U.S. patent application number 10/644875 was filed with the patent office on 2004-07-29 for transforming growth factor alpha hii.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Meissner, Paul S., Ni, Jian, Wei, Ying-Fei.
Application Number | 20040146510 10/644875 |
Document ID | / |
Family ID | 25459449 |
Filed Date | 2004-07-29 |
United States Patent
Application |
20040146510 |
Kind Code |
A1 |
Wei, Ying-Fei ; et
al. |
July 29, 2004 |
Transforming growth factor alpha HII
Abstract
The present invention discloses transforming growth factor alpha
HII polypeptides and polynucleotides encoding such polypeptides.
Also provided is a procedure for producing such polypeptides by
recombinant techniques and therapeutic uses of the polypeptides
which include stimulating wound healing, treating neurological
disorders, treating ocular disorders, treating kidney and liver
disorders, and stimulating embryogenesis and angiogenesis. Also
disclosed are antagonists against such polypeptides and their use
as a therapeutic to treat neoplasia. Also disclosed are diagnostic
assays for detecting altered levels of the polypeptide of the
present invention and mutations in the nucleic acid sequences which
encode the polypeptides of the present invention.
Inventors: |
Wei, Ying-Fei; (Berkeley,
CA) ; Meissner, Paul S.; (Barnesville, MD) ;
Ni, Jian; (Germantown, MD) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE LLP
275 MIDDLEFIELD ROAD
MENLO PARK
CA
94025-3506
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
25459449 |
Appl. No.: |
10/644875 |
Filed: |
August 21, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10644875 |
Aug 21, 2003 |
|
|
|
09227853 |
Jan 11, 1999 |
|
|
|
6642006 |
|
|
|
|
09227853 |
Jan 11, 1999 |
|
|
|
08930564 |
Jan 30, 1998 |
|
|
|
6410506 |
|
|
|
|
08930564 |
Jan 30, 1998 |
|
|
|
PCT/US95/06386 |
May 19, 1995 |
|
|
|
Current U.S.
Class: |
424/145.1 ;
435/320.1; 435/6.16; 435/69.1; 514/13.3; 514/15.4; 514/17.7;
514/19.2; 514/20.8; 514/8.9; 530/388.25; 530/399; 536/23.5 |
Current CPC
Class: |
Y10T 436/143333
20150115; A61K 48/00 20130101; A61K 38/1841 20130101; C07K 14/495
20130101; A61P 31/04 20180101 |
Class at
Publication: |
424/145.1 ;
435/006; 435/069.1; 435/320.1; 514/012; 530/399; 536/023.5;
530/388.25 |
International
Class: |
C12Q 001/68; G01N
033/53; A61K 039/395; C07K 016/22; C07K 014/475 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding a polypeptide
comprising amino acids 1 to 374 of SEQ NO ID:2; (b) a
polynucleotide encoding a polypeptide comprising amino acids 2 to
374 of SEQ NO ID:2; (c) a polynucleotide encoding a polypeptide
comprising amino acids 46 to 374 of SEQ NO ID:2; (d) a
polynucleotide encoding a polypeptide comprising amino acids 215 to
374 of SEQ NO ID:2; (e) a polynucleotide encoding a polypeptide
comprising amino acids 1 to 264 of SEQ NO ID:2; (f) a
polynucleotide encoding a polypeptide comprising amino acids 46 to
264 of SEQ NO ID:2; (g) a polynucleotide encoding a polypeptide
comprising amino acids 215 to 264 of SEQ NO ID:2; (h) a
polynucleotide encoding at least 30 contiguous amino acids of SEQ
NO ID:2; (i) a polynucleotide encoding at least 50 contiguous amino
acids of SEQ NO ID:2; (j) a polynucleotide capable of hybridizing
to the polynucleotide of (a), (b), (c), (d), (e), (f), or (g); (k)
a polynucleotide which is at least 70% identical to the
polynucleotide of (a), (b), (c), (d), (e), (f), or (g); and (l) a
polynucleotide fragment of the polynucleotide of (a), (b), (c),
(d), (e), (f), or (g).
2. The isolated polynucleotide of claim 1 wherein the
polynucleotide is DNA.
3. The isolated polynucleotide of claim 1 wherein the
polynucleotide is RNA.
4. The isolated polynucleotide of claim 1 wherein the
polynucleotide is genomic DNA.
5. The isolated polynucleotide of claim 1 encoding the polypeptide
comprising amino acids 1 to 374 as set forth in SEQ ID NO:2.
6. The isolated polynucleotide of claim 1 encoding the polypeptide
comprising amino acids 46 to 374 as set forth in SEQ ID NO:2.
7. The isolated polynucleotide of claim 1 encoding the polypeptide
comprising amino acids 1 to 264 as set forth in SEQ ID NO:2.
8. The isolated polynucleotide of claim 1 encoding the polypeptide
comprising amino acids 46 to 264 as set forth in SEQ ID NO:2.
9. The isolated polynucleotide of claim 1 encoding the polypeptide
comprising amino acids 215 to 264 as set forth in SEQ ID NO:2.
10. An isolated polynucleotide comprising a member selected from
the group consisting of: (a) a polynucleotide which encodes a
mature polypeptide having the amino acid sequence expressed by the
DNA contained in ATCC Deposit No. 97160; (b) a polynucleotide
capable of hybridizing to the polynucleotide of (a); (c) a
polynucleotide which is at least 70% identical to the
polynucleotide of (a); and (d) a polynucleotide fragment of the
polynucleotide of (a), (b), or (c).
11. The polynucleotide of claim 1 having the sequence as set forth
in SEQ ID NO:1.
12. The polynucleotide of claim 1 comprising nucleotide 323 to
nucleotide 1114 as set forth in SEQ ID NO:1.
13. The polynucleotide of claim 1 comprising nucleotide 458 to
nucleotide 1114 as set forth in SEQ ID NO:1.
14. The polynucleotide of claim 1 comprising nucleotide 965 to
nucleotide 1114 as set forth in SEQ ID NO:1.
15. A vector comprising the DNA of claim 2.
16. A host cell transformed or transfected with the vector of claim
15.
17. A process for producing a polypeptide comprising: expressing
from the host cell of claim 16 the polypeptide encoded by said
DNA.
18. A process for producing cells capable of expressing a
polypeptide comprising genetically engineering cells with the
vector of claim 15.
19. A polypeptide comprising a member selected from the group
consisting of: (a) amino acids 1 to 374 of SEQ ID NO:2; (b) amino
acids 46 to 374 of SEQ ID NO:2; (c) amino acids 1 to 264 of SEQ ID
NO:2; (d) amino acids 46 to 264 of SEQ ID NO:2; (e) amino acids 215
to 264 of SEQ ID NO:2; (f) a polypeptide encoded by the the cDNA
contained in ATCC Deposit No. 97160; (g) at least 30 contiguous
amino acids of SEQ NO ID:2; (h) at least 50 contiguous amino acids
of SEQ NO ID:2; (i) a polypeptide which is at least 70% identical
to the polypeptide of (a), (b), (c), (d), (e), or (f); and (j) a
polypeptide fragment of the polypeptide of (a), (b), (c), (d), (e),
or (f).
20. The polypeptide of claim 19 comprising amino acids 215 to 264
of SEQ ID NO:2.
21. An antibody against the polypeptide of claim 19.
22. A compound which inhibits activation of the polypeptide of
claim 19.
23. A compound which activates the polypeptide of claim 19.
24. A method for the treatment of a patient having need of
TGF.alpha.-HII comprising: administering to the patient a
therapeutically effective amount of the polypeptide of claim
19.
25. A method for the treatment of a patient having need to inhibit
TGF.alpha.-HII comprising: administering to the patient a
therapeutically effective amount of the compound of claim 22.
26. The method of claim 24 wherein said therapeutically effective
amount of the polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
27. A process for identifying compounds active as agonists to the
polypeptide of claim 19 comprising: contacting a reaction mixture
containing a cell type which expresses a TGF.alpha.-HII receptor
and a compound to be screened; and determining if the compound
generates a signal from said receptor to identify if the compound
is an effective agonist.
28. A process for identifying compounds active as antagonists to
the polypeptide of claim 19 comprising: contacting a reaction
mixture containing a cell type which expresses the TGF.alpha.-HII
receptor and a compound to be screened; and detecting the absence
of a signal generated from said receptor after binding of said
compound to identify if the compound is an effective
antagonist.
29. A process for diagnosing a disease or a susceptibility to a
disease comprising: determining a mutation in the polynucleotide of
claim 1.
30. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 19 in a sample derived from a host.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 09/227,853, filed Jan. 11, 1999, which is a divisional of U.S.
application Ser. No. 08/930,564, now U.S. Pat. No. 6,410,506, which
claims priority benefit under 35 U.S.C. .sctn. 371 of the filing
date of PCT/US95/06386, filed May 19, 1995.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. The polypeptide of the present
invention has been putatively identified as a human transforming
growth factor alpha homolog. More particularly, the polypeptide of
the present invention has been putatively identified as
transforming growth factor alpha HII, sometimes hereafter referred
to as "TGF.alpha.-HII". The invention also relates to inhibiting
the action of such polypeptides.
[0003] Cellular growth and differentiation appear to be initiated,
promoted, maintained and regulated by a multiplicity of
stimulatory, inhibitory and synergistic factors and hormones. The
alteration and/or breakdown of the cellular homeostasis mechanism
seems to be a fundamental cause of growth related diseases,
including neoplasia. Growth modular factors are implicated in a
wide variety of pathological and physiological processes including
signal transduction, cell communication, growth and development,
embryogenesis, immune response, hematopoiesis cell survival and
differentiation, inflammation, tissue repair and remodeling,
atherosclerosis and cancer. Epidermal growth factor (EGF),
transforming growth factor alpha (TGF.alpha.), betacellulin,
amphiregulin, and vaccinia growth factor among other factors are
growth and differentiation modulatory proteins produced by a
variety of cell types either under normal physiological conditions
or in response to exogenous stimuli and are members of the EGF
family.
[0004] These peptide growth factors influence wound cells through
autocrine and paracrine mechanisms. They also play important roles
in normal wound healing in tissues such as skin, cornea and
gastrointestinal tract and all share substantial, amino acid
sequence homology including the conserved placement of three
intra-chain disulfide bonds. In addition, all the factors of this
family bind to a 170,000 molecular weight transmembrane
glycoprotein receptor and activate the tyrosine kinase activity in
the receptor's cytoplasmic domain (Buhrow, S. A. et al., J. Bio.
Chem., 258:7824-7826 (1983)).
[0005] The receptors are expressed by many types of cells including
skin keratinocytes, fibroblasts, vascular endothelial cells, and
epithelial cells of the GI tract. These peptide growth factors are
synthesized by several cells involved in wound healing including
platelets, keratinocytes, and activated macrophages. These growth
factors have also been implicated in both the stimulation of growth
and differentiation of certain cells, for example, neoplasia, and
the inhibition of other types of cells.
[0006] Betacellulin is a 32-kilodalton glycoprotein that appears to
be processed from a larger transmembrane precursor by proteolytic
cleavage. The carboxyl-terminal domain of betacellulin has 50%
sequence similarity with that of rat transforming growth factor
.alpha.. Betacellulin is a potent mitogen for retinal pigment
epithelial cells and vascular smooth muscle cells.
[0007] Amphiregulin is a bifunctional cell growth regulatory factor
which exhibits potent inhibitory activity on DNA synthesis in
neoplastic cells, yet promotes the growth of certain normal cells.
A wide variety of uses for amphiregulin have been assigned
including the treatment of wounds and cancers. For example,
amphiregulin has potent anti-proliferative effects in vitro on
several human cancer cell lines of epithelial origin. Amphiregulin
also induces the proliferation of human foreskin fibroblasts as
shown in U.S. patent application Ser. No. 5,115,096.
[0008] TGF.alpha. has pleiotropic biological effects. The
production of certain members of TGF.alpha. is synthesized by a
number of oncogenically transformed fibroblasts (Ciardiello et al.,
J. Cell. Biochem., 42:45-57 (1990)), as well as by a variety of
tumors, including renal, breast and squamous carcinomas, melanomas
and glioblastomas (Derynck, R. et al., Cancer Res., 47:707-712
(1987)). There is direct evidence that TGF.alpha. expression can be
a contributing factor in the conversion of a normal cell to its
tumorigenic counterpart by analyzing transgenic mice in which tumor
cells express high levels of TGF.alpha.. TGF.alpha. transgenic
animals display a variety of neoplastic lesions, depending on the
strain of mouse and the choice of promotor regulating TGF.alpha.
expression (Sandgren, et al., Cell, 61:1121-1135 (1990)).
[0009] TGF.alpha. also plays a role in normal embryonic development
and adult physiology (Derynck, R. Adv. Cancer Res., 58:27-5
(1992)). TGF.alpha. has been expressed in many tissues including
skin, brain, gastrointestinal mucosa and activating macrophages.
Accordingly, TGF.alpha. is an important factor in controlling
growth of epithelial cells and has a role in wound healing.
TGF.alpha. has also been found to be angiogenic (Schreiber, et al.,
Science, 232:1250-1253 (1986)).
[0010] The polypeptide of the present invention has been putatively
identified as transforming growth factor TGF.alpha.-HII. This
identification has been made as a result of amino acid sequence
homology to human TGF.alpha..
[0011] In accordance with one aspect of the present invention,
there are provided novel mature polypeptides, as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The polypeptides of the
present invention are of human origin.
[0012] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding the
polypeptides of the present invention, including mRNAs, DNAS,
cDNAs, genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments thereof.
[0013] In accordance with yet a further aspect of the present
invention, there are provided processes for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention.
[0014] In accordance with yet a further aspect of the present
invention, there are provided processes for utilizing such
polypeptides, or polynucleotides encoding such polypeptides for
therapeutic purposes, for example, to stimulate wound healing to
restore normal neurological functioning after trauma or A/DS
dementia, to treat ocular disorders, to target certain cells, to
treat kidney and liver disorders and to promote hair follicular
development, to stimulate angiogenesis for the treatment of burns,
ulcers and corneal incisions and to stimulate embryogenesis.
[0015] In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to nucleic acid sequences of the present invention.
[0016] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0017] In accordance with yet a further aspect of the present
invention, there are provided agonists to the polypeptide of the
present invention.
[0018] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, in the treatment of corneal inflammation, neoplasia, for
example, tumors and cancers and for psoriasis.
[0019] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to overexpression of the polypeptide of the
present invention and mutations in the nucleic acid sequences
encoding such polypeptide.
[0020] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0021] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0022] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0023] FIG. 1 depicts the cDNA sequence (SEQ ID NO:1) and
corresponding deduced amino acid sequence (SEQ ID NO:2) of
TGF.alpha.-HII. The standard one letter abbreviations for amino
acids are used. The putative signal sequence has been
underlined.
[0024] FIG. 2 is an illustration of comparative amino acid sequence
homology between human betacellulin (SEQ ID NO:13), human
TGF.alpha. (SEQ ID NO:14) and human TGF.alpha.-HII (third row; SEQ
ID NO:2). An * denotes the conserved EGF motif which is shown to be
conserved in the polypeptide of the present invention. Underlining
denotes the mature sequence of human TGF.alpha..
[0025] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the cDNA of the clone deposited with the American Type Culture
Collection (10801 University Blvd., Mannasas, Va. 20110-2209) as
ATCC Deposit No. 97160, on May 24, 1995.
[0026] A polynucleotide encoding a polypeptide of the present
invention may be obtained from human brain and early stage brain
tissue. The polynucleotide of this invention was discovered in a
cDNA library derived from two-week old embryo. It is structurally
related to the EGF family. It contains an open reading frame
encoding a protein of 374 amino acid residues of which
approximately the 45 amino acids. residues are the putative leader
sequence. The protein exhibits the highest degree of homology to
human TGF.alpha. with 26% identity and 46% similarity over a 236
amino acid stretch. TGF.alpha.-HII contains all six of the
conserved cysteine residues found in all members of EGF family.
[0027] The full-length polypeptide of the present invention as set
forth in SEQ ID NO:2 has a putative signal sequence which comprises
amino acid 1 through amino acid 45 of SEQ ID NO:2 which aids in
secretion of the polypeptide from the cell. The polypeptide is
further processed wherein amino acid 46 through amino acid 214 of
SEQ ID NO:2 are cleaved from the polypeptide since this stretch of
amino acids is a putative precursor sequence. Further, amino acid
264 through amino acid 344 represent a putative transmembrane
portion which is thought to be necessary to direct the polypeptide
to particular target locations for the carrying out of biological
functions as hereinafter described. The transmembrane portion may
also be cleaved from the polypeptide such that the putative soluble
portion of the polypeptide of the present invention comprises amino
acid 215 through amino acid 264 of SEQ ID NO:2.
[0028] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO:1) or the
deposited cDNA.
[0029] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the deposited cDNA may include, but is not limited to: only the
coding sequence for the mature polypeptide; the coding sequence for
the mature polypeptide and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the coding
sequence for the mature polypeptide (and optionally additional
coding sequence) and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptide.
[0030] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0031] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. The variant of the polynucleotide
may be a naturally occurring allelic variant of the polynucleotide
or a non-naturally occurring variant of the polynucleotide.
[0032] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID
NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIG. 1 (SEQ ID NO:2) or the polypeptide encoded by
the cDNA of the deposited clone. Such nucleotide variants include
deletion variants, substitution variants and addition or insertion
variants.
[0033] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO:1) or of the coding
sequence of the deposited clone. As known in the art, an allelic
variant is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0034] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0035] Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0036] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0037] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0038] Fragments of the full length TGF.alpha.-HII gene may be used
as a hybridization probe for a cDNA library to isolate the full
length gene and to isolate other genes which have a high sequence
similarity to the gene or similar biological activity. Probes of
this type preferably have at least 30 bases and may contain, for
example, 50 or more bases. The probe may also be used to identify a
cDNA clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete TGF.alpha.-HII gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0039] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID NO:1) or
the deposited cDNA(s).
[0040] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0041] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0042] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn. 112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0043] The present invention further relates to a polypeptide which
has the deduced amino acid sequence of FIG. 1 (SEQ ID NO:2) or
which has the amino acid sequence encoded by the deposited cDNA, as
well as fragments, analogs and derivatives of such polypeptide.
[0044] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 (SEQ ID NO:2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0045] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0046] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID NO:2) or that encoded by the deposited cDNA may be
(i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence. Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0047] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0048] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0049] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably a 70% identity) to the polypeptide of SEQ ID NO:2 and
more preferably a 90% similarity (more preferably a 90% identity)
to the polypeptide of SEQ ID NO:2 and still more preferably a 95%
similarity (still more preferably a 90% identity) to the
polypeptide of SEQ ID NO:2 and also include portions of such
polypeptides with such portion of the polypeptide generally
containing at least 30 amino acids and more preferably at least 50
amino acids.
[0050] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0051] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing. the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used. to synthesize
full-length polynucleotides of the present invention.
[0052] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0053] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0054] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0055] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0056] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequencers) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0057] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0058] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0059] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0060] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiXI74, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0061] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0062] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0063] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0064] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0065] Transcription of the DNA encoding the polypeptides of the
present. invention by higher eukaryotes is increased by inserting
an enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0066] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0067] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0068] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0069] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0070] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0071] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0072] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0073] The polypeptides can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0074] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0075] The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials for
discovery of treatments and diagnostics for human disease.
[0076] The polypeptide of the present invention may be employed for
characterization of receptors. The EGF family receptors currently
includes four EGF receptors, denoted as EGFR1, EGFR2, EGFR3 and
EGFR4. The EGFR2 receptor may also be referred to as ERB-2 and this
molecule is useful for a variety of diagnostic and therapeutic
indications (Prigent, S. A., and Lemoine, N. R., Prog Growth Factor
Res., 4:1-24 (1992)). The TGF.alpha.-HII polypeptide is likely a
ligand for one or more of these receptors as well as for yet an
identified new EGF-type receptor. Use of the TGF.alpha.-HII can
assist with the identification, characterization and cloning of
such receptors. For example, the EGF receptor gene represents the
cellular homolog of the v-erb-B oncogene of avian erythroblastosis
virus. Over expression of the EGF-receptor or deletion of kinase
regulatory segments of the protein can bring about tumorigenic
transformation of cells (Manjusri, D. et al., Human Cytokines, 364
and 381 (1991)).
[0077] The polypeptides of the present invention may also be
employed for restoration or enhancement of neurological functions
diminished as a result of trauma or other damaging pathologies
(such as AIDS dementia, senile dementia, etc). TGF.alpha. and its
homologs have been found to be the most abundant ligand for the
EGF/TGF.alpha. receptor in most parts of the brain (Kaser, et al.,
Brain Res Mol Brain Res: 16:316-322, (1992)). There appears to be a
widespread distribution of TGF.alpha. in various regions of the
brain in contrast to EGF which is only present in smaller, more
discrete areas, suggesting that TGF-alpha might play a
physiological role in brain tissues. These numerous receptor sites
for TGF.alpha. in the brain suggest that TGF has an important
utility in promoting normal brain cell differentiation and
function. Accordingly, in instances where neurological functioning
is diminished, an administration of the polypeptide of the present
invention may stimulate the brain and enhance proper physiological
functions.
[0078] TGF.alpha.-HII or soluble form thereof may also be employed
to treat ocular disorders, for example, corneal inflammation. A
variety of experiments have implicated members of the TGF.alpha.
gene family in such pathologies. A recent paper summarizes some of
the data related to the role these growth factors play in eye
disease (Mann et al Cell 73:249-261 (1993)) Recent experiments have
shown that a number of mice lacking the TGF.alpha. gene displayed
corneal inflammation due to an infiltration of leukocytes and other
cells to the substantia propria of the eyes.
[0079] In addition, the specificity of the TGF.alpha. growth
factors for their target cells can be exploited as a mechanism to
destroy the target cell. For example, TGF.alpha.-HII or soluble
forms thereof can be coupled (by a wide variety of methods) to
toxic molecules: for example, a radiopharmaceutical which
inactivate target cells. These growth factor-toxin fusions kill the
target cell (and in certain cases neighboring cells by a variety of
"bystander" effects). A recent example of such toxin-fusion genes
is published by Mesri, et al., J. Biol. Chem. 268:4853-62 (1993).
TGF.alpha.-HII and related molecules may also be encapsulated in
liposomes and may be conjugated to antibodies which recognize and
bind to tumor or cell specific antigens, thereby providing a means
for "targeting" cells.
[0080] In this same manner, TGF.alpha.-HII can be employed as an
anti-neoplastic compound, since members of the EGF family show
anti-proliferative effects on transformed cells. For in vivo use,
the subject polypeptide may be administered in a variety of ways,
including but not limited to, injection, infusion, topically,
parenterally, etc. Administration may be in any physiologically
acceptable carrier, including phosphate buffered saline, saline,
sterilized water, etc.
[0081] The TGF.alpha.-HII polypeptide fragment may also be employed
to treat certain kidney disorders, since it has been found that
there has been expression of these growth factors in the kidney.
Thus, these factors may be necessary for the proper physiological
maintenance of this organ.
[0082] Treatments may also be related to liver regeneration or
liver dysfunction, since TGF.alpha. and its homologs and hepatocyte
growth factor trigger hepatocyte regeneration after partial
hepatectomy and after acute liver cell necrosis (Masuhara, M. et
al, Hepatology 16:1241-1249 (1992)).
[0083] A significant treatment involving TGF.alpha.-HII relates to
wound healing. The compositions of the present invention may be
employed for treating a wide variety of wounds including
substantially all cutaneous wounds, corneal wounds, and injuries to
the epithelial-lined hollow organs of the body. Wounds suitable for
treatment include those resulting from trauma such as burns,
abrasions and cuts, as well as from surgical procedures such as
surgical incisions and skin grafting. Other conditions suitable for
treatment with the polypeptide of the present invention include
chronic conditions, such as chronic ulcers, diabetic ulcers, and
other non-healing (trophic) conditions.
[0084] TGF.alpha.-HII or soluble fragment thereof may be
incorporated in physiologically-acceptable carriers for application
to the affected area. The nature of the carriers may vary widely
and will depend on the intended location of application. For
application to the skin, a cream or ointment base is usually
preferred; suitable bases include lanolin, Silvadene (Marion)
(particularly for the treatment of burns), Aquaphor (Duke
Laboratories, South Norwalk, Conn.), and the like. If desired, it
will be possible to incorporate TGF.alpha.-HII containing
compositions in bandages and other wound dressings to provide for
continuous exposure of the wound to the peptide. Aerosol
applications may also find use.
[0085] The concentration of TGF.alpha.-HII in the treatment
composition is not critical but should be enough to induce
epithelial cell proliferation. The compositions may be applied
topically to the affected area, typically as eye drops to the eye
or as creams, ointments or lotions to the skin. In the case of the
eyes, frequent treatment is desirable, usually being applied at
intervals of 4 hours or less. On the skin, it is desirable to
continually maintain the treatment composition on the affected area
during the healing, with applications of the treatment composition
from two to four times a day or more frequently.
[0086] The amount employed of the subject polypeptide will vary
with the manner of administration, the employment of other active
compounds, and the like, generally being in the range of about 1
.mu.g to 100 .mu.g. The subject polypeptide may be employed with a
physiologically acceptable carrier, such as saline,
phosphate-buffered saline, or the like. The amount of compound
employed will be determined empirically, based on the response of
cells in vitro and response of experimental animals to the subject
polypeptides or formulations containing the subject
polypeptides.
[0087] The TGF.alpha.-HII or soluble fragment thereof may be
employed in the modulation of angiogenesis, bone resorption, immune
response, and synaptic and neuronal effector functions.
TGF.alpha.-HII may also be used in the modulation of the
arachidonic acid cascade.
[0088] TGF.alpha.-HII or soluble fragment thereof may also be
employed for applications related to terminal differentiation. Many
TGF.alpha. factors, and their homologs, induce terminal
differentiation in their target cells. This property can be
exploited in vivo by administering the factor and inducing target
cell death. This regimen is under consideration for disorders
related to the hyper-proliferation of medically undesirable cell
types such as cancers and other proliferative disorders (eg
inflammation, psoriasis, etc). In addition to in vivo
administration, there are a variety of situations where in vitro
administration may be warranted. For example, bone marrow can be
purged of undesirable cell populations in vitro by treating the
cells with growth factors and/or derivatives thereof.
[0089] Applications are also related to alopecia, hair loss and to
other skin conditions which affect hair follicular development.
Several lines of evidence implicate the involvement TGF.alpha.
growth factors in such conditions. As described above, "knockout"
mice engineered to contain a null mutation in the TGF.alpha. gene
display abnormalities related to quantitative and qualitative hair
synthesis. In addition, mapping studies in mice have shown that
some mutations affecting hair growth map to the TGF.alpha. gene
locus (Mann et al, Cell 73:249-261(1993)). Topical or systemic
applications of TGF.alpha.-HII or derivatives thereof may be
employed to treat some forms of alopecia and hair loss and these
claims fall within the scope of this invention.
[0090] Certain disease pathologies may be partially or completely
ameliorated by the systemic clinical administration of the
TGF.alpha.-HII growth factor. This administration can be in the
form of gene therapy (see below); or through the administration of
peptides or proteins synthesized from recombinant constructs of
TGF.alpha.-HII DNA or from peptide chemical synthesis (Woo, et al.,
Protein Engineering 3:29-37 (1989).
[0091] This invention provides a method of screening compounds to
identify agonist or antagonist compounds to the polypeptide of the
present invention. As an example, a mammalian cell or membrane
preparation expressing a TGF.alpha.-HII receptor is incubated with
a potential compound and the ability of the compound to generate a
second signal from the receptor is measured to determine if it is
an effective agonist. Such second messenger systems include but are
not limited to, cAMP guanylate cyclase, ion channels or
phosphoinositide hydrolysis. Effective antagonists are determined
by the method above wherein an antagonist compound is detected
which binds to the receptor but does not elicit a second messenger
response to thereby block the receptor from TGF.alpha.-HII.
[0092] Another assay for identifying potential antagonists specific
to the receptors to the polypeptide of the present invention is a
competition assay which comprises isolating plasma membranes which
over express a receptor to the polypeptide of the present
invention, for example, human A431 carcinoma cells. Serially
diluted test sample in a medium (volume is approximately 10
microliters) containing 10 nM .sup.125I-TGF.alpha.-HII is added to
five micrograms of the plasma membrane in the presence of the
potential antagonist compound and incubated for 4 hours at
4.degree. C. The reaction mixtures are diluted and immediately
passed through a millipore filter. The filters are then rapidly
washed and the bound radioactivity is measured in a gamma counter.
The amount of bound TGF.alpha.-HII is then measured. A control
assay is also performed in the absence of the compound to determine
if the antagonists reduce the amount of bound TGF.alpha.-HII.
[0093] Potential antagonist compounds include an antibody, or in
some cases, an oligopeptide, which binds to the polypeptide.
Alternatively, a potential antagonist may be a closely related
protein which binds to the receptor which is an inactive forms of
the polypeptide and thereby prevent the action of the polypeptide
of the present invention.
[0094] Another antagonist compound is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix--see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of the
polypeptide of the present invention. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the polypeptide of the
present invention (Antisense--Okano, J. Neurochem., 56:560 (1991);
oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of the
polypeptide of the present invention.
[0095] Antagonist compounds include a small molecule which binds to
the polypeptide of the present invention and blocks its action at
the receptor such that normal biological activity is prevented. The
small molecules may also bind the receptor to the polypeptide to
prevent binding. Examples of small molecules include but are not
limited to small peptides or peptide-like molecules.
[0096] The antagonists may be employed to treat neoplasia, for
example, cancers and tumors. It is known that inhibition of
secretion or production of members of the EGF family by tumor cells
in mice causes regression of tumors.
[0097] The antagonists to the polypeptides of the present invention
may also be used therapeutically for the treatment of certain skin
disorders, for example, psoriasis. Elevated levels of expression of
members of this family of growth factors in skin biopsies taken
from diseases such as psoriatic lesions have been found to be
elevated (Cook, et al., Cancer Research, 52:3224-3227 (1992)). The
antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0098] The polypeptides of the present invention or agonist or
antagonist compounds may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide or compound,
and a pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to saline, buffered saline,
dextrose, water, glycerol, ethanol, and combinations thereof. The
formulation should suit the mode of administration.
[0099] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides or compounds of
the present invention may be employed in conjunction with other
therapeutic compounds.
[0100] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0101] The polypeptides, and agonists and antagonists which are
polypeptides, may also be employed in accordance with the present
invention by expression of such polypeptides in vivo, which is
often referred to as "gene therapy."
[0102] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art and are apparent from the teachings herein. For example, cells
may be engineered by the use of a retroviral plasmid vector
containing RNA encoding a polypeptide of the present invention.
[0103] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
For example, a packaging cell is transduced with a retroviral
plasmid vector containing RNA encoding a polypeptide of the present
invention such that the packaging cell now produces infectious
viral particles containing the gene of interest. These producer
cells may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention.
[0104] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0105] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0106] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0107] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12,
T19-14.times., VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86,
GP+envAm12, and DAN cell lines as described in Miller, Human Gene
Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by
reference in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means include, but
are not limited to, electroporation, the use of liposomes, and
CaPO.sub.4 precipitation. In one alternative, the retroviral
plasmid vector may be encapsulated into a liposome, or coupled to a
lipid, and then administered to a host.
[0108] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequencers)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0109] This invention is also related to the use of the gene of the
present invention as a diagnostic. Detection of a mutated form of
the gene of the present invention will allow a diagnosis of a
disease or a susceptibility to a disease which results from
underexpression of the polypeptide of the present invention for
example, improper wound healing, improper neurological functioning,
ocular disorders, kidney and liver disorders, hair follicular
development, angiogenesis and embryogenesis.
[0110] Individuals carrying mutations in the human gene of the
present invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding a polypeptide of the
present invention can be used to identify and analyze mutations
thereof. For example, deletions and insertions can be detected by a
change in size of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled RNA or alternatively, radiolabeled
antisense DNA sequences. Perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
[0111] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0112] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0113] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and Si protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0114] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0115] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0116] The present invention also relates to diagnostic assays for
detecting altered levels of the polypeptide of the present
invention in various tissues since an over-expression of the
proteins compared to normal control tissue samples can detect the
presence of certain disease conditions such as neoplasia, skin
disorders, ocular disorders and inflammation.
[0117] Assays used to detect levels of the polypeptide of the
present invention in a sample derived from a host are well-known to
those of skill in the art and include radioimmunoassays,
competitive-binding assays, Western Blot analysis and preferably an
ELISA assay. An ELISA assay initially comprises preparing an
antibody specific to an antigen of the polypeptide of the present
invention, preferably a monoclonal antibody. In addition a reporter
antibody is prepared against the monoclonal antibody. To the
reporter antibody is attached a detectable reagent such as
radioactivity, fluorescence or in this example a horseradish
peroxidase enzyme. A sample is now removed from a host and
incubated on a solid support, e.g. a polystyrene dish, that binds
the proteins in the sample. Any free protein binding sites on the
dish are then covered by incubating with a non-specific protein
such as bovine serum albumin. Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any polypeptides of the present invention attached to the
polystyrene dish. All unbound monoclonal antibody is washed out.
with buffer. The reporter antibody linked to horseradish peroxidase
is now placed in the dish resulting in binding of the reporter
antibody to any monoclonal antibody bound to polypeptides of the
present invention. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of protein present in a given volume of patient sample when
compared against a standard curve.
[0118] A competition assay may also be employed to determine levels
of the polypeptide of the present invention in a sample derived
from the hosts. Such an assay comprises isolating plasma membranes
which over-express the receptor for the polypeptide of the present
invention. A test sample containing the polypeptides of the present
invention which have been labeled, are then added to the plasma
membranes and then incubated for a set period of time. Also added
to the reaction mixture is a sample derived from a host which is
suspected of containing the polypeptide of the present invention.
The reaction mixtures are then passed through a filter which is
rapidly washed and the bound radioactivity is then measured to
determine the amount of competition for the receptors and therefore
the amount of the polypeptides of the present invention in the
sample.
[0119] Antibodies specific to TGF.alpha.-HII may be used for cancer
diagnosis and therapy, since many types of cancer cells up-regulate
various members of the TGF.alpha. family during the process of
neoplasia or hyperplasia. These antibodies bind to and inactivate
TGF.alpha.-HII. Monoclonal antibodies against TGF.alpha.-HII
(and/or its family members) are in clinical use for both the
diagnosis and therapy of certain disorders including (but not
limited to) hyperplastic and neoplastic growth abnormalities.
Upregulation of growth factor expression by neoplastic tissues
forms the basis for a variety of serum assays which detect
increases in growth factor in the blood of affected patients. These
assays are typically applied not only in diagnostic settings, but
are applied in prognostic settings as well (to detect the presence
of occult tumor cells following surgery, chemotherapy, etc).
[0120] In addition, malignant cells expressing the TGF.alpha.-HII
receptor may be detected by using labeled TGF.alpha.-HII in a
receptor binding assay, or by the use of antibodies to the
TGF.alpha.-HII receptor itself. Cells may be distinguished in
accordance with the presence and density of receptors for
TGF.alpha.-HII, thereby providing a means for predicting the
susceptibility of such cells to the biological activities of
TGF.alpha.-HII.
[0121] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and cat hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0122] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA,
thus complicating the amplification process. These primers are then
used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0123] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0124] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0125] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. Mckusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0126] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0127] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb) The polypeptides, their
fragments or other derivatives, or analogs thereof, or cells
expressing them can be used as an immunogen to produce antibodies
thereto. These antibodies can be, for example, polyclonal or
monoclonal antibodies. The present invention also includes
chimeric, single chain, and humanized antibodies, as well as Fab
fragments, or the product of an Fab expression library. Various
procedures known in the art may be used for the production of such
antibodies and fragments.
[0128] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0129] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0130] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0131] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0132] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0133] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0134] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0135] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0136] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0137] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0138] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of the Soluble Form of
TGF.alpha.-HII
[0139] The DNA sequence encoding TGF.alpha.-HII, ATCC Deposit No.
97160, was initially amplified using PCR oligonucleotide primers
corresponding to the 5' sequences of the processed TGF.alpha.-HII
protein (minus the signal peptide sequence) and the vector
sequences 3' to the TGF.alpha.-HII gene. Additional nucleotides
corresponding to TGF.alpha.-HII were added to the 5' and 3'
sequences respectively. The 5' oligonucleotide primer has the
sequence 5' CCCGGATCCGCACGAGACATACCTTGTCCG 3' (SEQ ID NO:3)
contains a BamHI restriction enzyme site (in bold) followed by 21
nucleotides of TGF.alpha.-HII coding sequence starting from the
presumed terminal amino acid of the processed protein codon. The 3'
sequence 5' GGGAAGCTTTTAATATGAATCGTACAGGAC 3' (SEQ ID NO:4)
contains complementary sequences to a Hind III site and is followed
by 23 nucleotides of TGF.alpha.-HII. The restriction enzyme sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQE-9 (Qiagen, Inc. Chatsworth, Calif., 91311).
pQE-9 encodes antibiotic resistance (Amp.sup.r), a bacterial origin
of replication (ori), an IPTG-regulatable promoter operator (P/O),
a ribosome binding site (RBS), a 6-His tag and restriction enzyme
sites. pQE-9 was then digested with BamHI and HindIII. The
amplified sequences were ligated into pQE-9 and were inserted in
frame with the sequence encoding for the histidine tag and the RBS.
The ligation mixture was then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989). M15/rep4 contains multiple copies of the
plasmid pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants were identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected. Plasmid DNA was isolated and
confirmed by restriction analysis. Clones containing the desired
constructs were grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture was used to inoculate a large culture at a ratio of 1:100
to 1:250. The cells were grown to an optical density 600
(O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 3 to 4 hours. Cells were then harvested
by centrifugation. The cell pellet was solubilized in the
chaotropic agent 6 Molar Guanidine HCl. After clarification,
solubilized TGF.alpha.-HII was purified from this solution by
chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E. et al., J. Chromatography 411:177-184 (1984)).
TGF.alpha.-HII (85% pure) was eluted from the column in 6 molar
guanidine HCl pH 5.0 and for the purpose of renaturation adjusted
to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 molar
glutathione (reduced) and 2 molar glutathione (oxidized). After
incubation in this solution for 12 hours the protein was dialyzed
to 10 molar sodium phosphate.
EXAMPLE 2
Cloning and Expression of TGF.alpha.-HII Using the Baculovirus
Expression System
[0140] The DNA sequence encoding the full length TGF.alpha.-HII
protein, ATCC Deposit No. 97160, was amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
[0141] Three sets of primers were used:
[0142] The first set of primers are,
[0143] 5' CGCGGATCCGCCATCATGGTGCTGTGGGAGTCC 3' (SEQ ID NO:5)
and
[0144] 5' GCGTCTAGACTAGTATAGAACACTGTAGTCC 3' (SEQ ID NO:6), this
construct starts at the nucleotide 321 and ends at nucleotide 1248
of SEQ ID NO:1 and includes the putative leader sequence;
[0145] The second set of primers are,
[0146] 5' CGCGGATCCGCCATCATGCTACTCATCGTAGCC 3' (SEQ ID NO:7)
[0147] 5' GCGTCTAGACTAGTATAGAACACTGTAGTCC 3' (SEQ ID NO:8), this
construct starts at nucleotide 402 and ends at nucleotide 1248 of
SEQ ID NO:1 and excludes the putative leader sequence;
[0148] The third set of primers are,
[0149] 5' CGCGGATCCAGAACACCACATACCTTGTCCG 3' (SEQ ID NO:9)
[0150] 5' GCGTCTAGACTAGTATAGAACACTGTAGTCC 3' (SEQ ID NO:10), this
construct starts at nucleotide 1100 and ends at nucleotide 1248 of
SEQ ID NO:1 and is the putative soluble portion of the polypeptide.
All three 5' primers have a BamHI restriction enzyme site (in bold)
followed by nucleotides resembling an efficient signal for the
initiation of translation in eukaryotic cells (Kozak, M., J. Mol.
Biol., 196:947-950 (1987) (the initiation codon for translation
"ATG" was underlined). For the third set of primers the baculovirus
signal peptide sequence was built in the pA2GP vector.
[0151] The 3' primer sequences contain the cleavage site for the
restriction endonuclease XbaI and have nucleotides complementary to
the 3' TGF.alpha. domain of the TGF.alpha.-HII gene. The amplified
sequences were isolated from a 1% agarose gel using a commercially
available kit ("Geneclean," BIO 101 Inc., La Jolla, Calif.). The
fragment was then digested with the endonucleases BamHI and XbaI
and then purified again on a 1% agarose gel. This fragment was
designated F2.
[0152] The vector pA2 was used for the first two sets of primers
and the pA2GP vector was used with the third set of primers. The
pA2 vector (modification of pVL941 vector, discussed below) was
used for the expression of the TGF.alpha.-HII protein using the
baculovirus expression system (for review see: Summers, M. D. and
Smith, G. E. 1987, A manual of methods for baculovirus vectors and
insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555). This expression vector contains the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by the recognition sites for
the restriction endonucleases. The polyadenylation site of the
simian virus (SV)40 was used for efficient polyadenylation. For an
easy selection of recombinant virus the beta-galactosidase gene
from E. coli was inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the polyhedrin
gene. The polyhedrin sequences were flanked at both sides by viral
sequences for the cell-mediated homologous recombination of
co-transfected wild-type viral DNA. Many other baculovirus vectors
could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1
(Luckow, V. A. and Summers, M. D., Virology, 170:31-39).
[0153] The plasmid was digested with the restriction enzymes BamHI
and XbaI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA was
designated V2.
[0154] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBacTGF.alpha.-HII)
with the TGF.alpha.-HII gene using the restriction enzymes BamHI
and XbaI. The sequence of the cloned fragment was confirmed by DNA
sequencing.
[0155] 5 .mu.g of the plasmid pBacTGF.alpha.-HII was co-transfected
with 1.0 .mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci.
USA, 84:7413-7417 (1987)).
[0156] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBacTGF.alpha.-HII were mixed in a sterile well of a
microtiter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added drop-wise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0157] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0158] Four days after the serial dilution, the virus was added to
the cells and blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0159] Sf9 cells were grown in Graces medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-TGF.alpha.-HII at a multiplicity of infection (MOI)
of 2. Six hours later the medium was removed and replaced with
SF900 II medium minus methionine and cysteine (Life Technologies
Inc., Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35
S-methionine and 5 .mu.Ci .sup.35 S cysteine (Amersham) were added.
The cells were further incubated for 16, hours before they were
harvested by centrifugation and the labeled proteins visualized by
SDS-PAGE and autoradiography.
EXAMPLE 3
Expression of Recombinant TGF.alpha.-HII in COS Cells
[0160] The expression of plasmid, TGF.alpha.-HII HA was derived
from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, an SV40
intron and polyadenylation site. A DNA fragment encoding the entire
TGF.alpha.-HII precursor and a HA tag fused in frame to its 3' end
was cloned into the polylinker region of the vector, therefore, the
recombinant protein expression was directed under the CMV promoter.
The HA tag corresponds to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H. Niman,
R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell
37:767, (1984)). The infusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope.
[0161] The plasmid construction strategy was described as
follows:
[0162] The DNA sequence encoding TGF.alpha.-HII, ATCC Deposit No.
97160, was constructed by PCR on the original EST cloned using two
primers: the 5' primer
[0163] 5' CGCGGATCCGCCATCATGGTGCTGTGGGAGTCC 3' (SEQ ID NO:11)
contains a BamHI site (in bold) followed by 18 nucleotides of
TGF.alpha.-HII coding sequence starting from the initiation codon;
the 3' sequence
[0164] 5' GCGCTCGAGGTATAGAACACTGTAGTCC 3' (SEQ ID NO:12) contains
complementary sequences to an XhoI site, the last 19 nucleotides of
the TGF.alpha. domain and an XhoI site. The pcDNA3/Amp vector
contains BamHI/XboI cloning sites which bring the PCR insert in
frame with the 3' HA tag followed by a stop codon. Therefore, the
PCR product contains a BamHI site, 936 base pair coding sequence
and an XhoI site. The PCR amplified DNA fragment and the vector,
pcDNA3/Amp, were digested with BamHI and XhoI restriction enzyme
and ligated. The ligation mixture was transformed into E. coli
strain SURE (available from Stratagene Cloning Systems, La Jolla,
Calif. 92037) the transformed culture was plated on ampicillin
media plates and resistant colonies were selected. Plasmid DNA was
isolated from transformants and examined by restriction analysis
for the presence of the correct fragment. For expression of the
recombinant TGF.alpha.-HII, COS cells were transfected with the
expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch,
T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989)). The expression of the TGF.alpha.-HII HA
protein was detected by radiolabelling and immunoprecipitation
method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8
hours with 35 S-cysteine two days post transfection. Culture media
was then collected and cells were lysed with detergent (RIPA buffer
(150 mM NaCl, 1% NP-40, 0.1%; SDS, 1% NP-40, 0.5% DOC, 50 mM Tris,
pH 7.5) (Wilson, I et al., Id. 37:767 (1984)). Both cell lysate and
culture media were precipitated with an HA specific monoclonal
antibody. Proteins precipitated were analyzed on 15% SDS-PAGE
gels.
EXAMPLE 4
Expression via Gene Therapy
[0165] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0166] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0167] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0168] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0169] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0170] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0171] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
* * * * *