U.S. patent application number 10/782129 was filed with the patent office on 2004-07-22 for artificial chromosomes, uses thereof and methods for preparing artificial chromosomes.
Invention is credited to Hadlaczky, Gyula, Szalay, Aladar A..
Application Number | 20040143861 10/782129 |
Document ID | / |
Family ID | 24524639 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040143861 |
Kind Code |
A1 |
Hadlaczky, Gyula ; et
al. |
July 22, 2004 |
Artificial chromosomes, uses thereof and methods for preparing
artificial chromosomes
Abstract
Methods for preparing cells that contain artificial chromosomes,
methods for preparation of artificial chromosomes, methods for
purification of artificial chromosomes, methods for targeted
insertion of heterologous DNA into artificial chromosomes, and
methods for delivery of the chromosomes to selected cells and
tissues are provided. Also provided methods for producing
transgenic plants and animals using the artificial chromosomes and
the resulting transgenic organisms are provided.
Inventors: |
Hadlaczky, Gyula; (Szamos,
HU) ; Szalay, Aladar A.; (Highland, CA) |
Correspondence
Address: |
STEPHANIE SEIDMAN
FISH & RICHARDSON
12390 EL CAMINO REAL
SAN DIEGO
CA
92130-2081
US
|
Family ID: |
24524639 |
Appl. No.: |
10/782129 |
Filed: |
February 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10782129 |
Feb 18, 2004 |
|
|
|
09096648 |
Jun 12, 1998 |
|
|
|
6743967 |
|
|
|
|
09096648 |
Jun 12, 1998 |
|
|
|
08629822 |
Apr 10, 1996 |
|
|
|
Current U.S.
Class: |
800/14 ; 119/300;
800/19; 800/20; 800/21; 800/8 |
Current CPC
Class: |
A01K 2217/05 20130101;
C12N 2800/206 20130101; A61K 38/00 20130101; C12N 15/8509 20130101;
C12N 2830/002 20130101; C12N 2800/20 20130101; A01K 2267/0337
20130101; A61K 48/00 20130101; A01K 2227/10 20130101; C07K 2319/61
20130101; A01K 2227/40 20130101; A01K 67/0275 20130101; A01K
2227/105 20130101; C12N 15/82 20130101; A01K 2267/03 20130101; C12N
2310/111 20130101; C12N 15/625 20130101; C12N 15/113 20130101; A01K
2267/01 20130101; C12N 15/85 20130101; A01K 2227/30 20130101; C12N
2800/208 20130101; C07K 2319/036 20130101 |
Class at
Publication: |
800/014 ;
800/019; 800/020; 800/021; 800/008; 119/300 |
International
Class: |
A01K 067/027; A01K
067/033 |
Claims
What is claimed:
1. A method for producing a transgenic non-human animal,
comprising: introducing a cell comprising a satellite artificial
chromosome into a female non-human animal, wherein the cell
develops into an embryo in a female non-human animal; and allowing
the embryo to develop into a transgenic non-human animal comprising
a satellite artificial chromosome.
2. The method of claim 1, wherein the satellite artificial
chromosome comprises heterologous DNA that encodes a therapeutic
product.
3. The method of claim 1, wherein the cell contains the satellite
artificial chromosome in a pronucleus.
4. The method of claim 1, wherein the cell is a zygote.
5. The method of claim 1, wherein the cell is a fertilized
ovum.
6. The method of claim 1, wherein the cell is an ovum that develops
into an embryo or zygote.
7. The method of claim 1, wherein the cell is a bird, mouse,
reptile, amphibian, insect or fish cell.
8. A method of producing a transgenic non-human animal embryo,
comprising: introducing a satellite artificial chromosome into a
cell, wherein the cell develops in culture into a non-human animal
embryo; and culturing the cell under conditions whereby it develops
into an embryo.
9. The method of claim 8, wherein the cell comprises a fertilized
oocyte, an ovum, a fertilized ovum or a zygote.
10. The method of claim 8, wherein the cell is a bird, mouse,
reptile, amphibian, insect, or fish cell.
11. The method of claim 1, wherein the satellite artificial
chromosome is isolated prior to introduction into the cell.
12 The method of claim 1, wherein the satellite artificial
chromosome is introduced into the cell by a method selected from
the group consisting of direct uptake, incubation with polyethylene
glycol (PEG), lipofection, microinjection, cell fusion, microcell
fusion, electroporation, electrofusion, particle bombardment,
projectile bombardment, calcium phosphate precipitation and
site-specific targeting.
13. The method of claim 1, wherein the embryo and the female
non-human animal are of the same species.
14. A method for producing a transgenic non-human animal,
comprising: introducing an embryo comprising a satellite artificial
chromosome into a female non-human animal; and allowing the embryo
to develop into a transgenic non-human animal comprising a
satellite artificial chromosome.
15. The method of claim 14, wherein: the embryo is produced by
introducing a satellite artificial chromosome into a cell that
develops into an embryo; and introduction is effected by a method
selected from the group consisting of direct uptake, incubation
with polyethylene glycol (PEG), lipofection, microinjection, cell
fusion, microcell fusion, electroporation, electrofusion, particle
bombardment, projectile bombardment, calcium phosphate
precipitation and site-specific targeting.
16. The method of claim 15, wherein the cell is selected from the
group consisting of a bird, insect or fish cell.
17. The method of claim 15, wherein the embryo and the female
non-human animal are of the same species.
18. A method for producing a transgenic non-human animal,
comprising: introducing a fertilized oocyte comprising a satellite
artificial chromosome into a female non-human animal; and allowing
the resulting embryo to develop into a transgenic non-human animal
comprising a satellite artificial chromosome.
19. A method for producing a transgenic animal, comprising:
introducing an embryonic stem cell comprising a satellite
artificial chromosome into an embryo; introducing the embryo into a
female mouse; and allowing the embryo to develop into a transgenic
animal comprising a satellite artificial chromosome.
20. The method of claim 19, wherein the animal is a bird.
21. A method for producing a transgenic non-human animal,
comprising: introducing an ovum comprising a satellite artificial
chromosome (SATAC) into a female non-human animal, wherein the ovum
develops into a zygote or embryo; and allowing the embryo or zygote
to develop into a transgenic non-human animal comprising the
SATAC.
22. The method of claim 21, wherein the satellite artificial
chromosome is a megachromosome derived from a cell line having all
of the identifying characteristics of the cell line deposited under
ECACC accession number 96040928 or 96040929.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of allowed U.S.
application Ser. No. 09/096,648, filed Jun. 12, 1998, which is a
continuation of U.S. application Ser. No. 08/629,822, filed Apr.
10, 1996. Accordingly benefit of priority of both applications is
claimed.
[0002] This application is related to U.S. application Ser. No.
08/759,558, now U.S. Pat. No. 5,288,625 and to U.S. application
Ser. No. 08/375,271, filed Jan. 19, 1995, which is a continuation
of U.S. application Ser. No. 08/080,097, filed Jun. 23, 1993 which
is a continuation of U.S. application Ser. No. 07/892,487, filed
Jun. 3, 1992, which is a continuation of U.S. application Ser. No.
07/521,073, filed May 9, 1990.
[0003] The subject matter of each of the above-listed U.S.
applications is incorporated in its entirety by reference
thereto.
FIELD OF THE INVENTION
[0004] The present invention relates to methods for preparing cell
lines that contain artificial chromosomes, to methods for isolation
of the artificial chromosomes, targeted insertion of heterologous
DNA into the chromosomes, isolation of the chromosomes, and
delivery of the chromosomes to selected cells and tissues. Also
provided are cell lines for use in the methods, and cell lines and
chromosomes produced by the methods.
BACKGROUND OF THE INVENTION
[0005] Several viral vectors, non-viral, and physical delivery
systems for gene therapy have been developed (see, e.g., Mitani et
al. (1993) Trends Biotech. 11:162-166). The presently available
systems, however, have numerous limitations, particularly where
persistent, stable, or controlled gene expression is required.
These limitations include: (1) size limitations because there is a
limit, generally on order of about ten kilobases (kB), at most, to
the size of the DNA insert (gene) that can be accepted by viral
vectors, whereas a number of mammalian genes of possible
therapeutic importance are well above this limit, especially if all
control elements are included; (2) the inability to specifically
target integration so that random integration is required which
carries a risk of disrupting vital genes or cancer suppressor
genes; (3) the expression of randomly integrated therapeutic genes
may be affected by the functional compartmentalization in the
nucleus and are affected by chromatin-based position effects; (4)
the copy number and consequently the expression of a given gene to
be integrated into the genome cannot be controlled. Thus,
improvements in gene delivery and stable expression systems are
needed (see, e.g., Mulligan (1993) Science 260:926-932).
[0006] In addition, safe and effective gene therapy methods and
vectors should have numerous features that are not assured by the
presently available systems. For example, a safe vector should not
contain DNA elements that can promote unwanted changes by
recombination or mutation in the host genetic material, should not
have the potential to initiate deleterious effects in cells,
tissues, or organisms carrying the vector, and should not interfere
with genomic functions. In addition, it would be advantageous for
the vector to be non-integrative, or designed for site-specific
integration. Also, the copy number of therapeutic gene(s) carried
by the vector should be controlled and stable, the vector should
secure the independent and controlled function of the introduced
gene(s); and the vector should accept large (up to Mb size) inserts
and ensure the functional stability of the insert.
[0007] The limitations of existing gene delivery technologies,
however, argue for the development of alternative vector systems
suitable for transferring large (up to Mb size or larger) genes and
gene complexes together with regulatory elements that will provide
a safe, controlled, and persistent expression of the therapeutic
genetic material.
[0008] At the present time, none of the available vectors fulfill
these requirements. Some of these characteristics, however, are
possessed by chromosomes. Thus, an artificial chromosome would be
an ideal vector for gene therapy, as well as for production of gene
products that require coordination of expression of numerous genes
or that are encoded by large genes, and other uses. Artificial
chromosomes for expression of heterologous genes in yeast are
available, but construction of a mammalian artificial chromosome
has not been achieved. Such construction has been hindered by the
lack of an isolated, functional, mammalian centromere and
uncertainty regarding the requisites for its production and stable
replication. Unlike in yeast, there are no selectable genes in
close proximity to a mammalian centromere, and the presence of long
runs of highly repetitive pericentric heterochromatic DNA makes the
isolation of a mammalian centromere using presently available
methods, such as chromosome walking, virtually impossible. Other
strategies are required for production of mammalian artificial
chromosomes, and some have been developed. For example, U.S. Pat.
No. 5,288,625 provides a cell line that contains an artificial
chromosome, a minichromosome, that is about 20 to 30 megabases.
Methods provided for isolation of these chromosomes, however,
provide preparations of only about 10-20% purity. Thus, development
of alternative artificial chromosomes and perfection of isolation
methods as well as development of more versatile chromosomes and
further characterization of the minichromosomes is required to
realize the potential of this technology.
[0009] Therefore, it is an object herein to provide mammalian
artificial chromosomes and methods for introduction of foreign DNA
into such chromosomes. It is also an object herein to provide
methods for introduction of the artificial mammalian chromosome
into selected cells, and to provide the resulting cells, as well as
transgenic animals and plants that contain the artificial
chromosomes. It is also an object herein to provide methods for
gene therapy and expression of gene products using artificial
chromosomes. It is a further object herein to provide methods for
constructing species-specific artificial chromosomes.
SUMMARY OF THE INVENTION
[0010] Mammalian artificial chromosomes (MACs) are provided. Also
provided are artificial chromosomes for other higher eukaryotic
species, such as insects and fish, produced using the MACS are
provided herein. Methods for generating and isolating such
chromosomes. Methods using the MACs to construct artificial
chromosomes from other species, such as insect and fish species are
also provided. The artificial chromosomes are fully functional
stable chromosomes. Two types of artificial chromosomes are
provided. One type, herein referred to as SATACs (satellite
artificial chromosomes) are stable heterochromatic chromosomes, and
the another type are minichromosomes based on amplification of
euchromatin.
[0011] Artificial chromosomes permit targeted integration of
megabase pair size DNA fragments that contain single or multiple
genes. Thus methods using the MACs to introduce the genes into
cells, animals and tissues are also provided. The artificial
chromosomes with integrated heterologous DNA are to be used in
methods of gene therapy, in methods of production of gene products,
particularly products that require expression of multigene
biosynthetic pathways, and also are intended for delivery into the
nuclei of germline cells, such as embryo-derived stem cells (ES
cells) for production of transgenic animals.
[0012] Mammalian artificial chromosomes provide extra-genomic
specific integration sites for introduction of genes encoding
proteins of interest and permit megabase size DNA integration so
that, for example, genes encoding an entire metabolic pathway or a
very large gene, such as the cystic fibrosis (CF; .about.600 kb)
gene, several genes, such as a series of antigens for preparation
of a multivalent vaccine, can be stably introduced into a cell.
Vectors for targeted introduction of such genes, including the
tumor suppressor genes, such as p53, the cystic fibrosis
transmembrane regulator gene (CFTR), anti-HIV ribozymes, such as an
anti-HIV gag ribozyme, into the artificial chromosomes also
provided.
[0013] The chromosomes provided herein are generated by introducing
heterologous DNA that includes DNA encoding a selectable marker
into cells, preferably a stable cell line, growing the cells under
selective conditions, and identifying from among the resulting
clones those that include chromosomes with more than one centromere
or that have chromosomes that are fragments of chromosomes that had
more than one centromere. The amplification that produces the
additional centromere occurs in cells that contain chromosomes in
which the heterologous DNA has integrated near the centromere in
the pericentric region of the chromosome. The selected clonal cells
are then used to generate artificial chromosomes.
[0014] In preferred embodiments, the DNA with the selectable marker
that is introduced includes sequences that target it to the
pericentric region of the chromosome. For example, vectors, such as
pTEMPUD, which includes such DNA specific for mouse satellite DNA,
are provided. Also provided are derivatives of pTEMPUD that
specifically target human satellite sequences. Upon integration,
these vectors can induce the amplification.
[0015] Artificial chromosomes are generated by culturing the cells
with the dicentric chromosomes under conditions whereby the
chromosome breaks to form a minichromosome and formerly dicentric
chromosome. The artificial chromosomes (the SATACs) are generated,
not from the minichromosome fragment as, for example, in U.S. Pat.
No. 5,288,625, but from the fragment of the formerly dicentric
chromosome.
[0016] Among the MACs provided herein are the SATACs, which are
primarily made up of repeating units of short satellite DNA and are
fully heterochromatic, so that absent insertion of heterologous or
foreign DNA, the chromosomes do not contain genetic information.
They can thus be used as "safe" vectors for delivery of DNA to
mammalian hosts because they do not contain any potentially harmful
genes.
[0017] In addition to MACs methods for generating euchromatic
minichromsomes and the use thereof are also provided herein.
Methods for generating one type of MAC the minichromosome,
previously described in U.S. patent No. U.S. Pat. No. 5,288,625,
and the use thereof for expression of heterologous DNA are
provided. Cell lines containing the minichromosome and the use
thereof for cell fusion are also provided.
[0018] In one embodiment, a cell line containing the mammalian
minichromosome is used as recipient cells for donor DNA encoding a
selected gene or multiple genes. The donor DNA is linked to a
second selectable marker and is targeted to and integrated into the
minichromosome. The resulting chromosome is transferred by cell
fusion into an appropriate recipient cell line, such as a Chinese
hamster cell line (CHO). After large scale production of the cells
carrying the engineered chromosome, the chromosome is isolated. In
particular, metaphase chromosomes are obtained, such as by addition
of colchicine, and they are purified from the cell lysate. These
chromosomes are used for cloning, sequencing and for delivery of
heterologous DNA into cells.
[0019] Also provided are SATACs of various sizes that are formed by
repeated culturing under selective conditions and subcloning of
cells that contain chromosomes produced from the formerly dicentric
chromosomes. These chromosomes are based on repeating units 7.5 to
10 Mb referred to herein as megareplicons, that are tandem blocks
of satellite DNA flanked by heterologous non-satellite DNA.
Amplification produces a tandem array of identical chromosome
segments (each called an amplicon) that contain two inverted
megareplicons bordered by heterologous ("foreign") DNA. Repeated
cell fusion, growth on selective medium and/or BrdU
(5-bromodeoxyuridine) treatment or other genome destabilizing
reagent or agent, such as ionizing radiation, including X-rays, and
subcloning results in cell lines that carry stable heterochromatic
or partially heterochromatic chromosomes, including a 150-200 Mb
"sausage" chromosome, a 500-1000 Mb gigachromosome, a stable
250-400 Mb megachromosome and various smaller stable chromosomes
derived therefrom. These chromosomes are based on these repeating
units and can include heterologous DNA that is expressed.
[0020] Thus methods for producing MACs of both types are provided.
These methods are applicable to any higher eukaryotic cell,
including mammals, insects and plants.
[0021] The resulting chromosomes can be purified by methods
provided herein to provide vectors for introduction of the
heterologous DNA into selected cells for production of the gene
product encoded by the heterologous DNA, for production of
transgenic animals and plants or for gene therapy. Vectors for
chromosome fragmentation are provided. These vectors will be used
to produce an artificial chromosome that contains a megareplicon, a
centromere and two telomeres and will be between about 10 Mb and
about 60 Mb, preferably between about 10 Mb-15 Mb and 30 Mb. Such
artificial chromosomes may be produced by other methods. Isolation
of the 7.5 Mb (or 15 Mb amplicon containing two 7.5 Mb inverted
repeats) or a 30 Mb multimer thereof should provide a stable
chromosomal vector that can be manipulated in vitro.
[0022] In addition, methods and vectors for fragmenting the
minichromosomes and SATACs are provided. Such methods and vectors
can be used for in vivo generation of smaller stable artificial
chromosomes. Methods for reducing the size of the MACs to generate
smaller stable self-replicating artificial chromosomes are also
provided.
[0023] Methods and vectors for targeting heterologous DNA into the
artificial chromosomes are also provided as are methods and vectors
for fragmenting the chromosomes to produce smaller but stable and
self-replicating artificial chromosomes. Vectors for targeted
introduction of heterologous DNA into artificial chromosomes are
provided.
[0024] The chromosomes are introduced into cells to produce stable
transformed cell lines or cells, depending upon the source of the
cells. Introduction is effected by any suitable method including,
but not limited to electroporation, direct uptake, such as by
calcium phosphate (see, e.g., Wigler et al. (1979) Proc. Natl.
Acad. Sci. U.S.A. 76:1373-1376; and Current Protocols in Molecular
Biology, Vol. 1, Wiley Inter-Science, Supplement 14, Unit
9.1.1-9.1.9 (1990)). precipitation, uptake of isolated chromosomes
by lipofection, by microcell fusion (see, EXAMPLES, see, also
Lambert (1991) Proc. Natl. Acad. Sci. U.S.A. 88:5907-5911, U.S.
Pat. No. 5,396,767) or other suitable method. The resulting cells
can be used for production of proteins in the cells. The
chromosomes can be isolated and used for gene delivery.
[0025] Methods for isolation of the chromosomes based on the DNA
content of the chromosomes, which differs from the authentic
chromosomes are provided.
[0026] These artificial chromosomes can be used in gene therapy,
gene product production systems, production of humanized organs,
production of transgenic plants and animals, including
invertebrates, vertebrate, reptiles and insects, any organism or
device that would employ chromosomal elements as information
storage vehicles, and also for analysis and study of centromere
function, for the production of artificial chromosome vectors that
can be constructed in vitro, and for the preparation of
species-specific artificial chromosomes. The artificial chromosomes
can be introduced into cells using microinjection, cell fusion,
microcell fusion, electroporation, electrofusion, projectile
bombardment, calcium phosphate precipitation, site-specific
targeting and other such methods. Cells particularly suited for use
with the artificial chromosomes include, but are not limited to
plant cells, particularly tomato, arabidopsis, and others, insect
cells, including silk worm cells, insect larvae, fish, reptiles,
amphibians, arachnids, mammalian cells, embryonic stem cells,
embryos and cells for use in methods of genetic therapy, such as
lymphocytes that are used in methods of adoptive immunotherapy and
nerve or neural cells. Thus methods of producing gene products and
transgenic animals and plants are provided. Also provided are the
resulting transgenic animals and plants.
[0027] Exemplary cell lines that contain these chromosomes are also
provided.
[0028] Methods for preparing artificial chromosomes for particular
species and for cloning centromeres are also provided. In
particular, a method for cloning a centromere from an animal or
plant by preparing a library of DNA fragments that contain the
genome of the plant or animal, introducing the each of the
fragments into a mammalian satellite artificial chromosome (SATAC)
that contains a centromere from a different species, generally a
mammal, from the selected plant or animal, generally a non-mammal,
and a selectable marker. The selected plant or animal is one in
which the mammalian species centromere does not function. Each of
the SATACs is introduced into the cells, which are grown under
selective conditions, and cells with SATACs are identified. Such
SATACS should contain a centromere encoded by the DNA from the
library.
[0029] Also provided are libraries in which the relatively large
fragments of DNA are contained on artificial chromosomes.
[0030] Transgenic animals, invertebrates and vertebrates, plants
and insects, fish, reptiles, amphibians, arachnids and mammals are
also provided. Of particular interest are transgenic animals that
express genes that confer resistance or reduce susceptibility to
disease. Since multiple genes can be introduced on a MAC, a series
of genes encoding an antigen can be introduced, which up expression
will serve to immunize (in a manner similar to a multivalent
vaccine) the host animal against the diseases for which exposure to
the antigens provide immunity or some protection.
[0031] Methods for cloning centromeres, such as mammalian
centromeres, are also provided. In particular, in one embodiment, a
library composed of fragments of the SATACs are cloned into YACs
(yeast artificial chromosomes) that include a detectable marker,
such as DNA encoding tyrosinase and then introduced into mammalian
cells, such as albino mouse embryos. Mice produced from YACs that
include a centromere that functions in mammals will express the
detectable marker. Thus, if albino mice will be pigmented or have
regions of pigmentation.
DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 is a schematic drawing depicting formation of the
MMCneo (the minichromosome) chromosome. A-G represents the
successive events consistent with observed data that would lead to
the formation and stabilization of the minichromosome.
[0033] FIG. 2 shows a schematic summary of the manner in which the
observed new chromosomes would form, and the relationships among
the different de novo formed chromosomes. In particular, this
figure shows a schematic drawing of the de novo chromosome
formation initiated in the centromeric region of mouse chromosome
7. (A) A single E-type amplification in the centromeric region of
chromosome 7 generates a neo-centromere linked to the integrated
"foreign" DNA, and forms a dicentric chromosome (FIG. 2-1).
Multiple E-type amplification forms the .lambda. neo-chromosome,
which was derived from chromosome 7 and stabilized in a
mouse-hamster hybrid cell line (FIGS. 2-2 and 2-6); (B) Specific
breakage between the centromeres of a dicentric chromosome 7
generates a chromosome fragment with the neo-centromere, and a
chromosome 7 with traces of heterologous DNA at the end (FIG. 2-3);
(C) Inverted duplication of the fragment bearing the neo-centromere
results in the formation of a stable neo-minichromosome (FIG. 2-4);
(D) Integration of exogenous DNA into the heterologous DNA region
of the formerly dicentric chromosome 7 initiates H-type
amplification, and the formation of a heterochromatic arm. By
capturing a euchromatic terminal segment, this new chromosome arm
is stabilized in the form of the "sausage" chromosome (FIG. 2-5);
(E) BrdU (5-bromodeoxyuridine), treatment and/or drug selection
induce further H-type amplification, which results in the formation
of an unstable gigachromosome (FIG. 2-7); (F) Repeated BrdU
treatments and/or drug selection induce further H-type
amplification including a centromere duplication, which leads to
the formation of another heterochromatic chromosome arm. It is
split off from the chromosome 7 by chromosome breakage, and by
acquiring a terminal segment, the stable megachromosome is formed
(FIG. 2-8).
[0034] FIG. 3 Schematic diagram of the replicon structure and a
scheme by which the megachromosome could be produced.
[0035] FIG. 4 sets forth the relationships among the some of the
exemplary cell lines described herein.
[0036] FIG. 5 is diagram of the plasmid pTEMPUD.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0037] Definitions
[0038] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which this invention belongs. All patents
and publications referred to herein are incorporated by
reference.
[0039] As used herein, a mammalian artificial chromosome (MAC) is
piece of DNA that can stably replicate and segregate alongside
endogenous chromosomes. It has the capacity to accommodate and
express heterologous genes inserted therein. It is referred to as a
mammalian artificial chromosome because it includes an active
mammalian centromere. Plant artificial chromosomes and an insect
artificial chromosomes refer to chromosomes that include plant and
insect centromeres, respectively. A human specific chromosome (HAC)
refers to chromosomes that include human centromeres, BUGACs refer
to artificial insect chromosomes, and AVACs refer to avian
artificial chromosomes.
[0040] As used herein, stable maintenance of chromosomes, occurs
when at least about 85%, preferably 90%, more preferably 95%, of
the cells retain the chromosome. Stability is measured in the
presence of selective agent. Preferably these chromosomes are also
maintained in the absence of a selective agent. Stable chromosomes
also retain their structure during cell culturing, suffering
neither intrachromosomal nor interchromosomal rearrangements.
[0041] As used herein, growth under selective conditions, means
growth of a cell under conditions that require expression of a
selectable marker for survival.
[0042] As used herein, euchromatin and heterochromatin have their
recognized meanings, euchromatin refers to DNA that contains genes,
and heterochromatin refers to chromatin that has been thought to be
inactive. Highly repetitive DNA sequences (satellite DNA) are
located in regions of centromeric heterochromatin (pericentric
heterochromatin). Constitutive heterochromatin refers to
heterochromatin that contains the highly repetitive DNA and that is
constitutively condensed.
[0043] As used herein, BrdU refers to 5-bromodeoxyuridine, which
during replication is inserted in place of thymidine. BrdU is used
as mutagen; it also inhibits condensation of metaphase chromosomes
during cell division.
[0044] As used herein, a dicentric chromosome is a chromosome that
contains two centromeres. A multicentric chromosome contains more
than two centromeres.
[0045] As used herein, a formerly dicentric chromosome is a
chromosome that is produced when a dicentric chromosome fragments
and acquires new telomeres so that two chromosomes, each having one
of the centromeres, are produced. Each of the fragments, are
replicable chromosomes. If one of the chromosomes undergoes
amplification of euchromatic DNA to produce a full functionally
chromosome that contains the heterologous DNA and primarily (at
least more than 50%) euchromatin, it is a minichromosome. The
remaining chromosome is a formerly dicentric chromosome. If one of
the chromosomes undergoes amplification, whereby heterochromatin
(satellite DNA) is amplified, a euchromatic portion (or arm
remains), it is referred to as a sausage chromosome. A chromosome
that is substantially all heterochromatin, except for portions of
heterologous DNA, is called a SATAC. Such chromosomes (SATACs) can
be produced from sausage chromosomes by culturing the cell
containing the sausage chromosome under conditions, such as BrdU
treatment and/or growth under selective conditions, that
destabilize the chromosome so that a satellite artificial
chromosomes (SATAC) is produced. For purposes herein, it is
understand that SATACs may not necessarily be produced in multiple
steps, but may appear after the initial introduction of the
heterologous DNA and growth under selective conditions, or they may
appear after several cycles of growth under selective conditions
and BrdU treatment.
[0046] As used herein an amplicon is the smallest repeated unit
that contains heterologous DNA in the MACs provided herein. A
megareplicon contains at least one amplicon, an inverted repeat
thereof, and a megareplicator. A megareplicator is a primary
replication initiation site.
[0047] As used herein, the minichromosome refers to a chromosome
derived from a dicentric chromosome (see, e.g., FIG. 1) that
contains more euchromatic than heterochromatic DNA.
[0048] As used herein, a megachromosome refers to a chromosome
that, except for introduced heterologous DNA is substantially
composed of heterochromatin. Megachromosomes are made of a tandem
array of amplicons that contain two inverted megareplicons bordered
by introduced heterologous DNA (see, e.g., FIG. 3 for a schematic
drawing of a megachromosome). For purposes herein, a megachromosome
is about 50 to 400 Mb, generally about 250-400 Mb. Shorter
variants, are also referred to as truncated megachromosomes (about
90 to 120 or 150 Mb), dwarf megachromosomes (.about.150-200 Mb) and
cell lines, and micro-megachromosomes (.about.60-90 Mb). For
purposes herein, the term megachromosome refers to the overall
repeated structure based on a tandem array of repeated chromosomal
segments (amplicons) that contain two inverted megareplicons
bordered by any inserted heterologous DNA. The size will be
specified.
[0049] As used herein, genetic therapy involves the transfer of
heterologous DNA to the certain cells, target cells, of an
individual afflicted with a disorder for which such therapy is
sought. The DNA is introduced into the selected target cells in a
manner such that the heterologous DNA is expressed and a product
encoded thereby is produced. Alternatively, the heterologous DNA
may in some manner mediate expression of DNA that encodes the
therapeutic product, it may encode a product, such as a peptide or
RNA that in some manner mediates, directly or indirectly,
expression of a therapeutic product. Genetic therapy may also be
used to introduce therapeutic compounds, such as TNF, that are not
normally produced in the host or that are not produced in
therapeutically effective amounts or at a therapeutically useful
time. The heterologous DNA encoding the therapeutic product may be
modified prior to introduction into the cells of the afflicted host
in order to enhance or otherwise alter the product or expression
thereof.
[0050] As used herein, heterologous or foreign DNA and RNA are used
interchangeably and refer to DNA or RNA that does not occur
naturally as part of the genome in which it is present or which is
found in a location or locations in the genome that differ from
that in which it occurs in nature. It is DNA or RNA that is not
endogenous to the cell and has been exogenously introduced into the
cell. Examples of heterologous DNA include, but are not limited to,
DNA that encodes a gene or gene(s) of interest, introduced for
purposes of gene therapy or for production of the encoded protein.
Other examples of heterologous DNA include, but are not limited to,
DNA that encodes traceable marker proteins, such as a protein that
confers drug resistance, DNA that encodes therapeutically effective
substances, such as anti-cancer agents, enzymes and hormones, and
DNA that encodes other types of proteins, such as antibodies.
Antibodies that are encoded by heterologous DNA may be secreted or
expressed on the surface of the cell in which the heterologous DNA
has been introduced.
[0051] As used herein, a therapeutically effective product is a
product that is encoded by heterologous DNA that, upon introduction
of the DNA into a host, a product is expressed that effectively
ameliorates or eliminates the symptoms, manifestations of an
inherited or acquired disease or that cures said disease.
[0052] As used herein, transgenic plants refer to plants in which
heterologous or foreign DNA is expressed or in which the expression
of a gene naturally present in the plant has been altered.
[0053] As used herein, operative linkage of heterologous DNA to
regulatory and effector sequences of nucleotides, such as
promoters, enhancers, transcriptional and translational stop sites,
and other signal sequences refers to the relationship between such
DNA and such sequences of nucleotides. For example, operative
linkage of heterologous DNA to a promoter refers to the physical
relationship between the DNA and the promoter such that the
transcription of such DNA is initiated from the promoter by an RNA
polymerase that specifically recognizes, binds to and transcribes
the DNA in reading frame.
[0054] As used herein, isolated, substantially pure DNA refers to
DNA fragments purified according to standard techniques employed by
those skilled in the art, such as that found in Maniatis et al.
((1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.).
[0055] As used herein, expression refers to the process by which
nucleic acid is transcribed into mRNA and translated into peptides,
polypeptides, or proteins. If the nucleic acid is derived from
genomic DNA, expression may, if an appropriate eukaryotic host cell
or organism is selected, include splicing of the mRNA.
[0056] As used herein, vector or plasmid refers to discrete
elements that are used to introduce heterologous DNA into cells for
either expression of the heterologous DNA or for replication of the
cloned heterologous DNA. Selection and use of such vectors and
plasmids are well within the level of skill of the art.
[0057] As used herein, transformation/transfection refers to the
process by which DNA or RNA is introduced into cells to for gene
expression. Transfection refers to the taking up of an expression
vector by a host cell whether or not any coding sequences are in
fact expressed. Numerous methods of transfection are known to the
ordinarily skilled artisan, for example, by direct uptake using
calcium phosphate (CaPO4; see, e.g., Wigler et al. (1979) Proc.
Natl. Acad. Sci. U.S.A. 76:1373-1376) and polyethylene glycol
(PEG)-mediated DNA uptake and electroporation. Successful
transfection is generally recognized when any indication of the
operation of this vector occurs within the host cell.
Transformation means introducing DNA into an organism so that the
DNA is replicable, either as an extrachromosomal element or by
chromosomal integrant.
[0058] As used herein, injected refers to the microinjection (use
of a small syringe) of DNA into a cell.
[0059] As used herein, substantially homologous DNA refers to DNA
that includes a sequence of nucleotides that is sufficiently
similar to another such sequence to form stable hybrids under
specified conditions.
[0060] It is well known to those of skill in this art, that nucleic
acid fragments with different sequences may, under the same
conditions, hybridize detectably to the same "target" nucleic acid.
Two nucleic acid fragments hybridize detectably, under stringent
conditions over a sufficiently long hybridization period, because
one fragment contains a segment of at least about 14 nucleotides in
a sequence which is complementary (or nearly complementary) to the
sequence of at least one segment in the other nucleic acid
fragment. If the time during which hybridization is allowed to
occur is held constant, at a value during which, under preselected
stringency conditions, two nucleic acid fragments with exactly
complementary base-pairing segments hybridize detectably to each
other, departures from exact complementarity can be introduced into
the base-pairing segments, and base-pairing will nonetheless occur
to an extent sufficient to make hybridization detectable. As the
departure from complementarity between the base-pairing segments of
two nucleic acids becomes larger, and as conditions of the
hybridization become more stringent, the probability decreases that
the two segments will hybridize detectably to each other.
[0061] Two single-stranded nucleic acid segments have
"substantially the same sequence," within the meaning of the
present specification, if (a) both form a base-paired duplex with
the same segment, and (b) the melting temperatures of said two
duplexes in a solution of 0.5.times.SSPE differ by less than
10.degree. C. If the segments being compared have the same number
of bases, then to have "substantially the same sequence", they will
typically differ in their sequences at fewer than 1 base in 10.
Methods for determining melting temperatures of nucleic acid
duplexes are well known (see, e.g., Meinkoth and Wahl (1984) Anal.
Biochem. 138:267-284 and references cited therein).
[0062] As used herein, a nucleic acid probe is a DNA or RNA
fragment that includes a sufficient number of nucleotides to
specifically hybridize to DNA or RNA that includes identical or
closely related sequences of nucleotides. A probe may contain any
number of nucleotides, from as few as about 10 and as many as
hundreds of thousands of nucleotides. The conditions and protocols
for such hybridization reactions are well known to those of skill
in the art as are the effects of probe size, temperature, degree of
mismatch, salt concentration and other parameters on the
hybridization reaction. For example, the lower the temperature and
higher the salt concentration at which the hybridization reaction
is carried out, the greater the degree of mismatch that may be
present in the hybrid molecules.
[0063] To be used as an hybridization probe, the nucleic acid is
generally rendered detectable by labelling it, with a detectable
moiety or label, such as .sup.32P, .sup.3H and .sup.14C, or by
other means, including chemical labelling, such as by
nick-translation in the presence of deoxyuridylate biotinylated at
the 5'-position of the uracil moiety. The resulting probe includes
the biotinylated uridylate in place of thymidylate residues and can
be detected (via the biotin moieties) by any of a number of
commercially available detection systems based on binding of
streptavidin to the biotin. Such commercially available detection
systems can be obtained, for example, from Enzo Biochemicals, Inc.
(New York, N.Y.). Any other label known to those of skill in the
art, including non-radioactive labels, may be used as long as it
renders the probes sufficiently detectable, which is a function of
the sensitivity of the assay, the time available (for culturing
cells, extracting DNA, and hybridization assays), the quantity of
DNA or RNA available as a source of the probe, the particular label
and the means used to detect the label.
[0064] Once sequences with a sufficiently high degree of homology
to the probe are identified, they can readily be isolated by
standard techniques, which are described, for example, by Maniatis
et al. ((1982) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
[0065] As used herein, conditions under which DNA molecules form
stable hybrids and are considered substantially homologous are such
that the DNA molecules with at least about 60% complementarity form
stable hybrids. Such DNA fragments are herein considered to be
"substantially homologous". For example, DNA that encodes a
particular protein is substantially homologous to an other DNA
fragment if the DNA forms stable hybrids such that the sequences of
the fragments are at least about 60% complementary and if a protein
encoded by the DNA retains its activity.
[0066] For purposes herein, the following stringency conditions are
defined:
[0067] 1) high stringency: 0.1.times.SSPE, 0.1% SDS, 65.degree.
C.
[0068] 2) medium stringency: 0.2.times.SSPE, 0.1% SDS, 50.degree.
C.
[0069] 3) low stringency: 1.0.times.SSPE, 0.1% SDS, 50.degree.
C.
[0070] or any combination of salt and temperature and other
reagents that result in selection of the same degree of mismatch or
matching.
[0071] As used herein, immunoprotective refers to the ability of a
vaccine or exposure to an antigen or immunity-inducing agent to
confer upon a host to whom the vaccine or antigen is administered
or introduced the ability to resist infection by a disease causing
pathogen or to have reduced symptoms. The selected antigen is
typically an antigen that is presented by the pathogen.
[0072] As used herein, all assays and procedures, such as
hybridization reactions and antibody-antigen reactions, unless
otherwise specified, are conducted under conditions recognized by
those of skill in the art as standard conditions.
[0073] A. Preparation of Cell Lines Containing MACs
[0074] The methods, cells and MACs provided herein are produced by
virtue of the discovery of the existence of a higher-order
replication unit (megareplicon) of the centromeric region. This
megareplicon is delimited by a primary replication initiation site
(megareplicator), and appears to facilitate replication of the
centromeric heterochromatin, and most likely, centromeres.
Integration of heterologous DNA into the megareplicator region or
in close proximity thereto, initiates a large-scale amplification
of megabase-size chromosomal segments, which leads to de novo
chromosome formation.
[0075] Cell lines containing MACs can be prepared using cells,
preferably a stable cell line, transforming it with a heterologous
DNA fragment that encodes a selectable marker, culturing under
selective conditions, and identifying cells that have a dicentric
chromosome. These cells can then be manipulated as described herein
to produce the minichromosomes and other MACs, particularly the
heterochromatic SATACs as described herein.
[0076] Development of a dicentric chromosome appears to require
integration of the heterologous DNA in the pericentric
heterochromatin. Thus, the probability of incorporation can be
increased by including DNA, such as satellite DNA, in the
heterologous fragment that encodes the selectable marker. The
resulting cell lines can then be treated as the exemplified cells
herein to produce cell in which the dicentric chromosome has
fragmented and to introduce additional selective markers into the
dicentric chromosome, whereby amplification of the pericentric
heterochromatin will produce the heterochromatic chromosomes. The
following discussion is with reference to the EC3/7 line and use of
resulting cells. The same procedures can be applied and to any
other cells, particularly cell lines to prepare create SATACs and
euchromatic minichromosomes.
[0077] 1. Formation of De Novo Chromosomes
[0078] De novo centromere formation in a transformed mouse
LMTK-fibroblast cell line (EC3/7) after cointegration of .lambda.
constructs (.lambda.CM8 and .lambda.gtWESneo) carrying human and
bacterial DNA (Hadlaczky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110 and U.S. application Ser. No. 08/375,271) has
been shown. The integration of the "heterologous" human and phage
DNA, and the subsequent amplification of mouse and heterologous DNA
that led to the formation of a dicentric chromosome, occurred at
the centromeric region of the short arm of a mouse chromosome. By
G-banding this chromosome was identified as mouse chromosome 7.
Because of the presence of two functionally active centromeres on
the same chromosome, regular breakages occur between the
centromeres. Such specific chromosome breakages gave rise to the
appearance (in approximately 10% of the cells) of a chromosome
fragment carrying the neo-centromere. From the EC3/7 cell line
(see, U.S. Pat. No. 5,288,625, deposited at the European Collection
of Animal cell Culture (hereinafter ECACC) under accession no.
90051001); see, also Hadlaczky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110, and U.S. application Ser. No. 08/375,271 and
the corresponding published European application EP 0 473 253)
carrying either the dicentric chromosome or a chromosome fragment
with the neo-centromere, two sublines (EC3/7C5 and EC3/7C6) were
selected by repeated single-cell cloning. In these cell lines, the
neo-centromere was found exclusively on a minichromosome
(neo-minichromosome)), while the formerly dicentric chromosome
carried traces of "heterologous" DNA.
[0079] It has now been discovered that integration of DNA encoding
a selectable marker in the heterochromatic region of the centromere
led to formation of the dicentric chromosome.
[0080] 2. The Neo-Minichromosome
[0081] The chromosome breakage in the EC3/7 cells, which separates
the neo-centromere from the mouse chromosome, occurred in the
G-band positive "heterologous" DNA region. This is supported by the
observation of traces of .lambda. and human DNA sequences at the
broken end of the formerly dicentric chromosome. Comparing the
G-band pattern of the chromosome fragment carrying the
neo-centromere with that of the stable neo-minichromosome, it is
apparent that the neo-minichromosome is an inverted duplicate of
the chromosome fragment that bears the neo-centromere. This is
supported by the observation that although the neo-minichromosome
carries only one functional centromere, both ends of the
minichromosome are heterochromatic, and mouse satellite DNA
sequences were found in these heterochromatic regions by in situ
hybridization.
[0082] Mouse cells containing the minichromosome, which is composed
of multiple repeats of the heterologous DNA, which in the
exemplified embodiment is lambda DNA and neo DNA, can be used as
recipient cells in cell transformation. Donor DNA, such as selected
heterologous DNA linked to a second selectable marker, such as
hygromycin resistance (hyg), can be introduced into the mouse cells
and integrated into the minichromosomes by homologous recombination
of lambda DNA in the donor DNA with that in the minichromosomes.
Integration is verified by in situ hybridization and Southern blot
analyses. Transcription and translation of the heterologous DNA is
confirmed by primer extension and immunoblot analyses.
[0083] For example, DNA has been targeted into the .lambda.-neo
minichromosome in EC3/7C5 cells using a lambda DNA-containing
construct (pNem1ruc) that also contains DNA encoding hygromycin
resistance and the Renilla luciferase gene linked to a promoter,
such as the cytomegalovirus (CMV) early promoter, and the bacterial
neo encoding DNA. Integration of the donor DNA into the chromosome
in selected cells (designated PHN4) was confirmed by nucleic acid
amplification (PCR) and in situ hybridization. Events that would
produce a neo-minichromosome are depicted in FIG. 1.
[0084] The resulting engineered minichromosome that contains the
heterologous DNA can then transferred by cell fusion into a
recipient cell line, such as Chinese hamster kidney cells (CHO) and
correct expression of the heterologous DNA can be verified.
Following production of the cells, metaphase chromosomes are
obtained, such as by addition of colchicine, and the chromosomes
purified by addition of AT and GC specific dyes on a dual laser
beam based cell sorter. Preparative amounts of chromosomes (2-3 mls
of 10.sup.6 chromosomes/ml) at a purity of 95% or higher can be
obtained. The resulting chromosomes are used for delivery to cells
by methods, such as microinjection, liposome packaged transfer.
[0085] Thus, the neo-minichromosome is stably maintained in cells,
replicates autonomously, and permits the persistent long-term
expression of neo gene under non-selective culture conditions. It
also contains megabases of heterologous known DNA (lambda DNA in
the exemplified embodiments) that serves as target sites form
homologous recombination and integration of DNA of interest. The
neo-minichromosome is, thus, a vector for genetic engineering of
cells.
[0086] The methods herein provide means to induce the events that
led to formation of the neo-minichromosome by introducing
heterologous DNA with a selective marker (preferably a dominant
selectable marker) and culturing under selective conditions. As a
result, cells that contain a dicentric chromosome or fragments
thereof produced by amplification, will be produced. Cells with the
dicentric chromosome can then be treated to destabilize the genome
with agents, such as BrdU and/or culturing under selective
conditions, resulting in cells in which the dicentric chromosome
has formed two chromosomes, a so-called minichromosome, and a
formerly dicentric chromosome that has typically undergone
amplification in the heterochromatin where the heterologous DNA has
integrated to produce a generally a SATAC or a sausage chromosome
(discussed below). These cells can be fused with other cells to
separate the minichromosome from the formerly dicentric chromosome
into different cells so that each type of MAC can be manipulated
separately.
[0087] 3. Preparation of SATACs
[0088] An Exemplary protocol for preparation of SATACs is
illustrated in FIG. 2 (particularly C, D and F) and FIG. 4 (see,
also the EXAMPLES, particularly EXAMPLES 4-7).
[0089] To prepare a SATAC, the starting materials are a cell,
preferably a stable cell line, such as a fibroblast cell line, and
a DNA fragment that includes DNA that encodes a selective marker.
To insure integration of the DNA fragment in the heterochromatin,
it is preferable to start with DNA that will be targeted to the
pericentric heterochromatic region of the chromosome, such as
.lambda.CM8 and vectors provided herein, such as pTEMPUD (FIG. 5)
that include satellite DNA. After introduction of the DNA, the
cells are grown under selective conditions. The resulting cells are
examined and any that have dicentric chromosomes (or
heterochromatic chromosomes or sausage chromosomes or other such
structure (see, FIGS. 2C, 2D, 2E and 2F) are selected.
[0090] In particular, if a cell with a dicentric chromosome is
selected, it can be grown under selective conditions, or,
preferably, additional DNA encoding a second selectable marker is
introduced, and the cells grown under conditions selective for the
second marker. The resulting cells should include chromosomes that
have structures similar to those depicted in FIGS. 2D, 2E, 2F.
Cells with a structure, such as the sausage chromosome, FIG. 2D,
can be selected and fused with a second cell line to eliminate
other chromosomes that are not of interest. If desired cells with
other chromosomes can be selected and treated as described herein.
If a cell with a sausage chromosome is selected, it is treated with
an agent, such as BrdU, that destabilizes the chromosome so that
the heterochromatic arm forms a chromosome that is substantially
heterochromatin (megachromosome, see, FIG. 2F). Structures such as
the gigachromsome in which the heterochromatic arm has amplified
but not broken off from the euchromatic arm, will also be observed.
The megachromosome is a stable chromosome. Further manipulation,
such as fusions and growth in selective conditions and/or BrdU
treatment or other such treatment, can lead to fragmentation of the
megachromosome to form smaller chromosomes that have the amplicon
as the basic repeating unit.
[0091] The megachromosome can be further fragmented in vivo using a
chromosome fragmentation vector, such as pTEMPUD (see, FIG. 5 and
EXAMPLE 12) to ultimately produce a chromosome that comprises the
smallest stable replicable unit, about 15 Mb-50 Mb, containing two
to four megareplicons.
[0092] Thus, the stable chromosomes formed de novo that originate
from the short arm of mouse chromosome 7 have been analyzed. This
chromosome region shows a capacity for amplification of large
chromosome segments, and promotes de novo chromosome formation.
Large-scale amplification at the same chromosome region leads to
the formation of dicentric and multicentric chromosomes, a
minichromosome, the 150-200 Mb size .lambda. neo-chromosome, the
"sausage" chromosome, the 500-1000 Mb gigachromosome, and the
stable 250-400 Mb megachromosome.
[0093] A clear segmentation is observed along the arms of the
megachromosome, and analyses show that the building units of this
chromosome are amplicons of .about.30 Mb composed of mouse major
satellite DNA with the integrated "foreign" DNA sequences at both
ends. The .about.30 Mb amplicons are composed of two .about.15 Mb
inverted doublets of .about.7.5 Mb mouse major satellite DNA
blocks, which are separated from each other by a narrow band of
non-satellite sequences (see, e.g., FIG. 3). The wider
non-satellite regions at the amplicon borders contain integrated,
exogenous (heterologous) DNA, while the narrow bands of
non-satellite DNA sequences within the amplicons are integral parts
of the pericentric heterochromatin of mouse chromosomes. These
results indicate that the .about.7.5 Mb blocks flanked by
non-satellite DNA are the building units of the pericentric
heterochromatin of mouse chromosomes, and the 15 Mb size
pericentric regions of mouse chromosomes contain two .about.7.5 Mb
units.
[0094] Apart from the euchromatic terminal segments, the whole
megachromosome is heterochromatic, and has structural homogeneity.
Therefore, this large chromosome offers a unique possibility for
obtaining information about the amplification process, and for
analyzing some basic characteristics of the pericentric
constitutive heterochromatin, as vector for heterologous DNA, and
as target for further fragmentation.
[0095] As shown herein, this phenomenon is generalizable and can be
observed with other chromosomes. Also, although these de novo
formed chromosome segments and chromosomes appear different, there
are, similarities that indicate that a similar amplification
mechanism plays a role in their formation: (i) in each case, the
amplification is initiated in the centromeric region of the mouse
chromosomes and large (Mb size) amplicons are formed; (ii) mouse
major satellite DNA sequences are constant constituents of the
amplicons, either by providing the bulk of the heterochromatic
amplicons (H-type amplification), or by bordering the euchromatic
amplicons (E-type amplification); (iii) formation of inverted
segments can be demonstrated in the .lambda. neo-chromosome and
megachromosome; (iv) chromosome arms and chromosomes formed by the
amplification are stable and functional.
[0096] The presence of inverted chromosome segments seems to be a
common phenomenon in the chromosomes formed de novo at the
centromeric region of mouse chromosome 7. During the formation of
the neo-minichromosome, the event leading to the stabilization of
the distal segment of mouse chromosome 7 that bears the
neo-centromere may have been the formation of its inverted
duplicate. Amplicons of the megachromosome are inverted doublets of
.about.7.5 Mb mouse major satellite DNA blocks.
[0097] 4. Cell Lines
[0098] Cell lines that contain MACs, such as the minichromosome,
the .lambda.-neo chromosome, and the SATACs are provided herein or
can be produced by the methods herein. Such cell lines provide a
convenient source of these chromosomes and can be manipulated, such
as by cell fusion or production of microcells for fusion with
selected cell lines, to deliver the chromosome of interest into
hybrid cell lines. Exemplary cell lines are described herein and
some have been deposited with the ECACC.
[0099] a. EC3/7C5 and EC3/7C6
[0100] Two cell lines EC3/7C5 and EC3/7C6 produced by single cell
cloning of EC3/7 were examined. For exemplary purposes EC3/7C5 has
been deposited with the ECACC. These cell lines contain a
minichromosome and the formerly dicentric chromosome from EC3/7.
The stable minichromosomes in cell lines (EC3/7C5 and EC3/7C6)
appear to be virtually identical and they seem to be a duplicated
derivatives of the .about.10-15 Mb "broken-off" fragment of the
dicentric chromosome. Their identical size in these independently
generated cell lines might indicate that .about.20-30 Mb is the
minimal or close to the minimal physical size for a stable
minichromosome.
[0101] b. TF1004G/19
[0102] Introduction of additional heterologous DNA, including a
second selectable marker hygromycin and also a detectable marker
.beta.-galactosidase, into the EC3/7C5 cell line and growth under
selective conditions produced cells designated TF1004G/19. In
particular, this cell line was produced from the EC3/7C5 cell line
by cotransfection with plasmids pH132, which contains an anti-HIV
ribozyme, and hygromycin resistance gene, pCH110 (encodes
.beta.-galactosidase) and .lambda. phage (.lambda.cl 875 Sam 7) DNA
and selection with hygromycin B.
[0103] Detailed analysis of TF1004G/19 cell line by in situ
hybridization with lambda phage and plasmid DNA sequences revealed
the formation of the sausage chromosome. The formerly dicentric
chromosome of EC3/7C5 cell translocated to the end of another
acrocentric chromosome. The heterologous DNA integrated into the
pericentric heterochromatin of formerly dicentric chromosome and is
amplified several times with megabases of mouse pericentric
heterochromatic satellite DNA sequences (FIG. 2D)) forming the
"sausage" chromosome. Subsequently the acrocentric mouse chromosome
was substituted by a euchromatic telomere.
[0104] In situ hybridization with biotin labeled subfragments of
the hygromycin resistance and .beta.-galactosidase genes resulted
in hybridization signal only in the heterochromatic arm of the
sausage chromosome, indicating that in TF1004G/19 transformant
cells these genes are localized in the pericentric heterochromatin.
A high level of gene expression, however, was detected.
[0105] In general, heterochromatin has a silencing effect in
Drosophila, yeast and on the HSV-tk gene introduced into satellite
DNA at mouse centromere. Thus, it was of interest to study the TF
1004G/19 transformant cell line in to confirm that gene expression
(of the .beta.-gal) was indeed localized in the heterochromatin
contrary to recognized dogma.
[0106] For this purpose, subclones of TF1004G/19 containing a
different a sausage chromosome (see FIG. 2D) by single cell cloning
were established. Southern DNA hybridization with subfragments of
hygromycin resistance and .beta.-galactosidase genes showed close
correlation to the intensity of hybridization and the length of
sausage chromosome. This finding supports the conclusion that these
genes are localized in the heterochromatic arm of the sausage
chromosome.
[0107] (1) TF1004G-19C5
[0108] TF1004G-19C5 is a mouse LMTK.sup.- fibroblast cell line
containing neo-minchromosomes and stable "sausage" chromosomes. It
is a subclone of TF1004G/19. It has been deposited as an exemplary
cell line and exemplary source of a sausage chromosome. Subsequent
fusion of this cell line with CHO K20 cells and selection with
hygromycin and hat resulted in hybrid cells that carry the sausage
chromosome and/or the neo-minichromosome. BrdU treatment, single
cell cloning and selection with G418 and/or hygromycin produced
various cells that carry chromosomes of interest, including
G3D5.
[0109] (2) Other Subclones
[0110] G3D5, which has been deposited is a mouse hamster hybrid
cell line that carries the neo-minichromosome and the
megachromosome. H1D3 is a subclone thereof that carries the
megachromosome. Fusion of this cell line with the CD4.sup.+ Hela
cell line and also DNA encoding an additional selection gene, neo,
produced cells that carry the megachromosome as well as a human
chromosome that carries CD4neo (H1D3 cells). Further BrdU treatment
and single cell cloning produced cell lines, such as 1B3 that
include cells with a truncated megachromosome.
[0111] 5. DNA Constructs Used to Transform the Cells
[0112] Heterologous DNA can be introduced into the cells by
transfection or other suitable method at any stage during
preparation of the chromosomes (see, e.g., FIG. 4). In general
integration of such DNA is assured by relying on site directed
integration, such as by inclusion of .lambda.-DNA for the
exemplified chromosomes and also an additional selective marker
gene. For example, cells with a MAC, such as the minichromosome or
a SATAC can be cotransfected with a plasmid encoding the desired
heterologous DNA, such as HIV ribozyme, cystic fibrosis gene, and a
second selectable marker, such as hygromycin resistance. Selection
is effected with the agent that selects for the new selectable
marker cells containing chromosomes that include the DNA in the MAC
are identified. Fusion with a second cell line can provide a means
to produce cell lines that contain one particular type of
chromosomal structure or MAC.
[0113] Various vectors for this purpose are provided herein (see,
Examples) and others can be readily constructed. The vectors should
include DNA that will target the DNA to the MAC, a selectable
marker and the selected heterologous gene of interest. Based on the
disclosure herein and the knowledge of the skilled artisan, one of
skill can construct such vectors.
[0114] Of particular interest herein is the vector pTEMPUD and
derivatives thereof that can target DNA into the heterochromatic
region of selected chromosomes. These vectors can also serve as
fragmentation vectors (see, e.g., Example 12).
[0115] Heterologous genes of interest include any gene that encodes
a therapeutic gene and DNA encoding gene products of interest.
These genes and DNA include, but are not limited to: the cystic
fibrosis gene (CF) cystic fibrosis transmembrane regulator (CFTR)
(see, e.g., U.S. Pat. No. 5,240,846; Rosenfeld et al. (1992) Cell
68:143-155; Hyde et al. (1993) Nature 362: 250-255; Kerem et al.
(1989) Science 245:1073-1080; Riordan et al. (1989) Science
245:1066-1072; Rommens et al. (1989) Science 245:1059-1065; Osborne
et al. (1991) Am. J. Hum. Genetics 48:6089-6122; White et al.
(1990) Nature 344:665-667; Dean et al. (1990) Cell 61:863-870;
Erlich et al. (1991) Science 252:1643; and U.S. Pat. Nos.
5,453,357, 5,449,604, 5,434,086, and 5,240,846, which provides a
retroviral vector encoding the normal CFTR gene).
[0116] B. Isolation of Artificial Chromosomes
[0117] The MACs provided herein can be isolated by any suitable
method known to those of skill in the art. Also, a method is
provided herein for effecting substantial purification. SATACs have
been isolated by fluorescence activated cell sorting (FACS). This
method takes advantage of the nucleotide base content of the
SATACs, which by virtue of their heterochromatic content will
differ from any other chromosomes in a cell. In particular,
metaphase chromosomes are isolated and stained with base specific
dyes, such as Hoechst 33258 and chromocycin A3. Fluorescence
activated cell sorting will separate the SATACs from the genomic
chromosomes. A dual-laser cell sorter (FACStar Plus and FAXStar
Vantage Becton Dickinson Immunocytometry System) in which two
lasers were set to excite the dyes separately, allowed a bivariate
analysis of the chromosomes by size and base-pair composition.
Cells containing such SATACs can be similarly sorted.
[0118] C. Introduction of Artificial Chromosomes into Cells,
Tissues, Animals and Plants
[0119] Suitable hosts for introduction of the MACs provided herein,
include but are not limited to any animal or plant, cell or tissue
thereof, including, but not limited to: mammals, birds, reptiles,
amphibians, insects, fish, arachnids, tobacco, tomato, wheat,
monocots, dicots and algae. The MACs may be introduced by cell
fusion or microcell fusion or subsequent to isolation by any method
known to those of skill in this art, including but not limited to:
direct DNA transfer, electroporation, lipofection, liposomes,
microprojectile bombardment, microinjection and any other suitable
method.
[0120] Other methods for introducing DNA into cells, include
nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells. Polycations, such as polybrene and
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see e.g., Keown et al. Methods in
Enzymology (1990) Vol. 185, pp. 527-537; and Mansour et al. (1988)
Nature 336:348-352.
[0121] DNA may be introduced by direct DNA transformation;
microinjection in cells or embryos, protoplast regeneration for
plants, electroporation, microprojectile gun and other such methods
(see, e.g., Weissbach et al. (1988) Methods for Plant Molecular
Biology, Academic Press, N.Y., Section VIII, pp. 421-463; Grierson
et al. (1988) Plant Molecular Biology, 2d Ed., Blackie, London, Ch.
7-9; see, also U.S. Pat. Nos. 5,491,075; 5,482,928; and 5,424,409;
see, also, e.g., U.S. Pat. No. 5,470,708, which describes
particle-mediated transformation of mammalian unattached
cells).
[0122] For example, isolated purified artificial chromosomes can be
injected into an embryonic cell line such as a human kidney primary
embryonic cell line (ATCC CRL 1573) or embryonic stem cells (see,
e.g., Hogan et al. (1994) Manipulating the Mouse Embryo, A
:Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., see, especially, pages 255-264 and Appendix
3). Preferably the chromosomes are introduced by microinjection,
using a system such as the Eppendorf automated microinjection
system, and grown under selective conditions, such as hygromycin B
or neomycin resistance.
[0123] 1. Methods for Introduction of Chromosomes into Hosts
[0124] Depending on the host cell used, transformation is done
using standard techniques appropriate to such cells. These methods
include any, including those described herein, known to those of
skill in the art.
[0125] a. DNA Uptake
[0126] For mammalian cells without such cell walls, the calcium
phosphate precipitation method (see, e.g., Graham et al. (1978)
Virology 52:456-457 is often preferred. DNA uptake can be
accomplished by DNA alone or in the presence of polyethylene glycol
(PEG-mediated gene transfer), which is a fusion agent, with plant
protoplasts or by any variations of such methods known to those of
skill in the art (see, et al. U.S. Pat. No. 4,684,611).
[0127] A commonly used approach for gene transfer in land plants
involves the direct introduction of purified DNA into protoplasts.
The three basic methods for direct gene transfer include: 1)
polyethylene glycol (PEG)-mediated DNA uptake, 2)
electroporation-mediated DNA uptake and 3) microinjection. In
addition, plants may be transformed using ultrasound treatment
(see, e.g., International PCT application No. WO 91/00358).
[0128] b. Electroporation
[0129] Electroporation, which involves providing high-voltage
electrical pulses to a solution containing a mixture of protoplasts
and foreign DNA to create reversible pores in the membranes of
plant protoplasts as well as other cells. Electroporation is
generally used for prokaryotes or other cells, such as plants that
contain substantial cell-wall barriers. Methods for effecting
electroporation are well known (see, e.g., U.S. Pat. Nos.
4,784,737, 5,501,967, 5,501,662, 5,019,034, 5,503,999; see, also
Fromm et al. (1985) Proc. Natl. Acad. Sci. U.S.A.
82:5824-5828).
[0130] For example, electroporation is often used for
transformation of plants (see, e.g., Ag Biotechnology News, Vol. 7
p. 3 and 17 (September/October 1990)). In this technique, plant
protoplasts are electroporated in the presence of the DNA of
interest that also includes a phenotypic marker. Electrical
impulses of high field strength reversibly permeabilize
biomembranes allowing the introduction of the plasmids.
Electroporated plant protoplasts reform the cell wall, divide, and
form plant callus. Transformed plant cells will be identified by
virtue of the expressed phenotypic marker. The exogenous DNA may be
added to the protoplasts in any form such as, for example, naked
linear, circular or supercoiled DNA, DNA encapsulated in liposomes,
DNA in spheroplasts, DNA in other plant protoplasts, DNA complexed
with salts, and other methods.
[0131] C. Microcells
[0132] The chromosomes can be transferred by preparing microcells
containing an artificial chromosome and then fusing with selected
target cells. Methods for such preparation and fusion or microcells
are well known (see, e.g., U.S. Pat. Nos. 5,240,840, 4,806,476,
5,298,429, Fournier (1981) Proc. Natl. Acad. Sci. U.S.A.
78:6349-6353; and Lambert et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:5907-59).
[0133] 2. Hosts
[0134] Suitable host include any host known to be useful for
introduction and expression of heterologous DNA. Of particular
interest herein, animal and plant cells and tissues, including, but
not limited to insect cells and larvae, plants, and animals,
particularly transgenic animals, and animal cells. Other hosts
include, but are not limited to mammals, birds, reptiles,
amphibians, insects, fish, arachnids, tobacco, tomato, wheat,
monocots, dicots and algae, and any host into which introduction of
heterologous DNA is desired. Such introduction can be effected
using the MACs provided herein, or, if necessary by using the MACs
provided herein to identify species-specific centromeres and/or
functional chromosomal units and then using the resulting
centromeres or chromosomal units as artificial chromosomes, or
alternatively, using the methods exemplified herein for production
of MACs to produce species-specific artificial chromosomes.
[0135] a. Introduction of DNA into Embryos for Production of
Transgenic Animals and Introduction of DNA into Animal Cells
[0136] Transgenic animals can be produced by introducing exogenous
genetic material into a pronucleus of a mammalian zygote by
microinjection (see, e.g., U.S. Pat. Nos. 4,873,191 and 5,354,674;
see, also, International PCT application No. WO95/14769, which is
based on U.S. application Ser. No. 08/159,084). The zygote is
capable of development into a mammal. The embryo or zygote is
transplanted into a host female uterus and allowed to develop.
Detailed protocols and examples are set forth below.
[0137] DNA can be introduced into animal cells using any known
procedure, including, but not limited to: direct uptake, incubation
with polyethylene glycol (PEG), microinjection, electroporation,
lipofection, cell fusion, microcell fusion, particle bombardment,
including microprojectile bombardment (see, e.g., U.S. Pat. No.
5,470,708, which provides a method for transforming unattached
mammalian cells via particle bombardment), and any other such
method. For example, the transfer of plasmid DNA in liposomes
directly to human cells in situ has been approved by the FDA for
use in humans (see, e.g., Nabel, et al. (1990) Science
249:1285-1288 and U.S. Pat. No. 5,461,032).
[0138] b. Introduction of Heterologous DNA into Plants.
[0139] Numerous methods for producing or developing transgenic
plants are available to those of skill in the art. The method used
is primarily a function of the species of plant. These methods
include, but are not limited to: direct transfer of DNA by
processes, such as PEG-induced DNA uptake, protoplast fusion,
microinjection, electroporation, and microprojectile bombardment
(see, e.g., Uchimiya et al. (1989) J. of Biotech. 12: 1-20 for a
review of such procedures, see, also, e.g., U.S. Pat. Nos.
5,436,392 and 5,489,520 and many others). For purposes herein, when
introducing a MAC, microinjection and protoplast fusion are
preferred
[0140] Plant species, including tobacco, rice, maize, rye, soybean,
Brassica napus, cotton, lettuce, potato and tomato, have been used
to produce transgenic plants. Tobacco and other species, such as
petunias, often serve as experimental models in which the methods
have been developed and the genes first introduced and
expressed.
[0141] DNA uptake can be accomplished by DNA alone or in the
presence of PEG, which is a fusion agent, with plant protoplasts or
by any variations of such methods known to those of skill in the
art (see, e.g., U.S. Pat. No. 4,684,611 to Schilperoot et al.).
Electroporation, which involves high-voltage electrical pulses to a
solution containing a mixture of protoplasts and foreign DNA to
create reversible pores, has been used, for example, to
successfully introduce foreign genes into rice and Brassica napus.
Microinjection of DNA into plant cells, including cultured cells
and cells in intact plant organs and embryoids in tissue culture
and microprojectile bombardment (acceleration of small high density
particles, which contain the DNA, to high velocity with a particle
gun apparatus, which forces the particles to penetrate plant cell
walls and membranes) have also been used. All plant cells into
which DNA can be introduced and that can be regenerated from the
transformed cells can be used to produce transformed whole plants
which contain the transferred chromosome. The particular protocol
and means for introduction of the DNA into the plant host may need
to be adapted or refined to suit the particular plant species or
cultivar.
[0142] C. Insect Cells
[0143] Insects are useful hosts for introduction of artificial
chromosomes for numerous reasons, including, but not limited to:
(a) amplification of genes encoding useful proteins can be
accomplished in the artificial mammalian chromosome to obtain
higher protein yields in insect cells; (b) insect cells support
required post translational modifications, such as glycosylation
and phosphorylation, that can be required for protein biological
functioning; (c) insect cells do not support mammalian viruses,
and, thus, eliminate the problem of cross-contamination of products
with such infectious agents; (d) this technology circumvents
traditional recombinant baculovirus systems for production of
nutritional, industrial or medicinal proteins in insect cell
systems; (e) the low temperature optimum for insect cell growth
(28.degree. C.) permits reduced energy cost of production; (f)
serum free growth medium for insect cells permits lower production
costs; (g) artificial chromosome-containing cells can be stored
indefinitely at low temperature; and (h) insect larvae will be
biological factories for production of nutritional, medicinal or
industrial proteins by microinjection of fertilized insect eggs
(see, e.g., Joy et al. (1991) Current Science 66:145-150, which
provides a method for microinjecting heterologous DNA into Bombyx
mori eggs).
[0144] Either MACs or insect-specific (BUGACs) will used to
introduce genes into insects. As described in the Examples, it
appears that MACs will function in insects to direct expression of
heterologous DNA contained thereon.
[0145] Insect host cells include, but are not limited to, hosts
such as Spodoptera frugiperda (caterpillar), Aedes aegypti
(mosquito), Aedes albopictus (mosquito), Drosophila melanogaster
(fruitfly), Bombyx mori (silkworm) and Trichoplusia ni (cabbage
looper). Effort haves been directed toward propagation of insect
cells in culture. Such efforts have focused on the fall armyworm,
Spodoptera frugiperda. The cell lines have been developed also from
other insects such as the cabbage looper, trichoplusia ni and the
silkworm, Bombyx mori. It has also been suggested that analogous
cell lines can be created using the tobacco hornworm, or Manduca
sexta. To introduce DNA into an insect, it should be introduced
into the larvae, and allowed to proliferate, and then the hemolymph
recovered from the larvae so that the proteins can be isolated
therefrom. The preferred method herein is microinjection (see,
e.g., Tamura et al. (1991) Bio Ind. 8:26-31; Nikolaev et al. (1989)
Mol. Biol. (Moscow) 23:1177-87; and methods exemplified and
discussed herein).
[0146] D. Applications for and Uses of Artificial Chromosomes
[0147] Artificial chromosomes provide convenient and useful
vectors, and in some instances the only vectors for introduction of
heterologous genes into hosts. Virtually any gene of interest is
amenable to introduction into a host via an artificial chromosomes.
Such genes include, but are not limited to genes that encode
receptors, cytokines, enzymes, proteases, hormones, growth factors,
tumor suppressor genes, therapeutic products and multigene
pathways.
[0148] The artificial chromosomes provided herein will be used in
methods of protein and gene product production, particularly using
insects as host cells for production of such products. They are
also intended for use in methods of gene therapy, and in for
production of transgenic plants and animals (discussed above, below
and in the EXAMPLES).
[0149] 1. Gene Therapy
[0150] Any therapeutic gene product or product of a multigene
pathway may be introduced into a host animal, such as a human, or
into a target cell line for introduction into an animal, for
therapeutic purposes. Such therapeutic purposes include, genetic
therapy to cure or to provide gene products that are missing or
defective, to deliver agents, such as anti-tumor agents, to
targeted cells or to an animal, and to provide gene products that
will confer resistance or reduce susceptibility to a pathogen or
ameliorate symptoms of a disease or disorder. The following are
some exemplary genes and gene products. Such exemplification is not
intended to be limiting.
[0151] a. Anti-HIV Ribozymes
[0152] As exemplified below, DNA encoding anti-HIV ribozymes can be
introduced and expressed using MACs, including the
euchromatin-based minichromosomes and the SATACs. These MACs can be
used to make a transgenic mouse with that express a ribozyme and,
thus, serve as a model for testing the activity of such ribozymes
or from which ribozyme-producing cell lines can be made. Also,
introduction of a MAC into human cells that encodes an anti-HIV
ribozyme will serve as treatment for HIV infection.
[0153] b. Tumor Suppressor Genes
[0154] Tumor suppressor genes are genes that, in their wild-type
alleles, express proteins that suppress abnormal cellular
proliferation. When the gene coding for a tumor suppressor protein
is mutated or deleted, the resulting mutant protein or the complete
lack of tumor suppressor protein expression may fail to correctly
regulate cellular proliferation, and abnormal cellular
proliferation may take place, particularly if there is already
existing damage to the cellular regulatory mechanism. A number of
well-studied human tumors and tumor cell lines have been shown to
have missing or nonfunctional tumor suppressor genes.
[0155] Examples of tumor suppression genes include, but are not
limited to, the retinoblastoma susceptibility gene or RB gene, the
p53 gene, the deleted in colon carcinoma (DCC) gene and the
neurofibromatosis type 1 (NF-1) tumor suppressor gene (see, e.g.,
U.S. Pat. No. 5,496,731; Weinberg et al. (1991) 254:1138-1146).
Loss of function or inactivation of tumor suppressor genes may play
a central role in the initiation and/or progression of a
significant number of human cancers.
[0156] The p53 Gene
[0157] Somatic cell mutations of the p53 gene are said to be the
most frequently mutated gene in human cancer (see, e.g., Weinberg
et al. (1991) Science 254:1138-1146). The normal or wild-type p53
gene is a negative regulator of cell growth, which, when damaged,
favors cell transformation. The p53 expression product is found in
the nucleus, where it may act in parallel with or cooperatively
with other gene products. Tumor cell lines in which p53 has been
deleted have been successfully treated with wild-type p53 vector to
reduce tumorigenicity (see, Baker et al. (1990) Science
249:912-915).
[0158] DNA encoding the p53 gene and plasmids containing this DNA
are well known (see, e.g., U.S. Pat. No. 5,260,191; see, also Chen
et al. (1990) Science 250:1576; Farrel et al. (1991) EMBO J.
10:2879-2887, plasmids containing the gene are available from the
ATCC, and the sequence is in the GenBank Database, accession nos.
X54156, X60020, M14695, M16494, K03199).
[0159] c. The CFTR Gene
[0160] Cystic fibrosis (CF) is an autosomal recessive disease that
affects epithelia of the airways, sweat glands, pancreas, and other
organs. It is a lethal genetic disease associated with a defect in
Cl transport, and is caused by mutations in the gene coding for
cystic fibrosis transmembrane conductance regulator (CFTR), a 1480
amino acid protein that has been associated with the expression of
chloride conductance in a variety of eukaryotic cell types. Defects
in CFTR destroy or reduce the ability of epithelial cells in the
airways, sweat glands, pancreas and other tissues to secret Cl in
response to cAMP-mediated agonists and impair activation of apical
membrane channels by cAMP-dependent protein kinase A (PKA). Given
the high incidence and devastating nature of this disease,
development of effective CF treatments is imperative.
[0161] The CFTR gene (.about.600 kb) can be transferred, such as
from a CF-YAC (see Green et al. Science 250:94-98) by construction
of a selectable CF YAC by inserting a selectable marker, such as
puromycin or hygromycin resistance and .lambda.-DNA by site
specific integration into the neo-minichromosome or into a SATAC.
The CF-YAC can be introduced into cells, such as EC3/7C5 or
19C5xHa4 by yeast protoplast fusion or microinjection of yeast
nuclei into mammalian cells, select stable transformants, and
establish antibiotic-resistant cell lines.
[0162] 2. Disease Resistant Animals and Plants
[0163] Artificial chromosomes are ideally suited for preparing
disease resistant animals, including vertebrates and invertebrates,
including fish as well as mammals. In particular, multivalent
vaccines can be prepared. Such vaccines will be encoded by multiple
antigens that can be included in a MAC and either delivered to a
host to induce immunity, or incorporated into embryos to produce
disease-resistant animals and plants (or plants and animals that
are less susceptible).
[0164] Fish and crustaceans will serve as model hosts for
production of disease resistant animals.
[0165] 3. Use of MACs and Other Artificial Chromosomes for
Preparation of and Screening of Libraries
[0166] Since large fragments can incorporated into each SATAC,
entire genomes can be readily screened. For example, DNA encoding
tree growth factors can be introduced into trees. Libraries can be
prepared, introduce large fragments into chromosomes, and introduce
them all into trees, thereby insuring expression.
[0167] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
EXAMPLE 1
[0168] General Materials and Methods
[0169] The following materials and methods are exemplary of methods
that are used in the following Examples and that can be used to
prepare cell lines containing artificial chromosomes. Other
suitable materials and methods known to those of skill in the art
may used. Modifications of these materials methods known to those
of skill in the art may also be employed.
[0170] A. Culture of Cell Lines, Cell Fusion, and Transfection of
Cells
[0171] 1. Chinese hamster K20 cells and mouse A9 fibroblast cells
were cultured in F-12 medium. EC3/7 (see, U.S. Pat. No. 5,288,625,
and deposited at the European Collection of Animal cell Culture
(ECACC) under accession no. 90051001; see, also Hadlaczky et al.
(1991) Proc. Natl. Acad. Sci. U.S.A. 88:8106-8110 and U.S.
application Ser. No. 08/375,271) and EC3/7C5 (see, U.S. Pat. No.
5,288,625 and Praznovszky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:11042-11046) mouse cell lines, and the KE1-2/4 hybrid
cell line were maintained in F-12 medium containing 400 .mu.g/ml
G-418 (SIGMA, St. Louis, Mo.).
[0172] 2. TF1004G19 and TF1004G19C5 mouse cells, described below,
and the 19xHa4 hybrid, described below, and its sublines were
cultured in F-12 medium containing 400 .mu.g/ml Hygromycin B
(Calbiochem). LP11 cells were maintained in F-12 medium containing
3-15 .mu.g/ml Puromycin (SIGMA, St. Louis, Mo.).
[0173] 3. Cotransfection of EC3/7C5 cells with plasmids (pH132,
pCH110 available from Pharmacia, see, also Hall et al. (1983) J.
Mol. Appl. Gen. 2:101-109) and with .lambda. DNA was made using the
calcium phosphate DNA precipitation method (see, e.g., Chen et al.
(1987) Mol. Cell. Biol. 7:2745-2752), using 2-5 .mu.g plasmid DNA
and 20 .mu.g .lambda. phage DNA per 5.times.10.sup.6 recipient
cells.
[0174] 4. Cell Fusion
[0175] Mouse and hamster cells were fused using polyethylene glycol
(Davidson et al. (1976) Som. Cell Genet. 2:165-176). Hybrid cells
were selected in HAT medium containing 400 .mu.g/ml Hygromycin
B.
[0176] Approximately 2.times.10.sup.7 recipient and
2.times.10.sup.6 donor cells were fused using polyethylene glycol
(Davidson et al. (1976) Som. Cell Genet. 2:165-176). Hybrids were
selected and maintained in F-12/HAT medium (Szybalsky et al. (1962)
Natl. Cancer Inst. Monogr. 7:75-89) containing 10% FCS and 400
.mu.g/ml G418. The presence of "parental" chromosomes in the
hybrids cell lines was verified by in situ hybridizations with
species-specific probes using biotin labeled human and hamster
genomic DNA, and a mouse long interspersed repetitive DNA
(pMCPE1.51).
[0177] 5. Microcell Fusion
[0178] Microcell-mediated chromosome transfer was done according to
Saxon et al. ((1985) Mol. Cell. Biol. 1:140-146) with the
modifications of Goodfellow et al. ((1989) Techniques for mammalian
genome transfer. In Genome Analysis a Practical Approach. K. E.
Davies, ed., IRL Press, Oxford, Washington D.C. pp. 1-17) and
Yamada et al. ((1990) Oncogene 5:1141-1147). Briefly,
5.times.10.sup.6 EC3/7C5 cells in a T25 flask were treated first
with 0.05 .mu.g/ml colcemid for 48 hr and then with 10 .mu.g/ml
cytochalasin B for 30 min. The T25 flasks were centrifuged on edge
and the pelleted microcells were suspended in serum free DME
medium. The microcells were filtered through first a 5 micron and
then a 3 micron polycarbonate filter, treated with 50 .mu.g/ml of
phytohemagglutin, and used for polyethylene glycol mediated fusion
with recipient cells. Selection of cells containing the MMCneo was
started 48 hours after fusion in medium containing 400-800 .mu.g/ml
G418.6
[0179] B. Chromosome Banding
[0180] Trypsin G-banding of chromosomes was performed using the
method of Wang & Fedoroff ((1972) Nature 235:52-54), and the
detection of constitutive heterochromatin with the BSG. C-banding
method was done according to Sumner ((1972) Cell Res. 75:304-306).
For the detection of chromosome replication by bromodeoxyuridine
(BrdU) incorporation, the Fluorescein Plus Giemsa (FPG) staining
method of Perry & Wolff ((1974) Nature 251:156-158) was
used.
[0181] C. Immunolabelling of Chromosomes and In Situ
Hybridization
[0182] Indirect immunofluorescence labelling with human
anti-centromere serum LU851 (Hadlaczky et al. (1986) Exp. Cell Res.
167:1-15, and indirect immunofluorescence and in situ hybridization
on the same preparation were performed as described previously
(see, Hadlaczky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:8106-8110, see, also U.S. application Ser. No. 08/375,271).
Immunolabelling with fluorescein-conjugated anti-BrdU monoclonal
antibody (Boehringer) was performed according to the procedure
recommended by the manufacturer, except that for treatment of mouse
A9 chromosomes, 2 M hydrochloric acid was used at 37.degree. C. for
25 min, and for chromosomes of hybrid cells, 1 M hydrochloric acid
was used at 37.degree. C. for 30 min.
[0183] D. Scanning Electron Microscopy
[0184] Preparation of mitotic chromosomes for scanning electron
microscopy using osmium impregnation was performed as described
previously (Sumner (1991) Chromosoma 100:410-418). The chromosomes
were observed with a Hitachi S-800 field emission scanning electron
microscope operated with an accelerating voltage of 25 kV.
[0185] E. DNA Manipulations, Plasmids and Probes
[0186] 1. General Methods
[0187] All general DNA manipulations were performed by standard
procedures (see, e.g., Sambrook et al. (1989) Molecular cloning: A
Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.). The mouse major satellite probe was provided by Dr.
J. B. Rattner (University of Calgary, Alberta, Canada). Cloned
mouse satellite DNA probes (see, Wong et al. (1988) Nucl. Acids
Res. 16:11645-11661), including the mouse major satellite probe,
were gifts from Dr. J. B. Rattner, University of Calgary. Hamster
chromosome painting was done with total hamster genomic DNA, and a
cloned repetitive sequence specific to the centromeric region of
the chromosome 2 (Ftyol et al. (1994) Nucl. Acids Res.
22:3728-3736) was also used. Mouse chromosome painting was done
with a cloned long interspersed repetitive sequence (pMCP1.51)
specific for the mouse euchromatin.
[0188] For cotransfection and for in situ hybridization, the pCH110
.beta.-galactosidase construct (Pharmacia or Invitrogen), and
.lambda.cl 875 Sam7 phage DNA (New England Biolabs) were used.
[0189] 2. Construction of Plasmid pPuroTel
[0190] Plasmid pPuroTel, which carries a Puromycin resistance gene
and a cloned 2.5 kb human telomeric sequence (see, SEQ ID No 3),
was constructed from the pBabe-puro retroviral vector (Morgenstern
et al. (1990) Nucl. Acids Res. 18:3587-3596; provided by Dr. L.
Szkely (Microbiology and Tumorbiology Center, Karolinska
Institutet, Stockholm); see, also Tonghua et al. (1995) Chin. Med.
J. (Beijing, Engl. Ed.) 108:653-659; Couto et al. (1994) Infect.
Immun. 62:2375-2378; Dunckley et al. (1992) FEBS Lett. 296:128-34;
French et al. (1995) Anal. Biochem. 228:354-355; Liu et al. (1995)
Blood 85:1095-1103; International PCT application Nos. WO 9520044;
WO 9500178, and WO 9419456).
[0191] F. Deposited Cell Lines
[0192] Cell lines KE1 2/4, EC3/7C5, TF1004G19C5, 19C5xHa4, G3D5 and
H1D3 and have been deposited in accord with the Budapest Treaty at
the European Collection of Animal cell Culture (ECACC) under
Accession Nos. 96040924, 96040925, 96040926, 96040927, 96040928 and
96040929, respectively.
EXAMPLE 2
[0193] Preparation EC3/7, EC3/7C5 and Related Cell Lines
[0194] The EC3/7 cell line is an LMTK.sup.- mouse cell line that
contains the neo-centromere. The EC3/7C5 cell line is a single-cell
subclone of EC3/7 that contains the neo-minichromosome.
[0195] A. EC3/7 Cell Line
[0196] As described in U.S. Pat. No. 5,288,625 (see, also
Praznovszky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:11042-11046 and Hadlaczky et al. (1991) Proc. Natl. Acad. Sci.
U.S.A. 88:8106-8110) de novo centromere formation occurs in a
transformed mouse LMTK-fibroblast cell line (EC3/7) after
cointegration of A constructs (.lambda.CM8 and .lambda.gtWESneo)
carrying human and bacterial DNA.
[0197] By cotransfection of a 14 kb human DNA fragment cloned in
lambda (.lambda.CM8) and a dominant marker gene (.lambda.gtWESneo),
a selectable centromere linked to a dominant marker gene
(neo-centromere) was formed in mouse LMTK.sup.- cell line EC3/7
(Hadlaczky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:8106-8110, see FIG. 1) Integration of the heterologous DNA (the
.lambda. DNA and marker gene-encoding DNA) occurred into the short
arm of an acrocentric chromosome (chromosome 7 (see, FIG. 1B)),
where an amplification process resulted in the formation of the new
centromere (neo-centromere (see FIG. 1C)). On the dicentric
chromosome (FIG. 1C) the newly formed centromere region contains
all the heterologous DNA (human, lambda, and neo) introduced into
the cell, and an active centromere.
[0198] Having two functionally active centromeres on the same
chromosome causes regular breakages between the centromeres (see,
FIG. 1E). The distance between the two centromeres on the dicentric
chromosome is estimated to be .about.10-15 Mb, and the breakage
that separates the minichromosome occurred between the two
centromeres. Such specific chromosome breakages result in the
appearance (in approximately 10% of the cells) of a chromosome
fragment that carries the neo-centromere (FIG. 1F). This chromosome
fragment is principally composed of human, lambda, plasmid, and neo
gene DNA, but it also has some mouse chromosomal DNA. Cytological
evidence suggests that during the stabilization of the MMCneo,
there was an inverted duplication of the chromosome fragment
bearing the neo-centromere. The size of minichromosomes in both
cell lines is approximately 20-30 Mb; this finding indicates a
two-fold increase in size.
[0199] From the EC3/7 cell line, which contains the dicentric
chromosome (FIG. 1E), two sublines (EC3/7C5 and EC3/7C6) were
selected by repeated single-cell cloning. In these cell lines, the
neo-centromere was found exclusively on a small chromosome
(neo-minichromosome), while the formerly dicentric chromosome
carried detectable amounts of the exogenously-derived DNA sequences
but not an active neo-centromere (FIGS. 1F and 1G).
[0200] The minichromosomes of cell lines EC3/7C5 and EC3/7C6 are
similar. No differences are detected in their architectures at
either the cytological or molecular level. The minichromosomes were
indistinguishable by conventional restriction endonuclease mapping
or by long-range mapping using pulsed field electrophoresis and
Southern hybridization. The cytoskeleton of cells of the EC3/7C6
line showed an increased sensitivity to colchicine, so the EC3/7C5
line was used for further detailed analysis.
[0201] B. Preparation of the EC3/7C5 and EC3/7C6 Cell Lines
[0202] Integration of the "foreign" DNA, and subsequent
amplification of mouse and "foreign" DNA that leads to the
formation of a dicentric chromosome, occurs at the centromeric
region of the short arm of a mouse chromosome, identified by
G-banding as mouse chromosome 7. Because of the presence of two
functionally active centromeres on the same chromosome, regular
breakages occur between the centromeres. Such specific chromosome
breakages give rise to the appearance (in approximately 10% of the
cells) of a chromosome fragment carrying the neo-centromere and the
remaining portion of he formerly dicentric chromosome. From the
EC3/7 cell line carrying either the dicentric chromosome or a
chromosome fragment with the neo-centromere, two sublines (EC3/7C5
and EC3/7C6) were selected by repeated single-cell cloning. In
these cell lines, the neo-centromere was found exclusively on a
minichromosome (neo-minichromosome), while the formerly dicentric
chromosome carried traces of "foreign" DNA sequences.
[0203] The EC3/7C5 cells, which contain the dicentric chromosome,
were produced by subcloning the EC3/7 cell line in high
concentrations of G418 (40-fold the lethal dose) for 350
generations. Two single cell-derived stable cell lines (EC3/7C5 and
EC3/7C6) were established. These cell lines carry the
neo-centromere on minichromosomes and also contain the remaining
fragment of the dicentric chromosome. Indirect immunofluorescence
with anti-centromere antibodies and subsequent in situ
hybridization experiments demonstrated that the minichromosomes
derived from the dicentric chromosome. In EC3/7C5 and EC3/7C6 cell
lines (140 and 128 metaphases, respectively) no dicentric
chromosomes were found and minichromosomes were detected in 97.2%
and 98.1% of the cells, respectively. The minichromosomes have been
maintained for over 150 cell generations. They do contain the
remaining portion of the formerly dicentric chromosome.
[0204] Multiple copies of telomeric DNA sequences were detected in
the marker centromeric region of the dicentric chromosome by in
situ hybridization. This indicates that mouse telomeric sequences
were coamplified with the foreign DNA sequences. These stable
minichromosome-carrying cell lines provide direct evidence that the
extra centromere containing human DNA is functioning and is capable
of maintaining the minichromosomes (see, U.S. Pat. No.
5,288,625).
[0205] The chromosome breakage in the EC3/7 cells, which separates
the neo-centromere from the mouse chromosome, occurred in the
G-band positive "foreign" DNA region. This is supported by the
observation of traces of .lambda. and human DNA sequences at the
broken end of the formerly dicentric chromosome. Comparing the
G-band pattern of the chromosome fragment carrying the
neo-centromere with that of the stable neo-minichromosome, reveals
that the neo-minichromosome is an inverted duplicate of the
chromosome fragment that bears the neo-centromere. This is also
evidenced by the observation that although the neo-minichromosome
carries only one functional centromere, both ends of the
minichromosome are heterochromatic, and mouse satellite DNA
sequences were found in these heterochromatic regions by in situ
hybridization.
[0206] These two cell lines EC3/7C5 and EC3/7C6, thus, carry a
selectable mammalian minichromosome (MMCneo) with a centromere
linked to a dominant marker gene Hadlaczky et al. (1991) Proc.
Natl. Acad. Sci. U.S.A. 88:8106-8110). MMCneo is intended to be
used as a vector for minichromosome-mediated gene transfer and has
been used as model of a minichromosome-based vector system.
[0207] Long range mapping studies of the MMCneo indicated that
human DNA and the neo gene constructs integrated into the mouse
chromosome separately, followed by the amplification of the
chromosome region that contains the exogenous DNA. The MMCneo
contains about 30-50 copies of the .lambda.CM8 and .lambda.gtWESneo
DNA in the form of approximately 160 kb repeated blocks, which
together cover at least a 3.5 Mb region. In addition to these,
there are mouse telomeric sequences (Praznovszky et al. (1991)
Proc. Natl. Acad. Sci. U.S.A. 88:11042-11046) and any DNA of mouse
origin necessary for the correct higher-ordered structural
organization of chromatids.
[0208] Using a chromosome painting probe mCPE1.51 (mouse long
interspersed repeated DNA), which recognizes exclusively
euchromatic mouse DNA, detectable amounts of interspersed repeat
sequences were found on the MMCneo by in situ hybridization. The
neo-centromere is associated with a small but detectable amount of
satellite DNA. The chromosome breakage that separates the
neo-centromere from the mouse chromosome occurs in the "foreign"
DNA region. This is demonstrated by the presence of lambda and
human DNA at the broken end of the formerly dicentric chromosome.
At both ends of the MMCneo, however, there traces of mouse major
satellite DNA occur as evidence by in situ hybridization. This
observation suggests that the doubling in size of the chromosome
fragment carrying the neo-centromere during the stabilization of
the MMCneo is a result of an inverted duplication. Although mouse
telomere sequences, which coamplified with the exogenous DNA
sequences during the neo-centromere formation, may provide
sufficient telomeres for the MMCneo, the duplication could have
supplied the functional telomeres for the minichromosome.
[0209] C. Isolation and Partial Purification of Minichromosomes
[0210] Mitotic chromosomes of EC3/7C5 cells were isolated as
described by Hadlaczky et al. ((1981) Chromosoma 81:537-555), using
a glycine-hexylene glycol buffer system (Hadlaczky et al. (1982)
Chromosoma 86:643-659). Chromosome suspensions were centrifuged at
1,200.times.g for 30 minutes. The supernatant containing
minichromosomes was centrifuged at 5,000.times.g for 30 minutes and
the pellet was resuspended in the appropriate buffer. Partially
purified minichromosomes were stored in 50% glycerol at -20.degree.
C.
[0211] D. Stability of the MMCneo Maintenance and Neo
Expression
[0212] EC3/7C5 cells grown in non-selective medium for 284 days and
then transferred to selective medium containing 400 .mu.g/ml G418
showed a 96% plating efficiency (colony formation) compared to
control cells cultured permanently in the presence of G418.
Cytogenetic analysis indicated that the MMCneo is stably maintained
at one copy per cell both under selective and non-selective culture
conditions. Only two metaphases with two MMCneo were found in 2,270
metaphases analyzed.
[0213] Southern hybridization analysis showed no detectable changes
in DNA restriction patterns, and similar hybridization intensities
were observed with a neo probe when DNA from cells grown under
selective or non-selective culture conditions were compared.
[0214] Northern analysis of RNA transcripts from the neo gene
isolated from cells grown under selective and non-selective
conditions showed only minor and not significant differences.
Expression of the neo gene persisted in EC3/7C5 cells maintained in
F-12 medium free of G418 for 290 days under non-selective culture
conditions. The long term expression of the neo gene(s) from the
minichromosome may be influenced by the nuclear location of the
MMCneo. In situ hybridization experiments revealed a preferential
peripheral location of the MMCneo in the interphase nucleus. In
more than 60% of the 2,500 nuclei analysis, the minichromosome was
observed at the perimeter of the nucleus near the nuclear
envelope.
EXAMPLE 3
[0215] Minichromosome Transfer and Production of the
.lambda.-Neo-Chromosome
[0216] A. Minichromosome Transfer
[0217] The neo-minichromosome (referred MMCneo, FIG. 2C) has been
used for gene transfer by fusion of minichromosome containing cells
(EC3/7C5 or EC3/7C6) with different mammalian cells, including
hamster and human. Thirty-seven stable hybrid cell lines have been
produced. All established hybrid cell lines proved to be true
hybrids as evidenced by in situ hybridization using biotinylated
human, and hamster genomic, or pMCPE1.51 mouse long interspersed
repeated DNA probes for "chromosome painting".
[0218] The MMCneo has also been successfully transferred into mouse
A9, L929 and pluripotent F9 teratocarcinoma cells by fusion of
microcells derived from EC3/7C5 cells. Transfer was confirmed by
PCR, Southern blotting and in situ hybridization with
minichromosome-specific probes. The cytogenetic analysis confirmed
that, as expected for microcell fusion, a few cells (1-5%) received
(or retained) the MMCneo.
[0219] These demonstrate that the MMCneo is tolerated by a wide
range of cells. The prokaryotic genes and the extra dosage for the
human and lambda sequences carried on the minichromosome seem to be
not disadvantageous for tissue culture cells.
[0220] The MMCneo is the smallest chromosome of the EC3/7C5 genome
and is estimated to be approximately 20-30 Mb, which is
significantly smaller than the majority of the host cell (mouse)
chromosomes. By virtue of the smaller size, minichromosomes can be
partially purified from a suspension of isolated chromosomes by a
simple differential centrifugation. In this way, minichromosome
suspensions of 15-20% purity have been prepared. These enriched
minichromosome preparations can be used to introduce, such as by
microinjection or lipofection the minichromosome into selected
target cells. Target cells include therapeutic cells that can be
use in methods of gene therapy, and also embryonic cells for the
preparation of transgenic animals.
[0221] The MMCneo is capable of autonomous replication, is stably
maintained in cells, and permits persistent expression of the neo
gene(s), even after long-term culturing under non-selective
conditions. It is a non-integrative vector that appears to occupy a
territory near the nuclear envelope. Its peripheral localization in
the nucleus may have an important role in maintaining the
functional integrity and stability of the MMCneo. Functional
compartmentalization of the host nucleus may have an effect on the
function of foreign sequences. In addition, contains megabases of
lambda DNA sequences that should serve as a target site for
homologous recombination and thus integration of desired gene(s)
into the MMCneo. It can be transferred by cell and microcell
fusion, microinjection, electroporation, or chromosome uptake. The
neo-centromere of the MMCneo is capable of maintaining and
supporting the normal segregation of a larger 150-200 Mb
.lambda.neo chromosome. This result (B) demonstrates that the
MMCneo chromosome should be useful for carrying large fragments of
heterologous DNA.
[0222] B. Production of the .lambda.-Neo-Chromosome
[0223] In one hybrid cell line KE1-2/4 made by fusion of EC3/7 and
Chinese hamster ovary cells (FIG. 2D), the separation of the
neo-centromere from the dicentric chromosome was associated with a
further amplification process. This amplification resulted in the
formation of a stable, chromosome of average size (i.e., the
.lambda. neo-chromosome; see, Praznovszky et al. (1991) Proc. Natl.
Acad. Sci. U.S.A. 88:11042-11046). The .lambda. neo-chromosome
carries a terminally located functional centromere, and is composed
of seven large amplicons containing multiple copies of .lambda.,
human, bacterial, and mouse DNA sequences (see FIG. 2). The
amplicons are separated by mouse major satellite DNA (Praznovszky
et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:11042-11046) which
forms narrow bands of constitutive heterochromatin between the
amplicons.
EXAMPLE 4
[0224] Formation of the "Sausage Chromosome" (SC)
[0225] The findings set forth in the above EXAMPLES demonstrate
that the centromeric region of the mouse chromosome 7 has the
capacity for large-scale amplification (other results indicate that
this capacity is not unique to chromosome 7). This conclusion is
further supported by results from cotransfection experiments, in
which a second dominant selectable marker gene and a non-selected
marker gene were introduced into EC3/7 cells carrying the formerly
dicentric chromosome 7 and the neo-minichromosome. The EC3/7C5 cell
line was transformed with .lambda. phage DNA, a hygromycin
construct (pH132), and a .beta.-galactosidase construct (pCH110).
Stable transformants were selected in the presence of high
concentrations (400 .mu.g/ml) Hygromycin B, and analyzed by
Southern hybridization. Established transformant cell lines showing
multiple copies of integrated exogenous DNA were studied by in situ
hybridization to localize the integration site(s), and by LacZ
staining to detect .beta.-galactosidase expression.
[0226] A. Materials and Methods
[0227] 1. Construction of pH132
[0228] The pH132 plasmid carries the hygromycin B resistance gene
and the anti-HIV-1 gag ribozyme (see, SEQ ID NO. 6 for DNA sequence
that corresponds to the sequence of the ribozyme) under control of
the .beta.-actin promoter. This plasmid was constructed from pHyg
plasmid (Sugden et al. (1985) Mol. Cell. Biol. 5:410-413; a gift
from Dr. A. D. Riggs, Beckman Research Institute, Duarte; see,
also, e.g., U.S. Pat. No. 4,997,764), and from pPC-RAG12 plasmid
(see, Chang et al. (1990) Clin Biotech 2:23-31; provided by Dr. J.
J. Rossi, Beckman Research Institute, Duarte; see, also U.S. Pat.
Nos. 5,272,262, 5,149,796 and 5,144,019, which describes the
anti-HIV gag ribozyme and construction of a mammalian expression
vector containing the ribozyme insert linked to the .beta.-actin
promoter and SV40 late gene transcriptional termination and polyA
signals). The ribozyme insert flanked by BamHI linkers was inserted
into BamHI-digested pH.beta.-Apr-1gpt (see, Gunning et al. (1987)
Proc. Natl. Acad. Sci. U.S.A. 84:4831-4835, see, also U.S. Pat. No.
5,144,019). An EcoRI/XhoI fragment of this vector was inserted into
EcoRI/XhoI-digested pHyg.
[0229] Plasmid pH132 was constructed as follows. First, pPC-RAG12
(described by Chang et al. (1990) Clin. Biotech. 2:23-31) was
digested with BamHI to excise a fragment containing an anti-HIV
ribozyme gene (referred to as ribozyme D by Chang et al. ((1990)
Clin. Biotech. 2:23-31); see also U.S. Pat. No. 5,144,019 to Rossi
et al., particularly FIG. 4 of the patent) flanked by the human
.beta.-actin promoter at the 5' end of the gene and the SV40 late
transcriptional termination and polyadenylation signals at the 3'
end of the gene. As described by Chang et al. ((1990) Clin.
Biotech. 2:23-31), ribozyme D is targeted for cleavage of the
translational initiation region of the HIV gag gene. This fragment
of pPC-RAG12 was subcloned into pBluescript-KS(+) (Stratagene, La
Jolla, Calif.) to produce plasmid 132. Plasmid 132 was then
digested with XhoI and EcoRI to yield a fragment containing the
ribozyme D gene flanked by the .beta.-actin promoter at the 5' end
and the SV40 termination and polyadenylation signals at the 3' end
of the gene. This fragment was ligated to the largest fragment
generated by digestion of pHyg (Sugden et al. (1985) Mol. Cell.
Biol. 5:410-413) with EcoRI and SalI to yield pH132. Thus, pH132 is
an .about.9.3 kb plasmid containing the following elements: the
.beta.-actin promoter linked to an anti-HIV ribozyme gene followed
by the SV40 termination and polyadenylation signals, the thymidine
kinase gene promoter linked to the hygromycin resistance gene
followed by the thymidine kinase gene polyadenylation signal, and
the E. coli ColE1 origin of replication and the
ampicillin-resistance gene.
[0230] The plasmid pHyg (see, e.g., U.S. Pat. Nos. 4,997,764,
4,686,186 and 5,162,215), which confers resistance to hygromycin B
using transcriptional controls from the HSV-1 tk gene, was
originally constructed from pKan2 (Yates et al. (1984) Proc. Natl.
Acad. Sci. U.S.A. 81:3806-3810) and pLG89 (see, Gritz et al. (1983)
Gene 25:179-188). Briefly pKan2 was digested with SmaI and BglII to
remove the sequences derived from transposon Tn5. The
hygromycin-resistance hph gene was inserted into the digested pKan2
using blunt-end ligation at the SnaI site and "sticky-end" ligation
(using 1 Weiss unit of T4 DNA ligase (BRL) in 20 microliter volume)
at the BglII site. The SmaI and BglII sites of pKan2 were lost
during ligation.
[0231] The resulting plasmid pH132, produced from introduction of
the anti-HIV ribozyme construct with promoter and polyA site into
pHyg, includes the anti-HIV ribozyme under control of the
.beta.-actin promoter as well as the Hyg gene under control of the
TK promoter.
[0232] 2. Chromosome Banding
[0233] Trypsin G-banding of chromosomes was performed as described
in EXAMPLE 1.
[0234] 3. Cell Cultures
[0235] TF1004G19 and TF1004G19C5 mouse cells and the 19xHa4 hybrid,
described below, and its sublines were cultured in F-12 medium
containing 400 .mu.g/ml Hygromycin B (Calbiochem). B.
Cotransfection of EC3/7C5 to produce TF1004G-19 Cotransfection of
EC3/7C5 cells with plasmids (pH132, pCH110 available from
Pharmacia, see, also Hall et al. (1983) J. Mol. Appl. Gen.
2:101-109) and with .lambda. DNA (.lambda.cl 875 Sam 7 (New England
Biolabs)) was made using the calcium phosphate DNA precipitation
method (see, e.g., Chen et al. (1987) Mol. Cell. Biol.
7:2745-2752), using 2-5 .mu.g plasmid DNA and 20 .mu.g .lambda.
phage DNA per 5.times.10.sup.6 recipient cells.
[0236] C. Cell Lines Containing the Sausage Chromosome
[0237] One transformant TF1004G-19 was identified. It has a high
copy number of integrated pH132 and pCH110 sequences, and a high
level of .beta.-galactosidase expression. G-banding and in situ
hybridization with a human probe (CM8; see, e.g., U.S. application
Ser. No. 08/375,271) revealed unexpectedly that integration had
occurred in the formerly dicentric chromosome 7 of the EC3/7C5 cell
line. Furthermore, this chromosome carried a newly formed
heterochromatic chromosome arm. The size of this heterochromatic
arm varied between .about.150 and .about.800 Mb in individual
metaphases.
[0238] By single cell cloning from the TF1004G-19 cell line, a
subclone TF1004G-19C5 (FIG. 2D), which carries a stable chromosome
7 with a .about.100-150 Mb heterochromatic arm (the sausage
chromosome) was obtained. This cell line has been deposited in the
ECACC under Accession No. 96040926. This chromosome arm is composed
of four to five satellite segments rich in satellite DNA, and
evenly spaced integrated heterologous "foreign" DNA sequences. At
the end of the compact heterochromatic arm of the sausage
chromosome, a less condensed euchromatic terminal segment is
regularly observed. This subclone was used for further
analyses.
[0239] D. Demonstration that the Sausage Chromosome is Derived from
the Formerly Dicentric Chromosome
[0240] In situ hybridization with lambda phage and pH132 DNA on the
TF1004G-19C5 cell line showed positive hybridization only on the
minichromosome and on the heterochromatic arm of the "sausage"
chromosome (FIG. 2D). It appears that the "sausage" chromosome
(herein also referred to as the SC) developed from the formerly
dicentric chromosome (FD) of the EC3/7C5 cell line.
[0241] To establish this, the integration sites of pCH110 and pH132
plasmids was determined. This was accomplished by in situ
hybridization on these cells with biotin-labeled subfragments of
the hygromycin resistance gene and the .beta.-galactosidase gene.
Both experiments resulted in narrow hybridizing bands on the
heterochromatic arm of sausage chromosome. The same hybridization
pattern was detected on the sausage chromosome using a mixture of
biotin-labeled .lambda. probe and pH132 plasmid, proving the
cointegration of lambda phages, pH132 and pCH110 plasmids.
[0242] To examine this further, the cells were cultured in the
presence of the DNA-binding dye Hoechst 33258. Culturing of mouse
cells in the presence of this dye results in under-condensation of
the pericentric heterochromatin of metaphase chromosomes, thereby
permitting better observation of the hybridization pattern. Using
this technique the heterochromatic arm of sausage chromosome of
19C5 cell showed regular under-condensation revealing the details
of the structure of "sausage" chromosome by in situ hybridization.
Results of in situ hybridization on Hoechst-treated TF1004G/19C5
cells with biotin-labeled subfragments of hygromycin resistance and
8-galactosidase genes shows that these genes are localized only in
the heterochromatic arm of the sausage chromosome. In addition an
equal banding hybridization pattern was observed. This pattern of
repeating units (amplicons) clearly indicates that the sausage
chromosome was formed by an amplification process and that the
lambda phage, pH132 and pCH110 plasmid DNA sequences border the
amplicons.
[0243] In another series of experiments, using fluorescence in situ
hybridization (FISH) was carried out with mouse major satellite
DNA, the main component of the mouse pericentric heterochromatin,
the results confirmed that the amplicons of the sausage chromosome
are primarily composed of satellite DNA.
[0244] E. The Sausage Chromosome has One Centromere
[0245] To determine whether mouse centromeric sequences had
participated in the amplification process forming the "sausage"
chromosome and whether or not the amplicons carry inactive
centromeres, in situ hybridization was carried out with mouse minor
satellite DNA. Mouse minor satellite DNA is localized specifically
near the centromeres of all mouse chromosome. Positive
hybridization was detected in all mouse centromeres including the
sausage chromosome, which, however, only showed a positive signal
at the beginning of the heterochromatic arm.
[0246] Indirect immunofluorescence with human anti-centromere
antibody (LU 851) that only which can recognizes the functional
centromeres (see, e.g., Hadlaczky et al. (1989) Chromosoma
97:282-288) proved that sausage chromosome has only one active
centromere. The centromere comes from the formerly dicentric part
of the chromosome and colocalizes with the in situ hybridization
signal of the mouse minor DNA probe.
[0247] F. The Selected and Non-Selected Heterologous DNA in the
Heterochromatin of the Sausage Chromosome is Expressed
[0248] 1. High Levels of the Heterologous Genes are Expressed
[0249] The TF1004G/19C5 cell line thus carries multiple copies of
hygromycin resistance and .beta.-galactosidase genes localized only
in the heterochromatic arm of the sausage chromosome. The 19C5
cells can grow very well in the presence of 200 .mu.g/ml or even
400 .mu.g/ml hygromycin B. (The level of expression was determined
by Northern hybridization with subfragment of hygromycin resistance
gene and single copy gene).
[0250] The expression of the non-selected .beta.-galactosidase gene
in the TF1004G/19C5 transformant, was detected with LacZ staining
of the cells. By this method one hundred percent of the cells
stained dark blue, showing that there is a high level of
.beta.-galactosidase expression in all of 19C5 cells.
[0251] 2. The Heterologous Genes that are Expressed are in the
Heterochromatin
[0252] To demonstrate that the genes localized in the constitutive
heterochromatin of the sausage chromosome provide the hygromycin
resistance and the LacZ staining capability of 19C5 transformant
(i.e. .beta.-gal express), PEG induced cell fusion between a
TF1004G/19C5 mouse cell and Chinese hamster ovary cell was
performed. The hybrids were selected and maintained in HAT medium
containing G418 (400 .mu.g/ml) and hygromycin (200 .mu.g/ml). Two
hybrid clones designated 19C5xHa3 and 19C5xHa4, which has been
deposited in the ECACC under Accession No. 96040927, were selected.
Both carry the sausage chromosome and the minichromosome.
[0253] Twenty-seven single cell derived colonies of 19C5xHa4 hybrid
were maintained and analyzed as individual subclones. In situ
hybridization with hamster and mouse chromosome painting probes and
hamster chromosome 2 specific probes verified that the 19C5xHa4
clone contains the complete Chinese hamster genome and a partial
mouse genome. All 19C5xHa4 subclones retained the hamster genome,
but different subclones showed different number of mouse
chromosomes indicating the preferential elimination of mouse
chromosomes.
[0254] To promote further elimination of mouse chromosomes hybrid
cells were repeatedly treated with BrdU. The BrdU treatments, which
destabilize the genome, result in significant loss of mouse
chromosomes. The BrdU treated 19C5xHa4 hybrid cells were divided to
three groups. One group of the hybrid cells (GH) was maintained in
the presence of hygromycin (200 .mu.g/ml) and G418 (400 .mu.g/ml),
and the other two groups of the cells were cultured under G418 (G)
or hygromycin (H) selection conditions to promote the elimination
of sausage or minichromosome.
[0255] One month later, single cell derived subclones were
established from these three subcultures of the TF1004G/19C5xHa4
hybrid line. The subclones were monitored by in situ hybridization
with biotin-labeled lambda phage and hamster chromosome painting
probes. Four individual clones (G2B5, G3C5, G4D6, G2B4) selected in
the presence of G418 that have lost the sausage chromosome but
retained minichromosome were found. Under hygromycin selection only
one subclone (H1D3) lost the minichromosome. In this clone the
sausage chromosome was present.
[0256] Since hygromycin resistance and .beta.-galactosidase genes
were thought to be expressed from the sausage chromosome, the
expression of these genes were analyzed in the four subclones that
had lost the sausage chromosome. In the presence of 200 .mu.g/ml
hygromycin, one hundred percent of the cells of four individual
subclones died. In order to detect the .beta.-galactosidase
expression hybrid subclones were analyzed by LacZ staining. One
hundred percent of the cells of the four subclones that lost the
sausage chromosome also lost the LacZ staining capability. All of
the other hybrid subclones that not lost the sausage chromosome
under the non-selective culture conditions showed positive LacZ
staining.
[0257] These findings demonstrate that the expression of hygromycin
resistance and .beta.-galactosidase genes is linked to the presence
of the sausage chromosome and results of in situ hybridizations
show that the heterologous DNA is expressed from the constitutive
heterochromatin of the sausage chromosome.
[0258] By in situ hybridization in three other hybrid subclones
(G2C6, G2D1, and G4D5) the presence of the sausage chromosome was
not detected. By the LacZ staining method some stained cells were
detected in these hybrid lines and when these subclones were
transferred to hygromycin selection some colonies survived.
Cytological analysis and in situ hybridization of these hygromycin
resistance colonies revealed the presence of the sausage
chromosome, suggesting that only the cells of G2C6, G2D1 and G4D5
hybrids that had not lost the sausage chromosome were able to
preserve the hygromycin resistance and .beta.-galactosidase
expression. These results confirmed that the expression of these
genes is linked to the presence of the sausage chromosome. The
level of .beta.-galactosidase expression was determined by the
immunoblot technique using monoclonal antibody.
[0259] Hygromycin resistance and .beta.-galactosidase expression of
the cells which contained the sausage chromosome were provided by
the genes localized in the mouse pericentric heterochromatin. This
was demonstrated by performing Southern DNA hybridizations on the
hybrid cells that lack the sausage chromosome with PCR amplified
subfragments of hygromycin resistance and .beta.-galactosidase
genes. None of the subclones showed hybridization with these
probes, however, all of the analyzed clones contained the
minichromosome as well. Other hybrid clones that contain the
sausage chromosome showed intense hybridization with these DNA
probes. These results lead to the conclusion that hygromycin
resistance and .beta.-galactosidase expression of the cells that
contain the sausage chromosome were provided by the genes localized
in the mouse pericentric heterochromatin.
EXAMPLE 5
[0260] The Gigachromosome
[0261] As described in Example 4, the sausage chromosome was
transferred into Chinese hamster cells by cell fusion. Using
Hygromycin B/HAT selection, two hybrid clones 19C5xHa3 and 19C5xHa4
were produced that carry sausage chromosome. In situ hybridization,
using hamster and mouse chromosome-painting probes and a hamster
chromosome 2 specific probe, verified that clone 19C5xHa4 contains
a complete Chinese hamster genome as well as partial mouse genomes.
Twenty-seven separate colonies of 19C5xHa4 cells were maintained
and analyzed as individual subclones. Twenty-six out of 27
subclones contained a morphologically unchanged sausage
chromosome.
[0262] In one clone 19C5xHa47 (see FIG. 2E), the heterochromatic
arm of the sausage chromosome became unstable and showed continuous
intrachromosomal growth. In extreme cases, the amplified chromosome
arm exceeded 1000 Mb in size (gigachromosome).
EXAMPLE 6
[0263] The Stable Megachromosome
[0264] A. Formation of the Megachromosome
[0265] All 19C5xHa4 subclones retained a complete hamster genome,
but different subclones showed different numbers of mouse
chromosomes, indicating the preferential elimination of mouse
chromosomes. As described in Example 4, to promote further
elimination of mouse chromosomes, hybrid cells were repeatedly
treated with 10.sup.-4 M BrdU for 16 hours and single cell
subclones were established. The BrdU treatments appeared to
destabilize the genome, resulting in a change in the sausage
chromosome as well. A gradual increase in a cell population in
which a further amplification had occurred was observed. In
addition to the .about.100-150 Mb heterochromatic arm of the
sausage chromosome, an extra centromere and a .about.150-250 Mb
heterochromatic chromosome arm were formed, which differed from
those of mouse chromosome 7. By the acquisition of another
euchromatic terminal segment, a new submetacentric chromosome
(megachromosome) was formed. Seventy-nine individual subclones were
established from these BrdU-treated cultures, by single-cell
cloning: 42 subclones carried the intact megachromosome, 5
subclones carried the sausage chromosome, and in 32 subclones
fragments or translocated segments of the megachromosome were
observed. Twenty-six subclones were cultured under non-selective
conditions over a 2 month period. In 19 out of 26 subclones, the
megachromosome was retained. Those subclones which lost the
megachromosomes all became sensitive to Hygromycin B and had no
.beta.-galactosidase expression, indicating that both markers were
linked to the megachromosome.
[0266] Two sublines (G3D5 and H1D3), which were chosen for further
experiments, showed no changes in the morphology of the
megachromosome during more than 100 generations under selective
conditions.
[0267] B. Structure of the Megachromosome
[0268] The following results demonstrate that, apart from the
euchromatic terminal segments, the whole megachromosome is
constitutive heterochromatin, containing a tandem array of at least
40 (.about.7.5 Mb) blocks of mouse major satellite DNA (see FIGS. 2
and 3). Four satellite DNA blocks are organized into a giant
palindrome (amplicon) carrying integrated exogenous DNA sequences
at each end. The long and short arms of the submetacentric
megachromosome contains 6 and 4 amplicons, respectively.
[0269] 1. The Megachromosome is Composed Primarily of
Heterochromatin
[0270] Except for the terminal regions, the megachromosome is
composed primarily of heterochromatin. This was demonstrated by
G-banding of the megachromosome, which resulted in positive
staining characteristic of constitutive heterochromatin. Apart from
the terminal regions, the whole megachromosome appears to be
heterochromatic. Mouse major satellite DNA is the main component of
the pericentric, constitutive heterochromatin of mouse chromosomes
and represents .about.10% of the total DNA (Waring et al. (1966)
Science 154:791-794). Using a mouse major satellite DNA probe for
in situ hybridization, strong hybridization was observed throughout
the megachromosome, except for its terminal regions. The
hybridization showed a segmented pattern: four large blocks
appeared on the short arm and usually 4-7 blocks were seen on the
long arm. By comparing these segments with the pericentric regions
of normal mouse chromosomes that carry approximately .about.15 Mb
of major satellite, the size of the blocks of major satellite on
the megachromosome was estimated to be .about.30 Mb.
[0271] Using a mouse probe specific to euchromatin (pMCPE1.51; a
mouse long interspersed repeated DNA probe), positive hybridization
was detected only on the terminal segments of the megachromosome of
the H1D3 hybrid subline. In the G3D5 hybrids, hybridization with a
hamster-specific probe revealed that several megachromosomes
contained terminal segments of hamster origin on the long arm. This
observation indicated that the acquisition of the terminal segments
on these chromosomes happened in the hybrid cells, and that the
long arm of the megachromosome was the recently formed one. When a
mouse minor satellite probe was used, specific to the centromeres
of mouse chromosomes (Wong et al. (1988) Nucl. Acids Res.
16:11645-11661), a strong hybridization signal was detected only at
the primary constriction of the megachromosome, which colocalized
with the positive immunofluorescence signal produced with human
anti-centromere serum (LU 851).
[0272] In situ hybridization experiments with pH132, pCH110, and
.lambda. DNA probes revealed that all heterologous DNA was located
in the gaps between the mouse major satellite segments. Each
segment of mouse major satellite was bordered by a narrow band of
integrated heterologous DNA, except at the second segment of the
long arm where a double band existed, indicating that the major
satellite segment was missing or considerably reduced in size here.
This chromosome region served as a useful cytological marker in
identifying the long arm of the megachromosome. At a frequency of
10.sup.-4, "restoration" of these missing satellite DNA blocks was
observed in one chromatid, when the formation of a whole segment on
one chromatid occurred.
[0273] After Hoechst 33258 treatment (50 .mu.g/ml for 16 hours),
the megachromosome showed undercondensation throughout its length
except for the terminal segments. This made it possible to study
the architecture of the megachromosome at higher resolution. In
situ hybridization with the mouse major satellite probe on
undercondensed megachromosomes demonstrated that the .about.30 Mb
major satellite segments were composed of four blocks of .about.7.5
Mb separated from each other by a narrow band of non-hybridizing
sequences (FIG. 3). Similar segmentation can be observed in the
large block of pericentric heterochromatin in metacentric mouse
chromosomes from the LMTK.sup.- and A9 cell lines.
[0274] 2. The Megachromosome is Composed of Segments Containing Two
Tandem .about.7.5 Mb Blocks are Followed by Two Inverted Blocks
[0275] Because of the asymmetry in thymidine content between the
two strands of the DNA of the mouse major satellite, when mouse
cells are grown in the presence of BrdU for a single S phase, the
constitutive heterochromatin shows lateral asymmetry after FPG
staining. Also, in the 19C5xHa4 hybrids, the thymidine-kinase the
(Tk) deficiency of the mouse fibroblast cells was complemented by
the hamster Tk gene, permitting BrdU incorporation experiments.
[0276] A striking structural regularity in the megachromosome was
detected using the FPG technique. In both chromatids, alternating
dark and light staining that produced a checkered appearance of the
megachromosome was observed. A similar picture was obtained by
labelling with fluorescein-conjugated anti-BrdU antibody. Comparing
these pictures to the segmented appearance of the megachromosome,
showed that one dark and one light FPG band corresponded to one
.about.30 Mb segment of the megachromosome. These results suggest
that the two halves of the .about.30 Mb segment have an inverted
orientation. This was verified by combining in situ hybridization
and immunolabelling of the incorporated BrdU with
fluorescein-conjugated anti-BrdU antibody on the same chromosome.
Since the .about.30 Mb segments of the megachromosome are composed
of four blocks of mouse major satellite, it can be concluded that
two tandem .about.7.5 Mb blocks are followed by two inverted blocks
within one segment.
[0277] Large-scale mapping of megachromosome DNA by pulsed-field
electrophoresis and Southern hybridization with "foreign" DNA
probes revealed a simple pattern of restriction fragments. Using
endonucleases with none, or only a single cleavage site in the
integrated foreign DNA sequences, followed by hybridization with a
hyg probe, 1-4 predominant fragments were detected. Since the
megachromosome contains 10-12 amplicons with an estimated 3-8
copies of hyg sequences per amplicon (30-90 copies per
megachromosome), the small number of hybridizing fragments
indicates the homogeneity of DNA in the amplified segments.
[0278] 3. Scanning Electron Microscopy of the Megachromosome
Confirmed the Above Findings
[0279] The homogeneous architecture of the heterochromatic arms of
the megachromosome was confirmed by high resolution scanning
electron microscopy. Extended arms of megachromosomes, and the
pericentric heterochromatic region of mouse chromosomes, treated
with Hoechst 33258, showed similar structure. The constitutive
heterochromatic regions appeared more compact than the euchromatic
segments. Apart from the terminal regions, both arms of the
megachromosome were completely extended, and showed faint grooves,
which should correspond to the border of the satellite DNA blocks
in the non-amplified chromosomes and in the megachromosome. Without
Hoechst treatment, the grooves seemed to correspond to the amplicon
borders on the megachromosome arms. In addition, centromeres showed
a more compact, finely fibrous appearance than the surrounding
heterochromatin.
[0280] C. Formation of the Megachromosome
[0281] FIG. 2 schematically sets forth the events leading to the
formation of the stable megachromosome: (A) A single E-type
amplification in the centromeric region of chromosome 7 generates
the neo-centromere linked to the integrated foreign DNA, and forms
a dicentric chromosome. Multiple E-type amplification forms the
.lambda. neo-chromosome, which was derived from chromosome 7 and
stabilized in a mouse-hamster hybrid cell line; (B) Specific
breakage between the centromeres of a dicentric chromosome 7
generates a chromosome fragment with the neo-centromere, and a
chromosome 7 with traces of foreign DNA at the end; (C) Inverted
duplication of the fragment bearing the neo-centromere results in
the formation of a stable neo-minichromosome; (D) Integration of
exogenous DNA into the foreign DNA region of the formerly dicentric
chromosome 7 initiates H-type amplification, and the formation of a
heterochromatic arm. By capturing a euchromatic terminal segment,
this new chromosome arm is stabilized in the form of the "sausage"
chromosome; (E) BrdU treatment and/or drug selection appears to
induce further H-type amplification, which results in the formation
of an unstable gigachromosome: (F) Repeated BrdU treatments and/or
drug selection induce further H-type amplification including a
centromere duplication, which leads to the formation of another
heterochromatic chromosome arm. It is split off from the chromosome
7 by chromosome breakage and acquires a terminal segment to form
the stable megachromosome.
EXAMPLE 7
[0282] Summary of some of the Cell Lines with SATACS and
Minichromosomes that have been Constructed
[0283] LMTK.sup.--derived cell line, which is a mouse fibroblast
cell line, was transfected with .lambda.CM8 and .lambda.gtWESneo
DNA (see, EXAMPLE 2) to produce transformed cell lines. Among these
cell lines was EC3/7, deposited at the European Collection of
Animal cell Culture (ECACC) under Accession No. 90051001 (see, U.S.
Pat. No. 5,288,625; see, also Hadlaczky et al. (1991) Proc. Natl.
Acad. Sci. U.S.A. 88:8106-8110 and U.S. application Ser. No.
08/375,271). This cell line contains the dicentric chromosome with
the neo centromere. Recloning and selection produced cell lines
such as EC3/7C5, which are cell lines with the stable
neo-minichromosome (see, FIG. 2C).
[0284] Fusion of EC3/7 with CHO-K20 cells and selection with
G418/HAT produced hybrid cell lines, among these was KE1 2/4, which
has been deposited with the ECACC under Accession No. 96040924. KE1
2/4 is a stable cell line that contains the A neo-chromosome (see,
FIG. 2D; see, also U.S. Pat. No. 5,288,625), produced by E type
amplifications. KE1 2/4 has been transfected with vectors
containing lambda DNA, selectable markers, such as puromycin
resistance, and genes of interest, such as p53, anti-HIV ribozymes.
These vectors target the gene of interest into the .lambda.
neo-chromosome by virtue of homologous recombination with the
heterologous DNA in the chromosome.
[0285] The EC3/7C5 cell line has been co-transfected with pH132,
pCH110 and .lambda. DNA (see, EXAMPLE 2) as well as other
constructs. Various clones and subclones have been selected. For
example transformation with a construct that includes p53 encoding
DNA, produced cells designated C5 pMCT53.
[0286] As discussed above, cotransfection of EC3/7C5 cells with
plasmids (pH132, pCH110 available from Pharmacia, see, also Hall et
al. (1983) J. Mol. Appl. Gen. 2:101-109) and with .lambda. DNA
(.lambda.cl 875 Sam 7 (New England Biolabs)) produced transformed
cells. Among these is TF1004G24, which contains the DNA encoding
the anti-HIV ribozyme in the neo-minichromosome. Recloning of
TF1004G24 produced numerous cell lines. Among these the NHHL24 cell
line. This cell line also has the anti-HIV ribozyme in the
neo-minichromosome and expresses high levels of .beta.-gal. It has
been fused with CHO-K20 cells to produce various hybrids. Recloning
and selection of the TF1004G transformants produced the cell line
TF1004G-19, discussed above in EXAMPLE 4, which contains the
unstable sausage chromosome. Single cell cloning produced the
TF1004G-19C5 (see FIG. 4) cell line, which has a stable sausage
chromosome. TF1004G-19C5 has been fused with CHO cells and the
hybrids grown under selective conditions to produce the 19C5xHa4
cell line (see, EXAMPLE 4) and others. BrdU treatment of 19C5xHa4
cells and growth under selective conditions (neomycin (G) and/or
hygromycin (H)) has produced hybrid cell lines with the
gigachromsome (see FIG. 2E) and the G3D5 and G4D6 cell lines and
others. G3D5 has the neo-minichromosome and the megachromosome,
G4D6 has only the neo-minichromosome.
[0287] Recloning of G3D5 in GH medium produced numerous clones.
Among these is H1D3 (see FIG. 4), which has the stable
megachromosome. Repeated BrDU treatment and recloning has produced
the HB31 cell line, which has been used for transformations with
the pTEMPUD, pTEMPU and pTEMPU3 vectors (see, Example 12,
below).
[0288] H1 D3 has been fused with a CD4.sup.+ Hela cell line that
carries DNA encoding CD4 and neomycin resistance on a plasmid (see,
e.g., U.S. Pat. Nos. 5,413,914, 5,409,810, 5,266,600, 5,223,263,
5,215,914 and 5,144,019, which describe these Hela cells).
Selection with GH has produced hybrids, including H1xHE41 (see FIG.
4), which carries the megachromosome and also a single human
chromosome that includes the CD4neo construct. Repeated BrdU
treatment and single cell cloning has produced cell lines with the
megachromosome (cell line 1B3, see FIG. 4), cell lines, such as 1B4
and others that have a dwarf megachromosome (.about.150-200 Mb) and
cell lines, such as 1C3, which has micro-megachromosome
(.about.60-90 Mb). About 25% of the 1B3 cells have a truncated
megachromosome (.about.90-120 Mb).
EXAMPLE 8
[0289] Replication of the Megachromosome
[0290] This homogeneous architecture of the megachromosomes
provides a unique opportunity to perform a detailed analysis of the
replication of the constitutive heterochromatin.
[0291] A. Materials and Methods
[0292] 1. Culture of Cell Lines
[0293] H1D3 mouse-hamster hybrid cells carrying the megachromosome
(see, EXAMPLE 4) were cultured in F-12 medium containing 10% fetal
calf serum (FCS) and 400 .mu.g/ml Hygromycin B (Calbiochem). G3D5
hybrid cells (see, Example 4) were maintained in F-12 medium
containing 10% FCS, 400 .mu.g/ml Hygromycin B (Calbiochem), and 400
.mu.g/ml G418 (SIGMA). Mouse A9 fibroblast cells were cultured in
F-12 medium supplemented with 10% FCS.
[0294] 2. BrdU Labelling
[0295] In typical experiments, 20-24 parallel semi-confluent cell
cultures were set up in 10 cm Petri dishes. Bromodeoxyuridine
(BrdU) (Fluka) was dissolved in distilled water alkalized with a
drop of NaOH, to make a 10.sup.-2 M stock solution. Aliquots of
10-50 .mu.l of this BrdU stock solution were added to each 10 ml
culture, to give a final BrdU concentration of 10-50 .mu.M. The
cells were cultured in the presence of BrdU for 30 min, and then
washed with warm complete medium, and incubated without BrdU until
required. At this point, 5 .mu.g/ml colchicine was added to a
sample culture every 1 or 2 h. After 1-2 h colchicine treatment,
mitotic cells were collected by "shake-off" and regular chromosome
preparations were made for immunolabelling.
[0296] 3. Immunolabelling of Chromosomes and In Situ
Hybridization
[0297] Immunolabelling with fluorescein-conjugated anti-BrdU
monoclonal antibody (Boehringer) was done according to the
manufacturer's recommendations, except that for mouse A9
chromosomes, 2 M hydrochloric acid was used at 37.degree. C. for 25
min, while for chromosomes of hybrid cells, 1 M hydrochloric acid
was used at 37.degree. C. for 30 min. In situ hybridization with
biotin-labelled probes, and indirect immunofluorescence and in situ
hybridization on the same preparation, were performed as described
previously (Hadlaczky et al. (1991) Proc. Natl. Acad. Sci. U.S.A.
88:8106-8110, see, also U.S. Pat. No. 5,288,625).
[0298] 4. Microscopy
[0299] All observations and microphotography were made by using a
Vanox AHBS (Olympus) microscope. Fujicolor 400 Super G or Fujicolor
1600 Super HG high-speed color negatives were used for
photographs.
[0300] B. Results
[0301] The replication of the megachromosome was analyzed by BrdU
pulse labelling followed by immunolabelling. The basic parameters
for DNA labelling in vivo were first established. Using a 30 min
pulse of 50 .mu.M BrdU in parallel cultures, samples were taken and
fixed at 5 min intervals from the beginning of the pulse, and every
15 min up to 1 h after the removal of BrdU. Incorporated BrdU was
detected by immunolabelling with fluorescein-conjugated anti-BrdU
monoclonal antibody. At the first time point (5 min) 38% of the
nuclei were labelled, and a gradual increase in the number of
labelled nuclei was observed during incubation in the presence of
BrdU, culminating in 46% in the 30 min sample, at the time of the
removal of BrdU. At further time points (60, 75, and 90 min) no
significant changes were observed, and the fraction of labelled
nuclei remaining constant (44.5-46%).
[0302] These results indicate that (i) the incorporation of the
BrdU is a rapid process, (ii) the 30 min pulse-time is sufficient
for reliable labelling of S-phase nuclei, and (iii) the BrdU can be
effectively removed from the cultures by washing.
[0303] The length of the cell cycle of the 19C5xHa4 hybrid cells
was estimated by measuring the time between the appearance of the
earliest BrdU signals on the extreme late replicating chromosome
segments and the appearance of the same pattern only on one of the
chromatids of the chromosomes after one completed cell cycle. The
length of G2 period was determined by the time of the first
detectable BrdU signal on prophase chromosomes and by the labelled
mitoses method (Qastler et al. (1959) Exp. Cell Res. 17:420-438).
The length of the S-phase was determined in three ways: (i) on the
basis of the length of cell cycle and the fraction of nuclei
labelled during the 30-120 min pulse; (ii) by measuring the time
between the very end of the replication of the extreme late
replicating chromosomes and the detection of the first signal on
the chromosomes at the beginning of S phase; (iii) by the labelled
mitoses method. In repeated experiments, the duration of the cell
cycle was found to be 22-26 h, the S phase 10-14 h, and the G2
phase 3.5-4.5 h.
[0304] Analyses of the replication of the megachromosome were made
in parallel cultures by collecting mitotic cells at two hour
intervals following two hours of colchicine treatment. In a repeat
experiment, the same analysis was performed using one hour sample
intervals and one hour colchicine treatment. Although the two
procedures gave comparable results, the two hour sample intervals
were viewed as more appropriate since approximately 30% of the
cells were found to have a considerably shorter or longer cell
cycle than the average. The characteristic replication patterns of
the individual chromosomes, especially some of the late replicating
hamster chromosomes, served as useful internal markers for the
different stages of S-phase. To minimize the error caused by the
different lengths of cell cycles in the different experiments,
samples were taken and analyzed throughout the whole cell cycle
until the appearance of the first signals on one chromatid at the
beginning of the second S-phase.
[0305] The sequence of replication in the megachromosome is as
follows. At the very beginning of the S-phase, the replication of
megachromosome starts at the ends of the chromosomes. The first
initiation of replication in an interstitial position can usually
be detected at the centromeric region. Soon after, but still in the
first quarter of the S-phase, when the terminal region of the short
arm has almost completed its replication, discrete initiation
signals appear along the chromosome arms. In the second quarter of
the S-phase, as replication proceeds, the BrdU-labelled zones
gradually widen, and the checkered pattern of the megachromosome
becomes clear (see, e.g., FIG. 2F). At the same time, pericentric
regions of mouse chromosomes also show intense incorporation of
BrdU. The replication of the megachromosome peaks at the end of the
second quarter and in the third quarter of the S-phase. At the end
of the third quarter, and at the very beginning of the last quarter
of the S-phase, the megachromosome and the pericentric
heterochromatin of the mouse chromosomes complete their
replication. By the end of S-phase only the very late replicating
segments of mouse and hamster chromosomes are still incorporating
BrdU.
[0306] The replication of the whole genome occurs in distinct
phases. The signal of incorporated BrdU increased continuously
until the end of the first half of the S-phase, but at the
beginning of the third quarter of the S-phase chromosome segments
other than the heterochromatic regions hardly incorporated BrdU. In
the last quarter of the S-phase, the BrdU signals increased again
when the extreme late replicating segments showed very intense
incorporation.
[0307] Similar analyses of the replication in mouse A9 cells were
performed as controls. To increase the resolution of the
immunolabelling pattern, pericentric regions of A9 chromosomes were
decondensed by treatment with Hoechst 33258. Because of the intense
replication of the surrounding euchromatic sequences, precise
localization of the initial BrdU signal in the heterochromatin was
normally difficult, even on undercondensed mouse chromosomes. On
those chromosomes where the initiation signal(s) were localized
unambiguously, the replication of the pericentric heterochromatin
of A9 chromosomes was similar to that of the megachromosome.
Chromosomes of A9 cells also exhibited replication patterns and
sequences similar to those of the mouse chromosomes in the hybrid
cells. These results indicate that the replicators of the
megachromosome and mouse chromosomes retained their original timing
and specificity in the hybrid cells.
[0308] By comparing the pattern of the initiation sites obtained
after BrdU incorporation with the location of the integration sites
of the "foreign" DNA in a detailed analysis of the first quarter of
the S-phase, an attempt was made to identify origins of replication
(initiation sites) in relation to the amplicon structure of the
megachromosome. The double band of integrated DNA on the long arm
of the megachromosome served as a cytological marker. The results
showed a colocalization of the BrdU and in situ hybridization
signals found at the cytological level, indicating that the
"foreign" DNA sequences are in close proximity to the origins of
replication, presumably integrated into the non-satellite sequences
between the replicator and the satellite sequences (see, FIG. 3).
In the pericentric region of several other chromosomes, dot-like
BrdU signals can also be observed that are comparable to the
initiation signals on the megachromosome. These signals may
represent similar initiation sites in the heterochromatic regions
of normal chromosomes.
[0309] At a frequency of 10.sup.-4, "uncontrolled" amplification of
the integrated DNA sequences was observed in the megachromosome.
Consistent with the assumption (above) that "foreign" sequences are
in the proximity to the replicators, this spatially restricted
amplification is likely to be a consequence of uncontrolled
repeated firings of the replication origin(s) without completing
the replication of the whole segment.
[0310] C. Discussion
[0311] It has generally been thought that the constitutive
heterochromatin of the pericentric regions of chromosomes is late
replicating (see, e.g., Miller (1976) Chromosoma 55:165-170). On
the contrary, these experiments evidence that the replication of
the heterochromatic blocks starts at a discrete initiation site in
the first half of the S-phase and continues through approximately
three-quarters of S-phase. This difference can be explained in the
following ways: (i) in normal chromosomes, actively replicating
euchromatic sequences that surround the satellite DNA obscure the
initiation signals, and thus the precise localization of initiation
sites is obscured; (ii) replication of the heterochromatin can only
be detected unambiguously in a period during the second half of the
S-phase, when the bulk of the heterochromatin replicates and most
other chromosomal regions have already completed their replication,
or have not yet started it. Thus, low resolution cytological
techniques, such as analysis of incorporation of radioactively
labelled precursors by autoradiography, only detect prominent
replication signals in the heterochromatin in the second half of
S-phase, when adjacent euchromatic segments are no longer
replicating.
[0312] In the megachromosome, the primary initiation sites of
replication colocalize with the sites where the "foreign" DNA
sequences are integrated at the amplicon borders. Similar
initiation signals were observed at the same time in the
pericentric heterochromatin of mouse chromosomes that do not have
"foreign" DNA, indicating that the replication initiation sites at
the borders of amplicons may reside in the non-satellite flanking
sequences of the satellite DNA blocks. The presence of a primary
initiation site at each satellite DNA doublet implies that this
large chromosome segment is a single huge unit of replication
(megareplicon) delimited by the primary initiation site and the
termination point at each end of the unit. Several lines of
evidence indicate that, within this higher-order replication unit,
"secondary" origins and replicons contribute to the complete
replication of the megareplicon:
[0313] 1. The total replication time of the heterochromatic regions
of the megachromosome was .about.9-11 h. At the rate of movement of
replication forks, 0.5-5 kb per minute, that is typical of
eukaryotic chromosomes (Kornberg et al. (1992) DNA Replication, 2nd
ed., New York: W.H. Freeman and Co., p. 474), replication of a
.about.15 Mb replicon would require 50-500 h. Alternatively, if
only a single replication origin was used, the average replication
speed would have to be 25 kb per minute to complete replication
within 10 h. By comparing the intensity of the BrdU signals on the
euchromatic and the heterochromatic chromosome segments, no
evidence for a 5- to 50-fold difference in their replication speed
was found.
[0314] 2. Using short BrdU pulse labelling, a single origin of
replication would produce a replication band that moves along the
replicon, reflecting the movement of the replication fork. In
contrast, a widening of the replication zone that finally gave rise
to the checkered pattern of the megachromosome and within the
replication period the most intensive BrdU incorporation occurred
in the second half of the S-phase was observed. This suggests that
once the megareplicator has been activated, it permits the
activation and firing of "secondary" origins, and that the
replication of the bulk of the satellite DNA takes place from these
"secondary" origins during the second half of the S-phase. This is
supported by the observation that in certain stages of the
replication of the megachromosome, the whole amplicon can
apparently be labelled by a short BrdU pulse.
[0315] Megareplicators and secondary replication origins seem to be
under strict temporal and spatial control. The first initiation
within the megachromosomes usually occurred at the centromere, and
that shortly afterward all the megareplicators become active. The
last segment of the megachromosome to complete replication was
usually the second segment of the long arm. Results of control
experiments with mouse A9 chromosomes indicate that replication of
the heterochromatin of mouse chromosomes corresponds to the
replication of the megachromosome amplicons. Therefore, the
pre-existing temporal control of replication in the heterochromatic
blocks is preserved in the megachromosome. Positive (Hassan et al.
(1994) J. Cell. Sci. 107:425-434) and negative (Haase et al. (1994)
Mol. Cell. Biol. 14:2516-2524) correlations between transcriptional
activity and initiation of replication have been proposed. In the
megachromosome, transcription of the integrated genes seems to have
no effect on the original timing of the replication origins. The
concerted, precise timing of the megareplicator initiations in the
different amplicons suggests the presence of specific, cis-acting
sequences, origins of replication.
[0316] Considering that pericentric heterochromatin of mouse
chromosomes contains thousands of short, simple repeats spanning
7-15 Mb, and the centromere itself may also contain hundreds of
kilobases, the existence of a higher-order unit of replication
seems probable. The observed uncontrolled intrachromosomal
amplification restricted to a replication initiation region of the
megachromosome is highly suggestive of a rolling-circle type
amplification, and provides additional evidence for the presence of
a replication origin in this region.
[0317] The finding that a specific replication initiation site
occurs at the boundaries of amplicons suggests that replication
might play a role in the amplification process. These results
suggest that each amplicon of the megachromosome can be regarded as
a huge megareplicon defined by a primary initiation site
(megareplicator) containing "secondary" origins of replication.
Fusion of replication bubbles from different origins of
bi-directional replication (DePamphilis (1993) Ann. Rev. Biochem.
62:29-63) within the megareplicon could form a giant replication
bubble, which would correspond to the whole megareplicon. In the
light of this, the formation of megabase-size amplicons can be
accommodated by a replication-directed amplification mechanism. In
both H and E-type amplifications, intrachromosomal multiplication
of the amplicons was observed (see, above EXAMPLES), which is
consistent with the unequal sister chromatid exchange model.
Induced or spontaneous unscheduled replication of a megareplicon in
the constitutive heterochromatin may also form new amplicon(s)
leading to the expansion of the amplification or to the
heterochromatic polymorphism of "normal" chromosomes. The
"restoration" of the missing segment on the long arm of the
megachromosome may well be the result of the re-replication of one
amplicon limited to one strand.
[0318] Taken together, without being bound by any theory, a
replication-directed mechanism is a plausible explanation for the
initiation of large-scale amplifications in the centromeric regions
of mouse chromosomes, as well as for the de novo chromosome
formations. If specific (amplificator) sequences play a role in
promoting the amplification process, sequences at the primary
replication initiation site (megareplicator) of the megareplicon
are possible candidates.
[0319] Preliminary sequence data indicates the presence of highly
G+C-rich sequence elements less than 10 kb from the integrated
heterologous "foreign" DNA in the megachromosome. These sequences
may represent the non-satellite DNA flanking of the A+T-rich
satellite DNA blocks.
EXAMPLE 9
[0320] Generation of Chromosomes with Amplified Regions Derived
from Mouse Chromosome 1
[0321] To show that the events described in EXAMPLES 2-7 are not
unique to mouse chromosome 7 and to show that the EC7/3 cell line
is not required for formation of these chromosomes, the experiments
have been repeated using different initial cell lines and DNA
fragments. Any cell or cell line should be amenable to use or can
readily be determined to be amenable or not.
[0322] A. Materials
[0323] The LP11 cell line was produced by the "scrape-loading"
transfection method (Fechheimer et al. (1987) Proc. Natl. Acad.
Sci. U.S.A. 84:8463-8467) using 25 .mu.g plasmid DNA for
5.times.10.sup.6 recipient cells. LP11 cells were maintained in
F-12 medium containing 3-15 .mu.g/ml Puromycin (SIGMA).
[0324] B. Amplification in LP11 Cells
[0325] The large-scale amplification described in the above
Examples is not restricted to the transformed EC3/7 cell line or to
the chromosome 7 of mouse. In an independent transformation
experiment, using a selectable puromycin construct pPuroTel, an
LMTK.sup.- cell line (LP11) was established, carrying chromosome(s)
with amplified chromosome segments of different lengths
(.about.150-600 Mb). Cytological analysis of the LP11 cells
indicated that the amplification occurred in the pericentric region
of the long arm of a submetacentric chromosome formed by
Robertsonian translocation. This chromosome arm was identified by
G-banding as chromosome 1. C-banding and in situ hybridization with
mouse major satellite DNA probe showed that an E-type amplification
had occurred: the newly formed region was composed of an array of
euchromatic chromosome segments containing different amounts of
heterochromatin. The size and C-band pattern of the amplified
segments were heterogeneous. In several cells, the number of these
amplified units exceeded 50; single-cell subclones of LP 11 cell
lines, however, carry stable marker chromosomes with 10-15 segments
and constant C-band patterns.
EXAMPLE 10
[0326] Purification of Artificial Chromosomes
[0327] I. Cell Sorting Based on Base Composition and Size
[0328] A. Cell Lines
[0329] 1B3 mouse-hamster-human hybrid cells (see, FIG. 4) carrying
the megachromosome or the truncated megachromosome were grown in
F-12 medium supplemented with 10% fetal calf serum, 150 .mu.g/ml
hygromycin B and 400 .mu.g/ml G418. GHB-42 (a cell line recloned
from G3D5) mouse-hamster hybrid cells carrying the megachromosome
and the mini-chromosome were cultured in F-12 medium containing 10%
fetal calf serum, 150 .mu.g/ml hygromycin B and 400 .mu.g/ml G418.
The doubling time of both cell lines was about 24 hours.
[0330] B. Chromosome Isolation
[0331] To accumulate mitotic cells, 5 .mu.g/ml colchicine was added
for 12 hours to the cultures. Mitotic cells were then harvested by
gentle pipetting of the medium on the layer cells. The mitotic
index obtained was 60-80%. The mitotic cells by were collected by
selective detachment. The cells were sedimented by centrifugation
of 200 g for 10 minutes.
[0332] Two procedures were used to prepare metaphase chromosomes
from these cells, one based on polyamine buffer system. (Cram et
al. (1990) Methods in Cell Biology 33:377-382) and the other on
modified hexylene glycol buffer system (Hadlaczky et al. (1982)
Chromosoma 86:643-65).
[0333] 1. Polyamine Procedure
[0334] In the polyamine procedure, about 10.sup.7 mitotic cells
were incubated in 10 ml hypotonic buffer (75 mM KCl, 0.2 mM
spermine, 0.5 mM spermidine) for 10 minutes at room temperature to
swell the cells. The cells were then centrifuged at 100 g for 8
minutes. The cell pellet was drained carefully and about 10.sup.7
cells were resuspended in 1 ml polyamine buffer (15 mM Tris-HCl, 20
mM NaCl, 80 mM KCl, 2 mM EDTA, 0.5 mM EGTA, 14 mM
.beta.-mercaptoethanol, 0.1% digitonin, 0.2 mM Spermine, 0.5 mM
spermidine). Chromosomes were then released by gently drawing the
cell suspension up and expelling it through a 22 G needle attached
to a 3 ml plastic syringe. The chromosome concentration was about
1-3.times.10.sup.8 chromosomes/ml.
[0335] 2. Hexylene Glycol Buffer System
[0336] In the second procedure, about 8.times.10.sup.6 mitotic
cells were resuspended in 10 ml glycine-hexylene glycol buffer (100
mM glycine, 1% hexylene glycol, pH 8.4-8.6 adjusted with saturated
Ca-hydroxide solution) and incubated for 10 minutes at 37.degree.
C., followed by centrifugation for 10 minutes to pellet the nuclei.
The supernatant was centrifuged again at 200 g for 20 minutes to
pellet the chromosomes. Chromosomes were resuspended in 1 ml
isolation buffer/1-3.times.10.sup.8 chromosomes.
[0337] C. Staining of Chromosomes with DNA Specific Dyes
[0338] Subsequent to isolation, the chromosome preparation was
stained with Hoechst 33258 at 6 .mu.g/ml and chromocycin A3 at 200
.mu.g/ml. Fifteen minutes prior to analysis, 25 mM Na-sulphite and
10 mM Na-citrate were added to the chromosome suspension.
[0339] D. Flow Sorting of Chromosomes
[0340] Chromosomes in suspension were passed through a dual-laser
cell sorter (FACStar Plus and FAXStar Vantage Becton Dickinson
Immunocytometry System) in which two lasers were set to excite the
dyes separately, allowing a bivariate analysis of the chromosome by
size and base-pair composition. Because of the difference between
the base composition of the MACs and the other chromosomes and the
resulting difference in interaction with the dyes, as well as size
differences, the artificial chromosomes were separated from the
other chromosomes.
[0341] E. Storage of the Sorted Artificial Chromosomes
[0342] The sorted chromosomes are stored in GH buffer (100 mM
glycine, 1% hexylene glycol pH 8.4-8.6 adjusted with saturated
Ca-hydroxide solution (see, e.g., Hadlaczky et al. (1982)
Chromosoma 86:643-659) for one day and embedded by centrifugation
into agarose. The sorted chromosomes were centrifuged into an
agarose bed and the plugs are stored in 500 mM EDTA at 4.degree. C.
They are stored for microinjection in 30% glycerol at -20.degree.
C.
[0343] F. Quality Control
[0344] 1. Analysis of the Purity
[0345] The purity of the sorted chromosomes was checked by
fluorescence in situ hybridization (FISH) with biotin labeled mouse
satellite DNA probe (see, Hadlaczky et al. (1991) Proc. Natl. Acad.
Sci. U.S.A. 88:8106-8110. Purity of the sorted chromosomes was
97-99%.
[0346] 2. Characteristics of the Sorted Chromosomes
[0347] Pulsed field gel electrophoresis and Southern hybridization
were carried out to determine the size distribution of the DNA
content of the sorted artificial chromosomes.
[0348] C. Functioning of the Artificial Chromosomes
[0349] To check whether their activity is preserved, the artificial
chromosomes are microinjected into primary cells, somatic cells and
stem cells.
[0350] II. Sorting of Mammalian Artificial Chromosome Containing
Microcells
[0351] A. Micronucleation
[0352] Cells were grown to 80-90% confluency in 4 T150 flasks.
Colcemid was added to a final concentration of 0.06 .mu.g/ml, and
then incubated with the cells at 37.degree. C. for 24 hours.
[0353] B. Enucleation
[0354] Ten .mu.g/ml cytochalasin B was added and the resulting
microcells were centrifuged the at 15,000 rpm for 70 minutes at
28-33.degree. C.
[0355] C. Purification of Microcells by Filtration
[0356] The microcells were purified using Swinnex filter units and
Nucleopore filters (5 .mu.m and 3 .mu.m).
[0357] D. Staining and Sorting Microcells
[0358] As above, the cells were stained Hoechst and chromomycin A3
dyes. The microcells were sorted by cell sorter to isolate the
microcells that contain the mammalian artificial chromosome.
[0359] E. Fusion
[0360] The microcells that contain the artificial chromosome are
fused to selected primary cells, somatic cells, embryonic stem
cells to generate transgenic animals for gene therapy purposes, and
other cells to deliver the chromosomes to the cells.
EXAMPLE 11
[0361] Introduction of Mammalian Artificial Chromosomes into Insect
Cells
[0362] Insect cells should be useful hosts for MACs, particularly
for production of gene products for a number of reasons,
including:
[0363] 1. A mammalian artificial chromosome provides extra genomic
specific integration site for introduction of genes encoding
proteins of interest (reduced chance of mutation in production
system).
[0364] 2. The large size of artificial chromosome permits megabase
size DNA integration so that genes encoding an entire pathway
leading to a protein or nonprotein of therapeutic value, such as an
alkaloid (digitalis, morphine, taxol).
[0365] 3. Amplification of genes encoding useful proteins can be
accomplished in the artificial mammalian chromosome to obtain
higher protein yields in insect cells.
[0366] 4. Insect cells support required post translational
modifications (glycosylation, phosphorylation) essential for
protein biological function.
[0367] 5. Insect cells do not support mammalian viruses--eliminates
cross-contamination of product with human infectious agents.
[0368] 6. The ability to introduce chromosomes, circumvents
traditional recombinant baculovirus systems for production of
nutritional, industrial or medicinal proteins in insect cell
systems.
[0369] 7 The low temperature optimum for insect cell growth
(28.degree. C.) permits reduced energy cost of production.
[0370] 8. Serum free growth medium for insect cells will result in
lower production costs.
[0371] 9. Artificial chromosome containing cells can be stored
indefinitely at low temperature.
[0372] 10. Insect larvae will serve as biological factories for the
production of nutritional, medicinal or industrial proteins by
microinjection of fertilized insect eggs.
[0373] A. Demonstration that Insect Cells Recognize Mammalian
Promoters
[0374] Gene constructs containing a mammalian promoter, such as CMV
linked to DNA encoding a detectable marker gene fusions (Renilla
luciferase gene (see, e.g., U.S. Pat. No. 5,292,658 for a
description of DNA encoding the Renilla luciferase, and plasmid
pTZrLuc-1, which can provide the starting material for construction
of such vectors, see SEQ ID NO. 10) and also including the simian
virus 40 (SV40) promoter operably linked to the beta galactosidase
gene) was introduced into the cells of two species Trichoplusia ni
(cabbage looper) and Bombyx mori (silk worm).
[0375] After transferring the constructs into the insect cell lines
either by electroporation or by microinjection, expression of the
marker genes was detected after a 24 h incubation. In each case a
positive result was obtained in the samples containing the genes
which was absent in samples in which the genes were omitted. In
addition, a .beta.-actin promoter-Renilla luciferase fusion was
introduced into the T. ni and B. mori cells yielding light
emission. Thus, mammalian promoters function to direct expression
of these marker genes in insects. Therefore, MACs are candidates
for expression of heterologous genes in insect cells.
[0376] B. Construction of Vectors for Use in Insect Cells and
Fusion with Mammalian Cells
[0377] 1. Transform LMTK.sup.- cells with expression vector
with:
[0378] a. B. mori .beta.-actin promoter--Hyg.sup.r selectable
marker gene for insect cells, and.
[0379] b. SV40 or CMV promoters controlling a puromycin.sup.r
selectable marker gene for mammalian cells.
[0380] 2. Detect expression of the mammalian promoter in LMTk cells
(puromycin.sup.r LMTk cells)
[0381] 3. Use pur.sup.r cells in fusion experiments with Bombyx and
Trichoplusia cells, select Hyg.sup.r cells.
[0382] C. Insertion of the MACs into Insect Cells
[0383] These experiments are designed to detect expression of a
detectable marker gene (such as .beta.-gal expressed under the
control of a mammalian promoter, such as pSV40) located on a MAC.
Data indicate that .beta.-gal was expressed.
[0384] Insect cells of each species are fused with mammalian cells
containing either the mini chromosome (EC3/7C5) or the mini and the
megachromosome (such as GHB-42, which is a cell line recloned from
G3D5) or a cell line that carries only the megachromosome (such as
H1D3 or a redone therefrom). Fusion is carried out as follows:
[0385] 1. mammalian+insect cells (50/50%) in log phase growth are
mixed;
[0386] 2. calcium/PEG cell fusion: (10 min-0.5 h);
[0387] 3. heterokaryons (+72 h) are selected.
[0388] The following selection conditions to select for insect
cells that contain a MAC can be used: (+=positive selection;
-=negative selection):
[0389] 1. growth at 28.degree. C. (+ insect cells, - mammalian
cells);
[0390] 2. Graces insect cell medium (SIGMA) (- mammalian
cells);
[0391] 3. no exogenous CO.sub.2 (- mammalian cells); and/or
[0392] 4. antibiotic selection (Hyg or G418) (+ transformed insect
cells).
[0393] Immediately following the fusion protocol, many
heterokaryons (fusion events) are observed between the mammalian
and each species of insect cells (up to 90% heterokaryons). After
growth (2+weeks) on insect medium containing G418 and/or hygromycin
at selection levels used for selection of transformed mammalian
cells, individual colonies are detected growing on the fusion
plates. By virtue of selection for the antibiotic resistance
conferred by the MAC and selection for insect cells, these colonies
should contain MACs.
EXAMPLE 12
[0394] Preparation of the Chromosome Fragmentation Vector and Other
Vectors for Targeted Integration of DNA into MACs
[0395] Fragmentation of the megachromosome, should ultimately
result in smaller stable chromosomes that contain about 15 Mb to 50
Mb that will be easily manipulated for use as vectors. Vectors to
effect such fragmentation should also aid in determination and
identification of the elements required for preparation of an in
vitro-produced artificial chromosome.
[0396] Reduction in the size of the megachromosome can be achieved
in a number of different ways including: stress treatment, such as
by starvation, or cold or heat treatment; treatment with agents
that destabilize the genome or nick DNA, such as BrdU, coumarin,
EMS and others; treatment with ionizing radiation (see, e.g., Brown
(1992) Curr. Opin. Genes Dev. 2:479-486); and telomere-directed in
vivo chromosome fragmentation (see, e.g., Far et al. (1995) EMBO J.
14:5444-5454).
[0397] A. Preparation Vectors for Fragmentation of the Artificial
Chromosome and Also for Targeted Integration of Selected Gene
Products
[0398] 1. Construction of pTEMPUD
[0399] Plasmid pTEMPUD (see, FIG. 5) is a mouse homologous
recombination "killer" vector for in vivo chromosome fragmentation,
and also for inducing large-scale amplification via site specific
integration. With reference to FIG. 5, the PstI to SalI fragment
was derived from pBabe-puro retroviral vector (see, Morgenstern et
al. (1990) Nucleic Acids Res. 18:3587-3596). This fragment contains
DNA encoding ampicillin resistance, the pUC origin of replication,
and the puromycin N-acetyl transferase gene under control of the
SV40 early promoter. The URA3 portion comes from the pYAC5 cloning
vector (SIGMA). URA3 was cut out of pYAC5 with SalI-XhoI digestion,
cloned into pNEB193 (New England Biolabs), which was then cut with
EcoRI-SalI and ligated to the SalI site of pBabepuro to produce
pPU.
[0400] A 1293 bp fragment (see SEQ ID NO. 1) encoding the mouse
major satellite, was isolated as an EcoRI fragment from a DNA
library produced from mouse LMTK.sup.- fibroblast cells and
inserted into the EcoRI site of pPU to produce pMPU.
[0401] The TK promoter driven diphtheria toxin gene (DT-A) was
derived from pMC1DT-A (see, Maxwell et al. (1986) Cancer Res.
46:4660-4666) by BglII-XhoI digestion and cloned into the pMC1neo
poly A expression vector (STRATAGENE, La Jolla, Calif.) by
replacing the neo coding sequence. The TK promoter, DT-A gene and
poly A sequence were removed from this vector, cohesive ends were
filled with Klenow and the resulting fragment blunt end-ligated and
ligated into the SnaB1 (TACGTA) of pMPU to produce pMPUD.
[0402] The Hutel 2.5 fragment (see SEQ ID NO. 3) was inserted at
the PstI site (see the 6100 PstI-3625 PstI fragment on pTEMPUD) of
pMPUD to produce pTEMPUD. This fragment includes a human telomere.
It includes a unique BglII site (see nucleotides 1042-1047 of SEQ
ID NO. 3), which will be used as a site for introduction of a
synthetic telomere that will include multiple repeats (80) of
GGGATT with BamHI and BglII ends for insertion into the BglII site
which will then remain unique, since the BamHI overhang is
compatible with the BglII site. Ligation of BamHI fragment to a
BglII destroys the BglII site, so that only a single BglII site
will remain. Selection for the unique BglII site insures that the
synthetic telomere will be inserted in the correct orientation. The
unique BglII site is the site at which the vector is
linearized.
[0403] 2. Use of pTEMPUD for In Vivo Chromosome Fragmentation
[0404] Linearization of pTEMPUD by BglII results in a linear
molecule with a human telomere at one end. Integration of this
linear fragment into the chromosome, such as the megachromosome in
hybrid cells or any mouse chromosome, which is contains repeats of
the mouse major satellite sequence, results integration of the
selectable marker puromycin and cleavage of the plasmid by virtue
of the telomeric end. The DT gene prevents that entire linear
fragment from integrating by random events, since upon integration
and expression it is toxic. Thus random integration will be toxic.
Thus, site directed integration into the targeted DNA will be
selected. Such integration will produce fragmented chromosomes.
[0405] The fragmented truncated chromosome with the new telomere
will survive, and the other fragment without the centromere will be
lost. Repeated in vivo fragmentations will ultimately result in
selection of the smallest functioning minichromosome possible.
[0406] Thus this vector can be used to produce minichromosomes from
mouse chromosomes, or to fragment the megachromosome.
[0407] 3. pTEMPhu and pTEMPhu3
[0408] Vectors that specifically target human chromosomes can be
constructed from pTEMPUD. These vectors can be used to fragment
specific human chromosomes, depending upon the selected satellite
sequence, to produce human minichromosomes, and also to isolate
human centromeres.
[0409] a. pTEMPhu
[0410] To render pTEMPUD suitable for fragmenting human
chromosomes, the mouse major satellite sequence is replaced with
human satellite sequences. Unlike mouse chromosomes, each human
chromosome has a unique satellite sequence. For example, the mouse
major satellite has been replace with a human hexameric
.alpha.-satellite (or alphoid satellite) DNA sequence. This
sequence is an 813 bp fragment (nucleotide 232-1044 of SEQ ID NO.
2) from clone pS12, deposited in the EMBL database under Accession
number X60716, isolated from a human colon carcinoma cell line
Colo320 (deposited under Accession No. ATCC CCL 220.1). The 813 bp
alphoid fragment can be obtained from the pS12 clone by nucleic
acid amplification using synthetic primers, which each contain an
EcoRI site, as follows:
[0411] GGGGAATTCAT TGGGATGTTT CAGTTGA forward primer (SEQ ID NO.
4)
[0412] CGAAAGTCCCC CCTAGGAGAT CTTAAGGA reverse primer (SEQ ID NO.
5).
[0413] Digestion of the amplified product with EcoRI results in a
fragment with EcoRI ends that includes the human .alpha.-satellite
sequence. This sequence is inserted into pTEMPUD in place of the
EcoRI fragment that contains the mouse major satellite.
[0414] b. pTEMPhu3
[0415] In pTEMPhu3, the mouse major satellite sequence is replaced
by the 3 kb human chromosome 3-specific .alpha.-satellite from D3Z1
(deposited under ATCC Accession No. 85434; see, also Yrokov (1989)
Cytogenet. Cell Genet. 51:1114).
[0416] 4. Use of the pTEMPHU3 to Induce Amplification on Human
Chromosome #3
[0417] Each human chromosome contains unique chromosome-specific
alphoid sequence. Thus, use of pTEMPHU3, which is targeted to the
chromosome 3-specific .alpha.-satellite can be introduced into
human cells under selective conditions, whereby large scale
amplification of the chromosome 3 centromeric region and production
of a de novo chromosome. Such induced large-scale amplification
provides a means for inducing de novo chromosome formation and also
for in vivo cloning of defined human chromosome fragments up to
megabase size.
[0418] For example, the break-point in human chromosome #3 is on
the short arm near the centromere. this region is involved in renal
cell carcinoma formation. By targeting pTEMPhu3 to this region, the
induced large-scale amplification may contain this region, which
can then be cloned using the bacterial and yeast markers in the
pTEMPhu3 vector.
[0419] The pTEMPhu3 cloning vector allows not only selection for
homologous recombinants, but also direct cloning of the integration
site in YACS. This vector can also be used to target human
chromosome #3, preferably with a deleted short arm, in a
mouse-human monochromosomal microcell hybrid line. Homologous
recombinants can be screened by nucleic acid amplification (PCR)
and amplification can be screened by DNA hybridization, Southern
hybridization, and in situ hybridization. The amplified region can
be cloned into YAC. This vector and these methods also permit a
functional analysis of cloned chromosome regions by reintroducing
the cloned amplified region into mammalian cells.
[0420] B. Preparation of Libraries in YAC Vectors for Cloning of
Centromeres and Identification of Functional Chromosomal Units
[0421] Another method that may be used to obtain smaller-sized
functional mammalian artificial chromosome units and to clone
centromeric DNA involves screening of mammalian DNA YAC
vector-based libraries and functional analysis of potential
positive clones in a transgenic mouse model system. A mammalian DNA
library is prepared in a YAC vector, such as YRT2 (see Schedl et
al. (1993) Nuc. Acids Res. 21:4783-4787), which contains the murine
tyrosinase gene. The library is screened for hybridization to
mammalian telomere and centromere sequence probes. Positive clones
are isolated and microinjected into pronuclei of fertilized oocytes
of NMRI/Han mice following standard techniques. The embryos are
then transferred into NMRI/Han foster mothers. Expression of the
tyrosinase gene in transgenic offspring confers an identifiable
phenotype (pigmentation). The clones that give rise to
tyrosinase-expressing transgenic mice are thus confirmed as
containing functional mammalian artificial chromosome units.
[0422] Alternatively, fragments of SATACs may be introduced into
the YAC vectors and then introduced into pronuclei of fertilized
oocytes of NMRI/Han mice following standard techniques as above.
The clones that give rise to tyrosinase-expressing transgenic mice
are thus confirmed as containing functional mammalian artificial
chromosome units, particularly centromeres.
[0423] C. Incorporation of Heterologous Genes into Mammalian
Artificial Chromosomes Through the Use of Homology Targeting
Vectors
[0424] As described above, the use of mammalian artificial
chromosomes for expression of heterologous genes obviates certain
negative effects that may result from random integration of
heterologous plasmid DNA into the recipient cell genome. An
essential feature of the mammalian artificial chromosome that makes
it a useful tool in avoiding the negative effects of random
integration is its presence as an extra-genomic gene source in
recipient cells. Accordingly, methods of specific, targeted
incorporation of heterologous genes exclusively into the mammalian
artificial chromosome, without extraneous random integration into
the genome of recipient cells, are desired for heterologous gene
expression from a mammalian artificial chromosome.
[0425] One means of achieving site-specific integration of
heterologous genes into artificial chromosomes is through the use
of homology targeting vectors. The heterologous gene of interest in
subcloned into a targeting vector which contains nucleic acid
sequences that are homologous to nucleotides present in the
artificial chromosome. The vector is then introduced into cells
containing the artificial chromosome for specific site-directed
integration into the artificial chromosome through a recombination
event at sites of homology between the vector and the chromosome.
The homology targeting vectors may also contain selectable markers
for ease of identifying cells that have incorporated the vector
into the artificial chromosome as well as lethal selection genes
that are expressed only upon extraneous integration of vector into
the recipient cell genome. Two exemplary homology targeting
vectors, .lambda.CF-7 and p.lambda.CF-7-DTA, are described
below.
[0426] 1. Construction of Vector .lambda.CF-7
[0427] Vector .lambda.CF-7 contains the cystic fibrosis
transmembrane conductance regulator (CFTR) gene as an exemplary
therapeutic molecule-encoding nucleic acid that may be incorporated
into mammalian artificial chromosomes for use in gene therapy
applications. This vector, which also contains the
puromycin-resistance gene as a selectable marker, as well as the
Saccharomyces cerevisiae ura3 gene (orotidine-5-phosphate
decarboxylase), was constructed in a series of steps as
follows.
[0428] a. Construction of pURA
[0429] Plasmid pURA was prepared by ligating a 2.6-kb SalI/XhoI
fragment from the yeast artificial chromosome vector pYAC5 (Sigma;
see also Burke et al. (1987) Science 236:806-812 for a description
of YAC vectors as well as GenBank Accession No. U01086 for the
complete sequence of pYAC5) containing the S. cerevisiae ura3 gene
with a 3.3-kb SalI/SmaI fragment of pHyg (see, e.g., U.S. Pat. Nos.
4,997,764, 4,686,186 and 5,162,215, and the description above).
Prior to ligation the XhoI end was treated with Klenow polymerase
for blunt end ligation to the SmaI end of the 3.3 kb fragment of
pHyyg. Thus, pURA contains the S. cerevisiae ura3 gene, and the E.
coli ColE1 origin of replication and the ampicillin-resistance
gene. The uraE gene is included to provide a means to recover the
integrated construct from a mammalian cell as a YAC clone.
[0430] b. Construction of pUP2
[0431] Plasmid pURA was digested with SalI and ligated to a 1.5-kb
SalI fragment of pCEPUR. Plasmid pCEPUR is produced by ligating the
1.1 kb SnaBI-NhaI fragment of pBabe-puro (Morgenstern et al. (1990)
Nucl. Acids Res. 18:3587-3596; provided by Dr. L. Szkely
(Microbiology and Tumorbiology Center, Karolinska Institutet,
Stockholm); see, also Tonghua et al. (1995) Chin. Med. J. (Beijing,
Engl. Ed.) 108:653-659; Couto et al. (1994) Infect. Immun.
62:2375-2378; Dunckley et al. (1992) FEBS Lett. 296:128-34; French
et al. (1995) Anal. Biochem. 228:354-355; Liu et al. (1995) Blood
85:1095-1103; International PCT application Nos. WO 9520044; WO
9500178, and WO 9419456) to the NheI-NruI fragment of pCEP4
(Invitrogen).
[0432] The resulting plasmid, pUP2, contains the all the elements
of pURA plus the puromycin-resistance gene linked to the SV40
promoter and polyadenylation signal from pCEPUR.
[0433] c. Construction of pUP-CFTR
[0434] The intermediate plasmid pUP-CFTR was generated in order to
combine the elements of pUP2 into a plasmid along with the CFTR
gene. First, a 4.5-kb SalI fragment of pCMV-CFTR that contains the
CFTR-encoding DNA (see, also, Riordan et al. (1989) Science
245:1066-1073, U.S. Pat. No. 5,240,846, and Genbank Accession No.
M28668 for the sequence of the CFTR gene) containing the CFTR gene
only was ligated to XhoI-digested pCEP4 (Invitrogen and also
described herein) in order to insert the CFTR gene in the multiple
cloning site of the Epstein Barr virus-based (EBV) vector pCEP4
(Invitrogen, San Diego, Calif.; see also Yates et al. (1985) Nature
313:812-815; see, also U.S. Pat. No. 5,468,615) between the CMV
promoter and SV40 polyadenylation signal. The resulting plasmid was
designated pCEP-CFTR. Plasmid pCEP-CFTR was then digested with SalI
and the 5.8-kb fragment containing the CFTR gene flanked by the CMV
promoter and SV40 polyadenylation signal was ligated to
SalI-digested pUP2 to generate pUP-CFTR. Thus, pUP-CFTR contains
all elements of pUP2 plus the CFTR gene linked to the CMV promoter
and SV40 polyadenylation signal.
[0435] d. Construction of .lambda.CF-7
[0436] Plasmid pUP-CFTR was then linearized by partial digestion
with EcoRI and the 13 kb fragment containing the CFTR gene was
ligated with EcoRI-digested Charon 4A .lambda. (see Blattner et al.
(1977) Science 196:161; Williams and Blattner (1979) J. Virol.
29:555 and Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual, Second Ed., Cold Spring Harbor Laboratory Press, Volume 1,
Section 2.18, for descriptions of Charon 4A.lambda.). The resulting
vector, .lambda.CF8, contains the Charon 4A.lambda. bacteriophage
left arm, the CFTR gene linked to the CMV promoter and SV40
polyadenylation signal, the ura3 gene, the puromycin-resistance
gene linked to the SV40 promoter and polyadenylation signal, the
thymidine kinase promoter (TK), the ColE1 origin of replication,
the ampicillin resistance gene and the Charon 4A.lambda.
bacteriophage right arm. The .lambda.CF8 construct was then
digested with XhoI and the resulting 27.1 kb was ligated to the 0.4
kb XhoI/EcoRI fragment of pJBP86 (described below), containing the
SV40 polyA signal and the EcoRI-digested Charon 4A .lambda. right
arm. The resulting vector .lambda.CF-7 contains the Charon 4A
.lambda. left arm, the CFTR encoding DNA linked to the CMV promoter
and SV40 polyA signal, the ura3 gene, the puromycin resistance gene
linked to the SV40 promoter and polyA signal and the Charon 4A
.lambda. right arm. The .lambda. DNA fragments provide sequences
homologous to nucleotides present in the exemplary artificial
chromosomes.
[0437] The vector is then introduced into cells containing the
artificial chromosomes exemplified herein. Accordingly, when the
linear .lambda.CF-7 vector is introduced into
megachromosome-carrying fusion cell lines, such as described
herein, it will be specifically integrated into the megachromosome
through recombination between the homologous bacteriophage .lambda.
sequences of the vector and the artificial chromosome.
[0438] 2. Construction of Vector .lambda.CF-7-DTA
[0439] Vector .lambda.CF-7-DTA also contains all the elements
contained in .lambda.CF-7, but additionally contains a lethal
selection marker, the diphtheria toxin-A (DT-A) gene as well as the
ampicillin-resistance gene and an origin of replication. This
vector was constructed in a series of steps as follows.
[0440] a. Construction of pJBP86
[0441] Plasmid pJBP86 was used in the construction of .lambda.CF-7,
above. A 1.5-kb SalI fragment of pCEPUR containing the
puromycin-resistance gene linked to the SV40 promoter and
polyadenylation signal was ligated to HindIII-digested pJB8 (see,
e.g., Ish-Horowitz et al. (1981) Nucleic Acids Res. 9:2989-2998;
available from ATCC as Accession No. 37074; commercially available
from Amersham, Arlington Heights, Ill.). Prior to ligation the SalI
ends of the 1.5 kb fragment of pCEPUR and the HindIII linearized
pJB8 ends were treated with Klenow polymerase before ligation. The
resulting vector pJBP86 contains the puromycin resistance gene
linked to the SV40 promoter and polyA signal, the 1.8 kb COS region
of Charon 4A.lambda., the ColE1 origin of replication and the
ampicillin resistance gene.
[0442] b. Construction of pMEP-DTA
[0443] A 1.1-kb XhoI/SalI fragment of pMC1-DT-A (see, e.g., Maxwell
et al. (1986) Cancer Res. 46:4660-4666) containing the diphtheria
toxin-A gene was ligated to XhoI-digested pMEP4 (Invitrogen, San
Diego, Calif.) to generate pMEP-DTA. To produce pMC1-DT-A, the
coding region of the DTA gene was isolated as a 800 bp PstI/HindIII
fragment from p2249-1 and inserted into pMC1neopolyA (pMC1
available from Stratagene) in place of the neo gene and under the
control of the TK promoter. The resulting construct pMC1DT-A was
digested with HindIII, the ends filled by Klenow and SalI linkers
were ligated to produce a 1061 bp TK-DTA gene cassette with an XhoI
end (5') and a SalI end containing the 270 bp TK promoter and the
.about.790 bp DT-A fragment. This fragment was ligated into
XhoI-digested pMEP4.
[0444] Plasmid pMEP-DTA thus contains the DT-A gene linked to the
TK promoter and SV40, ColE1 origin of replication and the
ampicillin-resistance gene.
[0445] c. Construction of pJB83-DTA9
[0446] Plasmid pJB8 was digested with HindIII and ClaI and ligated
with an oligonucleotide (see SEQ ID NOs. 7 and 8 for the sense and
antisense strands of the oligonucleotide, respectively) to generate
pJB83. The oligonucleotide that was ligated to
ClaI/HindIII-digested pJB8 contained the recognition sites of SwaI,
PacI and SrfI restriction endonucleases. These sites will permit
ready linearization of the p.lambda.CF-7-DTA construct.
[0447] Next, a 1.4-kb XhoI/SalI fragment of pMEP-DTA, containing
the DT-A gene was ligated to SalI-digested pJB83 to generate
pJB83-DTA9.
[0448] d. Construction of .lambda.CF-7-DTA
[0449] The 12-bp overhangs of .lambda.CF-7 were removed by Mung
bean nuclease and subsequent T4 polymerase treatments. The
resulting 41.1-kb linear .lambda.CF-7 vector was then ligated to
pFB83-DTA9 which had been digested with ClaI and treated with T4
polymerase. The resulting vector, .lambda.CF-7-DTA, contains all
the elements of .lambda.CF-7 as well as the DT-A gene linked to the
TK promoter and the SV40 polyadenylation signal, the 1.8 kB Charon
4A .lambda. COS region, the ampicillin-resistance gene (from
pJB83-DTA9) and the Col E1 origin of replication (from
pJB83-DT9A).
[0450] 3. pMCT-RUC,
[0451] Plasmid pMCT-RUC (14 kbp) was constructed for site-specific
targeting of the Renilla luciferase (see, e.g., U.S. Pat. Nos.
5,292,658 and 5,418,155 for a description of DNA encoding Renilla
luciferase, and plasmid pTZrLuc-1, which can provide the starting
material for construction of such vectors) gene to a mammalian
chromosome. The relevant features of this plasmid are the Renilla
luciferase gene under transcriptional control of the human
cytomegalovirus immediate-early gene enhancer/promoter; the
hygromycin gene under the transcriptional control of the thymidine
kinase promoter; and a unique HpaI site is for linearizing the
plasmid.
[0452] This construct was introduced into C5 cells (see, Lorenz et
al. (1996) J. Biolum. Chemilum. 11:31-37). C5 mouse fibroblasts
were maintained as a monolayer (see, Gluzman (1981) Cell
23:175-183). Cells at 50% confluency in 100 mm Petri dishes were
used for calcium phosphate transfection (see, Harper et al. (1981)
Chromosoma 83:431-439) using 10 .mu.g of linearized pMCT-RUC per
plate. Colonies originating from single transfected cells were
isolated and maintained in F-12 medium containing hygromycin (300
.mu.g/mL) and 10% fetal bovine serum. Cells were grown in 100 mm
Petri dishes prior to the Renilla luciferase assay.
[0453] The Renilla luciferase assay was performed (see, e.g.,
Matthews et al. (1977) Biochemistry 16:85-91). Hygromycin-resistant
cell lines obtained after transfection of mouse fibroblasts with
linearized plasmid pMCT-RUC ("B" cell lines) were grown to 100%
confluency for measurements of light emission in vivo and in vitro.
Light emission was measured in vivo after about 30 generations as
follows: growth medium was removed and replaced by 1 mL RPMI 1640
containing coelenterazine (1 mmol/L final concentration). Light
emission from cells was then visualized by placing the Petri dishes
in a low light video image analyzer (Hamamatsu Argus-100). An image
was formed after 5 min. of photon accumulation using 100%
sensitivity of the photon counting tube. For measuring light
emission in vitro, cells were trypsinized and harvested from one
Petri dish, pelleted, resuspended in 1 mL assay buffer (0.5 mol/L
NACl, 1 mmol/L EDTA, 0.1 mol/L potassium phosphate, pH 7.4) and
sonicated on ice for 10 s. Lysates were than assayed in a Turner
TD-20e lukminometer for 10 s after rapid injection of 0.5 mL of 1
mmol/L coelenterazine, and the average value of light emission was
recorded as LU (1 LU=1.6.times.106 hu/s for this instrument).
[0454] Independent cell lines of mouse fibroblasts transfected with
linearized plasmid pMCT-RUC showed different levels of Renilla
luciferase activity. Similar differences in light emission were
observed when measurements were performed on lysates of the same
cell lines. This variation in light emission was probably due to a
position effect resulting from the random integration of plasmid
pMCT-RUC into the mouse genome, since enrichment for site targeting
of the luciferase gene was not performed in this experiment.
[0455] D. Protein Secretion Targeting Vectors
[0456] Isolation of heterologous proteins produced intracellularly
in mammalian cell expression systems requires cell disruption under
potentially harsh conditions and purification of the recombinant
protein from cellular contaminants. The process of protein
isolation may be greatly facilitated by secretion of the
recombinantly produced protein into the extracellular medium where
there are fewer contaminants to remove during purification.
Therefore, secretion targeting vectors have been constructed for
use with the mammalian artificial chromosome system.
[0457] A useful model vector for demonstrating production and
secretion of heterologous protein in mammalian cells contains DNA
encoding a readily detectable reporter protein fused to an
efficient secretion signal that directs transport of the protein to
the cell membrane and secretion of the protein from the cell.
Vectors pLNCX-ILRUC and pLNCX-ILRUC.lambda., described below, are
examples of such vectors. These vectors contain DNA encoding an
interleukin-2 (IL2) signal peptide-Renilla reniformis luciferase
fusion protein. The IL-2 signal peptide (encoded by the sequence
set forth in SEQ ID NO. 9) directs secretion of the luciferase
protein, to which it is linked, from mammalian cells. Upon
secretion from the host mammalian cell, the IL-2 signal peptide is
cleaved from the fusion protein to deliver mature, active,
luciferase protein to the extracellular medium. Successful
production and secretion of this heterologous protein can be
readily detected by performing luciferase assays which measure the
light emitted upon exposure of the medium to the bioluminescent
luciferin substrate of the luciferase enzyme.
[0458] 1. Construction of Protein Secretion Vector pLNCX-ILRUC
[0459] Vector pLNCX-ILRUC contains a human IL-2 signal peptide-R.
reniformis fusion gene linked to the human cytomegalovirus (CMV)
immediate early promoter for constitutive expression of the gene in
mammalian cells. The construct was prepared as follows.
[0460] a. Preparation of the IL-2 Signal Sequence-Encoding DNA
[0461] A 69-bp DNA fragment containing DNA encoding the human IL-2
signal peptide was obtained through nucleic acid amplification,
using appropriate primers for IL-2, of an HEK 293 cell line (see,
e.g., U.S. Pat. No. 4,518,584 for an IL-2 encoding DNA; see, also
SEQ ID NO. 9; the IL-2 gene and corresponding amino acid sequence
is also provided in the Genbank Sequence Database as accession nos.
K02056 and J00264). The signal peptide includes the first 20 amino
acids shown in the translations provided in both of these Genbank
entries and in SEQ ID NO. 9. The corresponding nucleotide sequence
encoding the first 20 amino acids is also provided in these entries
(see, e.g., nucleotides 293-52 of accession no. K02056 and
nucleotides 478-537 of accession no. J00264), as well as in SEQ ID
NO. 9. The amplification primers included an EcoRI site (GAATTC)
that for subcloning of the DNA fragment into EcoRI-digested pGEMT
(Promega). The forward primer is set forth in SEQ ID NO. 11 and the
sequence of the reverse primer is set forth in SEQ ID NO. 12.
[0462] TTTGAATTCATGTACAGGATGCAACTCCTG forward (SEQ ID NO. 11)
[0463] TTTGAATTCAGTAGGTGCACTGTTTGTGAC reverse (SEQ ID NO. 12)
[0464] b. Preparation of the R. reniformis Luciferase-Encoding
DNA
[0465] The initial source of the R. reniformis luciferase gene was
plasmid pLXSN-RUC. Vector pLXSN (see, e.g., U.S. Pat. Nos.
5,324,655, 5,470,730, 5,468,634, 5,358,866 and Miller et al. (1989)
Biotechniques 7:980) is a retroviral vector capable of expressing
heterologous DNA under the transcriptional control of the
retroviral LTR; it also contains the neomycin-resistance gene
operatively linked for expression to the SV40 early region
promoter. The R. reniformis luciferase gene was obtained from
plasmid pTZrLuc-1 (see, e.g., U.S. Pat. No. 5,292,658; see also the
Genbank Sequence Database Accession No. M63501; and see also Lorenz
et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:4438-4442) and is
shown as SEQ ID NO. 10. The 0.97 kb EcoRI/SmaI fragment of
pTZrLuc-1 contains the coding region of the Renilla
luciferase-encoding DNA. Vector pLXSN was digested with and ligated
with the luciferase gene contained on a pLXSN-RUC, which contains
the luciferase gene located operably linked to the viral LTR and
upstream of the SV40 promoter, which directs expression of the
neomycin-resistance gene.
[0466] c. Fusion of DNA Encoding the IL-2 Signal Peptide and the R.
reniformis Luciferase Gene to Yield pLXSN-ILRUC
[0467] The pGEMT vector containing the IL-2 signal peptide-encoding
DNA described in 1.a. above was digested with EcoRI, and the
resulting fragment encoding the signal peptide was ligated to
EcoRI-digested pLXSN-RUC. The resulting plasmid, called
pLXSN-ILRUC, contains the IL-2 signal peptide-encoding DNA located
immediately upstream of the R. reniformis gene in pLXSN-RUC.
Plasmid pLXSN-ILRUC was then used as a template for nucleic acid
amplification of the fusion gene in order to add a SmaI site at the
3' end of the fusion gene. The amplification product was subcloned
into EcoRI/SmaI-digested pGEMT (Promega) to generate
ILRUC-pGEMT.
[0468] d. Introduction of the Fusion Gene into a Vector Containing
Control Elements for Expression in Mammalian Cells
[0469] Plasmid ILRUC-pGEMT was digested with KspI and SmaI to
release a fragment containing the IL-2 signal peptide-luciferase
fusion gene which was ligated to HpaI-digested pLNCX. Vector pLNCX
(see, e.g., U.S. Pat. Nos. 5,324,655 and 5,457,182; see, also
Miller and Rosman (1989) Biotechniques 7:980-990) is a retroviral
vector for expressing heterologous DNA under the control of the CMV
promoter; it also contains the neomycin-resistance gene under the
transcriptional control of a viral promoter. The vector resulting
from the ligation reaction was designated pLNCX-ILRUC. Vector
pLNCX-ILRUC contains the IL-2 signal peptide-luciferase fusion gene
located immediately downstream of the CMV promoter and upstream of
the viral 3' LTR and polyadenylation signal in pLNCX. This
arrangement provides for expression of the fusion gene under the
control of the CMV promoter. Placement of the heterologous
protein-encoding DNA (i.e., the luciferase gene) in operative
linkage with the IL-2 signal peptide-encoding DNA provides for
expression of the fusion in mammalian cells transfected with the
vector such that the heterologous protein is secreted from the host
cell into the extracellular medium.
[0470] 2. Construction of Protein Secretion Targeting Vector
pLNCX-ILRUC.lambda.
[0471] Vector pLNCX-ILRUC may be modified so that it can be used to
introduce IL-2 signal peptide-luciferase fusion gene into a
mammalian artificial chromosome in a host cell. To facilitate
specific incorporation of the pLNCX-ILRUC expression vector into a
mammalian artificial chromosome, nucleic acid sequences that are
homologous to nucleotides present in the artificial chromosome are
added to the vector to permit site directed recombination.
[0472] Exemplary artificial chromosomes described herein contain
lambda phage DNA. Therefore, protein secretion targeting vector
pLNCX-ILRUC.lambda. was prepared by addition of lambda phage DNA
(from Charon 4A arms) to produce the secretion vector
pLNCX-ILRUC.
[0473] 3. Expression and Secretion of R. reniformis Luciferase from
Mammalian Cells
[0474] a. Expression of R. reniformis Luciferase Using
pLNCX-ILRUC
[0475] Mammalian cells (LMTK.sup.- from the ATCC) were transiently
transfected with vector pLNCX-ILRUC (.about.10 .mu.g) by
electroporation (BIORAD, performed according to the manufacturer's
instructions). Stable transfectants produced by growth in G418 for
neo selection have also been prepared.
[0476] Transfectants were grown and then analyzed for expression of
luciferase. To determine whether active luciferase was secreted
from the transfected cells, culture media were assayed for
luciferase by addition of coelentrazine (see, e.g., Matthews et al.
(1977) Biochemistry 16:85-91).
[0477] The results of these assays establish that vector
pLNCX-ILRUC is capable of providing constitutive expression of
heterologous DNA in mammalian host cells. Furthermore, the results
demonstrate that the human IL-2 signal peptide is capable of
directing secretion of proteins fused to the C-terminus of the
peptide. Additionally, these data demonstrate that the R.
reniformis luciferase protein is a highly effective reporter
molecule, which is stable in a mammalian cell environment, and
forms the basis of a sensitive, facile assay for gene
expression.
[0478] b. Expression of R. reniformis Luciferase Using
pLNCX-ILRUC.lambda.
[0479] To express the IL-2 signal peptide-R. reniformis fusion gene
from an artificial mammalian chromosome, vector pLNCX-ILRUC.lambda.
is targeted for site-specific integration into an artificial
mammalian chromosome through homologous recombination of the lambda
DNA sequences contained in the chromosome and the vector. This is
accomplished by introduction of pLNCX-ILRUC.lambda. into either a
fusion cell line harboring mammalian artificial chromosomes or
mammalian host cells that contain artificial mammalian chromosomes.
If the vector is introduced into a fusion cell line harboring the
artificial chromosomes, for example through microinjection of the
vector or transfection of the fusion cell line with the vector, the
cells are then grown under selective conditions, i.e. artificial
chromosomes, which have incorporated vector pLNCX-ILRUC.lambda.,
are isolated from the surviving cells, using purification
procedures as described above, and then injected into the mammalian
host cells.
[0480] Alternatively, the mammalian host cells may first be
injected with mammalian artificial chromosomes which have been
isolated from a fusion cell line. The host cells are then
transfected with vector pLNCX-ILRUC.lambda. and grown.
[0481] The recombinant host cells are then assayed for luciferase
expression as described above.
[0482] D. Other Targeting Vectors
[0483] These vector rely on positive and negative selection to
insure insertion and selection for the double recombinants. A
single crossover results in incorporation of the DT-A, which kills
the cell, double crossover recombinations delete the DT-1 gene.
[0484] 1. Plasmid pNEM1 contains:
[0485] DT-A: Diphtheria toxin gene (negative selectable marker)
[0486] Hyg: Hygromycin gene (positive selectable marker)
[0487] ruc: Renilla luciferase gene (non-selectable marker)
[0488] 1: LTR-MMTV promoter
[0489] 2: TK promoter
[0490] 3: CMV promoter
[0491] MMR: Homology region (plasmid pAG60)
[0492] 2. plasmid pNEM-2 and -3 are similar to pNEM 1 except for
different negative selectable markers:
[0493] pNEM-1: diphtheria toxin gene as "-" selectable marker
[0494] pNEM-2: hygromycin antisense gene as "-" selectable
marker
[0495] pNEM-3: thymidine kinase HSV-1 gene as "-" selectable
marker
[0496] 3. Plasmid--lambda DNA based homology:
[0497] pNEMA-1: base vector
[0498] pNEMA-2: base vector containing p5=gene
[0499] 1: LTR MMTV promoter
[0500] 2: SV40 promoter
[0501] 3: CMV promoter
[0502] 4: .mu.TIIA promoter (metallothionein gene promoter)
[0503] - homology region (plasmid pAG60)
[0504] .lambda. L.A. and .lambda. R.A. homology regions for A left
and right arms (.lambda. gt-WES).
EXAMPLE 13
[0505] Microinjection of Mammalian Cells with Plasmid DNA
[0506] These procedure will be used to microinject MACS into
eukaryotic cells, including mammalian and insect cells.
[0507] The microinjection technique is based on the use of small
glass capillaries as a delivery system into cells and has been used
for introduction of DNA fragments into nuclei (see, e.g., Chalfie
et al. (1994) Science 263:802-804). It allows the transfer of
almost any type of molecules, e.g., hormones, proteins, DNA and
RNA, into either the cytoplasm or nuclei of recipient cells This
technique has no cell type restriction and is more efficient than
other methods, including Ca.sup.2+-mediated gene transfer and
liposome-mediated gene transfer. About 20-30% of the injected cells
become successfully transformed.
[0508] Microinjection is performed under a phase-contrast
microscope. A glass microcapillary, prefilled with the DNA sample,
is directed into a cell to be injected with the aid of a
micromanipulator. An appropriate sample volume (1-10 pl) is
transferred into the cell by gentle air pressure exerted by a
transjector connected to the capillary. Recipient cells are grown
on glass slides imprinted with numbered squares for convenient
localization of the injected cells.
[0509] a. Materials and Equipment
[0510] Nunclon tissue culture dishes 35.times.10 mm, Mouse cell
line EC3/7C5 Plasmid DNA pCH110 (Pharmacia), Purified Green
Florescent Protein (GFP) (GFPs from Aequorea and Renilla have been
purified and also DNA encoding GFPs has been cloned; see, e.g.,
Prasher et al. (1992) Gene 111:229-233; International PCT
Application No. WO 95/07463, which is based on U.S. application
Ser. No. 08/119,678 and U.S. application Ser. No. 08/192,274),
ZEISS Axiovert 100 microscope, Eppendorf transjector 5246,
Eppendorf micromanipulator 5171, Eppendorf Cellocate coverslips,
Eppendorf microloaders, Eppendorf femtotips and other standard
equipment
[0511] b. Protocol
[0512] (1) Fibroblast cells are grown in .O slashed. 35 mm tissue
culture dishes (37.degree. C., 5% CO.sub.2) until the cell density
reaches 80% confluency. The dishes are removed from the incubator
and medium to added to about a 5 mm depth.
[0513] (2) The dish is placed onto the dish holder and the cells
observed with 10.times. objective; the focus is desirably above the
cell surface.
[0514] (3) Plasmid or chromosomal DNA solution (1 ng/.mu.l) and GFP
protein solution are further purified by centrifuging the DNA
sample at force sufficient to removed any particular debris
(typically about 10,000 rpm for 10 minutes in a
microcentrifuge).
[0515] (4) Two 2 .mu.l of the DNA solution (1 ng/.mu.l) is loaded
into a microcapillary with an Eppendorf microloader. During
loading, the loader is inserted to the tip end of the
microcapillary. GFP (1 mg/ml) is loaded wit the same procedure.
[0516] (5) The protecting sheath is removed from the microcapillary
and the microcapillary is fixed onto the capillary holer connected
with the micromanipulator.
[0517] (6) The capillary tip lowered to the surface of the medium
and focus on the cells gradually until the tip of the capillary
reaches the surface of a cell. Lower the capillary further so that
the capillary is inserted into the cell. Various parameters, such
as the level of the capillary, the time and pressure are determined
for the particular equipment. For example, using the fibroblast
cell line C5 and the above-noted equipment, the best conditions
are: injection time 0.4 second, pressure 80 psi. DNA can then be
automatically injected into the nuclei of the cells.
[0518] (7) After injection, the cells are returned to the
incubator, and incubated for about 18-24 hours.
[0519] (8) After incubation the number of transformants can be
determined by a suitable method, which depends upon the selection
marker. For example, if green fluorescent protein is used, the
assay can be performed using UV light source and fluorescent filter
set at 0-24 hours after injection. If .beta.-gal-containing DNA,
such as DNA-derived from pHC110, has been injected, then the
transformants can be assayed for .beta.-gal.
[0520] i. Detection of .beta.-galactosidase in cells injected with
plasmid DNA. The medium is removed from the culture plate and the
cells are fixed by addition of 5 ml of fixation Solution I: (1%
glutaraldehyde; 0.1 M sodium phosphate buffer, pH 7.0; 1 mM
MgCl.sub.2), and incubated for 15 minutes at 37.degree. C. Fixation
Solution I is replaced with 5 ml of X-gal Solution II: (0.2% X-gal,
10 mM sodium phosphate buffer (pH 7.0), 150 mM NaCl, 1 mM
MgCl.sub.2, 3.3 mM K.sub.4Fe(CN).sub.6H.sub.2O, 3.3 mM
K.sub.3Fe(CN).sub.6), and the plates are incubated for 30-60
minutes at 37.degree. C.
[0521] The X-gal solution is removed and 2 ml of 70% glycerol is
added to each dish. Blue stained cells are identified under a light
microscope.
[0522] This will be used to introduce a MAC, particular the MAC
with the anti-HIV megachromosome, to produce a mouse model for
anti-HIV activity.
EXAMPLE 14
[0523] Transgenic Animals
[0524] Transgenic animals can be generated that express
heterologous genes which confer desired traits, e.g., disease
resistance, in the animals. A transgenic mouse is prepared to serve
as model of a disease-resistant animal. Genes that encode vaccines
or that encode therapeutic molecules can be introduced into embryos
or ES cells to produce animals that express the gene product and
thereby are resistant to or less susceptible to a particular
disorder.
[0525] The mammalian artificial megachromosome can be used to
generate transgenic animals that stably express genes conferring
desired traits, such as genes conferring resistance to pathogenic
viruses. Transgenic mice containing a transgene encoding an
anti-HIV ribozyme provide a useful model for the development of
stable transgenic animals using these methods.
[0526] 1. Development of Control Transgenic Mice Expressing
Anti-HIV Ribozyme
[0527] Control transgenic mice are generated in order to compare
stability and amounts of transgene expression in mice developed
using transgene DNA carried on a vector (control mice) with
expression in mice developed using transgenes carried in an
artificial megachromosome.
[0528] a. Development of Control Transgenic Mice Expressing
.beta.-Galactosidase
[0529] One set of control transgenic mice was generated by
microinjection of mouse embryos with the .beta.-galactosidase gene
alone. The microinjection procedure used to introduce the plasmid
DNA into the mouse embryos is as described in Example 13, but
modified for use with embryos (see, e.g., Hogan et al. (1994)
Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., see, especially
pages 255-264 and Appendix 3). Fertilized mouse embryos (Strain CB6
obtained from Charles River Co.) were injected with 1 ng of plasmid
pCH110 (Pharmacia) which had been linearized by digestion with
BamHI. This plasmid contains the .beta.-galactosidase gene linked
to the SV40 late promoter. The .beta.-galactosidase gene product
provides a readily detectable marker for successful transgene
expression. Furthermore, these control mice provide confirmation of
the microinjection procedure used to introduce the plasmid into the
embryos. Additionally, because the megachromosome that is
transferred to the mouse embryos in the model system (see below)
also contains the .beta.-galactosidase gene, the control transgenic
mice that have been generated by injection of pCH110 into embryos
serve as an analogous system for comparison of heterologous gene
expression from a plasmid versus from a gene carried on an
artificial chromosome.
[0530] After injection, the embryos are cultured in modified HTF
medium under 5% CO.sub.2 at 37.degree. C. for one day until they
divide to form two cells. The two-cell embryos are then implanted
into surrogate mother female mice (for procedures see, Manipulating
the Mouse Embryo: A Laboratory Manual (1994) Hogan et al., eds.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp.
127 et seq.).
[0531] b. Development of Control Transgenic Mice Expressing
Anti-HIV Ribozyme
[0532] One set of anti-HIV ribozyme gene-containing control
transgenic mice was generated by microinjection of mouse embryos
with plasmid pCEPUR-132 which contains three different genes: (1)
DNA encoding an anti-HIV ribozyme, (2) the puromycin-resistance
gene and (3) the hygromycin-resistance gene. Plasmid pCEPUR-132 was
constructed by ligating portions of plasmid pCEP-132 containing the
anti-HIV ribozyme gene (referred to as ribozyme D by Chang et al.
((1990) Clin. Biotech. 2:23-31); see also U.S. Pat. No. 5,144,019
to Rossi et al., particularly FIG. 4 of the patent) and the
hygromycin-resistance gene with a portion of plasmid pCEPUR
containing the puromycin-resistance gene.
[0533] Plasmid pCEP-132 was constructed as follows. Vector pCEP4
(Invitrogen, San Diego, Calif.; see also Yates et al. (1985) Nature
313:812-815) was digested with XhoI which cleaves in the multiple
cloning site region of the vector. This .about.10.4-kb vector
contains the hygromycin-resistance gene linked to the thymidine
kinase gene promoter and polyadenylation signal, as well as the
ampicillin-resistance gene and ColE1 origin of replication and
EBNA-1 (Epstein-Barr virus nuclear antigen) genes and OriP. The
multiple cloning site is flanked by the cytomegalovirus promoter
and SV40 polyadenylation signal.
[0534] XhoI-digested pCEP4 was ligated with a fragment obtained by
digestion of plasmid 132 (see Example 4 for a description of this
plasmid) with XhoI and SalI. This XhoI/SalI fragment contains the
anti-HIV ribozyme gene linked at the 3' end to the SV40
polyadenylation signal. The plasmid resulting from this ligation
was designated pCEP-132. Thus, in effect, pCEP-132 comprises pCEP4
with the anti-HIV ribozyme gene and SV40 polyadenylation signal
inserted in the multiple cloning site for CMV promoter-driven
expression of the anti-HIV ribozyme gene.
[0535] To generate pCEPUR-132, pCEP-132 was ligated with a fragment
of pCEPUR. pCEPUR was prepared by ligating a 7.7-kb fragment
generated upon NheI/NruI digestion of pCEP4 with a 1.1-kb
NheI/SnaBI fragment of pBabe (see Morgenstern and Land (1990)
Nucleic Acids Res. 18:3587-3596 for a description of pBabe) that
contains the puromycin-resistance gene linked at the 5' end to the
SV40 promoter. Thus, pCEPUR is made up of the ampicillin-resistance
and EBNA1 genes, as well as the ColE1 and OriP elements from pCEP4
and the puromycin-resistance gene from pBabe. The
puromycin-resistance gene in pCEPUR is flanked by the SV40 promoter
(from pBabe) at the 5' end and the SV40 polyadenylation signal
(from pCEP4) at the 3' end.
[0536] Plasmid pCEPUR was digested with XhoI and SalI and the
fragment containing the puromycin-resistance gene linked at the 5'
end to the SV40 promoter was ligated with XhoI-digested pCEP-132 to
yield the .about.12.1-kb plasmid designated pCEPUR-132. Thus,
pCEPUR-132, in effect, comprises pCEP-132 with puromycin-resistance
gene and SV40 promoter inserted at the XhoI site. The main elements
of pCEPUR-132 are the hygromycin-resistance gene linked to the
thymidine kinase promoter and polyadenylation signal, the anti-HIV
ribozyme gene linked to the CMV promoter and SV40 polyadenylation
signal, and the puromycin-resistance gene linked to the SV40
promoter and polyadenylation signal. The plasmid also contains the
ampicillin-resistance and EBNA1 genes and the ColE1 origin of
replication and OriP.
[0537] Zygotes were prepared from (C57BL/6JxCBA/J) F1 female mice
(see, e.g., Manipulating the Mouse Embryo: A Laboratory Manual
(1994) Hogan et al., eds., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., p. 429), which had been previously mated
with a (C57BL/6JxCBA/J) F1 male. The male pronuclei of these F2
zygotes were injected (see, Manipulating the Mouse Embryo: A
Laboratory Manual (1994) Hogan et al., eds., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.) with pCEPUR-132
(.about.3 .mu.g/ml), which had been linearized by digestion with
NruI. The injected eggs were then implanted in surrogate mother
female mice for development into transgenic offspring.
[0538] These primary carrier offspring were analyzed (as described
below) for the presence of the transgene in DNA isolated from tail
cells. Seven carrier mice that contained transgenes in their tail
cells (but that may not carry the transgene in all their cells,
i.e., they may be chimeric) were allowed to mate to produce
non-chimeric or germ-line heterozygotes. The heterozygotes were, in
turn, crossed to generate homozygote transgenic offspring.
[0539] 2. Development of Model Transgenic Mice Using Mammalian
Artificial Chromosomes
[0540] Fertilized mouse embryos are microinjected (as described
above) with megachromosomes (1-10 pL containing 0-1 chromosomes/pL)
isolated from fusion cell line G3D5' or H1D3' (described above).
The megachromosomes are isolated as described herein.
Megachromosomes isolated from either cell line carry the anti-HIV
ribozyme (ribozyme D) gene as well as the hygromycin-resistance and
.beta.-galactosidase genes. The injected embryos are then developed
into transgenic mice as described above.
[0541] Alternatively, the megachromosome-containing cell line G3D5*
or H1D3* is fused with mouse embryonic stem cells (see, e.g., U.S.
Pat. No. 5,453,357, commercially available; see Manipulating the
Mouse Embryo: A Laboratory Manual (1994) Hogan et al., eds., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pages
253-289) following standard procedures see also, e.g., "Guide to
Techniques in Mouse Development" in Methods in Enzymology Vol. 25,
Wassarman and De Pamphilis, eds. (1993), pages 803-932). (It is
also possible to deliver isolated megachromosomes into embryonic
stem cells using the Microcell procedure (such as that described
above).) The stem cells are cultured in the presence of a
fibroblast (e.g., STO fibroblasts that are resistant to hygromycin
and puromycin). Cells of the resultant fusion cell line, which
contains megachromosomes carrying the transgenes (i.e., anti-HIV
ribozyme, hygromycin-resistance and .beta.-galactosidase genes),
are then transplanted into mouse blastocysts, which are in turn
implanted into a surrogate mother female mouse where development
into a transgenic mouse will occur.
[0542] Mice generated by this method are chimeric in that the
transgenes will be expressed in only certain areas of the mouse,
e.g., the head, and thus may not be expressed in all cells.
[0543] 3. Analysis of Transgenic Mice for Transgene Expression
[0544] Beginning when the transgenic mice, generated as described
above, are three-to-four weeks old, they can be analyzed for stable
expression of the transgenes that were transferred into the embryos
(or fertilized eggs) from which they develop. The transgenic mice
may be analyzed in several ways as follows.
[0545] a. Analysis of Cells Obtained from the Transgenic Mice
[0546] Cell samples (e.g., spleen cells, lymphocytes, tail cells)
are obtained from the transgenic mice. Any cells may be tested for
transgene expression. If, however, the mice are chimeras generated
by microinjection of fertilized eggs with fusions of embryonic stem
cells with megachromosome-containing cells, only cells from areas
of the mouse that carry the transgene are expected to express the
transgene. If the cells survive growth on hygromycin (or hygromycin
and puromycin or neomycin, if the cells are obtained from mice
generated by transfer of both antibiotic-resistance genes), this is
one indication that they are stably expressing the transgenes. RNA
isolated from the cells according to standard methods may also be
analyzed by northern blot procedures to determine if the cells
express transcripts that hybridize to nucleic acid probes based on
the antibiotic-resistance genes.
[0547] Additionally, cells obtained from the transgenic mice may
also be analyzed for .beta.-galactosidase expression using standard
assays for this marker enzyme (for example, by direct staining of
the product of a reaction involving .beta.-galactosidase and the
X-gal substrate, see, e.g., Jones (1986) EMBO J. 5:3133-3142, or by
measurement of .beta.-galactosidase activity, see, e.g., Miller
(1972) in Experiments in Molecular Genetics pp. 352-355, Cold
Spring Harbor Press). Analysis of .beta.-galactosidase expression
is particularly used to evaluate transgene expression in cells
obtained from control transgenic mice in which the only transgene
transferred into the embryo was the .beta.-galactosidase gene.
[0548] Stable expression of the anti-HIV ribozyme gene in cells
obtained from the transgenic mice may be evaluated in several ways.
First, DNA isolated from the cells according to standard procedures
may be subjected to nucleic acid amplification using primers
corresponding to the ribozyme gene sequence. If the gene is
contained within the cells, an amplified product of pre-determined
size is detected upon hybridization of the reaction mixture to a
nucleic acid probe based on the ribozyme gene sequence.
Furthermore, DNA isolated from the cells may be analyzed using
Southern blot methods for hybridization to such a nucleic acid
probe. Second, RNA isolated from the cells may be subjected to
northern blot hybridization to determine if the cells express RNA
that hybridizes to nucleic acid probes based on the ribozyme gene.
Third, the cells may be analyzed for the presence of anti-HIV
ribozyme activity as described, for example, in Chang et al. (1990)
Clin. Biotech. 2:23-31. In this analysis, RNA isolated from the
cells is mixed with radioactively labeled HIV gag target RNA which
can be obtained by in vitro transcription of gag gene template
under reaction conditions favorable to in vitro cleavage of the gag
target, such as those described in Chang et al. (1990) Clin.
Biotech. 2:23-31. After the reaction has been stopped, the mixture
is analyzed by gel electrophoresis to determine if cleavage
products smaller in size than the whole template are detected;
presence of such cleavage fragments is indicative of the presence
of stably expressed ribozyme.
[0549] b. Analysis of Whole Transgenic Mice
[0550] Whole transgenic mice that have been generated by transfer
of the anti-HIV ribozyme gene (as well as selection and marker
genes) into embryos or fertilized eggs can additionally be analyzed
for transgene expression by challenging the mice with infection
with HIV. It is possible for mice to be infected with HIV upon
intraperitoneal injection with high-producing HIV-infected U937
cells (see, e.g., Locardi et al. (1992) J. Virol. 66:1649-1654).
Successful infection may be confirmed by analysis of DNA isolated
from cells, such as peripheral blood mononuclear cells, obtained
from transgenic mice that have been injected with HIV-infected
human cells. The DNA of infected transgenic mice cells will contain
HIV-specific gag and env sequences, as demonstrated by, for
example, nucleic acid amplification using HIV-specific primers. If
the cells also stably express anti-HIV ribozyme, then analysis of
RNA extracts of the cells should reveal the smaller gag fragments
arising by cleavage of the gag transcript by the ribozyme.
[0551] Additionally, the transgenic mice carrying the anti-HIV
ribozyme gene can be crossed with transgenic mice expressing human
CD4 (i.e., the cellular receptor for HIV) (see Gillespie et al.
(1993) Mol. Cell. Biol. 13:2952-2958; Hanna et al. (1994) Mol.
Cell. Biol. 14:1084-1094; and Yeung et al. (1994) J. Exp. Med.
180:1911-1920, for a description of transgenic mice expressing
human CD4). The offspring of these crossed transgenic mice
expressing both the CD4 and anti-HIV ribozyme transgenes should be
more resistant to infection (as a result of a reduction in the
levels of active HIV in the cells) than mice expressing CD4 alone
(without expressing anti-HIV ribozyme).
[0552] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 0
0
* * * * *