manner to maintain a low rate of recombination, for example by a
positive supercoiling activity of the reverse gyrase type, or by a
more direct mechanism at the level of the pairings of the
recombination intermediates.
[0018] Unlike the helicase SGS1, known to interact with yeast
topoisomerase III, the protein partner of topoisomerase III.alpha.
identified by the applicant does not belong to the family of RecQ
type helicases.
[0019] The polypeptides according to the invention show a high
degree of homology with the sequence of a human protein DDX14
published by Chung et al (Chung, J., Lee, S-G., and Song, K. 1995.
Korean J. Biochem. 27: 193-197). The protein DDX14 exhibits a
significant sequence homology with an RNA helicase of murine
origin; however, the helicase activity of this protein has not yet
been demonstrated and the function of DDX14 has not yet been
elucidated.
[0020] The polypeptides according to the invention also show a high
degree of homology with the sequence of a human protein DBX1
published by Lahn et al (Lahn, T. and Page, D. C. 1997. Science.
278: 675-680). The protein DBX1 encodes a protein which exhibits
homologies with RNA helicases but its helicase activity has never
been demonstrated and the function of the DBX1 protein has not yet
been identified.
[0021] The DBX1 protein encodes a protein of 662 amino acids. The
corresponding gene is situated on the X sex chromosome and its
homolog situated on the Y chromosome is 91% identical at the
protein level. The nucleic and polypeptide sequences of DBX1 are
presented in the sequences SEQ ID No. 5 and SEQ ID No. 6. The
expression of the DBX1 gene appears to be ubiquitous. It has now
been demonstrated that the DBX1 protein possesses the 8 motifs
characteristic of helicases of the "DEAD" family. More precisely,
it belongs to the subfamily represented by the helicase PL10, and
whose recorded members are the helicases DED1 and DBP1 from yeast,
the helicase An3 from amphibians and the murine helicases PL10,
mDEAD2 and mDEAD3 (Gee, S. L. and Conboy, J. G. 1994. Gene 140:
171-177). Helicases belonging to this subfamily contain, in
addition to the central catalytic domain containing, the 8
conserved motifs of helicases, particular N- and C-terminal
domains. The C-terminal domain is rich in arginines and serines,
which resembles the domains of splicing factors. However, in the
case of the helicases of this subfamily, this domain rich in
arginines and serines is shorter and does not possess as many RS
dipeptides as in the prototype domain of splicing factors.
[0022] The invention also provides a method for identifying
molecules capable of blocking the interaction between human
Topoisomerase III.alpha. and a polypeptide partner of topoisomerase
III.alpha.. Such a method makes it possible to identify molecules
which are in particular capable of blocking the reverse gyrase type
activity of these two proteins. Such molecules are useful for
modulating the processes of division, replication, transcription,
translation, splicing, repair or recombination of DNA. These
molecules are also capable of possessing a cytotoxic type antitumor
activity because of the disruption of these basic processes at the
level of the DNA.
[0023] A first subject of the invention therefore relates to
nucleotide sequences encoding polypeptides capable of interacting
with topoisomerase III.alpha..
[0024] Preferably, the nucleotide sequences according to the
invention encode a polypeptide comprising all or part of the
polypeptide sequence described in the sequence SEQ ID No. 4 or its
derivatives.
[0025] For the purposes of the present invention, the term derived
polypeptide sequence denotes any polypeptide sequence differing
from the sequence considered, obtained by one or more modifications
of a genetic and/or chemical nature, and possessing the capacity to
interact with topoisomerase III.alpha.. Modification of a genetic
and/or chemical nature is understood to mean any mutation,
substitution, deletion, addition and/or modification of one or more
residues. Such derivatives may be generated with different aims,
such as in particular that of improving its levels of production,
that of increasing its resistance to proteases or of improving its
passage across the cell membranes, that of increasing its
therapeutic efficacy or of reducing its side effects, that of
increasing the affinity of the peptide for its site of interaction,
or that of conferring novel pharmacokinetic and/or biological
properties on it. Advantageously, the variants comprise deletions
or mutations affecting amino acids whose presence is not decisive
for the activity of the derivative. Such amino acids may be
identified for example by tests of cellular activity as described
in the examples.
[0026] Preferably still, the nucleotide sequences according to the
present invention comprise all or part of the nucleotide sequence
described in the sequence SEQ ID No. 3 and encoding the sequence
SEQ ID No. 4 or the sequences derived from this nucleotide
sequence.
[0027] For the purposes of the present invention, the term derived
nucleotide sequence denotes any sequence differing from the
sequence considered because of the degeneracy of the genetic code,
obtained by one or more modifications of a genetic and/or chemical
nature, as well as any sequence hybridizing with these sequences or
fragments thereof and encoding a polypeptide capable of interacting
with Topoisomerase III.alpha.. The expression modification of a
genetic and/or chemical nature is understood to mean any mutation,
substitution, deletion, addition and/or modification of one or more
residues. The term derivative also comprises the sequences
homologous to the sequence considered, which are derived from other
cellular sources and in particular from cells of human origin, or
from other organisms. Such homologous sequences may be obtained by
hybridization experiments. The hybridizations may be carried out
starting with nucleic acid libraries, using the native sequence or
a fragment thereof as probe, under variable hybridization
conditions.
[0028] The nucleotide sequences according to the invention may be
of artificial origin or otherwise. They may be genomic sequences,
cDNA, RNA, hybrid sequences or synthetic or semisynthetic
sequences. These sequences may be obtained for example by screening
DNA libraries (cDNA library, genomic DNA library) by means of
probes produced on the basis of sequences presented above. Such
libraries may be prepared from cells of different origins by
conventional molecular biology techniques known to persons skilled
in the art. The nucleotide sequences of the invention may also be
prepared by chemical synthesis or by mixed methods including
chemical or enzymatic modification of sequences obtained by the
screening of libraries. In general, the nucleic acids of the
invention may be prepared according to any technique known to
persons skilled in the art.
[0029] The subject of the present invention is also polypeptides
capable of interacting with topoisomerase III.alpha..
[0030] For the purposes of the present invention, the name
topoisomerase III.alpha. covers human topoisomerase III.alpha. in
itself as well as the homologous forms corresponding in particular
to mutated forms of this protein.
[0031] Preferably, the polypeptides according to the invention
comprise all or part of the polypeptide sequence described in SEQ
ID No. 4 or of its derivatives.
[0032] The present invention also includes a polypeptide
characterized in that it is a fragment of the DBX1 protein, capable
of interacting with topoisomerase III.alpha. and comprising all or
part polypeptide fragment which extends between residues 318-662
and represented in the polypeptide sequence SEQ ID No. 6 or its
derivatives.
[0033] The subject of the present invention is also the use of the
polypeptides according to the invention or of fragments of these
polypeptides, for slowing down, inhibiting, stimulating or
modulating the activity of topoisomerase III.alpha..
[0034] Indeed, it is possible to envisage regulating the function
of topoisomerase III.alpha. by means of the polypeptides according
to the invention or of fragments thereof and in particular
inhibiting or slowing down the activity of topoisomerase
III.alpha.. This modification of the activity of topoisomerase
III.alpha. is capable of leading to a slowing down of cellular
growth or a blocking of the cell cycle or of inducing
apoptosis.
[0035] Another subject of the present invention relates to a method
for preparing the polypeptides according to the invention according
to which a cell containing a nucleotide sequence encoding said
polypeptides is cultured under conditions for expressing said
sequence and the polypeptide produced is recovered. In this case,
the part encoding said polypeptide is generally placed under the
control of signals allowing its expression in a cellular host. The
choice of these signals (promoters, terminators, leader sequence
for secretion, and the like) may vary according to the cellular
host used. Moreover, the nucleotide sequences of the invention may
form part of a vector which may be autonomously replicating or
integrative. More particularly, autonomously replicating vectors
may be prepared using autonomously replicating sequences in the
chosen host. As regards integrative vectors, these may be prepared,
for example, using sequences homologous to certain regions of the
genome of the host, allowing, through homologous recombination, the
integration of the vector.
[0036] The subject of the present invention is also host cells
transformed with a nucleic acid comprising a nucleotide sequence
according to the invention. The cellular hosts which can be used
for the production of the polypeptides of the invention by the
recombinant route are both eukaryotic and prokaryotic hosts. Among
the suitable eukaryotic hosts, animal cells, yeasts or fungi may be
mentioned. In particular, as regards yeasts, yeasts of the genus
Saccharomyces, Kluyveromyces, Pichia, Schwanniomyces or Hansenula
may be mentioned. As regards animal cells, the insect cells Sf9,
the cells COS, CHO, C127, of human neuroblastomas, and the like,
may be mentioned. Among the fungi, Aspergillus ssp. or Trichoderma
spp. may be more particularly mentioned. As prokaryotic hosts, the
use of the following bacteria E. coli, Bacillus or Streptomyces is
preferred.
[0037] According to a preferred mode, the host cells are
advantageously represented by recombinant yeast strains.
[0038] Preferably, the host cells comprise at least one sequence or
one fragment of a sequence chosen from the nucleotide sequences SEQ
ID No. 3 or SEQ ID No. 5, for the production of the polypeptides
according to the invention.
[0039] The nucleotide sequences according to the invention may be
incorporated into viral or nonviral vectors, allowing their
administration in vitro, in vivo or ex vivo.
[0040] Another subject of the invention relates, in addition, to
any vector comprising a nucleotide sequence encoding a polypeptide
according to the invention. The vector of the invention may be for
example a plasmid, a cosmid or any DNA not encapsulated by a virus,
a phage, an artificial chromosome, a recombinant virus, and the
like. It is preferably a plasmid or a recombinant virus.
[0041] As viral vectors in accordance with the invention, there may
be most particularly mentioned vectors of the adenovirus,
retrovirus, adeno-associated virus, herpesvirus or vaccina virus
type. The subject of the present application is also defective
recombinant viruses comprising a heterologous nucleic sequence
encoding a polypeptide according to the invention.
[0042] Another subject of the invention consists in polyclonal or
monoclonal antibodies or antibody fragments directed against a
polypeptide as defined above. Such antibodies may be generated by
methods known to persons skilled in the art. In particular, these
antibodies may be prepared by immunizing an animal against a
polypeptide whose sequence is chosen from the sequences SEQ ID No.
4 or SEQ ID No. 6 or any fragment or derivative thereof, and then
collecting blood and isolating antibodies. These antibodies may
also be generated by preparing hybridomas according to techniques
known to persons skilled in the art. The antibodies or antibody
fragments according to the invention may in particular be used to
inhibit and/or reveal the interaction between topoisomerase
III.alpha. and the polypeptides as defined above.
[0043] Another subject of the present invention relates to a method
for identifying compounds capable of binding to the polypeptides
according to the invention. The identification and/or isolation of
these compounds or ligands may be carried out according to the
following steps:
[0044] a molecule or a mixture containing various molecules,
optionally unidentified, is brought into contact with a polypeptide
of the invention under conditions allowing the interaction between
said polypeptide and said molecule in the case where the latter
might possess affinity for said polypeptide, and,
[0045] the molecules bound to said polypeptide of the invention are
detected and/or isolated.
[0046] According to a particular mode, such a method makes it
possible to identify molecules capable of blocking the helicase
type activity, in particular the DNA helicase activity of the DBX1
protein or of the polypeptides according to the invention and thus
modulate the processes of division, replication or transcription of
DNA. These molecules are capable of possessing a cytotoxic type
antitumor activity because of the disruption of these basic
processes at the level of the DNA.
[0047] In this regard, another subject of the invention relates to
compounds or ligands capable of binding to the polypeptides
according to the invention and capable of being obtained according
to the method defined above.
[0048] Another subject of the invention relates to the use of a
compound or of a ligand identified and/or obtained according to the
method described above as a medicament. Such compounds are indeed
capable of being used for the prevention, improvement or treatment
of certain conditions involving a cell cycle dysfunction.
[0049] The subject of the invention is also any pharmaceutical
composition comprising, as active ingredient, at least one ligand
obtained according to the method described above.
[0050] Another subject of the present invention relates to a method
of identifying compounds capable of modulating or of completely or
partially inhibiting the interaction between topoisomerase
III.alpha. and the polypeptides according to the invention or the
DBX1 protein.
[0051] The identification and/or isolation of modulators or ligands
capable of modulating or of completely or partially inhibiting the
interaction between topoisomerase III.alpha. and the polypeptides
according to the invention or the DBX1 protein may be carried out
according to the following steps:
[0052] the binding of topoisomerase III.alpha. or of a fragment
thereof to a polypeptide according to the invention is carried
out;
[0053] a compound to be tested for its capacity to inhibit the
binding between topoisomerase III.alpha. and the polypeptides
according to the invention is added;
[0054] it is determined whether topoisomerase III.alpha. or the
polypeptides according to the invention are displaced from the
binding or prevented from binding;
[0055] the compounds which prevent or which impede the binding
between topoisomerase III.alpha. and the polypeptides according to
the invention are detected and/or isolated.
[0056] In a particular mode, this method of the invention is suited
to the identification and/or isolation of agonists and antagonists
of the interaction between topoisomerase III.alpha. and the
polypeptides of the invention. Still according to a particular
mode, the invention provides a method for identifying molecules
capable of blocking the interaction between human Topoisomerase
III.alpha. and the helicase DBX1.
[0057] Such a method makes it possible to identify molecules
capable of blocking the reverse gyrase type activity of these two
proteins and thus modulate the processes of division, replication,
transcription, translation, splicing, repair or recombination of
DNA. These molecules are capable of possessing a cytotoxic type
antitumor activity because of the disruption of these basic
processes at the level of the DNA.
[0058] In this regard, another subject of the invention relates to
compounds or ligands capable of interfering at the level of the
interaction between topoisomerase III.alpha. and the polypeptides
according to the invention or the DBX1 protein and which are
capable of being obtained according to the method defined
above.
[0059] The invention also relates to the use of a compound or of a
ligand identified and/or obtained according to the method described
above as a medicament. Such compounds are indeed capable of being
used for the prevention, improvement or treatment of certain
conditions involving a cell cycle dysfunction.
[0060] The subject of the invention is also any pharmaceutical
composition comprising, as active ingredient, at least one ligand
obtained according to the method described above.
[0061] Other advantages of the present invention will emerge from
reading the examples which follow and which should be considered as
illustrative and nonlimiting.
LEGEND TO THE FIGURES
[0062] FIG. 1: This figure represents the beginning and the end of
the sequence SEQ ID No. 1 so as to present the introduction of the
BamHI and SalI sites in 5' and 3' of the topoisomerase III.alpha.
coding sequence and the position of the XhoI and HindIII sites.
MATERIALS AND METHODS
[0063] 1) General Molecular Biology Techniques
[0064] The methods conventionally used in molecular biology such as
preparative extractions of plasmid DNA, centrifugation of plasmid
DNA in cesium chloride gradient, electrophoresis on agarose or
acrylamide gels, purification of DNA fragments by electroelution,
phenol or phenol-chloroform extractions of proteins, precipitation
of DNA in saline medium with ethanol or isopropanol, transformation
in Escherichia coli, and the like, are well known to persons
skilled in the art and are abundantly described in the literature
[Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel
F. M. et al. (eds), "Current Protocols in Molecular Biology", John
Wiley & Sons, New York, 1987].
[0065] For the ligations, the DNA fragments may be separated
according to their size by electrophoresis on agarose or acrylamide
gels, extracted with phenol or with a phenol/chloroform mixture,
precipitated with ethanol and then incubated in the presence of T4
phage DNA ligase (Biolabs) according to the supplier's
recommendations.
[0066] The filling of the protruding 5' ends may be carried out
with the Klenow fragment of E. coli DNA Polymerase I (Biolabs)
according to the supplier's specifications. The destruction of the
protruding 3' ends is carried out in the presence of the T4 phage
DNA Polymerase (Biolabs) used according to the manufacturer's
recommendations. The destruction of the protruding 5' ends is
carried out by a controlled treatment with S1 nuclease.
[0067] Mutagenesis directed in vitro by synthetic
oligodeoxynucleotides may be carried out according to the method
developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764]
using the kit distributed by Amersham.
[0068] Enzymatic amplification of DNA fragments by the so-called
PCR technique [Polymerase-catalyzed Chain Reaction, Saiki R. K. et
al., Science 230 (1985) 1350-1354; Mullis K. B. and Faloona F. A.,
Meth. Enzym. 155 (1987) 335-350] may be carried out using a "DNA
thermal cycler" (Perkin Elmer Cetus) according to the
manufacturer's specifications.
[0069] The verification of the nucleotide sequences may be carried
out by the method developed by Sanger et al. [Proc. Natl. Acad.
Sci. USA, 74 (1977) 5463-5467] using the kit distributed by
Amersham.
[0070] 2) The Yeast Strains Used Are:
[0071] The strain yCM17 of the genus S. cerevisiae (MATa, ura3-52,
his3-200, ade2-101, lys2-801, trp1-901, leu2-3,112, canr, gal4-542,
gal80-538, URA3::GAL1/10-lacZ-URA3) was used as tool for screening
the library for fusion of Hela cells by the two-hybrid system.
[0072] The strain L40 of the genus S. cerevisiae (MATa, his3D200,
trp1-901, leu2-3,112, ade2, LYS2::(lexAop)4-HIS3,
URA3:(lexAop)8-LacZ, GAL4) was used to verify the protein-protein
interactions when one of the protein partners is fused with the
LexA protein. The latter is capable of recognizing the LexA
response element controlling the expression of the LacZ and His3
reporter genes.
[0073] They were cultured on the following culture media:
[0074] Complete YPD medium: yeast extract (10 g/l) (Difco),
bactopeptone (20 g/l) (Difco), glucose (20 g/l) (Merck). This
medium was made solid by addition of 20 g/l of agar (Difco).
[0075] Minimum YNB medium: Yeast Nitrogen Base (without amino
acids) (6.7 g/l) (Difco), glucose (20 g/l) (Merck). This medium may
be made solid by addition of 20 g/l of agar (Difco). This medium is
supplemented with amino acids or nitrogen bases (50 mg/ml) which
are necessary to bring about the growth of auxotrophic yeasts.
Ampicillin (100 .mu.g/ml) is added to the medium so as to avoid
bacterial contaminations.
[0076] 3) The Bacterial Strains Used Are:
[0077] The Escherichia coli TG1 strain of the supE, hsd.DELTA.5,
thi, .DELTA.(lac-proAB), F'[tra D36 pro A.sup.+B.sup.+ lacI.sup.q
lacZ.DELTA.M15] genotype was used for the construction of the
plasmids pLex-TopoIII.alpha. and pGBT-TopoIII.alpha..
[0078] The Escherichia coli HB101 strain of the supE44, ara14,
galK2, lacY1, .alpha.(gpt-proA)62, rpsL20(Str.sup.r), xy1-5,
recA13, .DELTA.(mcrC-mrr), HsdS.sup.-(r.sup.-m.sup.-) gentotype was
used as means for amplifying and isolating plasmids obtained from
the Hela cell cDNA library.
[0079] The TG1 strain was cultured on LB medium: NaCl (5 g/l)
(Difco), bactotryptone (10 g/l) (Difco), yeast extract (5 g/l)
(Difco). This medium may be made solid by adding 20 g/l of agar
(Difco). Ampicillin was used at 100 .mu.g/l for the selection of
bacteria which have received plasmids carrying, as marker, the gene
for resistance to this antibiotic.
[0080] The HB101 strain was cultured on M9 medium: Na2HPO4 (7 g/l)
(Sigma), KH2PO4 (3 g/l) (Sigma), NH4Cl (1 g/l) (Sigma), NaCl (0.5
g/l) (Sigma), glucose (20 g/l) (Sigma), MgSO4 (1 mm) (Sigma),
thiamine (0.001%). This medium is made solid by adding 15 g/l of
agar (Difco).
[0081] Leucine (50 mg/l) (Sigma) and proline (50 mg/l) (Sigma) are
added to the M9 medium to allow growth of the HB101 strain. During
the selection of plasmids obtained from the Hela cell two-hybrid
cDNA library, leucine was not added to the medium because the
plasmids carry a Leu2 selection marker.
[0082] 3) The Plasmids Used Are:
[0083] Vector pGBT9 (+2): this plasmid is derived from the plasmid
pGBT9 (Clontech). It exhibits a reading frame shift of +2, upstream
of the EcoR1 site, in the zone corresponding to the multiple
cloning site. The difference in sequence between pGBT9 (+2) and
pGBT9, upstream of the EcoRI site (underlined), is represented in
bold below:
1 SEQ ID No. 7 pGBT9 (+2): TCG CCG GAA TTG AAT TCC CGG GGA TCC GT
SEQ ID No. 8 pGBT9: TCG CCG GAA TTC CCG GGG ATC CGT
[0084] The vector PGBT9 (+2) is a shuttle plasmid of 5.4 kb which
possesses a bacterial and yeast replication origin allowing it to
replicate in a high copy number in these two microorganisms. This
plasmid contains a multiple cloning site situated downstream of the
sequence encoding the DNA-binding domain of GAL4 and upstream of a
terminator to form a fusion protein. It also contains the S.
cerevisiae TRP1 gene which makes it possible to complement yeasts
of the trp1 genotype so as to select them on a minimum medium not
containing tryptophan. This vector carries the gene for resistance
to ampicillin which makes it possible to select the bacteria on a
medium containing ampicillin.
[0085] pGBT-HaRasVal12: plasmid derived from pGBT9 and comprising
the sequence encoding the HaRas protein mutated at position Val12
known to interact with the mammalian Raf protein. This plasmid was
used to test the specificity of interaction of the protein
according to the invention with human topoisomerase III.alpha..
[0086] PGBT-Fe65: plasmid derived from pGBT9 and comprising a
portion of the sequence encoding the Fe65 protein known to interact
with the cytoplamic region of APP (Amyloid Peptide Precursor). This
plasmid was used as a control to verify the specificity of
interaction of the protein according to the invention with human
topoisomerase III.alpha.
[0087] The vector pGAD GH: provided by Clontech and which allows
the expression in yeast of proteins from the fusion between the
transactivating domain of GAL4 and a protein encoded by the cDNA
obtained from a Hela cell library, inserted at the level of the
EcoRI and XhoI sites.
[0088] The vector pLex9 (pBTM116) (Bartel et al D. A. Hartley Ed,
Oxford University press page 153) of 5 kb homologous to pGBT10
which contains a multiple cloning site downstream of the sequence
encoding the bacterial LexA repressor and upstream of a terminator
to form a fusion protein.
[0089] 4) The Synthetic Oligonucleotides Used Are:
2 SEQ ID No. 9 oligonucleotide 124 CGAGGTCTGAGGATGATCTT SEQ ID No.
10 oligonucleotide 125 CTGAGAAAGTGGCGTTCTCT
[0090] This pair of oligonucleotides served to amplify by PCR,
starting with a Hela cell cDNA library, a fragment corresponding to
the sequence encoding human topoisomerase III.alpha..
3 SEQ ID No. 11 oligonucleotide Top3Xho1 AAGTTACTCGAGATGGCCCTCCGAGG
SEQ ID No. 12: oligonucleotide Top3Hind3
ACGAGCAAGCTTCTCTACCCTACCCTG
[0091] The pair of oligonucleotides Top3Xho1 and Top3Hind3 made it
possible to introduce the XhoI and HindIII sites respectively
during a second PCR step on the fragment corresponding to
topoisomeraseIII.alpha. previously amplified by means of
oligonucleotides 124 and 125.
4 SEQ ID No. 13: oligonucleotide PCS1
AATTGCGAATTCTCGAGCCCGGGGATCCGTCGACTGCA SEQ ID No. 14:
oligonucleotide PCS2 GTCGCAGGATCCCCGGGCTCGAGAATTCGC
[0092] The pair of oligonucleotides PCS1 and PCS2 made it possible
to introduce to the plasmid pLex9 a XhoI site in phase with the
human topoisomeraseIII.alpha. coding sequence. The insert
comprising the gene encoding topoisomerase III.alpha. was therefore
recloned into this vector between the sites XhoI in 5' and Sal I in
3'.
[0093] SEQ ID No. 15 oligonucleotide GAL4TA
[0094] CCACTACAATGGATGATG
[0095] This oligonucleotide was used to sequence the inserts
contained in the plasmids of the Hela cell two-hybrid cDNA
library.
[0096] The oligonucleotides are synthesized on the Applied System
ABI 394-08 apparatus. They are detached from the synthesis template
with ammonia and precipitated twice with 10 volumes of n-butanol
and then taken up in water. The quantification is carried out by
measuring the optical density (one OD unit corresponds to 30
.mu.g/ml).
[0097] 5) Transformation of the TG1 Bacteria
[0098] The entire ligation volume (10 .mu.l) is used to transform
the TG1 bacteria made competent by the Chung et al. method (PNAS,
1988 86; 2172-2175).
[0099] The TG1 bacteria are cultured in a liquid LB medium for a
few hours in a shaking incubator at 37.degree. C., until an OD of
0.6 to 600 nm is obtained. The medium is then centrifuged at 6 000
rpm for 10 min. The bacteria are made competent by taking up the
bacterial pellet in a volume of TSB (LB medium+100 g/l of PEG 4000,
5% of DMSO, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4) corresponding to
{fraction (1/10)} of the volume of the initial culture medium.
After incubation at 4.degree. C. for 30 to 60 minutes, 200 .mu.l of
bacteria are brought into contact with the ligation products for 15
minutes on ice. After addition of 200 .mu.l of LB, the bacteria are
incubated for 30 min at 37.degree. C. and then plated on an
LB+ampicillin medium.
[0100] 6) Preparation of Plasmids from the Hela Cell Two-hybrid
cDNA Library (Clontech.RTM.)
[0101] The Hela cell two-hybrid cDNA library is sold in the form of
bacteria. The latter contain a plasmid pGAD GH containing an insert
corresponding to a Hela cell cDNA. The cDNAs of this library are
constituted by means of an oligodT primer. These cDNAs are cloned
in an orientated manner into the vector pGAD GH at the level of the
EcoRI and XhoI. 2.1 sites)
[0102] The plasmid DNA of the brain cDNA library was extracted
according to the Clontech.RTM. protocol. To preserve the
representativeness of the library which consists of
1.2.times.10.sup.6 independent plasmids, the batch of plasmid DNA
was prepared from a number of isolated bacterial colonies
corresponding to a little over twice the representativeness of the
library, that is 4.times.10.sup.6 colonies.
[0103] After verification of the titre of the library, 2 .mu.l of
bacteria of the Hela cell two-hybrid cDNA library, previously
placed in 8 ml of LB, are plated on a solid medium (16 dishes/770
cm.sup.2 in LB+ampicillin medium). The colonies which appear are
taken up for each of the dishes in 30 ml of liquid LB+ampicillin.
The suspensions obtained are incubated at 37.degree. C. for 3
hours. The DNA is then extracted from these strains by the
technique for extracting plasmid DNA in a large quantity. The DNA
concentration is determined at 260 nm.
[0104] 7) Transformation of Yeast
[0105] The yeasts previously cultured in 100 ml of liquid medium
are harvested by centrifugation (3 000 rpm, 3 minutes). The pellet
is washed twice by centrifuging with 1 ml of sterile water. The
yeasts are then taken up in 1 ml of transformation solution I (0.1
M LiAc, 10 mM Tris-HCl pH 7.5, 1 mM EDTA) and then centrifuged (3
000 rpm, 3 minutes). The pellet is taken up in 1 ml of
transformation solution I. 50 .mu.l of this yeast suspension are
brought into contact with 50 .mu.g of salmon sperm DNA and 1 to 5
.mu.g of plasmid DNA and 300 .mu.l of a transformation solution II
(0.1 M LiAc, 10 mM Tris-HCl pH 7.5, 1 mM EDTA in 40% PEG.sub.4000).
This mixture is incubated at 28.degree. C. for 30 minutes. After
application of a heat shock (40.degree. C., 15 minutes), the cells
are harvested by centrifugation (15 000 rpm for 1 min). This pellet
is taken up in 200 .mu.l of water and then plated on a minimum agar
medium not containing amino acids corresponding to the resistance
markers carried by the plasmids transforming the yeasts. The yeasts
are incubated for 72 hours at 28.degree. C.
[0106] 8) Transformation of Yeast with the Hela Cell Two-hybrid
cDNA Library
[0107] The yeast used was transformed beforehand with the plasmid
pLexTopoIII.alpha.. It is cultured in minimum YNB+His+Lys+Ad+Leu
medium (250 ml), at 28.degree. C., with stirring until a density of
10.sup.7 cells/ml is obtained. The cells are harvested by
centrifugation (3 000 rpm, 10 minutes) and then taken up in 250 ml
of water. After another centrifugation, the cellular pellet is
taken up in 100 ml of water and again centrifuged. The pellet is
then taken up in 10 ml of transformation solution I and incubated
for 1 hour at 28.degree. C. with stirring. After centrifugation,
the cells are again taken up in 2.5 ml of transformation solution
I, 100 .mu.l of the Hela cell cDNA library and 20 ml of
transformation solution II, and then incubated for 1 hour at
28.degree. C. with stirring. A heat shock is applied to this
transformation mixture at 42.degree. C. for 20 minutes. The cells
are then centrifuged and the cellular pellet harvested is washed
with 10 ml of sterile water. This operation is repeated twice and
then the pellet is taken up in 2.5 ml of PBS. At this stage, the
PEG which is toxic to the cells is removed. 2.4 ml of this
suspension are used to inoculate 250 ml of minimum medium
containing the amino acids His, Lys, Ad and cultured overnight in a
shaker at 28.degree. C. The remaining 100 .mu.l of this suspension
serve to determine the transformation efficiency by dilution on
solid minimum medium in the presence of His, Lys and Ad. The
overnight culture is then centrifuged (3 000 rpm for 5 min) and
washed twice with sterile water. The pellet is then taken up in 2.5
ml of water. One aliquot of 2.4 ml of this mixture is brought to 10
ml in sterile water, this solution is used to inoculate 10 dishes
of 435 cm.sup.2 containing 200 ml of YNB+Lys+Ad medium and
incubated for 3 days. The remaining 100 .mu.l are used to determine
the level of amplification of the number of colonies during an
overnight culture.
[0108] 9) Extraction of Nucleic Acids from Yeasts
[0109] The value of an average loop of a yeast clone is placed in
200 .mu.l of a TELT solution (2% Triton X100, 1% SDS, 100 mM NaCl,
10 mM Tris pH 8, 1 mM EDTA), in the presence of 3 g of glass beads
450 .mu.m in diameter and 200 .mu.l of phenol/chloroform. This
mixture is stirred for 15 minutes and then centrifuged for 2
minutes at 14 000 rpm. The supernatant is collected without
removing the protein cake and the DNA contained in this phase is
precipitated with 2.5 volumes of absolute ethanol. After
centrifuging for 2 minutes at 14 000 rpm, the DNA pellet is dried
and taken up in 20 .mu.l of TE-RNAse. 3 .mu.l of this DNA solution
previously dialyzed against water, which corresponds to a mixture
of nucleic acids, serves directly to transform HB101 bacteria. Only
the plasmid DNA is capable of replicating in the bacteria and may
be analyzed by the technique for preparing plasmid DNA from
bacteria in a small quantity.
[0110] 10) Test for .beta.-galactosidase Activity
[0111] A nitrocellulose sheet is deposited beforehand on the Petri
dish containing the individualized yeast clones. This sheet is then
immersed in liquid nitrogen for 30 seconds so as to break the
yeasts and thus release the .beta.-galactosidase activity. After
thawing, the nitrocellulose sheet is deposited, colonies at the
top, in another Petri dish containing a Whatman 3M paper
impregnated beforehand with 1.5 ml of PBS solution (60 mM
Na.sub.2HPO4, 40 mM NaH.sub.2PO.sub.4, 10 mM KCl, 1 mM MgSO.sub.4,
pH 7) and 10 to 30 .mu.l of X-Gal (5-bromo-4-chloro-3-indo-
yl-.beta.-D-galactoside) containing 50 mg/ml of
N,N-dimethylformamide. The dish is then incubated at 37.degree.
C.
EXAMPLE 1
Construction of a Vector Allowing the Expression of a Protein from
the Fusion Between Human Topoisomerase III.alpha. and a DNA-binding
Protein
[0112] The screening of a cDNA library using the. two-hybrid system
requires beforehand that the human topoisomerase III.alpha. is
fused with a protein capable of binding to the promoters
controlling the expression of reporter genes such as the LexA
protein of the bacterial repressor or the DNA-binding domain (DB)
of GAL4. The expression of the fusion proteins is carried out by
means of the vector pLex9 in the case of a fusion with the LexA
protein or by means of the vector pGBT9 (+2) for a fusion with the
DB of GAL4 (cf. Materials and Methods). The sequence encoding the
human topoisomerase III.alpha. presented in SEQ ID No. 1 was
introduced into these two types of vector in the same reading frame
as the sequence corresponding to the LexA protein or to the DB of
Gal4.
[0113] The DNA fragment corresponding to the sequence encoding
human topoisomerase III.alpha. was amplified by PCR from a Hela
cell cDNA library (Clontech) by means of oligonucleotides 124 and
125. A second PCR amplification step was performed on the DNA
fragment so as to introduce at the two ends the XhoI and HindIII
sites by means of the pair of oligonucleotides Top3Xho1 and
Top3Hind3. The new DNA fragment obtained, digested with XhoI and
HindIII, was introduced at the corresponding sites into the vector
pBlueBacHis2A (Invitrogen) which gives the possibility of using new
BamHI and SalI restriction sites (represented in bold with the XhoI
and HindIII sites in FIG. 1) so as to produce the final
constructs.
[0114] The plasmid pLex-TopoIII.alpha. was constructed by inserting
the XhoI-SalI fragment, of the preceding plasmid, corresponding to
human topoisomeraseIII.alpha., into the plasmid pLex9 modified
beforehand by insertion of the oligonucleotides PCS1 and PCS2 at
the EcoRI-PstI1 sites. This plasmid was used to screen a Hela cell
two-hybrid cDNA library with the aim of identifying. proteins
interacting with human topoisomerase III.alpha..
[0115] The plasmid pGBT-TopoIII.alpha. was constructed by
inserting, at the BamHI and SalI sites of the plasmid pGBT9 (+2), a
fragment obtained by partial digestion with BamHI and total
digestion with SalI and corresponding to human topoisomerase
III.alpha.. This plasmid was used to validate, by the two-hybrid
technique, the specificity of interaction of the proteins selected
during the screening with human topoisomerase III.alpha..
[0116] The constructs were verified by sequencing the DNA. This
verification made it possible to show that the fragments of human
topoisomerase III.alpha. did not exhibit mutations generated during
the PCR reaction and that they were fused in the same open reading
frame as that of the fragments corresponding to the LexA protein or
to the DB of GAL4.
EXAMPLE 2
Screening by the Two-hybrid Technique of a HeLa Cell cDNA
Library
[0117] The screening of a fusion library makes it possible to
identify clones producing proteins fused with the transactivating
domain of GAL4, which can interact with topoisomerase III.alpha..
This interaction makes it possible to reconstitute a transactivator
which will then be capable of inducing the expression of the
reporter genes His3 and LacZ in the L40 strain used.
[0118] To carry out this screening, a fusion library produced from
cDNA obtained from Hela cells was chosen.
Transformation of Yeast with the Hela Cell Two-hybrid cDNA Library
and Selection of the Positive Clones
[0119] During the screening, it is necessary to preserve the
probability that each independent plasmid of the fusion library is
present in at least one yeast at the same time as the plasmid
pLex-TopoIII.alpha.. To preserve this probability, it is important
to have a good efficiency of transformation of the yeast; for this
purpose, a yeast transformation protocol giving an efficiency of
10.sup.5 transformed cells per .mu.g of DNA was chosen.
Furthermore, as the cotransformation of yeast with two different
plasmids reduces this efficiency, an L40 yeast transformed
beforehand with the plasmid pLex-TopoIII.alpha. was used. This
strain containing pLex-TopoIII.alpha., of the phenotype His-, Lys-,
Leu-, was transformed with 100 .mu.g of plasmid DNA the two-hybrid
library. This quantity of DNA made it possible to obtain after
estimation (see Materials and Methods) 6.times.10.sup.6 transformed
cells, which corresponds to the number of independent plasmids
which the library constitutes. It is thus possible to estimate that
less than all of the plasmids of the library served to transform
the yeasts. The selection of the transformed cells, capable of
reconstituting a functional GAL4 transactivator, was performed on
an YNB+Lys+Ad medium.
[0120] At the end of this selection, about 500 clones of the His+
phenotype were obtained. A test for .beta.-galactosidase activity
was performed on these transformants so as to determine the number
of clones expressing the other reporter gene, LacZ. Of the 500
clones obtained, sixty-three exhibited the double phenotype His+
and .beta.Gal+, thus showing that they express proteins which can
interact with human topoisomerase III.alpha..
EXAMPLE 3
Isolation of the Plasmids from the Yeast Clones Selected
[0121] To identify the proteins which interact with human
topoisomerase III.alpha., the plasmids obtained from the two-hybrid
library of the yeasts selected during the two-hybrid screening were
extracted. The DNA of the yeast strains of the phenotype His+ and
.beta.Gal+ is used to transform the E. coli HB101 strain.
[0122] The plasmid DNAs of the bacterial colonies obtained after
transformation with yeast DNA extracts were analyzed by digesting
with restriction enzymes and separating the DNA fragments on
agarose gel. Two different restriction profiles were obtained out
of 15 yeast clones analyzed. One of these profiles was highly
represented. These results show that at least 2 different plasmids
were isolated during this screening, the DNA fragment obtained from
the cDNA library contained in the most highly represented plasmid
was selected for the remainder of the study.
EXAMPLE 4
Determination of the Sequence of the Insert Contained in the
Plasmid Selected
[0123] The sequencing was carried out on the most highly
represented plasmid. The sequencing is carried out using the
oligonucleotide GAL4TA complementary to the region close to the
site of insertion of the Hela cell cDNA library, at 52 base pairs
from the EcoRI site.
[0124] Comparison of the sequence obtained with the sequences
contained in the GenBank and EMBL (European Molecular Biology Lab)
databanks has shown that the sequence of the cDNA present in the
plasmid selected exhibits 98.2% at the nucleic level with the human
gene encoding the Dead Box X isoform protein (DBX1) also called
helicase like protein 2 (DDX14) having the accession number
AF000982 and U50553 respectively. Comparison of the sequence of the
cDNA present in the plasmid selected also shows 98.1% identity with
the DDX14 protein.
[0125] The nucleotide and polypeptide sequence of DBX1 is presented
in the sequence SEQ ID No. 5. The sequence of the gene cloned by
two hybrids starts at nucleotide 952 relative to the putative
initiation codon, that is at the 318th amino acid and contains a
sequence homologous to the sequence encoding the C-terminal part of
the DBX1 protein including the stop codon.
[0126] This result shows that the domain for interaction of the
protein or polypeptide partners of human topoisomerase III.alpha.
is contained in the second C-terminal half of said partners.
[0127] Differences were noted relative to the published DBX1
sequence, in particular the AGT codon (at position 1768 relative to
the initiation codon, that is at position 2624 on the sequence SEQ
ID No. 5) encoding serine 590 is absent in the cloned fragment.
[0128] Likewise, the presence of a C residue in place of a T at
position 2068 of the ATG was noted.
[0129] The sequence of the cloned fragment is represented in SEQ ID
No. 3.
EXAMPLE 5
Analysis of the Specificity of Interaction Between Topoisomerase
III.alpha. and the Polypeptides of the Invention
[0130] The specificity of interaction between human topoisomerase
III.alpha. and the polypeptide according to the invention was
confirmed in a two-hybrid interaction test using the plasmid
pGBT-TopoIII.alpha. in place of the plasmid pLex-TopoIII.alpha..
The plasmid pGBT-TopoIII.alpha. comprises the gene encoding human
topoisomerase III.alpha. fused with the DNA-binding domain of
GAL4.
[0131] The strain yCM17 was transformed with the plasmid isolated
during the screening of the two-hybrid library and with the plasmid
pGBT-TopoIII.alpha.. Controls for specificity of interaction were
also performed by transforming this strain with the control
plasmids pGBT-HaRasVal12 or pGBT-Fe65, in place of the plasmid
pGBT-TopoIII.alpha.. A test of .beta.-Gal activity on the cells
transformed with the various plasmids was performed to demonstrate
the protein-protein interactions.
[0132] The results of the test showed that only the yeasts
transformed with the plasmid isolated during the screening of the
two-hybrid library and with the plasmid pGBT-TopoIII.alpha.
exhibited a .beta.-Gal+ activity, thus showing interaction between
human topoisomerase III.alpha. and the C-terminal region of the
polypeptides according to the invention. These-results also show
that this interaction is independent of the fusion protein used.
Sequence CWU 1
1
15 1 2973 DNA Homo sapiens 1 ggatccgagc tcgagatggc cctccgaggc
gtgcggaaag tcctctgtgt ggccgaaaaa 60 aacgacgcgg ccaaggggat
cgccgacctg ctgtcaaacg gtcgcatgag gcggagagaa 120 ggactttcaa
aattcaacaa gatctatgaa tttgattatc atctgtatgg ccagaatgtt 180
accatggtaa tgacttcagt ttctggacat ttactggctc atgatttcca gatgcagttt
240 cgaaaatggc agagctgcaa ccctcttgtc ctctttgaag cagaaattga
aaagtactgc 300 ccagagaatt ttgtagacat caagaaaact ttggaacgag
agactcgcca gtgccaggct 360 ctggtgatct ggactgactg tgatagagaa
ggcgaaaaca tcgggtttga gattatccac 420 gtgtgtaagg ctgtaaagcc
caatctgcag gtgttgcgag cccgattctc tgagatcaca 480 ccccatgccg
tcaggacagc ttgtgaaaac ctgaccgagc ctgatcagag ggtgagcgat 540
gctgtggatg tgaggcagga gctggacctg aggattggag ctgcctttac taggttccag
600 accctgcggc ttcagaggat ttttcctgag gtgctggcag agcagctcat
cagttacggc 660 agctgccagt tccccacact gggctttgtg gtggagcggt
tcaaagccat tcaggctttt 720 gtaccagaaa tcttccacag aattaaagta
actcatgacc acaaagatgg tatcgtagaa 780 ttcaactgga aaaggcatcg
actctttaac cacacggctt gcctagttct ctatcagttg 840 tgtgtggagg
atcccatggc aactgtggta gaggtcagat ctaagcccaa gagcaagtgg 900
cggcctcaag ccttggacac tgtggagctt gagaagctgg cttctcgaaa gttgagaata
960 aatgctaaag aaaccatgag gattgctgag aagctctaca ctcaagggta
catcagctat 1020 ccccgaacag aaacaaacat ttttcccaga gacttaaacc
tgacggtgtt ggtggaacag 1080 cagacccccg atccacgctg gggggccttt
gcccagagca ttctagagcg gggtggtccc 1140 accccacgca atgggaacaa
gtctgaccaa gctcaccctc ccattcaccc caccaaatac 1200 accaacaact
tacagggaga tgaacagcga ctgtacgagt ttattgttcg ccatttcctg 1260
gcttgctgct cccaggatgc tcaggggcag gagaccacag tggagatcga catcgctcag
1320 gaacgctttg tggcccatgg cctcatgatt ctggcccgaa actatctgga
tgtgtatcca 1380 tatgatcact ggagtgacaa gatcctccct gtctatgagc
aaggatccca ctttcagccc 1440 agcaccgtgg agatggtgga cggggagacc
agcccaccca agctgctcac cgaggccgac 1500 ctcattgccc tcatggagaa
gcatggcatt ggtacggatg ccactcatgc ggagcacatc 1560 gagaccatca
aagcccggat gtacgtgggc ctcaccccag acaagcggtt cctccctggg 1620
cacctgggca tgggacttgt ggaaggttat gattccatgg gctatgaaat gtctaagcct
1680 gacctccggg ctgaactgga agctgatctg aagctgatct gtgatggcaa
aaaggacaaa 1740 tttgtggttc taaggcagca agtgcagaaa tacaagcagg
ttttcattga agcggtggct 1800 aaagcaaaga aattggacga ggccttggcc
cagtactttg ggaatgggac agagttggcc 1860 cagcaagaag atatctaccc
agccatgcca gagcccatca ggaagtgccc acagtgcaac 1920 aaggacatgg
tccttaagac caagaagaat ggcgggttct acctcagctg catgggtttc 1980
ccagagtgtc gctcagctgt gtggcttcct gactcggtgc tggaggccag cagggacagc
2040 agtgtgtgtc cagtttgtca gccacaccct gtgtacaggt taaagttaaa
gtttaagcgc 2100 ggtagccttc ccccgaccat gcctctggag tttgtttgct
gcatcggcgg atgcgacgac 2160 accctgaggg agatcctgga cctgagattt
tcagggggcc cccccagggc tagccagccc 2220 tctggccgcc tgcaggctaa
ccagtccctg aacaggatgg acaacagcca gcacccccag 2280 cctgctgaca
gcagacagac tgggtcctca aaggctctgg cccagaccct cccaccaccc 2340
acggctgctg gtgaaagcaa ttctgtgacc tgcaactgtg gccaggaggc tgtgctgctc
2400 actgtccgta aggagggccc caaccggggc cggcagttct ttaagtgcaa
cggaggtagc 2460 tgcaacttct tcctgtgggc agacagcccc aatccgggag
caggagggcc tcctgccttg 2520 gcatatagac ccctgggcgc ctccctggga
tgcccaccag gcccagggat ccacctaggt 2580 gggtttggca accctggtga
tggcagtggt agtggcacat cctgcctttg cagccagccc 2640 tccgtcacac
ggactgtgca gaaggatgga cccaacaagg ggcgccagtt ccacacatgt 2700
gccaagccga gagagcagca gtgtggcttt ttccagtggg tcgatgagaa caccgctcca
2760 gggacttctg gagccccgtc ctggacagga gacagaggaa gaaccctgga
gtcggaagcc 2820 agaagcaaaa ggccccgggc cagttcctca gacatggggt
ccacagcaaa gaaaccccgg 2880 aaatgcagcc tttgccacca gcctggacac
acccgtccct tttgtcctca gaacagatga 2940 gctcagggta gggtagagaa
gcttggagtc gac 2973 2 974 PRT Homo sapiens 2 Met Ala Leu Arg Gly
Val Arg Lys Val Leu Cys Val Ala Glu Lys Asn 1 5 10 15 Asp Ala Ala
Lys Gly Ile Ala Asp Leu Leu Ser Asn Gly Arg Met Arg 20 25 30 Arg
Arg Glu Gly Leu Ser Lys Phe Asn Lys Ile Tyr Glu Phe Asp Tyr 35 40
45 His Leu Tyr Gly Gln Asn Val Thr Met Val Met Thr Ser Val Ser Gly
50 55 60 His Leu Leu Ala His Asp Phe Gln Met Gln Phe Arg Lys Trp
Gln Ser 65 70 75 80 Cys Asn Pro Leu Val Leu Phe Glu Ala Glu Ile Glu
Lys Tyr Cys Pro 85 90 95 Glu Asn Phe Val Asp Ile Lys Lys Thr Leu
Glu Arg Glu Thr Arg Gln 100 105 110 Cys Gln Ala Leu Val Ile Trp Thr
Asp Cys Asp Arg Glu Gly Glu Asn 115 120 125 Ile Gly Phe Glu Ile Ile
His Val Cys Lys Ala Val Lys Pro Asn Leu 130 135 140 Gln Val Leu Arg
Ala Arg Phe Ser Glu Ile Thr Pro His Ala Val Arg 145 150 155 160 Thr
Ala Cys Glu Asn Leu Thr Glu Pro Asp Gln Arg Val Ser Asp Ala 165 170
175 Val Asp Val Arg Gln Glu Leu Asp Leu Arg Ile Gly Ala Ala Phe Thr
180 185 190 Arg Phe Gln Thr Leu Arg Leu Gln Arg Ile Phe Pro Glu Val
Leu Ala 195 200 205 Glu Gln Leu Ile Ser Tyr Gly Ser Cys Gln Phe Pro
Thr Leu Gly Phe 210 215 220 Val Val Glu Arg Phe Lys Ala Ile Gln Ala
Phe Val Pro Glu Ile Phe 225 230 235 240 His Arg Ile Lys Val Thr His
Asp His Lys Asp Gly Ile Val Glu Phe 245 250 255 Asn Trp Lys Arg His
Arg Leu Phe Asn His Thr Ala Cys Leu Val Leu 260 265 270 Tyr Gln Leu
Cys Val Glu Asp Pro Met Ala Thr Val Val Glu Val Arg 275 280 285 Ser
Lys Pro Lys Ser Lys Trp Arg Pro Gln Ala Leu Asp Thr Val Glu 290 295
300 Leu Glu Lys Leu Ala Ser Arg Lys Leu Arg Ile Asn Ala Lys Glu Thr
305 310 315 320 Met Arg Ile Ala Glu Lys Leu Tyr Thr Gln Gly Tyr Ile
Ser Tyr Pro 325 330 335 Arg Thr Glu Thr Asn Ile Phe Pro Arg Asp Leu
Asn Leu Thr Val Leu 340 345 350 Val Glu Gln Gln Thr Pro Asp Pro Arg
Trp Gly Ala Phe Ala Gln Ser 355 360 365 Ile Leu Glu Arg Gly Gly Pro
Thr Pro Arg Asn Gly Asn Lys Ser Asp 370 375 380 Gln Ala His Pro Pro
Ile His Pro Thr Lys Tyr Thr Asn Asn Leu Gln 385 390 395 400 Gly Asp
Glu Gln Arg Leu Tyr Glu Phe Ile Val Arg His Phe Leu Ala 405 410 415
Cys Cys Ser Gln Asp Ala Gln Gly Gln Glu Thr Thr Val Glu Ile Asp 420
425 430 Ile Ala Gln Glu Arg Phe Val Ala His Gly Leu Met Ile Leu Ala
Arg 435 440 445 Asn Tyr Leu Asp Val Tyr Pro Tyr Asp His Trp Ser Asp
Lys Ile Leu 450 455 460 Pro Val Tyr Glu Gln Gly Ser His Phe Gln Pro
Ser Thr Val Glu Met 465 470 475 480 Val Asp Gly Glu Thr Ser Pro Pro
Lys Leu Leu Thr Glu Ala Asp Leu 485 490 495 Ile Ala Leu Met Glu Lys
His Gly Ile Gly Thr Asp Ala Thr His Ala 500 505 510 Glu His Ile Glu
Thr Ile Lys Ala Arg Met Tyr Val Gly Leu Thr Pro 515 520 525 Asp Lys
Arg Phe Leu Pro Gly His Leu Gly Met Gly Leu Val Glu Gly 530 535 540
Tyr Asp Ser Met Gly Tyr Glu Met Ser Lys Pro Asp Leu Arg Ala Glu 545
550 555 560 Leu Glu Ala Asp Leu Lys Leu Ile Cys Asp Gly Lys Lys Asp
Lys Phe 565 570 575 Val Val Leu Arg Gln Gln Val Gln Lys Tyr Lys Gln
Val Phe Ile Glu 580 585 590 Ala Val Ala Lys Ala Lys Lys Leu Asp Glu
Ala Leu Ala Gln Tyr Phe 595 600 605 Gly Asn Gly Thr Glu Leu Ala Gln
Gln Glu Asp Ile Tyr Pro Ala Met 610 615 620 Pro Glu Pro Ile Arg Lys
Cys Pro Gln Cys Asn Lys Asp Met Val Leu 625 630 635 640 Lys Thr Lys
Lys Asn Gly Gly Phe Tyr Leu Ser Cys Met Gly Phe Pro 645 650 655 Glu
Cys Arg Ser Ala Val Trp Leu Pro Asp Ser Val Leu Glu Ala Ser 660 665
670 Arg Asp Ser Ser Val Cys Pro Val Cys Gln Pro His Pro Val Tyr Arg
675 680 685 Leu Lys Leu Lys Phe Lys Arg Gly Ser Leu Pro Pro Thr Met
Pro Leu 690 695 700 Glu Phe Val Cys Cys Ile Gly Gly Cys Asp Asp Thr
Leu Arg Glu Ile 705 710 715 720 Leu Asp Leu Arg Phe Ser Gly Gly Pro
Pro Arg Ala Ser Gln Pro Ser 725 730 735 Gly Arg Leu Gln Ala Asn Gln
Ser Leu Asn Arg Met Asp Asn Ser Gln 740 745 750 His Pro Gln Pro Ala
Asp Ser Arg Gln Thr Gly Ser Ser Lys Ala Leu 755 760 765 Ala Gln Thr
Leu Pro Pro Pro Thr Ala Ala Gly Glu Ser Asn Ser Val 770 775 780 Thr
Cys Asn Cys Gly Gln Glu Ala Val Leu Leu Thr Val Arg Lys Glu 785 790
795 800 Gly Pro Asn Arg Gly Arg Gln Phe Phe Lys Cys Asn Gly Gly Ser
Cys 805 810 815 Asn Phe Phe Leu Trp Ala Asp Ser Pro Asn Pro Gly Ala
Gly Gly Pro 820 825 830 Pro Ala Leu Ala Tyr Arg Pro Leu Gly Ala Ser
Leu Gly Cys Pro Pro 835 840 845 Gly Pro Gly Ile His Leu Gly Gly Phe
Gly Asn Pro Gly Asp Gly Ser 850 855 860 Gly Ser Gly Thr Ser Cys Leu
Cys Ser Gln Pro Ser Val Thr Arg Thr 865 870 875 880 Val Gln Lys Asp
Gly Pro Asn Lys Gly Arg Gln Phe His Thr Cys Ala 885 890 895 Lys Pro
Arg Glu Gln Gln Cys Gly Phe Phe Gln Trp Val Asp Glu Asn 900 905 910
Thr Ala Pro Gly Thr Ser Gly Ala Pro Ser Trp Thr Gly Asp Arg Gly 915
920 925 Arg Thr Leu Glu Ser Glu Ala Arg Ser Lys Arg Pro Arg Ala Ser
Ser 930 935 940 Ser Asp Met Gly Ser Thr Ala Lys Lys Pro Arg Lys Cys
Ser Leu Cys 945 950 955 960 His Gln Pro Gly His Thr Arg Pro Phe Cys
Pro Gln Asn Arg 965 970 3 1233 DNA Homo sapiens 3 catttgttag
tagccactcc aggacgtcta gtggatatga tggaaagagg aaagattgga 60
ttagactttt gcaaatactt ggtgttagat gaagctgatc ggatgttgga tatggggttt
120 gagcctcaga ttcgtagaat agtcgaacaa gatactatgc ctccaaaggg
tgtccgccac 180 actatgatgt ttagtgctac ttttcctaag gaaatacaga
tgctggctcg tgatttctta 240 gatgaatata tcttcttggc tgtaggaaga
gttggctcta cctctgaaaa catcacacag 300 aaagtagttt gggtggaaga
atcagacaaa cggtcatttc tgcttgacct cctaaatgca 360 acaggcaagg
attcactgac cttagtgttt gtggagacca aaaagggtgc agattctctg 420
gaggatttct tataccatga aggatacgca tgtaccagca tccatggaga ccgttctcag
480 agggatagag aagaggccct tcaccagttc cgctcaggaa aaagcccaat
tttagtggct 540 acagcagtag cagcaagagg actggacatt tcaaatgtga
aacatgttat caattttgac 600 ttgccaagtg atattgaaga atatgtacat
cgtattggtc gtacgggacg tgtaggaaac 660 cttggcctgg caacctcatt
ctttaacgag aggaacataa atattactaa ggatttgttg 720 gatcttcttg
ttgaagctaa acaagaagtg ccgtcttggt tagaaaacat ggcttatgaa 780
caccactaca agggtagcag tcgtggacgt tctaagagca gatttagtgg agggtttggt
840 gccagagact accgacaaag tagcggtgcc agcagttcca gcttcagcag
cagccgcgca 900 agcagcagcc gcagtggcgg aggtggccac ggtagcagca
gaggatttgg tggaggtggc 960 tatggaggct tttacaacag tgatggatat
ggaggaaatt ataactccca gggggttgac 1020 tggtggggta actgagcctg
ctttgcagta ggtcaccctg ccaaacaagc taatatggaa 1080 accacatgta
acttagccag actatacctt gtgtagcttc aagaactcgc agtacattac 1140
cagctgtgat tctccactga aatttttttt ttaagggagc tcaaggtcac aagaagaaat
1200 gaaaggaaca atcagcagcc ctgttcagaa gga 1233 4 344 PRT Homo
sapiens 4 His Leu Leu Val Ala Thr Pro Gly Arg Leu Val Asp Met Met
Glu Arg 1 5 10 15 Gly Lys Ile Gly Leu Asp Phe Cys Lys Tyr Leu Val
Leu Asp Glu Ala 20 25 30 Asp Arg Met Leu Asp Met Gly Phe Glu Pro
Gln Ile Arg Arg Ile Val 35 40 45 Glu Gln Asp Thr Met Pro Pro Lys
Gly Val Arg His Thr Met Met Phe 50 55 60 Ser Ala Thr Phe Pro Lys
Glu Ile Gln Met Leu Ala Arg Asp Phe Leu 65 70 75 80 Asp Glu Tyr Ile
Phe Leu Ala Val Gly Arg Val Gly Ser Thr Ser Glu 85 90 95 Asn Ile
Thr Gln Lys Val Val Trp Val Glu Glu Ser Asp Lys Arg Ser 100 105 110
Phe Leu Leu Asp Leu Leu Asn Ala Thr Gly Lys Asp Ser Leu Thr Leu 115
120 125 Val Phe Val Glu Thr Lys Lys Gly Ala Asp Ser Leu Glu Asp Phe
Leu 130 135 140 Tyr His Glu Gly Tyr Ala Cys Thr Ser Ile His Gly Asp
Arg Ser Gln 145 150 155 160 Arg Asp Arg Glu Glu Ala Leu His Gln Phe
Arg Ser Gly Lys Ser Pro 165 170 175 Ile Leu Val Ala Thr Ala Val Ala
Ala Arg Gly Leu Asp Ile Ser Asn 180 185 190 Val Lys His Val Ile Asn
Phe Asp Leu Pro Ser Asp Ile Glu Glu Tyr 195 200 205 Val His Arg Ile
Gly Arg Thr Gly Arg Val Gly Asn Leu Gly Leu Ala 210 215 220 Thr Ser
Phe Phe Asn Glu Arg Asn Ile Asn Ile Thr Lys Asp Leu Leu 225 230 235
240 Asp Leu Leu Val Glu Ala Lys Gln Glu Val Pro Ser Trp Leu Glu Asn
245 250 255 Met Ala Tyr Glu His His Tyr Lys Gly Ser Ser Arg Gly Arg
Ser Lys 260 265 270 Ser Arg Phe Ser Gly Gly Phe Gly Ala Arg Asp Tyr
Arg Gln Ser Ser 275 280 285 Gly Ala Ser Ser Ser Ser Phe Ser Ser Ser
Arg Ala Ser Ser Ser Arg 290 295 300 Ser Gly Gly Gly Gly His Gly Ser
Ser Arg Gly Phe Gly Gly Gly Gly 305 310 315 320 Tyr Gly Gly Phe Tyr
Asn Ser Asp Gly Tyr Gly Gly Asn Tyr Asn Ser 325 330 335 Gln Gly Val
Asp Trp Trp Gly Asn 340 5 5321 DNA Homo sapiens 5 tttcccctta
ctccgctccc ctcttttccc tccctctcct ccccttccct ctgttctctc 60
ctcctcttcc cctcccctcc cccgtccggg gcactctata ttcaagccac cgtttcctgc
120 ttcacaaaat ggccaccgca cgcgacacct acggtcacgt ggcctgccgc
cctctcagtt 180 tcgggaatct gcctagctcc cactaagggg aggctacccg
cggaagagcg agggcagatt 240 agaccggaga aatcccacca catctccaag
cccgggaact gagagaggaa gaagagtgaa 300 ggccagtgtt aggaaaaaaa
aaaacaaaaa caaaaaaaac gaaaaacgaa agctgagtgc 360 atagagttgg
aaaggggagc gaatgcgtaa ggttggaaag gggggcgaag aggcctaggt 420
taacattttc aggcgtctta gccggtggaa agcgggagac gcaagttctc gcgagatctc
480 gagaactccg aggctgagac tagggtttta gcggagagca cgggaagtgt
agctcgagag 540 aactgggaca gcatttcgca ccctaagctc caaggcagga
ctgctagggg cgacaggact 600 aagtaggaaa tcccttgagc ttagacctga
gggagcgcgc agtagccggg cagaagtcgc 660 cgcgacaggg aattgcggtg
tgagagggag ggcacacgtt gtacgtgctg acgtagccgg 720 ctttccagcg
ggtatattag atccgtggcc gcgcggtgcg ctccagagcc gcagttctcc 780
cgtgagaggg ccttcgcggt ggaacaaaca ctcgcttagc agcggaagac tccgagttct
840 cggtactctt cagggatgag tcatgtggca gtggaaaatg cgctcgggct
ggaccagcag 900 tttgctggcc tagacctgaa ctcttcagat aatcagagtg
gaggaagtac agccagcaaa 960 gggcgctata ttcctcctca tttaaggaac
cgagaagcta ctagaggttt ctacgataaa 1020 gacagttcag ggtggagttc
tagcaaagat aaggatgcgt atagcagttt tggatctcgt 1080 agtgattcaa
gagggaagtc tagcttcttc agtgatcgtg gaagtggatc aaggggaagg 1140
tttgatgatc gtggacggag tgattacgat ggcattggca gccgtggtga cagaagtggc
1200 tttggcaaat ttgaacgtgg tggaaacagt cgctggtgtg acaaatcaga
tgaagatgat 1260 tggtcaaaac cactcccacc aagtgaacgc ttggaacagg
aactcttttc tggaggcaac 1320 actgggatta attttgagaa atacgatgac
attccagttg aggcaacagg caacaactgt 1380 cctccacata ttgaaagttt
cagtgatgtt gagatgggag aaattatcat gggaaacatt 1440 gagcttactc
gttatactcg cccaactcca gtgcaaaagc atgctattcc tattatcaaa 1500
gagaaaagag acttgatggc ttgtgcccaa acagggtctg gaaaaactgc agcatttctg
1560 ttgcccatct tgagtcagat ttattcagat ggtccaggcg aggctttgag
ggccatgaag 1620 gaaaatggaa ggtatgggcg ccgcaaacaa tacccaatct
ccttggtatt agcaccaacg 1680 agagagttgg cagtacagat ctacgaagaa
gccagaaaat tttcataccg atctagagtt 1740 cgtccttgcg tggtttatgg
tggtgccgat attggtcagc agattcgaga cttggaacgt 1800 ggatgccatt
tgttagtagc cactccagga cgtctagtgg atatgatgga aagaggaaag 1860
attggattag acttttgcaa atacttggtg ttagatgaag ctgatcggat gttggatatg
1920 gggtttgagc ctcagattcg tagaatagtc gaacaagata ctatgcctcc
aaagggtgtc 1980 cgccacacta tgatgtttag tgctactttt cctaaggaaa
tacagatgct ggctcgtgat 2040 ttcttagatg aatatatctt cttggctgta
ggaagagttg gctctacctc tgaaaacatc 2100 acacagaaag tagtttgggt
ggaagaatca gacaaacggt catttctgct tgacctccta 2160 aatgcaacag
gcaaggattc actgacctta gtgtttgtgg agaccaaaaa gggtgcagat 2220
tctctggagg atttcttata ccatgaagga tacgcatgta ccagcatcca tggagaccgt
2280 tctcagaggg atagagaaga ggcccttcac cagttccgct caggaaaaag
cccaatttta 2340 gtggctacag cagtagcagc aagaggactg gacatttcaa
atgtgaaaca tgttatcaat 2400 tttgacttgc caagtgatat tgaagaatat
gtacatcgta ttggtcgtac gggacgtgta 2460 ggaaaccttg gcctggcaac
ctcattcttt aacgagagga acataaatat tactaaggat 2520 ttgttggatc
ttcttgttga agctaaacaa gaagtgccgt cttggttaga aaacatggct 2580
tatgaacacc
actacaaggg tagcagtcgt ggacgttcta agagtagcag atttagtgga 2640
gggtttggtg ccagagacta ccgacaaagt agcggtgcca gcagttccag cttcagcagc
2700 agccgcgcaa gcagcagccg cagtggcgga ggtggccacg gtagcagcag
aggatttggt 2760 ggaggtggct atggaggctt ttacaacagt gatggatatg
gaggaaatta taactcccag 2820 ggggttgact ggtggggtaa ctgagcctgc
tttgcagtag gtcaccctgc caaacaagct 2880 aatatggaaa ccacatgtaa
cttagccaga ctataccttg tgtagtttca agaactcgca 2940 gtacattacc
agctgtgatt ctccactgaa attttttttt taagggagct caaggtcaca 3000
agaagaaatg aaaggaacaa tcagcagccc tgttcagaag gtggtttgaa gacttcattg
3060 ctgtagtttg gattaactcc cctcccgcct acccccatcc caaactgcat
ttataatttt 3120 gtgactgagg atcatttgtt tgttaatgta ctgtgccttt
aactatagac aactttttat 3180 tttgatgtcc tgttggctca gtaatgctca
agatatcaat tgttttgaca aaataaattt 3240 actgaacttg ggctaaaatc
aaaccttggc acacaggtgt gatacaactt aacaggaatc 3300 atcgattcat
ccataaataa tataaggaaa aacttatgcg gtagcctgca ttagggcttt 3360
ttgatacttg cagattgggg gaaaacaaca aatgtcttga agcatattaa tggaattagt
3420 ttctaatgtg gcaaactgta ttaagttaaa gttctgattt gctcactcta
tcctggatag 3480 gtatttagaa cctgatagtc tttaagccat tccagtcatg
atgaggtgat gtatgaatac 3540 atgcatacat tcaaagcact gttttcaaag
ttaatgcaag taaatacagc aattcctctt 3600 tcaacgttta ggcagatcat
taattatgag ctagccaaat gtgggcatac tattacaggg 3660 aaagtttaaa
ggtctgataa cttgaaaata ggtttttagg agaattcatc tacttagact 3720
ttttaagtgc ctgccataaa tgaaattgaa atggtagaat ggctgaccac agcaatgacc
3780 agccctcatt agggccctgg atgatttttg gtctaataac gcatgctagt
gttgatgttt 3840 tttggtcaga gggtatgaac aggaagaatt aaatgcagca
ggctttattt taaatgccga 3900 ttcacattac tctgttcaag ctgcgttgag
atgttaaact ggcttactat agacttcgta 3960 aaaatggctc cagaaaagta
acaaactgaa atctttgaga tcacacaggt tggaaatatg 4020 tacataactg
cacaaggtgt caattctgct ctacagtgca gttttagtca gttttagttg 4080
cataggtttc cattgtattt atagtctgtt tatgctaaat ctggccaaag atgaacattg
4140 tccaccacta aaatgcctct gccactttga attctgtgct aattttgtgg
ccagaatgcg 4200 gtgatcaaaa cgctccatct ttttacagtg gcataggaag
acggcaaaaa tttcctaaag 4260 tgcaatagat tttcaagtgt attgtgcctt
gttctaaaac ttttattaag taggtgcact 4320 tgacagtatt gaggtcattt
gttatggtgc tatttcaatt agtctaggtt taggcccttg 4380 tacattttgc
ccataacttt ttacaaagta cttcttttat tgcacattca gagaatttta 4440
tatatatgtc ttgtgtgcgt gtccttaaac ttccaatctt actttgtctc ttggagattg
4500 ttgaacgcag cttgtctagg aaggggatgg gactagattc taaaatttat
ttgggaccat 4560 gggaatgata gttgggaaga aaactatttg cacacgacag
atttctagat actttttgct 4620 gctagcttta tgtaatattt attgaacatt
ttgacaaata tttatttttg taagcctaaa 4680 agtgattctt tgaaagttta
aagaaacttg accaaaagac agtacaaaaa cactggcact 4740 tgaatgttga
atgtcaccgt atgcgtgaaa ttatatattt cggggtagtg tgagctttta 4800
atgtttaagt catattaaac tcttaagtca aattaagcag acccggcgtt ggcagtgtag
4860 ccataacttt ctgatgttag taaaaacaaa attggcgact tgaaattaaa
ttatgccaag 4920 gttttgatac acttgtctta agatattaat gaaacacttc
aaaacactga tgtgaagtgt 4980 ccagattctc agatgtttgt tgtgtggatt
ttgtttagtt gtgtgttttt ttttttttca 5040 gtgaatgtct ggcacattgc
aatcctcaaa catgtggtta tctttgttgt attggcataa 5100 tcagtgactt
gtacattcag caatagcatt tgagcaagtt ttatcagcaa gcaatatttt 5160
cagttaataa ggtttcaaaa atcatgtaag gatttaaact tgctgaatgt aaagattgaa
5220 cctcaagtca ctgtagcttt agtaattgct tattgtatta gtttagatgc
tagcactgca 5280 tgtgctgtgc atattctgat tttattaaaa taaaaaaaaa a 5321
6 662 PRT Homo sapiens 6 Met Ser His Val Ala Val Glu Asn Ala Leu
Gly Leu Asp Gln Gln Phe 1 5 10 15 Ala Gly Leu Asp Leu Asn Ser Ser
Asp Asn Gln Ser Gly Gly Ser Thr 20 25 30 Ala Ser Lys Gly Arg Tyr
Ile Pro Pro His Leu Arg Asn Arg Glu Ala 35 40 45 Thr Arg Gly Phe
Tyr Asp Lys Asp Ser Ser Gly Trp Ser Ser Ser Lys 50 55 60 Asp Lys
Asp Ala Tyr Ser Ser Phe Gly Ser Arg Ser Asp Ser Arg Gly 65 70 75 80
Lys Ser Ser Phe Phe Ser Asp Arg Gly Ser Gly Ser Arg Gly Arg Phe 85
90 95 Asp Asp Arg Gly Arg Ser Asp Tyr Asp Gly Ile Gly Ser Arg Gly
Asp 100 105 110 Arg Ser Gly Phe Gly Lys Phe Glu Arg Gly Gly Asn Ser
Arg Trp Cys 115 120 125 Asp Lys Ser Asp Glu Asp Asp Trp Ser Lys Pro
Leu Pro Pro Ser Glu 130 135 140 Arg Leu Glu Gln Glu Leu Phe Ser Gly
Gly Asn Thr Gly Ile Asn Phe 145 150 155 160 Glu Lys Tyr Asp Asp Ile
Pro Val Glu Ala Thr Gly Asn Asn Cys Pro 165 170 175 Pro His Ile Glu
Ser Phe Ser Asp Val Glu Met Gly Glu Ile Ile Met 180 185 190 Gly Asn
Ile Glu Leu Thr Arg Tyr Thr Arg Pro Thr Pro Val Gln Lys 195 200 205
His Ala Ile Pro Ile Ile Lys Glu Lys Arg Asp Leu Met Ala Cys Ala 210
215 220 Gln Thr Gly Ser Gly Lys Thr Ala Ala Phe Leu Leu Pro Ile Leu
Ser 225 230 235 240 Gln Ile Tyr Ser Asp Gly Pro Gly Glu Ala Leu Arg
Ala Met Lys Glu 245 250 255 Asn Gly Arg Tyr Gly Arg Arg Lys Gln Tyr
Pro Ile Ser Leu Val Leu 260 265 270 Ala Pro Thr Arg Glu Leu Ala Val
Gln Ile Tyr Glu Glu Ala Arg Lys 275 280 285 Phe Ser Tyr Arg Ser Arg
Val Arg Pro Cys Val Val Tyr Gly Gly Ala 290 295 300 Asp Ile Gly Gln
Gln Ile Arg Asp Leu Glu Arg Gly Cys His Leu Leu 305 310 315 320 Val
Ala Thr Pro Gly Arg Leu Val Asp Met Met Glu Arg Gly Lys Ile 325 330
335 Gly Leu Asp Phe Cys Lys Tyr Leu Val Leu Asp Glu Ala Asp Arg Met
340 345 350 Leu Asp Met Gly Phe Glu Pro Gln Ile Arg Arg Ile Val Glu
Gln Asp 355 360 365 Thr Met Pro Pro Lys Gly Val Arg His Thr Met Met
Phe Ser Ala Thr 370 375 380 Phe Pro Lys Glu Ile Gln Met Leu Ala Arg
Asp Phe Leu Asp Glu Tyr 385 390 395 400 Ile Phe Leu Ala Val Gly Arg
Val Gly Ser Thr Ser Glu Asn Ile Thr 405 410 415 Gln Lys Val Val Trp
Val Glu Glu Ser Asp Lys Arg Ser Phe Leu Leu 420 425 430 Asp Leu Leu
Asn Ala Thr Gly Lys Asp Ser Leu Thr Leu Val Phe Val 435 440 445 Glu
Thr Lys Lys Gly Ala Asp Ser Leu Glu Asp Phe Leu Tyr His Glu 450 455
460 Gly Tyr Ala Cys Thr Ser Ile His Gly Asp Arg Ser Gln Arg Asp Arg
465 470 475 480 Glu Glu Ala Leu His Gln Phe Arg Ser Gly Lys Ser Pro
Ile Leu Val 485 490 495 Ala Thr Ala Val Ala Ala Arg Gly Leu Asp Ile
Ser Asn Val Lys His 500 505 510 Val Ile Asn Phe Asp Leu Pro Ser Asp
Ile Glu Glu Tyr Val His Arg 515 520 525 Ile Gly Arg Thr Gly Arg Val
Gly Asn Leu Gly Leu Ala Thr Ser Phe 530 535 540 Phe Asn Glu Arg Asn
Ile Asn Ile Thr Lys Asp Leu Leu Asp Leu Leu 545 550 555 560 Val Glu
Ala Lys Gln Glu Val Pro Ser Trp Leu Glu Asn Met Ala Tyr 565 570 575
Glu His His Tyr Lys Gly Ser Ser Arg Gly Arg Ser Lys Ser Ser Arg 580
585 590 Phe Ser Gly Gly Phe Gly Ala Arg Asp Tyr Arg Gln Ser Ser Gly
Ala 595 600 605 Ser Ser Ser Ser Phe Ser Ser Ser Arg Ala Ser Ser Ser
Arg Ser Gly 610 615 620 Gly Gly Gly His Gly Ser Ser Arg Gly Phe Gly
Gly Gly Gly Tyr Gly 625 630 635 640 Gly Phe Tyr Asn Ser Asp Gly Tyr
Gly Gly Asn Tyr Asn Ser Gln Gly 645 650 655 Val Asp Trp Trp Gly Asn
660 7 29 DNA Artificial oligonucleotide pGBT9(+2) 7 tcgccggaat
tgaattcccg gggatccgt 29 8 24 DNA Artificial oligonucleotide pGBT9 8
tcgccggaat tcccggggat ccgt 24 9 20 DNA Artificial oligonucleotide
124 9 cgaggtctga ggatgatctt 20 10 20 DNA Artificial oligonucleotide
125 10 ctgagaaagt ggcgttctct 20 11 26 DNA Artificial
oligonucleotide Top3XhoI 11 aagttactcg agatggccct ccgagg 26 12 27
DNA Artificial oligonucleotide Top3Hind3 12 acgagcaagc ttctctaccc
taccctg 27 13 38 DNA Artificial oligonucleotide PCS1 13 aattgcgaat
tctcgagccc ggggatccgt cgactgca 38 14 30 DNA Artificial
oligonucleotide PCS2 14 gtcgcaggat ccccgggctc gagaattcgc 30 15 18
DNA Artificial oligonucleotide GALT4 15 ccactacaat ggatgatg 18
* * * * *