U.S. patent application number 10/759602 was filed with the patent office on 2004-07-22 for regulatory sequences for transgenic plants.
Invention is credited to Ainley, Michael, Armstrong, Katherine, Belmar, Scott, Folkerts, Otto, Hopkins, Nicole, Menke, Michael A., Pareddy, Dayakar, Petolino, Joseph F., Smith, Kelley, Woosley, Aaron.
Application Number | 20040143868 10/759602 |
Document ID | / |
Family ID | 21961514 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040143868 |
Kind Code |
A1 |
Ainley, Michael ; et
al. |
July 22, 2004 |
Regulatory sequences for transgenic plants
Abstract
Regulatory seqeunces derived from the maize per5 gene have
utility in plant biotechnology.
Inventors: |
Ainley, Michael; (Carmel,
IN) ; Armstrong, Katherine; (Zionsville, IN) ;
Belmar, Scott; (Indianapolis, IN) ; Folkerts,
Otto; (Guilford, CT) ; Hopkins, Nicole;
(Indianapolis, IN) ; Menke, Michael A.;
(Indianapolis, IN) ; Pareddy, Dayakar; (Carmel,
IN) ; Petolino, Joseph F.; (Zionsville, IN) ;
Smith, Kelley; (Lebanon, IN) ; Woosley, Aaron;
(Fishers, IN) |
Correspondence
Address: |
DOW AGROSCIENCES LLC
9330 ZIONSVILLE RD
INDIANAPOLIS
IN
46268
US
|
Family ID: |
21961514 |
Appl. No.: |
10/759602 |
Filed: |
January 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10759602 |
Jan 16, 2004 |
|
|
|
09643971 |
Aug 22, 2000 |
|
|
|
6699984 |
|
|
|
|
09643971 |
Aug 22, 2000 |
|
|
|
09097319 |
Jun 12, 1998 |
|
|
|
6384207 |
|
|
|
|
60049752 |
Jun 12, 1997 |
|
|
|
Current U.S.
Class: |
800/278 ;
536/23.6; 800/320.1 |
Current CPC
Class: |
C12N 9/0065 20130101;
C12N 15/8216 20130101; C12N 15/8222 20130101; C12N 15/8227
20130101 |
Class at
Publication: |
800/278 ;
800/320.1; 536/023.6 |
International
Class: |
A01H 001/00; C12N
015/82; A01H 005/00; C07H 021/04 |
Claims
We claim:
1. An isolated DNA molecule selected from the following per5
promoter sequences bp 4086-4148 of SEQ ID NO 1, bp 4086 to 4200 of
SEQ ID NO 1, bp 4086 to 4215 of SEQ ID NO 1, bp 3187-4148 of SEQ ID
NO 1, bp 3187-4200 of SEQ ID NO 1, bp 3187-4215 of SEQ ID NO 1, bp
2532-4148 of SEQ ID NO 1, bp 2532-4200 of SEQ ID NO 1, bp 2532-4215
of SEQ ID NO 1, bp 1-4148 of SEQ ID NO 1, bp 14200 of SEQ ID NO 1,
and bp 1-4215 of SEQ ID NO 1, or a fragment, genetic variant or
deletion of such a sequence which retains the ability of
functioning as a promoter in plant cells.
2. An isolated DNA molecule selected from the following per5 intron
sequences bp 4426-5058 of SEQ ID NO 1, bp 4420-5064 of SEQ ID NO 1,
bp 5251-5382 of SEQ ID NO 1, bp 5245-5388 of SEQ ID NO 1, bp
5549-5649 of SEQ ID NO 1, and bp 5542-5654 of SEQ ID NO 1.
3. An isolated DNA molecule corresponding to the per5 transcription
termination sequence and having the sequence of bp 6068-6431 of SEQ
ID NO 1.
4. An isolated DNA molecule having a 20 base pair nucleotide
portion identical in sequence to a consecutive 20 base pair portion
of the sequence set forth in SEQ ID NO 1.
5. A recombinant gene cassette competent for effecting preferential
expression of a gene of interest in a selected tissue of
transformed maize, said gene cassette comprising: a) a promoter
operable in maize; b) an untranslated leader sequence; c) the gene
of interest; d) a 3'UTR; said promoter, untranslated leader
sequence, gene of interest, and 3'UTR being operably linked from 5'
to 3'; and e) an intron sequence that is incorporated in said
untranslated leader sequence,in said gene of interest, or in said
3'UTR, said intron sequence being from an intron of a maize gene
that is preferentially expressed in said selected tissue, and said
intron sequence being from a gene other than the gene of
interest.
6. A recombinant gene cassette of claim 5, wherein the promoter is
from a first maize gene, said first maize gene being one that is
naturally expressed preferentially in the selected tissue.
7. A recombinant gene cassette of claim 5 wherein said intron
sequence is incorporated in said untranslated leader.
8. A recombinant gene cassette of claim 5 wherein said selected
tissue is root tissue.
9. A recombinant gene cassette of claim 8 wherein said intron
sequence is comprised of bp 4420 to bp 5064 of SEQ ID NO 1.
10. A recombinant gene cassette of claim 5 wherein said promoter is
a per5 promoter comprised of bp 2532-4148 of SEQ ID NO 1.
11. A recombinant gene cassette of claim 10 wherein said promoter
is a per5 promoter comprised of bp 1-4148 of SEQ ID NO 1.
12. A recombinant gene cassette of claim 5 wherein the 3'UTR is a
per5 3'UTR comprised of bp 6068 to bp 6431 of SEQ ID NO 1.
13. A recombinant gene cassette competent for effecting
constitutive expression of a gene of interest in transformed maize
comprising: a) a promoter from a first maize gene, said first maize
gene being one that is naturally expressed preferentially in a
specific tissue; b) an untranslated leader sequence; c) the gene of
interest, said gene being one other than said first maize gene; d)
a 3'UTR; said promoter, untranslated sequence, gene of interest,
and 3'UTR being operably linked from 5' to 3'; and e) an intron
sequence that is incorporated in said untranslated leader or in
said gene of interest, said intron sequence being from an intron of
a maize gene that is naturally expressed constitutively.
14. A recombinant gene cassette of claim 13 wherein said intron is
the Adh1 intron 1 or an operative portion thereof.
15. A recombinant gene cassette of claim 14 wherein said promoter
is a per5 promoter comprised of bp 2532 to 4148 of SEQ ID NO 1, or
an operative portion thereof.
16. In a recombinant gene cassette for effecting expression of a
gene of interest in a transformed plant cell wherein said gene
cassette is comprised of: a promoter; an untranslated leader
sequence; the gene of interest, said gene of interest being a gene
other than per5; and a 3'UTR; the improvement wherein said 3'UTR is
a per5 3'UTR comprised of bp 6068 to 6431 of SEQ ID NO 1.
17. A recombinant gene cassette of claim 16 wherein said promoter
is selected from the group consisting of the 3 5T promoter, the
ubiquitin promoter, and the per5 promoter comprising bp 2532 to
4148 of SEQ ID NO 1.
18. A DNA construct comprising, operatively linked in the 5' to 3'
direction, a) a promoter comprising bp 4086-4148 bp of SEQ ID NO 1;
b) an untranslated leader sequence, c) a gene of interest not
naturally associated with said promoter; d) a 3'UTR.
19. A DNA construct of claim 18 wherein the promoter and
untranslated leader sequence together comprise bp 4086-4200 of SEQ
ID NO 1.
20. A DNA construct of claim 18 wherein the promoter is comprised
of bp 3187-4148 of SEQ ID NO 1.
21. A DNA construct of claim 18 wherein the promoter is comprised
of bp 2532-4148 of SEQ ID NO 1.
22. A DNA construct of claim 18 wherein the promoter is comprised
of bp 1-4148 of SEQ ID NO 1.
23. A DNA construct of claim 18 wherein said 3'UTR is the nos
3'UTR.
24. A DNA construct of claim 18 wherein said 3'UTR has the sequence
of bp 6066-6550 of SEQ ID NO 1.
25. A DNA construct comprising, operatively linked in the 5' to 3'
direction, a) a promoter comprised of bp 4086-4148 bp of SEQ ID NO
1; b) an intron selected from the group consisting of Adh1 intron 1
and bp 4426-5058 of SEQ ID NO 1; c) a gene of interest not normally
associated with said promoter; d) a 3'UTR.
26. A DNA construct of claim 25 wherein said 3'UTR is selected from
the group consisting of nos and bp 6067-6340 of SEQ ID NO 1.
27. A DNA construct of claim 25 wherein said 3'UTR is selected from
the group consisting of nos and bp 6067-6439 of SEQ ID NO 1.
28. A DNA construct comprising, in the 5' to 3' direction, a) a
promoter having as at least part of its sequence bp 4086-4148 bp of
SEQ ID NO 1; b) an intron selected from the group consisting of
Adh1 intron 1 and bp 4426-5058 of SEQ ID NO 1; c) a cloning site;
d) a 3'UTR.
29. A DNA construct of claim 28 wherein said 3'UTR is selected from
the group consisting of nos and bp 6067-6340 of SEQ ID NO 1.
30. A plasmid including a promoter that is comprised of bp
4086-4148 of SEQ ID NO 1.
31. A plasmid of claim 30 wherein the promoter is comprised of bp
3187-4148 of SEQ ID NO 1.
32. A plasmid of claim 30 wherein the promoter is comprised of bp
2532-4148 of SEQ ID NO 1.
33. A plasmid of claim 30 wherein the promoter is comprised of bp
1-4148 of SEQ ID NO 1.
34. A plasmid comprising a recombinant gene cassette of claim
5.
35. A plasmid comprising a DNA construct of claim 18.
36. A transformed plant comprising at least one plant cell that
contains a recombinant gene cassette according to claim 5.
37. A transformed plant comprising at least one plant cell that
contains a DNA construct according to claim 18.
38. Seed or grain that contains a recombinant gene cassette of
claim 5.
39. Seed or grain that contains a DNA construct of claim 18.
40. A method for expressing a gene of interest preferentially in a
selected tissue which comprises transforming maize with a gene
cassette of claim 5.
41. A method for expressing a gene of interest in maize
preferentially in root tissue which comprises transforming maize
with a gene cassette of claim 5 wherein the selected tissue is root
tissue.
42. A method of claim 41 wherein the intron sequence in the gene
cassette is comprised of bp 4420 to 5064 of SEQ ID NO 1.
43. A method of claim 40, wherein the promoter in the gene cassette
is a per 5 promoter comprised of bp 2532 to 4148 of SEQ ID NO 1, or
an operative portion thereof.
Description
RELATED APPLICATIONS
[0001] 1. Field of the Invention
[0002] This invention relates to genetic engineering of plants.
More particularly, the invention provides DNA sequences and
constructs that are useful to control expression of recombinant
genes in plants. Specific constructs of the invention use novel
regulatory sequences derived from a maize root preferential
cationic peroxidase gene.
[0003] 2. Background of the Invention
[0004] Through the use of recombinant DNA technology and genetic
engineering, it has become possible to introduce desired DNA
sequences into plant cells to allow for the expression of proteins
of interest. However, obtaining desired levels of expression
remains a challenge. To express agronomically important genes in
crops at desired levels through genetic engineering requires the
ability to control the regulatory mechanisms governing expression
in plants, and this requires access to suitable regulatory
sequences that can be coupled with the genes it is desired to
express.
[0005] A given project may require use of several different
expression elements, for example one set to drive a selectable
marker or reporter gene and another to drive the gene of interest.
The selectable marker may not require the same expression level or
pattern as that required for the gene of interest. Depending upon
the particular project, there may be a need for constitutive
expression, which directs transcription in most or all tissues at
all times, or there may be a need for tissue specific expression.
For example, a root specific or root preferential expression in
maize would be highly desirable for use in expressing a protein
toxic to pests that attack the roots of maize.
[0006] Cells use a number of regulatory mechanisms to control which
genes are expressed and the level at which they are expressed.
Regulation can be transcriptional or post-transcriptional and can
include, for example, mechanisms to enhance, limit, or prevent
transcription of the DNA, as well as mechanisms that limit the life
span of the mRNA after it is produced. The DNA sequences involved
in these regulatory processes can be located upstream, downstream
or even internally to the structural DNA sequences encoding the
protein product of a gene. the transcriptional activation that has
been described by many as constitutive. The 35S promoter is very
efficiently expressed in most dicots and is moderately expressed in
monocots. The addition of enhancer elements to this promoter has
increased expression levels in maize and other monocots.
Constitutive promoters of monocot origin (that are not as well
studied) include the polyubiquitin-1 promoter and the nice actin-1
promoter. Wilmink et al. (1995). In addition, a recombinant
promoter, Emu, has been constructed and shown to drive expression
in monocots in a constitutive manner, Wilmink et al. (1995).
[0007] Few tissue specific promoters have been characterized in
maize. The promoters from the zein gene and oleosin gene have been
found to regulate GUS in a tissue specific manner. Kriz et al.
(1987); Lee and Huang (1994). No root specific promoters from maize
have been described in the literature. However, promoters of this
type have been characterized in other plant species.
[0008] Despite both the important role of tissue specific promoters
in plant development, and the opportunity that availability of a
root preferential promoter would represent for plant biotechnology,
relatively little work has yet been done on the regulation of gene
expression in roots. Yamamoto reported the expression of E. coli:
uidA gene, encoding .beta.-glucuronidase (GUS), under control of
the promoter of a tobacco (N. tabacum) root-specific gene, TobRB7.
Yamamoto et al. (1991), Conkling et al. (1990). Root specific
expression of the fusion genes was analyzed in transgenic tobacco.
Significant expression was found in the root-tip meristem and
vascular bundle. EPO Application Number 452 269 (De Framond)
teaches that promoters from metallathionein-like genes are able to
function as promoters of tissue-preferential transcription of
associated DNA sequences in plants, particularly in the roots.
Specifically, a promoter from a metallathionein-like gene was
operably linked to a GUS reporter gene and tobacco leaf disks were
transformed. The promoter was shown to express in roots, leaves and
stems. WO 9113992 (Croy, et al.) teaches that rape (Brassica napus
L.) extensin gene promoters are capable of directing
tissue-preferential transcription of associated DNA sequences in
plants, particularly in the roots. Specifically, a rape extensin
gene promoter was operably linked to a eta (extensin structural
gene) and tobacco leaf disks were transformed. It was reported that
northern analysis revealed no hybridization of an extensin probe to
leaf RENA from either control or transformed tobacco plants and
hybridization of the extensin probe to transgenic root RNA of all
transformants tested, although the levels of hybridization varied
for the transformants tested. While each of these promoters has
shown some level of tissue-preferential gene expression in a dicot
model system (tobacco), the specificity of these promoters, and
expression patterns and levels resulting from activity of the
promoters, has yet to be achieved in monocots, particularly
maize.
[0009] DNA sequences called enhancer sequences have been identified
which have been shown to enhance gene expression when placed
proximal to the promoter. Such sequences have been identified from
viral, bacterial, and plant gene sources. An example of a well
characterized enhancer sequence is the ocs sequence from the
octopine synthase gene in Agrobacterium tumefaciens. This short (40
bp) sequence has been shown to increase gene expression in both
dicots and monocots, including maize, by significant levels. Tandem
repeats of this enhancer have been shown to increase expression of
the GUS gene eight-fold in maize. It remains unclear how these
enhancer sequences function. Presumably enhancers bind activator
proteins and thereby facilitate the binding of RNA polymerase II to
the TATA box. Grunstein (1992). WO95/14098 describes testing of
various multiple combinations of the ocs enhancer and the mas
(mannopine synthase) enhancer which resulted in several hundred
fold increase in gene expression of the GUS gene in transgenic
tobacco callus.
[0010] The 5' untranslated leader sequence of mRNA, introns, and
the 3' untranslated region of mRNA affect expression by their
effect on post-transcription events, for example by facilitating
translation or stabilizing mRNA.
[0011] Expression of heterologous plant genes has also been
improved by optimization of the non-translated leader sequence,
i.e. the 5' end of the mRNA extending from the 5' CAP site to the
AUG translation initiation codon of the DNA. The leader plays a
critical role in translation initiation and in regulation of gene
expression. For most eukaryotic mRNAs, translation initiates with
the binding of the CAP binding protein to the mRNA CAP. This is
then followed by the binding of several other translation factors,
as well as the 43S ribosome pre-initiation complex. This complex
travels down the mRNA molecule while scanning for an AUG initiation
codon in an appropriate sequence context. Once this has been found,
and with the addition of the 60S ribosomal subunit, the complete
80S initiation complex initiates protein translation. Pain (1986);
Kozak (1986). Optimization of the leader sequence for binding to
the ribosome complex has been shown to increase gene expression as
a direct result of improved translation initiation efficiency.
Significant increases in gene expression have been produced by
addition of leader sequences from plant viruses or heat shock
genes. Raju et al. (1993); Austin (1994) reported that the length
of the 5' non-translated leader was important for gene expression
in protoplasts.
[0012] In addition to the untranslated leader sequence, the region
directly around the AUG start appears to play an important role in
translation initiation. Luerhsen and Walbot (1994). Optimization of
the 9 bases around the AUG start site to a Kozak consensus sequence
was reported to improve transient gene expression 10-fold in BMS
protoplasts. McElroy et al. (1994).
[0013] Studies characterizing the role of introns in the regulation
of gene expression have shown that the first intron of the maize
alcohol dehydrogenase gene (Adh-1) has the ability to increase
expression under anaerobiosis. Callis et al. (1987). The intron
also stimulates expression (to a lesser degree) in the absence of
anaerobiosis. This enhancement is thought to be a result of a
stabilization of the pre-mRNA in the nucleus. Mascarenhas et al.
reported a 12-fold and 20-fold enhancement of CAT expression by use
of the Adh-1 intron. Mascarenhas et al. (1990). Several other
introns have been identified from maize and other monocots which
increase gene expression. Vain et al. (1996).
[0014] The 3' end of the mRNA can also have a large effect on
expression, and is believed to interact with the 5' CAP. Sullivan
(1993). The 3'untranslated region (3'UTR) has been shown to have a
significant role in gene expression of several maize genes.
Specifically, a 200 base pair 3' sequence has been shown to be
responsible for suppression of light induction of the maize small
m3 subunit of the ribulose-1,5-biphosphate carboxylase gene
(rbc/m3) in mesophyll cells. Viret et al. (1994). Some 3' UTRs have
been shown to contain elements that appear to be involved in
instability of the transcript. Sullivan et al. (1993). The 3'UTRs
of most eukaryotic genes contain consensus sequences for
polyadenylation. In plants, especially maize, this sequence is not
very well conserved. The 3' untranslated region, including a
polyadenylation signal, derived from a nopaline synthase gene (3'
nos) is frequently used in plant genetic engineering. Few examples
of heterologous 3'UTR testing in maize have been published.
[0015] Important aspects of the present invention are based on the
discovery that DNA sequences derived from a maize root specific
cationic peroxidase gene are exceptionally useful for use in
regulating expression of recombinant genes in plants.
[0016] The peroxidases (donor:hydrogen-peroxide oxidoreductase, EC
1.11. 1.7) are highly catalytic enzymes with many potential
substrates in the plant. See Gaspar, et al. (1982). They have been
implicated in such diverse functions as secondary cell wall
biosynthesis, wound-healing, auxin catabolism, and defense of
plants against pathogen attack. See Lagrimini and Rothstein (1987);
Morgens et al. (1990); Nakamura et al. (1988); Fujiyama et al.
(1988); and Mazza et al. (1980).
[0017] Most higher plants possess a number of different peroxidase
isozymes whose pattern of expression is tissue specific,
developmentally regulated, and influenced by environmental factors.
Lagrimini & Rothstein (1987). Based upon their isoelectric
point, plant peroxidases are subdivided into three subgroups:
anionic, moderately anionic, and cationic.
[0018] The function of anionic peroxidase isozymes (pI 3.-4.0) is
best understood. Isozymes from this group are usually cell wall
associated. They display a high activity for polymerization of
cinnamyl alcohols in vitro and have been shown to function in
lignification and cross-linking of extensin monomers and
feruloylated polysaccharides. Lagrimini and Rothstein (1987). In
both potato and tomato, expression of anionic peroxidases have been
shown to be induced upon both wound induction and abscisic acid
treatment. Buffard et al. (1990). This suggests their involvement
in both wound healing and in the regulation of tissue
suberization.
[0019] Moderately anionic peroxidase isozymes (pI, 4.5-6.5) are
also cell wall associated and have some activity toward lignin
precursors. In tobacco, isozymes of this class have been shown to
be highly expressed in wounded stem tissue Fujiyama et al. (1988).
These isozymes may also serve a function in suberization and wound
healing. Morgens et al. (1990).
[0020] The actual function of cationic peroxidase isozymes (pI,
8.1-11) in the plant remains unclear. Some members of this group,
however, have been shown to efficiently catalyze the synthesis of
H.sub.2O.sub.2 from NADH and H.sub.2O. Others are localized to the
central vacuole. In the absence of H.sub.2O.sub.2, some of these
isozymes possess indoleacetic acid oxidase activity. Lagrimini and
Rothstein (1987).
[0021] Electrophoretic studies of maize peroxidases have revealed
13 major isozymes. Brewbaker et al. (1985). All isozymes were
judged to be functional as monomers, despite major differences in
molecular weight. All maize tissues had more than one active
peroxidase locus, and all loci were tissue-specific. The
peroxidases have proved unique in that no maize tissue has been
found without activity, and no peroxidase has proven expressed in
all maize tissues.
SUMMARY OF THE INVENTION
[0022] The invention provides isolated DNA molecules derived from
the per5 maize root preferential cationic peroxidase gene that can
be used in recombinant constructs to control expression of genes in
plants. More particularly, the invention provides isolated DNA
molecules derived from the per5 promoter sequence and having as at
least a part of its sequence bp 4086-4148 of SEQ ID NO 1. Preferred
embodiments are isolated DNA molecules that have as part of their
sequences bp 4086 to 4200, bp 4086 to 4215, bp 3187 to 4148, bp
3187 to 4200, bp 3187 to 4215, bp 2532-4148, bp 2532 to 4200, bp
2532 to 4215, bp 1-4148, bp 1-4200, or bp 1-4215 of SEQ ID NO
1.
[0023] The invention also provides isolated DNA molecules selected
from the following per5 intron sequences: bp 4426-5058, bp
4420-5064, bp 5251-5382, bp 5245-5388, bp 5549-5649, and bp
5542-5654 of SEQ ID NO 1.
[0024] The invention also provides isolated DNA molecules derived
from the per5 transcription termination sequence and having the
sequence of bp 6068-6431 of SEQ ID NO 1.
[0025] In another of its aspects, the present invention provides a
recombinant gene cassette competent for effecting preferential
expression of a gene of interest in a selected tissue of
transformed maize, said gene cassette comprising:
[0026] a) a promoter from a first maize gene, said first maize gene
being one that is naturally expressed preferentially in the
selected tissue;
[0027] b) an untranslated leader sequence;
[0028] c) the gene of interest, said gene being one other than said
first maize gene;
[0029] d) a 3'UTR; said promoter, untranslated sequence, gene of
interest, and 3'UTR being operably linked from 5' to 3'; and
[0030] e) an intron sequence that is incorporated in said
untranslated leader sequence or in said gene of interest, said
intron sequence being from an intron of a maize gene that is
preferentially expressed in said selected tissue.
[0031] A related embodiment of the invention is a recombinant gene
cassette competent for effecting constitutive expression of a gene
of interest in transformed maize comprising:
[0032] a) a promoter from a first maize gene, said first maize gene
being one that is naturally expressed preferentially in a specific
tissue;
[0033] b) an untranslated leader sequence;
[0034] c) the gene of interest, said gene being one other than said
first maize gene;
[0035] d) a 3'UTR:
[0036] said promoter, untranslated sequence, gene of interest, and
3'UTR being operably linked from 5' to 3'; and
[0037] e) an intron sequence that is incorporated in said
untranslated leader or in said gene of interest, said intron
sequence being from an intron of a maize gene that is naturally
expressed constitutively.
[0038] In a particular embodiment the intron is one from the maize
Adh1 expressed gene, and the resulting recombinant gene cassette
provides constitutive expression in maize.
[0039] In another of its aspects, the invention provides DNA
constructs comprising, operatively linked in the 5' to 3'
direction,
[0040] a) a promoter having as at least part of its sequence bp
4086-4148 bp of SEQ ID NO 1;
[0041] b) an untranslated leader sequence comprising bp 4149-4200
of SEQ ID NO 1,
[0042] c) a gene of interest not naturally associated with said
promoter, and
[0043] d) a 3'UTR.
[0044] Preferred embodiments of this aspect of the invention are
those wherein the promoter comprises bp 3187 to 4148, bp 2532-4148,
or bp 1-4148 of SEQ ID NO 1. Particularly preferred are each of the
preferred embodiments wherein said 3UTR has the sequence of bp
6066-6340 or bp 6066-6439 of SEQ ID NO 1.
[0045] In another of its aspects, the invention provides DNA
constructs comprising, operatively linked in the 5' to 3'
direction,
[0046] a) a promoter having as at least part of its sequence bp
4086-4148 bp of SEQ ID NO 1;
[0047] b) an untranslated leader sequence not naturally associated
with said promoter,
[0048] c) a gene of interest,
[0049] d) a 3'UTR.
[0050] Preferred embodiments of this aspect of the invention are
those wherein the promoter comprises bp 3187 to 4148, bp 2532-4148,
or bp 1-4148 of SEQ ID NO 1. Particularly preferred are each of the
preferred embodiments wherein said 3'UTR has the sequence of bp
6066-6340 or bp 6066-6439 of SEQ ID NO 1.
[0051] In another of its aspects, the invention provides a DNA
construct comprising, operatively linked in the 5' to 3'
direction,
[0052] a) a promoter having as at least a part of its sequence bp
4086-4148 bp of SEQ ID NO 1:
[0053] b) an untranslated leader sequence comprising bp 4149-4200
of SEQ ID NO 1;
[0054] c) an intron selected from the group consisting of an Adh1
gene intron and bp 4426-5058 of SEQ ID NO 1;
[0055] d) a gene of interest; and
[0056] e) a 3'UTR.
[0057] Preferred embodiments of this aspect of the invention are
again those wherein the promoter comprises bp 3187 to 4148, bp
2532-4148, or bp 1-4148 of SEQ ID NO 1. Particularly preferred are
each of the preferred embodiments wherein said 3'UTR has the
sequence of bp 6066-6340 or bp 6066-6439 of SEQ ID NO 1.
[0058] In another of its aspects, the invention provides a DNA
construct comprising, in the 5' to 3' direction,
[0059] a) a promoter having as at least part of its sequence bp
4086-4148 bp of SEQ ID NO 1;
[0060] b) an untranslated leader sequence;
[0061] c) an intron selected from the group consisting of an Adh1
gene intron and bp 4426-5058 of SEQ ED NO 1;
[0062] d) a cloning site;
[0063] e) a 3'UTR.
[0064] In accordance with another significant aspect of the
invention, there is provided a recombinant gene cassette comprised
of the following operably linked sequences, from 5' to 3' a
promoter; an untranslated leader sequence; a gene of interest; and
the per5 3'UTR, bp 6068-6431 of SEQ ID NO 1.
[0065] In another of its aspects, the invention provides a plasmid
comprising a promoter having as at least part of its sequence bp
4086-4148 of SEQ ID NO 1.
[0066] In another of its aspects, the invention provides a
transformed plant comprising at least one plant cell that contains
a DNA construct of the invention. The plant may be a monocot or
dicot. Preferred plants are maize, rice, cotton and tobacco.
[0067] In another of its aspects, the invention provides seed or
grain that contains a DNA construct of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0068] In one of its aspects, the present invention relates to
regulatory sequences derived from the maize root preferential
cationic peroxidase protein (per) that are able to regulate
expression of associated DNA sequences in plants. More
specifically, the invention provides novel promoter sequences and
constructs using them. It also provides novel DNA constructs
utilizing the per5 untranslated leader and/or 3'UTR. It also
provides novel DNA constructs utilizing the introns from the per5
gene.
[0069] The DNA sequence for a 6550 bp fragment of the genomic clone
of the maize root-preferential cationic peroxidase gene is given in
SEQ ID NO 1. The sequence includes a 5' flanking region (nt
1-4200), of which nucleotides 4149-4200 correspond to the
untranslated leader sequence. The coding sequence for the maize
root-preferential cationic peroxidase is composed of four exons:
exon 1 (nt 4201-4425), exon 2 (nt 5059-5250), exon 3 (nt
5383-5547), and exon 4 (nt 5649-6065). It should be noted that the
first 96 nucleotides of exon 1 (nt 4201-4296) code for a 32 amino
acid signal peptide, which is excised from the polypeptide after
translation to provide the mature protein. Three introns were
found: intron 1 (nt 4426-5058), intron 2 (5251-5382), and intron 3
(5548-5648). The 3' flanking region (373 nucleotides in length)
extends from nucleotide 6069 (after the UGA codon at nucleotides
6066-6068) to nucleotide 6550, including a polyadenylation signal
at nucleotides 6307-6312.
[0070] We have discovered that promoters derived from certain
tissue preferential maize genes require the presence of an intron
in the transcribed portion of the gene in order for them to provide
effective expression in maize and that the temporal and tissue
specificity observed depends on the intron used. A recombinant gene
cassette having a tissue preferential maize promoter, but lacking
an intron in the transcribed portion of the gene, does not give
appropriate expression in transformed maize. If the transcribed
portion of the cassette includes an intron derived from a maize
gene of similar tissue specificity to the maize gene from which the
promoter was obtained, the gene cassette will restore tissue
preferential expression in maize. The intron may be, but need not
necessarily be, from the same gene as the promoter. If an intron
derived from another maize gene, such as Adh1 intron 1, is used in
a gene cassette with a promoter from a tissue preferential maize
gene, the cassette will give generally constitutive expression in
maize. We have also found that these considerations apply to
transgenic maize, but not to transgenic rice. Tissue preferential
maize promoters can be used to drive recombinant genes in rice
without an intron.
[0071] In accordance with the foregoing unexpected and significant
findings, the present invention provides a recombinant gene
cassette competent for effecting preferential expression of a gene
of interest in a selected tissue of transformed maize, said gene
cassette comprising:
[0072] a) a promoter from a first maize gene, said first maize gene
being one that is naturally expressed preferentially in the
selected tissue;
[0073] b) an untranslated leader sequence;
[0074] c) the gene of interest, said gene being one other than said
first maize gene;
[0075] d) a 3'UTR;
[0076] said promoter, untranslated sequence, gene of interest, and
3'UTR being operably linked from 5' to 3'; and
[0077] e) an intron sequence that is incorporated in said
untranslated leader sequence or in said gene of interest, said
intron sequence being from an intron of a maize gene that is
preferentially expressed in said selected tissue.
[0078] The promoter used in this embodiment can be from any maize
gene that is preferentially expressed in the tissue of interest.
Such maize genes can be identified by conventional methods, for
example, by techniques involving differential screening of mRNA
sequences.
[0079] A detailed example of identification and isolation of a
tissue preferential maize gene is given herein for the root
preferential maize cationic peroxidase gene. The method illustrated
in this example can be used to isolate additional genes from
various maize tissues.
[0080] Examples of tissue preferential maize genes that have
promoters suitable for use in the invention include: O-methyl
transferase and glutamine svntlietase 1.
[0081] A preferred promoter is the per5 promoter, i.e. synthetase
promoter from the root preferential maize cationic peroxidase gene.
Particularly preferred is the promoter comprising bp to 415 of SEQ
ID NO 1.
[0082] The non-translated leader sequence can be derived from any
suitable source and may be specifically modified to increase the
translation of the mRNA. The 5' non-translated region may be
obtained from the promoter selected to express the gene, the native
leader sequence of the gene or coding region to be expressed, viral
RNAs, suitable eukaryotic genes, or may be a synthetic
sequence.
[0083] The gene of interest may be any gene that it is desired to
express in plants. Particularly useful genes are those that confer
tolerance to herbicides, insects, or viruses, and genes that
provide improved nutritional value or processing characteristics of
the plant. Examples of suitable agronomically useful genes include
the insecticidal gene from Bacillus thuringiensis for conferring
insect resistance and the 5'-enolpyruvyl-3'-phosphoshikimate
synthase (EPSPS) gene and any variant thereof for conferring
tolerance to glyphosate herbicides. Other suitable genes are
identified hereinafter. As is readily understood by those skilled
in the art, any agronomically important gene conferring a desired
trait can be used.
[0084] The 3' UTR, or 3' untranslated region, that is employed is
one that confers efficient processing of the mRNA, maintains
stability of the message and directs the addition of adenosine
ribonucleotides to the 3' end of the transcribed mRNA sequence. The
3' UTR may be native with the promoter region, native with the
structural gene, or may be derived from another source. Suitable 3'
UTRs include but are, not limited to: the per5 3' UTR, and the 3'
UTR of the nopaline synthase (nos) gene.
[0085] The intron used will depend on the particular tissue in
which it is desired to preferentially express the gene of interest.
For tissue preferential expression in maize, the intron should be
selected from a maize gene that is naturally expressed
preferentially in the selected tissue.
[0086] The intron must be incorporated into a transcribed region of
the cassette. It is preferably incorporated into the untranslated
leader 5' of the gene of interest and 3' of the promoter or within
the translated region of the gene.
[0087] Why certain tissue preferential maize genes require an
intron to enable effective expression in maize tissues is not
known, but experiments indicate that the critical event is
post-transcriptional processing. Accordingly, the present invention
requires that the intron be provided in a transcribed portion of
the gene cassette.
[0088] A related embodiment of the invention is a recombinant gene
cassette competent for effecting constitutive expression of a gene
of interest in transformed maize comprising:
[0089] a) a promoter from a first maize gene, said first maize gene
being one that is naturally expressed preferentially in a specific
tissue;
[0090] b) an untranslated leader sequence;
[0091] c) the gene of interest, said gene being one other than said
first maize gene;
[0092] d) a 3'UTR;
[0093] said promoter, untranslated sequence, gene of interest, and
3'UTR being operably linked from 5' to 3'; and
[0094] e) an intron sequence that is incorporated in said
untranslated leader or in said gene of interest, said intron
sequence being from an intron of a maize gene that is naturally
expressed constitutively.
[0095] This embodiment differs from the previous embodiment in that
the intron is one from a gene expressed in most tissues, and the
expression obtained from the resulting recombinant gene cassette in
maize is constitutive. Suitable introns for use in this embodiment
of the invention include Adh1 intron 1, Ubiquitin intron 1, and
Bronze 2 intron 1. Particularly preferred is the Adh1 intron 1.
Although it has previously been reported that the Adh1 intron 1 is
able to enhance expression of constitutively expressed genes, it
has never been reported or suggested that the Adh1 intron can alter
the tissue preferential characteristics of a tissue preferential
maize promoter.
[0096] The present invention is generally applicable to the
expression of structural genes in both monocotyledonous and
dicotyledonous plants. This invention is particularly suitable for
any member of the monocotyledonous (monocot) plant family
including, but not limited to, maize, rice, barley, oats, wheat,
sorghum, rye, sugarcane, pineapple, yams, onion, banana, coconut,
and dates. A preferred application of the invention is in
production of transgenic maize plants.
[0097] This invention, utilizing a promoter constructed for
monocots, is particularly applicable to the family Graminaceae, in
particular to maize, wheat, rice, oat, barley and sorghum.
[0098] In accordance with another aspect of the invention, there is
provided a recombinant gene cassette comprised of: a promoter; an
untranslated leader sequence; a gene of interest; and the per5
3'UTR. Use of the per5 3'UTR provides enhanced expression compared
to similar gene cassettes utilizing the nos 3'UTR.
[0099] The promoter used with the per5 3'UTR can be any promoter
suitable for use in plants. Suitable promoters can be obtained from
a variety of sources, such as plants or plant DNA viruses.
Preferred promoters are the per5 promoter, the 35T promoter
(described hereinafter in Examples 20 and 23), and the ubiquitin
promoter. Useful promoters include those isolated from the
caulimovirus group, such as the cauliflower mosaic virus 19S and
35S (CaMV19S and CaMV35S) transcript promoters. Other useful
promoters include the enhanced CaMV35S promoter (eCaMV35S) as
described by Kat et al. (1987) and the small subunit promoter of
ribulose 1,5-bisphosphate carboxylase oxygenase (RUBISCO). Examples
of other suitable promoters are rice actin gene promoter;
cyclophilin promoter; Adh1 gene promoter, Callis et al. (1987);
Class I patatin promoter, Bevan et al. (1986); ADP glucose
pyrophosphorylase promoter; .beta.-conglycinin promoter. Tierney et
al. (1987); E8 promoter. Deikman et al. (1988): 2AII promoter. Pear
et al. (1989); acid chitinase promoter, Samac et al. (1990). The
promoter selected should be capable of causing sufficient
expression of the desired protein alone, but especially when used
with the per5 3'UTR, to result in the production of an effective
amount of the desired protein to cause the plant cells and plants
regenerated therefrom to exhibit the properties which are
phenotypically caused by the expressed protein.
[0100] The untranslated leader used with the per5 3'UTR is not
critical. The untranslated leader will typically be one that is
naturally associated with the promoter. The untranslated leader may
be one that has been modified in accordance with another aspect of
the present invention to include an intron. It may also be a
heterologous sequence, such as one provided by U.S. Pat. No.
5,362,865. This non-translated leader sequence can be derived from
any suitable source and can be specifically modified to increase
translation of the mRNA.
[0101] The gene of interest may be any gene that it is desired to
express in plants, as described above.
[0102] The terms "per5 3'UTR" and/or "per5 transcription
termination region" are intended to refer to a sequence comprising
bp 6068 to 6431 of SEQ ID NO 1.
[0103] Construction of gene cassettes utilizing the per5 3'UTR is
readily accomplished utilizing well known methods, such as those
disclosed in Sambrook et al. (1989); and Ausubel et al. (1987).
[0104] As used in the present application, the terms
"root-preferential promoter", "root-preferential expression",
"tissue-preferential expression" and "preferential expression" are
used to indicate that a given DNA sequence derived from the 5'
flanking or upstream region of a plant gene of which the structural
gene is expressed in the root tissue exclusively, or almost
exclusively and not in the majority of other plant parts. This DNA
sequence when connected to an open reading frame of a gene for a
protein of known or unknown function causes some differential
effect; i.e., that the transcription of the associated DNA
sequences or the expression of a gene product is greater in some
tissue, for example, the roots of a plant, than in some or all
other tissues of the plant, for example, the seed. Expression of
the product of the associated gene is indicated by any conventional
RNA, cDNA, protein assay or biological assay, or that a given DNA
sequence will demonstrate.
[0105] This invention involves the construction of a recombinant
DNA construct combining DNA sequences from the promoter of a maize
root-preferential cationic peroxidase gene, a plant expressible
structural gene (e.g. the GUS gene (Jefferson. (1987)) and a
suitable terminator.
[0106] The present invention also includes DNA sequences having
substantial sequence homology with the specifically disclosed
regulatory sequences, such that they are able to have the disclosed
effect on expression.
[0107] As used in the present application, the term "substantial
sequence homology" is used to indicate that a nucleotide sequence
(in the case of DNA or RNA) or an amino acid sequence (in the case
of a protein or polypeptide) exhibits substantial, functional or
structural equivalence with another nucleotide or amino acid
sequence. Any functional or structural differences between
sequences having substantial sequence homology will be de minimis;
that is they will not affect the ability of the sequence to
function as indicated in the present application. For example, a
sequence which has substantial sequence homology with a DNA
sequence disclosed to be a root-preferential promoter will be able
to direct the root-preferential expression of an associated DNA
sequence. Sequences that have substantial sequence homology with
the sequences disclosed herein are usually variants of the
disclosed sequence, such as mutations, but may also be synthetic
sequences.
[0108] In most cases, sequences having 95% homology to the
sequences specifically disclosed herein will function as
equivalents, and in many cases considerably less homology, for
example 75% or 80%, will be acceptable. Locating the parts of these
sequences that are not critical may be time consuming, but is
routine and well within the skill in the art.
[0109] DNA encoding the maize root-preferential cationic peroxidase
promoter may be prepared from chromosomal DNA or DNA of synthetic
origin by using well-known techniques. Specifically comprehended as
part of this invention are genomic DNA sequences. Genomic DNA may
be isolated by standard techniques. Sambrook et al. (1989); Mullis
et al. (1987); Horton et al. (1989); Erlich (ed.)(1989). It is also
possible to prepare synthetic sequences by oligonucleotide
synthesis. See Caruthers (1983) and Beaucage et al. (1981).
[0110] It is contemplated that sequences corresponding to the above
noted sequences may contain one or more modifications in the
sequences from the wild-type but will still render the respective
elements comparable with respect to the teachings of this
invention. For example, as noted above, fragments may be used. One
may incorporate modifications into the isolated sequences including
the addition, deletion, or nonconservative substitution of a
limited number of various nucleotides or the conservative
substitution of many nucleotides. Further, the construction of such
DNA molecules can employ sources which have been shown to confer
enhancement of expression of heterologous genes placed under their
regulatory control. Exemplary techniques for modifying
oligonucleotide sequences include using polynucleotide-mediated,
site-directed mutagenesis. See Zoller et al. (1984); Higuchi et al.
(1988); Ho et al. (1989); Horton et al. (1989); and PCR Technology:
Principles and Applications for DNA Amplification, (ed.) Erlich
(1989).
[0111] In one embodiment, an expression cassette of this invention,
will comprise, in the 5' to 3' direction, the maize
root-preferential cationic peroxidase promoter sequence, in reading
frame, one or more nucleic acid sequences of interest followed by a
transcript termination sequence. The expression cassette may be
used in a variety of ways, including for example, insertion into a
plant cell for the expression of the nucleic acid sequence of
interest.
[0112] The tissue-preferential promoter DNA sequences are
preferably linked operably to a coding DNA sequence, for example, a
DNA sequence which is transcribed into RNA, or which is ultimately
expressed in the production of a protein product.
[0113] A promoter DNA sequence is said to be "operably linked" to a
coding DNA sequence if the two are situated such that the promoter
DNA sequence influences the transcription of the coding DNA
sequence. For example, if the coding DNA sequence codes for the
production of a protein, the promoter DNA sequence would be
operably linked to the coding DNA sequence if the promoter DNA
sequence affects the expression of the protein product from the
coding DNA sequence. For example, in a DNA sequence comprising a
promoter DNA sequence physically attached to a coding DNA sequence
in the same chimeric construct, the two sequences are likely to be
operably linked.
[0114] The DNA sequence associated with the regulatory or promoter
DNA sequence may be heterologous or homologous, that is, the
inserted genes may be from a plant of a different species than the
recipient plant. In either case, the DNA sequences, vectors and
plants of the present invention are useful for directing
transcription of the associated DNA sequence so that the mRNA
transcribed or the protein encoded by the associated DNA sequence
is expressed in greater abundance in some plant tissue, such as the
root, leaves or stem, than in the seed. Thus, the associated DNA
sequence preferably may code for a protein that is desired to be
expressed in a plant only in preferred tissue, such as the roots,
leaves or stems, and not in the seed.
[0115] Promoters are positioned 5' (upstream) to the genes that
they control. As is known in the art, some variation in this
distance can be accommodated without loss of promoter function.
Similarly, the preferred positioning of a regulatory sequence
element with respect to a heterologous gene to be placed under its
control is defined by the positioning of the element in its natural
setting, i.e., the genes from which it is derived. Again, as is
known in the art and demonstrated herein with multiple copies of
regulatory elements, some variation in this distance can occur.
[0116] Any plant-expressible structural gene can be used in these
constructions. A structural gene is that portion of a gene
comprising a DNA segment encoding a protein, polypeptide, antisense
RNA or ribozyme or a portion thereof. The term can refer to copies
of a structural gene naturally found within the cell, but
artificially introduced, or the structural gene may encode a
protein not normally found in the plant cell into which the gene is
introduced, in which case it is termed a heterologous gene.
[0117] The associated DNA sequence may code, for example, for
proteins known to inhibit insects or plant pathogens such as fungi,
bacteria and nematodes. These proteins include, but are not limited
to, plant non-specific lipid acyl hydrolases, especially patatin;
midgut-effective plant cystatins, especially potato papain
inhibitor; magainins, Zasloff (1987); cecropins, Hultmark et al.
(1982); attacins, Hultmark et al. (1983); melittin; gramicidin S,
Katsu et al. (1988); sodium channel proteins and synthetic
fragments, Oiki et al. (1988): the alpha toxin of Staphylococcus
aureus, Tobkes et al. (1985); apolipoproteins and fragments
thereof, Knott et al. (1985)and Nakagawa et al. (1985); alamethicin
and a variety of synthetic amphipathic peptides, Kaiser et al.
(1987); lectins, Lis et al. (1986) and Van Parijs et al. (1991);
pathogenesis-related proteins, Linthorst (1991); osmotins and
permatins, Vigers et al. (1992) and Woloscuk et al. (1991);
chitinases; glucanases, Lewah et al. (1991); thionins, Bohlmann and
Apel (1991); protease inhibitors, Ryan (1990); plant anti-microbial
peptides, Cammue et al. (1992); and polypeptides from Bacillus
thuringiensis, which are postulated to generate small pores in the
insect gut cell membrane, Knowles et al. (1987) and Hofte and
Whitely (1989).
[0118] The structural gene sequence will generally be one which
originates from a plant of a species different from that of the
target organism. However, the present invention also contemplates
the root preferential expression of structural genes which
originates from a plant of the same species as that of the target
plant but which are not natively expressed under control of the
native root preferential cationic peroxidase (per5) promoter.
[0119] The structural gene may be derived in whole or in part from
a bacterial genome or episome, eukaryotic genomic, mitochondrial or
plastid DNA, cDNA, viral DNA, or chemically synthesized DNA. It is
possible that a structural gene may contain one or more
modifications in either the coding or the untranslated regions
which could affect the biological activity or the chemical
structure of the expression product, the rate of expression, or the
manner of expression control. Such modifications include, but are
not limited to, mutations, insertions, deletions, rearrangements
and substitutions of one or more nucleotides. The structural gene
may constitute an uninterrupted coding sequence or it may include
one or more introns, bounded by the appropriate plant-functional
splice junctions. The structural gene may be a composite of
segments derived from a plurality of sources, naturally occurring
or synthetic. The structural gene may also encode a fusion protein,
so long as the experimental manipulations maintain functionality in
the joining of the coding sequences.
[0120] The use of a signal sequence to secrete or sequester in a
selected organelle allows the protein to be in a metabolically
inert location until released in the gut environment of an insect
pathogen. Moreover, some proteins are accumulated to higher levels
in transgenic plants when they are secreted from the cells, rather
than stored in the cytosol. Hiatt, et al. (1989).
[0121] At the 3' terminus of the structural gene will be provided a
termination sequence which is functional in plants. A wide variety
of termination regions are available that may be obtained from
genes capable of expression in plant hosts. e.g., bacterial, opine,
viral, and plant genes. Suitable 3' UTRs include those that are
known to those skilled in the art, such as the nos 3', tmL 3', or
acp 3', for example.
[0122] In preparing the constructs of this invention, the various
DNA fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Adapters or linkers may be employed for
joining the DNA fragments or other manipulations may be involved to
provide for convenient restriction sites, removal of superfluous
DNA, removal of restriction sites, or the like.
[0123] In carrying out the various steps, cloning is employed, so
as to amplify a vector containing the promoter/gene of interest for
subsequent introduction into the desired host cells. A wide variety
of cloning vectors are available, where the cloning vector includes
a replication system functional in E. coli and a marker which
allows for selection of the transformed cells. Illustrative vectors
include pBR322, pUC series, pACYC184, Bluescript series
(Stratagene) etc. Thus, the sequence may be inserted into the
vector at an appropriate restriction site(s), the resulting plasmid
used to transform the E. coli host (e.g., E. coli strains HB101,
JM101 and DH5.alpha.), the E. coli grown in an appropriate nutrient
medium and the cells harvested and lysed and the plasmid recovered.
Analysis may involve sequence analysis, restriction analysis,
electrophoresis, or the like. After each manipulation the DNA
sequence to be used in the final construct may be restricted and
joined to the next sequence, where each of the partial constructs
may be cloned in the same or different plasmids.
[0124] Vectors are available or can be readily prepared for
transformation of plant cells. In general, plasmid or viral vectors
should contain all the DNA control sequences necessary for both
maintenance and expression of a heterologous DNA sequence in a
given host. Such control sequences generally include, in addition
to the maize root-preferential cationic peroxidase promoter
sequence (including a transcriptional start site), a leader
sequence and a DNA sequence coding for translation start-signal
codon (generally obtained from either the maize root-preferential
cationic peroxidase gene or from the gene of interest to be
expressed by the promoter or from a leader from a third gene which
is known to work well or enhance expression in the selected host
cell), a translation terminator codon, and a DNA sequence coding
for a 3' non-translated region containing signals controlling
messenger RNA processing. Selection of appropriate elements to
optimize expression in any particular species is a matter of
ordinary skill in the art utilizing the teachings of this
disclosure; in some cases hybrid constructions are preferred,
combining promoter elements upstream of the tissue preferential
promoter TATA and CAAT box to a minimal 35S derived promoter
consisting of the 35S TATA and CART box. Finally, the vectors
should desirably have a marker gene that is capable of providing a
phenotypical property which allows for identification of host cells
containing the vector, and an intron in the 5' untranslated region,
e.g., intron 1 from the maize alcohol dehydrogenase gene that
enhances the steady state levels of mRNA of the marker gene.
[0125] The activity of the foreign gene inserted into plant cells
is dependent upon the influence of endogenous plant DNA adjacent
the insert. Generally, the insertion of heterologous genes appears
to be random using any transformation technique; however,
technology currently exists for producing plants with site specific
recombination of DNA into plant cells (see WO/9109957). The
particular methods used to transform such plant cells are not
critical to this invention, nor are subsequent steps, such as
regeneration of such plant cells, as necessary. Any method or
combination of methods resulting in the expression of the desired
sequence or sequences under the control of the promoter is
acceptable.
[0126] Conventional technologies for introducing biological
material into host cells include electroporation, as disclosed in
Shigekawa and Dower (1988), Miller, et al. (1988), and. Powell, et
al (1988); direct DNA uptake mechanisms, as disclosed in Mandel and
Higa (1972) and Dityatkin, et al. (1972), Wigler, et al. (1979) and
Uchimiya, et al (1982); fusion mechanisms, as disclosed in Uchidaz,
et al. (1980); infectious agents, as disclosed in Fraley, et al.
(1986) and Anderson (1984); microinjection mechanisms, as disclosed
in Crossway, et al. (1986); and high velocity projectile
mechanisms, as disclosed in EPO 0 405 696.
[0127] Plant cells from monocotyledonous or dicotyledonous plants
can be transformed according to the present invention.
Monocotyledonous species include barley, wheat, maize, oat and
sorghum and rice. Dicotyledonous species include tobacco, tomato,
sunflower, cotton, sugarbeet, potato, lettuce, melon, soybean and
canola (rapeseed).
[0128] The appropriate procedure to transform a selected host cell
may be chosen in accordance with the host cell used. Based on the
experience to date, there appears to be little difference in the
expression of genes, once inserted into cells, attributable to the
method of transformation itself. Once introduced into the plant
tissue, the expression of the structural gene may be assayed in a
transient expression system, or it may be determined after
selection for stable integration within the plant genome.
[0129] Techniques are known for the in vitro culture of plant
tissue, and in a number of cases, for regeneration into whole
plants. The appropriate procedure to produce mature transgenic
plants may be chosen in accordance with the plant species used.
Regeneration varies from species to species of plants. Efficient
regeneration will depend upon the medium, on the genotype and on
the history of the culture. Once whole plants have been obtained,
they can be sexually or clonally reproduced in such a manner that
at least one copy of the sequence is present in the cells of the
progeny of the reproduction. Seed from the regenerated plants can
be collected for future use, and plants grown from this seed.
Procedures for transferring the introduced gene from the originally
transformed plant into commercially useful cultivars are known to
those skilled in the art.
EXAMPLE 1
Characterization Of A Maize Root-Preferential Cationic
Peroxidase
[0130] The presence of peroxidase activity can be detected in situ
in sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) by
incubation with H.sub.2O.sub.2 and a chromogenic substrate such as
3,3'-diaminobenzidine. Tissue specific peroxidase activity was
detected by extraction of proteins from root, stem and leaf tissue
of maize followed by detection in gels according to Nakamura et al.
(see Nakamura et al. (1988)) essentially as follows. One gram of
maize tissue was macerated in mortar in 1 mL extraction buffer,
composed of 62.5 mM TrisHCl pH 6.8, 5 mM MgCl.sub.2, 0.5 M sucrose,
and 0.1% ascorbic acid, centrifuged and passed over 0.2 .mu.M
filter to remove plant debris. Total protein was determined using
the Bradford protein assay. See Bradford (1976). Ten micrograms of
protein of each tissue was electrophoresed on a SDS-poly acrylamide
gel. Beta-mercaptoethanol was omitted from the sample buffer to
retain enzyme activity. Following electrophoresis the gel was
washed two times in 50 mM TrisHCl pH 7.5 for 30 minutes each to
remove SDS, and then incubated in the assay solution, which was
composed of 50 mM TrisHCl pH 7.5, 0.5 mg/mL diamino benzidine and
0.01% hydrogen peroxide for 10 minutes. Bands corresponding to
peroxidase activity were visualized by the formation of a brown
precipitate. Non-reduced molecular weight markers (Amersham
Corporation) were run in a parallel lane and visualized by standard
protein staining in a separate incubation with Coomassie Brilliant
Blue. Peroxidase activity in the gel corresponding to a band
migrating at approximately 44 kD was only detected in root tissue
and was not present in either leaf or stem tissue. Identical
patterns of peroxidase staining were produced when several
different maize genotypes were examined for root-specific
peroxidase isozymes (B37.times.H84, Pioneer Hybrid 8737, B73).
EXAMPLE 2
Isolation Of cDNA Clones Encoding The Maize Root-Preferential
Cationic Peroxidase
[0131] A. RNA Isolation. cDNA Synthesis and Library
Construction.
[0132] Maize kernels (Zea mays hybrid B37.times.H84) were
germinated on filter paper under sterile conditions. At 6 days post
germination root tissue was harvested and frozen in liquid nitrogen
and ground in a mortar and pestle until a fine powder was obtained.
The powder was added to 10 mLs of TLE buffer (0.2 M Tris HCl pH
8.2, 0.1 M LiCl, 5 mM EDTA) containing 1% SDS and extracted with 50
mLs of TLE equilibrated phenol and 50 mLs of chloroform. The
extraction was incubated on ice for 45 minutes with shaking, and
subsequently incubated at 50.degree. C. for 20 minutes. The aqueous
phase was transferred to a clean centrifuge tube following
centrifugation, and reextracted twice with one half volume of
phenol/chloroform (1:1), followed by extractions with chloroform.
RNA was precipitated from the aqueous phase by addition of one
third volume of 8 M LiCl and incubation at 4.degree. C. for 24 hrs.
The precipitate was collected by centrifugation, washed with 2M
LiCl and resuspended in 12 mLs of water. RNA was reprecipitated by
addition of an equal volume of 4 M LiCl, incubation at 4.degree. C.
for 24 hrs and centrifugation. The RNA pellet was resuspended in 2
mL of water and ethanol precipitated by addition of 200 .mu.l 3 M
Na Acetate and 5.5 mL of ethanol and 16 hr incubation at
-20.degree. C., followed by centrifugation. The final RNA pellet
was resuspended in 1 mL water. The concentration of the RNA was
determined using measurement of the absorption at 260 nm. Messenger
RNA was purified by binding to and subsequent elution of polyA
Quickkit.TM. columns exactly as described by the supplier
(Scratagene Cloning Systems, La Jolla, Calif.). The concentration
was determined by A260 measurement. cDNA was synthesized from 5
micrograms of polyA+RNA using the ZAP-cDNA.RTM. synthesis kit,
cloned into the Uni-ZAP.RTM. vector, packaged into phage heads
using Stratagene Gigapack Gold.RTM. packaging extracts and infected
and amplified on E. coli strain PLK-F' exactly according to the
protocols provided by the supplier (Stratagene). The titer of the
resulting amplified library was determined by plating on PLK-F'
cells and was determined at 2.7.times.10.sup.9 plaque forming units
(pfu)/mL.
[0133] B. Isolation of a Peroxidase Hybridization Probe.
[0134] A hybridization probe corresponding to a central portion of
peroxidase cDNA sequences was isolated as follows. Sequence
analysis of a number of cloned peroxidases indicated that there are
several domains in the predicted and/or determined amino acid
sequences that are highly conserved. See Lagrimini and Rothstein
(1987). Two degenerate oligonucleotide primers were synthesized
against two conserved domains, taking in account a bias for C or G
over A or T in the third codon position in maize. Part of the first
conserved domain, FHDCFVNGC corresponding to amino acids 41 through
49 of the tobacco peroxidase (see Lagrimini and Rothstein (1987))
was reverse translated into the degenerate oligonucleotide MMM1:
5'-TTYCAYGAYTGYTTYGTYAAYGGBTG-3' (SEQ ID NO 3). Part of a second
conserved domain, VKLSGAHT (corresponding to amino acids 161
through 168 of the tobacco peroxidase (see Lagrimini and Rothstein
(1987)) was reverse translated and reverse complemented to give the
degenerate oligonucleotide MM3: 5'-SGTRTGSGCSCCGSWSAGVGCSAC-3' (SEQ
ID NO 4). In both oligonucleotides, Y indicates the degeneracy C
and T; R indicates A and G. S indicates C and G; W indicates A and
T; V indicates A, C, and G; and B indicates C ,G, and T;
[0135] Using the Polymerase Chain Reaction.TM. kit (Perkin Elmer
Cetus) a 380 bp DNA fragment was amplified using total root cDNA
library DNA as template. The size of this fragment corresponded
well to the expected size based on the distance of the two domains
in peroxidase proteins, 128 amino acids corresponding to 384 nt.
Following gel purification the 380 nt fragment was radiolabeled
using random primer labeling with an Oligo Labeling.TM. kit
(Pharmacia LKB Biotechnology, Inc, Piscataway, N.J.) as per the
supplier's instructions with .sub.[Di]50 microCuries
[.alpha.-.sup.32P}dCTP.
[0136] C. Screening of the Root cDNA Library.
[0137] Two hundred thousand phages were plated on E. coli XL1 Blue
cells (Stratagene) divided over ten plates. Duplicate plaque lift
filters were made of each plate. Filters were prehybridized and
hybridized in a total volume of 150 mLs of hybridization solution
according to standard procedures (Sambrook et al. 1989). The
approximate concentration of labelled probe in the hybridization
was 2.20.times.10.sup.5 cpm/mL. Following hybridization filters
were washed according to standard procedures, air dried, covered
and exposed to Kodak XAR5 Film. Signals were determined positive if
they occurred in the same position on the two duplicate filters of
one plate relative to the markings. Putative positive phage were
cored out of the plate and stored in 1 mL of SM buffer. Thirty four
positive phage were rescreened twice to obtain a pure phage stock
using similar hybridization experiments as described above. DNA
from all 34 positive phage cDNA clones was prepared by alkaline
lysis minipreps following in vivo rescue of phagemids according to
the protocol provided by the supplier (Stratagene) and digested
with EcoRI and XhoI to release inserts. All plasmids contained one
insert in the size range of 1.3-1.4 kb which hybridized with the
380 nt peroxidase probe.
EXAMPLE 3
Analysis of Maize Root-Preferential Cationic Peroxidase cDNA Clone
Per5
[0138] A. Analysis of Expression Pattern by Northern
Hybridization.
[0139] RNA was prepared from root, stem, leaf, kernel and tassel
tissue as described in Example 2, section A. Thirty micrograms of
denatured total RNA of each tissue was electrophoresed on a 1%
agarose/Na phosphate gel and transferred to nylon membrane and
prehybridized and hybridized with the labeled 380 nt peroxidase
probe according to standard procedures. A.about.1470 nt transcript
was detected in root and stem RNA, but was absent from leaf, kernel
and tassel RNA. The level of the detected transcript in roots was
at least 5.5 fold higher than in stem tissue.
[0140] B. Sequence Analysis of the per5 cDNA Clone.
[0141] Both strands of dsDNA from the cDNA clone with the longest
insert (per5) were sequenced using the Sequenase.TM. sequencing kit
(United States Biochemical, Cleveland, Ohio). Sequencing was
started using the T3 and T7 primers and completed by walking along
the DNA using sequencing primers designed based on sequence derived
in previous runs. The sequence of the per5 cDNA insert is shown in
SEQ ID NO 5. The per5 cDNA insert is 1354 nucleotides (nt) in
length and has a 5'-untranslated leader of 52 nt and a 275 nt 3'
untranslated sequence before the start of polyadenylation. It also
contains the animal consensus polyadenylation signal sequence
AATAAA 34 nucleotides prior to the addition of a 28 nucleotide
poly(A) tail. The cDNA has an open reading frame of 999 bp, which
spans between nucleotides 53 and 1051. The first ATG codon in the
cDNA sequence was chosen as the start of translation. The predicted
size of the mature maize peroxidase is 301 amino acids with a MW of
32,432 and an estimated pI of 9.09. The N-terminus of the mature
protein was assigned by alignment of the maize amino acid sequence
with other published sequences and known N-terminal sequences
obtained by N-terminal amino acid sequencing. It is predicted from
the cDNA sequence that the protein is initially synthesized as a
preprotein of MW 35,685 with a 32-amino acid signal sequence that
is 72% hydrophobic. The presence of this signal sequence, which has
also been observed in several other plant peroxidases, suggests
that the protein is taken up in the endoplasmic reticulum and
modified for sub-cellular targeting or secretion. This is supported
by the presence of four potential N-glycosylation sites
(Asn-Xaa-Thr/Ser), which are at residues 53, 138, 181 and 279 of
the putative mature protein. The presence of four putative
N-glycosylation sites suggest a role for post-translational
modification (eg. glycosylation) and explains the discrepancy in
the observed (.about.44 kD) and predicted size of the mature
protein (.about.36 kD). Comparison of the deduced amino acid
sequences of the maize per5 cDNA with the published sequences of
wheat (see Hertig et al. (1991)), horseradish [C1] (see Fujiyama et
al. (1988)), turnip [TP7] (see Mazza and Welinder (1980)), peanut
[PNC1] (see Buffard et al. (1990)), tobacco (see Lagrimini et al.
(1987)), and cucumber (see Morgens et al. (1990)) confirms that
per5 encodes a peroxidase protein. There is >80% to >92%
sequence similarity between these seven plant peroxidases in four
conserved domains. All seven peroxidases have eight cysteines,
conserved in position in the primary sequence. These cysteines in
the horseradish and turnip enzymes have been shown to be involved
in intramolecular disulfide linkages.
EXAMPLE 4
Isolation of the Maize Root-Preferential Cationic Peroxidase
Genomic Clone
[0142] A. Genomic DNA Blot Hybridization.
[0143] Genomic DNA was isolated from a maize diploid, homozygous
line (B73). The DNA was digested with the restriction enzymes
EcoRI, HindIII, and SacI, fractionated on a 1% agarose gel,
subjected to transfer to membrane and hybridization to both a
.sup.32P-labeled per5 full-length cDNA and a per5 cDNA
gene-specific probe (GSP5). The 136 bp GSP5 probe was amplified by
PCR using the per5 cDNA clone as template DNA and primers MM21:
5'-GTCATGAACTGTGGG-3'(SEQ ID NO 6); and MM22:
5'-ATAACATAGTACAGCG-3' (SEQ ID NO 7). This probe is composed of nt
25-160 of the per5 cDNA clone and includes 27 bp of the 5'
untranslated sequence, the entire coding sequence for the putative
endoplasmic reticulum signal peptide and 7 bp which code for the
amino-terminus of the putative per5 mature domain.
[0144] Using the per5 cDNA full length probe two strong
hybridization signals were detected in each digest. This suggested
that the per gene may be present in two copies per haploid genome.
However, using GSP5 as a probe only one band per lane was detected
which suggested that there is only one copy of the per5 gene per
haploid genome and that the other hybridizing band on the genomic
DNA blot corresponds to more distantly related sequences. This also
demonstrated that probe GSP5 was gene specific and would be
suitable for the isolation of the peroxidase genomic clone from a
maize genomic library.
[0145] B. Isolation of the Root-Preferential Cationic Peroxidase
Gene from a Maize W22 Library.
[0146] Approximately 2.times.10.sup.6 plaques of a maize W22
genomic library (Clontech Laboratories, Inc., Palo Alto, Calif.)
were screened using GSP5 as the probe according to standard
protocol for library screening. GSP5 was used as probe because it
would recognize only the genomic clones corresponding to the per5
cDNA clone. Ten genomic clones were isolated and plaque purified.
The clones were plate amplified to increase their titers, liquid
lysates were grown up and phage DNA was isolated from these
cultures. Restriction analysis on nine of the ten clones using
SalI, which liberates the genomic DNA inserts from the phage arms,
showed that eight of the nine clones had the same SalI banding
pattern. These eight clones contained .about.14.9 Kb inserts which
could be cut into two SalI fragments of .about.10.4 Kb and
.about.4.5 Kb, respectively. The ninth clone (perGEN19) contained
an .about.15.6 Kb insert which upon SalI digestion yields two
fragments, .about.13.1 Kb and .about.2.5 Kb in size. Restriction
and DNA hybridization analysis suggest that perGEN19 contains an
insert which overlaps with the Sau3A inserts of the other 8 clones.
A representative of the eight identical genomic clones (perGEN1)
was further analyzed. The .about.10.4 Kb fragment was subcloned
into the SalI site of the plasmid pBluescript.RTM. II SK(-)
(Stratagene, Inc.) generating plasmid perGEN1(10.44). Restriction
digests (using ApaI, BamHI, EcoRI, HindIII, KpnI, NcoI, SacI, and
XbaI) and DNA blot hybridization analyses (using either the
full-length per5 cDNA or GSP5 as probes) indicated that the 10.44
Kb SalI fragment on perGEN1 contained the peroxidase sequences.
Further restriction digests using single and double digests of
HindIII, KpnI, SacI, and XbaI and DNA blot hybridization analyses
using gel-purified KpnI perGEN1(10.44) fragments as probes was
performed on perGEN1(10.44).
EXAMPLE 5
Sequence of the Maize Root-Preferential Cationic Peroxidase
Gene
[0147] A total of 6550 nt of genomic sequence covering the maize
root-preferential cationic peroxidase gene and its 5' and 3'
flanking sequences was obtained by sequencing overlapping
subfragments of plasmid perGEN1(10.44) which hybridized with the
GSP5 probe described in Example 3 as well as the per5 cDNA insert.
The sequence is shown in SEQ ID NO 1. The sequencing procedures
were standard techniques known to those skilled in the art. The
upstream flanking region from the 5'-most NcoI site to the putative
start site of translation was determined to be 4200 nt in length.
The maize root-preferential cationic peroxidase gene is composed of
exons: exon 1 (225 bp), exon 2 (192 bp), exon 3 (166 bp), and exon
4 (416 bp). The GC-content of the exons is 54.7%. The sequence of
the compiled exon sequences was 100% identical to that of the
coding region for the per5 cDNA. Translation of these exons
resulted in a deduced protein sequence that is 100% identical to
the deduced protein sequence for the per5 cDNA sequence. Three
introns were found: intron 1 (633 bp, % AU=62.7, % U=33.8), intron
2 (132 bp, % AU=63.6, % U=35.6), and intron 3 (101 bp, % AU=65.3, %
U=37.6). The downstream flanking region from the UGA codon to the
3' most XbaI site was found to be 373 bp in length. The intron
splice sites did not fit the putative monocot 5' and 3' splice site
consensus sequences perfectly, but did follow the mammalian "GU/AG
rule" for splice sites. The intron sequences also conformed to the
definition of maize intron sequences suggested by Walbot. See
Walbot et al. (1991).
EXAMPLE 6
pDAB 406
[0148] This Example describes pDAB 406, a vector designed for
testing of promoter activity in both transient and stable
transformation experiments. The complete sequence for pDAB 406 is
given in SEQ ID NO 8. With reference to SEQ ID NO 8, significant
features of pDAB 106 are given in Table 1.
1TABLE 1 Features of pDAB 406 nt (SEQ ID NO 3) Features 1-6 ApaI
site 7-24 multiple cloning site (NheI, KpnI, SmaI) 25-30 SalI site
32-1840 E. coli uidA reporter gene encoding the beta-glucuronidase
protein (GUS) from pKA882 and TGA stop codon 1841-1883 3'
untranslated region from pBI221 1894-1899 SstI site 1900-2168
nopaline synthetase 3' polyA sequence (nos 3'UTR) 2174-2179 HindIII
site 2180-2185 BglII site 2186-2932 a modified CaMV 35S promoter
2195-2446 MCASTRAS nt 7093-7344 2455-2801 MCASTRAS nt 7093-7439
2814-2932 Synthetic Maize Streak Virus (MSV) untranslated leader
containing the maize Adh1 intron 1 2933-2938 BglII/BclI junction
2933-3023 Adh1.S nt 269-359 MZEADH1.S 3024-3141 Adh1.S nt 704-821
MZEADH1.S 3146-3151 BamHI/Bg/II junction 3150-3187 synthetic MSV
leader containing the maize Adh1 intron 1 3188-3193 NcoI 3190-4842
internal reference gene composed of the firefly luciferase gene
(Lux) 4907-5165 nopaline synthetase 3' polyA sequence (nos 3'UTR)
5172-5177 BglII site 5178-5183 NdeI site 5186-5191 SstI site
5195-5672 nt 6972-6495 MCASTRAS (CaMV 35S promoter) 5680-6034 nt
7089-7443 MCASTRAS (CaMV 35S promoter) 6042-7021 Tn5 nt 1539-2518;
mutated 2X 6054-6848 a selectable marker gene composed of the
bacterial NPTII gene encoding neomycin phosphotransferase which
provides resistance to the antibiotics kanamycin, neomycin and G418
7022-7726 3' UTR of ORF26 gene Agrobacterium tumifaciens Ti plasmid
(pTi 15955. nt 22438 to 21726) 7727-7732 NdeI site 7733-7914 pUC19
nt 1-182, reverse complement 7915-10148 nt 453 to 2686 pUC19,
reverse complement 10149-10160 multiple cloning site, HindIII,
SstI
[0149] The vector can readily be assembled by those skilled in the
art using well known methods.
EXAMPLE 7
pDAB 411
[0150] This Example describes plasmid pDAB 411, which is a 11784 bp
plasmid that has a pUC19 backbone and contains a gene cassette
comprising 1.6 kb of per5 promoter, the per5 untranslated leader,
the GUS gene, and the nos 3' UTR. No intron is present in the
untranslated leader of pDAB 411. The complete sequence for pDAB 411
is given in SEQ ID NO 9. With reference to SEQ ID NO 9, significant
features of pDAB 411 are given in Table 2.
2TABLE 2 Significant Features of pDAB 411 nt (SEQ ID NO 9) Feature
1-6 ApaI site 7-1648 Per5 promoter and untranslated leader sequence
(corresponding to nt 2559 to 4200 of SEQ ID NO 1) 1649-1654 SalI
site 1656-3464 E. coli uidA reporter gene encoding the
beta-glucuronidase protein (GUS) 3465-3507 3' untranslated region
from pBI221 3518-3523 SstI site 3524-3792 nopaline synthetase 3'
polyA sequence (nos 3'UTR) 3793-11784 corresponds to 2169 to 10160
of pDAB 406 SEQ ID NO 8
[0151] Preliminary testing of pDAB 411 in transgenic maize plants
failed to demonstrate appreciable GUS expression. This failure is
consistent with our discovery that certain tissue preferential
maize promoters require the presence of an intron in the
transcribed portion of the gene for significant expression to be
observed.
EXAMPLE 8
pDAB 419
[0152] This Example describes construction of Plasmid pDAB 419,
which is a 11991 bp plasmid that is identical to pDAB 411, except
that the untranslated leader preceding the GUS gene includes a 207
bp sequence comprising a deleted version the maize Adh1 intron 1.
The complete sequence for pDAB 419 is given in SEQ ID NO 10. With
reference to SEQ ID NO 10, critical features of pDAB 419 are as
follows:
3TABLE 3 Critical Features of pDAB 419 nt (SEQ ID NO 10) Feature
1-6 ApaI site 7-1648 Per5 promoter and untranslated leader sequence
(corresponding to nt 2559 to 4200 of SEQ ID NO 1) 1649-1855 deleted
version of maize Adh1 intron 1 corresponding to nt 2939-3145 of SEQ
ID NO 8 1856-1861 SalI site 1863-3671 E. coli uidA reporter gene
encoding the beta- glucuronidase protein (GUS) 3672-3714 3'
untranslated region from pBI221 3725-3730 SstI site 3731-3999
nopaline synthetase 3' polyA sequence (nos 3'UTR) 4000-11991
corresponds to 2169 to 10160 of pDAB 406 SEQ ID NO 8
[0153] Plasmid pDAB 419 was constructed from pDAB 411 using
conventional techniques. More specifically, the per5 promoter in
plasmid pDAB411 was amplified with primers MM88:
5'-ACGTACGTACGGGCCCACCACTGTTGTAACT TGAAGCC-3' (SEQ ID NO 11) and OF
192: 5' AGGCGGACCTTTGCACTGTGA GTTACCTTCGC-3'(SEQ ID NO 12). The
modified Adh1 intron 1, corresponding to nt 2939 to 3145 of SEQ ID
NO 8, was amplified from plasmid pDAB406 using primers OF190:
5'-CTCTGTCGACGAGCGCAGCTGCAC GGGTC-3'(SEQ ID NO 13) and OF191:
5'-GCGAAGGTAACTCACAGTGCA AAGGTCCGCCT-3' (SEQ ID NO 14). Following
amplification both fragments were purified through a 1% agarose
gel. Splice Overlap Extension PCR was used to join the per5
promoter fragment to the Adh1 intron 1 fragment. Samples (2.5
.mu.L) of each gel-purified fragment were mixed and re-amplified
using primers MM88 and OF192 (SEQ ID NOS 11 and 12). The resulting
1.6 kB per5adh fragment was digested with ApaI and SalI,
gel-purified, and ligated into pDAB406 which was digested with ApaI
and SalI resulting in an 11,991 bp plasmid, pDAB419.
EXAMPLE 9
Transformation of Rice with pDAB 419
[0154] This example describes transformation of rice with pDAB 419,
and the histochemical and quantitative patterns of GUS expression
in the transformed rice plants.
[0155] A. Transgenic Production.
[0156] 1. Plant Material and Callus Culture.
[0157] For initiation of embryogenic callus, mature seeds of a
Japonica cultivar, Taipei 309 were dehusked and surface-sterilized
in 70% ethanol for 2-5 min. followed by a 30-45 min soak in 50%
commercial bleach (2.6% sodium hypochlorite) with a few drops of
`Liquinox` soap. The seeds were then rinsed 3 times in sterile
distilled water and placed on filter paper before transferring to
`induction` media (NB). The NB medium consisted of N6 macro
elements (Chu, 1978), B5 micro elements and vitamins (Gamborg et
al., 1968), 300 mg/L casein hydrolysate, 500 mg/L L-proline, 500
mg/L-glutamine, 30 g/L sucrose, 2 mg/L 2,4dichloro-phenoxyacetic
acid (2,4D), and 2.5 g/L Gelrite (Schweizerhall, N.J.) with a pH
adjusted to 5.8. The mature seed cultured on `induction` media were
incubated in the dark at 28.degree. C. After 3 weeks of culture,
the emerging primary callus induced from the scutellar region of
mature embryo was transferred to fresh NB medium for further
maintenance.
[0158] 2. Plasmids and DNA Precipitation.
[0159] pDAB354 containing 35T-hpt (hygromycin phosphotransferase
providing resistance to the antibiotic hygromycin; (described in
Example 25) was used in cotransformations with pDAB 419. About 140
.mu.g of DNA was precipitated onto 60 mg of gold particles. The
plasmid DNA was precipitated onto 1.5-3.0 micron (Aldrich Chemical
Co., Milwaukee, Wis.) or 1.0 micron (Bio-Rad) gold particles. The
precipitation mixture included 60 mg of pre-washed gold particles,
300 .mu.L of water/DNA (140 .mu.g), 74 .mu.L of 2.5 M CaCl.sub.2,
and 30 .mu.L of 0.1 M spermidine. After adding the components in
the above order, the mixture was vortexed immediately, and allowed
to settle for 2-3 min. Then, the supernatant was pipetted off and
discarded. The DNA-coated gold particles were resuspended in 1 mL
of 100% ethanol and diluted to 17.5 .mu.g DNA/7.5 mg gold per mL of
ethanol for use in blasting experiments.
[0160] 3. Helium Blasting into Embryogenic Callus and
Selection.
[0161] Actively growing embryogenic callus cultures, 2-4 mm in
size, were subjected to a high osmoticum treatment. This treatment
included placing of callus on NB medium with 0.2 M mannitol and 0.2
M sorbitol (Vain et al., 1993) for 4 hrs before helium blasting.
Following osmoticum treatment, callus cultures were transferred to
`blasting` medium (NB+2% agar) and covered with a stainless steel
screen (230 micron). Helium blasting involved accelerating the
suspended DNA-coated gold particles towards and into the prepared
tissue targets. The device used was an earlier prototype to the one
described in U.S. Pat. No. 5,141,131 which is incorporated herein
by reference, although both function in a similar manner. The
callus cultures were blasted at different helium pressures
(1,750-2,250 psi) once or twice per target. After blasting, callus
was transferred back to the media with high osmoticum overnight
before placing on selection medium, which consisted of NB medium
with 30 mg/L hygromycin. After 2 weeks, the cultures were
transferred to fresh selection medium with higher concentrations of
selection agent, i.e., NB+50 mg/L hygromycin (Li et al., 1993).
[0162] 1. Regeneration.
[0163] Compact, white-yellow, embryogenic callus cultures,
recovered on NB+50 mg/L hygromycin, were regenerated by
transferring to `pre-regeneration` (PR) medium+50 mg/L hygromycin.
The PR medium consisted of NB medium with 2 mg/L 6-benzlaminopurine
(BAP), 1 mg/L naphthaleneacetic acid (NAA), and 5 mg/L abscisic
acid (ABA). After 2 weeks of culture in the dark, they were
transferred to `regeneration` (RN) medium. The composition of RN
medium is NB medium with 3 mg/L BAP, and 0.5 mg/L NAA. The cultures
on RN medium were incubated for 2 weeks at 28.degree. C. under high
fluorescent light (325-ft-candles). The plantlets with 2 cm shoot
were transferred to 1/2 MS medium (Murashige and Skoog, 1962) with
1/2 B5 vitamins, 10 g/L sucrose, 0.05 mg/L NAA, 50 mg/L hygromycin
and 2.5 g/L Gelrite adjusted to pH 5.8 in magenta boxes. When
plantlets were established with well-developed root system, they
were transferred to soil (1 metromix: 1 top soil) and raised in a
growth chamber or greenhouse (29/24.degree. C. day/night cycle,
50-60% humidity, 12 h photoperiod) until maturity. A total of 23
hygromycin-resistant callus lines were established.
[0164] B. GUS Histochemical Assays
[0165] GUS histochemical assays were conducted according to
Jefferson (1987). Tissues were placed in 24-well microtitre plates
(Corning, New York, N.Y.) containing 500 .mu.L of assay buffer per
well. The assay buffer consisted of 0.1 M sodium phosphate (pH
8.0), 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide,
10 mM sodium EDTA, 1.9 mM
5-bromo-4-chloro-3-indolyl-beta-D-glucuronide, and 0.06% triton
X-100. The plates were incubated in the dark for 1-2 days at
37.degree. C. before observations under a microscope. Fourteen of
the 23 hygromycin resistant rice lines expressed the GUS gene as
evidenced by blue staining after 48 hours in the GUS histochemical
assay. Nine of the 14 GUS expressing lines were further
characterized (Table 4).
4TABLE 4 Histochemical GUS Staining of Transgenic Rice Callus Line
Rating 354/419-03 ++++ 354/419-04 ++++ 354/419-07 ++++ 354/419-11
+++ 354/419-12 ++ 354/419-13 +++ 354/419-15 ++ 354/419-18 +++
354/419-21 ++ + = Occasional blue region ++ = Light blue staining
throughout +++ = Dark blue regions ++++ = Intense blue staining
throughout
[0166] C. Southern Analysis
[0167] Southern analysis was used to identify primary regenerate
(Ro) plant lines from rice that contained an intact copy of the
transgene and to measure the complexity of the integration event.
Several leaves from each rice plant were harvested and up to five
plants were sampled individually from each line. Genomic DNA from
the rice Ro plants was prepared from lyophilized tissue as
described by Saghai-Maroof et al. (1984). Eight micrograms of each
DNA was digested with the restriction enzyme, XbaI using conditions
suggested by the manufacturer (Bethesda Research Laboratory,
Gaithersburg, Md.) and separated by agarose gel electrophoresis.
The DNA was blotted onto nylon membrane as described by Southern
(1975, 1980).
[0168] A probe specific for .beta.-glucuronidase (GUS) coding
region was excised from the pDAB419 plasmid using the restriction
enzymes NcoI and SstI. The resulting 1.9 kb fragment was purified
with the Qiaex II DNA purification kit (Qiagen Inc., Chatsworth,
Calif.). The probe was prepared using an oligo-labeling kit
(Pharmacia LKB, Piscataway, N.J.) with 50 microcuries of
.alpha..sup.32P-dCTP (Amersham Life Science, Arlington Heights,
Ill.). The GUS probe hybridized to the genomic DNA on the blots.
The blots were washed at 60.degree. C. in 0.25.times.SSC and 0.2%
SDS for 45 minutes, blotted dry and exposed to XAR-5 film overnight
with two intensifying screens.
[0169] D. GUS Quantification
[0170] 1. Tissue Preparation.
[0171] Histochemically GUS positive plantlets, grown in Magenta
boxes, were dissected into root and leaf tissues. Duplicate samples
of approximately 300 mg root and 100 mg leaf were transferred to a
1.5 ml sterile sample tube (Kontes, Vineland, N.J.) and placed on
ice prior to freezing at -80.degree. C. Extraction of proteins
consisted of grinding tissue using a stainless steel Kontes Pellet
Pestle powered by a 0.35 amp, 40 Watt motor (Model 102. Rae Corp.,
McHenry, Ill.), at a setting of "40". GUS Lysis buffer from the
GUS-Light.TM. assay kit (Tropix, Bedford, Mass.) was modified with
the addition of 20% glycerol to produce the extraction buffer.
Before grinding, frozen samples were placed on ice and aliquots of
100 .mu.l extraction buffer were added to the sample tube. Tissue
was homogenized in approximately four 25-second intervals during
which additional aliquots of extraction buffer were added for a
final volume of 300 .mu.l for root and 200 .mu.l for leaf tissues.
Samples were maintained on ice until all sample grinding was
completed. Samples were then centrifuged twice at 5.degree. C. for
8 minutes at full speed (Eppendorf Centrifuge Model 5415).
Supernatant was transferred to sterile microcentrifuge tubes on ice
and later used to quantitate proteins and GUS; the pellet was
discarded.
[0172] 2. Total Protein Quantification.
[0173] Quantification of extractable proteins was determined with
the Bio-Rad Protein Assay kit (Bio-Rad Laboratories, Hercules,
Calif.). A protein standard made from bovine albumin (Sigma, St.
Louis. Mo.) was used to obtain a standard curve from zero to 10
.mu.g/ml. Duplicate samples for each tissue were prepared using 5
.mu.l of protein extract with 5 .mu.l GUS lysis buffer in a
sterilized microcentrifuge tube. Water was added to bring the
volume up to 800 .mu.l before 200 .mu.l dye reagent was added.
Tubes were vortexed, then incubated at room temperature for at
least 5 minutes before the liquid was transferred into 1.5 ml
cuvetts and place in the spectrophotometer (Shimadzu, Japan).
Absorbance measurements were made at 595 nm.
[0174] 3. GUS Quantification.
[0175] Analysis of GUS activity required the use of the GUS-Lights
assay kit and an automatic luminescence photometer (Model 1251
Luminometer and Model 1291 Dispenser, Bio-Orbit, Finland). For each
sample, a relative level of GUS activity was measured on 1 .mu.l
extract. From the initial reading, sample volumes were scaled up
between 2 and 10 .mu.l of extract per luminometer vial while
remaining within the detection limits of the equipment. Samples
were prepared in triplicate to which 180 .mu.l aliquots of
GUS-Light.TM. reaction buffer was added to each luminometer vial at
10-second intervals. After a one hour incubation at room
temperature in the dark, the vials were loaded into the sample
holder of the luminometer. As each vial entered the measuring
chamber, 300 .mu.l of GUS-Light.TM. Light Emission Accelerator
Buffer was added and luminescence was detected over a 5-second
integration period. A "blank reaction" was included in the assay,
using 10 .mu.l of the GUS extraction buffer. A GUS standard,
prepared to read 8,000 relative light units (RLU) prom commercially
available .beta.-glucuronidase (Sigma, Mo.), was used to confirm
the sensitivity of the equipment and reagents used. GUS readings
(RLU) were corrected for the "blank" and the GUS standard readings
before dividing by .mu.g total protein.
[0176] Rice plants regenerated from transgenic callus stained
positively for GUS in both roots and leaves indicating constitutive
expression. It was not expected that constitutive expression of GUS
would be observed from the pDAB419 construct because of the lack of
expression in the leaves of the native per5 gene in maize.
EXAMPLE 10
Transformation of Maize with pDAB 419
[0177] A. Establishment of Type 11 Callus Targets.
[0178] Two parents of `High II` (Armstrong and Phillips, (1991))
were crossed and when the developing embryos reached a size of
1.0-3.0 mm (10-14 days after pollination), the ear was excised and
surface sterilized. Briefly, ears were washed with Liquinox soap
(Alconox, Inc., N.Y.) and subjected to immersions in 70% ethanol
for 2-5 minutes and 20% commercial bleach (0.1% sodium
hypochlorite) for 30-45 minutes followed by 3 rinses in sterile,
distilled water. Immature embryos were isolated and used to produce
Type II callus.
[0179] For Type II callus production, immature embryos were placed
(scutellum-side up) onto the surface of `initiation medium (15
Ag10) which included N6basal salts and vitamins (Chu. 1978), 20 g/L
sucrose. 2.9 g/L L-proline, 100 mg/L enzymatic casein hydrolysate
(ECH), 37 mg/L Fe-EDTA, 10 mg/L silver nitrate, 1 mg/L
2,4-dichloro-phenoxyacetic acid (2,4-D), and 2.5 g/L Gelrite
(Schweizerhall, N.J.) with pH adjusted to 5.8. After 2-3 weeks
incubation in the dark at 28.degree. C., soft, friable callus with
numerous globular and elongated somatic embryo-like structures
(Type II) were selected. After 2-3 subcultures on the `initiation`
medium, callus was transferred to `maintenance` medium (#4). The
`maintenance` medium differed from the `initiation` medium in that
it contained 690 mg/L L-proline and no silver nitrate. Type II
callus was used for transformation experiments after about 16-20
weeks.
[0180] B. Helium Blasting and Selection.
[0181] pDAB367 (Example 27) and pDAB419 were co-precipitated onto
the surface of 1.5-3.0 micron gold particles (Aldrich Chem. Co.,
Milwaukee, Wis.). pDAB367 contains a phosphinothricin acetyl
transferase gene fusion which encodes resistance to the herbicide
Basta..TM. This gene is used to select stable transgenic events.
The precipitation mixture included 60 mg of pre-washed gold
particles. 140 .mu.g of plasmid DANA (70 .mu.g of each) in 300
.mu.L of sterile water, 74 .mu.L of 2.5 M CaCl.sub.2, and 30 .mu.L
of 0.1 M spermidine. After adding the components in the above
order, the mixture was vortexed immediately, and allowed to settle
for 2-3 minutes. The supernatant was removed and discarded and the
plasmid/gold particles were resuspended in 1 mL of 100% ethanol and
diluted to 7.5 mg plasmid/gold particles per mL of ethanol just
prior to blasting.
[0182] Approximately 400-600 mg of Type [I callus was placed onto
the surface of #4 medium with 36.4 g/L sorbitol and 36.4 g/L M
mannitol for 4 hours. In preparation for blasting, the callus was
transferred to #4 medium with 2% agar (JRH Biosciences, Lenexa,
Kans.) and covered with a stainless steel screen (104 micron).
Helium blasting was completed using the same device described in
Example 9. Each callus sample was blasted a total of four times.
After blasting the callus was returned to #4 medium with 36.4 g/L
sorbitol and 36.4 g/L mannitol for 18-24 hours after which it was
transferred to `selection` medium (#4 medium with 30 mg/L Basta.TM.
and no ECH or L-proline). The callus was transferred to fresh
`selection` medium every four weeks for about three months. After
8-12 weeks, actively growing transgenic colonies were isolated and
sub-cultured every two weeks on fresh `selection` medium to bulk-up
callus for regeneration.
[0183] C. Histochemical GUS Assay.
[0184] Basta.TM.-resistant callus was analyzed for GUS expression
by incubating a 50 mg sample in 150 .mu.L of assay buffer for 48
hours at 37.degree. C. The assay buffer consisted of 0.2 M sodium
phosphate pH 8.0, 0.5 mM each of potassium ferricyanide and
potassium ferrocyanide, 10 mM sodium EDTA, 1.9 mM
5-bromo-4-chloro-3-indolyl-b-D-glucuronide, and 0.06% v/v Triton
x-100 (Jefferson et al., 1987). Transgenic callus expressing the
GUS gene turned blue. A total of 17 Basta.TM.-resistant callus
lines were established for maize, with three maize lines expressing
the GUS gene as evidenced by blue staining after 48 hours in the
GUS histochemical assay.
5TABLE 6 Histochemical GUS Staining of Transgenic Maize Callus Line
rating 311/419-01 + 311/419-02 +++ 311/419-16 +++ + = Occasional
blue region ++ = Light blue staining throughout +++ = Dark blue
regions ++++ = Intense blue staining throughout
[0185] There was considerable variability in intensity of staining
among the expressing callus ranging from very intense to somewhat
spotty (Table 6). Generally, callus staining was more intense in
rice than in maize.
[0186] D. Plant Regeneration.
[0187] GUS-expressing callus was transferred to `induction` medium
and incubated at 28.degree. C., 16/8 light/dark photoperiod in low
light (13 mE/m.sup.2/sec) for one week followed by one week in high
light (40 mE/m.sup.2/sec) provided by cool white fluorescent lamps.
The `induction` medium was composed of MS salts and vitamins
(Murashige and Skoog (1962)), 30 g/L sucrose, 100 mg/L
myo-inositol, 5 mg/L 6-benzylamino purine, 0.025 mg/L 2,4D, 2.5 g/L
Gelrite (Schweizerhall, N.J.) adjusted to pH 5.7. Following this
two-week induction period, the callus was transferred to
`regeneration` medium and incubated in high light (40
mE/m.sup.2/sec) at 28.degree. C. The `regeneration` medium was
composed of MS salts and vitamins, 30 g/L sucrose, and 2.5 g/L
Gelrite (Schweizerhall., N.J.) adjusted to pH 5.7. The callus was
sub-cultured to fresh `regeneration` medium every two weeks until
plantlets appeared. Both `induction` and `regeneration` medium
contained 30 mg/L Basta.TM.. Plantlets were transferred to 10 cm
pots containing approximately 0.1 kg of dry Metro-Mix (The Scotts
Company, Marysville, Ohio), moistened thoroughly, and covered with
clear plastic cups for approximately 4 days. At the 3-5 leaf stage,
plants were transplanted to 5-gallon pots and grown to
maturity.
[0188] E. Southern Analysis
[0189] A DNA probe specific for the .beta.-glucuronidase (GUS)
coding region was excised from the pDAB418 plasmid using the
restriction enzymes NcoI and SstI. The 1.9 kb fragment was purified
with the Qiaex II DNA purification kit (Qiagen Inc., Chatsworth,
Calif.). The probe was prepared using an oligo-labeling kit
(Pharmacia LKB, Piscataway, N.J.) with 50 microcuries of
a.sup.32P-dCTP (Amersham Life Science, Arlington Heights, Ill.).
Southern analysis was used to identify maize callus material that
contained an intact copy of the transgene and to measure the
complexity of the integration event. The callus material was
removed from the media, soaked in distilled water for 30 minutes
and transferred to a new petri dish, prior to lyophilization.
Genomic DNA from the callus was prepared from lyophilized tissue as
described by Saghai-Maroof et al. (1984). Eight micrograms of each
DNA was digested with the restriction enzyme XbaI using conditions
suggested by the manufacturer (Bethesda Research Laboratory,
Gaithersburg, Md.) and separated by agarose gel electrophoresis.
The DNA was blotted onto nylon membrane as described by Southern
(1975, 1980). The GUS probe was hybridized to the genomic DNA on
the blots. The blots were washed at 60.degree. C. in 0.25.times.SSC
and 0.2% SDS for 45 minutes, blotted dry and exposed to XAR-5 film
overnight with two intensifying screens.
[0190] F. Screening of R.sub.0 Plants for Uniform Expression.
[0191] The 6th leaf was collected from five or six "V6-equivalent"
stage plants (because of inability of determining exact leaf number
from RO plants, a plant characteristic of the V6 stage was used).
The entire leaf was removed, cut into pieces and stored in a
plastic bag at -70.degree. C. until further processing. Leaves were
powdered in liquid nitrogen and tissues samples representing
approximately 400 .mu.L of tissue were placed in microfuge tubes.
The tissue was either stored or extracted immediately. GUS was
extracted by mixing the powdered tissue with GUS Lysis Buffer
(Jefferson, 1987) as modified by the addition of 1%
polyvinylpyrrolidone (hydrated in the buffer for at least one
hour), 20% glycerol, 50 mg/mL antipain, 50 mg/mL leupeptin, 0.1 mM
chymostatin, 5 mg/mL pepstatin and 0.24 mg/mL Pefabloc.TM.
(Boehringer Mannheim, Indianapolis, Ind.). After incubation on ice
for at least 10 min, the samples were centrifuged at 16,000 g for
10 min. The supernatants were recovered and centrifuged a second
time as described above. The supernatants were recovered and frozen
on dry ice and stored at -70.degree. C. Experiments showed that GUS
activity was stable for at least 4 freeze-thaw cycles when stored
in the buffer described above. GUS activity was measured using a
GUS-Light.TM. kit (Tropix, Inc. Bedford, Mass.). Five .mu.L samples
of undiluted extract or of extract diluted so that the luminescence
was within the range measured by the luminometer was added to 195
.mu.l of the GUS-Light.TM. Reaction Buffer. After 1 hr the
luminescence was measured using a BioOrbit 1251 luminometer
equipped with a BioOrbit 1291 injector after injection of 300 .mu.L
of GUS-Light.TM. Accelerator. Luminescence was integrated for 5 sec
after a 5 sec delay. Protein was measured with the assay developed
by Bradford (1976) using human serum albumin as the standard.
[0192] G. Organ-Specific Expression Quantitative Analyses.
[0193] Plants grown in the greenhouse in 5 gallon pots were
harvested to determine organ-specificity of GUS expression. Prior
to harvesting tissue from V6-equivalent plants, roots were cut
approximately one inch from the side of the pot to remove any dead
root tissue. Roots from VT stage (mature) plants were washed and
any dead root tissue was removed before freezing at -70.degree. C.
Leaves, stems (VT-stage plants only) and roots were harvested and
either frozen at -70.degree. C. or powdered in liquid nitrogen
immediately. Experiments showed that GUS is stable in frozen
tissue. After powdering the tissues, three aliquots of
approximately 10 ml of tissue were collected into preweighed tubes,
and the tubes with tissue weighed and stored at -70.degree. C.
Tissue was extracted in the same buffer as described above except
protease inhibitors were only added to aliquots of the extracts
instead to the entire extract volume. For extraction, the powdered
tissues were thawed into 4 ml buffer/g tissue and homogenized for
5-10 sec at 8,000 rpm using a Ultra-Turrax T 25 (IKA-Works, Inc.)
homogenizer with an 18 mm probe. The samples were centrifuged at
4.degree. C. for 5 min at 2015 g. After removing the supernatants,
the pellets were extracted again but with 2 ml buffer/g tissue and
the supernatant after centrifugation was pooled with the
supernatant from the first extraction. The pellet was extracted
again with 2 ml/g tissue; the supernatant after centrifugation was
processed separately from the pooled supernatants from the first
two extractions. GUS activity recovered in the final extract was
used to determine extraction efficiency of the first two
extractions. GUS and protein assays were done as described above
for both sets of supernatants. Roots at each node from V7 plants
grown in approximately 15 gallon pots were analyzed separately as
described above.
[0194] H. Histochemical Analyses Staining of Maize Tissues.
[0195] Histochemical analyses of per5adh/GUS/nos gene expression
was done essentially as described by Jefferson (1987). Roots were
first treated 1 h at 37.degree. C. in 100 mM NaPO.sub.4 buffer, pH
7.0. 10 mM EDTA, 0.1% Triton X-100 and 10 mM
.beta.-mercaptoethanol. The root sections were washed 3 times with
the same buffer but without .beta.-mercaptoethanol and then
incubated 1 hr in the same buffer at 37.degree. C. GUS
histochemical assay buffer Jefferson (1987) was added and the
tissues were incubated for various times at 37.degree. C. Roots
from V6 and VT plants were removed from each node and treated
separately. Roots from each node of V6 plants were measured, cut
into 6 equal parts, and 2-one centimeter pieces were removed from
the ends of each root section. One root piece from each section was
stained until the ends were blue: the other piece from each section
was stained overnight. Roots from VT plants were stained similarly,
but two roots from each node, if available, were cut into several
pieces and stained together. One root from each node was stained
until the roots turned blue; the other root from each node was
stained overnight. One intact leaf was removed from the bottom,
middle and top of the V6 and VT plants and analyzed. The leaves
were cut lengthwise. The leaf half containing the midrib was
transversely cut at intervals across the midrib and along the outer
edge of the leaves. The leaves were vacuum infiltrated with GUS
histochemical assay buffer and incubated at 37.degree. C. until
stained regions were visible. Chlorophyll was removed by incubation
in 70% ethanol at room temperature. Pieces of stems that included a
node and adjacent internodal regions were cut from the bottom,
middle and top sections of VT plants. Cross sections of the
internodal regions and longitudinal sections that included the node
and internodal regions above and below the node were stained. One
longitudinal and one cross sectional piece of each stem region
analyzed was stained until blue was visible; another set of stem
pieces was stained overnight. After staining, the stem pieces were
placed in 70% alcohol to remove chlorophyll. Pollen was collected
from transgenic per5adh/GUS/nos plants for 2 hr from tassels from
which all extruded anthers were removed. Pollen was stained
overnight. Kernels were analyzed 20 days post-pollination from
crosses done in which the transgenic plant was the male parent and
from crosses in which the transgenic plant was the female parent.
The kernels were dissected longitudinally through the embryo.
[0196] I. Screening of R.sub.0 Plants for Uniform Expression.
[0197] To define the spatial and temporal expression patterns of a
promoter of interest, the expression pattern of a transgene must
not be affected by its chromosomal location. Evidence suggests that
transgene expression can be "silenced" non-uniformly in different
parts of plants, resulting in spatial and temporal expression
patterns that do not represent the true promoter activity in
transgenic plants. Gene silencing often occurs stochastically,
occurring to different extents in individuals within a population
(reviewed by Matzke et al. (1993)). All transformation events were
screened for uniform expression among five or six R.sub.0 plants
for each event (Table 7), thus eliminating transformation events
that display silencing of the transgene in a population of this
size. GUS expression among R.sub.0 plants analyzed for each of
three transformation events reported here were statistically
indistinguishable.
6TABLE 7 Expression of GUS with pDAB 419 in Individual R.sub.0
Plants in Three Transformation Events TRANSFORMATION EVENTS
308/419-01.sup.a 419-02 419-16 Relative Relative Relative Light
Light Light Units/mg Standard Units/mg Standard Units/mg Standard
Protein Deviation.sup.b Protein Deviation.sup.b Protein
Deviation.sup.b 24973 853 5261 562 1011 97 23811 641 4537 381 1039
14 29747 5055 573 1213 9 24081 614 5743 137 942 12 25729 199 4645
315 1367 57 27025 1282 46 .sup.aonly one sample was analyzed for
some of the 308/419-01 plants .sup.bstandard deviations were
determined from independent analyses of two aliquots of tissue from
each plant
[0198] J. Quantitative Analyses of pDAB 419 Maize Plants.
[0199] Quantitative analyses of GUS activity was done at two
starves of core development: V6 (whorl stage) and VT (tassel
emergence). Entire leaf, stem or root samples were powdered and
duplicate aliquots were analyzed. GUS activity was determined
relative to either extracted protein concentration or to fresh
weight of tissue. The high percent recovery of GUS activity
indicates extraction procedure for GUS is efficient (Tables 8 and
9). The 308/419-01 and 419-02 plants are BC.sub.1 (crossed
consecutively with the same inbred twice) and R.sub.0 generations,
respectively. The per5adh promoter is expressed in root, stem (VT
plants) and leaf tissue (Tables 8 and 9). When normalized to
extractable protein, roots express higher levels of GUS than leaves
in V6 and VT plants; stem accumulates GUS at levels higher than
either leaves or roots in VT plants (Tables 8 and 9). GUS
expression normalized to fresh weight of tissue and expression
normalized to extractable protein levels follow similar trends of
organ-specificity of expression in VT plants, although the relative
proportions of expression among the organs are different. In V6
plants, the per5adh promoter expresses GUS at similar levels in
leaves and roots based on fresh weight of tissue, but the promoter
clearly expresses GUS higher in roots than in leaves when
expression is normalized to extractable protein.
7TABLE 8 Expression of Per5adh/GUS/nos in V6 Transgenic Plant
Organs Relative Relative Light Average Light Units/g Percent
Units/mg Standard Tissue Standard Extraction Plant Organ Protein
Deviation.sup.a (.div.1000) Deviation.sup.a Efficiency.sup.b
308/419-02 leaves 5,518 155 39,687 4,231 86.8 roots 15,496 2,918
33,155 7,620 91.1 419-02 leaves 3,256 111 23,367 1,704 85.8 roots
8,871 35 14,316 333 89.3 .sup.astandard deviations were determined
from independent analyses of two aliquots of tissue from each
sample .sup.bextraction efficiency was percent recovery of GUS
activity in the first two extractions relative to the total GUS
activity in all three extractions of the tissues
[0200]
8TABLE 9 Expression of Per5adh/GUS/nos in VT Transgenic Plant
Organs Relative Relative Light Average Light Units/g Percent
Units/mg Standard Tissue Standard Extraction Plant Organ Protein
Deviation.sup.a (.div.1000) Deviation.sup.a Efficiency.sup.b
308/419-02 leaves 2,915 177 30,426 1,567 87.3 stem 15,701 837
35,601 593 85.2 roots 10,197 351 15,393 310 82.8 419-02 leaves
2,319 15 18,112 1,305 86.7 stem 14,721 165 32,619 747 84.0 roots
3,923 734 6,473 814 83.1 .sup.astandard deviations were determined
from independent analyses of two aliquots of tissue from each
sample .sup.bextraction efficiency was percent recovery of GUS
activity in the first two extractions relative to the total GUS
activity in all three extractions of the tissues
[0201] The per5adh promoter activity was examined in detail in
roots. For these experiments. 308/419-01 plants were grown in 15
gallon pots to improve root quality. Roots at all nodes express
GUS, but the GUS activity/mg extractable protein increases in nodes
3-5 relative to expression in nodes 1 and 2 (Table 10).
9TABLE 10 Expression of GUS with pDAB 419 in Transgenic Plant Root
Nodes Relative Light Units/mg Root Node Protein Standard
Deviation.sup.a node 1 5,479 node 2 4,268 297.5 node 3 6,836 47.3
node 4 8,148 92.6 node 5 10,887 305.9 .sup.astandard deviations
were determined from independent analyses of two aliquots of tissue
from each sample; only one sample was available for node 1
[0202] K. Histochemical Analyses of pDAB 419 Maize Plants.
[0203] The per5adh promoter expresses GUS to levels that are
detectable in all tissues tested using the histochemical staining
procedure of Jefferson (1987) with the exception of kernels (but
only when the transgenic plant is used as a pollen donor) and
pollen. Roots at all nodes of these transgenic plants express GUS.
GUS is expressed over the entire length of the roots with the
exception that in at least some roots, the expression drops
dramatically at the distal end of the root. The loss of stainable
activity in the root ends is not due to technological limitations
of the protocol in that roots from transformation events expressing
transgenes driven by other promoters express highly in these
regions. The stem stains for GUS activity non-uniformly, with the
pith showing poor or no staining; the nodes and areas adjacent to
the outer edge of the stem stain. Most of the areas that stain
correspond to regions rich in vascular tissue. The blade, sheath
and the midrib of the leaves express GUS. Kernels do not display
any stainable activity in overnight incubations in GUS
histochemical staining solution when the kernels are from crosses
using the per5adh/GUS/nos plants as the pollen donor. However, when
the transgenic plant is used as the maternal parent in the cross,
GUS is expressed in the pericarp (seed coat) as well as a discrete
area of the embryo.
[0204] Expression patterns of maize plants transformed with pDAB419
were similar to the expression patterns observed in transgenic
rice. The per5 promoter/adh I intron combination appear to promote
a pattern of expression which is constitutive. That is, significant
expression is observed in both roots and leaves. This is unexpected
as the per 5 gene is natively root-preferentially expressed. This
result is consistent with the expression pattern that was observed
in rice.
EXAMPLE 11
PerGUS 16
[0205] PerGUS 16 is a plasmid containing 4 kb of per5 promoter, the
per5 untranslated leader sequence, the coding sequence for the
first five amino acids of per5, the GUS gene, and the nos 3'UTR.
The complete sequence of PerGUS 16 is given in SEQ ID NO 15. With
reference to SEQ ID NO 15, significant features of PerGUS 16 are
given in Table 11.
10TABLE 11 Significant Features of PerGUS 16 nt (SEQ ID NO 15)
Features 1-6 SstI site 37-42 BamHI site 43-48 SalI site 48-53 NcoI
site 48-4247 Per5 promoter nt 1-4200 at SEQ ID NO 1 and
untranslated leader 4248-4263 Per5 exon nt 4201-4215 of SEQ ID NO 1
4264-6068 .beta. glucuronidase gene (GUS) 6069-6111 untranslated
sequence from pBI221 6122-2127 SstI site 6122-6396 nos 3' UTR
6397-6407 linker 6402-6407 HindIII site 6408-9299 Bluescript .RTM.
II SK.sup.-
[0206] PerGUS16 is different from pDAB411 in that PerGUS16 includes
the coding sequence for the first 5 amino acids of the per5
protein. In addition PerGUS 16 contains 4 kB of upstream promoter
sequence, whereas pDAB4 1 only contains 2 kB of sequence. Neither
PerGUS 16 nor pDAB411 includes an intron in the untranslated
leader. PerGUS16 was constructed and tested in a transient maize
root expression assay as follows.
[0207] A. Construction of PerGUS 16.
[0208] A 4.0 kB NcoI fragment, containing 4 kB of upstream per5
sequence, the per5 untranslated leader sequence and the coding
sequence for the first 5 amino acids of per5, from perGEN1(10.4)
was purified from a 1.0% agarose gel using Qiagen kit. This 4.0 kB
promoter fragment was ligated into an NcoI site at the translation
initation start site of the GUS gene in pGUSnos12. pGUSnos12 is a
plasmid based on Bluescript.RTM. II SK.sup.- with an inserted
BamHI-HindIII fragment containing the coding region for the GUS
gene and the nos 3' UTR. The resultant translation fusion is PerGUS
16.
[0209] B. Expression Assay.
[0210] Results of testing PerGUS16 in a transient maize root
expression assay are given in Table 14.
EXAMPLE 12
PERGUSPER3
[0211] PERGUSPER3 is a plasmid containing 4 kb of per5 promoter,
the per5 untranslated leader sequence, the coding sequence for the
first five amino acids of per5, the GUS gene, and the per5 3' UTR.
The complete sequence of PERGUSPER3 is given in SEQ ID NO 16. With
reference to SEQ ID NO 16, critical features of PERGUSPER3 are as
follows:
11TABLE 12 Significant Features of PERGUSPER3 nt (SEQ ID NO 16)
Features 1-6 SstI site 1-42 Bluescript SK polylinker 37-42 BamHI
site 43-48 XbaI site 43-53 synthetic linker 54-59 NcoI site 54-4253
Per5 promoter nt 1-4200 SEQ ID NO 1 4254-4269 Per 5 exon nt
4201-4215 SEQ ID NO 1 4264-4269 NcoI site 4266-6074 .beta.
glucuronidase gene (GUS) 6075-6117 untranslated sequence from
pBI221 6135-6140 XhoI site 6140-6510 Pet5 3' UTR nt 6069-6439 SEQ
ID NO 1 6511-6516 HindIII site 6517-9408 Bluescript .RTM. II
SK.sup.-
[0212] PERGUSPER3 is identical to PerGUS 16 except for its 3' UTR.
PerGUS16 has the nos and PERGUSPER3 has the per5 3'UTR. Neither
PERGUSPER3 nor PerGUS 16 has an intron in the untranslated leader.
PERGUSPER3 was constructed and tested in a transient maize root
assay, in stable transformed rice callus, and in stable transformed
rice plants as follows.
[0213] A. Construction of PERGUSPER3
[0214] 1. BSGUSper4.
[0215] The 3' UTR from the per5 gene was amplified on a 396 bp
fragment (corresponding to bp 6069 to 6439 of SEQ ID NO 1 plus 26
bases of synthetic linker sequence) from the plasmid perGEN1(10.4)
using Amplitaq polymerase with buffers supplied and synthetic
primers,
12 TTATCTCGAGGGCACTGAAGTCGCTTGATGTGCTGAATT (SEQ ID NO 17) and
GGGGAAGCTTCTCTAGATTTGGATATATGCCGTGAACAATTG. (SEQ ID NO 18)
[0216] The 5' primer added an XhoI restriction site, and the 3'
primer included a HindIII site, to facilitate cloning. This
fragment contains a canonical AAUAAA poly-A addition signal at
position 247 (corresponding to bp 6306 of SEQ ID NO 1). The
amplification product was ligated into an XhoI/HindIII of plasmid
pDAB356/X note: The structure of plasmid pDAB356/X is not directly
relevant to the end result of this construction series. It was
constructed during an unrelated series, and was chosen because it
contained restriction recognition sites for XhoI and HindIII at the
3' end of the GUS coding region. Those skilled in the art will
realize that other plasmids can be substituted at this step with
equivalent results.] and transformed into DH5.alpha.. Ampicillin
resistant transformants were screened by colony hybridization using
the per5 3' UTR amplification product as a probe.
[0217] Three of the resulting transformants hybridized to .sup.32P
radiolabelled 3'UTR amplification product. The plasmid from each of
these three transformants was extracted for sequence analysis.
Sequence analysis using an Applied Biosystems automated sequencer
revealed that a clone designated p3'per26 was free of PCR induced
errors. A 2.0 kB BamHI/HindIII fragment from p3'per26 containing
the GUS-per 5 3' UTR was gel purified as described above and
ligated into the BamHI/HindIII cloning site of Bluescript.RTM. II
SK.sup.-. One of the resulting plasmids, designated BSGUSper4, was
characterized and selected for subcloning.
[0218] 2. PERGUSPER3
[0219] The 4.0 kB NcoI per5 promoter fragment from perGEN1(10.4)
described above was ligated into the NcoI site of BSGUSper4 (the
translational initiation of the GUS gene). The resultant clone,
PERGUSPER3, contains 4 kB of per5 promoter, the per5 untranslated
leader sequence, the first 5 amino acids of per5, the GUS gene, and
the per5 3' UTR.
[0220] B. Expression Assays.
[0221] Results of testing PERGUSPER3 in a transient maize root
assay are given in Table 14. Results of testing PERGUSPER3 in
stable transformed rice callus and rice plants is given in Tables
15.
EXAMPLE 13
5' Deletions of PERGUSPER3
[0222] A series of 5' deletions of PERGUSPER3 was assembled to test
the effect on expression. Construction of these vectors utilized
naturally occurring restrictions sites in the 4.0 kB NcoI promoter
region.
[0223] A. Construction of SPGP1
[0224] SPGP1 is identical to PERGUSPER3 except for the absence of 2
kB of 5' upstream sequence (i.e., bp 25 to 2585 of SEQ ID NO 16 are
deleted). SPGP1 was derived from PERGUSPER3 by subcloning the XbaI
fragment of PERGUSPER3 into the XbaI site of Bluescript.RTM.
SK.sup.-
[0225] B. Construction of HSPGP4.
[0226] HSPCP4 is identical to SPGP1 except for the absence of 1 kB
of 5' upstream sequence (i.e., bp 25 to 3240 of SEQ ID NO 16 are
deleted). This vector was derived from SPSP1 by the deletion of the
1 kB HindIII fragment.
[0227] C. Construction of PSPGP1
[0228] PSPGP1 is identical to SPGP1 except for the absence of 1.9
kB of PstI sequence (i.e., bp 25 to 4139 of SEQ ID NO 16 are
deleted). PSPGP1 only had 109 bases of 5' sequence which includes
the TATA box.
[0229] D. Expression Assay.
[0230] Results of testing SPGP1, HSPGP4 and PSPGP1 in a transient
maize root expression assay are given in Table 14.
EXAMPLE 14
Transient Root Expression Assay
[0231] Transient assays have been successfully used for studying
gene expression in plants, especially where an efficient stable
transformation system is not available (ie., maize, wheat). In
protoplasts, these assays have been used to study the expression of
regulatory elements with relatively simple expression patterns. For
example, constitutive promoters, including the CaMV 35S, have been
extensively studied in maize protoplasts. Luehrsen and Walbot
(1991). However, it was believed that a root preferrential
promoter, such as per5, would be unlikely to function normally in
protoplasts, particularly those derived from tissue culture.
Therefore, a system to study expression in intact root tissue was
desirable. Particle bombardment of root tissue would enable
transient expression analysis and reduce the need for production of
stable transgenics.
[0232] A. Helium Blasting into Roots.
[0233] Captan.TM.-treated seed of CQ806 and OQ403 were soaked for
45 min., rinsed 3 times in sterile distilled water, and germinated
in sterile petri dishes (100.times.25 mm) containing Whatman #1
filter paper moistened with sterile milli Q water for about 4-7
days. Approximately 1 cm size root tips were excised and arranged
(6 per target) in `blasting` medium (#4 with 2% agar). The
`blasting medium` consisted of N6 basal salts and vitamins (Chu,
1978), Fe-EDTA, 20 g/L sucrose, 690 mg/L L-proline, 100 mg/L
enzymatic casein hydrolysate (ECH), 1 mg/L 2,4dichlorophenoxyacetic
acid (2,4-D), and 20 g/L agar. The roots were covered with a 204
micron screen prior to blasting. Each target was blasted once at
1,500-2,000 psi using two times dilution of gold/DNA solution. The
gold particles (Biorad 1.0 micron) were coated with DNA (different
plasmids as mentioned in the text) as described in Example 10B.
Different blasting parameters, i.e., 1) different helium pressures
(500, 1,000, 1,500, and 2,000 psi), 2) number of blastings per
target (1-4 blastings per target), 3) concentration of gold/DNA
(1-4 times dilutions of gold/DNA solution), 4) particle size
(Aldrich 1.5-3.0 micron vs. Biorad 1.0 micron gold particles), and
5) high osmoticum treatment (0.2M mannitol and 0.2M sorbitol
treatment 4h prior to and 16-18 h after blasting) were tested.
Following blasting, roots were transferred to 15 Ag10-2D medium and
incubated in the dark at 27.degree. C. The 15Ag10-2D medium
differed from #4 medium in that it contained 2.9 g/L L-proline, 10
mg/L silver nitrate, 2 mg/L 2,4-D, and 2.5 g/L Gelrite.
[0234] B. Histochemical GUS Assay
[0235] After 13-24 hrs, the blasted roots were assayed for
transient GUS expression according to Jefferson (1987). Roots were
placed in 24-well microtitre plates (Corning, New York, N.Y.)
containing 500 .mu.L of assay buffer per well (six per well). The
assay buffer consisted of 0.1 M sodium phosphate (pH 8.0), 0.5 mM
potassium ferricyanide, 0.5 mM potassium ferrocyanide, 10 M sodium
EDTA, 1.9 mM 5-bromo-4-chloro-3-indol- y-beta-D-glucuronide, and
0.06% triton X-100. The plates were incubated in the dark for 1-2
days at 37.degree. C. before observations of GUS expression under a
microscope.
[0236] C. Optimization of DNA Delivery into Roots.
[0237] Transient expression increased with increased helium
pressure with highest levels observed at 1,500-2,000 psi. High
osmoticum treatment prior to blasting did not enhance GUS
expression. Also, increasing the number of blastings per target did
not result in increased expression. One blasting per target yielded
highest expression in roots of both OQ403 and CQ806. In addition,
two times dilution of gold/DNA solution and use of the Biorad 1.0
micron particles were found to be most suited for obtaining
consistently high levels of expression. Based on these results, a
set of conditions were established for blasting into roots. With
these conditions, 60-100% of the blasted roots expressed GUS with
an average number of ca. 50 GUS expression units per target using
pDAB418 (Ub1-GUS-nos).
[0238] D. Transient Expression of Different per5 Constructs in
Roots.
[0239] Transient GUS expression of different per5 constructs was
tested in roots following helium blasting using the conditions
described above. The results from ten different experiments are
summarized in Table 14.
13TABLE 14 Transient expression of different per5 constructs in
roots. Plasmid Description # GEUs* (N).dagger-dbl. Rating PerGUS16
4.5 kB per5, first 5 aa of per5 protein-GUS-nos 3.4 (24) ++
PERGUSPER3 4.5 kB per5, first 5 aa of per5 protein-GUS-per5 10.0
(24) ++++ SPGP1 2.0 kB per5, first 5 aa of per5 protein-GUS-per5
10.7 (24) ++++ HSPGP 1.0 kB per5, first 5 aa of per5
protein-GUS-per5 5.8 (15) +++ PSPGP 0.1 kB per5, first 5 aa of per5
protein-GUS-per5 10.8 (16) ++++ pDAB411 2.0 kB per5-GUS-nos 1.1 (5)
+ pDAB419 2.0 kB per5, Adh1 intron1-GUS-nos 6.7 (3) +++ *GUS
expression units (number of blue spots observed) per target
.dagger-dbl.N = # of targets blasted
[0240] pDAB411, the construct containing 2.0 kB per5, expressed at
very low levels. With PerGUS 16 containing 4.0 kB per5 and a fusion
including the first five amino acids of the per5 protein, the
expression was 3-fold higher than that of pDAB411. Further.
PerGUSper3 consisting of per5 with the 3'UTR showed a further
3-fold increase over PerGUS16 demonstrating that 3' end is also
important for regulation of expression. Although SPGP1 contained
2.0 kB of per5, no difference was observed between the expression
of SPGP1 and PerGUSper3. With additional deletion in the 5' region
of per5 in HSPGP (which contains 1.0 kB of per5 ), expression was
decreased over that of SPGP1 and PerGUSper3. However, relatively
high levels of expression were observed with PSPGP containing only
0.1 kB region of per5.
[0241] Probably all of the promoter elements which were necessary
for maximal root specific expression are present in the first 1 kB
of 5' sequence. However, elements which may suppress expression in
other tissues may not be present in this 1 kB sequence. Similar
observations have been made with the 5' upstream sequences of the
Sus4 gene from potato which contains a negative element that
suppresses expression in stems and leaves. Fu et al. (1995).
Transient assays in other tissues would be necessary to obtain this
information from the per5 constructs. Expression from PSPGP, which
contained only 100 bases 5' sequence, probably acts as a basal
promoter and, therefore, would not be expected to contain the
elements necessary for root specific expression nor enhancer
elements necessary for maximal activity of the promoter. Expression
from this construct in stable plants would be expected to be
constitutive.
[0242] A translational fusion of the per5 gene which included the
per5 5' untranslated leader (UTL) and the first 5 amino acids of
the per5 gene fused to the uidA was included in PerGUS16,
PERGUSPER3, SPGP1, HSPGP, and PSPGP constructs. The ability of
these constructs to express GUS, demonstrated that this UTL
sequence was capable of promoting translation and therefore can be
used to express commercially important transgenes.
[0243] The most obvious improvement in expression was observed from
the addition of the per5 3' UTR in place of the nos sequence. 3'
UTR's are known to contain sequences which affect gene expression
by altering message stability (Sullivan and Green (1993)) or
influencing translation (Jackson and Standart (1990)). Examples
include polyadenylation signals (Rothnie et al. (1994)) and
destabilizing elements (Gallie et al. (1989)). However, the per5
and nos 3'UTR's cannot be distinguished by the presence or absence
of these sequences. Both UTR's contain a canonical AAUAAA poly-A
addition signal. Neither sequence appears to contain any of the
published destabilizing elements. An obvious difference between the
two UTR's is the length; the longer per5 UTR may confer greater
stability of the message.
EXAMPLE 15
Rice Transformation of PERGUSPER3
Transgenic Production and Histochemical GUS Assay
[0244] To study the expression of PerGUSPer3 in transgenic rice, a
total of 35 independent transgenic lines were produced. Out of
these, plants of 9 lines
(354/PERGUSPER3-03,20,21,23,24,27,28,30,and 34) displayed GUS
expression in roots. Although GUS expression was variable from line
to line, a few lines showed very intense expression in roots.
Histochemical GUS analysis of different tissues following vacuum
infiltration showed GUS expression in cut portions of leaves,
glumes, anthers, pollen and embryo. No expression was seen in
endosperm. All of these results suggest that per5 expresses in a
constitutive manner in rice.
[0245] Rice plants from six PERGUSPER3 Ro lines were characterized
by Southern analysis. The rice DNA was also cut with the
restriction enzyme XbaI which should result in a 4.2 kb fragment
when hybridized to the GUS probe. All of the six lines contain the
gene construct. A moderately complex integration event was detected
in one of the six lines containing an intact copy of the gene
construct. The remaining five lines all had complex integration
events with as many as nine hybridization products. A summary of
the genetic analysis is located in Table 15.
14TABLE 15 Assay of Transformed Rice Plants Presence of Relative
Light Relative Light the Intact Number of Gus Units per ug Units
per ug Gene Hybridization Histochemical of protein - of protein -
Plant Construct Products Results Root Leaf 354/PGP3-20 Yes 5
Positive 13,129 26,220 354/PGP3-21 Yes 9 Positive 1,579 623
354/PGP3-22 n.d. -- Negative 5 11 354/PGP3-23 Yes 4 Positive 61 20
354/PGP3-24 Yes 3 Positive 1,484 1,398 354/PGP3-27 Yes 6 Positive
115 12 354/PGP3-28 Yes 5 Positive 338 222 n.d. = not determined
[0246] Both longitudinal and transverse root sections prepared from
transgenic rice seedlings showed cells with GUS expression (blue
color) and cells interpreted to lacks GUS expression (red color
resulting from the counterstain). Longitudinal section of a primary
root showed GUS expression present in all cells except for those
present in the root cap, meristematic zone, and a portion of the
cell elongation zone. This pattern of expression was confirmed for
secondary root formation in a transverse section of root tissue.
Cross section of a primary root, prepared from within the zones of
cell elongation and differentiation, showed most cells expressing
GUS. Very intense GUS expression (dark blue) was observed in the
exodermis or outer cortex of the root sample. GUS expression was
noted as slight to absent in the epidermal layer even though root
hairs were observed macroscopically to be blue. Both vascular and
cortical tissues showed moderate expression. Based on the
consistent staining patterns obtained from free hand tissue
sections, cells in the vascular and cortical tissues genuinely
expressed the GUS protein rather than appear as artifacts with the
diffusion of histochemical stain from the exodermis.
[0247] Analysis of variance showed that sample to sample variation
within each of the independent events was not significant. However,
most of the variation was associated among the different events.
Based on the GUS quantitative data, only event 354/PERGUSPER3-20
was shown to be highly significant different (p<0.001) from zero
(Table 15) even though five other events were shown to be
histochemically GUS positive.
[0248] The maize per5 5' region in combination with the 3'
untranslated sequences promoted high-level expression of the
introduced .beta.-glucuronidase gene in young transgenic rice
plants. Functional activity was observed in both roots and leaves.
Quantitative data indicated that there was considerable variability
of expression between the different events. This variability is
most likely a result of a combination of factors including position
effects of the integrated transgene, differences in copy number of
the insertion products, and rearrangements of the insertion events.
All of these variables have the potential to effect expression
levels and have been documented in most transgenic studies.
[0249] Despite high degree of variability in the expression levels,
the expression pattern of PerGUSPer3 in different transformation
events was consistent. Slight to verbs intense expression was
evident in the entire primary and secondary roots except in the
root tips. Histological analysis showed very intense expression in
the outer cortex and moderate expression in cortex and vascular
tissues. Such pattern and level of expression observed appears to
be very suitable for expression of genes to control root pests
(i.e., root weevil). In addition, consistent with expression in
roots, high levels of expression was also observed in stem and leaf
tissue (quantitative data) thus providing opportunity for
controlling other insects (i.e., stem borer). These data
demonstrate that the per5 promoter, in the absence of an intron,
drives constitutive expression of transgenes in rice.
EXAMPLE 16
Maize Transformation of PERGUSPER3
[0250] Establishment of typeII callus targets and helium blasting
conditions were that same as described in Example 10. A total of 82
independent transgenic colonies of maize were produced. Of these,
55 lines were subjected to Southern analysis as described in
Example. 15. Twenty-nine lines were found to be Southern positive
and contained an intact hybridization product of the GUS gene.
Following GUS histochemical assay, callus of about 72 lines showed
no expression. Also, roots and leaves of different
Southern-positive lines displayed no GUS expression when callus was
regenerated on the `regeneration` medium. This data supported the
observation that sequences other than the 5' promoter region and
the 3' UTR were critical for expression in corn.
EXAMPLE 17
Plasmid PIGP/367
[0251] Plasmid PIGP/367 contains the per5 promoter, the per5
untranslated leader modified to include the per, intron 1, the GUS
gene, and the per5 3'UTR. The complete sequence for PIGP/367 is
given in SEQ ID NO 19. With reference to SEQ ID NO 19, critical
features of PIGP/367 are given in Table 16.
15TABLE 16 Significant Features of PIGP/367 nt (SEQ ID NO 19)
Features 1-40 synthetic polylinker 41-75 pCR .TM. 2.1 polylinker
81-1741 Per5 promoter nt 2532-4192 SEQ ID NO 1 1742-1747
BglII/BamHI junction 1748-1763 Per 5 exon1 nt 4410-4425 SEQ ID NO 1
1764-2396 Per5 intron nt 4426-5058 SEQ ID NO 1 2397-2405 Per5 exon2
nt 5059-5067 SEQ ID NO 1 2406-2411 NcoI site 2408-4215 .beta.
glucuronidase gene (GUS) 4217-4264 sequence from pB1221 4280-4652
Per5 3' UTR nt 6067-6439 SEQ ID NO 1 4653-4869 synthetic linker
4870-5121 CaMV DNA nt 7093-7344 5122-5129 linker 5130-5476 CaMV DNA
nt 7093-7439 5477-5496 linker 5497-5606 synthetic MSV leader(MSV nt
167-186, 188-277) 5608-5613 BglI/BclI junction 5608-5698 Adh1.S nt
119-209 5699-5820 Adh1.S nt 555-672 plus 4 bases linker sequence
5821-5827 BamHI/BglII junction 5828-5864 MSV nt 278-317 5863-5868
NcoI site 5865-6419 phosphinothricin acetyl transferase gene (Basta
.TM. resistance selectable marker) 6420-6699 nos 3' UTR 6700-9335
pUC19 sequences
[0252] Because intron flanking sequences (exon DNA) have been shown
to be important in the processing of the intron (Luehrsen and
Walbot (1991)), 16 bases of flanking exon DNA were included the
fusion within the per5 untranslated leader.
[0253] Construction of PIGP/367. The promoter from the per5 gene
was amplified using the forward primer
GGGGGATCCTCTAGACAATGATATACATAGATAAAACC (SEQ ID NO 20) which
introduces a BamHI (GGATCC) site 5' of the promoter to facilitate
cloning. The reverse primer within the untranslated leader of the
per5 gene was GGGAGATCTCCTTCGCTGTACTATGTTATAAGAGAAGAG (SEQ ID NO
21) and introduced a BglII (AGATCT) restriction site 3'. Sequences
homologous to the promoter are underlined. The primers were
synthesized on a 394 DNA/RNA Synthesizer (Applied Biosystems,
Foster City, Calif.). Amplification reactions were completed with
the Expand.TM. Long Template PCR System (Boehringer Mannheim,
Indianapolis, Ind.). Plasmid perGen10.44, which contains 10.1 kb of
the maize peroxidase gene and untranslated and non-transcribed
sequences, was used as the template DNA. Amplifications were cycled
with a 56.degree. C. annealing temperature. Amplification products
were separated and visualized by 1.0% agarose gel electrophoresis.
Resulting amplification products were excised from the agarose and
the DNA was purified using Qiaex II (Qiagen, Hilden, Germany). The
products were ligated into pCR2.1 using the Original TA Cloning Kit
(Invitogen Corporation, San Diego, Calif.). Recombinant plasmids
were selected on Luria agar (Gibco, Bethesda, Md.) containing 75
mg/liter ampicillin (Sigma. St Louis, Mo.) and 40 ml/plate of a 40
mg/ml stock of X-gal (Boehringer Mannheim, Indianapolis, Ind.).
Plasmid DNAs were purified using Wizard.TM. plus Miniprep DNA
Purification System (Promega, Madison, Wis.). DNA was analyzed and
subcloned with restriction endonucleases and T4 DNA ligase from
Bethesda Research Laboratories (Bethesda, Md.). The resultant per5
promoter clone was named p121-20.
[0254] Intron 1 and 25 bases of flanking exon DNA from the per5
gene was amplified using the forward primer
GGGGGATCCTGACTGCTTTGTCAAGGTTCAATTCTGCT- T (SEQ. ID NO 22) which
introduced a BamHI (GGATCC) site 5' the exon/intron DNA, and the
reverse primer, GGGCCATGGATCGCAGCCCTACACATGTAACA- GTGTTGT (SEQ ID
NO 23), which introduced an NcoI (CCATGG) site 3' to facilitate
fusion at the ATG start codon of the GUS gene. Sequences homologous
to the per5 sequence are underlined. Amplification and cloning was
completed as described above with the resultant intron clone named
p122-2. The intron was then excised from p122-2 on the BamHI/NcoI
fragment and introduced 5' to the GUS gene/per 5 3' untranslated
region in BSGUSper4. Ligations were transformed into DH5.alpha.
(Laboratory, Bethesda, Md.) and DNA was extracted as described
above. Sequence across the junction was verified using Dye
Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer,
Foster City, Calif.) and 373A DNA Sequencer (Applied Biosystems,
Foster City, Calif.). Computer analysis of the sequences was
facilitated by Sequencher.TM. 3.0 (Gene Codes Corporation, Ann
Arbor, Mich.). The intermediate, p128-1, was then digested with
BamHI and ligated to the purified promoter BglII/BamHI fragment
from p121-20. To generate a final construct containing the
selectable marker gene for Basta.TM. resistance, the per5
promoter/per5 intron/GUS gene/per5 3' UTR were excised from
PIPG147-2 on a PvuII/NotI fragment and introduced into a PmeI/NotI
site of pDAB367. pDAB367 which contains the gene for Basta.TM.
resistance, is described in Example 27. The final construct was
designated pPIGP/367.
EXAMPLE 18
Transformation of Maize with pPIGP/367
[0255] A. Establishment of Type II Callus Targets.
[0256] The materials and methods used were the same as in Example
10.
[0257] B. Helium Blasting and Selection.
[0258] The materials and methods used were the same as in Example
10. Thirty three Basta.TM. resistant lines, designated pPIGP-01
thru pPIGP-33, were obtained.
[0259] C. Plant Regeneration.
[0260] The materials and methods used were the same as in Example
8. Plantlets were regenerated from five of the PIGP/367 transgenic
lines (PIGP/367-01, PIGP/367-06, PIGP/367-19. PIGP/367-32 and
PIGP/367-33).
[0261] D. GUS Histochemical Staining.
[0262] Tissue from plantlets of pPIGP-01 were histochemically
evaluated as described in Example 10. The plantlets showed good GUS
expression in the roots except for the root cap where no expression
was observed. No expression was observed in the leaves of these
young plants.
[0263] F. Protein Extraction and Measurement of GUS.
[0264] Leaf and root tissue was collected and analysis for GUS
expression completed from four of the PIGP/367 transgenic lines
(PIGP/367-06. PIGP/367-19, PIGP/367-32 and PIGP/367-33) which
showed positive GUS histochemical expression. An untransformed
plant at the same stage of development, CS405, served as a negative
control. The 6th leaf and cleaned roots (roots were cleaned under
cold running tap water and rinsed with distilled water) were
collected from 4-5 R.sub.0 plants plants within transgenic lines.
The samples were either stored at -70.degree. C. or powdered using
liquid nitrogen. Fifty mL tubes, chilled on dry ice, were filled to
10 mL mark with powdered samples. Protein from each sample was
extracted in duplicate. Four volumes/weight of extraction buffer
(Extraction buffer is 1% polyvinylpolypyrrolidone (hydrated in the
solution for at least one hour), 20% glycerol, 0.7 .mu.L/mL
.beta.-mercaptoethanol, 50 mM NaPO; pH 7.0, 10 mM EDTA, 0.1% Triton
X-100, 0.1% sarcosyl, 10 mM .beta.-mercaptoethanol) was added to
each sample. Samples were ground using Ultra-Turrax T 25 (IKA-Works
INC, Staufen I. Br., W. Germany) and kept on ice. Samples were spun
at 3000 rpm at 4.degree. C. for five minutes. Ten .mu.L/mL of
protease inhibitor (50 4g/mL antipain, 50 .mu.g/mL leupeptin, 0.1
mM chymostain, 5 .mu.g/mL pepstatin, 0.24 .mu.g/mL pefabloc
(Boehringer Mannheim, Indianapolis, Ind.)) was added to withdrawn
sample supernatant. The samples were then spun at 4.degree. C. for
10 minutes at 13,000 rpm. The supernatants were withdrawn and
stored at -70.degree. C. Protein concentration was measured on a
UV-Visible Spectrophotometer (Shimadzu, Kyoto, Japan). Five .mu.L
of sample was added to 2.5 mL of protein dye reagent (Sigma
Diagnostics, St. Louis, Mo.) and 100 .mu.L of sterile water. A
range of standards was made from protein standard solution (Sigma
Diagnostics, St. Louis. Mo.).
[0265] GUS activity was measured using a GUS-Light.TM. Kit (Tropix
Inc., Bedford, Mass.) in replicate samples of the duplicate
extractions. Five .mu.L samples of undiluted extract or of extract
diluted so that the luminescence was within the range measured by
the luminometer was added to 195 .mu.L of the GUST-.TM. Diluent
Solution. After 1 hr incubation, at 28.degree. C. in the dark,
luminescence was measured using a Bio Orbit 1251 luminometer,
equipped with a Bio Orbit 1291 injector, after injection of 300
.mu.L of GUS-Light.TM. Accelerator. Luminescence was integrated for
5 sec after a 5 sec delay. The standards used were extraction
buffer, non-transformed tissue stock and GUS-Light.TM. Gus
Standard. The results are summarized in Table 17 and showed high
levels of expression in the roots, but low to no significant
expression in the leaves.
16TABLE 17 Expression of GUS with PIGP/367 in Plants from Four
Transformation Events Leaf Root (RLU/.mu.g (RLU/.mu.g Line protein)
protein) PIGP/367-06 734 5735 PIGP/367-19 49 5745 PIGP/367-32 8 349
PIGP/367-33 72 1586 CS405 1 13
[0266] G. Summary of Expression Results.
[0267] In the previous examples herein, no significant expression
was observed in any maize tissue (although it was in rice) in the
absence of an intron downstream from the per5 promoter. When the
Adh1 intron was fused to the promoter (Examples 8, 10), expression
in maize was observed. The Adh1 intron 1 was not capable of
restoring the root-preferential expression in maize that is
characteristic of the native per5 gene. Root-preferential
expression was only achieved when the promoter was placed in
combination with the per5 intron. This is the first demonstration
of an intron directing tissue specific or tissue-preferential
expression in transgenic plants. Xu et al. (1994) have reported
preliminary studies on the promoter of another root-preferential
gene, the triosephosphate isomerase gene from rice. They found that
an intron is required for expression from this promoter in rice
protoplasts, but the effects of the intron on gene expression in
mature tissues has not been described.
[0268] The mechanism for enhancement by an intron is not well
understood. The effect appears to be post-transcriptional (rather
than promoter-like effects on the initiation of transcription)
because the enhancements are only seen when the intron is present
in the region of DNA that is transcribed (Callis, 1987). Introns
could play a role in stabilizing the pre-mRNA in the nucleus, or in
directing subsequent processing (Luehrsen and Walbot, 1991). The
root-preferential expression of the per5 promoter-intron
combination could be explained by requiring an intron for
processing, and a limited tissue distribution of other factor(s)
necessary for correct processing.
EXAMPLE 19
Plasmid p188-1
[0269] Plasmid p188-1 is a clone of the per5 3'UTR. The per5 3' UTR
was amplified on Plasmid Xba4, which contains the 4.1 kb XbaI
fragment from nt 2532 to 6438 of SEQ ID NO 1, using the forward
primer, AAA GAG CTC TGA GGG CAC TGA AGT CGC TTG ATG TGC (SEQ ID NO
24), which introduced a SstI site on the 5' end, and the reverse
primer, GGG GAA TTC TTG GAT ATA TGC CGT GAA CAA TTG TTA TGT TAC
(SEQ ID NO 25), which introduced an EcoRI site on the 3' end of a
366 bp segment of per5 3' UTR (corresponding to nt 6066 to 6431 of
SEQ ID NO 1). Sequences homologous to the promoter are underlined.
The primers were synthesized on a 394 DNA/RNA Synthesizer, (Applied
Biosystems, Foster City, Calif.). Amplification reactions were
completed with the Expand.TM. Long Template PCR System (Boehringer
Mannheim, Indianapolis, Ind.). Plasmid Xba amplifications were
cycled with a 56.degree. C. annealing temperature. Amplification
products were separated and visualized by 1.0% agarose gel
electrophoresis. Resulting amplification products were excised from
the agarose and the DNA was purified using Qiaex II (Qiagen,
Hilden, Germany). The products were ligated into pCR2.1 from the
Original TA Cloning Kit (Invitrogen Corporation, San Diego,
Calif.).
[0270] Recombinant plasmids were selected on Luria agar (Gibco,
Bethesda, Md.) containing 75 mg/liter ampicillin (Sigma, St Louis,
Mo.) and 40 ml/plate of a 40 mg/ml stock of X-gal (Boehringer
Mannheim, Indianapolis, Ind.). Plasmid DNAs were purified using
Wizard.TM. plus Miniprep DNA Purification System (Promega, Madison,
Wis.). DNA was analyzed and subcloned with restriction
endonucleases and T4 DNA ligase From Bethesda Research Laboratories
(Bethesda, Md.). The resultant per5 3'UTR clone was named
p188-1.
EXAMPLE 20
pTGP !90-1
[0271] Plasmid pTGP190-1 is a 5887 bp plasmid comprising a gene
cassette in which the following components are operably joined: the
35T promoter, the GUS gene, and the per5 3'UTR. The complete
sequence of pTGP190-1 is given in SEQ ID NO 26. With reference to
SEQ ID NO 26. important features of pTGP 190-1 include:
17TABLE 18 Significant Features of pTGP 190-1 nt (SEQ ID NO 26)
Features 12-17 PstI site 18-30 linker 31-282 CaMV MCASTRAS nt
7093-7344 283-290 linker 291-637 CaMV DNA MCASTRAS 7093-7439
638-657 linker 650-655 BamHI site 651-1024 374 bp BamHI/NcoI
fragment containing MSV leader and Adh1 intron 658-677 MSV nt
167-186 678-767 MSV nt 188-277 769-774 BglII/BclI junction 769-978
Adh1.S intron with deletion described in Example 24 979-988 linker
982-987 BamHI/BglII junction 989-1028 MSV nt 278-317 1024-1029 NcoI
site 1026-2834 .beta. glucuronidase coding sequence (GUS) 2835-2890
sequence from pKA882 2890-2895 SstI site 2896-3261 Per5 3'UTR nt
6066 to 6431 of SEQ ID NO 1 3262-3267 EcoRI site 3268-5897 pUC19
sequences
[0272] Construction of pTGP190-1. The per5 3' UTR was excised from
p188-1 (Example 19) using the SstI/EcoRI sites and purified from an
agarose gel as described above. This fragment was ligated to the
SstI/EcoRI A fragment of pDAB305. (pDAB305 is described in detail
in Example 24.) Plasmid pDAB305 is a 5800 bp plasmid that contains
a heterologous promoter which is known as 35T. Construction of the
35T promoter is described in detail in Example 24. Basically this
construct contains tandem copies of the Cauliflower Mosaic Virus
35S promoter (35S), a deleted version of the Adh1 intron 1, and the
untranslated leader from the Maize Streak Mosaic Virus (MSV) Coat
Protein fused to the .beta.-glucuronidase gene, which is then
followed by the nos 3'UTR.) The SstI/EcoRI A fragment of pDAB305
deletes the nos 3'UTR. Ligations were transformed into DH5.alpha.
(Bethesda Research Laboratory, Bethesda, Md.) and DNA was extracted
as described above. Sequence across the promoter/GUS junction was
verified using Dye Terminator Cycle Sequencing Ready Reaction Kit
(Perkin Elmer. Foster City, Calif.) and 373A DNA Sequencer (Applied
Biosystems, Foster City, Calif.). Computer analysis of the
sequences was facilitated by Sequencher.TM. 3.0 (Gene Codes
Corporation, Ann Arbor, Mich.). Plasmid pTGP190-1 is identical to
pDAB305 except for the substitution of the per5 3'UTR for the nos
3'UTR following the GUS gene.
EXAMPLE 21
UGP232-4
[0273] Plasmid UGP232-4 is similar to pTGP190-1, but contains the
ubiquitin 1 (ubi) promoter and intron 1 from maize in place of the
35T promoter. The ubi promoter was excised on a HindIII/NcoI
fragment from pDAB 1538 (described in Example 29) and ligated to
the HindIII/NcoI A fragment of pTGP 190-1 to derive UGP232-4. The
complete sequence for UGP232-4 is given in SEQ ID NO 27. With
reference to SEQ ID NO 27, important features of UGP232-4 are given
in Table 19.
18TABLE 19 Significant Features of UGP232-4 nt (SEQ ID NO 27)
Features 1-5 HindIII site 1-14 pUC19 polylinker 15-993 ubiquitin
promoter from maize 994-2007 ubiquitin intron 2008-2026 Synthetic
polylinker from previous constructs (KpnI, SmaI and SalI) 2025-2030
NcoI site 2027-3835 .beta. glucuronidase coding sequence (GUS)
3836-3890 sequence from pKA882 3891-3896 SstI site 3897-4262 Per5
3'UTR nt 6066 to 6431 of SEQ ID NO 1 4263-4268 EcoRI site 4269-6898
pUC19 sequence
[0274] pUGN81-3 was used as the Ubiquitin/GUS/nos control
plasmid.
EXAMPLE 22
Quantitative Transient Assays of Maize Callus
Bombarded with pTGP 1931-1 or UGP232-4
[0275] A. Preparation of DNA for Transient Testing.
[0276] Each of the test constructs, in addition to pDAB305
(described in Example 24), was co-precipitated onto gold particles
with pDeLux (described in Example 26) according to the following
protocol. Equal molar amounts of the GUS constructs were used. A
total of 140 .mu.g of DNA, 70 .mu.g of pDeLux plus 70 .mu.g of test
DNA and Bluescript.RTM. II SK.sup.- DNA (when necessary), was
diluted in sterile water to a volume of 300 .mu.L. The DNA and
water were added to 60 mg of surface-sterilized 1.0 .mu.m spherical
gold particles (Bio-Rad Laboratories, Hercules, Calif.). The
mixture was vortexed briefly (approximately 15 seconds) before
adding 74 .mu.L of 2.5 M calcium chloride and 30 .mu.L of 0.1
spermidine (free base). After vortexing for 30 seconds, the DNA and
gold were allowed to precipitate from solution. The supernatant was
removed and 1 mL of ethanol was added. The DNA/gold mixture was
diluted 1:8 before use for transformation.
[0277] B. Transient Testing in Maize Callus.
[0278] Regenerable (Type II) maize callus was pretreated on osmotic
medium (N6 salts and vitamins (Chu (1978)), 1 mg/L
2,4-dichlorophenoxyacetic acid. 0.2 M sorbitol, 0.2 M mannitol, 7
g/L Gelrite, pH 5.8) for approximately 16 hours. Afterward, it was
placed onto 60.times.20 mm plates of osmotic medium solidified with
2% agar for helium blasting. Cages of 104 .mu.m mesh screen covered
each "target" (500-600 mg of callus) to prevent splattering and
loss of tissue. Targets were individually blasted with DNA/gold
mixture using the helium blasting device described in Example 10.
Under a vacuum of 650 mm Hg, at a shooting distance of 10 cm and
pressure of 1500 psi, DNA/gold mixture was accelerated toward each
target four times, delivering 20 .mu.L per shot. The targets were
rotated 180.degree. after each blast. The tissue was also mixed
halfway through the blasting procedure to expose unblasted callus.
Upon completion of blasting, the targets were again placed onto the
original osmotic medium for overnight incubation at 26.degree. C.
in the dark.
[0279] Four Type II callus cell lines were selected for each
experiment. Two targets from each line were used per treatment
group. Also, two nontransformed controls (NTC) were included within
each experiment, composed of tissue pooled from all four lines.
These controls were transferred to osmotic and blasting media
according to the protocol above, but were not subjected to helium
blasting.
[0280] C. GUS Quantitative Analysis.
[0281] Approximately 20 hours after blasting, 200-400 mg of each
target was transferred to a 1.5 mL sample tube (Kontes, Vineland,
N.J.). For extraction of proteins, callus was homogenized using a
stainless steel Kontes Pellet Pestle powered by a 0.35 amp, 40 Watt
motor (Model 102, Rae Corporation, McHenry, Ill.), at a setting of
"90". Cell Culture Lysis Reagent from a Luciferase Assay kit
(Promega. Madison, Wis.) served as the extraction buffer. Protease
inhibitors, phenylmethylsulfonyl fluoride (PMSF) and leupeptin
hemisulfate salt, were added to the lysis buffer at the
concentrations of 1 mM and 50 .mu.M, respectively. Before grinding,
0.5 .mu.L of lysis buffer per mg tissue was added to the sample
tube. The callus was homogenized in four 25-second intervals with a
10-second incubation on ice following each period of grinding.
Afterward, 1.0 .mu.L of lysis buffer per mg tissue was added to the
sample which was maintained on ice until all sample grinding was
completed. The samples were then centrifuged twice at 5.degree. C.
for 7 minutes at full speed (Eppendorf Centrifuge Model 5415).
After the first spin, the supernatant from each tube was removed
and the pellet was discarded. Callus extracts (supernatants) were
also collected after the second spin and maintained on ice for GUS
and Luciferase (LUC) analyses.
[0282] From the LUC Assay kit, LUC Assay Buffer was prepared
according to the manufacturer's instructions by reconstituting
lyophilized luciferin substrate. This buffer was warmed to room
temperature and loaded into the dispensing pump of an automatic
luminescence photometer (Model 1251 Luminometer and Model 1291
Dispenser, Bio-Orbit, Finland). Each sample was tested in
triplicate by adding 20 .mu.L of extract to three polypropylene
luminometer vials (Wallac, Gaithersburg, Md.). Per vial, 100 .mu.L
of assay buffer was dispensed, and luminescence was detected over a
45-second integration period. "Blank reactions", including 20 .mu.L
of extraction buffer rather than callus extract, were also measured
within each experiment to determine the extent of background
readings of the luminometer.
[0283] For analysis of GUS activity, a GUS-Light.TM. assay kit
(Tropix, Bedford, Mass.) was used. Again, each sample was tested in
triplicate, using 20 .mu.L of extract per luminometer vial.
GUS-Light.TM. Reaction Buffer was prepared from the assay kit by
diluting liquid Glucuron.TM. substrate according to the
manufacturer's instructions. This buffer was warmed to room
temperature and added in 180 .mu.L aliquots to each luminometer
vial at 7-second intervals. After a one hour incubation at room
temperature, 300 .mu.L of GUS-Light.TM. Light Emission Accelerator
Buffer was added and luminescence was detected over a 5-second
integration period. "Blank reactions" were also included in the GUS
assay, using 20 .mu.L of extraction buffer rather than callus
extract.
[0284] GUS and LUC results were reported in relative light units
(RLU). Both "blank" and NTC readings were subtracted from sample
RLU levels. For comparison of one construct to another, GUS
readings were normalized to LUC data by calculating GUS/LUC ratios
for each sample tested. The ratios for all samples within a
treatment group were then averaged and the means were subjected to
a T-test for determination of statistical significance. Within each
experiment, results were reported as a percent of pDAB305
expression.
[0285] Transient bombardment of Type II callus for each of the
constructs was completed as described above. By including pDAB305
as a standard in each experiment and reporting results as a percent
of the standard, data from numerous experiments could be
meaningfully compared. Table 20. lists results from three
experiments testing the nos versus the per5 3'UTRs using two
promoters. With either the 35T or Ubi1 promoter, the per5 3'UTR
resulted in higher transient GUS expression than the nos 3' end
constructs. pUGN223-3 is a plasmid that contains a fusion of the
maize ubiquitin promoter and ubiquitin intron 1 to the GUS gene
similar to pUGP2732-4. However, pUGN223-3 has the nos 5 3'UTR
instead of the per 3'UTR. pUGN223-3 was used as a control to
directly compare expression relative to the 3'UTRs of per5 and nos
in combination with the maize ubiquitin 1 (Ubi1) promoter and
intron 1.
19TABLE 20 Summary of transient GUS expression for all of the
constructs tested. Construct GUS/LUC Ratio (% of pDAB305) pDAB305
(35T/GUS/nos) (control) *100 pTGP190-1 (35T/GUS/per5) *114
pUGN223-3 (Ubi/GUS/nos) (control) .dagger.137 pUGP232-4
(Ubi/GUS/per5) .dagger.163 *not significantly different (p = 0.05)
.dagger.significantly different (p = 0.05)
[0286] Transient analysis indicated that the per5 3' UTR functioned
as well as nos when the GUS gene was driven by the 35T promoter and
19% better than nos when driven by the maize Ubiquitin 1 promoter.
The reason for this increased efficiency is not known, but it could
result from changes in the efficiency of processing or increased
stability of the message.
EXAMPLE 23
Comparison of GUS Expression in Transformed Rice for Per5 3' UTR
and nos 3' UTR Constricts
[0287] This example measures quantitative GUS expression levels
obtained when the 3' UTR is used as a polyadenylation regulatory
sequence, UGP232-4, in transgenic rice plants. In this example the
GUS gene is driven by the maize ubiquitin1 (Ubi1) promoter.
Expression levels are compared with the nos 3' UTR sequence and the
same promoter (Ubi1)/GUS fusion. pDAB 1518 (described in Example
28).
[0288] A. Transgenic Production.
[0289] As described in Example 9.
[0290] 1. Plasmids. The plasmid UGP232-4, containing the GUS gene
driven by the maize ubiquitin1 promoter and the Per5 3' UTR was
described in Example 21. The plasmid pDAB354. which carries a gene
for hygromycin resistance, was described in Example 25.
[0291] 2. Rice Transformation. Production of transgenic rice plants
was described in Example 9.
[0292] B. Expression Analysis.
[0293] Analysis of GUS expression and Southern analysis techniques
were described in Example 9. These results are summarized in Table
21 for 30 independent transgenic events recovered with UGP232-4 and
8 independent events from the control plasmid, pDAB1518 (described
in Example 28).
20TABLE 21 GUS Expression in Transformed Rice Plants For PER5 and
NOS 3' UTR Constructs GUS Activity (RLU/.mu.g protein) Presence of
Transgenic Event Root Leaf Intact Construct 354/UGP-45 349,310
295,012 YES 354/UGP-36 326,896 172,316 YES 354/UGP-39 152,961
127,619 YES 354/UGP-40 126,027 106,275 YES 354/UGP-02 58,359 21,720
YES 354/UGP-03 54,509 20,758 YES 354/UGP-04 54,501 20,838 YES
354/UGP-10 53,222 26,514 YES 354/UGP-37 45,288 90,428 YES
354/UGP-34 43,226 7,180 NO* 354/UGP-48 37,284 28,029 YES 354/UGP-29
35,630 14,631 NO* 354/UGP-28 32,177 16,317 YES 354/UGP-19 29,646
13,143 NO* 354/UGP-31 29,520 19,774 YES 354/UGP-50 11,320 9,752 YES
354/UGP-44 9,301 9,556 NO* 354/UGP-35 7,113 2,062 YES 354/UGP-17
4,590 3,350 YES 354/UGP-27 3,367 975 YES 354/UGP-38 1,567 258 YES
354/UGP-22 1,202 1,229 YES 354/UGP-12 903 15 YES 354/UGP-42 670 780
NO* 354/UGP-11 378 96 YES 354/UGP-26 160 80 YES 354/UGP-25 152 340
YES 354/UGP-18 77 26 YES 354/UGP-06 69 95 YES 354/UGP-24 43 26 YES
1518-03 278,286 108,075 n.d. 1518-08 140,952 42,867 n.d. 1518-09
97,769 83,209 n.d. 1518-24 84,844 45,807 n.d. 1518-23 47,734 62,279
n.d. 1518-07 2,406 3,146 n.d. 1518-10 2,188 1,759 n.d. 1518-04 44
52 n.d. *The expected 3.9 kb fragment was not obtained but instead
a range of 2 to 4 other hybridization bands were noted. n.d. = not
determined
[0294] For both constructs there was a great deal of variability of
GUS expression observed in both roots and leaves. Although a few
events displayed higher GUS expression with the UGP construct,
overall the expression levels using the per5 3' UTR were comparable
to that of the nos 3' UTR. Southern analysis of plants from the 30
UGP232-4 events verified a corresponding 3.9 kb fragment to the GUS
probe for the majority of events. Overall, the per5 3' UTR
demonstrates the ability to augment expression as good, or better
than the nos 3' UTR. The per5 3' UTR has also been used to express
the GUS reporter gene in stably transformed maize (Examples 16).
Therefore, this sequence has broad utility as a 3' UTR for
expression of transgenic products in monocots, and probably in
dicots.
[0295] Various combinations of the regulatory sequences from the
Per5 gene have proven to have utility in driving the expression of
transgenic products in multiple crops. Table 22 summarizes the
transient and stable expression patterns observed from each of the
constructs tested in maize and the stable expression patterns
observed in rice. These data demonstrate the ability of any of the
per5 promoter iterations to drive transgene expression. An
unexpected finding was that introns significantly affect tissue
specificity of transgene expression in stably transformed maize
plants, but do not similarly affect expression in rice. In stably
transformed maize plants the Adh1 intron supported expression in
all tissues, whereas the per5 intron supported a tissue
preferential pattern of expression. Finally, the pert ' LTR was
capable of supporting transgenic expression when used in
combination with the per5 promoter or other heterologous promoters
in maize or rice.
21TABLE 22 Summary of GUS expression patterns observed from various
per5 elements. Pro- moter Intron 3'UTR Transient (root) Stable
Maize Stable Rice per5 nos positive (low) negative n.d. per5 per5
positive negative constitutive per5 adh1 nos positive constitutive
constitutive per5 per5 per5 n.d. root specific n.d. 35T adh1 per5
positive n.d. n.d. ubi ubi nos positive (high) n.d. constitutive
ubi ubi per5 positivie (high) n.d. constitutive n.d. = not
determined
EXAMPLE 24
pDAB 305
[0296] Plasmid pDAB305 is a 5800 bp plasmid that harbors a promoter
containing tandem copy of the Cauliflower Mosaic Virus 35S enhancer
(35S), a deleted version of the Adh1 intron 1, and the untranslated
leader from the Maize Streak Mosaic Virus Coat Protein fused to the
.beta.-glucuronidase gene, which is then followed by the nos
3'UTR.
[0297] A. Construction of a Doubly-Enhanced CaMV 35S Promoter.
[0298] This section describes molecular manipulations which result
in a duplication of the expression-enhancer element of a plant
promoter. This duplication has been shown (Kay et al (1987)) to
result in increased expression in tobacco plants of marker genes
whose expression is controlled by such a modified promoter. [Note:
The sequences referred to in this discussion are derived from the
Cabb S strain of Cauliflower Mosaic Virus (CaMV). They are
available as the MCASTRAS sequence of GenBank, which is published.
(Franck et al., 1980). All of the DNA sequences are given in the
conventional 5' to 3' direction. The starting material is plasmid
pUC13/35S(-343) as described by Odell et al. (1985). This plasmid
comprises, starting at the 3' end of the SmaI site of pUC13
(Messing(1983)) and reading on the strand contiguous to the
noncoding strand of the lacZ gene of pUC13, nucleotides 6495 to
6972 of CaMV, followed by the linker sequence CATCGATG (which
contains a ClaI recognition site), followed by CaMV nucleotides
7089 to 7443, followed by the linker sequence CAAGCTTG, the latter
sequence comprising the recognition sequence for HindIII, which is
then followed by the remainder of the pUC13 plasmid DNA.
[0299] 1. pUC13/35S(-343) DNA was digested with ClaI and NcoI, the
3429 base pair (bp) large fragment was separated from the 66 bp
small fragment by agarose gel electrophoresis, and then purified by
standard methods.
[0300] 2. pUC13/35S(-343) DNA was digested with ClaI, and the
protruding ends were made flush by treatment with T4 DNA
polymerase. The blunt-ended DNA was the ligated to synthetic
oligonucleotide linkers having the sequence CCCATGGG, which
includes an NcoI recognition site. The ligation reaction was
transformed into competent Escherichia coli cells, and a
transformant was identified that contained a plasmid (named pOO#1)
that had an NcoI site positioned at the former ClaI site. DNA of
pOO#1 was digested with NcoI and the compatible ends of the large
fragment were religated, resulting in the deletion of 70 bp from
pOO#1, to generate intermediate plasmid pOO#1 Nco.DELTA..
[0301] 3. pOO#1 Nco.DELTA.DNA was digested with EcoRV, and the
blunt ends were ligated to ClaI linkers having the sequence
CATCGATG. An E. coli transformant harboring a plasmid having a new
ClaI site at the position of the previous EcoRV site was
identified, and the plasmid was named pOO#1
Nco.DELTA.RV>Cla.
[0302] 4. DNA of pOO#1 Nco.DELTA.RV>Cla DNA was digested with
ClaI and NcoI, and the small (268 bp) fragment was purified from an
agarose gel. This fragment was then ligated to the 3429 bp
ClaI/NcoI fragment of pUC13/35S(-343) prepared above in step 1, and
an E. coli transformant that harbored a plasmid having ClaI/NcoI
fragments 3429 and 268 bp was identified. This plasmid was named
pUC13/35S En.
[0303] 5. pUC 13/35S En DNA was digested with NcoI, and the
protruding ends were made blunt by treatment with T4 DNA
polymerase. The treated DNA was then cut with SmaI, and was ligated
to BglII linkers having the sequence CAGATCTG. An E. coli
transformant that harbored a plasmid in which the 416 bp SmaI/NcoI
fragment had been replaced with at least two copies of the BglII
linkers was identified, and named p35S En.sup.2. [NOTE: The
tandomization of these BgalII linkers generate, besides BglII
recognition sites, also PstI recognition sites, CTGCAG].
[0304] The DNA structure of p35s En.sup.2 is as follows: Beginning
with the nucleotide that follows the third C residue of the SmaI
site on the strand contiguous to the noncoding strand of the lacZ
gene of pUC13; the linker sequence CAGATCTGCAGATCTGCATGGGCGATG (SEQ
ID NO 28), followed by CaMV nucleotides 7090 to 7344, followed by
the ClaI linker sequence CATCGATG, followed by CaMV nucleotides
7089 to 7443, followed by the HindIII linker sequence CAAGCTT,
followed by the rest of pUC13 sequence. This stricture has the
feature that the enhancer sequences of the CaMV 35S promoter, which
lie in the region upstream of the EcoRV site in the viral genome
(nts 7090 to 7344), have been duplicated. This promoter construct
incorporates the native 35S transcription start site, which lies 11
nucleotides upstream of the first A residue of the HindIII
site.
[0305] B. Plasmids Utilizing the 35S Promoter and the Agrobacterium
nos Poly A Sequences.
[0306] The starting material for the first construct is plasmid
pBI221, purchased from CLONTECH (Palo Alto, Calif.). This plasmid
contains a slightly modified copy of the CaMV 35S promoter, as
described in Bevan et al. (1985), Baulcombe et al. (1986).
Jefferson et al., (1986) and Jefferson (1987). Beginning at the 3'
end of the Pst I site of pUC19 (Yanisch-Perron et al.(1985)) and
reading on the same strand as that which encodes the lacZ gene of
pUC 19, the sequence is comprised of the linker nucleotides GTCCCC,
followed by CaMV nucleotides 6605 to 7439 (as described in 24A),
followed by the linker sequence
GGGGACTCTAGAGGATCCCCGGGTGGTCAGTCCCTT (SEQ ID NO29), wherein the
underlined bases represent the BamHI recognition sequence. These
bases are then followed by 1809 bp comprising the coding sequence
of the E. coli uidA gene, which encodes the .beta.-glucuronidase
(GUS) protein, and 55 bp of 3' flanking bases that are derived from
the E. coli genome (Jefferson, 1986), followed by the SacI linker
sequence GAGCTC, which is then followed by the linker sequence
GAATTTCCCC (SEQ D NO 30). These bases are followed by the RNA
transcription termination/polyadenylation signal sequences derived
from the Agrobacterium tumefaciens nopaline synthase (nos) gene,
and comprise the 256 bp Sau3A 1 fragment corresponding to
nucleotides 1298 to 1554 of DePicker et al. (1982), followed by two
C residues, the EcoRI recognition sequence GAATTC, and the rest of
pUC19.
[0307] 1. pBI221 DNA was digested with EcoRI and BamHI, and the
3507 bp fragment was purified from an agarose gel. pRAJ275
(CLONTECH, Jefferson, 1987) DNA was digested with EcoRI and SalI,
and the 1862 bp fragment was purified from an agarose gel. These
two fragments were mixed together, and complementary synthetic
oligonucleotides having the sequence GATCCGGATCCG (SEQ ID NO 31)
and TCGACGGATCCG (SEQ ID NO 32) were added. [These oligonucleotides
when annealed have protruding single-stranded ends compatible with
the protruding ends generated by BamHI and SalI.] The fragments
were ligated together, and an E.coli transformant harboring a
plasmid having the appropriate DNA structure was identified by
restriction enzyme analysis. DNA of this plasmid, named pKS881, was
digested with BalI and EcoRI, and the 4148 bp fragment was isolated
from an agarose gel. DNA pBI221 was similarly digested, and the
1517 bp EcoRI/BalI fragment was gel purified and ligated to the
above pKA881 fragment, to generate plasmid pKA882.
[0308] 2. pKA882 DNA was digested with SacI, the protruding ends
were made blunt by treatment with T4' DNA polymerase, and the
fragment was ligated to synthetic BamHI linkers having the sequence
CGGATCCG. An E.coli transformant that harbored a plasmid having
BamHI fragments of 3784 and 1885 bp was identified and named
pKA882B.
[0309] 3. pKA882B DNA was digested with BamHI, and the mixture of
fragments was ligated. An E.coli transformant that harbored a
plasmid that generated a single 3783 bp fragment upon digestion
with BamHI was identified and named p35S/nos. This plasmid has the
essential DNA structure of pBI221, except that the coding sequences
of the GUS gene have been deleted. Therefore, CaMV nucleotides 6605
to 7439 are followed by the linker sequence
GGGGACTCTAGAGGATCCCGATTTCCCC (SEQ ID NO 33), where the single
underlined bases represent an XbaI site, and the double underlined
bases represent a BamHI site. The linker sequence is then followed
by the nos Polyadenylation sequences and the rest of pBI221.
[0310] 4. p35/nos DNA was digested with EcoRV and PstI, and the
3037 bp fragment was purified and ligated to the 534 bp fragment
obtained from digestion of p35S En.sup.2 DNA with EcoRV and PstI.
An E. coli transformant was identified that harbored a plasmid that
generated fragments of 3031 and 534 bp upon digestion with EcoRV
and PstI, and the plasmid was named p35S En.sup.2/nos. This plasmid
contains the duplicated 35S promoter enhancer region described for
p35S En.sup.2 in Example 24A Step 5, the promoter sequences being
separated from the nos polyadenylation sequences by linker
sequences that include unique XbaI and BamHI sites.
[0311] C. Construction of a Synthetic Untranslated Leader.
[0312] This example describes the molecular manipulations used to
construct a DNA fragment that includes sequences which comprise the
5' untranslated leader portion of the major rightward transcript of
the Maize Streak Virus (MSV) genome. The MSV genomic sequence was
published by Mullineaux et al., (1984), and Howell (1984), and the
transcript was described by Fenoll et al. (1988). The entire
sequence, comprising 154 bp, was constructed in three stages (A, B,
and C) by assembling blocks of synthetic oligonucleotides.
[0313] 1. The A Block: Complementary oligonucleotides having the
sequence GATCCAGCTGAAGGCTCGACAAGGCAGATCCACGGAGGAGCTGATATTTGGTGG ACA
(SEQ ID NO 34) and
AGCTTGTCCACCAAATATCAGCTCCTCCGTGGATCTGCCTTGTCCAGCCTTCAGC TG (SEQ ID
NO 35) were synthesized and purified by standard procedures.
Annealing of these nucleotides into double-stranded structures
leaves 4-base single stranded protruding ends [hereinafter referred
to as "sticky ends"] that are compatible with those generated by
BamHI on one end of the molecule (GATC), and with HindIII-generated
single stranded ends on the other end of the molecule (AGCT). Such
annealed molecules were ligated into plasmid Bluescript.RTM. II
SK.sup.- that had been digested with BamHI and HindIII. The
sequence of these oligonucleotides is such that, when ligated onto
the respective BamHI and HindIII sticky ends, the sequences of the
respective recognition sites are maintained. An E. coli
transformant harboring a plasmid containing the oligonucleotide
sequence was identified by restriction enzyme analysis, and the
plasmid was named pMSV A.
[0314] 2. The B Block: Complementary oligonucleotides having the
sequences AGCTGTGGATAGGAGCAACCCTATCCCTAATATACC
AGCACCACCAAGTCAGGGCAATCCCGGG (SEQ ID NO 36) and
TCGACCCGGGATTGCCCTGACTTGGTGGTGCTGGTATATTAGGGATAGGGTTGCT CCTATCCAC
(SEQ ID NO 37) were synthesized and purified by standard
procedures. The underlined bases represent the recognition sequence
for restriction enzymes SmaI and XmaI. Annealing of these
nucleotides into double-stranded structures leaves abase sticky
ends that are compatible with those generated by HindIII on one end
of the molecule (AGCT), and with SalI-generated sticky ends on the
other end of the molecule (TCGA). The sequence of these
oligonucleotides is such that, when ligated onto the HindIII sticky
ends, the recognition sequence for HindIII is destroyed.
[0315] DNA of pMSV A was digested with HindIII and SalI, and was
ligated to the above annealed oligonucleotides. An E. coli
transformant harboring a plasmid containing the new
oligonucleotides was identified by restriction enzyme site mapping,
and was named pMSV AB.
[0316] 3. The C Block: Complementary oligonucleotides having the
sequences CCGCCCCATTTGTTCCCGGCACGGGATAAGCATTCAGCCATGGGATATCAAGCT
TGGATCCC (SEQ ID NO 38) and
TCGAGGGATCCAAGCTTGATATCCCATGGCTGAATGCTTATCCCGTGCCTGGAAC AAATGGC
(SEQ ID NO 39) were synthesized and purified by standard
procedures. The oligonucleotides incorporate bases that comprise
recognition sites (underlined) for NcoI (CCATGG), EcoRV (GATATC),
HindIII (AAGCTT), and BamHI (GGATCC). Annealing of these
nucleotides into double-stranded structures leaves 4-base sticky
ends that are compatible with those generated by XmaI on one end of
the molecule (CCGG), and with XhoI-generated sticky ends on the
other end of the molecule (TCGA). Such annealed molecules were
ligated into pMSV AB DNA that had been digested with XmaI and XhoI.
An E.coli transformant harboring a plasmid containing the
oligonucleotide sequence was identified by restriction enzyme
analysis, and DNA structure was verified by sequence analysis. The
plasmid was named pMSV CPL; it contains the A, B and C blocks of
nucleotides in sequential order ABC. Together, these comprise the
5' untranslated leader sequence ("L") of the MSV coat protein
("CP") gene. These correspond to nucleotides 167 to 186, and 188 to
317 of the MSV sequence of Mullineaux et al., (1984), and are
flanked on the 5' end of the BamHI linker sequence GGATCCAG, and on
the 3' end by the linker sequence GATATCAAGCTTGGATCCC (SEQ ID NO
40). [Note: An A residue corresponding to base 187 of the wild type
MSV sequence was inadvertently deleted during cloning.]
[0317] 4. BglII Site Insertion: pMSV CPL DNA was digested at the
SmaI site corresponding to base 277 of the MSV genomic sequence,
and the DNA was ligated to BglII linkers having the sequence
CAGATCTG. An E.coli transformant harboring a plasmid having a
unique BglII site at the position of the former Sma I site was
identified and verified by DNA sequence analysis, and the plasmid
was named pCPL-Bgl.
[0318] D. Construction of a Deleted Version of the Maize Alcohol
Dehydrogenase 1 (Adh1) Intron 1
[0319] The starting material is plasmid pVW119, which was obtained
from V. Walbot, Stanford University, Stanford, Calif. This plasmid
contains the DNA sequence of the maize Adh1.S gene, including
intron 1, from nucleotides 119 to 672 [numbering of Dennis et al.
(1984)], and was described in Callis et al. (1987). In pVW119, the
sequence following base 672 of Dennis et al. (1984) is GACGGATCC,
where the underlined bases represent a BamHI recognition site. The
entire intron 1 sequence, with 14 bases of exon 1, and 9 bases of
exon 2. can be obtained from this plasmid on a 556 bp fragment
following digestion with BclI and BamHI.
[0320] 1. Plasmid pSG3525a(Pst) DNA was divested with BamHI and
BclI, and the 3430 bp fragment was purified from an agarose gel.
[NOTE: The structure of plasmid pSG 3525a(Pst) is not directly
relevant to the end result of this construction series. It was
constructed during an unrelated series, and was chosen because it
contained restriction recognition sites for both BclI and BamHI,
and lacks HindIII and StuI sites. Those skilled in the art will
realize that other plasmids can be substituted at this step with
equivalent results.] DNA of plasmid pVW119 was digested with BamHI
and BclI, and the gel purified fragment of 546 bp was ligated to
the 3430 bp fragment. An E.coli transformant was identified that
harbored a plasmid that generated fragments of 3430 and 546 upon
digestion with BamHI and BclI. This plasmid was named pSG
AdhA1.
[0321] 2. DNA of pSG AdhA1 was digested with HindIII, [which cuts
between bases 209 and 210 of the Dennis et al., (1984) sequence,
bottom strand], and with StuI, which cuts between bases 554 and
555. The ends were made flush by T4 DNA polymerase treatment, and
then ligated. An E.coli transformant that harbored a plasmid
lacking HindIII and StuI sites was identified, and the DNA
structure was verified by sequence analysis. The plasmid was named
pSG AdhA1.DELTA.. In this construct, 344 bp of DNA have been
deleted from the interior of the intron 1. The loss of these bases
does not affect splicing of this intron. The functional intron
sequences are obtained on a 213 bp fragment following digestion
with BclI and BamHI.
[0322] 3. DNA of plasmid pCPL-Bgl (Example 24C Step 4), was
digested with BglII, and the linearized DNA was ligated to the 213
bp BclI/BamHI fragment containing the deleted version of the Adh1.S
intron sequences from pSG AdhA1.DELTA.. [Note: The sticky ends
generated by digestion of DNA with BglII, BclI, and BamHI are
compatible, but ligation of the BamHI or BclI sticky ends onto ones
generated by BglII creates a sequence not cleaved by any of these
three enzymes.] An E.coli transformant was identified by
restriction enzyme site mapping that harbored a plasmid that
contained the intron sequences ligated into the BglII site, in the
orientation such that the BglII/BclI juncture was nearest the 5'
end of the MSV CPL leader sequence, and the BglII/BamHI juncture
was nearest the 3' end of the CPL. This orientation was confirmed
by DNA sequence analysis. The plasmid was named pCPL AlIl.DELTA..
The MSV leader/intron sequences can be obtained from this plasmid
by digestion with BamHI and NcoI, and purification of the 373 bp
fragment.
[0323] E. Construction of Plant Expression Vectors Based on the
Enhanced 35S Promoter, the MSV CPL, and the deleted version of the
Adh1 Intron 1
[0324] 1. DNA of plasmid p35S En.sup.2/nos was digested with BamHI,
and the 3562 bp linear fragment was ligated to a 171 bp fragment
prepared from pMSV CPL DNA digested with BamHI. This fragment
contains the entire MSV CPL sequence described in Example 7C. An
E.coli transformant was identified by restriction enzyme site
mapping that harbored a plasmid that contained these sequences in
an orientation such that the NcoI site was positioned near the nos
Poly A sequences. This plasmid was named p35S En.sup.2 CPL/nos. It
contains the enhanced version of the 35S promoter directly
continuous to the MSV leader sequences, such that the derived
transcript will include the MSV sequences in its 5' untranslated
portion.
[0325] 2. DNA of plasmid pKA882 (see Example 24B Step 1) was
digested with HindIII and NcoI, and the large 4778 bp fragment was
ligated to an 802 bp HindIII/NcoI fragment containing the enhanced
35S promoter sequences and MSV leader sequences from p35S En
CPL/nos. An E.coli transformant harboring a plasmid that contained
fragments of 4778 and 802 bp following digestion with HindIII and
NcoI was identified, and named pDAB310. In this plasmid, the
enhanced version of the 35S promoter is used to control expression
of the GUS gene. The 5' untranslated leader portion of the
transcript contains the leader sequence of the MSV coat protein
gene.
[0326] 3. DNA of plasmid pDAB310 was digested with NcoI and Sac I.
The large 3717 bp fragment was purified from an agarose gel and
ligated to complementary synthetic oligonucleotides having the
sequences CGGTACCTCGAGTTAAC (SEQ ID NO 41) and
CATGGTTAACTCGAGGTACCGAGCT (SEQ ID NO 42). These oligonucleotides,
when annealed into double stranded structures, generate molecules
having sticky ends compatible with those left by SacI, on one end
of the molecule, and with NcoI on the other end of the molecule. In
addition to restoring the sequences of the recognition sites for
these two enzymes, new sites are formed for the enzymes KpnI
(GGTACC), XhoI (CTCGAG), and HpaI (GTTAAC). An E. coli transformant
was identified that harbored a plasmid that contained sites for
these enzymes, and the DNA structure was verified by sequence
analysis. This plasmid was named pDAB1148.
[0327] 4. DNA of plasmid pDAB1148 was digested with BamHI and NcoI,
the large 3577 bp fragment was purified from an agarose gel and
ligated to a 373 bp fragment purified from pCPL AlIl_(Example 24D
Step 3) following digestion with BamHI and NcoI. An E.coli
transformant was identified that harbored a plasmid with BamHI and
NcoI, and the plasmid was named pDAB303. This plasmid has the
following DNA structure: beginning with the base after the final G
residue of the PstI site of pUC19 (base 435), and reading on the
strand contiguous to the coding strand of the lacZ gene, the linker
sequence ATCTGCATGGGTG (SEQ ID NO 43), nucleotides 7093to 7344 of
CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of
CaMV, the linker sequence GGGGACTCTAGAGGATCCAG (SEQ ID NO 44)
nucleotides 167 to 186 of MSV, nucleotides 188 to 277 of MSV, a C
residue followed by nucleotides 119 to 209 of Adh1.S, nucleotides
555 to 672 of maize Adh1.S, the linker sequence GACGGATCTG,
nucleotides 278 to 317 of MSV, the polylinker sequence
GTTACTCGAGGTACCGAGCTCGAATTTCCCC (SEQ ID NO 45) containing
recognition sites for HpaI, XhoI, KpnI, and SacI, nucleotides 1298
to 1554 of nos, and a G residue followed by the rest of the pUC19
sequence (including the EcoRI site). It is noteworthy that the
junction between nucleotide 317 of MSV and the long polylinker
sequence creates an NcoI recognition site.
[0328] 5. DNA of plasmid pDAB303 was digested with NcoI and SacI,
and the 3939 bp fragment was ligated to the 1866 bp fragment
containing the GUS coding region prepared from similarly digested
DNA of pKA882. The appropriate plasmid was identified by
restriction enzyme site mapping, and was named pDAB305. This
plasmid has the enhanced promoter, MSV leader and Adh1 intron
arrangement of pDAB303, positioned to control expression of the GUS
gene.
EXAMPLE 25
Plasmid pDAB354
[0329] All procedures were by standard methods as taken from
Maniatis et al., (1982).
[0330] Step 1: Plasmid pIC19R (Marsh et al., (1984) was digested to
completion with restriction enzyme SacI, the enzyme was inactivated
by heat treatment, and the plasmid DNA was ligated on ice overnight
with an 80-fold excess of nonphosphorylated oligonucleotide linker
having the sequence 5' GAGTTCAGGCTTTTTCATAGCT 3' (SEQ ID NO 46),
where AGCT is complementary to the overhanging ends generated by
SacI digestion. The linker-tailed DNA was then cut to completion
with enzyme HindIII, the enzyme was inactivated, and the DNA
precipitated with ethanol.
[0331] Step 2: Plasmid pLG62 contains a 3.2 Kb SalI fragment that
includes the hygromycin B phosphotransferase (resistance) gene as
set forth in Gritz and Davies (1983). One microgram of these
fragments was isolated from an agarose gel and digested to
completion with restriction enzyme Hph I to generate fragments of
1257 bp. The enzyme was inactivated, and the 3' ends of the DNA
fragments were resected by treatment with T4 DNA polymerase at
37.degree. for 30 min in the absence of added deoxynucleotide
triphosphates.
[0332] Step 3: Following inactivation of the polymerase and ethanol
precipitation of the DNA, the fragments prepared in Step 2 were
mixed in Nick Translation Salts (Maniatis et al., 1982) with the
linker-tailed vector prepared in Step 1, heated 5 min at
65.degree., and slowly cooled to 37.degree.. The non-annealed ends
were made blunt and single-stranded regions filled in by treatment
with the Klenow fragment of Escherichia coli DNA polymerase by
incubation at 37.degree. for 45 min, and then the mixture was
ligated overnight at 15.degree.. Following transformation into E.
coli MC1061 cells and plating on LB agar with 50 .mu.g each of
ampicillin and hygromycin B, an isolate was identified that
contained a plasmid which generated appropriately-sized fragments
when digested with EcoRI, PstI, or HincII. DNA sequence
determination of a portion of this plasmid (pHYG1) revealed the
sequence 5' AGATCTCGTGAGATATGAAAAAG 3', (SEQ ID NO 47) where the
underlined ATG represents the start codon of the hygromycin B
resistance gene, and AGATCT is the BglII recognition sequence. In
pHYG1, downstream of the hygromycin B resistance coding region, are
about 100 bases of undetermined sequence that were deleted in the
next step.
[0333] Step 4: DNA of plasmid pHYG1 was digested to completion with
restriction enzyme BamHI, and the linear fragment thus produced was
partially digested with ScaI. Fragments of 3644 bp were isolated
from an agarose gel and ligated to phosphorylated, annealed
complementary oligonucleotides having the sequences:
22 5' ACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAAT (SEQ ID
NO 48) AGTAAGAGCTCGG 3', and 5'
GATCCCGAGCTCTTACTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGT (SEQ ID NO
49) TTCCACTATCGGCGAGT 3'.
[0334] When annealed, these oligonucleotides have a protruding
4-base overhang on one end that is complementary to that generated
by BamHI. Following transformation of the ligation mixture into E.
coli DH5.alpha. cells and selection on LB media containing 50
.mu.g/ml of ampicillin, a transformant was identified that
contained a plasmid which generated expected fragments when
digested with BamHI, BglII, EcoRI, or SacI. This plasmid was named
pHYG1 3'.DELTA.. The sequence of this plasmid downstream from the
stop codon of the hygromycin B resistance coding region (underlined
TAG in above sequence: Gritz and Davies, 1983) encodes the
recognition sequence for SacI.
[0335] Step 5. DNA of plasmid pDAB309 was digested to completion
with restriction enzyme BsmI, and the ends were made blunt by
treatment with T4 DNA polymerase. Plasmid pDAB309 has the same
basic structure as pDA305 described elsewhere herein, except that a
kanamycin resistance (NPTII) coding region is substituted for the
GUS coding region present in pDAB305. This DNA was then ligated to
phosphorylated, annealed oligonucleotide BglII linkers having the
sequence 5' CAGATCTG 3'. A transformed colony of DH5.alpha. cells
harboring a plasmid that generated appropriately-sized fragments
following BglII digestion was identified. This plasmid was named
pDAB309(Bg). DNA of plasmid pDAB309(Bg) was cut to completion with
SacI, and the linearized fragments were partially digested with
BglII. Fragments of 3938 bp (having ends generated by BglII and
SacI) were isolated from an agarose gel.
[0336] Step 6. DNA of plasmid pHYG1 3'.DELTA. was digested to
completion with BglII and SacI. The 1043 bp fragments were isolated
from an agarose gel and ligated to the 3938 bp BglII/SacI fragments
of pDAB309(Bg) prepared above. After transformation into E. coli
DH5.alpha. cells and selection on ampicillin, a transformant was
identified that harbored a plasmid which generated the
appropriately-sized restriction fragments with BglII plus SacI,
PstI, or EcoRI. This plasmid was named pDAB354. Expression of the
hygromycin B resistance coding region is placed under the control
of essentially the same elements as the GUS coding region in
pDAB305.
EXAMPLE 26
Plasmid pDeLux
[0337] Production of the GUS protein from genes controlled by
different promoter versions was often compared relative to an
internal control gene that produced firefly luciferase. DeWet et al
(1987). A plasmid (pT3/T7-1 LUC) containing the luciferase (LUC)
coding region was purchased from CLONTECH (Palo Alto, Calif.), and
the coding region was modified at its 5' and 3' ends by standard
methods. Briefly, the sequences surrounding the translational start
(ATG) codon were modified to include an NcoI site (CCATGG) and an
alanine codon (GCA) at the second position. At the 3' end, an Ssp I
recognition site positioned 42 bp downstream of the Stop codon of
the luciferase coding region was made blunt ended with T4 DNA
polymerase, and ligated to synthetic oligonucleotide linkers
encoding the BgalII recognition sequence. These modifications
permit the isolation of the intact luciferase coding region on a
1702 bp fragment following digestion by NcoI and BglII. This
fragment was used to replace the GUS gene of plasmid pDAB305 (see
Example 24E, step 5), such that the luciferase coding region was
expressed from the enhanced 35S promoter, resulting in plasmid
pDeLux. The 5' untranslated leader of the primary transcript
includes the modified MSV leader/Adh intron sequence.
EXAMPLE 27
Plasmid pDAB367
[0338] Plasmid pDAB367 has the following DNA structure: beginning
with the base after the final C residue of the SphI site of pUC 19
(base 441), and reading on the strand contiguous to the LacZ gene
coding strand, the linker sequence
CTGCAGGCCGGCCTTAATTAAGCGGCCGCGTTTAAACGCCCGGGCATTTAAATGGC
GCGCCGCGATCGCTTGCAGATCTGCATGGGTG (SEQ ID NO 50), nucleotides 7093
to 7344 of CaMV DNA (Frank et al. (1980)), the linker sequence
CATCGATG, nucleotides 167 to 186 of MSV (Mullineaux et al. (1984)),
nucleotides 188 to 277 of MSV (Mullineaux et al. (1984)), a C
residue followed by nucleotides 119 to 209 of maize Adh 1S
containing parts of exon 1 and intron 1 (Denis et al. (1984)),
nucleotides 555 to 672 containing parts of Adh 1S intron 1 and exon
2 (Denis et al. (1984)), the linker sequence GACGGATCTG (SEQ ID NO
51), and nucleotides 278 to 317 of MSV. This is followed by a
modified BAR coding region from pIJ4104 (White et al. (1990))
having the AGC serine codon in the second position replaced by a
GCC alanine codon, and nucleotide 546 of the coding region changed
from G to A to eliminate a BglII site. Next the linker sequence
TGAGATCTGAGCTCGAATTTCCCC (SEQ ID NO 52), nucleotides 1298 to 1554
of nos (DePicker et al. (1982)), and a G residue followed by the
rest of the pUC19 sequence (including the EcoRI site.).
EXAMPLE 28
Plasmid pDAB1518
[0339] pDAB 1518 has the following DNA structure: the sequence
CCGCGG, bases -899 to +1093 of the maize ubiquitin 1 (Ubi1)
promoter and Ubi1 intron 1 described by Christensen et al. (1992),
a polylinker consisting of the sequence GGTACCCCCCGGGTCGACCATGG
(SEQ ID NO: 53) (containing restriction sites for KpnI, SmaI, SalI,
and NcoI, with the NcoI site containing the translational fusion
ATG). bases 306-2153 of the .beta.-glucuronidase gene from pRAJ920
described by Jefferson et al. (1986), the sequence
GGCTTGGAGCTCGAATTTCCCC (SEQ ID NO: 54), bases 1298 to 1554 of nos
(Depicker et al. (1982)), and the sequence GGGAAATTAAGCTT (SEQ ID
NO: 55), followed by pUC 8 (Yanisch-Perron et al., 1985) sequence
from base 398 to base 399 (reading on the strand opposite to the
strand contiguous to the LacZ gene coding strand).
EXAMPLE 29
Plasmid pDAB1538
[0340] pDAB1538 has the following DNA structure: the sequence
AGCGGCCGCATTCCCGG
GAAGCTTGCATGCCTGCAGAGATCCGGTACCCGGGGATCCTCTAGAGTCGAC (SEQ ID NO:
56), bases -899 to +1093 of the maize ubiquitin 1 (Ubi1) promoter
and Ubi1 intron 1 described by Christensen et al. (1992), a
polylinker consisting of the sequence
GGTACCCCCGGGGTCGACCATGGTTAAACTCGAGG- TACCGAGCTCGAATTTCCCC (SEQ ID
NO: 57), bases 1298 to 1554 of nos (Depicker et al. (1982)), and
the sequence GGGAATTGGTTTAAACGCGGCCGCTT (SEQ ID NO:58), followed by
pUC19 (Yanisch-Perron et al., 1985) sequence starting at base 400
and ending at base 448 (reading on the strand opposite to the
strand contiguous to the LacZ gene coding strand). The NcoI site in
the Ubi1 sequence beginning at base 143 was replaced by the
sequence CCATGCATGG (SEQ ID NO:59).
References
[0341] Anderson (1984), Science, 226:401.
[0342] Armstrong et al. (1991), Maize Genet. Coop. New Lett.
65:92.
[0343] Austin. G. D. (1994). U.S. Pat. No. 5,362,865.
[0344] Ausubel et al. (1987) Current Protocols in Molecular
Biology, John Wiley and Sons, New York, N.Y.
[0345] Baulcombe et al., (1986). Nature 321:446-449.
[0346] Beaucage et al. ( 1981), Tetrahedron Letters, 22:
1859-1962).
[0347] Benfey P. N., L. Ren and N.-H. Chua. (1989), EMBO Journal
8:2195-2202.
[0348] Benfey, P. N. and Nam-Hai Chua. (1990), Science
250:959-966.
[0349] Bevan et al. (1985), EMBO J. 4:1921-1926.
[0350] Bevan et al. (1986) Nucleic Acids Res. 14 (11),
4675-4638.
[0351] Bohimann and Apel (1991). Annu. Rev. Plant Physiol Plant
Mol. Biol., 42:227-240.
[0352] Bradford (1976) Anal. Biochem. 72: 248-254.
[0353] Brewbaker et al. (1985), Journal of Heredity,
76:159-167.
[0354] Buffard et al. (1990), Proc. Natl. Acad. Sci.,
87:8874-8878.
[0355] Callis J., M. Fromm, and V. Walbot. (1987), Gene Dev. 1:1183
-1200.
[0356] Cammue et al. (1992), J. Biol. Chem, 267:2278-2223.
[0357] Caruthers (1983) in: Methodology of DNA and RNA, (ed.)
Weissman.
[0358] Christensen. et al. (1992) Plant Mol. Biol. 18: 675-689.
[0359] Chu (1978), Proc. Symp. Plant Tissue Culture, Peking Press,
p43-56.
[0360] Conkling et al. (1990), Plant Physiol., 93(3),
1203-1211.
[0361] Crossway, et al. (1986), Mol. Gen. Genet. 202:179-185.
[0362] Croy, et al., WO 9113992
[0363] Datla, R. S. S. et al. (1993), Plant Science 94:139-149.
[0364] De Framond, EPO Application Number 452 269
[0365] Deikman et al. (1988), Embo J. 7 (11) 3315.
[0366] Dennis et al. (1984), Nucl. Acids Res. 12:3983-4000.
[0367] DePicker et al. (1982), J. Molec. Appl. Genet. 1:
561-573.
[0368] DeWet et al. (1987), Molec. Cell Biol. 7:725-737.
[0369] Dityatkin, et al. (1972), Biochimica et Biophysica Acta,
281:319-323.
[0370] EPO 0 405 696.
[0371] Erlich (ed.)(1989)). PCR Technology: Principles and
Applications for DNA Amplification.
[0372] Fenoll et al. (1983), EMBO J. 7: 1589-1596.
[0373] Fraley, et al. (1986). CRC Crit. Rev. Plant Sci.,
4:1-46.
[0374] Frank et al. (1980) Cell 21:285-294.
[0375] Fu et al. (1995), The Plant Cell, 7:1387-1394.
[0376] Fujiyama et al. (1988), Eur. J. Biochem., 173:681-687.
[0377] Gallie et al. (1989), The Plant Cell, 1:301-311.
[0378] Gamborg et al. (1968), Exp. Cell Res. 50: 151-158.
[0379] Gaspar et al. (1982), Peoxidases: A Survey of Their
Biochemical and Physiological Roles in Higher Plant (Univ. of
Geneva Press. Geneva).
[0380] Gritz et al. (1983), Gene 25:179-188.
[0381] Grunstein, M. (1992), Scientific American, October
68-74.
[0382] Hertig, et al. (1991), Plant Mol. Biol., 16:171-174.
[0383] Hiatt, et al. (1989), Nature, 342:76-78.
[0384] Higuchi et al. (1988), Nucl. Acids Res., 16:7351.
[0385] Higuchi et al. (1988), Nucl. Acids Res., 16:7351-7367.
[0386] Ho et al. (1989), Gene, 77:51-59.
[0387] Hofte and Whitely (1989), Microbiol. Rev., 53:242-255.
[0388] Horton et al. (1989), Gene, 77:61.
[0389] Howell (1984). Nucl. Acids Res. 12:7359-7375.
[0390] Hultmark et al. (1982), EUR. J. Biochem., 127:207-217.
[0391] Hultmark et al. (1983), EMBO J., 2:571-576.
[0392] Jackson and Standart (1990), Cell 62:15-24.
[0393] Jefferson (1987) Plant Molec. Biol. Reporter 5:387.
[0394] Jefferson et al. (1986), Proc. Natl. Acad. Sci.
83:8447-8451.
[0395] Jefferson et al. (1987), EMBO J. 6: 3901.
[0396] Kaiser et al. (1987), Ann. RevBiophys. Biophys. Chem.,
16:561-581).
[0397] Kat et al. (1987), Science 236:1299.
[0398] Katsu et al. (1988), Biochim. Biophys. Acta, 939:57-63.
[0399] Kay et al. (1987), Science 236 1299-1302.
[0400] Knott et al. (1985), Science, 230:37.
[0401] Knowles et al. (1987), Biochim. Biophys. Acta
924:509-518.
[0402] Kozak (1986), Cell 44:283-2929
[0403] Kriz. A. L. et al. (1987), Molecular and General Genetics
207: 90-98.
[0404] Lagrimini et al. (1987), Plant Physiol., 84:438-442.
[0405] Lagrimini et al. (1987), Proc. Natl. Acad. Sci.,
84:7542-7546. MD.
[0406] Lee, K. and A. H. C. Huang. (1994), Plant Molecular Biology,
26:1981-1987.
[0407] Lewah et al. (1991). J. Biol. Chem., 266:1564-1573.
[0408] Li et al. (1993), Plant Cell Rep. 12: 250-255.
[0409] Linthorst (1991), Critical Rev. Plant Sci., 10:123-150.
[0410] Lis et al. (1986). Ann. Rev. Biochem., 55:35-68.
[0411] Luehrsen, K. R. and V. Walbot. (1994), Plant Cell Reports
13:454-458.
[0412] Mandel and Higa (1972), J. Mol. Biol., 53:159.
[0413] Maniatis et al., eds. (1982) Molecular Cloning, First
Edition, Cold Spring Harbor Press.
[0414] Marsh et al. (1984), Gene 32:481.
[0415] Matzke et al. (1993), Ann. Rev. Plant Physiol. Plant Mol.
Biol. 44: 53-76.
[0416] Mazza and Welinder (1980), Eur. J. Biochem. 108:481-489.
[0417] McElroy, D. and R. S. Brettell. (1994), Trends Biotechnology
12:62-68.
[0418] Messing et al. (1983) in:Genetic Engineering of Plants,
(Kosuga et al. eds.), Plenum Press, pp. 211-227).
[0419] Miller, et al. (1988), Proc. Natl. Acad. Sci. USA,
85:856-860;
[0420] Morgens et al. (1990), Plant Mol. Biol., 14:715.
[0421] Mullineaux et al. (1984),
[0422] EMBO J. 3:3063.
[0423] Mullis et al. (1987), Meth. Enz., 155:335.
[0424] Murashige and Skoog (1962), Physiol. Plant, 15: 473.
[0425] Nakagawa et al., (1985) J. Am. Chem. Soc., 107:7087;
[0426] Nakamura et al. (1988), Plant Physiol., 88:845.
[0427] Odell et al. (1985), Nature 313: 810-812.
[0428] Oiki et al. (1988), PNAS USA, 85:2393-2397.
[0429] Pain (1986), Biochem. J., 235:625-637.
[0430] Pear et al. (1989), Plant Mol. Biol. 13: 639.
[0431] Powell, et al (1988), Appl. Environ. Microbiol.,
54:655-660.
[0432] Raju, S. S. D. et al (1993), Plant Science 94: 139-149.
[0433] Rothnie et al. (1994), EMBO Journal, 13:2200-2210.
[0434] Ryan (1990), Annu Rev. Phytopathol., 28:425.
[0435] Saghai-Maroof et al. (1984), Proc. Natl. Acad. Sci. USA
51:8014.
[0436] Samac et al. (1990), Plant Physiol. 93: 907-914
[0437] Sambrook et al. (1989), Molecular Cloning: A Laboratory
Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor,
N.Y.
[0438] Shigaekawa and Dower (1988), Biotechniques, 6:742.
[0439] Southern, E. (1975), J. Mol. Biol. 98:503.
[0440] Southern, E. (1980), Methods Enzymol. 69:152.
[0441] Sullivan, M. L. and P. Green (1993), Plant Molecular Biology
23: 1091-1104.
[0442] Tierney et al. (1987), Planta 172: 356.
[0443] Tobkes et al. (1985), Biochem. 24:1915-1920.
[0444] Uchidaz, et al. (1980), in: Introduction of Macromolecules
Into Viable Mammalian Cells, (Baserga et al. ,eds.) Wistar
Symposium Series, Vol. 1, A. R. Liss Inc., N.Y, pp. 169-185.
[0445] Uchimiya, et al. (1982), in: Proc. 5th Intl. Cong. Plant
Tissue and Cell Culture, (Fujiwara, ed.), Jap. Assoc. for Plant
Tissue Culture, Tokyo, 507.
[0446] Vain, P. et al. (1996), Plant Cell Reports 15:489-494.
[0447] Vain et al. (1993), Plant Cell Rep. 12: 84.
[0448] Van Parijis et al. (1991), Planta, 183:258.
[0449] Vigers et al. (1992), Plant Sci., 83:155.
[0450] Viret, J.-F. et al. (1994), Proc. Nat Acad. Sci.
91:8577-8581.
[0451] Walbot et al. (1991), ISPMB Third International Congress,
Tucson, Ariz. Abstract No. 30.
[0452] White et al. (1990), Nucl. Acids. Res. 18: 1062.
[0453] Wigler, et al. (1979), Cell, 16:77.
[0454] Wilmink et al. (1995), Plant Molecular Biology
28:949-955.
[0455] Woloscuk et al. (1991), The Plant Cell, 3:619-628.
[0456] Xu et al (1994), Plant Physiol. 106:459-467.
[0457] Yamamoto et al. (1991), Plant Cell, 3(4):371-382.
[0458] Yanisch-Perron et al.(1985), Gene 33:103- 119.
[0459] Zasloff (1987), PNAS USA, 84:5449-5453.
[0460] Zoller et al. (1984), DNA, 3:479.
Sequence CWU 1
1
* * * * *