U.S. patent application number 10/703812 was filed with the patent office on 2004-08-05 for materials and methods for the efficient production of acetate and other products.
Invention is credited to Causey, Thomas B., Neal Ingram, Lonnie O?apos, Shanmugam, Keelnathan T., Zhou, Shengde.
Application Number | 20040152159 10/703812 |
Document ID | / |
Family ID | 32312800 |
Filed Date | 2004-08-05 |
United States Patent
Application |
20040152159 |
Kind Code |
A1 |
Causey, Thomas B. ; et
al. |
August 5, 2004 |
Materials and methods for the efficient production of acetate and
other products
Abstract
The subject invention provides materials and methods wherein
unique and advantageous combinations of gene mutations are used to
direct carbon flow from sugars to a single product. The techniques
of the subject invention can be used to obtain products from native
pathways as well as from recombinant pathways. In preferred
embodiments, the subject invention provides new materials and
methods for the efficient production of acetate and pyruvic
acid.
Inventors: |
Causey, Thomas B.;
(Gainesville, FL) ; Ingram, Lonnie O?apos;Neal;
(Gainesville, FL) ; Zhou, Shengde; (Gainesville,
FL) ; Shanmugam, Keelnathan T.; (Gainesville,
FL) |
Correspondence
Address: |
SALIWANCHIK LLOYD & SALIWANCHIK
A PROFESSIONAL ASSOCIATION
2421 N.W. 41ST STREET
SUITE A-1
GAINESVILLE
FL
326066669
|
Family ID: |
32312800 |
Appl. No.: |
10/703812 |
Filed: |
November 6, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60424372 |
Nov 6, 2002 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/252.3 |
Current CPC
Class: |
C12N 9/0008 20130101;
Y02E 50/17 20130101; C12N 9/14 20130101; C12N 9/0006 20130101; Y02E
50/10 20130101; C12P 7/54 20130101; C12P 7/40 20130101; C12N 9/001
20130101; C12N 9/1029 20130101 |
Class at
Publication: |
435/069.1 ;
435/252.3 |
International
Class: |
C12P 021/02; C12P
007/54; C12N 001/21 |
Goverment Interests
[0002] The subject invention was made with government support under
research projects supported by USDA/NRI, Grant No.
2001-35504-10669; USDA/IFAS, Grant No. 00-52104-9704; and USDOE
Grant No. FG02-96ER20222. The government has certain rights in this
invention.
Claims
We claim:
1. A method for enhancing the microbial production of a desired
product wherein said method comprises culturing a microbe having
one or more genetic modifications that reduce ATP, such that the
microbe's sugar metabolism is increased as is the rate of
production of the desired product.
2. The method, according to claim 1, wherein said modification(s)
decrease the amount of ATP produced during metabolism.
3. The method, according to claim 1, wherein said modification(s)
increase the rate of ATP consumption during metabolism.
4. The method, according to claim 1, wherein said modification(s)
decrease the amount of ATP produced during metabolism and increase
the rate of ATP consumption during metabolism.
5. The method, according to claim 1, wherein said genetic
modification(s) result in the elimination or substantial reduction
of ATP production by oxidative phosphorylation.
6. The method, according to claim 4, wherein there is a retention
of cytoplasmic F.sub.i-ATP synthase for consumption of ATP.
7. The method, according to claim 1, wherein said microbe comprises
genetic modifications that inactivate oxidative phosphorylation,
disrupt the cyclic function of the tricarboxylic acid cycle, and
eliminate one or more fermentation pathways.
8. The method, according to claim 1, wherein the microbe is a
derivative of E. coli that comprises one or more chromosomal
deletions selected from the group consisting of focA-pflB; frdBC;
ldhA; atpFH; sucA and adhE.
9. The method, according to claim 1, which comprises introducing
into said microbe, one or more mutations into chromosomal genes
thereby inactivating one or more pathways selected from the group
consisting of lactate dehydrogenase, pyruvate formatelyase,
fumarate reductase, ATP synthase, alcohol/aldehyde dehydrogenase,
and 2-ketoglutarate dehydrogenase.
10. The method, according to claim 1, wherein the desired product
is selected from the group consisting of acetic acid;
1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids;
adipic acid; amino acids; and alcohols.
11. The method, according to claim 10, wherein said product is
acetic acid.
12. The method, according to claim 10, wherein said product is
pyruvic acid.
13. The method, according to claim 10, wherein said amino acid is
selected from the group consisting of aliphatic and aromatic amino
acids.
14. The method, according to claim 10, wherein said alcohol is
selected from the group consisting of ethanol, butanol, isopropanol
and propanol.
15. The method, according to claim 1, wherein said microbe is an E.
coli.
16. The method, according to claim 1, wherein said microbe is
selected from the group consisting of TC36, TC24, TC44, and
SZ47.
17. The method, according to claim 16, wherein said microbe is
TC36.
18. The method, according to claim 16, wherein said microbe is
TC44.
19. The method, according to claim 1, wherein the desired product
is produced via a natural pathway.
20. The method, according to claim 1, wherein the desired product
is produced via a recombinant pathway.
21. The method, according to claim 1, wherein said microbe is
devoid of plasmids and antibiotic resistance genes.
22. The method, according to claim 1, wherein said method comprises
a two-step batch feeding strategy wherein a second addition of
glucose follows the end of an initial growth phase.
23. The method, according to claim 22, wherein said method further
comprises a nitrogen limitation.
24. A biocatalyst for acetate production wherein said biocatalyst
is TC36.
25. A biocatalyst for pyruvate production wherein said biocatalyst
is TC44.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application Serial No. 60/424,372, filed Nov. 6, 2002.
BACKGROUND OF INVENTION
[0003] Recent trends toward the production of "green" chemicals
will require development of innovative synthesis techniques that
are highly efficient and cost effective.
[0004] Throughout the past decade, a number of traditional chemical
companies in the United States and Europe have begun to develop
infrastructures for the production of compounds using biocatalytic
processes. Considerable progress has been reported toward new
processes for commodity chemicals such as ethanol (Ingram, L. O.,
H. C. Aldrich, A. C. C. Borges, T. B. Causey, A. Martinez, F.
Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J.
Zaldivar, and S. Zhou, 1999 "Enteric bacterial catalyst for fuel
ethanol production" Biotechnol. Prog. 15:855-866; Underwood, S. A.,
S. Zhou, T. B. Causey, L. P. Yomano, K. T. Shanmugam, and L. O.
Ingram, 2002 "Genetic changes to optimize carbon partitioning
between ethanol and biosynthesis in ethanologenic Escherichia
coli." Appl. Environ. Microbiol. 68:6263-6272), lactic acid (Zhou,
S., T. B. Causey, A. Hasona, K. T. Shanmugam and L. O. Ingram, 2003
"Production of optically pure D-lactic acid in mineral salts medium
by metabolically engineered Escherichia coli W3110" Appl. Environ.
Microbiol. 69:399-407; Chang, D., S. Shin, J. Rhee, and J. Pan,
1999 "Homofermentative production of D- or L-lactate in
metabolically engineered Escherichia coli RR1" Appl. Environ.
Microbiol. 65:1384-1389; Dien, B. S., N. N. Nichols, and R. J.
Bothast, 2001 "Recombinant Escherichia coli engineered for the
production of L-lactic acid from hexose and pentose sugars" J. Ind.
Microbiol. Biotechnol. 27:259-264), 1,3-propanediol (Nakamura, U.S.
Pat. No. 6,013,494; Tong, I., H. H. Liao, and D. C. Cameron, 1991
"1,3-propanediol production by Escherichia coli expressing genes
from the Klebsiella-pneumoniae-DHA regulon" App. Env. Microbiol.
57:3541-3546), and adipic acid (Niu, W., K. M. Draths, and J. W.
Frost, 2002 "Benzene-free synthesis of adipic acid" Biotechnol.
Prog. 18:201-211).
[0005] In addition, advances have been made in the genetic
engineering of microbes for higher value specialty compounds such
as acetate, polyketides (Beck, B. J., C. C. Aldrich, R. A. Fecik,
K. A. Reynolds, and D. H. Sherman, 2003 "Iterative chain elongation
by a pikromycin monomodular polyketide synthase" J. Am. Chem. Soc.
125:4682-4683; Dayem, L. C., J. R. Carney, D. V. Santi, B. A.
Pfeifer, C. Khosla, and J. T. Kealey, 2002 "Metabolic engineering
of a methylmalonyl-CoA mutase--epimerase pathway for complex
polyketide biosynthesis in Escherichia coli." Biochem.
41:5193-5201) and carotenoids (Wang, Chia-wei, Min-Kyu Oh, J. C.
Liao, 2000 "Directed evolution of metabolically engineered
Escherichia coli for carotenoid production" Biotechnol. Prog.
16:922-926).
[0006] Acetic acid, a widely used specialty chemical in the food
industry, has recently emerged as a potential bulk chemical for the
production of plastics and solvents. Acetic acid has been produced
using microbial systems; however, the production of acetic acid in
microbial systems competes with the production of CO.sub.2 and cell
mass. Thus, while efficient acetate-producing microbial systems are
important for industrial uses, the systems must have an increased
output of acetate with a decreased input of expensive microbial
nutrients.
[0007] The biological production of acetic acid has been largely
displaced by petrochemical routes as the uses for this commodity
chemical have expanded from food products to plastics, solvents,
and road de-icers (Freer, S. N., 2002 "Acetic acid production by
Dekkera/Brettanomyces yeasts" World J. Microbiol. Biotechnol.
18:271-275). In 2001, the world production of acetic acid reached
an estimated 6.8 million metric tons, half of which was produced in
the United States.
[0008] Previously, three microbial approaches have been explored
for acetic acid production. In the two-step commercial process,
sugars are fermented to ethanol by Saccharomyces yeast. Then, the
resulting beers are oxidized to acetic acid by Acetobacter under
aerobic conditions (Berraud, C., 2000 "Production of highly
concentrated vinegar in fed-batch culture" Biotechnol. Lett.
22:451-454; Cheryan, M., S. Parekh, M. Shah, and K. Witjitra, 1997
"Production of acetic acid by Clostridium thermoaceticum" Adv.
Appl. Microbiol. 43:1-33). Using this process, acetic acid titres
of around 650 mM are typically produced; however, higher titres can
be readily achieved by the addition of complex nutrients in
fed-batch processes requiring 60-120 hours. Overall yields for this
commercial process have been estimated to be 76% of the theoretical
maximum (2 acetate per glucose; 0.67 g acetic acid per g
glucose).
[0009] Under a second approach, carbohydrates can be anaerobically
metabolized to acetic acid at substantially higher yields (3
acetates per glucose) by Clostridia that contain the Ljungdahl-Wood
pathway for acetogenesis (Berraud, C., 2000 "Production of highly
concentrated vinegar in fed-batch culture" Biotechnol. Lett.
22:451-454; Ljungdahl, L. G., 1986 "The autotrophic pathway of
acetate synthesis in acetogenic bacteria" Ann. Rev. Microbiol.
40:415-450). In particular, Clostridium thermoaceticum containing
the Ljungdahl-Wood pathway produces high yields of acetic acid
(Cheryan, M., S. Parekh, M. Shah, and K. Witjitra, 1997 "Production
of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol.
43:1-33).
[0010] Recently, Freer (Freer, S. N., 2002 "Acetic acid production
by Dekkera/Brettanomyces yeasts" World J. Microbiol. Biotechnol.
18:271-275) identified yeast strains (Dekkera and Brettanomyces)
that produce acetic acid as a primary product from glucose for
potential use in acetic acid production. All three of these current
microbial acetic acid production systems require complex nutrients,
which increase the cost of materials, acetate purification, and
waste disposal.
[0011] Escherichia coli is widely used as a biocatalyst for high
value products such as recombinant proteins (Akesson, M., P.
Hagander, and J. P. Axelsson, 2001 "Avoiding acetate accumulation
in Escherichia coli cultures using feedback control of glucose
feeding" Biotechnol. Bioeng. 73:223-230; Aristidou, A. A., K. San,
and G. N. Bennett, 1995 "Metabolic engineering of Escherichia coli
to enhance recombinant protein production through acetate
reduction" Biotechnol. Prog. 11:475-478; Contiero, J., C. Beatty,
S. Kumar, C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects
of mutations in acetate metabolism on high-cell-density growth of
Escherichia coli" J. Ind. Microbiol. 24:421-430; Luli, G. W. and R.
Strohl, 1990 "Comparison of growth, acetate production and acetate
inhibition of Escherichia coli strains in batch and fed-batch
fermentations" Appl. Environ. Microbiol. 56:1004-1011) and amino
acids (Chotani, G., T. Dodge, A. Hsu, M. Kumar, R. LaDuca, D.
Trimbur, W. Weyler, and K. Sanford, 2000 "The commercial production
of chemicals using pathway engineering" Biochem. Biophys. Acta
1543:434-455; Eggeling, L., W. Pfefferle, and H. Sahm, 2001 "Amino
acids," p. 281-304 in C. Ratledge and B. Kristiansen (ed.), Basic
Biotechnology, 2.sup.nd edition. Cambridge University Press.
Cambridge, U.K.).
[0012] Escherichia coli generate acetyl.about.CoA during
fermentative and oxidative metabolism, which the cell then uses to
produce small amounts of acetate (Akesson, M., P. Hagander, and J.
P. Axelsson, 2001 "Avoiding acetate accumulation in Escherichia
coli cultures using feedback control of glucose feeding"
Biotechnol. Bioeng. 73:223-230; Contiero, J., C. Beatty, S. Kumar,
C. L. DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of
mutations in acetate metabolism on high-cell-density growth of
Escherichia coli" J. Ind. Microbiol. 24:421-430).
[0013] Many E.coli strains grow well in simple mineral salts medium
and readily metabolize all of the hexose and pentose sugar
constituents of plant biomass (Ingram, L. O., H. C. Aldrich, A. C.
C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A.
Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999
"Enteric bacterial catalyst for fuel ethanol production"
Biotechnol. Prog. 15:855-866). During aerobic and anaerobic
carbohydrate metabolism, acetate is typically produced as a minor
product. Recent successes have been reported in the engineering of
E.coli strains for commodity chemicals such as propanediol
(Nakamura, C. E., A. A. Gatenby, Hsu, A. K.-H., R. D. LaReau, S. L.
Haynie, M. Diaz-Torres, D. E. Trimbur, G. M. Whited, V. Nagarajan,
M. S. Payne, S. K. Picataggio, and R. V. Nair, 2000 "Method for the
production of 1,3-propanediol by recombinant microorganisms" U.S.
Pat. No. 6,013,494; Tong, I., H. H. Liao, and D. C. Cameron, 1991
"1,3-propanediol production by Escherichia coli expressing genes
from the Klebsiella-pneumoniae-DHA regulon" App. Env. Microbiol.
57:3541-3546), adipic acid (Niu, W., K. M. Draths, and J. W. Frost,
2002 "Benzene-free synthesis of adipic acid" Biotechnol. Prog.
18:201-211), lactic acid (Chang, D., S. Shin, J. Rhee, and J. Pan,
1999 "Homofermentative production of D- or L-lactate in
metabolically engineered Escherichia coli RR1" Appl. Environ.
Microbiol. 65:1384-1389; Dien, B. S., N. N. Nichols, and R. J.
Bothast, 2001 "Recombinant Escherichia coli engineered for the
production of L-lactic acid from hexose and pentose sugars" J. Ind.
Microbiol. Biotechnol. 27:259-264), succinic acid (Donnelly, M. I.,
C. Sanville-Millard, and R. Chatterjee, 1998 "Method for
construction of bacterial strains with increased succinic acid
production" U.S. Patent No. 6,159,738; Vemuri, G. N., M. A. Altman,
and E. Altman, 2002 "Effects of growth mode and pyruvate
carboxylase on succinic acid production by metabolically engineered
strains of Escherichia coli" J. Bacteriol. 68:1715-1727), and
ethanol (Ingram, L. O., H. C. Aldrich, A. C. C. Borges, T. B.
Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P.
Yomano, S. W. York, J. Zaldivar, and S. Zhou, 1999 "Enteric
bacterial catalyst for fuel ethanol production" Biotechnol. Prog.
15:855-866). In using these aerobic and anaerobic processes, the
resultant production of acetate by the native pathway
(phosphotransacetylase and acetate kinase) has generally been
regarded as an undesirable consequence of excessive glycolytic flux
(Akesson, M., P. Hagander, and J. P. Axelsson, 2001 "Avoiding
acetate accumulation in Escherichia coli cultures using feedback
control of glucose feeding" Biotechnol. Bioeng. 73:223-230;
Aristidou, A. A., K. San, and G. N. Bennett, 1995 "Metabolic
engineering of Escherichia coli to enhance recombinant protein
production through acetate reduction" Biotechnol. Prog. 11:475-478;
Contiero, J., C. Beatty, S. Kumar, C. L. DeSanti, W. R. Strohl, and
A. Wolfe, 2000 "Effects of mutations in acetate metabolism on
high-cell-density growth of Escherichia coli" J. Ind. Microbiol.
24:421-430; Farmer, W. R., and J. C. Liao, 1997 "Reduction of
aerobic acetate production by Escherichia coli 1997" Appl. Environ.
Microbiol 63:3205-3210).
[0014] Chao and Liao (Chao, Y., and J. C. Liao, 1994 "Metabolic
responses to substrate futile cycling in Escherichia coli" J. Biol.
Chem. 269:5122-5126) and Patnaik et al. (Patnaik, R., W. D. Roof,
R. F. Young, and J. C. Liao, 1992 "Stimulation of glucose
catabolism in Escherichia coli by a potential futile cycle" J.
Bacteriol. 174:7525-7532) demonstrated a 2-fold stimulation of
glycolytic flux in E. coli using plasmids to express genes that
created futile cycles to consume ATP.
[0015] Recently, Koebmann et al. (Koebmann, B. J., H. V.
Westerhoff, J. L. Snoep, D. Nilsson, and P. R. Jensen, 2002 "The
glycolytic flux in Escherichia coli is controlled by the demand for
ATP" J. Bacteriol. 184:3909-3916) independently concluded that
glycolytic flux is limited by ATP utilization during the oxidative
metabolism of glucose. In their studies, flux increased in a
dose-dependent manner with controlled expression of F.sub.1 ATPase
from a plasmid. Thus glycolytic flux appears to be regulated by the
economy of supply and demand as proposed by Hofmeyr and
Comish-Bowden (Hofmeyer, J.-H. S., and A. Comish-Bowden, 2000
"Regulating the cellular economy of supply and demand" FEBS Lett.
467:47-51).
[0016] Currently, only the two-part commercial process, the
Ljungdahl-Wood pathway-containing Clostridia, as well as special
yeast strains have been investigated as potential biocatalysts for
the production of acetate. Due to the competing production of
dicarboxylic acids and cell mass from glucose, the level of acetate
production using these methods has been relatively low. Indeed,
none of these methods have been reported to grow and produce
acetate efficiently in mineral salts media containing sugar. In
fact, each of these methods requires the use of complex nutrients,
which ultimately increases the cost of materials, acetate
purification, and waste disposal. Therefore, a need remains for
better biocatalysts that efficiently produce acetate and other
fermentation products using a mineral salts medium.
[0017] Pyruvic acid is currently manufactured for use as a food
additive, nutriceutical, and weight control supplement (Li, Y., J.
Chen, and S.-Y. Lun, 2001 "Biotechnological production of pyruvic
acid" Appl. Microbiol. Biotechnol. 57:451-459). Pyruvic acid can
also be used as a starting material for the synthesis of amino
acids such as alanine, tyrosine, phenylalanine, and tryptophan and
for acetaldehyde production.
[0018] Pyruvate is produced commercially by both chemical and
microbial processes. Chemical synthesis involves the
decarboxylation and dehydration of calcium tartrate, a by-product
of the wine industry. This process involves toxic solvents and is
energy intensive with an estimated production cost of $8,650 per
ton of pyruvate. Microbial pyruvate production is based primarily
on two microorganisms, a multi-vitamin auxotroph of the yeast
Torulopsis glabrata (Li, Y., J. Chen, and S.-Y. Lun, and X. S. Rui,
2001 "Efficient pyruvate production by a multi-vitamin auxotroph of
Torulopsis glabrata: key role and optimization of vitamin levels"
Appl. Microbiol. Biotechnol. 55:680-68) and a lipoic acid auxotroph
of Escherichia coli containing a mutation in the F.sub.1 ATPase
component of (F.sub.1F.sub.0)H.sup.+-ATP synthase (Yokota, A., Y.
Terasawa, N. Takaoka, H. Shimizu, and F. Tomita, 1994 "Pyruvic acid
production by an F.sub.1-ATPase-defective mutant of Escherichia
coli W1485lip2" Biosci. Biotech. Biochem. 58:2164-2167). Both of
these production strains require precise regulation of media
composition during fermentation and complex supplements. The
estimated production costs of pyruvate production by microbial
fermentation with these strains is estimated to be 14.5% ($1,255
per ton pyruvate) of that for chemical synthesis.
[0019] Recently, Tomar et al. (Tomar, A., M. A. Eiteman, and E.
Altman, 2003 "The. effect of acetate pathway mutations on the
production of pyruvate in Escherichia coli." Appl. Microbiol.
Biotechnol. 62:76-82.2003) have described a new mutant strain of E.
coli for pyruvate production. This strain contains three mutations,
ppc (phosphoenolpyruvate carboxylase), aceF (pyruvate
dehydrogenase), and adhE (alcohol dehydrogenase) and is capable of
producing 0.65 grams pyruvate per gram of glucose using complex
media supplemented with acetate.
[0020] Typical production rates of pyruvate for biocatalysts are
around 1 g L.sup.-1 h.sup.-1 with yields exceeding half the weight
of substrate. Torulopsis glabrata, the yeast strain currently used
for the commercial production of pyruvate, can achieve pyruvate
titers of 69 g L.sup.-1. As noted above, T. glabrata strains used
in the commercial process are multivitamin auxotrophs requiring
tight regulation of vitamin concentrations which result in complex
vitamin feeding strategies during fermentation (Li, Y., J. Chen,
and S.-Y. Lun, 2001 "Biotechnological production of pyruvic acid"
Appl. Microbiol. Biotechnol. 57:451-459). Previous E. coli strains
constructed for pyruvate production were cultured in complex media
and have been plagued by low titers and yields (Tomar, A. et al.
2003, "The effect of acetate pathway mutations on the production of
pyruvate in Escherichia coli." Appl. Microbiol. Biotechnol.
62:76-82; Yokota A. et al., 1994 "Pyruvic acid production by an
F.sub.1-ATPase-defective mutant of Escherichia coli W1485lip2."
Biosci. Biotech. Biochem. 58:2164-6167).
[0021] Nutrients in culture medium often represent a major cost
associated with commercial fermentations. The use of a mineral
salts medium and inexpensive carbon source offers the potential to
improve the economics of many biological processes by reducing the
costs of materials, product purification, and waste disposal
(Zhang, J. and R. Greasham, 1999. Appl. Microbiol. Biotechnol.
51:407-421).
[0022] There is a need in the art to identify and develop new,
efficient, and environmentally friendly processes for producing
specialty compounds.
BRIEF SUMMARY
[0023] The subject invention provides materials and methods wherein
unique and advantageous combinations of gene mutations are used to
direct carbon flow from sugars to a desired product. The techniques
of the subject invention can be used to obtain products from native
pathways as well as from recombinant pathways.
[0024] The materials and methods of the subject invention can be
used to produce a variety of products with only mineral salts and
sugar as nutrients. Useful products include pure acetic acid;
1,3-propanediol; 2,3-propanediol; pyruvate; dicarboxylic acids;
adipic acid; amino acids, including aliphatic and aromatic amino
acids; and alcohols including ethanol, butanol, isopropanol, and
propanol. In preferred embodiments, the subject invention provides
new materials and methods for the efficient production of acetate.
In further preferred embodiments, the subject invention provides
advantageous biocatalysts for acetate production and for pyruvate
production.
[0025] In a specific embodiment, the subject invention provides a
recombinant derivative of Escherichia coli W3110 that contains six
chromosomal deletions (focA-pflB frdBC ldhA atpFH sucA adhE). The
resulting strain (TC36) exhibits approximately a 2-fold increase in
maximal rates of acetate production (specific and volumetric) over
W3110. This increase can be attributed to the mutation in the
(F.sub.1F.sub.0)H.sup.+-ATP synthase, which eliminates ATP
production by oxidative phosphorylation while retaining cytoplasmic
F.sub.1-ATP synthase for the gratuitous consumption of ATP.
[0026] TC36 produces acetic acid in mineral salts medium containing
glucose with a yield of 68% of the maximum theoretical yield using
native pathways (two acetates per glucose). Advantageously, TC36 is
devoid of plasmids and antibiotic resistance genes.
[0027] Further embodiments of the subject invention provide
additional derivatives of Escherichia coli W3110 as new
biocatalysts for the production of homo-acetate. In one embodiment,
homo-acetate production by the new strain, TC36, approaches the
theoretical maximum of two acetates per glucose. Eliminating the
fermentation pathways of W3110 resulted in the new strain SZ47 and
doubled the loss of carbon as volatile products. While the rate of
acetate production decreased in SZ47 as compared to W3110, the cell
yield increased. The inactivation of oxidative phosphorylation
(.DELTA.atpFH) in SZ47 to produce TC24 resulted in a 5-fold
increase in acetate yield and a 3-fold improvement in carbon
recovery.
[0028] In accordance with the subject invention, competing pathways
are eliminated by chromosomal inactivation of genes encoding
lactate dehydrogenase, pyruvate formatelyase, and fumarate
reductase (.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA),
(F.sub.1F.sub.0)H.sup.+-ATP synthase (atpFH), alcohol/aldehyde
dehydrogenase (adhE), and 2-ketoglutarate dehydrogenase (sucA),
which increases the production of acetate.
[0029] Using a simple two-step batch feeding strategy can increase
acetate production. Specifically, a second addition of 3% glucose
added at the end of the growth phase (12 h) and metabolized to
completion results in 78% of the theoretical maximum. A further
increase in acetate production can be obtained by combining the
two-step batch feeding strategy with a nitrogen limitation, which
results in 86% of the theoretical maximum.
[0030] The subject invention provides a method to reduce the loss
of substrate carbon into cell mass and/or into carbon dioxide.
Also, the subject invention provides a method to reduce oxygen
demand during bioconversion process.
[0031] The use of mineral salts medium, lack of antibiotic
resistance genes or plasmids, high yield of homo-acetate, and high
product purity achieved according to the subject invention are
advantageous because of reduced costs associated with nutrients,
purification, containment, BOD, and waste treatment.
[0032] In an alternative embodiment, the subject invention provides
a new biocatalyst for the efficient production of pyruvate from
glucose that requires only simple mineral salts as nutrients.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIG. 1 Diagram summarizing genetic modifications used to
redirect glucose metabolism to acetate. Bold arrows mark principle
metabolic routes in TC36. Reactions which have been blocked by gene
deletions in TC36 are marked with solid circles. Genes encoding
enzymes are shown in italics. A. Central carbon metabolism. Bold
arrows indicate the primary pathway for acetate production from
glucose in TC36. This strain produces a net of 4 ATP equivalents
(.about.P) per glucose molecule. B. Oxidative phosphorylation. The
ATPsynthase is inactive in TC36 although the electron transport
system remains functional as the primary route for NADH oxidation
in TC36 (bold arrows). C. F.sub.1-ATPase remains active in TC36 for
the regeneration of ADP but lacks subunits for membrane
assembly.
[0034] FIG. 2 Diagram summarizing plasmid constructions.
[0035] FIG. 3 Effects of selected mutations on growth (A), glucose
utilization (B), and base consumption (C). Symbols: .box-solid.,
W3110 (wild type); .quadrature., SZ47(.DELTA.(focA-pflB)::FRT
.DELTA.frdBC .DELTA.ldhA); .largecircle.,
TC24(.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT); .circle-solid., TC36 (succ.sup.+;
.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE: :FRT .DELTA.sucA::FRT).
[0036] FIG. 4 Effects of selected mutations on the production of
acetate (A), dicarboxylic acids (B), and pyruvate (C). Symbols:
.box-solid., W3110 (wild type); .quadrature.,
SZ47(.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA);
.largecircle., TC24(.DELTA.(focA-pflB)::FRT .DELTA.frdBC
.DELTA.ldhA .DELTA.atp(FH)::FRT); , TC36 (Succ.sup.+;
.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE::FRT .DELTA.sucA::FRT).
[0037] FIG. 5 Fermentation of 6% glucose to acetate by TC36 in
mineral salts medium. Fermentation was begun with 3% glucose
followed by a second addition of 3% glucose after 12 h. Symbols:
.quadrature., cell mass; .largecircle., glucose; .circle-solid.,
acetate.
[0038] FIG. 6 Summary of central metabolism in E. coli. A. Carbon
metabolism. B. Oxidative phosphorylation. C. Cytoplasmic
F.sub.1ATPase subunit (active).
[0039] FIG. 7 Effect of oxygen level on pyruvate production by
TC36. Cells were inoculated into fermentation broth at 100% air
saturation and continuously sparged with air until the oxygen
levels declined to 5% saturation. At this time, oxygen was blended
to maintain 5% saturation during the remaining period of incubation
(open symbols). Alternatively, media was sparged with a mixture of
air and nitrogen to provide 5% air saturation prior to inoculation
and sparging switched to air and oxygen as needed to maintain 5%
air saturation (closed symbols).
[0040] FIG. 8 Batch fermentation of glucose by mutant strains of E.
coli. A. Cell growth; B. Glucose utilization; C. Acetate
production; D. Pyruvate production.
BRIEF DESCRIPTION OF THE SEQUENCES
[0041] SEQ ID NO:1 is a sense primer used according to the subject
invention.
[0042] SEQ ID NO:2 is an antisense primer used according to the
subject invention.
DETAILED DISCLOSURE
[0043] The subject invention provides materials and methods wherein
unique and advantageous combinations of gene mutations are used to
direct carbon flow to a desired product. The techniques of the
subject invention can be used to obtain products from native
pathways as well as from recombinant pathways.
[0044] Advantageously, the subject invention provides a versatile
platform for the production of a variety of products with only
mineral salts and sugar as nutrients. Useful products include pure
acetic acid; 1,3-propanediol; 2,3-propanediol; pyruvate;
dicarboxylic acids; adipic acid; and amino acids, including
aliphatic and aromatic amino acids. In preferred embodiments, the
subject invention provides new materials and methods for the
efficient production of acetate.
[0045] In preferred embodiments, the subject invention provides
strains of E. coli (lacking plasmids and antibiotic resistance
genes) as biocatalysts for the production of chemically pure
acetate and/or pyruvate. Unlike other acetate-producing microbial
systems, the subject invention can employ a single step process
using sugars as substrates, high rates of acetate production
(almost two-fold higher), high acetate yields, simple nutrition
requirements (mineral salts medium), and a robust metabolism
permitting the bioconversion of hexoses, pentoses, and many
dissacharides.
[0046] Specifically exemplified herein is a new E. coli biocatalyst
containing six chromosomal deletions (.DELTA.focApflB .DELTA.frdCD
.DELTA.ldhA .DELTA.atpFH .DELTA.sucA .DELTA.adhE). The resulting
strain (TC36) contains no plasmids or antibiotic resistance genes
and produces high yields of acetate from glucose in a mineral salts
medium.
[0047] Further embodiments of the subject invention provide
additional derivatives of Escherichia coli W3110 as new
biocatalysts for the production of acetate. Eliminating the
fermentation pathways of W3110 resulted in the new strain SZ47 and
doubled the loss of carbon as volatile products. While the rate of
acetate production decreased in SZ47 as compared to W3110, the cell
yield increased. The inactivation of oxidative phosphorylation
(.DELTA.atpFH) in SZ47 to produce TC24 resulted in a 5-fold
increase in acetate yield and a 3-fold improvement in carbon
recovery. Homo-acetate production by the new strain, TC36,
approaches the theoretical maximum of two acetates per glucose.
[0048] The methods of the subject invention are particularly
advantageous because, in a preferred embodiment, deletions (rather
than mutations which simply change a sequence) are used to
inactivate pathways. Deletions provide maximum stability; with
deletions, there is no opportunity for a reverse mutation to
restore function. Please note, however, that as used herein,
"mutations" includes changes in sequence or deletions unless the
context clearly indicates otherwise. Such changes or deletions in
polynucleotide sequences are also referred to herein as genetic
"modifications."
[0049] For optimal acetate production in accordance with a specific
embodiment of the subject invention, deletions in W3110 that
inactivate oxidative phosphorylation (.DELTA.atpFH), disrupt the
cyclic function of the tricarboxylic acid cycle (.DELTA.sucA), and
eliminate all major fermentation pathways (.DELTA.focA-pflB,
.DELTA.frdBC, .DELTA.ldhA, .DELTA.adhE) are combined. One such
strain, TC36, metabolizes sugars to acetate with the efficiency of
fermentative metabolism, diverting a minimum of carbon to cell mass
(biocatalyst) and CO.sub.2, which results in extremely high product
yields.
[0050] For improved acetic acid yields, a simple two-step batch
feeding strategy can be used in which a second addition of 3%
glucose is added at the end of the growth phase (12 h). Further
improved acetic acid yields can be obtained by combining this
two-step batch feeding strategy with a nitrogen limitation.
[0051] Although production of homo-acetate using a recombinant gene
is specifically exemplified herein, those skilled in the art having
the benefit of the subject disclosure could utilize other genes
(single genes or combinations), to produce alternative oxidized or
reduced products.
[0052] The choice of genes for inactivation of competing
fermentation pathways, as described herein, is important to
maximize yield and minimize nutritional requirements. For example,
carbohydrates can be anaerobically metabolized to acetic acid at
substantially higher yields (3 acetates per glucose) by Clostridia
(anaerobic) that contain the Ljungdahl-Wood pathway for
acetogenesis (Berraud, C., 2000 "Production of highly concentrated
vinegar in fed-batch culture" Biotechnol. Lett. 22:451-454;
Ljungdahl, L. G., 1986, "The autotrophic pathway of acetate
synthesis in acetogenic bacteria" Ann. Rev. Microbiol. 40:415-450).
Specifically, Clostridium thermoaceticum containing the
Lungdahl-Wood pathway produce higher yields of acetate than TC36
(Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997 "Production
of acetic acid by Clostridium thermoaceticum" Adv. Appl. Microbiol.
43:1-33). As well, maximum titres with TC36 are lower than can be
achieved by ethanol oxidation using Acetobacter in the two-step
commercial process (Berraud, C., 2000 "Production of highly
concentrated vinegar in fed-batch culture" Biotechnol. Lett.
22:451-454). However, the specific gene deletions of TC36 lead to
acetate production rates almost two-fold higher than either of the
aforementioned processes and require only mineral salts as
nutrients.
[0053] E. coli TC36 offers a unique set of advantages over
currently employed biocatalysts for the commercial production of
acetate: a single step process using sugars as substrates, high
rates of acetate production, high acetate yields, simple nutrition
(mineral salts medium), and a robust metabolism permitting the
bioconversion of hexoses, pentoses, and many dissacharides.
[0054] In an alternative embodiment, the subject invention provides
a new biocatalyst for the efficient production of pyruvate from
glucose that requires only simple mineral salts as nutrients.
[0055] As discussed herein, in a preferred embodiment, the
materials and methods of the subject invention provide at least the
following advantages:
[0056] 1. The ability to convert hexose and pentose sugars to
acetate at very high carbon efficiency in mineral salts medium
without the addition of complex nutrients.
[0057] 2. The lack of plasmids, which may be lost during scale up.
This results in a simplified process at less cost.
[0058] 3. The absence of a need for antibiotic selection. This
provides cost and public health advantages.
[0059] 4. The absence of antibiotic resistance genes. This also
provides a public health advantage.
[0060] Production of Acetate
[0061] Genetically modified E. coli W3110 was developed to produce
acetic acid as the primary product from glucose during aerobic
growth using only mineral salts as nutrients. The resulting
biocatalyst (TC36) contains multiple chromosomal alterations (FIG.
1) that direct carbon flow to acetate and minimize carbon loss to
cell mass, CO.sub.2, and alternative products. Strain TC36 is
devoid of plasmids and antibiotic resistance genes, both potential
advantages for commercial use. The subject invention provides an
additional derivative of Escherichia coli W3110 as a new
biocatalyst for the production of homo-acetate. Acetate production
by this new strain (TC36) approaches the theoretical maximum of two
acetate per glucose due to the disruption of oxidative
phosphorylation.
[0062] Chromosomal deletions were used instead of point mutations
to maximize stability. All antibiotic resistance genes and
auxotrophic requirements were eliminated to permit growth in simple
mineral salts medium. During oxidative metabolism, up to half of
the substrate carbon can be converted to roughly equal amounts of
cell mass and CO.sub.2 (Contiero, J., C. Beatty, S. Kumar, C. L.
DeSanti, W. R. Strohl, and A. Wolfe, 2000 "Effects of mutations in
acetate metabolism on high-cell-density growth of Escherichia coli"
J. Ind. Microbiol. 24:421-430; Neidhardt, F. C., J. L. Ingraham,
and M. Schaechter, 1990 "Physiology of the bacterial cell: A
molecular approach" Sinauer Associates, Inc., Sunderland, Mass.;
Varma, A., B. W. Boesch, and B. O. Palsson, 1993 "Stoichiometric
interpretation of Escherichia coli glucose catabolism under various
oxygenation rates" Appl. Environ. Microbiol. 59:2465-2473) with
minimal carbon flow into alternative products, such as acetate.
[0063] To reduce the opportunity for excessive growth during
oxidative metabolism, ATP production from NADH oxidation (oxidative
phosphorylation) can be eliminated (or substantially reduced) by
deleting the portion of (F.sub.1F.sub.0)H.sup.+-ATP synthase
involved in membrane assembly while preserving a functional
cytoplasmic F.sub.1-ATPase to provide gratuitous hydrolysis of ATP.
With this mutation, a maximum of 4 ATP molecules (net) can be
produced per glucose (assumes all pyruvate is metablized to
acetyl.about.CoA and acetate) as compared to a theoretical maximum
of 33 ATP molecules for wild-type strains of E. coli. Substantial
reduction refers to a greater than 80% reduction.
[0064] Excessive oxidation of substrate to CO.sub.2 and NADH
production were eliminated by disrupting the cyclic function of the
tricarboxylic acid cycle (.DELTA.sucA) with the added benefit of
reducing oxygen demand for NADH oxidation. Additional mutations
were introduced to eliminate all major fermentation pathways as
alternative routes for NADH oxidation, minimizing the formation of
alternative products. The resulting strain, TC36, has absolute
requirements for substrate level phosphorylation and for an
external electron acceptor that can couple to the electron
transport system during growth in mineral salts medium to maintain
redox balance. With genetic blocks in all major fermentation
pathways and oxidative phosphorylation, this strain is relatively
insensitive to variations in dissolved oxygen.
[0065] The (F.sub.1F.sub.0)H.sup.+-ATP synthase and 2-ketoglutarate
dehydrogenase mutations introduced into TC36 to miminize the levels
of ATP and NAD(P)H from glucose under oxidative conditions would
also be expected to promote glycolysis through native allosteric
controls (Neidhardt, F. C., J. L. Ingraham, and M. Schaechter, 1990
"Physiology of the bacterial cell: A molecular approach" Sinauer
Associates, Inc., Sunderland, Mass.; Underwood, S. A., M. L.
Buszko, K. T. Shanmugam, and L. O. Ingram, 2002 "Flux through
citrate synthase limits the growth of ethanologenic Escherichia
coli KO11 during xylose fermentation" Appl. Environ. Microbiol.
68:1071-1081), providing a mechanism for the observed 2-fold
increase in glycolytic flux as compared to W3110 (wild type).
[0066] With additional mutations in fermentation pathways, further
metabolism of pyruvate was limited primarily to small biosynthetic
needs and conversion to acetyl.about.CoA by the pyruvate
dehydrogenase complex. Although pyruvate dehydrogenase is activated
by low NADH, acetyl.about.CoA production may be limited by the
availability of free CoA (note pyruvate accumulation in TC36 broth
between 9 h and 15 h; FIG. 4C). Resulting rises in pyruvate pools
would serve as an allosteric activator of phosphotransferase
(Suzuki, T., 1969 "Phosphotransacetylase of Escherichia coli B,
activation by pyruvate and inhibition by NADH and certain
nucleotides" Biochim. Biophys. Acta 191:559-569), the first
committed step for acetate production from acetyl.about.CoA.
Gratuitous ATP hydrolysis by F1-ATPase should ensure the
availability of ADP for the final step in acetate production
catalyzed by acetate kinase (FIG. 1). Excess pyruvate can also be
directly oxidized to acetate by pyruvate oxidase (poxB), an enzyme
that is induced during the latter stages of growth and by
environmental stress (Chang, Y.-Y., A.-Y. Wang, and J. E. Cronan,
Jr., 1994 "Expression of Escherichia coli pyruvate oxidase (PoxB)
depends on the sigma factor enocoded by the rpoS (katF) gene" Mol.
Microbiol. 11:1019-1028). This enzyme may also contribute to
acetate production by TC36.
[0067] Eliminating oxidative phosphorylation while preserving
F.sub.1 ATPase resulted in a 2-fold increase in glycolytic flux
(TC24 and TC36).
[0068] In a specific embodiment, the subject invention utilizes
strategies that delete subunits concerned with the membrane
assembly of the (F.sub.1F.sub.0)H.sup.+-ATP synthase, create futile
cycles for ATP consumption, or increase cytoplasmic levels of the
ATPase activities, to decrease cell yield, increase metabolic flux,
and increase product yield in bioconversion processes.
[0069] Strain TC36 can be used as a biocatalysis platform for the
efficient production of oxidized products. Under conditions of
glucose excess, strain TC36 produced a maximum of 878 mM acetate,
75% of the maximum theoretical yield or 0.50 g acetate per g
glucose. Only cell mass and small amounts of organic acids were
produced as co-products with acetate. It is likely that 878 mM
acetate approaches the upper limit of tolerance for the metabolism
in TC36. Concentrations as low as 50 mM acetate have been shown to
induce a stress response in E. coli (Kirkpatrick, C., L. M. Maurer,
N. E. Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski,
2001 "Acetate and formate stress: Opposite responses in the
proteomes of Escherichia coli" J. Bacteriol. 183:6466-6477). The
minimal inhibitory concentration for growth has been previously
reported as 300-400 mM acetate at neutral pH (Lasko, D. R., N.
Zamboni, and U. Sauer, 2000 "Bacterial response to acetate
challenge: a comparison of tolerance among species" Appl.
Microbiol. Biotechnol. 54:243-247; Zaldivar, J., and L. O. Ingram,
1999 "Effects of organic acids on the growth and fermentation of
ethanologenic Escherichia coli LY01" Biotechnol. Bioengin.
66:203-210).
[0070] Oxygen transfer often becomes limiting during aerobic
bioconversion processes, promoting the accumulation of reduced
products (Tsai, P. S., M. Nageli, and J. E. Bailey, 2002
"Intracellular expression of Vitreoscilla hemoglobin modifies
microaerobic Escherichia coli metabolism through elevated
concentration and specific activity of the cytochrome o"
Biotechnol. Bioeng. 79:558-567; Varma, A., B. W. Boesch, and B. O.
Palsson, 1993 "Stoichiometric interpretation of Escherichia coli
glucose catabolism under various oxygenation rates" Appl. Environ.
Microbiol. 59:2465-2473). Synthesis of reduced products was
eliminated by mutations in genes (.DELTA.focApflB .DELTA.frdCD
.DELTA.ldhA .DELTA.adhE) encoding the four major fermentation
pathways. Excessive oxygen demand and NADH production were also
reduced by a deletion in succinate dehydrogenase (sucA.DELTA.). The
resulting strain, TC36 (.DELTA.focApflB.DELTA.frdCD .DELTA.ldhA
.DELTA.atpFH .DELTA.sucA .DELTA.adhE) metabolizes sugars to acetate
with the efficiency of fermentative metabolism, diverting a minimum
of carbon to cell mass (biocatalyst) and CO.sub.2. By replacing the
acetate pathway, a variety of alternative oxidized products can be
produced using the mutational strategies employed for the
construction of TC36.
[0071] Genetically engineered E. coli TC36 can produce acetate in a
simpler, single step process using glucose and mineral salts with
titres and yields equivalent or higher than current batch
processes. Although yields for TC36 were lower than those reported
for Clostridium thermoaceticum which contain the Ljungdahl-Wood
Pathway (Cheryan, M., S. Parekh, M. Shah and K. Witjitra, 1997
"Production of acetic acid by Clostridium thermoaceticum" Adv.
Appl. Microbiol. 43:1-33) and maximum titres with TC36 are lower
than can be achieved by ethanol oxidation using Acetobacter
(Berraud, C., 2000 "Production of highly concentrated vinegar in
fed-batch culture" Biotechnol. Lett. 22:451-454), acetate
production rates by TC36 are almost two-fold higher than both and
required only mineral salts as nutrients.
[0072] E. coli TC36 offers a unique set of advantages over
currently employed biocatalysts for the commercial production of
acetate: a single step process using sugars as substrates, high
rates of acetate production, high acetate yields, simple nutrition
(mineral salts), and a robust metabolism permitting the
bioconversion of hexoses, pentoses, and many dissacharides.
Materials and Methods
[0073] Bacterial strains and plasmids. Selected E. coli strains and
plasmids are listed in Table 1.
1TABLE 1 Strains and plasmids. Strains & Plasmids Relevant
Characteristics Reference Strains W3110 wild type ATCC 27325
TOP10F' lacl.sup.q (episome) Invitrogen SE2279 MG1655, pflB
ldhA::Tn10 Laboratory collection (KTS) SZ33 W3110, ldhA::Tn10
Described herein SZ40 W3110, .DELTA.(focA-pflB)::FRT .DELTA.frdBC
Described herein SZ46 W3110, .DELTA.(focA-pflB)::FRT .DELTA.frdBC
Described herein ldhA::Tn10 SZ47 W3110, .DELTA.(focA-pflB)::FRT
.DELTA. Described herein frdBC .DELTA.ldhA TC20 W3110,
.DELTA.adhE:: Described herein FRT-tet-FRT TC21 W3110,
.DELTA.atpFH:: Described herein FRT-tet-FRT TC23 W3110,
.DELTA.(focA-pflB,):: Described herein FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT-tet-FRT TC24 W3110, .DELTA.(focA-pflB)::FRT
.DELTA. Described herein frdBC .DELTA.ldhA .DELTA.atp(FH)::FRT TC25
W3110, .DELTA.sucA::FRT-tet-FRT Described herein TC30 W3110,
.DELTA.(focA-pflB)::FRT .DELTA. Described herein frdBC .DELTA.ldhA
.DELTA.atp(FH):: FRT .DELTA.adhE::FRT-tet-FRT SE1706 .DELTA.frdBC
zid::Tn10 Footnote.sup.1 TC31 W3110, .DELTA.(focA-pflB)::FRT
.DELTA. Described herein frdBC .DELTA.ldhA .DELTA.atp(FH)::FRT
.DELTA.adhE::FRT TC32 W3110, (Succ.sup.-), .DELTA.(focA-pflB)::
Described herein FRT .DELTA.frdBC.DELTA.ldhA .DELTA.atp(FH):: FRT
.DELTA.adhE::FRT.DELTA.sucA::FRT- tet-FRT TC35 W3110, (Succ.sup.+),
.DELTA.(focA-pflB):: Described herein FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE::FRT .DELTA.sucA::FRT-tet-FRT TC36
W3110, (Succ.sup.+), .DELTA.(focA-pflB):: Described herein FRT
.DELTA.frdBC .DELTA.ldhA .DELTA.atp(FH)::FRT .DELTA.adhE::FRT
.DELTA.sucA::FRT Plasmids pCR2.1-TOPO bla kan, TOPO .TM. TA cloning
vector Invitrogen pFT-A bla flp low-copy vector containing
Footnote.sup.2 recombinase and temperature- conditional pSC101
replicon pKD46 bla .gamma..beta. exo low-copy vector Footnote.sup.3
contaiing red recombinase and temperature-conditional pSC101
replicon pLOI2065 bla, SmaI fragment containing the Described
herein FRT flanked tet gene pLOI2800 bla kan sucA Described herein
pLOI2801 bla kan sucA::FRT-tet-FRT Described herein pLOI2802 bla
kan adhE Described herein pLOI2803 bla kan adhE::FRT-tet-FRT
Described herein pLOI2805 bla kan atpEFH Described herein pLOI2807
bla kan atpFH::FRT-tet-FRT Described herein .sup.1Ohta, K., D. S.
Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram (1991)
"Genetic improvement of Escherichia coli for ethanol production of
chromosomal integration of Zymamonas mobilis genes encoding
pyruvate decarboxylase and alcohol dehydrogenase II. Appl. Environ.
# Microbiol. 57: 893-900. .sup.2Posfai, G., M. D. Koob, H. A.
Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion plasmids
for targeted genome manipulations in bacteria: Isolation, deletion,
and rescue of the pathogenicity island LEE of the Escherichia coli
O157:H7 genome. J. Bacteriol. 179: 4426-4428. .sup.3Datsenko, K. A.
and B. L. Wanner. 2000. One-step inactivation of chromosomal genes
in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645.
[0074] Working cultures of E. coli W3110 (ATCC 27325) derivatives
were maintained on a mineral salts medium (per liter: 3.5 g
KH.sub.2PO.sub.4; 5.0 g K.sub.2HPO.sub.4; 3.5 g
(NH.sub.4).sub.2HPO.sub.4, 0.25 g MgSO.sub.4.7 H.sub.2O, 15 mg
CaCl.sub.2.2 H.sub.2O, 0.5 mg thiamine, and 1 ml of trace metal
stock) containing glucose (2% in plates; 3% in broth) and 1.5%
agar. The trace metal stock was prepared in 0.1 M HCl (per liter:
1.6 g FeCl.sub.3, 0.2 g CoCl.sub.2.6 H.sub.2O, 0.1 g CuCl.sub.2,
0.2 g ZnCl.sub.2.4 H.sub.2O, 0.2 g NaMoO.sub.4, and 0.05 g
H.sub.3BO.sub.3). MOPS (0.1 M, pH7.1) was added to both liquid and
solid media (autoclaved separately) when needed for pH control, but
was not included in medium used for 10-L fermentations. Minimal
medium was also prepared using succinate (1 g L.sup.-1) and
glycerol (1 g L-.sup.1) as sole sources of carbon (nonfermentable).
Succinate (1 g L-.sup.1) was added as a supplement to
glucose-minimal medium when needed. During plasmid and strain
construction, cultures were grown in Luria-Bertani (LB) broth or on
LB plates (1.5% agar) (Sambrook, J. and D. W. 25 Russell, 2001
"Molecular cloning: A laboratory manual" Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.). Glucose (2%) was added to LB medium for
all strains containing mutations in (F.sub.1F.sub.0)H.sup.+-ATP
synthase. Antibiotics were included as appropriate (kanamycin, 50
mg L.sup.-1; ampicillin, 50 mg L.sup.-1; and tetracycline, 12.5 or
6.25 mg L.sup.-1). Fusaric acid plates were used to select for loss
of tetracycline resistance.
[0075] Genetic methods. Standard methods were used for plasmid
construction, phage P1 transduction, electroporation, and
polymerase chain reaction (PCR) (Miller, J. H., 1992 "A short
course in bacterial genetics: A laboratory manual and handbook for
Escherichia coli and related bacteria" Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.; Sambrook, J. and D. W. Russell, 2001
"Molecular cloning: A laboratory manual" Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.). Chromosomal DNA from E. coli W3110 (and
derivatives) served as a template to amplify genes using primers
complementary to coding regions (ORFmers) purchased from the Sigma
Scientific Company (St. Louis, Mo.).
[0076] PCR products were initially cloned into plasmid vector
pCR2.1-TOPO. During plasmid constructions, restriction products
were converted to blunt ends using either the Klenow fragment of
DNA polymerase (5' overhang) or T4 DNA polymerase (3' overhang) as
needed. Integration of linear DNA was facilitated by using pKD46
(temperature conditional) containing an arabinose-inducible red
recombinase (Datsenko, K. A. and B. L. Wanner, 2000 "One-step
inactivation of chromosomal genes in Escherichia coli K-12 using
PCR products" Proc. Natl. Acad. Sci. USA 97:6640-6645). Integrants
were selected for tetracycline resistance (6.25 mg L.sup.-1) and
screened for appropriate antibiotic resistance markers and
phenotypic traits. At each step, mutations were verified by
analyses of PCR products and fermentation products. FRT-flanked
antibiotic resistance genes used for selection were deleted using a
temperature-conditional plasmid (pFT-A) expressing FLP recombinase
from a chlortetracycline-inducible promoter (Martinez-Morales, F.,
A. G. Borges, A. Martinez, K. T. Shanmugam, and L. O. Ingram, 1999
"Chromosomal integration of heterologous DNA in Escherichia coli
with precise removal of markers and replicons during construction"
J. Bacteriol. 181:7143-7148; Posfai, G., M. D. Koob, H. A.
Kirkpatrick, and F. C. Blattner, 1997 "Versatile insertion plasmids
for targeted genome manipulations in bacteria: Isolation, deletion,
and rescue of the pathogenicity island LEE of the Escherichia coli
O157:H7 genome" J. Bacteriol. 179:4426-4428).
[0077] A removable tetracycline cassette (FRT-tet-FRT) was
constructed (pLOI2065) which is analogous to the kanamycin cassette
(FRT-kan-FRT) in pKD4 (Datsenko, K. A. and B. L. Wanner, 2000
"One-step inactivation of chromosomal genes in Escherichia coli
K-12 using PCR products" Proc. Natl. Acad. Sci. USA 97:6640-6645).
In both cassettes, flanking FRT sites are oriented in the same
direction to allow efficient in vivo excision by FLP recombinanase
(Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner,
1997 "Versatile insertion plasmids for targeted genome
manipulations in bacteria: Isolation, deletion, and rescue of the
pathogenicity island LEE of the Escherichia coli O157:H7 genome" J.
Bacteriol. 179:4426-4428). Plasmid pLOI2065 contains two EcoRI
sites and two SmaI sites for isolation of the FRT-tet-FRT cassette.
The sequence for pLOI2065 has been deposited in GenBank (Accession
No. AF521666).
[0078] Deletion of adhE. To construct an adhE mutant, the coding
region (2.68 kbp) was amplified by PCR and cloned into pCR2.1-TOPO.
The central region of adhE (1.06 kbp) was deleted using HincII (2
sites) and replaced with a 1.7 kbp SmaI fragment from pLO12065
containing the FRT-tet-FRT cassette to produce pLOI2803. This
plasmid was linearized by digestion with PvuI and ScaI, and served
as a template to amplify (adhE primers) the 3.17 kbp region
containing adhE::FRT-tet-FRT. Amplified DNA was purified and
introduced into W3110 by electroporation. Recombinants from double
cross-over events were identified by antibiotic markers, confirmed
by analysis of PCR and fermentation products. One clone was
selected and designated TC20.
[0079] P1 transduction was used to transfer a mutation (frdBC
zid::Tn10) from SE1706 into SZ32, designated
SZ35(.DELTA.focA-pflB::FRT .DELTA.frdBC zid::Tn10). The tet gene
was removed from SZ35 by fusaric acid selection to produce
SZ40(.DELTA.focA-pflB:FRT .DELTA.frdBC).
[0080] Deletion of pflB. A focA-pflB::FRT mutation was constructed
using the method of Datsenko and Wanner (Datsenko, K. A. and B. L.
Wanner, 2000 "One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products" Proc. Natl. Acad. Sci.
USA 97:6640-6645). Hybrid primers were designed which are
complementary to E. coli chromosomal genes and to the antibiotic
cassette (FRT-kan-FRT) in pKD4. The sense primer
(TTACTCCGTATTTGCATAAAAA-CCATGCGAGTTACGGGCCTATAAGTGTAGGCTGGAGCTGCTT-
C) (SEQ ID NO.:1) consisted of an initial 45 bp (bold)
corresponding to the -130 to -85 region of foc followed by 20 bp
(underlined) corresponding to the primer 1 region of pKD4. The
antisense primer
TAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGC-TGTTCTCATATGAATATCCTCCTTAG)
(SEQ ID NO.:2) consisted of an initial 45 bp (bold) of the
C-terminal end of pflB followed by 20 bp (underlined) corresponding
to primer 2 region of pKD4. The FRT-kan-FRT cassette was amplified
by PCR using these primers and pKD4 as the template. After
purification, amplified DNA was electroporated into E. coli BW25113
(pKD46). The resulting kanamycin-resistant recombinant, pAH218,
contained FRT-kan-FRT in the deleted region of pflB (46 bp
remaining). A phage P1 lysate prepared from AH218
(pflB::FRT-kan-FRT) was used to transfer this mutation into W3110
to produce strain SZ31 (pflB::FRT-kan-FRT). After verifying this
mutation by analyses of PCR products, fermentation products, and
antibiotic markers, the kan gene was removed from the chromosome by
FLP recombinase using a temperature-conditional helper plasmid
(pFT-A). After removal of helper plasmid by growth at 42.degree.
C., the resulting kanomycin-sensitive strain (focA-pflB::FRT) was
designated SZ32.
[0081] Deletion of focA-pflB:FRT, frdBC, ldhA. The ldhA::Tn10
mutation in E. coli SE2279 was transduced into E. coli W3110 using
phage P1 to produce strain SZ33. P1 phage grown on SZ33 was used to
transfer this mutation into SZ40(.DELTA.(focA-pflB)::FRT
.DELTA.frdCD) to produce SZ46. Tetracycline-sensitive derivatives
of SZ46 were selected using fusaric acid medium. One clone was
designated SZ47 (.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA).
The .DELTA.ldhA mutation in SZ47 was confirmed by the absence of
lactate in fermentation broth, an inability to grow anaerobically
in glucose-minimal media, and by PCR analysis using ldhA ORFmers
(1.0 kbp for the wild type ldhA as compared to 1.1 kbp for SZ47).
The slightly larger size of the amplified product from SZ47 is
attributed to remnants of Tn10.
[0082] Deletion of atpFH. The atpEFH coding region of the
atpIBEFHAGDC operon was amplified by PCR using primers (ORFmers,
Sigma Scientific, St. Louis, Mo.) complementary to the 5'-end of
the atpE gene and the 3'-end of the atpH. The amplified fragment
(1.3 kbp) was cloned into pCR2.1-TOPO and one clone selected in
which the atpEFH genes were oriented to permit expression from the
lac promoter (pLOI2805; FIG. 2). The atpF gene and 117 nucleotides
at the 5' end of atpH gene were removed from pLOI2805 by digestion
with HpaI and BstEII (Klenow-treated). This region was replaced
with a 1.7 kbp SmaI fragment from pLOI2065 containing the
FRT-tet-FRT cassette to produce pLOI2807 (FIG. 2). After digestion
with ScaI, pLOI2807 served as a template for amplification of the
atpE.DELTA.(FH)::FRT-tet-FRT region (2.4 kbp) using the 5' atpE and
3' atpH primers. Amplified DNA was precipitated, digested again
with ScaI to disrupt any residual plasmid, and purified by phenol
extraction. This DNA was introduced into E. coli W3110(pKD46) by
electroporation while expressing red recombinase. Plasmid pKD46 was
eliminated by growth at 42.degree. C. Recombinants (double
cross-over) were identified using antibiotic markers (tetracycline
resistant; sensitive to ampicillin and kanamycin) and by the
inability to grow on succinate-minimal plates or glycerol-minimal
plates in the absence of glucose (fermentable carbon source).
Integration was further confirmed by PCR analysis using the 5' atpE
primer and the 3' atpH primer (1.3 kbp fragment for W3110; 2.3 kbp
fragment for mutants). One clone was selected and designated
TC21(.DELTA.atp(FH)::FRT-tet-FRT).
[0083] Phage P1 was used to transduce the
.DELTA.atp(FH)::FRT-tet-FRT mutation in TC21 to SZ47 and produce
TC23. The tet gene was removed from TC23 by the FLP recombinase
(pFT-A). After elimination of pFT-A by growth at 42.degree. C., the
.DELTA.atp(FH)::FRT mutation was further confirmed by PCR analysis
using the 5' atpE primer and the 3' atpH primer (0.8 kbp for
deletion and 1.3 kbp for SZ47). The resulting strain was designated
TC24(.DELTA.focA-pflB::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atpFH::FRT).
[0084] Deletion of adhE. Phage P1 was used to transduce the
.DELTA.adhE::FRT-tet-FRT mutation in TC20 to TC24 and produce TC30.
Chromosomal integration was confirmed by PCR analysis using adhE
primers (2.7 kbp for TC24 and 3.2 kbp for the
.DELTA.adhE::FRT-tet-FRT mutant). The tet gene was deleted from
TC30 by FLP recombinase using pFT-A. After elimination of pFT-A by
growth at 42.degree. C., a clone was selected and designated TC31
(.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE::FRT).
[0085] Deletion of part of sucA. The sucA coding region was
amplified using ORFmers. The resulting 2.8 kbp PCR product was
cloned into pCR2.1-TOPO to produce pLOI2800 (FIG. 2) in which the
sucA coding region was oriented to permit expression from the lac
promoter. A 1.1 kbp fragment was removed from central region of
sucA by digestion of pLOI2800 with SnaBI and AccI (Klenow-treated).
This region was replaced with a 1.7 kbp SmaI fragment containing
the FRT-tet-FRT cassette from pLOI2065 to produce pLOI2801 (FIG.
2). Plasmid pLOI2801 was digested with PvuI and ScaI and used as a
template to amplify the 3.3 kbp region containing sucA::FRT-tet-FRT
using sucA ORFmers. Amplified DNA was precipitated, digested with
PvuI and ScaI to disrupt any residual circular plasmid, and
extracted with phenol. Purified DNA was electroporated into E. coli
W3110(pKD46) while expressing red recombinase. Plasmid pKD46 was
eliminated by growth at 42.degree. C. Disruption of sucA was
confirmed by PCR analysis using sucA ORFmers (2.8 kbp fragment for
wild type and 3.3 kbp for sucA::FRT-tet-FRT mutants) and designated
TC25.
[0086] Phage P1 was used to transduce the sucA::FRT-tet-FRT
mutation from TC25 into TC31. Transfer was verified by PCR analysis
(2.8 kbp for wild type sucA and 3.3 kbp for sucA::FRT-tet-FRT
mutants) and phenotype (succ.sup.-). Inactivation of
2-ketoglutarate dehydrogenase (.DELTA.sucA) in this .DELTA.frdBC
background resulted in an undesirable auxotrophic requirement for
succinate (Succ.sup.-) during growth on glucose-minimal medium. The
resulting strain was designated TC32(Succ.sup.-,
.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE::FRT .DELTA.sucA::FRT-tet-FRT).
[0087] Elimination of Succ.sup.- mutants. Spontaneous Succ.sup.+
mutants of TC32 were readily obtained after serial transfers in
glucose-minimal broth containing decreasing amounts of succinate (4
mM to 0.4 mM) followed by selection on glucose-minimal plates
without succinate. Over 170 clones were recovered per ml of culture
after enrichment, approximately 3% of viable cells. Ten clones were
tested and all grew well in glucose minimal broth without succinate
and produced acetate as the dominant product. One was selected
(TC35) for deletion of the tet gene using the FLP recombinase. This
deletion was confirmed by analysis of PCR products using sucA
primers (3.3 kbp for TC35 and 1.8 kbp after tet deletion). The
resulting strain was designated TC36 (Succ.sup.+,
.DELTA.(focA-pflB)::FRT .DELTA.frdBC .DELTA.ldhA
.DELTA.atp(FH)::FRT .DELTA.adhE::FRT .DELTA.sucA::FRT).
[0088] Total ATPase activity was examined in disrupted cell
extracts of TC36 and W3110 (wild type). The activity in TC36 (0.355
U mg.sup.-1 protein) was equivalent to 71% of the unmodified parent
(0.502 U mg.sup.-1 protein), confirming that F.sub.1-ATPase was not
inactivated by the .DELTA.atpFH::FRT mutation. This is similar to
the levels of ATPase reported for an atpH mutant of E. coli which
blocked membrane assembly and coupling to oxidative phosphorylation
(Sorgen, P. L., T. L. Caviston, R. C. Perry, and B. D. Cain, 1998
"Deletions in the second stalk of F1F0-ATP synthase in Escherichia
coli" J. Biol. Chem. 273:27873-27878).
[0089] Fermentation. Acetate production was examined in
glucose-minimal medium containing 167 mM glucose using a New
Brunswick Bioflow 3000 fermentor with a 10 L working volume
(37.degree. C., dual Rushton impellers, 450 rpm). Dissolved oxygen
was maintained at 5% of air saturation (unless otherwise stated) by
altering the proportion of N.sub.2 and O.sub.2. Broth was
maintained at pH 7.0 by the automatic addition of 11.4 M KOH. For
fed batch experiments, additional glucose was added from a sterile
60% stock. Three fed batch regimes were investigated: A. 3% glucose
initially with the addition of 3% after 12 h (6% total); B. 6%
glucose initially with the addition of 4% glucose after 16 h (10%
total); C. 3% glucose initially with multiple additions to maintain
glucose levels above 100 mM.
[0090] Seed cultures were prepared by inoculating colonies from a
fresh plate (48 h) into 3 ml of glucose-minimal medium
(13.times.100 mm tube) containing 0.1 M MOPS. After incubation for
14 h (120 rpm rotator), cultures were diluted 400-fold into 1-L
baffled flask containing 200 ml of mineral salts medium (37.degree.
C., 280 rpm). When cells reached 1.5-2.2 OD.sub.550nm, sufficient
culture volume was harvested (5000 rpm, 25.degree. C.) to provide
an inoculum of 33 mg dry cell weight L.sup.-1 in the 10-L working
volume.
[0091] Broth samples were removed to measure organic acids,
residual glucose, and cell mass. Volumetric and specific rates were
estimated from measured values for glucose and acetate using Prism
software (GraphPad Software, San Diego, Calif.). A smooth curve was
generated with 10 points per min (Lowess method) to fit measured
results. The first derivative (acetate or glucose versus time) of
each curve served as an estimate of volumetric rate. Specific rates
(mmoles L.sup.-1 h.sup.-1 mg.sup.-1 dry cell weight) were
calculated by dividing volumetric rates by respective values for
cell mass.
[0092] ATPase. Cells were grown for enzyme assays as described
above for seed cultures. Upon reaching 0.75-1.0 OD.sub.550nm,
cultures were chilled on ice and harvested by centrifugation
(8000.times.g, 5 min at 4.degree. C.). Cell pellets were washed 5
times with 0.1 M Tris-HCl (pH 7.55), resuspended in 1 ml of this
buffer, and broken using a model W220F ultrasonic cell disruptor
(Heat Systems Ultrasonics, Plainview, N.Y., USA). Total ATPase
activity in disrupted cell preparations was assayed at pH 7.55
essentially as described by Evans (Evans, D. J., Jr., 1969
"Membrane adenosine triphosphate of Escherichia coli: activation by
calcium ion and inhibition by cations" J. Bacteriol. 100:914-922).
Inorganic phosphate was measured by the method of Rathbun and
Betlach (Rathbun, W. B., and M. V. Betlach, 1969 "Estimation of
enzymatically produced orthophosphate in the presence of cysteine
and adenosine triphosphate" Anal. Biochem. 20:436-445). Results
represent an average for three cultures of each strain. Specific
activity is expressed as .mu.mol P.sub.i released min.sup.-1
mg.sup.-1 protein.
[0093] Total ATPase activity was examined in disrupted cell
extracts of TC36 and W3110 (wild type). The activity in TC36 (0.355
U mg.sup.-1 protein) was equivalent to 71% of the unmodified parent
(0.502 U mg.sup.-1 protein), confirming that F.sub.1-ATPase was not
inactivated by the .DELTA.atpFH::FRT mutation. This is similar to
the levels of ATPase reported for an atpH mutant of E. coli which
blocked membrane assembly and coupling to oxidative phosphorylation
(Sorgen, P. L., T. L. Caviston, R. C. Perry, and B. D. Cain, 1998
"Deletions in the second stalk of F1F0-ATP synthase in Escherichia
coli" J. Biol. Chem. 273:27873-27878).
[0094] Analyses. Organic acids and glucose concentrations were
determined using a Hewlett Packard HPLC (HP 1090 series II)
equipped with a UV monitor (210 nm) and RI detector. Products were
separated using a Bio-Rad HPX 87H column (10 .mu.l injection) with
4 mM H.sub.2SO.sub.4 as the mobile phase (0.4 ml min.sup.-1, 45
.degree. C.). Cell mass was estimated by measuring OD.sub.550nm
(1.0 OD.sub.550nm is equivalent to 0.33 g L.sup.-1 dry cell weight)
using a Bausch & Lomb Spectronic 70 spectrophotometer with
10.times.75 mm culture tubes as cuvettes. Protein concentration was
determined using the BCA Protein Assay Kit from Pierce (Rockford,
Ill.).
[0095] Following are examples which illustrate procedures for
practicing the invention. These examples should not be construed as
limiting. All percentages are by weight and all solvent mixture
proportions are by volume unless otherwise noted.
EXAMPLE 1
Construction of a Homo-Acetate Fermentation Pathway in E. coli
W3110
[0096] Fermentation of sugars through native pathways in E. coli
produces a mixture of organic acids, ethanol, CO.sub.2 and H.sub.2
(FIG. 1). Acetate and ethanol are typically produced in
approximately equimolar amounts from acetyl.about.CoA to provide
redox balance (Clark, D. P., 1989 "The fermentation pathways of
Escherichia coli. FEMS" Microbiol. Rev. 63:223-234; de Graef, M.
R., S. Alexeeva, J. L. Snoep, and M. J. Teixiera de Mattos, 1999
"The steady-state internal redox state (NADH/NAD) reflects the
external redox state and is correlated with catabolic adaptation in
Escherichia coli" J. Bacteriol. 181:2351-2357). To construct a
strain for homo-acetate production, removable antibiotic resistance
genes were used to sequentially inactivate chromosomal genes
encoding alternative pathways.
[0097] Inspection of native pathways in E. coli (FIG. 1) indicated
that the production of acetate and CO.sub.2 as sole metabolic
products from glucose will require an external electron acceptor
such as oxygen. Due to low oxygen solubility, however, it is
difficult to satisfy the oxygen demand from active E. coli
metabolism and a portion of substrate is typically converted to
fermentation products such as lactate and ethanol. This problem was
eliminated by combining deletions in genes encoding lactate
dehydrogenase, pyruvate formatelyase, and alcohol/aldehyde
dehydrogenase.
[0098] A deletion was inserted into the pflB gene, the ldhA gene,
and the adhE gene of W3110. These mutations eliminated the
production of CO.sub.2, lactate, and ethanol in 3% glucose-minimal
media (Table 2)
2TABLE 2 Comparison of metabolic rates. Max Vol.sup.a Max Spec Max
Vol.sup.a Max Spec.sup.b Specific Glucose Glucose.sup.b Acetate
Acetate Growth Utilization Utilization Production Production Strain
Rate (.mu.) (mmol liter.sup.-1 h.sup.-1) (mmol h.sup.-1 g.sup.-1)
(mmol liter.sup.-1 h.sup.-1) (mmol h.sup.-1 g.sup.-1) W3110 0.87 18
9 9.5 10 SZ47 0.87 22 11 9 10 TC24 0.78 28 20 26 16 TC36 0.69 33 18
23 16 .sup.aMaximum volumetric rates for glucose utilization and
acetate production. .sup.bMaximim specific rates (dry cell weight
basis) for glucose utilization and acetate production. Values for
glucose represents a measure of maximal glycolytic flux.
[0099] Several different mutations can be used to block succinate
production (FIG. 1).
[0100] During fermentation, the tricarboxlyic acid (TCA) pathway
serves primarily as a source of carbon skeletons for biosynthesis.
Previous experience with E. coli B strains (Ingram, L. O., H. C.
Aldrich, A. C. C. Borges, T. B. Causey, A. Martinez, F. Morales, A.
Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and
S. Zhou, 1999 "Enteric bacterial catalysts for fuel ethanol
production." Biotechnol. Prog. 15:855-866) engineered for ethanol
production has shown that a deletion in the frdABCD operon can be
used as an alternative method to block succinate production by
preventing the production of fumarate reductase. Thus, the deletion
of the frdCD gene eliminates the production of succinate by
reductive reactions.
[0101] The TCA cycle was further disrupted by the deletion of sucA
(FIG. 1) During oxidative growth, up to 50% of substrate carbon can
be lost as CO.sub.2 (Neidhardt, F. C., J.
[0102] L. Ingraham, and M. Schaechter, 1990 "Physiology of the
bacterial cell: A molecular approach" Sinauer Associates, Inc.,
Sunderland, Mass.). This loss of carbon can be attributed in large
measure to the high efficiency of the TCA cycle and the electron
transport system (NADH oxidation). During fermentative metabolism,
the production of CO.sub.2 and NADH are reduced primarily by strong
repression of sucAB encoding 2-ketoglutarate dehydrogenase
(Cunningham, L. and J. R. Guest, 1998 "Transcription and transcript
processing in the sdhCDAB-sucABCD operon of Escherichia coli"
Microbiology 144:2113-2123; Park, S.-J., G. Chao, and R. P.
Gunsalus, 1997 "Aerobic regulation of the sucABCD gene of
Escherichia coli, which encode .alpha.-ketoglutarate dehydrogenase
and succinyl coenzyme A synthetase: roles of ArcA, Fnr, and the
upstream sdhCDAB promoter" J. Bacteriol. 179:4138-4142), disrupting
the cyclic function of the TCA cycle. Deleting part of the sucA
gene imposed a restriction in carbon flow through the TCA
cycle.
[0103] Again, growth under oxidative conditions is characterized by
conversion of up to 50% of substrate carbon to cell mass
(Neidhardt, F. C., J. L. Ingraham, and M. Schaechter, 1990
"Physiology of the bacterial cell: A molecular approach" Sinauer
Associates, Inc., Sunderland, Mass.). To reduce the potential drain
of substrate into cell mass, a mutation was introduced into SZ47
that deleted portions of two subunits in
(F.sub.1F.sub.0)H.sup.+-ATP synthase concerned with assembly to the
plasma membrane (Sorgen, P. L., T. L. Caviston, R. C. Perry, and B.
D. Cain, 1998 "Deletions in the second stalk of F1F0-ATP synthase
in Escherichia coli" J. Biol. Chem. 273:27873-27878), disrupting
oxidative phosphorylation while preserving the hydrolytic activity
of F.sub.1-ATPase in the cytoplasm. Thus, the strain is able to
grow in minimal medium without a fermentable carbon source
(substrate level phosphorylation) and retains the ability to
oxidize NADH by the electron transport system.
[0104] These deletions resulted in strain TC32, which required
succinate for growth on glucose-minimal medium. Thus, spontaneous
Succ.sup.+ mutants of TC32 were obtained by performing serial
transfers in glucose-minimal broth containing decreasing amounts of
succinate followed by selection on glucose-minimal plates without
succinate.
[0105] The resulting strain, TC36 has absolute requirements for a
fermentable carbon source (substrate level phosphoylation) and for
an external electron acceptor that can couple to the electron
transport system during growth in mineral salts medium to maintain
redox balance. With genetic blocks in all major fermentation
pathways and oxidative phosphorylation, this strain is relatively
insensitive to variations in dissolved oxygen. TC36(.DELTA.focApflB
.DELTA.frdCD .DELTA.ldhA .DELTA.atpFH .DELTA.sucA .DELTA.adhE)
metabolizes sugars to acetate with the efficiency of fermentative
metabolism, diverting a minimum of carbon to cell mass
(biocatalyst) and CO.sub.2. By replacing the acetate pathway, a
variety of alternative oxidized products can be produced using the
mutational strategies employed for the construction of TC36.
EXAMPLE 2
Effects of Gene Disruptions on Growth and Glycolytic Flux
[0106] TC36 was genetically engineered for the production of
acetate from carbohydrates such as glucose. Batch fermentations
with pH control were used to compare the performance of this strain
with W3110 (wild type) and two intermediate strains used for
construction, SZ47(.DELTA.pflB,.DELTA.f- rdCD,.DELTA.ldhA) and
TC24(.DELTA.pflB,.DELTA.frdCD,.DELTA.ldhA .DELTA.atpFH). Under 5%
oxygen saturation and 3% glucose (37.degree. C.) test conditions,
the broth pH was maintained at neutrality to minimize toxicity from
undissociated acids (Chotani, G., T. Dodge, A. Hsu, M. Kumar, R.
LaDuca, D. Trimbur, W. Weyler, and K. Sanford, 2000 "The commercial
production of chemicals using pathway engineering" Biochim.
Biophys. Acta 1543:434-455).
[0107] Disruption of oxidative phosphorylation and the cyclic
function of the tricarboxylic acid cycle, elimination of the
primary fermentation pathways, and the production of acetate as the
primary end-product from glycolysis had relatively little effect on
the growth of E. coli. The maximum growth rates for strains W3110
(wild type) and SZ47 (lacking the three native fermentation
pathways) were similar although the cell yield for SZ47 was higher
(FIG. 3A; Table 2 and Table 3). Inactivation of oxidative
phosphorylation (.DELTA.atpFH) resulted in a small reduction in
growth rate and cell yield (TC24). Cell yield and growth rate were
lowest for strain TC36 containing additional mutations in
2-ketoglutarate dehydrogenase (.DELTA.sucA) and alcohol
dehydrogenase (.DELTA.adhE), approximately 80% of the unmodified
parent W3110.
[0108] Maximal rates for glucose utilization (specific and
volumetric) were higher for TC36 and TC24 than for W3110 and SZ47
(Table 2). This increase in metabolic activity can be primarily
attributed to the .DELTA.atpFH mutation. ATP levels serve as an
allosteric regulator of several key glycolytic enzymes (Neidhardt,
F. C., J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the
bacterial cell: A molecular approach" Sinauer Associates, Inc.,
Sunderland, Mass.), and acetate kinase (Suzuki, T., 1969
"Phosphotransacetylase of Escherichia coli B, activation by
pyruvate and inhibition by NADH and certain nucleotides" Biochim.
Biophys. Acta 191:559-569). Differences between strains were
particularly evident when comparing incubation times required to
complete sugar metabolism (FIG. 3B). With TC36 and TC24, glucose
was exhausted in 16-18 h as compared to 26 h for SZ47 and 30 h for
W3110. The maximum specific rate of glucose utilization (glycolytic
flux) was 9 mmole h.sup.-1 g.sup.-1 dry cell weight in the
unmodified parent (W3110), 20 mmole h.sup.-1 g.sup.-1 dry cell
weight in TC24, and 18 mmole h.sup.-1 g.sup.-1 dry cell weight in
TC36. The slightly lower glycolytic flux in TC36 as compared to
TC24 may be related to the increase in ATP yield resulting from
improvements in acetate yield (1 ATP per acetate). Assuming protein
represents 55% of dry cell weight, maximal glycolytic flux in TC36
is approximately 0.55 .mu.moles glucose min.sup.-1 mg.sup.-1
protein.
[0109] The (F.sub.1F.sub.0)H.sup.+-ATP synthase and 2-ketoglutarate
dehydrogenase mutations introduced into TC36 to miminize the levels
of ATP and NAD(P)H from glucose under oxidative conditions also
promote glycolysis through native allosteric controls (Neidhardt,
F. C., J. L. Ingraham, and M. Schaechter, 1990 "Physiology of the
bacterial cell: A molecular approach" Sinauer Associates, Inc.,
Sunderland, Mass.; Underwood, S. A., M. L. Buszko, K. T. Shanmugam,
and L. O. Ingram, 2002 "Flux through citrate synthase limits the
growth of ethanologenic Escherichia coli KO11 during xylose
fermentation" Appl. Environ. Microbiol. 68:1071-1081), providing a
mechanism for the observed 2-fold increase in glycolytic flux as
compared to W3110(wild type).
EXAMPLE 3
Production of Other Organic Acids
[0110] A substantial portion of glucose carbon was not recovered in
the carbon balance (Table 3) for W3110 (40%) and SZ47 (80%). This
loss is attributed to the production of volatile products by high
flux through the tricarboxylic acid cycle (CO.sub.2) but may also
include the reduction of acetyl.about.CoA to acetaldehyde and
ethanol (FIG. 1).
3TABLE 3 Summary of fermentation products. Cell Carbon Yield
Fermentation Products.sup.a (mM) Recovery.sup.c Strain Conditions
(g/liter) Acetate 2-ketoglutarate Fumarate Lactate Pyruvate
Succinate Yield.sup.b(%) (% substrate C) W3110 3% glucose 4.5 30 39
0.8 33 <1 5 9 60 5% DO SZ47 3% glucose 5.3 6 11 0.9 <1 1 3 2
20 5% DO TC24 3% glucose 4.4 156 1 1.0 <1 <1 2 47 66 5% DO
TC36 3% glucose 3.5 224 16 0.4 <1 0 4 68 89 5% DO _0.2 _14 _6
_0.1 _0.5 _1 TC36 3% glucose 3.2 190 24 <1 <1 <1 3 57 88
15% DO TC36 3% Glucose 2.5 220 31 <1 <1 <1 10 66 95 5% DO
N-limited TC36 3 + 3% glucose 3.8 523 21 <1 3 14 2 78 95 5% DO
TC36 3 + 3% glucose 3.0 572 33 <1 <1 <1 6 86 102 5% DO
N-limited TC36 6% glucose 4.18 415 47 0.3 <1 46 7 62 92 5% DO
TC36 6 + 4% glucose.sup.d 4.5 767 37 0.5 <1 72 5 72 97 5% DO
TC36 Fed batch.sup.e 4.1 878 33 3.4 <1 <1 25 75 88 5% DO
.sup.aConcentrations in broth after all glucose had been depleted,
except as noted. .sup.bYield expressed as a percentage of the
maximal theoretical yield (0.67 g acetate per g glucose).
.sup.cCarbon recovery represents the percentage of substrate carbon
recovered. Recovered carbon was calculated as the sum of carbon in
cell mass, fermentation products, and CO2. .sup.dIn the final
sample, 44 mM glucose was present. .sup.eExcess glucose (9.5%) was
added to fermentation to maintain levels above 100 mM; 107 mM
glucose was present in the final sample.
[0111] Although ethanol was absent in broth samples from all
pH-controlled fermentations (sparged at 1 L min.sup.-1), a small
amount of ethanol (6 mM) was found in seed cultures of W3110
(shaken flasks). No ethanol was present in seed cultures of TC36,
because of the mutation in alcohol dehydrogenase E (adhE). In
W3110, the electron transport system (5% dissolved oxygen) and
native fermentation pathways (Table 3) serve as complementary
routes for NADH oxidation.
[0112] Eliminating the fermentation pathways to produce the strain
SZ47, doubled the loss of carbon as volatile products (Table 3)
through the TCA cycle. While SZ47 cell yield increased, the rate of
acetate production in comparison to W3110 decreased (Table 2 and
Table 3).
[0113] Strain W3110 accumulated the highest levels of dicarboxylic
acids (primarily succinate and 2-ketoglutarate produced through the
TCA cycle) during glucose metabolism, approximately 3-fold that of
the engineered strains (FIG. 4B). The order of appearance of
dicarboxylic acids in the broth correlated with growth rate and the
order in which each strain entered into stationary phase.
Dicarboxylic acids were partially consumed as glucose levels
declined, and may represent spillover products from excessive
glycolysis during the transition from exponential to stationary
phase. Although dicarboxylic acids were produced by each strain, no
significant accumulation of pyruvate was observed for W3110, SZ47
or TC24.
[0114] Pyruvate levels in the broth of TC36 increased (16 mM at 12
h) during the transition stage (FIG. 4C). Although this pyruvate
was subsequently metabolized, the excretion of pyruvate indicates
that glucose uptake and glycolysis per se may not be limiting for
acetate production. Because of the various mutations in TC36,
metabolism of pyruvate is limited primarily to small biosynthetic
needs and conversion to acetyl.about.CoA by the pyruvate
dehydrogenase complex (FIG. 1). Although pyruvate dehydrogenase is
activated by low NADH, acetyl.about.CoA production may be limited
by the availability of free CoA. Resulting rises in pyruvate pools
(FIG. 4C), would serve as an allosteric activator of
phosphotransferase (Suzuki, T., 1969 "Phosphotransacetylase of
Escherichia coli B, activation by pyruvate and inhibition by NADH
and certain nucleotides" Biochim. Biophys. Acta 191:559-569), since
phosphotransferase (pta) is the first committed step for acetate
production from acetyl.about.CoA (FIG. 1). Gratuitous ATP
hydrolysis by F.sub.1-ATPase (FIG. 1C) should ensure the
availability of ADP for the final step in acetate production
catalyzed by acetate kinase (ackA) (FIG. 1). Excess pyruvate can
also be directly oxidized to acetate by pyruvate oxidase (poxB), an
enzyme that is induced during the latter stages of growth and by
environmental stress (Chang, Y.-Y., A.-Y. Wang, and J. E. Cronan,
Jr., 1994 "Expression of Escherichia coli pyruvate oxidase (PoxB)
depends on the sigma factor enocoded by the rpoS (katF) gene" Mol.
Microbiol. 11:1019-1028). Thus, pyruvate oxidase (poxB) may also
contribute to acetate production by TC36.
[0115] Total organic acid production can be measured by the
consumption of base to maintain pH 7.0 (FIG. 3C). Consistent with a
more rapid glucose metabolism, TC24 and TC36 exhibit higher rates
and maxima. In general, variations in glucose utilization were
accompanied by corresponding changes in base utilization. Thus, a
higher consumption of base corresponds to a higher utilization of
glucose. The exponential nature of the early time points reflects
growth of the biocatalysts.
EXAMPLE 4
Production of Acetate
[0116] Inactivation of oxidative phosphorylation (.DELTA.atpFH ) in
SZ47 to produce TC24 resulted in a 5-fold increase in acetate yield
and a 3-fold improvement in carbon recovery, (Table 3), since less
carbon was used in the production of cell mass. Acetate yield and
carbon recovery increased by another 30% with the introduction of
the sucA and adhE mutations to produce TC36. The sucA mutation
disrupted the TCA cycle, while the adhE mutation blocked the
production of ethanol; therefore, both mutations directed carbon
atoms to the production of acetate instead of other competing
products. With 3% glucose mineral salts medium, TC36 produced an
average of 224 mM acetate in 16 h with only small amounts of other
competing products (Table 2). This represents 68% of the maximum
theoretical yield using native pathways (2 acetates per glucose),
remaining carbon being divided between cell mass, dicarboxylic
acids, and CO.sub.2.
[0117] The maximal rates of acetate production (specific and
volumetric) were approximately 2-fold higher for TC24 and TC36 than
for SZ47 and W3110 (Table 3), a difference which can be attributed
solely to the mutation in the (F.sub.1F.sub.0)H.sup.+-ATP synthase.
This mutation eliminated ATP production by oxidative
phosphorylation while retaining cytoplasmic
(F.sub.1F.sub.0)H.sup.+-ATP synthase for the gratuitous consumption
of ATP. Thus, less carbon was used in building cell mass, but
rather carbon was efficiently directed to the assimilation of
acetate.
[0118] The consumption of base to maintain pH 7.0 provides an
overall measure of total organic acid production (FIG. 3C). Higher
rates and maxima for TC24 and TC36 are consistent with more rapid
glucose metabolism. In general, variations in glucose utilization
were accompanied by corresponding changes in base utilization.
Thus, a higher consumption of base corresponds to a higher
utilization of glucose. The exponential nature of the early time
points reflects growth of the biocatalysts.
EXAMPLE 5
Improving Acetate Yields
[0119] Dicarboxylic acids and cell mass were the dominant competing
co-products from glucose. In order to evaluate the potential for
process changes to improve acetate yield, experiments were
conducted. Acetate yield was not improved by increasing the oxygen
level from 5% dissolved oxygen to 15% dissolved oxygen, by reducing
ammonia nitrogen (2 g L.sup.-1 ammonium phosphate) by 40% to limit
growth, or by increasing the initial concentration of glucose from
3% to 6% (Table 3).
[0120] However, a simple two-step batch feeding strategy was
beneficial. A second addition of 3% glucose at the end of the
growth phase (12 h) was metabolized to completion and produced 523
mM acetate with minimal increase in cell mass (FIG. 5). Acetate
yield for this two-step addition (6% total glucose) was 78% of the
theoretical maximum as compared to 68% for 3% glucose. The highest
acetate yield, 86% of the theoretical maximum, was obtained by
combining the one-step addition of 3% glucose with the nitrogen
limitation (Table 3). Additional fed-batch experiments were
conducted in which multiple additions were made to glucose levels
above 100 mM. With this approach, 878 mM acetate was produced
representing 75% of the maximum theoretical yield (Table 3).
[0121] Strain TC36 can be used as a biocatalysis platform for the
efficient production of oxidized products. Under conditions of
glucose excess, strain TC36 produced a maximum of 878 mM acetate,
75% of the maximum theoretical yield (Table 3) or 0.50 g acetate
per g glucose. Along with the acetate, only cell mass and small
amounts of organic acids were produced. It is likely that 878 mM
acetate approaches the upper limit of tolerance for the metabolism
in TC36.
[0122] Concentrations as low as 50 mM acetate have been shown to
induce a stress response in E. coli (Kirkpatrick, C., L. M. Maurer,
N. E. Oyelakin, Y. N. Yoncheva, R. Maurer, and J. L. Slonczewski,
2001 "Acetate and formate stress: Opposite responses in the
proteomes of Escherichia coli" J. Bacteriol. 183:6466-6477). The
minimal inhibitory concentration for growth has been previously
reported as 300-400 mM acetate at neutral pH (Lasko, D. R., N.
Zamboni, and U. Sauer, 2000 "Bacterial response to acetate
challenge: a comparison of tolerance among species" Appl.
Microbiol. Biotechnol. 54:243-247; Zaldivar, J., and L. O. Ingram,
1999 "Effects of organic acids on the growth and fermentation of
ethanologenic Escherichia coli LY01" Biotechnol. Bioengin.
66:203-210). Oxygen transfer often becomes limiting during aerobic
bioconversion processes, promoting the accumulation of reduced
products (Tsai, P. S., M. Nageli, and J. E. Bailey, 2002
"Intracellular expression of Vitreoscilla hemoglobin modifies
microaerobic Escherichia coli metabolism through elevated
concentration and specific activity of the cytochrome o"
Biotechnol. Bioeng. 79:558-567; Varma, A., B. W. Boesch, and B. O.
Palsson, 1993 "Stoichiometric interpretation of Escherichia coli
glucose catabolism under various oxygenation rates" Appl. Environ.
Microbiol. 59:2465-2473).
[0123] Synthesis of reduced products was eliminated by mutations in
genes (.DELTA.focApflB .DELTA.frdCD .DELTA.ldhA .DELTA.adhE)
encoding the four major fermentation pathways. Excessive oxygen
demand and NADH production were also reduced by a deletion in
succinate dehydrogenase (sucA.DELTA.). The resulting strain,
TC36(.DELTA.focApflB.DELTA.frdCD .DELTA.ldhA .DELTA.atpFH
.DELTA.sucA .DELTA.adhE) metabolizes sugars to acetate with the
efficiency of fermentative metabolism, diverting a minimum of
carbon to cell mass (biocatalyst) and CO.sub.2. By replacing the
acetate pathway, a variety of alternative oxidized products can be
produced using the mutational strategies employed for the
construction of TC36.
[0124] E. coli TC36 offers a unique set of advantages over
currently employed biocatalysts for the commercial production of
acetate: a single step process using sugars as substrates, high
rates of acetate production, high acetate yields, simple nutrition
(mineral salts), and a robust metabolism permitting the
bioconversion of hexoses, pentoses, and many dissacharides.
EXAMPLE 6
Production of Pyruvic Acid
Materials and Methods
[0125] Microorganisms and media. Strains and plasmids used
according to this Example 6 are listed in Table 4. Working cultures
of E. coli W3110 (ATCC 27325) and derivatives were maintained on a
minimal medium containing mineral salts (per liter: 3.5 g
KH.sub.2PO.sub.4; 5.0 g K.sub.2HPO.sub.4; 3.5 g
(NH.sub.4).sub.2HPO.sub.4, 0.25 g MgSO.sub.4 7 H.sub.2O, 15 mg
CaCl.sub.2 2 H.sub.2O, 0.5 mg thiamine, and 1 ml of trace metal
stock), glucose (2% in plates; 3% in broth), and 1.5% agar. The
trace metal stock was prepared in 0.1 M HCl (per liter: 1.6 g
FeCl.sub.3, 0.2 g CoCl.sub.2 6 H.sub.2O, 0.1 g CuCl.sub.2, 0.2 g
ZnCl.sub.2 4 H.sub.2O, 0.2 g NaMoO.sub.4, and 0.05 g H.sub.3BO3).
MOPS (0.1 M, pH 7.4) was added to both liquid and solid media when
needed for pH control, but was not included in pH-controlled
fermentations. During plasmid and strain construction, cultures
were grown in Luria-Bertani (LB) broth or on LB plates (1.5% agar)
(Miller, J. H. 1992). Glucose (2%) was added to LB medium for all
strains containing mutations in (F.sub.1F.sub.0)H.sup.+- -ATP
synthase. Antibiotics were included as appropriate (kanamycin, 50
mg L.sup.-1; ampicillin, 50 mg L.sup.-1; apramycin, 50 mg L.sup.-1;
and tetracycline, 12.5 or 6.25 mg L.sup.-1).
[0126] Genetic Methods. Standard methods were used for plasmid
construction, phage P1 transduction, electroporation, and
polymerase chain reaction (PCR) (Miller, J. H., 1992 "A short
course in bacterial genetics: A laboratory manual and handbook for
Escherichia coli and related bacteria. Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.; Sambrook, J. and D. W. Russell, 2001
Molecular cloning: A laboratory manual. Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.). Chromosomal DNA served as a template to
amplify ackA and poxB genes using primers (ORFmers) complementary
to coding regions purchased from Sigma-Genosys, Inc. (The
Woodlands, Tex.). PCR products were initially cloned into plasmid
vector pCR2.1-TOPO. Integration of linear DNA was facilitated by
using pKD46 (temperature conditional) containing an
arabinose-inducible Red recombinase (Datsenko, K. A. & Wanner,
B. L. 2000). Integrants were selected for tetracycline (6.25 mg
L.sup.-1) resistance and screened for appropriate antibiotic
resistance markers and phenotypic traits. At each step, mutations
were verified by analyses of PCR products and fermentation
profiles. The FRT-flanked antibiotic resistance genes used for
selection were deleted using a temperature-conditional plasmid
(pFT-A) expressing FLP recombinase from a
chlortetracycline-inducible promoter (Martinez-Morales, F., A. G.
Borges, A. Martinez, K. T. Shanmugam, and L. O. Ingram, 1999
"Chromosomal integration of heterologous DNA in Escherichia coli
with precise removal of markers and replicons during construction"
J. Bacteriol. 181:7143-7148; Posfai, G., M. D. Koob, H. A.
Kirkpatrick, and F. C. Blattner, 1997 "Versatile insertion plasmids
for targeted genome manipulations in bacteria: Isolation, deletion,
and rescue of the pathogenicity island LEE of the Escherichia coli
O157:H7 genome" J. Bacteriol. 179:4426-4428).
[0127] Disruption of pyruvate oxidase (poxB). The poxB coding
region (1.7 kbp) was amplified by PCR using primers (ORFmers)
obtained from Sigma-Genosys (The Woodlands, Tex.) and ligated into
pCR2.1-TOPO. A single clone was selected in which the poxB gene was
oriented in the same direction as the lac promoter (pLOI2075). To
eliminate extraneous BsaBI sites in the vector, the EcoRI fragment
from pLOI2075 containing poxB was ligated into the unique EcoR1
site of pLOI2403 to produce plasmid pLOI2078. The small SmaI
fragment (1.63 kbp) from pLOI2065 containing a tet gene flanked by
FRT sites was ligated into the unique BsaBI site within the poxB
gene in pLOI2078 to produce pLOI2080. After digestion with HindIII,
pLOI2080 served as a template for the amplification of
poxB::FRT-tet-FRT (3.4 kbp) using poxB primers. Amplified DNA was
electroporated into E. coli W3110(pKD46) while expressing Red
recombinase. Plasmid pKD46 was eliminated by incubation at
42.degree. C. Double crossover recombinants were identified using
antibiotic markers (tetracycline resistant; sensitive to ampicillin
and kanamycin) and confirmed by PCR analysis using the poxB ORFmers
(1.7 kbp fragment for W3110; 3.4 kbp fragment for mutants). One
clone was selected and designated LY74.
[0128] Phage P1 was used to transduce the poxB::FRT-tet-FRT
mutation from LY74 into TC36 to produce TC41. The tet gene was
removed from TC41 using the FLP recombinase (pFT-A). After
elimination of pFT-A by growth at 42.degree. C., the poxB::FRT was
confirmed by a comparison of PCR products using poxB primers (1.8
kbp for the mutant; 1.7 kbp for the wild type). The resulting
strain was designated TC42 [(focA-pflB::FRT)
frdBC::FRT.ldhA.atpFH::FRT.adhE::FRT.sucA::FRTpoxB::FRT].
4TABLE 4 Sources and characteristics of strains and plasmids used
in Example 6. Strains & Plasmids Relevant Characteristics
Reference Strains W3110 K12 wild type ATCC 27325 TOP10F' lacl.sup.q
(episome) Invitrogen LY01 E. coli B, frd pfl::pdc.sub.Zm
adhE.sub.Zm Footnote.sup.1 cat LY74 W3110, .DELTA.poxB::FRT-tet-FRT
Described herein SZ61 W3110, .DELTA.ackA::FRT-tet-FRT
Footnote.sup.2 TC36 W3110, (Succ.sup.+), Footnote.sup.3
.DELTA.(focA-pflB)::FRT .DELTA. frdBC .DELTA.
ldhA.DELTA.atp(FH)::FRT .DELTA.adhE:: FRT .DELTA.sucA::FRT TC37
W3110, (Succ.sup.+), Described herein .DELTA.(focA-pflB)::FRT
.DELTA.frdBC .DELTA.ldhA .DELTA.atp(FH)::FRT .DELTA.adhE::FRT
.DELTA.sucA:: FRT .DELTA.ackA::FRT- tet-FRT TC38 W3110,
(Succ.sup.+), .DELTA.(focA-pflB):: Described herein FRT
.DELTA.frdBC .DELTA.ldhA.DELTA.atp(FH):: FRT .DELTA.adhE::FRT
.DELTA.sucA:: FRT .DELTA.ackA::FRT TC41 W3110, (Succ.sup.+),
.DELTA.(focA-pflB):: Described herein FRT .DELTA.frdBC
.DELTA.ldhA.DELTA.atp(FH):: FRT .DELTA.adhE::FRT .DELTA.sucA:: FRT
.DELTA.poxB::FRT-tet-FRT TC42 W3110, (Succ.sup.+),
.DELTA.(focA-pflB):: Described herein FRT .DELTA.frdBC
.DELTA.ldhA.DELTA.atp(FH):: FRT .DELTA.adhE::FRT .DELTA.sucA:: FRT
.DELTA.poxB::FRT TC43 W3110, (Succ.sup.+), .DELTA.(focA-pflB)::
Described herein FRT .DELTA.frdBC .DELTA.ldhA.DELTA.atp(FH)::FRT
.DELTA. adhE::FRT .DELTA.sucA::FRT .DELTA.poxB:: FRT
.DELTA.ackA::FRT-tet-FRT TC44 W3110, (Succ.sup.+),
.DELTA.(focA-pflB):: Described herein FRT .DELTA.frdBC
.DELTA.ldhA.DELTA.atp(FH)::FRT .DELTA. adhE::FRT .DELTA.sucA::FRT
.DELTA.poxB:: FRT .DELTA.ackA::FRT Plasmids pCR2.1-TOPO bla kan,
TOPO .TM. TA cloning vector Invitrogen pFT-A bla flp low-copy
vector containing Footnote.sup.4 recombinase and temperature-
conditional pSC101 replicon pKD46 bla .gamma..beta. exo low-copy
vector Footnote.sup.5 containing red recombinase and
temperature-conditional pSC101 replicon pLOI2065 bla, SmaI fragment
with FRT flanked Footnote.sup.6 tet gene pLOI2075 bla kan poxB
Described herein pLOI2078 bla poxB Described herein pLOI2080 bla
poxB::FRT-tet-FRT Described herein pLOI2403 bla Footnote.sup.7
.sup.1Yomano, L. P., S. W. York, and L. O. Ingram. 1998. Isolation
and characterization of ethanol-tolerant mutants of Escherichia
coli KO11 for fuel ethanol production. J. Ind. Microbiol. Biot. 20:
132-138. .sup.2Zhou, S., T. B. Causey, A. Hasona, K. T. Shanmugam
and L. O. Ingram. 2003. Production of optically pure D-lactic acid
in mineral salts medium by metabolically engineered Escherichia
coli W3110. Appl. Environ. Microbiol. 69: 399-407. .sup.3Causey, T.
B., S. Zhou, K. T. Shanmugam, L. O. Ingram. 2003. Engineering
Escherichia coli W3110 for the conversion of sugar to redox-neutral
and oxidized products: Homoacetate production. Proc. Natl. Acad.
Sci, USA. 100: 825-832. .sup.4Posfai, G., M. D. Koob, H. A.
Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion plasmids
for targeted genome manipulations in bacteria: Isolation, deletion,
and rescue of the pathogenicity island LEE of the Escherichia coli
O157:H7 genome. J. Bacteriol. .sup.5Datsenko, K. A. and B. L.
Wanner. 2000. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.
USA 97: 6640-6645. .sup.6Underwood, S. A., S. Zhou, T. B. Causey,
L. P. Yomano, K. T. Shanmugam, and L. O. Ingram. 2002. Genetic
changes to optimize carbon partitioning between ethanol and
biosynthesis in ethanologenic Escherichia coli. Appl. Environ.
Microbiol. 68: 6263-6272. .sup.7Martinez-Morales, F., A. G. Borges,
A. Martinez, K. T. Shanmugam, and L. O. Ingram. 1999. Chromosomal
integration of heterologous DNA in Escherichia coli with precise
removal of markers and replicons during construction. J. Bacteriol.
181: 7143-7148.
[0129] Deletion of ackA (acetate kinase). Phage P1 was used to
transduce the .ackA::FRT-tet-FRT mutation from SZ61 (Zhou, S., T.
B. Causey, A. Hasona, K. T. Shanmugam and L. O. Ingram, 2003
"Production of optically pure D-lactic acid in mineral salts medium
by metabolically engineered Escherichia coli W3110" Appl. Environ.
Microbiol. 69:399-407) into TC36 and TC42 to produce strain TC37
[(focA-pflB::FRT)frdBC::FRT.ldhA.atpFH::F-
RT.adhE::FRT.sucA::FRT.ackA::FRT-tet-FRT] and TC43
[(focA-pflB::FRT)frdBC:-
:FRT.ldhA.atpFH::FRT.adhE::FRT.sucA::FRTpoxB::FRT.ackA::FRT-tet-FRT],
respectively. Chromosomal integration was verified by comparison of
PCR products obtained from SZ61(2.8 kbp) and W3110 (1.2 kbp) using
ackA primers (ORFmers, Sigma-Genosys). A reduction in acetate
production was verified for each strain by HPLC analysis of broth
obtained from overnight cultures grown in mineral salts medium
containing 167 mM glucose (37.degree. C.,120-rpm). Plasmid pFT-A
containing the FLP recombinase was used to excise the tet genes.
After removal of this plasmid by incubation at 42.degree. C.,
resulting strains were designated TC38 [(focA-pflB::FRT)
frdBC::FRT.ldhA.atpFH::FRT.adhE::FRT.sucA::FRT.ack- A::FRT) and
TC44 [(focA-pflB::FRT)frdBC::FRT.ldhA.atpFH::FRT.adhE::FRTsucA-
::FRTpoxB::FRT.ackA::FRT], respectively.
[0130] Fermentation. Ten-liter batch fermentations (37.degree. C.,
dual Rushton impellers, 450 rpm) with strain TC36 were conducted in
minimal medium containing glucose (170 mM and 340 mM) using New
Brunswick Bioflow 3000 fermentors (New Brunswick Scientific) as
described previously (Causey, T. B., S. Zhou, K. T. Shanmugam, L.
O. Ingram, 2003 "Engineering Escherichia coli W3110 for the
conversion of sugar to redox-neutral and oxidized products:
Homoacetate production" Proc. Natl. Acad. Sci, USA 100:825-832).
Five-liter batch fermentations (37.degree. C., dual Rushton
impellers, 350 rpm) were carried out in 8 L vessels. Unless stated
otherwise, dissolved oxygen levels were 100% of air saturation at
the time of inoculation and allowed to fall to 5% of air saturation
during continuous sparging with air (0.2 vvm). This 5% level was
maintained during subsequent incubation by mixing O.sub.2 with air
while maintaining a constant flow rate of 1.0 L min.sup.-1. Broth
was maintained at pH 7.0 by the automatic addition of 11.4 M KOH.
During fed-batch experiments, glucose was added from a sterile 4 M
stock. Two fed batch regimes were investigated: 1) 3% initial
glucose followed the addition of 3% glucose after 15 h (6% total);
2) 3% initial glucose with the addition of 590 ml of 4 M glucose at
a constant rate over a 20-h period (9.8% total glucose).
[0131] Seed cultures were prepared by inoculating colonies from a
fresh plate (48 h) into 3 ml of glucose-minimal medium
(13.times.100 mm tube) containing 0.1 M MOPS. One ml of this cell
suspension was diluted 100-fold into 1-L baffled flasks containing
200 ml of mineral salts medium (37.degree. C., 280 rpm). When cells
reached 1.0-1.5 OD.sub.550nm, sufficient culture volume was
harvested (5000.times.g, 25.degree. C.) to provide an inoculum of
16.5 mg dry cell weight L.sup.-1.
[0132] Broth samples were removed to measure organic acids,
residual glucose, and cell mass. Volumetric and specific rates were
estimated from measured values for glucose and acetate using
GraphPad Prism (GraphPad Software, San Diego, Calif.). A smooth
curve was generated with 10 points per min (Lowess method) to fit
measured results. The first derivative (acetate or glucose versus
time) of each curve served as an estimate of volumetric rate.
Specific rates (mmoles L.sup.-1 h.sup.-1 mg.sup.-1 dry cell weight)
were calculated by dividing volumetric rates by respective values
for cell mass.
[0133] Analyses. Organic acids and glucose were measured using a
Hewlett Packard HPLC (HP 1090 series II) equipped with a UV monitor
(210 nm) and refractive index detector. Products were separated
using a Bio-Rad HPX-87H column (10 .mu.l injection) with 4 mM
H.sub.2SO.sub.4 as the mobile phase (0.4 ml min.sup.-1, 45.degree.
C.). Cell mass was estimated by measuring OD.sub.550nm (1.0
OD.sub.550nm is equivalent to 0.33 g L.sup.-1 dry cell weight)
using a Bausch & Lomb Spectronic 70 spectrophotometer and
10.times.75 mm culture tubes as cuvettes.
[0134] Results and Methods
[0135] Pyruvate as a co-product during acetate fermentations.
Escherichia coli TC36 (pflBfrdBC.ldhA.atpFH.adhE.sucA), as
described above, was engineered from W3110 (prototrophic) for the
production of acetate (FIG. 6A) by combining chromosomal deletions
which minimize cell yield, fermentation products (reduced), oxygen
consumption, and CO.sub.2 evolution (Causey, T. B. et al. 2003). In
this strain, glycolytic flux was 2-fold that of the parent W3110
due to deletion of genes (atpFH) encoding two membrane proteins
that coupling the F.sub.1 and F.sub.0 components of the
F.sub.1F.sub.0(H.sup.+)ATP synthase complex. This mutation
eliminated ATP production by oxidative phosphorylation and also
created an active, cytoplasmic F.sub.1(H.sup.+)ATPase (FIGS. 6B and
6C). Glycolytic flux in TC36 exceeded the capacity for acetate
production under the conditions used for acetate production (5% air
saturation at inoculation and during fermentation) resulting in the
transient accumulation of approximately 16 mM pyruvate near the end
of exponential growth (FIG. 7).
[0136] By inoculating the fermentor at an initial dissolved oxygen
level of 100% air saturation (rather than 5% of saturation) and
sparging with air until the oxygen level declined from 100% to 5%
air saturation, then adding oxygen to maintain 5% of air
saturation, the peak level of pyruvate of was increased to 81 mM
(FIG. 7). Under these conditions, pyruvate yields were 25% of the
maximum theoretical yield at the peak and 11% of the maximum
theoretical yield at the end of fermentation when glucose was fully
metabolized (Table 5).
[0137] Effect of an acetate kinase (ackA) mutation on pyruvate
production. Although there are many metabolic routes that can lead
to acetate, the primary catabolic routes for acetate production in
E. coli are the conversion of acetyl.about.CoA to acetate by
phosphotransacetylase (pta) and acetate kinase (ackA) and the
direct oxidation of pyruvate to acetate by pyruvate oxidase (poxB)
(FIG. 6A).
[0138] To block the acetate kinase route, strain TC38 was
constructed from TC36 by deleting the central region of the ackl
gene. This additional deletion reduced the net production of ATP by
30% (FIG. 6A), cell yield by 36% (FIG. 8A; Table 5), and the rate
of growth by 45% (Table 6). This mutation also reduced glycolytic
flux by 45% (Table 6) and increased the time required to complete
fermentations from 18 h for TC36 to 24 h for TC44 (FIG. 8B).
Acetate production was reduced by 85% (FIG. 8C; Table 5),
consistent with the acetate kinase pathway being the dominant route
for acetate production in TC36.
[0139] Although both volumetric and specific rates of glucose
metabolism were lower for TC38 (Table 6), the pyruvate yield was
5.5-fold higher (Table 5; FIG. 8D) and the specific rate of
pyruvate production was 4-fold higher (Table 6) than for TC36.
SmaII amounts of 2-oxoglutarate, succinate, and fumarate were
produced by both strains. From 10% to 15% of the carbon was not
recovered as cell mass or acidic fermentation products and may have
been lost as CO.sub.2 due to metabolic cycling. With strain TC38,
the pyruvate yield was 58% of the theoretical maximum. Acetate
(28.9 mM) remained as the second most abundant product.
[0140] Effect of a pyruvate oxidase (poxB) mutation on pyruvate
production. Pyruvate can be converted directly to acetate by the
membrane-bound protein pyruvate oxidase using the electron
transport system to couple oxygen as the terminal electron
acceptor. The poxB gene is typically repressed during exponential
growth but is induced by stress or entry into stationary phase
(Chang, Y.-Y. and J. E. Cronan Jr. 1983; Chang, Y.-Y. et al.
1994).
[0141] Strain TC42 was constructed from TC36 by inserting a short
DNA segment containing stop codons into the central region of poxB.
In contrast to the ackA deletion (TC38), the poxB mutation (TC42)
caused relatively small changes in metabolic products (Table 5)
consistent with a minor role for the PoxB pathway. Acetate levels
for TC42 were 10% lower and pyruvate levels were higher than for
TC36 (Table 5; FIGS. 8C and 8D). Although this represented a 2-fold
improvement in pyruvate yield over TC36, the overall yield for
pyruvate with TC42 was less than 30% of the theoretical maximum
(Table 5). These changes in metabolic products would have little
effect on ATP yields (FIG. 6A). Unlike the mutation in ackA,
inactivation of poxB did not reduce the rate of growth or glucose
metabolism (FIG. 6A; Table 6).
[0142] Effect of combining mutations in pyruvate oxidase (poxB) and
acetate kinase (ackA) on the production of pyruvate. To improve
pyruvate yield and reduce acetate production, strain TC44
(pflBfrdBC.ldhA.atpFH.ad- hE.sucA poxB::FRT.ackA) was constructed
in which both acetate kinase and pyruvate oxidase are inactive.
Inactivation of poxB was beneficial for growth and pyruvate
production (FIG. 8A; Table 5 and Table 6) in comparison to TC38, an
isogenic strain containing a functional poxB. Adding the poxB
mutation substantially restored both volumetric and specific rates
of glucose metabolism to that observed for TC36 (Table 6) in which
both acetate pathways are functional, while further reducing
acetate production. Acetate production by TC44 was reduced by more
than half in comparison to TC38 (acetate kinase deletion) and
pyruvate yield was increased by 17%. The specific rate of pyruvate
production by TC44 was 8-fold that of TC36 and twice that of TC38
(Table 5). The time required to complete fermentation with TC44 was
30% shorter than with TC 38 (FIG. 8B). Broth containing 3% glucose
(167 mM) was converted into 2.2% pyruvate (252 mM) after 18 h in
mineral salts medium (FIG. 8D). Although acetate levels were
substantially reduced by the combining of poxB and ackA mutation
(FIG. 8C), acetate and dicarboxylic acids remained as minor
products.
[0143] The beneficial role of a poxB mutation for pyruvate
production. The pyruvate oxidase catalyzed oxidation of pyruvate to
acetate (and CO.sub.2) also contributes to the requirement for
oxygen as an electron acceptor. Oxygen transfer rates are
frequently limiting during aerobic fermentations at relatively high
levels of saturation, and may be even more problematic under
fermentation conditions (5% of air saturation). Eliminating the
primary route for acetyl.about.CoA dissimilation (ackA) in TC38
increased pyruvate production and may also increase the amount of
pyruvate that is metabolized by PoxB. Increasing oxygen saturation
from 5% to 50% during TC38 fermentations (Table 5 and Table 6) was
beneficial. Cell yield, pyruvate yield, and the specific rate of
glucose metabolism were 8% to 41% higher for TC38 at 50% air
saturation than at 5% air saturation. These results were very
similar to those observed for the isogenic poxB mutant, TC44,
during fermentation at 5% air saturation. Increasing the oxygen
saturation during TC38 fermentations also decreased the final
concentrations of acetate to a level equivalent to TC44 at 5% air
saturation and decreased the production of dicarboxylic acids. As
with TC44, low levels of acetate and dicarboxylic acids were also
present at the end of fermentation with TC38 (50% air saturation)
(Table 5).
[0144] Improving pyruvate yields and titers in TC44 by altering
fermentation conditions. With TC44 decreasing the ammonia level by
half did not increase product yields (Table 5). Doubling of the
initial concentration of glucose or providing a second addition of
glucose (3% plus 3%) resulted in a small increase (11%) in yield
accompanied by a 2-fold increase in final pyruvate titer. The
highest level of pyruvate, 749 mM, was produced with excess
glucose. This may represent the limit for pyruvate tolerance. When
pyruvate is added to minimal media at 600 mM, growth of wild type
strains of E. coli is substantially inhibited.
[0145] In contrast to biocatalysts where vitamins and other complex
nutrients are required for effective production of pyruvate by
fermentation, the new biocatalyst of the subject invention, E. coli
TC44, requires only mineral salts and glucose. The lack of a
requirement for vitamin supplements, complex nutrients or
complicated process controls for TC44 provides a substantial
savings in production costs. In addition, the lack of complex
nutrients in the fermentation broth reduces costs associated with
product purification and waste disposal.
[0146] Pyruvate can be produced by a variety of microorganism
including mutants of yeasts and bacteria. However, E. coli TC44
provides a competitive alternative to the current
pyruvate-producing biocatalysts due to high yields, high product
titers, simple fermentation conditions, and the ability to grow
well in mineral salts medium with glucose as the sole carbon source
(Table 7).
5TABLE 5 Products formed from glucose catabolism by E. coli strains
described herein. Carbon Product Concentrations (mM).sup.a Rep-
Cell mass Balance Pyruvate yield 2- Strain Condition licates (g
.multidot. L.sup.-1) (%) (% theoretical).sup.b Pyruvate Acetate
Oxoglutarate Succinate Fumarate 3% Glucose TC36 5% DO.sup.c 3 3.64
.+-. 0.31 97.9 .+-. 4.8 0.31 .+-. 0.22 1.0 .+-. 0.7 223.8 .+-. 14.0
29.0 .+-. 23.7 4.6 .+-. 2.2 <0.1 3% Glucose TC36 100->5%
DO.sup.d 3 3.47 .+-. 0.23 89.0 .+-. 2.7 10.5 .+-. 7.9 .sup. 38.1
.+-. 27.2.sup.j 197.7 .+-. 21.1 16.6 .+-. 16.2 13.7 .+-. 13.2 1.4
.+-. 0.2 3% Glucose TC38 100->5% DO.sup.d 3 2.21 .+-. 0.09 84.3
.+-. 5.2 57.5 .+-. 2.6 194.5 .+-. 9.1 28.9 .+-. 16.7 10.5 .+-. 1.9
8.1 .+-. 9.1 0.8 .+-. 0.7 3% Glucose TC38 100->50% DO.sup.e 2
2.40 84.7 68.8 241.9 7.0 7.9 nd.sup.k nd.sup.k 3% Glucose TC42
100->5% DO.sup.d 2 3.40 86.8 29.1 79.0 178.4 76.2 24.3 1.7 3%
Glucose TC44 100->5% DO.sup.d 3 2.36 .+-. 0.10 88.5 .+-. 0.6
69.3 .+-. 1.5 252.5 .+-. 6.2 11.6 .+-. 1.2 3.6 .+-. 1.2 16.8 .+-.
0.7 1.1 .+-. 0.2 3% Glucose 1/2 Nitrogen TC44 100->5% DO.sup.f 2
2.02 73.6 38.8 125.2 50.3 30.0 7.7 2.9 3 + 3% Glucose TC44
100->5% DO.sup.g 2 2.63 86.7 72.3 479.8 39.8 31.7 10.9 0.7 6%
Glucose TC44 100->5% DO.sup.h 2 1.95 94.8 77.9 588.9 46.0 26.1
nd.sup.k 0.7 Excess Glucose TC44 100->5% DO.sup.i 2 2.51
na.sup.l na.sup.l 749.0 na.sup.l 45.3 na.sup.l 4.9 .sup.aUnless
stated otherwise the concentrations represent measurements at the
time of complete glucose consumption. .sup.bMaximum theoretical
yield is 2 moles pyruvate per mole glucose (0.978 g pyruvate
g.sup.-1 glucose). .sup.c3% glucose 10 L batch fermentation with
the dissolved oxygen controlled at 5% of air saturation by
adjusting the ratio of O.sub.2 and N.sub.2 (Causey et al. 2003).
.sup.d3% glucose 5 L batch fermentation with the dissolved oxygen
allowed to fall from 100% to 5% of air saturation. .sup.e3% glucose
5 L batch fermentation with the dissolved oxygen allowed to fall
from 100% to 50% of air saturation. .sup.f3% glucose 5 L batch
fermentation with the dissolved oxygen allowed to fall from 100% to
50% of air saturation. The (NH.sub.4).sub.2PO.sub.4 concentration
was reduced to 1.25 g L.sup.-1. .sup.g3% initial glucose 5 L batch
fermentation with the addition of 3% glucose after 15 h. The
dissolved oxygen was allowed to fall from 100% to 50% of air
saturation. .sup.h6% glucose 5 L batch fermentation with the
dissolved oxygen allowed to fall from 100% to 50% of air
saturation. .sup.i3% initial glucose 5 L batch fermentation with
the automatic addition of 590 ml of 4 M glucose over a period of 20
h. The dissolved oxygen was allowed to fall from 100% to 50% of air
saturation. .sup.jThe maximum pyruvate concentration measured
during glucose fermentations ranged from 14.88 mM to 111.89 mM.
Pyruvate excretion in TC36 is very sensitive to dissolved oxygen,
where elevated dissolved oxygen results in more pyruvate being
excreted. The concentration of acetate at the time all glucose has
been consumed depends on the amount of pyruvate produced. Pyruvate
is rapidly converted to acetate after glucose is depleted. # The
high standard deviations are a result of small differences in
dissolved oxygen concentrations between fermentors and
co-metabolism of the excreted pyruvate and glucose. .sup.kNot
detected. .sup.lNot available
[0147]
6TABLE 6 Comparison of biocatalysts for pyruvate production.
Volumetric Pyruvate Relevant Carbon Nitrogen Fermentation
[Pyruvate] Production Yield Strain genotype/phenotype Source Source
Time (h) (g .multidot. L.sup.-1) (g .multidot. L.sup.-1h.sup.-1) (g
.multidot. g.sup.-1) Reference Candida lipolytica B.sub.1.sup.-
Met.sup.- glucose NH.sub.4NO.sub.3 72 44 0.61 0.44 Footnote.sup.1
AJ 14353 Debaryomyces B.sub.1.sup.- Bio.sup.- glucose Peptone 96 42
0.44 0.42 Footnote.sup.1 hansenii Y-256 Torulopsis B.sub.1.sup.-
Bio.sup.- B.sub.6.sup.- NA.sup.- glucose Soybean 47 60 1.28 0.68
Footnote.sup.1 glabrata acetate leaky hydrolysate ACII-3
(NH.sub.4).sub.2SO.sub.4 Torulopsis B.sub.1.sup.- Bio.sup.- B.sub.6
.sup.- NA.sup.- glucose NH.sub.4Cl 56 69 1.23 0.62 Footnote.sup.1
glabrata WSH-IP 303 Escherichia coli lipA2 bgl.sup.+atpA401 glucose
Polypeptone 24 30 1.25 0.60 Footnote.sup.2 TBLA-1 Escherichia coli
aceF fadR adhE ppc glucose Tryptone 36 35 0.97 0.65 Footnote.sup.3
CGSC7916 acetate (NH.sub.4).sub.2HPO.sub- .4 Escherichia coli pflB
frdBC ldhA glucose (NH.sub.4).sub.2HPO.sub- .4 43 52 1.21 0.76
Described herein TC44 atpFH adhE sucA ackA poxB .sup.1Li, Y., J.
Chen, and S. -Y. Lun, and X. S. Rui, 2001 "Efficient pyruvate
production by a multi-vitamin auxotroph of Torulopsis glabrata: key
role and optimization of vitamin levels" Appl. Microbiol.
Biotechnol. 55: 680-685. .sup.2Yokota, A., Y. Terasawa, N. Takaoka,
H. Shimizu, and F. Tomita, 1994 "Pyruvic acid production by an
F.sub.1-ATPase-defective mutant of Escherichia coli W1485lip2"
Biosci. Biotech. Biochem. 58: 2164-2167. .sup.3Tomar, A., M. A.
Eiteman, and E. Altman, 2003 "The effect of acetate pathway
mutations on the production of pyruvate in Escherichia coli." Appl.
Microbiol. Biotechnol. 62: 76-82.
[0148]
7TABLE 7 Comparison of metabolic rates. Glucose Consumption Rate
Pyruvate Production Rate Volumetric.sup.a Specific.sup.b
Volumetric.sup.a Specific.sup.b .mu..sub.max (mmol .multidot. (mmol
.multidot. (mmol .multidot. (mmol .multidot. Strain (h.sup.-1)
L.sup.-1 .multidot. h.sup.-1) L.sup.-1 .multidot. h.sup.-1
.multidot. g.sup.-1 cdw) L.sup.-1 .multidot. h.sup.-1) L.sup.-1
.multidot. h.sup.-1 .multidot. g.sup.-1 cdw) TC36.sup.c 0.49 .+-.
0.03 10.1 .+-. 2.6 17.6 .+-. 1.5 nd.sup.f nd.sup.f (pflB frdBC ldhA
atpFH adhE sucA) TC36.sup.d 0.51 .+-. 0.01 10.7 .+-. 0.9 29.7 .+-.
3.5 3.8 .+-. 3.0 5.3 .+-. 3.1 (pflB frdBC ldhA atpFH adhE sucA)
TC38.sup.d 0.28 .+-. 0.01 6.7 .+-. 0.6 16.3 .+-. 2.2 8.3 .+-. 0.7
21.1 .+-. 3.7 (pflB frdBC ldhA atpFH adhE sucA ackA) TC38.sup.e, g
0.21 6 28 8 28 (pflB frdBC ldhA atpFH adhE sucA ackA) TC42.sup.d, g
0.55 10 17 6 10 (pflB frdBC ldhA atpFH adhE sucA poxB) TC44.sup.d
0.34 .+-. 0.02 9.7 .+-. 0.7 27.2 .+-. 4.1 13.1 .+-. 0.3 40.4 .+-.
7.4 (pflB frdBC ldhA atpFH adhE sucA poxB ackA) .sup.aAverage
volumetric rates of glucose utilization and pyruvate production.
.sup.bMaximum specific rates of glucose utilization and pyruvate
production per g dry cell weight (dcw). .sup.c3% glucose 10 L batch
fermentation with the dissolved oxygen controlled at 5% of air
saturation by adjusting the ratio of O.sub.2 and N.sub.2. .sup.d3%
glucose 5 L batch fermentation with the dissolved oxygen allowed to
fall from 100% to 5% of air saturation. .sup.eFermentation
conducted with the dissolved oxygen controlled at 50% of air
saturation. .sup.fNot determined. .sup.gAverage of two
experiments.
[0149] All patents, patent applications, provisional applications,
and publications referred to or cited herein are incorporated by
reference in their entirety, including all figures and tables, to
the extent they are not inconsistent with the explicit teachings of
this specification.
[0150] It should be understood that the examples and embodiments
described herein are for illustrative purposes only and that
various modifications or changes in light thereof will be suggested
to persons skilled in the art and are to be included within the
spirit and purview of this application.
Sequence CWU 1
1
2 1 65 DNA Artificial Sequence sense primer 1 ttactccgta tttgcataaa
aaccatgcga gttacgggcc tataagtgta ggctggagct 60 gcttc 65 2 64 DNA
Artificial Sequence antisense primer 2 tagattgagt gaaggtacga
gtaataacgt cctgctgctg ttctcatatg aatatcctcc 60 ttag 64
* * * * *