U.S. patent application number 10/802823 was filed with the patent office on 2004-07-29 for prostate-specific gene, pcgem1, and methods of using pcgem1 to detect, treat, and prevent prostate cancer.
This patent application is currently assigned to Henry M. Jackson Foundation for the Advancement of Military Medicine. Invention is credited to Moul, Judd W., Srikantan, Vasantha, Srivastava, Shiv, Zou, Zhiqiang.
Application Number | 20040146932 10/802823 |
Document ID | / |
Family ID | 32737876 |
Filed Date | 2004-07-29 |
United States Patent
Application |
20040146932 |
Kind Code |
A1 |
Srivastava, Shiv ; et
al. |
July 29, 2004 |
Prostate-specific gene, PCGEM1, and methods of using PCGEM1 to
detect, treat, and prevent prostate cancer
Abstract
A nucleic acid sequence that exhibits prostate-specific
expression and over-expression in tumor cells is disclosed. The
sequence and fragments thereof are useful for detecting,
diagnosing, preventing, and treating prostate cancer and other
prostate related diseases. The sequence is also useful for
measuring hormone responsiveness of prostate cancer cells.
Inventors: |
Srivastava, Shiv; (Potomac,
MD) ; Srikantan, Vasantha; (Rockville, MD) ;
Zou, Zhiqiang; (Gaithersburg, MD) ; Moul, Judd
W.; (Bethesda, MD) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
1300 I STREET, NW
WASHINGTON
DC
20005
US
|
Assignee: |
Henry M. Jackson Foundation for the
Advancement of Military Medicine
|
Family ID: |
32737876 |
Appl. No.: |
10/802823 |
Filed: |
March 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10802823 |
Mar 18, 2004 |
|
|
|
09534072 |
Mar 24, 2000 |
|
|
|
60126469 |
Mar 26, 1999 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/7.23; 536/23.2 |
Current CPC
Class: |
C07K 14/4748 20130101;
A61K 48/00 20130101 |
Class at
Publication: |
435/006 ;
435/007.23; 536/023.2 |
International
Class: |
C12Q 001/68; G01N
033/574; C07H 021/04 |
Goverment Interests
[0002] The invention described herein may be manufactured,
licensed, and used for governmental purposes without payment of
royalties to us thereon.
Claims
We claim:
1. An isolated nucleic acid molecule selected from: (a) the
polynucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID
NO:8; (b) an isolated nucleic acid molecule that hybridizes to
either strand of a denatured, double-stranded DNA comprising the
nucleic acid sequence of (a) under conditions of moderate
stringency in about 50% formarnide and about 6.times.SSC at about
42.degree. C. with washing conditions of approximately 60.degree.
C., about 0.5.times.SSC, and about 0.1% SDS; (c) an isolated
nucleic acid molecule that hybridizes to either strand of a
denatured, double-stranded DNA comprising the nucleic acid sequence
of (a) under conditions of high stringency in about 50% formamide
and about 6.times.SSC, with washing conditions of approximately
68.degree. C., about 0.2.times.SSC, and about 0.1% SDS; (d) an
isolated nucleic acid molecule derived by in vitro mutagenesis from
SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:8; (e) an isolated nucleic
acid molecule degenerate from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID
NO:8, as a result of the genetic code; and (f) an isolated nucleic
acid molecule selected from the group consisting of human PCGEM1
DNA, an allelic variant of human PCGEM1 DNA, and a species homolog
of PCGEM1 DNA.
2. A recombinant vector that directs the expression of the nucleic
acid molecule of claim 1.
3. A host cell transfected or transduced with the vector of claim
2.
4. The host cell of claim 3 selected from bacterial cells, yeast
cells, and animal cells.
5. An isolated nucleic acid molecule comprising the polynucleotide
sequence selected from SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:
11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ
ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:
20, SEQ ID NO: 21, and SEQ ID NO: 22.
6. A method of detecting prostate cancer in a patient, the method
comprising: (a) detecting PCGEM1 mRNA in a biological sample from
the patient; and (b) correlating the amount of PCGEM1 mRNA in the
sample with the presence of prostate cancer in the patient.
7. The method according to claim 6, wherein step (a) includes: (a)
isolating RNA from the sample; (b) amplifying a PCGEM1 cDNA
molecule; (c) incubating the PCGEM1 cDNA with the nucleic acid
according to claim 1 or 5; and (d) detecting hybridization between
the PCGEM1 cDNA and the nucleic acid.
8. The method according to claim 7, wherein the PCGEM1 cDNA is
amplified with at least two nucleotide sequences selected from SEQ
ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID
NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19,
SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22.
9. The method according to claim 8, wherein the at least two
nucleotide sequences are SEQ ID NO:15 and SEQ ID NO:22.
10. A method according to claim 6, wherein the biological sample is
selected from blood, urine, and prostate tissue.
11. The method according to claim 10, wherein the biological sample
is blood.
12. A vector, comprising a PCGEM1 promoter sequence operatively
linked to a nucleotide sequence encoding a cytotoxic protein.
13. The vector of claim 12, wherein the PCGEM1 promoter sequence is
a nucleic acid molecule comprising the polynucleotide sequence of
SEQ ID NO:3.
14. A method of selectively killing a prostate cancer cell, the
method comprising: (a) introducing the vector according to claim 12
to the prostate cancer cell under conditions sufficient to permit
selective cell killing.
15. The method according to claim 14, wherein the cytotoxic protein
is selected from ricin, abrin, diphtheria toxin, p53, thymidine
kinase, tumor necrosis factor, cholera toxin, Pseudomonas
aeruginosa exotoxin A, ribosomal inactivating proteins, and
mycotoxins.
16. A method of identifying an androgen-responsive cell line, the
method comprising: (a) obtaining a cell line suspected of being
androgen responsive, (b) incubating the cell line with an androgen;
and (c) detecting PCGEM1 mRNA in the cell line, wherein an increase
in PCGEM1 mRNA, as compared to an untreated cell line, correlates
with the cell line being androgen responsive.
17. A method of measuring the responsiveness of a prostate tissue
to hormone-ablation therapy, the method comprising: (a) treating
the prostate tissue with hormone ablation therapy; and (b)
measuring PCGEM1 mRNA in the prostate tissue following hormone
ablation therapy, wherein a decrease in PCGEM1 mRNA, as compared to
an untreated cell line, correlates with the prostate tissue
responding to hormone ablation therapy.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is based upon U.S. provisional
application S.No. 60/126,469, filed Mar. 26, 1999, priority to
which is claimed under 35 U.S.C. .sctn. 119(e). The entire
disclosure of U.S. provisional application S.No. 60/126,469 is
expressly incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to nucleic acids that are
expressed in prostate tissue. More particularly, the present
invention relates to the first of a family of novel,
androgen-regulated, prostate-specific genes, PCGEM1, that is
over-expressed in prostate cancer, and methods of using the PCGEM1
sequence and fragments thereof to measure the hormone
responsiveness of prostate cancer cells and to detect, diagnose,
prevent and treat prostate cancer and other prostate related
diseases.
BACKGROUND
[0004] Prostate cancer is the most common solid tumor in American
men (1). The wide spectrum of biologic behavior (2) exhibited by
prostatic neoplasms poses a difficult problem in predicting the
clinical course f6r the individual patient (3, 4). Public awareness
of prostate specific antigen (PSA) screening efforts has led to an
increased diagnosis of prostate cancer. The increased diagnosis and
greater number of patients presenting with prostate cancer has
resulted in wider use of radical prostatectomy for localized
disease (5). Accompanying the rise in surgical intervention is the
frustrating realization of the inability to predict organ-confined
disease and clinical outcome for a given patient (5, 6).
Traditional prognostic markers, such as grade, clinical stage, and
pretreatment PSA have limited prognostic value for individual men.
There is clearly a need to recognize and develop molecular and
genetic biomarkers to improve prognostication and the management of
patients with clinically localized prostate cancer. As with other
common human neoplasia (7), the search for molecular and genetic
biomarkers to better define the genesis and progression of prostate
cancer is the key focus for cancer research investigations
worldwide.
[0005] The new wave of research addressing molecular genetic
alterations in prostate cancer is primarily due to increased
awareness of this disease and the development of newer molecular
technologies. The search for the precursor of prostatic
adenocarcinoma has focused largely on the spectrum of microscopic
changes referred to as "prostatic intraepithelial neoplasia" (PIN).
Bostwick defines this spectrum as a histopathologic continuum that
culminates in high grade PIN and early invasive cancer (8). The
morphologic and molecular changes include the progressive
disruption of the basal cell-layer, changes in the expression of
differentiation markers of the prostatic secretory epithelial
cells, nuclear and nucleolar abnormalities, increased cell
proliferation, DNA content alterations, and chromosomal and allelic
losses (8, 9). These molecular and genetic biomarkers, particularly
their progressive gain or loss, can be followed to trace the
etiology of prostate carcinogenesis. Foremost among these
biomarkers would be the molecular and genetic markers associated
with histological phenotypes in transition between normal prostatic
epithelium and cancer. Most studies so far seem to agree that PIN
and prostatic adenocarcinoma cells have a lot in common with each
other. The invasive carcinoma more often reflects a magnification
of some of the events already manifest in PIN.
[0006] Early detection of prostate cancer is possible today because
of the widely propagated and recommended blood PSA test that
provides a warning signal for prostate cancer if high levels of
serum PSA are detected. However, when used alone, PSA is not
sufficiently sensitive or specific to be considered an ideal tool
for the early detection or staging of prostate cancer (10).
Combining PSA levels with clinical staging and Gleason scores is
more predictive of the pathological stage of localized prostate
cancer (11). In addition, new molecular techniques are being used
for improved molecular staging of prostate cancer (12, 13). For
instance, reverse transcriptase--polymerase chain reaction (RT-PCR)
can measure PSA of circulating prostate cells in blood and bone
marrow of prostate cancer patients.
[0007] Despite new molecular techniques, however, as many as 25
percent of men with prostate cancer will have normal PSA
levels--usually defined as those equal to or below 4 nanograms per
milliliter of blood (14). In addition, more than 50 percent of the
men with higher PSA levels are actually cancer free (14). Thus, PSA
is not an ideal screening tool for prostate cancer. More reliable
tumor-specific biomarkers are needed that can distinguish between
normal and hyperplastic epithelium, and the preneoplastic and
neoplastic stages of prostate cancer.
[0008] Identification and characterization of genetic alterations
defining prostate cancer onset and progression is important in
understanding the biology and clinical course of the disease. The
currently available TNM staging system assigns the original primary
tumor (T) to one of four stages (14). The first stage, T1,
indicates that the tumor is microscopic and cannot be felt on
rectal examination. T2 refers to tumors that are palpable but fully
contained within the prostate gland. A T3 designation indicates the
cancer has spread beyond the prostate into surrounding connective
tissue or has invaded the neighboring seminal vesicles. T4 cancer
has spread even further. The TNM staging system also assesses
whether the cancer has metastasized to the pelvic lymph nodes (N)
or beyond (M). Metastatic tumors result when cancer cells break
away from the original tumor, circulate through the blood or lymph,
and proliferate at distant sites in the body.
[0009] Recent studies of metastatic prostate cancer have shown a
significant heterogeneity of allelic losses of different chromosome
regions between multiple cancer foci (21-23). These studies have
also documented that the metastatic lesion can arise from cancer
foci other than dominant tumors (22). Therefore, it is critical to
understand the molecular changes which define the prostate cancer
metastasis especially when prostate cancer is increasingly detected
in early stages (15-21).
[0010] Moreover, the multifocal nature of prostate cancer needs to
be considered (22-23) when analyzing biomarkers that may have
potential to predict tumor progression or metastasis. Approximately
50-60% of patients treated with radical prostatectomy for localized
prostate carcinomas are found to have microscopic disease that is
not organ confined, and a significant portion of these patients
relapse (24). Utilizing biostatistical modeling of traditional and
genetic biomarkers such as p53 and bcl-2, Bauer et al. (25-26) were
able to identify patients at risk of cancer recurrence after
surgery. Thus, there is clearly a need to develop biomarkers
defining various stages of the prostate cancer progression.
[0011] Another significant aspect of prostate cancer is the key
role that androgens play in the development of both the normal
prostate and prostate cancer. Androgen ablation, also referred to
as "hormonal therapy," is a common treatment for prostate cancer,
particularly in patients with metastatic disease (14). Hormonal
therapy aims to inhibit the body from making androgens or to block
the activity of androgen. One way to block androgen activity
involves blocking the androgen receptor; however, that blockage is
often only successful initially. For example, 70-80% of patients
with advanced disease exhibit an initial subjective response to
hormonal therapy, but most tumors progress to an
androgen-independent state within two years (16). One mechanism
proposed for the progression to an androgen-independent state
involves constitutive activation of the androgen signaling pathway,
which could arise from structural changes in the androgen receptor
protein (16).
[0012] As indicated above, the genesis and progression of cancer
cells involve multiple genetic alterations as well as a complex
interaction of several gene products. Thus, various strategies are
required to fully understand the molecular genetic alterations in a
specific type of cancer. In the past, most molecular biology
studies had focused on mutations of cellular proto-oncogenes and
tumor suppressor genes (TSGs) associated with prostate cancer (7).
Recently, however, there has been an increasing shift toward the
analysis of "expression genetics" in human cancer (27-31), i.e.,
the under-expression or over-expression of cancer-specific genes.
This shift addresses limitations of the previous approaches
including: 1) labor intensive technology involved in identifying
mutated genes that are associated with human cancer; 2) the
limitations of experimental models with a bias toward
identification of only certain classes of genes, e.g.,
identification of mutant ras genes by transfection of human tumor
DNAs utilizing NIH3T3 cells; and 3) the recognition that the human
cancer associated genes identified so far do not account for the
diversity of cancer phenotypes.
[0013] A number of studies are now addressing the alterations of
prostate cancer-associated gene expression in patient specimens
(32-36). It is inevitable that more reports on these lines are to
follow.
[0014] Thus, despite the growing body of knowledge regarding
prostate cancer, there is still a need in the art to uncover the
identity and function of the genes involved in prostate cancer
pathogenesis. There is also a need for reagents and assays to
accurately detect cancerous cells, to define various stages of
prostate cancer progression, to identify and characterize genetic
alterations defining prostate cancer onset and progression, to
detect micro-metastasis of prostate cancer, and to treat and
prevent prostate cancer.
SUMMARY OF THE INVENTION
[0015] The present invention relates to the identification and
characterization of a novel gene, the first of a family of genes,
designated PCGEM1, for Prostate Cancer Gene Expression Marker 1.
PCGEM1 is specific to prostate tissue, is androgen-regulated, and
appears to be over-expressed in prostate cancer. More recent
studies associate PCGEM1 cDNA with promoting cell growth. The
invention provides the isolated nucleotide sequence of PCGEM1 or
fragments thereof and nucleic acid sequences that hybridize to
PCGEM1. These sequences have utility, for example, as markers of
prostate cancer and other prostate related diseases, and as targets
for therapeutic intervention in prostate cancer and other prostate
related diseases. The invention further provides a vector that
directs the expression of PCGEM1, and a host cell transfected or
transduced with this vector.
[0016] In another embodiment, the invention provides a method of
detecting prostate cancer cells in a biological sample, for
example, by using nucleic acid amplification techniques with
primers and probes selected to bind specifically to the PCGEM1
sequence. The invention further comprises a method of selectively
killing a prostate cancer cell, a method of identifying an androgen
responsive cell line, and a method of measuring responsiveness of a
cell line to hormone-ablation therapy.
[0017] In another aspect, the invention relates to an isolated
polypeptide encoded by the PCGEM1 gene or a fragment thereof, and
antibodies generated against the PCGEM1 polypeptide, peptides, or
portions thereof, which can be used to detect, treat, and prevent
prostate cancer.
[0018] Additional features and advantages of the invention will be
set forth in the description which follows, and in part will be
apparent from the description, or may be learned by practice of the
invention. The objectives and other advantages of the invention
will be realized and attained by the sequences, cells, vectors, and
methods particularly pointed out in the written description and
claims herein as well as the appended drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 depicts the scheme for the identification of
differentially expressed genes in prostate tumor and normal
tissues.
[0020] FIG. 2 depicts a differential display pattern of mRNA
obtained from matched tumor and normal tissues of a prostate cancer
patient. Arrows indicate differentially expressed cDNAs.
[0021] FIG. 3 depicts the analysis of PCGEM1 expression in primary
prostate cancers.
[0022] FIG. 4 depicts the expression pattern of PCGEM1 in prostate
cancer cell lines.
[0023] FIG. 5a depicts the androgen regulation of PCGEM1 expression
in LNCaP cells, as measured by reverse transcriptase PCR.
[0024] FIG. 5b depicts the androgen regulation of PCGEM1 expression
in LNCaP cells, as measured by Northern blot hybridization.
[0025] FIG. 6a depicts the prostate tissue specific expression
pattern of PCGEM1.
[0026] FIG. 6b depicts a RNA master blot showing the prostate
tissue specificity of PCGEM1.
[0027] FIG. 7A depicts the chromosomal localization of PCGEM1 by
fluorescent in situ hybridization analysis.
[0028] FIG. 7B depicts a DAPI counter-stained chromosome 2 (left),
an inverted DAPI stained chromosome 2 shown as G-bands (center),
and an ideogram of chromosome 2 showing the localization of the
signal to band 2q32(bar).
[0029] FIG. 8 depicts a cDNA sequence of PCGEM1 (SEQ ID NO:1).
[0030] FIG. 9 depicts an additional cDNA sequence of PCGEM1 (SEQ ID
NO:2).
[0031] FIG. 10 depicts the colony formation of NIH3T3 cell lines
expressing various PCGEM1 constructs.
[0032] FIG. 11 depicts the cDNA sequence of the promoter region of
PCGEM1 SEQ ID NO:3.
[0033] FIG. 12 depicts the cDNA of a probe, designated SEQ ID
NO:4.
[0034] FIG. 13 depicts the cDNAs of primers 1-3, designated SEQ ID
NOs:5-7, respectively.
[0035] FIG. 14 depicts the genomic DNA sequence of PCGEM1,
designated SEQ ID NO:8.
[0036] FIG. 15 depicts the structure of the PCGEM1 transcription
unit.
[0037] FIG. 16 depicts a graph of the hypothetical coding capacity
of PCGEM1.
[0038] FIG. 17 depicts a representative example of in situ
hybridization results showing PCGEM1 expression in normal and tumor
areas of prostate cancer tissues.
DETAILED DESCRIPTION OF THE INVENTION
[0039] The present invention relates to PCGEM1, the first of a
family of genes, and its related nucleic acids, proteins, antigens,
and antibodies for use in the detection, prevention, and treatment
of prostate cancer (e.g., prostatic intraepithelial neoplasia
(PIN), adenocarcinomas, nodular hyperplasia, and large duct
carcinomas) and prostate related diseases (e.g., benign prostatic
hyperplasia), and kits comprising these reagents.
[0040] Although we do not wish to be limited by any theory or
hypothesis, preliminary data suggest that the PCGEM1 nucleotide
sequence may be related to a family of non-coding poly A+RNA that
may be implicated in processes relating to growth and embryonic
development (40-44). Evidence presented herein supports this
hypothesis. Alternatively, PCGEM1 cDNA may encode a small
peptide.
[0041] Nucleic Acid Molecules
[0042] In a particular embodiment, the invention relates to certain
isolated nucleotide sequences that are substantially free from
contaminating endogenous material. A "nucleotide sequence" refers
to a polynucleotide molecule in the form of a separate fragment or
as a component of a larger nucleic acid construct. The nucleic acid
molecule has been derived from DNA or RNA isolated at least once in
substantially pure form and in a quantity or concentration enabling
identification, manipulation, and recovery of its component
nucleotide sequences by standard biochemical methods (such as those
outlined in Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y. (1989)).
[0043] Nucleic acid molecules of the invention include DNA in both
single-stranded and double-stranded form, as well as the RNA
complement thereof. DNA includes, for example, cDNA, genomic DNA,
chemically synthesized DNA, DNA amplified by PCR, and combinations
thereof. Genomic DNA may be isolated by conventional techniques,
e.g., using the cDNA of SEQ ID NO:1, SEQ ID NO:2, or suitable
fragments thereof, as a probe.
[0044] The DNA molecules of the invention include full length genes
as well as polynucleotides and fragments thereof. The full length
gene may include the N-terminal signal peptide. Although a
non-coding role of PCGEM1 appears likely, the possibility of a
protein product cannot presently be ruled out. Therefore, other
embodiments may include DNA encoding a soluble form, e.g., encoding
the extracellular domain of the protein, either with or without the
signal peptide.
[0045] The nucleic acids of the invention are preferentially
derived from human sources, but the invention includes those
derived from non-human species, as well.
[0046] Preferred Sequences
[0047] Particularly preferred nucleotide sequences of the invention
are SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO: 8, as set forth in
FIGS. 8, 9, and 14, respectively. Two cDNA clones having the
nucleotide sequences of SEQ ID NO:1 and SEQ ID NO:2, and the
genomic DNA having the nucleotide sequence of SEQ ID NO: 8, were
isolated as described in Example 2.
[0048] Thus, in a particular embodiment, this invention provides an
isolated nucleic acid molecule selected from the group consisting
of (a) the polynucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, or
SEQ ID NO: 8; (b) an isolated nucleic acid molecule that hybridizes
to either strand of a denatured, double-stranded DNA comprising the
nucleic acid sequence of (a) under conditions of moderate
stringency in 50% formamide and about 6.times.SSC at about
42.degree. C. with washing conditions of approximately 60.degree.
C., about 0.5.times.SSC, and about 0.1% SDS; (c) an isolated
nucleic acid molecule that hybridizes to either strand of a
denatured, double-stranded DNA comprising the nucleic acid sequence
of (a) under conditions of high stringency in 50% formamide and
about 6.times.SSC, with washing conditions of approximately
68.degree. C., about 0.2.times.SSC, and about 0.1% SDS; (d) an
isolated nucleic acid molecule derived by in vitro mutagenesis from
SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:8; (e) an isolated nucleic
acid molecule degenerate from SEQ ID NO:1, SEQ ID NO:2, or SEQ ID
NO:8 as a result of the genetic code; and (f) an isolated nucleic
acid molecule selected from the group consisting of human PCGEM1
DNA, an allelic variant of human PCGEM1 DNA, and a species homolog
of PCGEM1 DNA.
[0049] As used herein, conditions of moderate stringency can be
readily determined by those having ordinary skill in the art based
on, for example, the length of the DNA. The basic conditions are
set forth by Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2d ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory
Press, (1989), and include use of a prewashing solution for the
nitrocellulose filters of about 5.times.SSC, about 0.5% SDS, and
about 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50%
formamide, about 6.times.SSC at about 42.degree. C. (or other
similar hybridization solution, such as Stark's solution, in about
50% formrnamide at about 42.degree. C.), and washing conditions of
about 60.degree. C., about 0.5.times.SSC, and about 0.1% SDS.
Conditions of high stringency can also be readily determined by the
skilled artisan based on, for example, the length of the DNA.
Generally, such conditions are defined as hybridization conditions
as above, and with washing at approximately 68.degree. C., about
0.2.times.SSC, and about 0.1% SDS. The skilled artisan will
recognize that the temperature and wash solution salt concentration
can be adjusted as necessary according to factors such as the
length of the probe.
[0050] Additional Sequences
[0051] Due to the known degeneracy of the genetic code, wherein
more than one codon can encode the same amino acid, a DNA sequence
can vary from that shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID
NO:8, and still encode PCGEM1. Such variant DNA sequences can
result from silent mutations (e.g., occurring during PCR
amplification), or can be the product of deliberate mutagenesis of
a native sequence.
[0052] The invention thus provides isolated DNA sequences of the
invention selected from: (a) DNA comprising the nucleotide sequence
of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:8; (b) DNA capable of
hybridization to a DNA of (a) under conditions of moderate
stringency; (c) DNA capable of hybridization to a DNA of (a) under
conditions of high stringency; and (d) DNA which is degenerate as a
result of the genetic code to a DNA defined in (a), (b), or (c).
Such sequences are preferably provided and/or constructed in the
form of an open reading frame uninterrupted by internal
non-translated sequences, or introns, that are typically present in
eukaryotic genes. Sequences of non-translated DNA can be present 5'
or 3' from an open reading frame, where the same do not interfere
with manipulation or expression of the coding region. Of course,
should PCGEM1 encode a polypeptide, polypeptides encoded by such
DNA sequences are encompassed by the invention. Conditions of
moderate and high stringency are described above.
[0053] In another embodiment, the nucleic acid molecules of the
invention comprise nucleotide sequences that are at least 80%
identical to a nucleotide sequence set forth herein. Also
contemplated are embodiments in which a nucleic acid molecule
comprises a sequence that is at least 90% identical, at least 95%
identical, at least 98% identical, at least 99% identical, or at
least 99.9% identical to a nucleotide sequence set forth
herein.
[0054] Percent identity may be determined by visual inspection and
mathematical calculation. Alternatively, percent identity of two
nucleic acid sequences may be determined by comparing sequence
information using the GAP computer program, version 6.0 described
by Devereux et al. (Nucl. Acids Res. 12:387, 1984) and available
from the University of Wisconsin Genetics Computer Group (UWGCG).
The preferred default parameters for the GAP program include: (1) a
unary comparison matrix (containing a value of 1 for identities and
0 for non-identities) for nucleotides, and the weighted comparison
matrix of Gribskov and Burgess, Nucl. Acids Res. 14:6745, 1986, as
described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence
and Structure, National Biomedical Research Foundation, pp.
353-358, 1979; (2) a penalty of 3.0 for each gap and an additional
0.10 penalty for each symbol in each gap; and (3) no penalty for
end gaps. Other programs used by one skilled in the art of sequence
comparison may also be used.
[0055] The invention also provides isolated nucleic acids useful in
the production of polypeptides. Such polypeptides may be prepared
by any of a number of conventional techniques. A DNA sequence of
this invention or desired fragment thereof may be subcloned into an
expression vector for production of the polypeptide or fragment.
The DNA sequence advantageously is fused to a sequence encoding a
suitable leader or signal peptide. Alternatively, the desired
fragment may be chemically synthesized using known techniques. DNA
fragments also may be produced by restriction endonuclease
digestion of a full length cloned DNA sequence, and isolated by
electrophoresis on agarose gels. If necessary, oligonucleotides
that reconstruct the 5' or 3' terminus to a desired point may be
ligated to a DNA fragment generated by restriction enzyme
digestion. Such oligonucleotides may additionally contain a
restriction endonuclease cleavage site upstream of the desired
coding sequence, and position an initiation codon (ATG) at the
N-terminus of the coding sequence.
[0056] The well-known polymerase chain reaction (PCR) procedure
also may be employed to isolate and amplify a DNA sequence encoding
a desired protein fragment. Oligonucleotides that define the
desired termini of the DNA fragment are employed as 5' and 3'
primers. The oligonucleotides may additionally contain recognition
sites for restriction endonucleases, to facilitate insertion of the
amplified DNA fragment into an expression vector. PCR techniques
are described in Saiki et al., Science 239:487 (1988); Recombinant
DNA Methodology, Wu et al., eds., Academic Press, Inc., San Diego
(1989), pp. 189-196; and PCR Protocols: A Guide to Methods and
Applications, Innis et al., eds., Academic Press, Inc. (1990).
[0057] Use of PCGEM1 Nucleic Acid or Oligonucleotides
[0058] In a particular embodiment, the invention relates to PCGEM1
nucleotide sequences isolated from human prostate cells, including
the complete genomic DNA (FIG. 14, SEQ ID NO: 8), and two full
length cDNAs: SEQ ID NO:1 (FIG. 8) and SEQ ID NO:2 (FIG. 9), and
fragments thereof. The nucleic acids of the invention, including
DNA, RNA, mRNA and oligonucleotides thereof, are useful in a
variety of applications in the detection, diagnosis, prognosis, and
treatment of prostate cancer. Examples of applications within the
scope of the present invention include, but are not limited to:
[0059] amplifying PCGEM1 sequences;
[0060] detecting a PCGEM1-derived marker of prostate cancer by
hybridization with an oligonucleotide probe;
[0061] identifying chromosome 2;
[0062] mapping genes to chromosome 2;
[0063] identifying genes associated with certain diseases,
syndromes, or other conditions associated with human chromosome
2;
[0064] constructing vectors having PCGEM1 sequences;
[0065] expressing vector-associated PCGEM1 sequences as RNA and
protein;
[0066] detecting defective genes in an individual;
[0067] developing gene therapy;
[0068] developing immunologic reagents corresponding to
PCGEM1-encoded products; and
[0069] treating prostate cancer using antibodies, antisense nucleic
acids, or other inhibitors specific for PCGEM1 sequences.
[0070] Detecting, Diagnosing, and Treating Prostate Cancer
[0071] The present invention provides a method of detecting
prostate cancer in a patient, which comprises (a) detecting PCGEM1
mRNA in a biological sample from the patient; and (b) correlating
the amount of PCGEM1 mRNA in the sample with the presence of
prostate cancer in the patient. Detecting PCGEM1 mRNA in a
biological sample may include: (a) isolating RNA from said
biological sample; (b) amplifying a PCGEM1 cDNA molecule; (c)
incubating the PCGEM1 cDNA with the isolated nucleic acid of the
invention; and (d) detecting hybridization between the PCGEM1 cDNA
and the isolated nucleic acid. The biological sample can be
selected from the group consisting of blood, urine, and tissue, for
example, from a biopsy. In a preferred embodiment, the biological
sample is blood. This method is useful in both the initial
diagnosis of prostate cancer, and the later prognosis of disease.
This method allows for testing prostate tissue in a biopsy, and
after removal of a cancerous prostate, continued monitoring of the
blood for micrometastases.
[0072] According to this method of diagnosing and prognosticating
prostate cancer in a patient, the amount of PCGEM1 mRNA in a
biological sample from a patient is correlated with the presence of
prostate cancer in the patient. Those of ordinary skill in the art
can readily assess the level of over-expression that is correlated
with the presence of prostate cancer.
[0073] In another embodiment, this invention provides a vector,
comprising a PCGEM1 promoter sequence operatively linked to a
nucleotide sequence encoding a cytotoxic protein. The invention
further provides a method of selectively killing a prostate cancer
cell, which comprises introducing the vector to prostate cancer
cells under conditions sufficient to permit selective killing of
the prostate cells. As used herein, the phrase "selective killing"
is meant to include the killing of at least a cell which is
specifically targeted by a nucleotide sequence. The putative PCGEM1
promoter, contained in the 5' flanking region of the PCGEM1 genomic
sequence, SEQ ID NO: 3, is set forth in FIG. 11. Applicants
envision that a nucleotide sequence encoding any cytotoxic protein
can be incorporated into this vector for delivery to prostate
tissue. For example, the cytotoxic protein can be ricin, abrin,
diphtheria toxin, p53, thymidine kinase, tumor necrosis factor,
cholera toxin, Pseudomonas aeruginosa exotoxin A, ribosomal
inactivating proteins, or mycotoxins such as trichothecenes, and
derivatives and fragments (e.g., single chains) thereof.
[0074] This invention also provides a method of identifying an
androgen-responsive cell line, which comprises (a) obtaining a cell
line suspected of being androgen-responsive, (b) incubating the
cell line with an androgen; and (c) detecting PCGEM1 mRNA in the
cell line, wherein an increase in PCGEM1 mRNA, as compared to an
untreated cell line, correlates with the cell line being
androgen-responsive.
[0075] The invention further provides a method of measuring the
responsiveness of a prostatic tissue to hormone-ablation therapy,
which comprises (a) treating the prostatic tissue with
hormone-ablation therapy; and (b) measuring PCGEM1 mRNA in the
prostatic tissue following hormone-ablation therapy, wherein a
decrease in PCGEM1 mRNA, as compared to an untreated cell line,
correlates with the cell line responding to hormone-ablation
therapy.
[0076] In another aspect of the invention, these nucleic acid
molecules may be introduced into a recombinant vector, such as a
plasmid, cosmid, or virus, which can be used to transfect or
transduce a host cell. The nucleic acids of the present invention
may be combined with other DNA sequences, such as promoters,
polyadenylation signals, restriction enzyme sites, multiple cloning
sites, and other coding sequences.
[0077] Probes
[0078] Among the uses of nucleic acids of the invention is the use
of fragments as probes or primers. Such fragments generally
comprise at least about 17 contiguous nucleotides of a DNA
sequence. The fragment may have fewer than 17 nucleotides, such as,
for example, 10 or 15 nucleotides. In other embodiments, a DNA
fragment comprises at least 20, at least 30, or at least 60
contiguous nucleotides of a DNA sequence. Examples of probes or
primers of the invention include those of SEQ ID NO: 5, SEQ ID NO:
6, and SEQ ID NO: 7, as well as those disclosed in Table I.
1TABLE I Starting Primer Sequence (5'.fwdarw.3') S/AS Base # SEQ ID
NO. p413 TGGCAACAGGCAAGCAGAG S 510 SEQ ID NO: 9 p414
GGCCAAAATAAAACCAAACAT AS 610 SEQ ID NO: 10 p489
GCAAATATGATTTAAAGATACAAC S 752 SEQ ID NO: 11 p490
GGTTGTATCTTTAAATCATATTTGC AS 776 SEQ ID NO: 12 p491
ACTGTCTTTTCATATATTTCTCAATGC S 559 SEQ ID NO: 13 p517
AAGTAGTAATTTTAAACATGGGAG AS 1516 SEQ ID NO: 14 p518
TTTTTCAATTAGGCAGCAACC S 131 SEQ ID NO: 15 p519
GAATTGTCTTTGTGATTGTTTTTAG S 1338 SEQ ID NO: 16 p560
CAATTCACAAAGACAATTCAGTTAAG AS 1355 SEQ ID NO: 17 p561
ACAATTAGACAATGTCCAGCTGA AS 1154 SEQ ID NO: 18 p562
CTTTGGCTGATATCATGAAGTGTC AS 322 SEQ ID NO: 19 p623
AACCTTTTGCCCTATGCCGTAAC S 148 SEQ ID NO: 20 p624
GAGACTCCCAACCTGATGATGT AS 376 SEQ ID NO: 21 p839
GGTCACGTTGAGTCCCAGTG AS 270 SEQ ID NO: 22 S/AS indicates whether
the primer is Sense or AntiSense Starting Base # indicates the
starting base number with respect to the sequence of SEQ ID NO:
1.
[0079] However, even larger probes may be used. For example, a
particularly preferred probe is derived from PCGEM1 (SEQ ID NO: 1)
and comprises nucleotides 116 to 1140 of that sequence. It has been
designated SEQ ID NO: 4 and is set forth in FIG. 12.
[0080] When a hybridization probe binds to a target sequence, it
forms a duplex molecule that is both stable and selective. These
nucleic acid molecules may be readily prepared, for example, by
chemical synthesis or by recombinant techniques. A wide variety of
methods are known in the art for detecting hybridization, including
fluorescent, radioactive, or enzymatic means, or other ligands such
as avidin/biotin.
[0081] In another aspect of the invention, these nucleic acid
molecules may be introduced into a recombinant vector, such as a
plasmid, cosmid, or virus, which can be used to transfect or
transduce a host cell. The nucleic acids of the present invention
may be combined with other DNA sequences, such as promoters,
polyadenylation. signals, restriction enzyme sites, multiple
cloning sites, and other coding sequences.
[0082] Because homologs of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID
NO: 8 from other mammalian species are contemplated herein, probes
based on the human DNA sequence of SEQ ID NO: 1, SEQ ID NO: 2, and
SEQ ID NO: 8 may be used to screen cDNA libraries derived from
other mammalian species, using conventional cross-species
hybridization techniques.
[0083] In another aspect of the invention, one can use the
knowledge of the genetic code in combination with the sequences set
forth herein to prepare sets of degenerate oligonucleotides. Such
oligonucleotides are useful as primers, e.g., in polymerase chain
reactions (PCR), whereby DNA fragments are isolated and amplified.
Particularly preferred primers are set forth in FIG. 13 and Table I
and are designated SEQ ID NOS: 5-7 and 9-22, respectively. A
particularly preferred primer pair is p518 (SEQ ID NO: 15) and p839
(SEQ ID NO: 22), which when used in PCR, preferentially amplifies
mRNA, thereby avoiding less desirable cross-reactivity with genomic
DNA.
[0084] Chromosome Mapping
[0085] As set forth in Example 3, the PCGEM1 gene has been mapped
by fluorescent in situ hybridization to the 2q32 region of
chromosome 2 using a bacterial artificial chromosome (BAC) clone
containing PCGEU1 genomic sequence. Thus, all or a portion of the
nucleic acid molecule of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:8,
including oligonucleotides, can be used by those skilled in the art
using well-known techniques to identify human chromosome 2, and the
specific locus thereof, that contains the PCGEM1 DNA. Useful
techniques include, but are not limited to, using the nucleotide
sequence of SEQ ID NO:1, SEQ ID NO:2, or SE ID NO:8, or fragments
thereof, including oligonucleotides, as a probe in various
well-known techniques such as radiation hybrid mapping (high
resolution), in situ hybridization to chromosome spreads (moderate
resolution), and Southern blot hybridization to hybrid cell lines
containing individual human chromosomes (low resolution).
[0086] For example, chromosomes can be mapped by radiation
hybridization. First, PCR is performed using the Whitehead
Institute/MIT Center for Genome Research Genebridge4 panel of 93
radiation hybrids (http://www-genome.wi.mit.edu/ftp/distribution/
human_STS_releases/july97- /rhmap/genebridge4.html). Primers are
used which lie within a putative exon of the gene of interest and
which amplify a product from human genomic DNA, but do not amplify
hamster genomic DNA. The results of the PCRs are converted into a
data vector that is submitted to the Whitehead/MIT Radiation
Mapping site on the internet (http://www-seq.wi.mit.edu). The data
is scored and the chromosomal assignment and placement relative to
known Sequence Tag Site (STS) markers on the radiation hybrid map
is provided. (The following web site provides additional
information about radiation hybrid mapping:
http://www-genome.wi.mit.edu/ftp/distribution/human_STS_releases/july97/0-
7-97.INTRO.html).
[0087] Identifying Associated Diseases
[0088] As noted above, PCGEM1 has been mapped to the 2q32 region of
chromosome 2. This region is associated with specific diseases,
which include but are not limited to diabetes mellitus (insulin
dependent), and T cell leukemia/lymphoma. Thus, the nucleic acids
of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:8; or fragments
thereof, can be used by one skilled in the art using well-known
techniques to analyze abnormalities associated with gene mapping to
chromosome 2. This enables one to distinguish conditions in which
this marker is rearranged or deleted. In addition, nucleotides of
SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:8, or fragments thereof, can
be used as a positional marker to map other genes of unknown
location.
[0089] The DNA may be used in developing treatments for any
disorder mediated (directly or indirectly) by defective, or
insufficient amounts of PCGEM1, including prostate cancer.
Disclosure herein of native nucleotide sequences permits the
detection of defective genes, and the replacement thereof with
normal genes. Defective genes may be detected in in vitro
diagnostic assays, and by comparison of a native nucleotide
sequence disclosed herein with that of a gene derived from a person
suspected of harboring a defect in this gene.
[0090] Sense-Antisense
[0091] Other useful fragments of the nucleic acids include
antisense or sense oligonucleotides comprising a single-stranded
nucleic acid sequence (either RNA or DNA) capable of binding to
target mRNA (sense) or DNA (antisense) sequences. Antisense or
sense oligonucleotides, according to the present invention,
comprise a fragment of DNA (SEQ ID NO:1, SEQ ID NO:2, or SEQ ID
NO:8). Such a fragment generally comprises at least about 14
nucleotides, preferably from about 14 to about 30 nucleotides. The
ability to derive an antisense or a sense oligonucleotide, based
upon a cDNA sequence encoding a given protein is described in, for
example, Stein and Cohen (Cancer Res. 48:2659, 1988) and van der
Krol et al. (BioTechniques 6:958, 1988).
[0092] The biologic activity of PCGEM1 in assay cells and the over
expression of PCGEM1 in prostate cancer tissues suggest that
elevated levels of PCGEM1 promote prostate cancer cell growth.
Thus, the antisense oligonucleotides to PCGEM1 may be used to
reduce the expression of PCGEM1 and, consequently, inhibit the
growth of the cancer cells.
[0093] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes. The
antisense oligonucleotides thus may be used to block expression of
proteins or to inhibit the function of RNA. Antisense or sense
oligonucleotides further comprise oligonucleotides having modified
sugar-phosphodiester backbones (or other sugar linkages, such as
those described in WO91/06629) and wherein such sugar linkages are
resistant to endogenous nucleases. Such oligonucleotides with
resistant sugar linkages are stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to
be able to bind to target nucleotide sequences.
[0094] Other examples of sense or antisense oligonucleotides
include those oligonucleotides which are covalently linked to
organic moieties, such as those described in WO 90/10448, and other
moieties that increases affinity of the oligonucleotide for a
target nucleic acid sequence, such as poly-(L-lysine). Further
still, intercalating agents, such as ellipticine, and alkylating
agents or metal complexes may be attached to sense or antisense
oligonucleotides. Such modifications may modify binding
specificities of the antisense or sense oligonucleotide for the
target nucleotide sequence.
[0095] Antisense or sense oligonucleotides may be introduced into a
cell containing the target nucleic acid sequence by any gene
transfer method, including, for example, lipofection,
CaPO.sub.4-mediated DNA transfection, electroporation, or by using
gene transfer vectors such as Epstein-Barr virus or adenovirus.
[0096] Sense or antisense oligonucleotides also may be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not
substantially interfere with the ability of the ligand binding
molecule to bind to its corresponding molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0097] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0098] Polypeptides and Fragments Thereof
[0099] The invention also encompasses polypeptides and fragments
thereof in various forms, including those that are naturally
occurring or produced through various techniques such as procedures
involving recombinant DNA technology. Such forms include, but are
not limited to, derivatives, variants, and oligomers, as well as
fusion proteins or fragments thereof.
[0100] The polypeptides of the invention include full length
proteins encoded by the nucleic acid sequences set forth above. The
polypeptides of the invention may be membrane bound or they may be
secreted and thus soluble. The invention also includes the
expression, isolation and purification of the polypeptides and
fragments of the invention, accomplished by any suitable
technique.
[0101] The following examples further illustrate preferred aspects
of the invention.
EXAMPLE 1
Differential Gene Expression Analysis in Prostate Cancer
[0102] Using the differential display technique, we identified a
novel gene that is over-expressed in prostate cancer cells.
Differential display provides a method to separate and clone
individual messenger RNAs by means of the polymerase chain
reaction, as described in Liang et al., Science, 257:967-71 (1992),
which is hereby incorporated by reference. Briefly, the method
entails using two groups of oligonucleotide primers. One group is
designed to recognize the polyadenylate tail of messenger RNAs. The
other group contains primers that are short and arbitrary in
sequence and anneal to positions in the messenger RNA randomly
distributed from the polyadenylate tail. Products amplified with
these primers can be differentiated on a sequencing gel based on
their size. If different cell populations are amplified with the
same groups of primers, one can compare the amplification products
to identify differentially expressed RNA sequences.
[0103] Differential display ("DD") kits from Genomyx (Foster City,
Calif.) were used to analyze differential gene expression. The
steps of the differential display technique are summarized in FIG.
1. Histologically well defined matched tumor and normal prostate
tissue sections containing approximately similar proportions of
epithelial cells were chosen from individual prostate cancer
patients.
[0104] Genomic DNA-free total RNA was extracted from this enriched
pool of cells using RNAzol B (Tel-Test, Inc., Friendswood, Tex.)
according to manufacturer's protocol. The epithelial nature of the
RNA source was further confirmed using cytokeratin 18 expression
(45) in reverse transcriptase-polymerase chain reaction (RT-PCR)
assays. Using arbitrary and anchored primers containing 5' M13 or
T7 sequences (obtained from Biomedical Instrumentation Center,
Uniformed Services University of the Health Sciences, Bethesda),
the isolated DNA-free total RNA was amplified by RT-PCR which was
performed using ten anchored antisense primers and four arbitrary
sense primers according to the protocol provided by Hieroglyph.TM.
RNA Profile Kit 1 (Genomyx Corpration, Calif.). The cDNA fragments
produced by the RT-PCR assay were analyzed by high resolution gel
electrophoresis, carried out by using Genomyx.TM. LR DNA sequencer
and LR-Optimized.TM. HR-1000.TM. gel formulations (Genomyx
Corporation, CA).
[0105] A partial DD screening of normal/tumor tissues revealed 30
differentially expressed cDNA fragments, with 53% showing reduced
or no expression in tumor RNA specimens and 47% showing over
expression in tumor RNA specimen (FIG. 2). These cDNAs were excised
from the DD gels, reamplified using T7 and M13 primers and the RT
PCR conditions recommended in Hieroglyph.TM. RNA Profile Kit-1
(Genomyx Corp., CA), and sequenced. The inclusion of T7 and M13
sequencing primers in the DD primers allowed rapid sequencing and
orientation of cDNAs (FIG. 1).
[0106] All the reamplified cDNA fragments were purified by
Centricon-c-100 system (Amicon, USA). The purified fragments were
sequenced by cycle sequencing and DNA sequence determination using
an ABI 377 DNA sequencer. Isolated sequences were analyzed for
sequence homology with known sequences by running searches through
publicly available DNA sequence databases, including the National
Center for Biotechnology Information and the Cancer Genome Anatomy
Project. Approximately two-thirds of these cDNA sequences exhibited
homology to previously described DNA sequences/genes e.g.,
ribosomal proteins, mitochondrial DNA sequences, growth factor
receptors, and genes involved in maintaining the redox state in
cells. About one-third of the cDNAs represented novel sequences,
which did not exhibit similarity to the sequences available in
publicly available databases. The PCGEM1 fragment, obtained from
the initial differential display screening represents a 530 base
pair (nucleotides 410 to 940 of SEQ ID NO: 1) cDNA sequence which,
in initial searches, did not exhibit any significant homology with
sequences in the publicly available databases. Later searching of
the high throughput genome sequence (HTGS) database revealed
perfect homology to a chromosome 2 derived uncharacterized,
unfinished genomic sequence (accession #AC 013401).
EXAMPLE 2
Characterization of Full Length PCGEM1 cDNA Sequence
[0107] The full length of PCGEM1 was obtained by 5' and 3' RACE/PCR
from the original 530 bp DD product (nucleotides 410 to 940 of
PCGEM1 cDNA SEQ ID NO: 1) using a normal prostate cDNA library in
lambda phage (Clontech, CA). The RACE/PCR products were directly
sequenced. Lasergene and MacVector DNA analysis software were used
to analyze DNA sequences and to define open reading frame regions.
We also used the original DD product to screen a normal prostate
cDNA library. Three overlapping cDNA clones were identified.
[0108] Sequencing of the cDNA clones was performed on an ABI-310
sequence analyzer and a new dRhodamine cycle sequencing kit
(PE-Applied Biosystem, CA). The longest PCGEM1 cDNA clone, SEQ ID
NO:1 (FIG. 8), revealed 1643 nucleotides with a potential
polyadenylation site, ATTAAA, close to the 3' end followed by a
poly (A) tail. As noted above, although initial searching of PCGEM1
gene in publically available DNA databases (e.g., National Center
for Biotechnology Information) using the BLAST program did not
reveal any homology, a recent search of the HTGS database revealed
perfect homology of PCGEM1 (using cDNA of SEQ ID NO: 1) to a
chromosome 2 derived uncharacterized, unfinished genomic sequence
(accession #AC 013401). One of the cDNA clones, SEQ ID NO:2 (FIG.
9), contained a 123 bp insertion at 278, and this inserted sequence
showed strong homology (87%) to Alu sequence. It is likely that
this clone represented the premature transcripts. Sequencing of
several clones from RT-PCR further confirmed the presence of the
two forms of transcripts.
[0109] Sequence analysis did not reveal any significant long open
reading frame in both-strands. The longest ORF in the sense strand
was 105 nucleotides (572-679) encoding 35 amino acid peptides.
However, the ATG was not in a strong context of initiation.
Although we could not rule out the coding capacity for a very small
peptide, it is possible that PCGEM1 may function as a non-coding
RNA.
[0110] The sequence of PCGEM1 cDNA has been verified by several
approaches including characterization of several clones of PCGEM1
and analysis of PCGEM1 cDNAs amplified from normal prostate tissue
and prostate cancer cell lines. We have also obtained the genomic
clones of PCGEM1, which has helped to confirm the PCGEM1 cDNA
sequence. The complete genomic DNA sequence of PCGEM1 (SEQ ID NO:8)
is shown in FIG. 14. In FIG. 14 (and in the accompanying Sequence
Listing), "Y" represents any one of the four nucleotide bases,
cylosine, thymine, adenine, or guanine. Comparison of the cDNA and
genomic sequences revealed the organization of the PCGEM1
transcription unit from three exons (FIG. 15: E, Exon; B: BamHI; H:
HindIII; X: XbaI; R: EcoRI).
EXAMPLE 3
Mapping the Location of PCGEM1
[0111] Using fluorescent in situ hybridization and the PCGEM1
genomic DNA as a probe, we mapped the location of PCGEM1 on
chromosome 2q to specific region 2q32 (FIG. 7A). Specifically, a
Bacterial Artificial Chromosome (BAC) clone containing the PCGEM1
genomic sequence was isolated by custom services of Genome Systems
(St. Louis, Mo.). PCGEM1-Bac clone 1 DNA was nick translated using
spectrum orange (Vysis) as a direct label and flourescent in situ
hybridization was done using this probe on normal human male
metaphase chromosome spreads. Counterstaining was done and
chromosomal localization,was determined based on the G-band
analysis of inverted 4',6-diamidino-2-phenylindole (DAPI) images.
(FIG. 7B: a DAPI counter-stained chromosome 2 is shown on the left;
an inverted DAPI stained chromosome 2 shown as G-bands is shown in
the center; an ideogram of chromosome 2 showing the localization of
the signal to band 2q32(bar) is shown on the right.) NU200 image
acquisition and registration software was used to create the
digital images. More than 20 metaphases were analyzed.
EXAMPLE 4
Analysis of PCGEM1 Gene Expression in Prostate Cancer
[0112] To further characterize the tumor specific expression of
the. PCGEM1 fragment, and also to rule out individual variations of
gene expression alterations commonly observed in tumors, the
expression of the PCGEM1 fragment was evaluated on a test panel of
matched tumor and normal RNAs derived from the microdissected
tissues of twenty prostate cancer patients.
[0113] Using the PCGEM1 cDNA sequence (SEQ ID NO:1), specific PCR
primers (Sense primer 1 (SEQ ID NO: 5): 5' TGCCTCAGCCTCCCAAGTAAC 3
' and Antisense primer 2 (SEQ ID NO: 6): 5' GGCCAAAATAAAACCAAACAT
3') were designed for RT-PCR assays. Radical prostatectomy derived
OCT compound (Miles Inc. Elkhart, Ind.) embedded fresh frozen
normal and tumor tissues from prostate cancer patients were
characterized for histopathology by examining hematoxylin and eosin
stained sections (46). Tumor and normal prostate tissues regions
representing approximately equal number of epithelial cells were
dissected out of frozen sections. DNA-free RNA was prepared from
these tissues and used in RT-PCR analysis to detect PCGEM1
expression. One hundred nanograms of total RNA was reverse
transcribed into cDNA using RT-PCR kit (Perkin-Elmer, Foster,
Calif.). The PCR was performed using Amplitaq Gold from
Perkin-Elmer (Foster, Calif.). PCR cycles used were: 95.degree. C.
for 10 minutes, 1 cycle; 95.degree. C. for 30 seconds, 55.degree.
C. for 30 seconds, 72.degree. C. for 30 seconds, 42 cycles, and
72.degree. C. for 5 minutes, 1 cycle followed by a 4.degree. C.
storage. Epithelial cell-associated cytokeratin 18 was used as an
internal control.
[0114] RT-PCR analysis of microdissected matched normal and tumor
tissue derived RNAs from 23 CaP patients revealed tumor associated
overexpression of PCGEM1 in 13 (56%) of the patients (FIG. 5). Six
of twenty-three (26%) patients did not exhibit detectable PCGEM1
expression in either normal or tumor tissue. derived RNAs. Three of
twenty-three (13%) tumor specimens showed reduced expression in
tumors. One of the patients did not exhibit any change. Expression
of housekeeping genes, cytokeratin-18 (FIG. 3) and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (data not shown)
remained constant in tumor and normal specimens of all the patients
(FIG. 3). These results were further confirmed by another set of
PCGEM1 specific primers (Sense Primer 3 (SEQ ID NO: 7): 5'
TGGCAACAGGCAAGCAGAG 3' and Antisense Primer 2 (SEQ ID NO: 6): 5'
GGCCAAAATAAAACCAAACAT 3'). Four of 16 (25%) patients did not
exhibit detectable PCGEM1 expression in either normal or tumor
tissue derived RNAs. Two of 16 (12.5%) tumor specimens showed
reduced expression in tumors. These results of PCGEM1 expression in
tumor tissues could be explained by the expected individual
variations between tumors of different patients. Most importantly,
initial DD observations were confirmed by showing that 45% of
patients analyzed did exhibit over expression of PCGEM1 in tumor
prostate tissues when compared to corresponding normal prostate
tissue of the same individual.
EXAMPLE 5
In situ Hybridization
[0115] In situ hybridization was performed essentially as described
by Wilkinson and Green (48). Briefly, OCT embedded tissue slides
stored at -80.degree. C. were fixed in 4% PFA (paraformaldehyde),
digested with proteinase K and then again fixed in 4% PFA. After
washing in PBS, sections were treated with 0.25% acetic anhydride
in 0.1M triethanolamine, washed again in PBS, and dehydrated in a
graded ethanol series. Sections were hybridized with
.sup.35S-labeled riboprobes at 52.degree. C. overnight. After
washing and RNase A treatment, sections were dehydrated, dipped
into NTB-2 emulsion and exposed for 11 days at 4.degree. C. After
development, slides were lightly stained with hematoxylin and
mounted for microscopy. In each section, PCGEM1 expression was
scored as percentage of cells showing .sup.35S signal: 1+, 1-25%;
2+, 25-50%; 3+, 50-75%, 4+, 75-100%.
[0116] Paired normal (benign) and tumor specimens from 13 patients
were tested using in situ hybridization. A representative example
is shown in FIG. 17. In 11 cases (84%) tumor associated elevation
of PCGEM1 expression was detected. In 5 of these 11 patients the
expression of PCGEM1 increased to 1+ in the tumor area from an
essentially undetectable level in the normal area (on the 0 to 4+
scale). Tumor specimens from 4 of 11 patients scored between 2+
(example shown in FIG. 17B) and 4+. Two of 11 patients showed focal
signals with 3+ score in the tumor area, and one of these patients
had similar focal signal (2+) in an area pathologically designated
as benign. In the remaining 2 of the 13 cases there was no
detectable signal in any of the tissue areas tested. The results
indicate that PCGEM1 expression appears to be restricted to
glandular epithelial cells. (FIG. 17 shows an example of in situ
hybridization of .sup.35S labeled PCGEM1 riboprobe to matched
normal (A) versus tumor (B) sections of prostate cancer patients.
The light gray areas are hematoxylin stained cell bodies, the black
dots represent the PCGEM1 expression signal. The signal is
background level in the normal (A), 2+ level in the tumor (B)
section. The magnification is 40.times..)
EXAMPLE 6
PCGEM1 Gene Expression in Prostate Tumor Cell Lines
[0117] PCGEM1 gene expression was also evaluated in established
prostate cancer cell lines: LNCaP, DU145, PC3 (all from ATCC),
DuPro (available from Dr. David Paulson, Duke University, Durham,
N.C.), and an E6/E7--immortalized primary prostate cancer cell
line, CPDR1 (47). CPDR1 is a primary CaP derived cell line
immortalized by retroviral vector, LXSN 16 E6 E7, expressing E6 and
E7 gene of the human papilloma virus 16. LNCaP is a well studied,
androgen-responsive prostate cancer cell line, whereas DU145, PC3,
DuPro and CPDR1 are androgen-independent and lack detectable
expression of the androgen receptor. Utilizing the RT-PCR assay
described above, PCGEM1 expression was easily detectable in LNCaP
(FIG. 4). However, PCGEM1 expression was not detected in prostate
cancer cell lines DU145, PC3, DuPro and CPDR. Thus, PCGEM1 was
expressed in the androgen-responsive cell line but not in the
androgen-independent cell lines. These results indicate that
hormones, particularly androgen, may play a key role in regulating
PCGEM1 expression in prostate cancer cells. In addition, the
results suggest that PCGEM1 expression may be used to distinguish
between hormone responsive tumor cells and more aggressive hormone
refractory tumor cells.
[0118] To test if PCGEM1 expression is regulated by androgens, we
performed experiments evaluating PCGEM1 expression in LNCaP cells
(ATCC) cultured with and without androgens. Total RNA from LNCaP
cells, treated with synthetic androgen R1881 obtained from (DUPONT,
Boston, Mass.), were analyzed for. PCGEM1 expression. Both RT-PCR
analysis (FIG. 5a) and Northern blot analysis (FIG. 5b) were
conducted as follows.
[0119] LNCaP cells were maintained in RPMI 1640 (Life Technologies,
Inc., Gaithersburg, Md.) supplemented with 10% fetal bovine serum
(FBS, Life Technologies, Inc., Gaithersburg, Md.) and experiments
were performed on cells between passages 20 and 35. For the studies
of NKX3.1 gene expression regulation, charcoal/dextran stripped
androgen-free FBS (cFBS, Gemini Bio-Products, Inc., Calabasas,
Calif.) was used. LNCaP cells were cultured first in RPMI 1640 with
10% cFBS for 4 days and then stimulated with a non-metabolizable
androgen analog R1881 (DUPONT, Boston, Mass.) at different
concentrations for different times as shown in FIG. 5A. LNCaP cells
identically treated but without R1881 served as control. Poly A+
RNA derived from cells treated with/without R1881 was extracted at
indicated time points with RNAzol B (Tel-Test, Inc, TX) and
fractionated (2 .mu.g/lane) by running on 1% formaldehyde-agarose
gel and transferred to nylon membrane. Northern blots were analyzed
for the expression of PCGEM1 using the nucleic acid molecule set
forth in SEQ ID NO: 4 as a probe. The RNA from LNCaP cells treated
with R1881 and RNA from control LNCaP cells were also analyzed by
RT-PCR assays as described in Example 4.
[0120] As set forth in FIGS. 5a and 5b, PCGEM1 expression increases
in response to androgen treatment. This finding further supports
the hypothesis that the PCGEM1 expression is regulated by androgens
in prostate cancer cells.
EXAMPLE 7
Tissue Specificity of PCGEM1 Expression
[0121] Multiple tissue Northern blots (Clontech, CA) conducted
according to the manufacturer's directions revealed prostate
tissue-specific expression of PCGEM1. Polyadenylate RNAs of 23
different human tissues (heart, brain, placenta, lung, liver
skeletal muscle, kidney, pancreas, spleen, thymus, prostate,
testis, ovary, small intestine, colon, peripheral blood, stomach,
thyroid, spinal cord, lymph node, trachea, adrenal gland and bone
marrow) were probed with the 530 base pair PCGEM1 cDNA fragment
(nucleotides 410 to 940 of SEQ ID NO: 1). A 1.7 kilobase mRNA
transcript hybridized to the PCGEM1 probe in prostate tissue (FIG.
6a). Hybridization was not observed in any of the other human
tissues (FIG. 6a). Two independent experiments revealed identical
results.
[0122] Additional Northern blot analyses on an RNA master blot
(Clontech, CA) conducted according to the manufacturer's directions
confirm the prostate tissue specificity of the PCGEM1 gene (FIG.
6b). Northern blot analyses reveal that the prostate tissue
specificity of PCGEM1 is comparable to the well known prostate
marker PSA (77 mer oligo probe) and far better than two other
prostate specific genes PSMA (234 bp fragment from PCR product) and
NKX3.1 (210 bp cDNA). For instance, PSMA is expressed in the brain
(37) and in the duodenal mucosa and a subset of proximal renal
tubules (38). While NKX3.1 exhibits high levels of expression in
adult prostate, it is also expressed in lower levels in testis
tissue and several other tissues (39).
EXAMPLE 8
Biologic Functions of the PCGEM1
[0123] The tumor associated PCGEM1 overexpression suggested that
the increased expression of PCGEM1 may favor tumor cell
proliferation. NIH3T3 cells have been extensively used to define
cell growth promoting functions associated with a wide variety of
genes (40-44). Utilizing pcDNA3.1/Hygro(+/-)(Invitrogen, CA),
PCGEM1 expression vectors were constructed in sense and anti-sense
orientations and were transfected into NIH3T3 cells, and hygromycin
resistant colonies were counted 2-3 weeks later. Cells transfected
with PCGEM1 sense construct formed about 2 times more colonies than
vector alone in three independent experiments (FIG. 10). The size
of the colonies in PCGEM1 sense construct transfected cells were
significantly larger. No appreciable difference was observed in the
number of colonies between anti-sense PCGEM1 constructs and vector
controls. These promising results document a cell growth
promoting/cell survival function(s) associated with PCGEM1.
[0124] The function of PCGEM1, however, does not appear to be due
to protein expression. To assess this hypothesis, we used the
TestCode program (GCG Wisconsin Package, Madison, Wis.), which
identifies potential protein coding sequences of longer than 200
bases by measuring the non-randomness of the composition at every
third base, independently from the reading frames. Analysis of the
PCGEM1 cDNA sequence revealed that, at greater than 95% confidence
level, the sequence does not contain any region with protein coding
capacity (FIG. 16A). Similar results were obtained when various
published non-coding RNA sequences were analyzed with the TestCode
program (data not shown), while known protein coding regions of
similar size i.e., alpha actin (FIG. 16B) can be detected with high
fidelity. (In FIG. 16, evaluation of the coding capacity of the
PCGEM1 (A) and the human alpha actin (B), is performed
independently from the reading frame, by using the TestCode
program. The number of base pairs is indicated on the X-axis, the
TestCode values are shown on the Y-axis. Regions of longer than 200
base pairs above the upper line (at 9.5 value) are considered
coding, under the lower line (at 7.3 value) are considered
non-coding, at a confidence level greater than 95%.)
[0125] The Codon Preference program (GCG Wisconsin Package,
Madison, Wis.), which locates protein coding regions in a reading
frame specific manner further suggested the absence of protein
coding capacity in the PCGEM1 gene (see www.cpdr.org). In vitro
transcription/translation of PCGEM1 cDNA did not produce a
detectable protein/peptide. Although we can not unequivocally rule
out the possibility that PCGEM1 codes for a short unstable peptide,
at this time both experimental and computational approaches
strongly suggest that PCGEM1 cDNA does not have protein coding
capacity. (It should be recognized that conclusions regarding the
role of PCGEM1 are speculative in nature, and should not be
considered limiting in any way.
[0126] The most intriguing aspect of PCGEM1 characterization has
been its apparent lack of protein coding capacity. Although we have
not completely ruled out the possibility that PCGEM1 codes for a
short unstable peptide, careful sequencing of PCGEM1 cDNA and
genomic clones, computational analysis of PCGEM1 sequence, and in
vitro transcription/translation experiments (data not shown)
strongly suggest a non-coding nature of PCGEM1. It is interesting
to note that an emerging group of novel mRNA-like non-coding RNAs
are being discovered whose function and mechanisms of action remain
poorly understood (49). Such RNA molecules have also been termed as
"RNA riboregulators" because of their function(s) in development,
differentiation, DNA damage, heat shock responses and tumorigenesis
(40-42, 50). In the context of tumorigenesis, the H19, His-1 and
Bic genes code for functional non-coding mRNAs (50). In addition, a
recently reported prostate cancer associated gene, DD3 also appears
to exhibit a tissue specific non-coding mRNA (51). In this regard
it is important to point out that PCGEM1 and DD3 may represent a
new class of prostate specific genes. The recent discovery of a
steroid receptor co-activator as an mRNA, lacking protein coding
capacity further emphasizes the role of RNA riboregulators in
critical biochemical function(s) (52). Our preliminary results
showed that PCGEM1 expression in NIH3T3 cells caused a significant
increase in the size of colonies in a colony forming assay and
suggests that PCGEM1 cDNA confers cell proliferation and/or cell
survival function(s). Elevated expression of PCGEM1 in prostate
cancer cells may represent a gain in function favoring tumor cell
proliferation/survival. On the basis of our first characterization
of PCGEM1 gene, we propose that PCGEM1 belongs to a novel class of
prostate tissue specific genes with potential functions in prostate
cell biology and the tumorigenesis of the prostate gland.
[0127] In summary, utilizing surgical specimens and rapid
differential display technology, we have identified candidate genes
of interest with differential expression profile in prostate cancer
specimens. In particular, we have identified a novel nucleotide
sequence, PCGEM1, with no match in the publicly available DNA
databases (except for the homology shown in the high throughput
genome sequence database, discussed above). A PCGEM1 cDNA fragment
detected a 1.7 kb mRNA on Northern blots with selective expression
in prostate tissue. Furthermore, this gene was found to be
up-regulated by the synthetic androgen, R1881. Careful analysis of
microdissected matched tumor and normal tissues further revealed
PCGEM1 over-expression in a significant percentage of prostate
cancer specimens. Thus, we have provided a gene with broad
implications for the diagnosis, prevention, and treatment of
prostate cancer.
[0128] The specification is most thoroughly understood in light of
the teachings of the references cited within the specification
which are hereby incorporated by reference. The embodiments within
the specification provide an illustration of embodiments of the
invention and should not be construed to limit the scope of the
invention. The skilled artisan readily recognizes that many other
embodiments are encompassed by the invention.
[0129] References
[0130] 1. Parker S L, Tong T, Bolden S, and Wingo P A: Cancer
statistics. CA Cancer J. Clin., 46:5-27, 1996.
[0131] 2. Visakorpi T, Kallioniemi O P, Koivula T and Isola J: New
prognostic factors in prostate carcinoma. Eur. Uro., 24:438-449,
1993.
[0132] 3. Mostofi F K: Grading of prostate carcinoma. Cancer
Chemothera Rep, 59:111, 1975.
[0133] 4. Lu-Yao G L, McLerran D, Wasson J, Wennberg J E: An
assessment of radical prostatectomy. Time trends, Geographical
Variations and Outcomes. JAMA, 269:2633-2636, 1993.
[0134] 5. Partin A W and Oesterling J E: The clinical usefulness of
prostate-specific antigen: update 1994,J. Urol., 152:1358-1368,
1994.
[0135] 6. Wasson J H, Cushman C C, Bruskewitz R C, Littenberg B,
Mulley A G, and Wennberg J E: A structured literature review of
treatment for localized CaP. Arch. Fam. Med., 2:487-493, 1993.
[0136] 7. Weinberg R A: How cancer arises. Sci. Amer., 9, 62-70,
1996.
[0137] 8. Bostwick D G: High grade prostatic intraepithelial
neoplasia: The most likely precursor of prostate cancer. Cancer,
75:1823-1836, 1995.
[0138] 9. Bostwick D G, Pacelli A, Lopez-Beltran A: Molecular
Biology of Prostatic Intraepithelial Neoplasia. The Prostate,
29:117-134, 1996.
[0139] 10. Pannek J, Partin A W: Prostate specific antigen: What's
new in 1997. Oncology, 11:1273-1278, 1997.
[0140] 11. Partin A W, Kattan M W, Subong E N, Walsh P C, Wojno K
J, Oesterling J E, Scardino P T, Pearson J D: Combination of
prostate specific antigen, clinical stage, and Gleason score to
predict pathological stage of localized prostate cancer. A
multi-institutional update. JAMA, 277:1445-1451, 1997.
[0141] 12. Gomella L G, Raj G V, Moreno J G: Reverse transcriptase
polymerase chain reaction for prostate specific antigen in
management of prostate cancer. J. Urol., 158:326-337, 1997.
[0142] 13. Gao C L, Dean R C, Pinto A, Mooneyhan R, Connelly R R,
McLeod D G, Srivastava, S, Moul J W: Detection of PSA-expressing
prostatic cells in bone marrow of radical prostatectomy patients by
sensitive reverse transcriptase-polymerase chain reaction (RT-PCR).
1998 International Symposium on Biology of Prostate growth,
National Institutes of Health, p. 83, 1998.
[0143] 14. Garnick M B, Fair W R: Prostate cancer. Sci. Amer.,
75-83, 1998.
[0144] 15. Moul J W, Gaddipati J, and Srivastava S: 1994. Molecular
biology of CaP. Oncogenes and tumor suppressor genes. Current
Clinical Oncology: CaP. (Eds. Dawson, N. A. and Vogelzang, N. J.),
Wiley-Liss Publications, 19-46.
[0145] 16. Lalani E-N, Laniado M E and Abel P D: Molecular and
cellular biology of prostate cancer. Cancer and Mets. Rev.
16:29-66, 1997.
[0146] 17. Shi X B, Gumerlock P H, deVere White R W: Molecular
Biology of CaP World J. Urol; 14, 318-328, 1996.
[0147] 18. Heidenberg H B, Bauer J J, McLeod D G, Moul J W and
Srivastava S: The role of p53 tumor suppressor gene in CaP: a
possible biomarker? Urology, 48:971-979, 1996.
[0148] 19. Bova G S and Issacs W B: Review of allelic loss and gain
in prostate cancer. World J Urol., 14:338-346, 1996.
[0149] 20. Issacs W B and Bova G S: Prostate Cancer: The Genetic
Basis of Human Cancer. Eds. Vogelstein B, and Kinzler K W,
McGraw-Hill Companies, Inc., pp. 653-660, 1998.
[0150] 21. Srivastava S and Moul J W: Molecular Progression of
Prostate Cancer. Advances in Oncobiology. (In Press) 1998.
[0151] 22. Sakr W A, Macoska J A, Benson P, Benson D J, Wolman S R,
Pontes J E, and Crissman: Allelic loss in locally metastatic,
multi-sampled prostate cancer. Cancer Res., 54:3273-3277, 1994.
[0152] 23. Mirchandani D, Zheng J, Miller G L, Ghosh A K, Shibata D
K, Cote R J and Roy-Burman P: Heterogeneity in intratumor
distribution of p53 mutations in human prostate cancer. Am. J.
Path. 147:92-101, 1995.
[0153] 24. Bauer J J, Moul J W, and McLeod D G: CaP: Diagnosis,
treatment, and experience at one tertiary medical center,
1989-1994. Military Medicine, 161:646-653, 1996.
[0154] 25. Bauer J J, Connelly R R, Sesterhenn I A, Bettencourt M
C, McLeod D G, Srivastava S, Moul J W: Biostatistical modeling
using traditional variables and genetic biomarkers predicting the
risk of prostate cancer recurrence after radical prostatectomy.
Cancer, 79:952-962, 1997.
[0155] 26. Bauer J J, Connelly R R, Sesterhenn I A, DeAusen J D,
McLeod D G, Srivastava S, Moul J W: Biostatistical modeling using
traditional preoperative and pathological prognostic variables in
the selection of men at high risk of disease recurrence after
radical prostatectomy. J. Urol., 159(3):929-933, 1998
[0156] 27. Sager R: Expression genetics in cancer: Shifting the
focus from DNA to RNA. Proc Natl. Acad Sci. USA, 94:952-957,
1997
[0157] 28. Strausberg R L, Dahl C A, and Klausner R D: New
opportunities for uncovering the molecular basis of cancer. Nature
Genetics, 15:415-16, 1997.
[0158] 29. Liang, Peng, and Pardec A B: Differential display of
eukaryotic messenger RNA by means of the polymerase chain reaction.
Science 257:967-971, 1992.
[0159] 30. Velculescu V E, Zhang L, Vogelstein B, and Kinzler K W:
Serial analysis of gene expression Science, 270:484-487, 1995.
[0160] 31. Chena M, Shalon D S, Davis R W, and Brown P O:
Quantitative monitoring of gene expression patterns with a
complementary DNA microarrays. Science, 270:467-470, 1995.
[0161] 32. Liu A Y, Corey E, Vessella R L, Lange P H, True L D,
Huang G M, Nelson P S and Hood L: Identification of differentially
expressed prostate genes: Increased expression of transcription
factor ETS-2 in prostate cancer. The Prostate 30:145-153, 1997.
[0162] 33. Chuaqui R F, Englert C R, Strup S E, Vocke C D, Zhuang
Z, Duray P H, Bostwick D G, Linehan W M, Liotta L A and Emmert-Buck
M R: Identification of a novel transcript up-regulated in a
clinically aggressive prostate carcinoma. Urology, 50:302-307,
1997.
[0163] 34. Thigpen A E, Cala K M, Guileyardo J M, Molberg K H,
McConnell J D, and Russell D W: Increased expression of early
growth response-1 messenger ribonucleic acid in prostate
adenocarcinoma. J. Urol., 155:975-981, 1996.
[0164] 35. Wang F L, Wang Y, Wong W K, Liu Y, Addivinola F J, Liang
P, Chen L B, Kantoff P W and Pardee A B: Two differentially
expressed genes in normal human prostate tissues and in carcinoma.
Cancer Res., 56:3634-3637, 1996.
[0165] 36. Schleicher R L, Hunter S B, Zhang M, Zheng M, Tan W,
Bandea C I, Fallon M T, Bostwick D G, and Varma V A: Neurofilament
heavy, chain-like messenger RNA and protein are present in benign
prostate and down regulated in prostate carcinoma. Cancer Res.,
57:3532-3536, 1997.
[0166] 37. O'Keefe, D S, Su, S L, Bacich D J, Horiguchi Y, Luo Y,
Powell C T, Zandvliet D, Russell P J, Molloy P L, Nowak, N J,
Shows, T B, Mullins, C, Vonder Haar R A, Fair W R, and Heston W D:
Mapping, genomic organization and promoter analysis of the human
prostate-specific membrane antigen gene. Biochim Biophys Acta,
1443(1-2):113-127, 1998.
[0167] 38. Silver D A, Pellicer I, Fair W R, Heston, W D, and
Cordon-Cardo C: Prostate-specific membrane antigen expression in
normal and malignant human tissues. Clin Cancer Res, 3(1):81-85,
1997.
[0168] 39. He W W, Sciavolino P J, Wing J, Augustus M, Hudson P,
Meissner P S, Curtis R T, Shell B K, Bostwick D G, Tindall D J,
Gelmann E P, Abate-Shen C, and Carter K C: A novel
prostate-specific, androgen-regulated homeobox gene (NKX3.1) that
maps to 8p21, a region frequently deleted in prostate cancer.
Genomics 43(1):69-77, 1997.
[0169] 40. Crespi M D, Jurkevitch E, Poiret M, d'Aubenton-Carafa Y,
Petrovics G, Kondorosi E, and Kondorosi A: Enod 40, a gene
expressed during nodule organogenesis, codes for a non-translatable
RNA involved in plant growth. The EMBO J 13:5099-5112, 1994.
[0170] 41. Velleca M A, Wallace M C and Merlie J P: A novel
synapse-associated non-coding RNA. Mol. Cell Bio. 14:7095-7104,
1994.
[0171] 42. Takeda K. Ichijoh, Fujii M, Mochida Y, Saitoh M,
Nishitoh H, Sampath T K and Miyazonok: Identification of a novel
bone morphogenetic protein responsive gene that may function as
non-coding RNA. J. Biol. Chem. 273:17079-17085, 1998.
[0172] 43. Van de Sande K, Pawlowski K, Czaja I, Wieneke U, et al:
Modification of phytohormone response by a peptide encode by ENOD
40 of legumes and a non-legume. Science 273:370-373.
[0173] 44. Hao Y, Crenshaw T, Moulton T, Newcomb E and Tycko B:
Tumor suppressor activity of H19RNA. Nature. 365:764-767, 1993.
[0174] 45. Neumaier M, Gerhard M, Wagener C: Diagnosis of
micrometastases by the amplification of tissue specific genes.
Gene. 159(1):43-47, 1995.
[0175] 46. Gaddipati J, McLeod D, Sesterhenn I, Hussussian C, Tong
Y, Seth P, Dracopoli N, Moul J and Srivastava S: Mutations of the
p16 gene product are rare in prostate cancer. The Prostate.
30:188-194, 1997.
[0176] 47. Davis L D, Sesterhenn I A, Moul J W and Srivastava S:
Characterization of prostate cancer cells immortalized with E6/E7
genes. Int. Symp. On Biol. Of Prost. Growth Proceedings, National
Institutes of Health., 77, 1998.
[0177] 48. Wilkinson, D., & Green, J. (1990) in Post
implantation Mammalian Embryos, eds. Copp, A. J. & Cokroft, D.
L. (Oxford University Press, London), pp. 155-171.
[0178] 49. Erdmann, V. A., Szymanski, M., Hochberg, A., de Groot,
N., & Barciszewski, J. (1999) Nucleic Acids Research 27,
192-195.
[0179] 50. Askew, D. S., & Xu, F. (1999) Histol Histopatho.
14,235-241.
[0180] 51. Bussemakers, M. J. H., Van Bokhoven, A., Verhaegh, G.
W., Smit, F. P., Karthaus, H. F., Schalken, J. A., Debruyne, F. M.,
Ru, N., & Isaacs, W. B. (1999) Cancer Res. 59, 5975-5979.
[0181] 52. Lanz, R. B., McKenna, N. J., Onate, S. A., Albrecht, U.,
Wong, J., Tsai, S. Y., Tsai, M. J., & O'Mally, B. W. (1999)
Cell 97, 17-27.
[0182] 53. Srikantan V, Zou Z, Petrovics G, Xu L, Augustus M, Davis
L, Livezey J R, Connell T, Sesterhenn I A, Yoshino K, Buzard G S,
Mostofi F K, McLeod D G, Moul J W, and Srivastava S: PCGEM1: A
Novel Prostate Specific Gene is Overexpressed in Prostate Cancer.
Submitted to Proceedings of the National Academy of Sciences.
Sequence CWU 1
1
22 1 1603 DNA Homo sapiens 1 aaggcactct ggcacccagt tttggaactg
cagttttaaa agtcataaat tgaatgaaaa 60 tgatagcaaa ggtggaggtt
tttaaagagc tatttatagg tccctggaca gcatcttttt 120 tcaattaggc
agcaaccttt ttgccctatg ccgtaacctg tgtctgcaac ttcctctaat 180
tgggaaatag ttaagcagat tcatagagct gaatgataaa attgtactac gagatgcact
240 gggactcaac gtgaccttat caagtgagca ggcttggtgc atttgacact
tcatgatatc 300 agccaaagtg gaactaaaaa cagctcctgg aagaggacta
tgacatcatc aggttgggag 360 tctccaggga cagcggaccc tttggaaaag
gactagaaag tgtgaaatct attagtcttc 420 gatatgaaat tctctgtctc
tgtaaaagca tttcatattt acaagacaca ggcctactcc 480 tagggcagca
aaaagtggca acaggcaagc agagggaaaa gagatcatga ggcatttcag 540
agtgcactgt cttttcatat atttctcaat gccgtatgtt tggttttatt ttggccaagc
600 ataacaatct gctcaagaaa aaaaaatctg gagaaaacaa aggtgccttt
gccaatgtta 660 tgtttctttt tgacaagccc tgagatttct gaggggaatt
cacataaatg ggatcaggtc 720 attcatttac gttgtgtgca aatatgattt
aaagatacaa cctttgcaga gagcatgctt 780 tcctaagggt aggcacgtgg
aggactaagg gtaaagcatt cttcaagatc agttaatcaa 840 gaaaggtgct
ctttgcattc tgaaatgccc ttgttgcaaa tattggttat attgattaaa 900
tttacactta atggaaacaa cctttaactt acagatgaac aaacccacaa aagcaaaaaa
960 tcaaaagccc tacctatgat ttcatatttt ctgtgtaact ggattaaagg
attcctgctt 1020 gcttttgggc ataaatgata atggaatatt tccaggtatt
gtttaaaatg agggcccatc 1080 tacaaattct tagcaatact ttggataatt
ctaaaattca gctggacatt gtctaattgt 1140 tttttatata catctttgct
agaatttcaa attttaagta tgtgaattta gttaattagc 1200 tgtgctgatc
aattcaaaaa cattactttc ctaaatttta gactatgaag gtcataaatt 1260
caacaaatat atctacacat acaattatag attgtttttc attataatgt cttcatctta
1320 acagaattgt ctttgtgatt gtttttagaa aactgagagt tttaattcat
aattacttga 1380 tcaaaaaatt gtgggaacaa tccagcatta attgtatgtg
attgttttta tgtacataag 1440 gagtcttaag cttggtgcct tgaagtcttt
tgtacttagt cccatgttta aaattactac 1500 tttatatcta aagcatttat
gtttttcaat tcaatttaca tgatgctaat tatggcaatt 1560 ataacaaata
ttaaagattt cgaaatagaa aaaaaaaaaa aaa 1603 2 1579 DNA Homo sapiens 2
gcggccgcgt cgacgcaact tcctctaatt gggaaatagt taagcagatt catagagctg
60 aatgataaaa ttgtacttcg agatgcactg ggactcaacg tgaccttatc
aagtgagatg 120 gagtcttgcc ctgtctccaa ggctggagcc caatggtgtg
atcttggctc actgcaacct 180 ccacctccca ggttcaaacg tttctcctgc
ctcagcctcc caagtaactg ggattacagc 240 aggcttggtg catttgacac
ttcatgatat cagccaaagt ggaactaaaa acagctcctg 300 gaagaggact
atgacatcat caggttggga gtctccaggg acagcggacc ctttggaaaa 360
ggactagaaa gtgtgaaatc tattagtctt cgatatgaaa ttctctgtct ccgtaaaagc
420 atttcatatt tacaagacac aggcctactc ctagggcagc aaaaagtggc
aacaggcaag 480 cagagggaaa agagatcatg aggcatttca gagtgcactg
tcttttcata tatttctcaa 540 tgccgtatgt ttggttttat tttggccaag
cataacaatc tgctcaaaaa aaaaaaatct 600 ggagaaaaca aaggtgcctt
tgccaatgtt atgtttcttt ttgacaagcc ctgagatttc 660 tgaggggaat
tcacataaat gggatcaggt cattcattta cgttgtgtgc aaatatgatt 720
taaagataca acctttgcag agagcatgct ttcctaaggg taggcacgtg gaggactaag
780 ggtaaagcat tcttcaagat cagttaatca agaaaggtgc tctttgcatt
ctgaaatgcc 840 cttgttgcaa atattggtta tattgattaa atttacactt
aatggaaaca acctttaact 900 tacagatgaa caaaccccac aaaagcaaaa
aatcaaaagc cctacctatg atttcatatt 960 ttctgtgtaa ctggattaaa
ggattcctgc ttgcttttgg gcataaatga taatggaata 1020 tttccaggta
ttgtttaaaa tgagggccca tctacaaatt cttagcaata ctttggataa 1080
ttctaaaatt cagctggaca ttgtctaatt gttttttata tacatctttg ctagaatttc
1140 aaattttaag tatgtgaatt tagttaatta gctgtgctga tcaattcaaa
aacattactt 1200 tcctaaattt tagactatga aggtcataaa ttcaacaaat
atatctacac atacaattat 1260 agattgtttt tcattataat gtcttcatct
taacagaatt gtctttgtga ttgtttttag 1320 aaaactgaga gttttaattc
ataattactt gatcaaaaaa ttgtgggaac aatccagcat 1380 taattgtatg
tgattgtttt tatgtacata aggagtctta agcttggtgc cttgaagtct 1440
tttgtactta gtcccatgtt taaaattact actttatatc taaagcattt atgtttttca
1500 attcaattta catgatgcta attatggcaa ttataacaaa tattaaagat
ttcgaaatag 1560 aaaaaaaaaa aaaaatcta 1579 3 1819 DNA Homo sapiens 3
tccctcttgc gttctgcaat ttctgaaaaa aagatgttta ttgcaaagtg atatgagcac
60 tggaaaggta ctaattccaa tttgattcta attggatgag tgacatgggt
aagcgattct 120 aagcatttgt gtttttttta gtagtatgga atttaattag
ttctcagtat gttagtgaag 180 atgaatgaaa acatgcatat gtttccatgt
attataaata ttttaaaatg caaaaaatta 240 ttctaatgaa tatataaata
taaagcataa caataataat acaataccac ccataaagtc 300 atcatctaat
ttaaaaacta aaacattaac acttgaatct cccccattgc aacatctttc 360
ccgacttgtg tgtttttttc ttttgctttt aaaatttttg ttttatcata tgtctgcata
420 agattatata gctttccttg ttttaagctt tttaaataat atattgtagt
tatattattt 480 gtgctttgct ttttttactt aacattatgg ttctaaaatt
cagtaatgtg ttgggcatgt 540 ataatttgtt tatttttaat ctctttgaca
ttcgactata taaatttcag tttgtttatt 600 gactcctttg tctatagata
ctctgctatt tctgtttttg ctgttacaaa aataatgctg 660 ttttaaattt
cattttgtat acttttttga ggcatgtgta tgagttattc taaggtaaaa 720
aaataagaaa aaattgctgg gttataagat tgtcacatgc tcgaatttac aagataatgc
780 caaatcattt ttcaaagtaa ttatacctat ttatactacc ggtatgagta
tattggtgcc 840 cacatagttg cttgttctgc caaagtttgg tatgatcgaa
caataatttt tgcccatcaa 900 atggcataaa ataaaatctc agtgtgcttt
taatttgcat tttctatgtt taagaattgt 960 ttctttttta accatttata
atttactttt gctgaaatgc ttgcttatta tttttgctcc 1020 ccattttttc
ctattggatt gcttttctca ttaatttata agaattttat atggtttaga 1080
tactaattat tatattactg aaaatacctt tatcagtttg ttgtgtactt tctactttat
1140 gtcttgtgat ggataaaagt tttaaattgt attgtgttga agttaacatt
tttaaatttt 1200 ataatcagca tctttaataa tctctttmta aaattttcct
ttacatagat gtcataaaga 1260 tacatctcta taatttctta tttttttggc
atatgttcat taagtcattt tatcattttt 1320 tagtaataaa ttgcagttat
ttatgaaaca aataattttt aaaattatat atgctttctt 1380 taaaaattga
tcttagcatg cttcactatg aagcttgagg cttcactgca cgttgtactg 1440
aaattatgta taaaacagtg gttctgaaaa tctctgagtt catgacacct ttagtgtctc
1500 aggttttttt gcttttgttc ttgttttttc tcacaaagca cctaagttaa
ataaaaacaa 1560 agcacaaagc tatcagcttc atgtattaag tagtaagctc
ccatgttaac agttgtaact 1620 tgcctggtgc ccaatagatg tcactctgtt
ttcctagaaa ctttaaaata tccctcagtg 1680 ctcctgttaa ttcatggtag
tgccccaagg cactctggca cccagttttg gaactgcagt 1740 tttaaaagtc
ataaattgaa tgaaaatgat agcaaaggtg gaggttttta aagagctatt 1800
tataggtccc tggacagca 1819 4 1025 DNA Homo sapiens 4 ttttttcaat
taggcagcaa cctttttgcc ctatgccgta acctgtgtct gcaacttcct 60
ctaattggga aatagttaag cagattcata gagctgaatg ataaaattgt actacgagat
120 gcactgggac tcaacgtgac cttatcaagt gagcaggctt ggtgcatttg
acacttcatg 180 atatcatcca aagtggaact aaaaacagct cctggaagag
gactatgaca tcatcaggtt 240 gggagtctcc agggacagcg gaccctttgg
aaaaggacta gaaagtgtga aatctattag 300 tcttcgatat gaaattctct
gtctctgtaa aagcatttca tatttacaag acacaggcct 360 actcctaggg
cagcaaaaag tggcaacagg caagcagagg gaaaagagat catgaggcat 420
ttcagagtgc actgtctttt catatatttc tcaatgccgt atgtttggtt ttattttggc
480 caagcataac aatctgctca agaaaaaaaa atctggagaa aacaaaggtg
cctttgccaa 540 tgttatgttt ctttttgaca agccctgaga tttctgaggg
gaattcacat aaatgggatc 600 aggtcattca tttacgttgt gtgcaaatat
gatttaaaga tacaaccttt gcagagagca 660 tgctttccta agggtaggca
cgtggaggac taagggtaaa gcattcttca agatcagtta 720 atcaagaaag
gtgctctttg cattctgaaa tgcccttgtt gcaaatattg gttatattga 780
ttaaatttac acttaatgga aacaaccttt aacttacaga tgaacaaacc cacaaaagca
840 aaaaatcaaa agccctacct atgatttcat attttctgtg taactggatt
aaaggattcc 900 tgcttgcttt tgggcataaa tgataatgga atatttccag
gtattgttta aaatgagggc 960 ccatctacaa attcttagca atactttgga
taattctaaa attcagctgg acattgtcta 1020 attgt 1025 5 21 DNA
Artificial Sequence Description of Artificial SequenceProbe/Primer
5 tgcctcagcc tcccaagtaa c 21 6 21 DNA Artificial Sequence
Description of Artificial SequenceProbe/Primer 6 ggccaaaata
aaaccaaaca t 21 7 19 DNA Artificial Sequence Description of
Artificial SequenceProbe/Primer 7 tggcaacagg caagcagag 19 8 11801
DNA Homo sapiens unsure (7470) n may represent any of the four
nucleotide bases 8 tccctcttgc gttctgcaat ttctgaaaaa aagatgttta
ttgcaaagtg atatgagcac 60 tggaaaggta ctaattccaa tttgattcta
attggatgag tgacatgggt aagcgattct 120 aagcatttgt gtttttttta
gtagtatgga atttaattag ttctcagtat gttagtgaag 180 atgaatgaaa
acatgcatat gtttccatgt attataaata ttttaaaatg caaaaaatta 240
ttctaatgaa tatataaata taaagcataa caataataat acaataccac ccataaagtc
300 atcatctaat ttaaaaacta aaacattaac acttgaatct cccccattgc
aacatctttc 360 ccgacttgtg tgtttttttc ttttgctttt aaaatttttg
ttttatcata tgtctgcata 420 agattatata gctttccttg ttttaagctt
tttaaataat atattgtagt tatattattt 480 gtgctttgct ttttttactt
aacattatgg ttctaaaatt cagtaatgtg ttgggcatgt 540 ataatttgtt
tatttttaat ctctttgaca ttcgactata taaatttcag tttgtttatt 600
gactcctttg tctatagata ctctgctatt tctgtttttg ctgttacaaa aataatgctg
660 ttttaaattt cattttgtat acttttttga ggcatgtgta tgagttattc
taaggtaaaa 720 aaataagaaa aaattgctgg gttataagat tgtcacatgc
tcgaatttac aagataatgc 780 caaatcattt ttcaaagtaa ttatacctat
ttatactacc ggtatgagta tattggtgcc 840 cacatagttg cttgttctgc
caaagtttgg tatgatcgaa caataatttt tgcccatcaa 900 atggcataaa
ataaaatctc agtgtgcttt taatttgcat tttctatgtt taagaattgt 960
ttctttttta accatttata atttactttt gctgaaatgc ttgcttatta tttttgctcc
1020 ccattttttc ctattggatt gcttttctca ttaatttata agaattttat
atggtttaga 1080 tactaattat tatattactg aaaatacctt tatcagtttg
ttgtgtactt tctactttat 1140 gtcttgtgat ggataaaagt tttaaattgt
attgtgttga agttaacatt tttaaatttt 1200 ataatcagca tctttaataa
tctctttata aaattttcct ttacatagat gtcataaaga 1260 tacatctcta
taatttctta tttttttggc atatgttcat taagtcattt tatcattttt 1320
tagtaataaa ttgcagttat ttatgaaaca aataattttt aaaattatat atgctttctt
1380 taaaaattga tcttagcatg cttcactatg aagcttgagg cttcactgca
cgttgtactg 1440 aaattatgta taaaacagtg gttctgaaaa tctctgagtt
catgacacct ttagtgtctc 1500 aggttttttt gcttttgttc ttgttttttc
tcacaaagca cctaagttaa ataaaaacaa 1560 agcacaaagc tatcagcttc
atgtattaag tagtaagctc ccatgttaac agttgtaact 1620 tgcctggtgc
ccaatagatg tcactctgtt ttcctagaaa ctttaaaata tccctcagtg 1680
ctcctgttaa ttcatggtag tgccccaagg cactctggca cccagttttg gaactgcagt
1740 tttaaaagtc ataaattgaa tgaaaatgat agcaaaggtg gaggttttta
aagagctatt 1800 tataggtccc tggacagcat cttttttcaa ttaggcagca
acctttttgc ctatgccgta 1860 actgtgtctg cacttcctct aattggggtg
agtaagagat tttgttatgt atataatagc 1920 taagaatata gtaataatgg
cttaaatcat ggttattttt aaactactaa catttagaag 1980 acaaaataaa
aatgctttga aaagtataga ggttttagtg taattagcag ggaataatga 2040
aatgatttga tagggctact cagttttgta taactttggt gctttaagtc tgaatgcaga
2100 gcatggatgt tgtgatccag cctttatatg ttttccctga agaagattta
atttatttgg 2160 ccttttgaga aacacatttg gcattgtaat atgttttgct
tccaggttct atctccaagg 2220 ataatttgac aaaatcacac ataaatttat
tttcagggca cacagtttcc cttttaggga 2280 actcacagag gtagagagta
atacaataat cacatttgaa tattcagtaa gtgaggtcct 2340 catagatctt
atgtgtatgt caccatgtat ataattttgt taatcactag atgtatgaga 2400
caagaaattt gaggaatctt aactagagat taaaatcagg gatttaaatc aaagaaacat
2460 ttaaatgcct cctttattat ttaaatacct gcatgggaga atcattgaaa
aaaaaataaa 2520 aagcatacaa cttgggaata ttataaacca agaagaattt
gttattctgg ttgatttttt 2580 tttcaggctc cgcacaggca acttaccttt
atctctttgt gatttttatt tcttgttaaa 2640 atatacagaa atagttaagc
agattcatag agctgaatat aaaatttact acgagatgca 2700 ctgggactca
acgtgacctt atcaagtgac ttatcagtga ggtgagcatt cttaattcag 2760
ataatggaac ttattatcat aatcttttgc ttatgctatt gttgagctta actacttatt
2820 catatttgca tatgcatatt gagataatat catttcatta atttcagtac
tgaacactaa 2880 tctcctaaga gtaattgtga aagtttcaga ttgcactatt
tttaactata tatctgtatg 2940 ttatcttcat atatgcttga ataacttata
agcaattgaa actttcaatt acagtatact 3000 attgaagcaa atcaactaat
atatacacat atccattagc aatagtagat aatttttgta 3060 aatgtccagc
acagttcttc atatgtagag gatgttcaaa ttggctaagt tccttttctc 3120
tcttaattat tagtattttt cctactgctc tttgtataat tattccttcc tctttagctc
3180 caatccttac aatctattct taacatagca actgggaaga aagtttttaa
acataaacca 3240 gatgatgtca ctccacccca caaaacttcc actattctct
gtcacacata gaaagaaaga 3300 aaaaaaatat tgaaaaccta caaagacttg
ctatgatctg gtccaggctc tccctaaaat 3360 ttcatgtaat ttccagccac
taggcctttc tggctctcct tcaatctcat tagccttttc 3420 actactacaa
gttagactgg gttttggccg aggtatttct ttttttcata ttttgccttt 3480
gcctagattg ctcttccaat agatattcac aattgcatca tcatttctat atacgtgcta
3540 aaaggtttcc ttgtccaaaa tagcttcagt gaccacctga tctagaatag
tctcgatcaa 3600 aagtttcttt tccttttcct caccacttga tatttatatc
aaacatttat ttgtgtaatt 3660 tatgtgtttg tttgttttct gtactagcat
tatgatgacc atactatttg atgcccccca 3720 aaaaatactt tcgagaatga
cagggcaaag ctaaaataat taaattatat aattttgaca 3780 taggcactat
tgacaaaaag caattgatgt tatgatagtg ttagatctat gaaatagtac 3840
tatttaaaag taattctctg aaatacaatt ttctaaaact aaaagcagca tatgtacatg
3900 aaacaccaaa aaacttcctt atatttatca ctggaagatt taaaatagta
taagtagtaa 3960 cttatttaat atatttttga ttatttaatt aattttatag
tatccaactc taatataatg 4020 ccagtggtat ttgttcaaaa tattttaatg
ttgtctattt atttttaatt tgcctaaaaa 4080 ttatcttaaa tgaaaatttt
tggttaataa atttgaaaat actgaaaccc tcatctccag 4140 tctctgtgga
tcctaaagtt tttagttgag aaaataattt ttctctagag aatgaagtag 4200
cttgtaagct tggagaaatt tctgctaaat aaatgatatt atcaactctt attttcttca
4260 atacgaaata tataaatatt tcagctcata tatttttgca ggtgctatgc
ttttgcttcc 4320 aatcataatt tctgacaaat attttggaag tcaaaacttg
tcttctattt tgttatttaa 4380 aattatatag actacttttg taaaccttta
tactatcaaa tcataggcaa tttcagtttg 4440 atttcattct ggtgcagaat
ataagtttat ccaagtaaaa caggagtcac ttcaaaagat 4500 tcctcccact
gactgagata ttccaaagcc aactttgcaa aatttcagaa ttaaatatta 4560
tacttctttg taccttcatt ttatttgttc aatttttctt tgtgtttgta gaaaatttta
4620 atatttttct gttttcaagt tttgatttta atttactact ttataatttt
taaaggtaag 4680 ttttgtgagg ctatattcat tatgtgtttt gaataaagac
atacaattaa ttttgagaac 4740 tgcaataaaa attataagac tattaaaaat
gcagtaagtg tactacactt aggctgctaa 4800 aaatgcagta ccagtagact
acatttaggc tgcttaaagt tagttcttct aagtaccata 4860 tactttaaaa
ttttagctaa tgatggagaa caaagacaga aagactgtgt taccatattc 4920
tagttggcca ttttgttttg ttttgagaga cgtcacatca gccttatcat aaaaattatt
4980 tggttttacc attttgactg tgagcaaaat atacagcata atatacaaaa
taaaatatat 5040 gtacatcttc acaacttctt gtttaggatg caattatata
tatatatata tatatattta 5100 ttattatact ttaagttcta gggtacatgg
caccacgtgc aggttgttac atatgtatac 5160 atgtgccatg ttggtgtgct
gcacccatta actcgtcatt tacattaggt gtatctccta 5220 atgctatccc
tcccctctct ccccacccca caacaagccc cggtgtgtga tgttcccctt 5280
cctgtgtcca tgtgttctca ttgttcaatt cccacctatg agtgagaaca cgcagtgttt
5340 gcttttttgt ccttgcaata gtttgctgag aatgatggtt tccagcttca
tccatgtccc 5400 tacaaaggac atgaactcat cattttttat ggctgcatag
tattccatgg tgtatatgtg 5460 ccaccatttt cttaatccga gtctgtccat
tgttgttgga catttgggtt gcaattttga 5520 gtttcatgtg tagcatgtat
agcacaacca attaagattt ctttctttct ctcttttttt 5580 tttttttttg
ttgaaatgga gtcttgcctg tctccaaggc tggagcccaa tggtgtgatc 5640
ttggcttact gcaacctcca cctcccgggt tcaagcgatt ctcctgcctc agccatccga
5700 gtagctggga ctataggcgt gcaccaccat gcccagctaa tttttgtatt
tttagtacag 5760 acggggtttc accacggtgg ccaggatggt ctcaatttct
tgacctcatg attcacccgc 5820 cttggcctcc caaagtgctg ggattacagg
tgtgaaccac caagcccggc ctgtcacaag 5880 tttttagtgt tctattttaa
tacagaaatt agataaatcc aaagagaaag acatttcata 5940 tgtgcgtaga
gttgtcggaa gaaatgagag tcttataaat aactttaaaa attgtgaaga 6000
aataaaggca aaatagtcct atgcagtttg atttaaatat attcttaata agagctactt
6060 ttgtgaaaac cagaatattg aaacatgtag atatggatct tcattagtga
ctgacataat 6120 atattgttat tgttactatt ttattgtatc agccaactaa
tattgagtgc tttgtgtatc 6180 ctaagcacta tgctaaacac tgtaccagta
ttacctgata taatcatatt aatatttatt 6240 atttcacttt tcatatgaaa
aaattgaagc acagattaag acactccgaa atcatacctc 6300 tattgattat
cagcaccagg atttgaattg aggcactctg atccagagaa gcttttgttt 6360
ccatgaaggc ttatgttggg gaaaaataat caaattgcct gtacctcagt tgtataaata
6420 agaggttggg ttggtagatg attctggctg attcagcaga aaagaaattt
attcaaagga 6480 tatcacacag ttttcataac agttaagaat acagaggaaa
cagggcacca gggctaagta 6540 cagaccaaag tccaaaacca ctgccaaagt
tgcagcaagg agaacagcac aaatttgctt 6600 gctgtcaccc gccactagat
gcttttgttt ggagccttga acttgactta cactgccact 6660 gacatcagca
ccagtgctct ctgtgtacta ggaggtggag ttggtgacgt tgctgaactc 6720
aaagcagatg tttctgctgt gaaatagata cctaatacag aacctgcttc ctcattcatt
6780 ccctccccaa atcatatgct tgtagtgtgg ctagagtttc tgtttctcct
tggtccaggc 6840 agaatttatg aagcttgcta tttatcgcct taaagattag
aagaatattc ataaggtatt 6900 agattgccat aaggttgaac aaatcaacat
tcaacttcaa ggattcaaca ttgttttgtt 6960 ttcttttggg atacctctgc
agcagttcaa atcttatttc tgcccttgga caaccaggtt 7020 tataaatatt
gcagattctc cactgactgc tttgatccta tcttctatat ttatgtatac 7080
taattagcat ataataaaag attatgttac agaatctcaa aattagtaat tatgaattga
7140 gatggtgtta tacagtacac taacatccaa gagacttgtt tattccaagg
aaaatattta 7200 gagatattaa atgatatttc tcatccttta gacatataca
ttttttagct tacagcctgc 7260 tttaggcaag caacagactc tcaggatctg
ctcctaccag ggtctgaaca tttcctccca 7320 gttttaaaga aacaaattca
aataacattg taacctccag aggaaagttc aagctctttt 7380 atagtattgt
ttaaacagta cagctgagga aactaaagac agagaagtta aatgccttgg 7440
cacttagtct agatttacaa taaactcctn tctacttagg acccactaac aggggctgca
7500 tttacaccaa aaccatgaag gtggcccaag tcatcactga gaagtagtac
aagcaccgag 7560 ggaatgactt caacaggaac aagaaagcgt ggaaggagat
cctagcagga agctccacaa 7620 gaagatagca tgttacgtct tgcattggat
gaagcaggtt cagagagacc tagtgacagc 7680 tatctccgtc aaggtgcaga
aggagagatc attgaatgta gcattttcat gcaaaaaaaa 7740 aaatgttgaa
gtctttggac ttcgggagtc tgtccaaact gcaggtcact cagcctacag 7800
ttgggatgaa tttcaaaaca ccagttggag ccggttgaat ctttctgcta tgctgtaata
7860 ttttcagtaa acccagcgca acaacaacaa caaaacacaa aaggaggaga
agcagccaag 7920 tctcttggtt tacagagtag ctcctaatac cccttgctgt
ctgtctcaag tgcccaatgg 7980 gaagatagtc aaaacaatat tcacacctgt
gattcatctc tctacatgca gtgtgtgtga 8040 atctttatat actgcatatt
aaggatctgt ctttacagat aaaaactaaa gcattgaagg 8100 aactccttgt
tttgacttat caaagtcctt aagaaaatac tagaaaatta tagccattgt 8160
ttcaaatttt agctttatat tatcacttga aatgtgatga aatgtggctg atagataata
8220 attcactgat aacctacaga caattcccat cttaaaatgg accattggat
tgaagaatta 8280
aataaaattg agggttttcc ttacatgttt tgtctaaaga gcgaagtaga aacaactgtt
8340 catagatctt cattgaggat tcgcatgtga agtaagtact cctaacataa
acaagtggac 8400 ttatcaacca agttccataa atcatgaaca aaaatatttg
tccccagaga gactattttt 8460 ccaccacatc tcttgtaata aacacagagc
ccagttcagt taaaatagtt taagggtgga 8520 cggttcaggg cctgctgagt
ggcactcagt aagaaaaccc agcagaacat ttacttctct 8580 ctttattcca
gagcatcaat ggccaaggct ggaagatccc agaacactga acagacattt 8640
ggtctcttat ggcctgccaa ttttcacagt gggttccaac gctttgggtc aaaccaaaat
8700 agacctgtta gaaaaatgtc ggttggaata cgctaacaat aagacagaat
aaatgtgatt 8760 atttcacctc atttttatag gacttgagta attttattat
aacattcttg agggctggaa 8820 aatctgaatg ttaggacacc aaatatctcc
agaaaacaag ttttatattt ctaatcctgc 8880 ataataaacc tggggccact
gcaggcctca ttaataaaaa cctaatggta taacaataat 8940 gaggaggaaa
tgccaatgcc gcacaaatct gttgagacta aaatatttct caccccagca 9000
ggcttggtgc atttgacact tcatgatatc agccaaagtg gaactaaaaa cagctcctgg
9060 aagaggacta tgacatcatc aggttgggag tctccaggga cagcggaccc
tttggaaaag 9120 gactagaaag tgtgaaatct attagtcttc gatatgaaat
tctctgtctc tgtcaaaagc 9180 atttcatatt tacaagacac aggcctactc
ctagggcagc aaaaagtggc aacaggcaag 9240 cagagggaaa agagatcatg
aggcatttca gagtgcactg tcttttcata tatttctcaa 9300 tgccgtatgt
ttggttttat tttggccaag cataacaatc tgctcaagaa aaaaaaatct 9360
ggagaaaaca aaggtgcctt tgccaatgtt atgtttcttt ttgacaagcc ctgagatttc
9420 tgaggggaat tcacataaat gggatcaggt cattcattta cgttgtgtgc
aaatatgatt 9480 taaagataca acctttgcag agagcatgct ttcctaaggg
taggcacgtg gaggactaag 9540 ggtaaagcat tcttcaagaa tcagttaatc
aaagaaaggt gctctttgca ttctgaaatg 9600 cccttgttgc aaatattggt
tatattgatt aaatttacac ttaatggaaa caacctttaa 9660 cttacagatg
aacaaaccca caaaagcaaa aaatcaaaag ccctacctat gatttcatat 9720
tttctgtgta actggattaa aggattcctg cttgcttttg ggcataaatg ataatggaat
9780 atttccaggt attgtttaaa atgagggccc atctacaaat tcttagcaat
actttggata 9840 attctaaaat tcagctggac attgtctaat tgttttttat
atacatcttt gctagaattt 9900 caaattttaa gtatgtgaat ttagttaatt
agctgtgctg atcaattcaa aaacattact 9960 ttcctaaatt ttagactatg
aaggtcataa attcaacaaa tatatctaca catacaatta 10020 tagattgttt
ttcattataa tgtcttcatc ttaacagaat tgtctttgtg attgttttta 10080
gaaaactgag agttttaatt cataattacg ttgatcaaaa aattgtggga acaatccagc
10140 attaattgta tgtgattgtt tttatgtaca taaggagtct taagcttggt
gccttgaagt 10200 cttttgtact tagtcccatg tttaaaatta ctactttata
tctaaagcat ttatgttttt 10260 caattcaatt tacatgatgc taattatggc
aattataaca aatattaaag atttcgaaat 10320 agaatatgtg aattgttcac
catacataga aatgaaaagt tcatttcgta aagcaagatg 10380 ctgggtgaaa
gagtgctttt gattgaaaga tcactagatt agtagagggc aagactttta 10440
gtccctaatc tacccttaat agccatgtgg tcacgtgtaa gtcagtgaac ccatctcatt
10500 ctcctcatac ttttttcatc tctaaaatga gggtataatt taagctcgtt
catttttttt 10560 tttttttgag atagagtttt gctcttgtca cccaggttgg
agtgcaatgg cacgatctca 10620 gctcactgca accctctgct tcctcggttc
aagtgattct ccctgcttca gcctcccaag 10680 tgagcccggg attacaggtg
cccgccacca catctgggcc tagatttttt gtattttcac 10740 catgttggcc
aggctggtct cgaaccccta cctcaggtga tccctcgcct cggcctctca 10800
aagtgctggg attacaggtg tgagccacca cgcccagccc aatatcagtt tttctttttt
10860 aacacaaggc taacacaatc aaaatactag ctaggggaga aaaaaaaaat
aaggcactgt 10920 ttatgtgtaa caggctcttg ttgcaatcca ctggggcaga
ccaaataaac agtaagaatc 10980 aaatcctttt catataatcc tttctttgca
gaatacataa aatccccaca aatggcttat 11040 cttccttttt atgatatgtt
ggagaattgt agctaagtga cagatatttt gcttgggtgt 11100 atagaccaca
aaggactgtg tcttgatgat ggtttgcata aaattatacc ttagttttta 11160
ctttgtatgt tacatgttag atttagagta tgaaaattag tagggaggat tattaacaaa
11220 gaacagggca agaggagtag aattaaacct cttctaatac ctgtgcacaa
gtaggctttt 11280 cagaaactct acaaccccaa cataaactgg atagttagaa
aagcacactc ccaaggaagg 11340 cggttatgtt ttgcagtttg aatcagaaga
atagagctat agcaatcttc attctatagt 11400 aacattaaag agcctggttt
atattatagc agtcattaag atttaaaaat ttacatcttg 11460 ccgttcttct
tactcacaga ttttcgagag gtaatgtaat gatcacacga ggtgagaatc 11520
actgcctttt ataatgcgat taaatgcatg aacaaagttt ccaacaaata acagtaataa
11580 aaagaaacat gtattagcac ttaataagcc aggtgctgta cgacgtgtgt
tacatgcttt 11640 caatccatga actggtaaac tggtactagt atctctattg
gacatgtgag gaaaccaaat 11700 ggagttgata aacagtagag ttaaaaatta
ctcttcatat attatattgc ctcaatctca 11760 cagacatctc tgctaccaaa
agctatcata tctagactcg a 11801 9 19 DNA Artificial Sequence
Description of Artificial SequenceProbe/Primer 9 tggcaacagg
caagcagag 19 10 21 DNA Artificial Sequence Description of
Artificial SequenceProbe/Primer 10 ggccaaaata aaaccaaaca t 21 11 24
DNA Artificial Sequence Description of Artificial
SequenceProbe/Primer 11 gcaaatatga tttaaagata caac 24 12 25 DNA
Artificial Sequence Description of Artificial SequenceProbe/Primer
12 ggttgtatct ttaaatcata tttgc 25 13 27 DNA Artificial Sequence
Description of Artificial SequenceProbe/Primer 13 actgtctttt
catatatttc tcaatgc 27 14 24 DNA Artificial Sequence Description of
Artificial SequenceProbe/Primer 14 aagtagtaat tttaaacatg ggac 24 15
21 DNA Artificial Sequence Description of Artificial
SequenceProbe/Primer 15 tttttcaatt aggcagcaac c 21 16 25 DNA
Artificial Sequence Description of Artificial SequenceProbe/Primer
16 gaattgtctt tgtgattgtt tttag 25 17 26 DNA Artificial Sequence
Description of Artificial SequenceProbe/Primer 17 caattcacaa
agacaattca gttaag 26 18 23 DNA Artificial Sequence Description of
Artificial SequenceProbe/Primer 18 acaattagac aatgtccagc tga 23 19
24 DNA Artificial Sequence Description of Artificial
SequenceProbe/Primer 19 ctttggctga tatcatgaag tgtc 24 20 23 DNA
Artificial Sequence Description of Artificial SequenceProbe/Primer
20 aaccttttgc cctatgccgt aac 23 21 22 DNA Artificial Sequence
Description of Artificial SequenceProbe/Primer 21 gagactccca
acctgatgat gt 22 22 20 DNA Artificial Sequence Description of
Artificial SequenceProbe/Primer 22 ggtcacgttg agtcccagtg 20
* * * * *
References