U.S. patent application number 10/789113 was filed with the patent office on 2004-07-22 for uses of transport proteins.
This patent application is currently assigned to Phogen Limited. Invention is credited to Brewis, Neil Douglas, Normand, Nadia Michelle, O'Hare, Peter Francis Joseph, Phelan, Anne.
Application Number | 20040142900 10/789113 |
Document ID | / |
Family ID | 10866955 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040142900 |
Kind Code |
A1 |
O'Hare, Peter Francis Joseph ;
et al. |
July 22, 2004 |
Uses of transport proteins
Abstract
This invention relates to uses of transport-active proteins,
particularly of proteins and fusion polypeptides with the function
of VP22, for control of the cell cycle, particularly in the
reduction of the proliferating activity of proliferating cells.
Inventors: |
O'Hare, Peter Francis Joseph;
(Surrey, GB) ; Normand, Nadia Michelle; (Surrey,
GB) ; Brewis, Neil Douglas; (Surrey, GB) ;
Phelan, Anne; (Kent, GB) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
Phogen Limited
|
Family ID: |
10866955 |
Appl. No.: |
10/789113 |
Filed: |
February 26, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10789113 |
Feb 26, 2004 |
|
|
|
09747772 |
Dec 20, 2000 |
|
|
|
6734167 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
435/455 |
Current CPC
Class: |
A61P 9/10 20180101; A61P
35/00 20180101; A61P 17/06 20180101; A61P 17/02 20180101; A61K
47/62 20170801 |
Class at
Publication: |
514/044 ;
435/455 |
International
Class: |
A61K 048/00; C12N
015/85 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 24, 1999 |
GB |
9930519.5 |
Claims
1. A method of reducing proliferation of cells, comprising: a)
exposing said cells to a composition comprising a nucleic acid
encoding at least one polypeptide comprising an amino acid sequence
with the transport function of herpesviral VP22 protein, said
polypeptide being coupled to at least one functionally active amino
acid sequence, wherein the functionally active amino acid sequence
is a protein or peptide which can regulate cell cycle progression,
or functional analogue thereof; and b) exposing said cells to at
least one agent to further stimulate cell death, said agent being
selected from: drugs which can induce cell cycle arrest, cytotoxic
chemotherapeutic drugs commonly used as part of a treatment of
malignant disease, DNA damaging agents, agents which increase
cellular sensitivity to DNA damage, and cytotoxic amounts of
radiation.
2. A method according to claim 1, wherein said cells are
hyperproliferating cells.
3. A method according to claim 1, wherein said coupled polypeptide
can induce apoptosis, or can arrest cells from the cell cycle.
4. A method according to claim 2, wherein said cells are cancer
cells.
5. A method according to claim 3, wherein said polypeptide is a
cyclin-dependent kinase inhibitor.
6. A composition comprising (a) a nucleic acid encoding a coupling
product between a protein with the transport function of VP22 and a
protein which can regulate cell cycle progression; and (b) at least
one agent to further stimulate cell death, said agent being
selected from the group consisting of drugs which can induce cell
cycle arrest, cytotoxic chemotherapeutic drugs commonly used as
part of a treatment of malignant disease, DNA damaging agents, and
agents which increase cellular sensitivity to DNA damage; in
combination with a suitable pharmaceutical excipient.
7. A method of manufacture of a medicament to reduce cell
proliferation comprising formulating a preparation comprising (a) a
nucleic acid encoding a coupling product between a protein with the
transport function or VP22 and a protein which can regulate cell
cycle progression, and (b) at least one agent to further stimulate
cell death, said agent being selected from the group consisting of
drugs which can induce cell cycle arrest, cytotoxic
chemotherapeutic drugs commonly used as part of a treatment of
malignant disease, DNA damaging agents, and agents which increase
cellular sensitivity to DNA damage, with a suitable pharmaceutical
excipient.
8. A method of reducing cell proliferation comprising exposing said
cells to a preparation comprising: (a) a nucleic acid encoding a
coupling product between a protein with the transport function or
VP22 and a protein which can regulate cell cycle progression; and
(b) at least one agent to further stimulate cell death, said agent
being selected from the group consisting of drugs which can induce
cell cycle arrest, cytotoxic chemotherapeutic drugs commonly used
as part of a treatment of malignant disease, DNA damaging agents,
and agents which increase cellular sensitivity to DNA damage, in
combination with a suitable pharmaceutical excipient, thereby
reducing proliferation of said cells.
9. A method according to claim 1, wherein the polypeptide is
coupled to a plurality of functionally active amino acid
sequences.
10. A method according to claim 1, comprising further (c) exposing
said cells to at least one agent that can prevent export from the
cell of any one of the agents administered in a) and/or b), wherein
said exposure occurs after step a) and/or step b).
11. A method according to claim 10, wherein said agent that can
prevent export from the cell of any one of the agents administered
in a) and/or b) is an Acf protein or an inhibitor of the multi-drug
resistance protein.
12. A method according to claim 11, wherein said agent is an
antisense molecule.
13. The composition of claim 6, further comprising (c) at least one
agent that can prevent export from the cell of any one of the
agents (a) and/or (b).
14. The method of claim 7, wherein the preparation further
comprises (c) at least one agent that can prevent export from the
cell of any one of the agents (a) and/or (b).
15. The method of claim 8, and wherein said preparation further
comprises (c) at least one agent that can prevent export from the
cell of any one of the agents (a) and/or (b).
Description
[0001] This is a continuation of U.S. patent application Ser. No.
09/747,772, filed Dec. 20, 2000, which claims the benefit of Great
Britain Application No. 9930519.5, filed Dec. 24, 1999. Both of the
prior applications are incorporated herein by reference in their
entirety.
FIELD OF THE INVENTION
[0002] This invention relates to uses of transport-active proteins,
particularly of proteins and fusion polypeptides with the function
of VP22, for control of the cell cycle, particularly in the
reduction of the proliferating activity of proliferating cells.
BACKGROUND OF THE INVENTION AND PRIOR ART
[0003] The transport properties of VP22 and homologues thereof are
described in WO 97/05265 (P O'Hare and G Elliott). WO 98/32866 (P
O'Hare et al.) discusses coupled polypeptides and fusion
polypeptides for intracellular transport, and their preparation and
use. Intercellular trafficking and protein delivery by a
herpesvirus structural protein is described in Cell (1997), Vol.
88, pp223-233 (G Elliott and P O'Hare).
[0004] The prior art generally includes a variety of cell cycle
control proteins, especially in the forms of protein and
polynucleotide sequences enabling genetic manipulation by standard
techniques.
[0005] For example, among cell cycle control proteins, protein p53
is known as a tumor suppressor. p53 is a 53 kDa nuclear
phosphoprotein. Wild type and mutant p53 proteins have been
expressed by means of recombinant vaccinia viruses (Ronen et al.,
Nucleic Acids Research, 20, pp 3435-3441, 1992). p53 functions to
regulate cell cycle progression and under conditions of DNA damage
can induce cell cycle arrest or apoptosis through a complex signal
transduction mechanism (Levine A. J. Cell, 88, pp323-331,
1997).
[0006] Other proteins known to promote cell death include the bax
protein, and homologues such as the Bak protein, including its BH3
domain (E P Hollinger et al., 1999, J Biol. Chem., 274 (19), pp
13298-13304).
SUMMARY AND DESCRIPTION OF THE INVENTION
[0007] According to an aspect of the invention there is provided a
method of reducing cell proliferation, for example, a method of
reducing proliferation of hyperproliferating cells, e.g. cancer
cells, comprising the steps of:
[0008] a) exposing said proliferating cells, e.g.
hyperproliferating cells, to a composition comprising at least one
polypeptide comprising an amino acid sequence with the transport
function of herpesviral VP22 protein, said polypeptide being
coupled to at least one or a plurality of functionally active amino
acid sequences, selected from proteins or peptides which can
regulate cell cycle progression, e.g. proteins which can induce
apoptosis, or proteins which can arrest cells from the cell cycle,
for example at the G0 phase of the cell cycle, or functional
analogues thereof; or exposing said cells to therapeutic
compositions comprising nucleic acid encoding said protein(s) or
nucleic acids which can regulate cell cycle progression; and
[0009] b) exposing said cells to at least one agent to further
stimulate cell death, said agent being selected from: drugs which
can induce cell cycle arrest, cytotoxic chemotherapeutic drugs
commonly used as part of a treatment of malignant disease, DNA
damaging agents, agents which increase cellular sensitivity to DNA
damage, and cytotoxic amounts of radiation; and optionally after
step a) and/or step b)
[0010] c) further exposing said cells to at least one agent that
can prevent export from the cell of any one of the agents
administered in a) and/or b), for example, an Acf protein, or an
inhibitor of the multi-drug resistance protein (MDR, also termed
the P glycoprotein), e.g. an antisense molecule.
[0011] Proliferating cells which can be treated by the process of
the invention can be tumor cells, for example tumor cells present
in a tumor cell mass. Alternatively, the proliferating cells can be
non-malignant cells, for example benign tumor cells such as genital
warts, smooth muscle cells, such as vascular smooth muscle cells
present in restenosis, or they can be proliferating skin cells, for
example psoriasis or eczema skin cells, or proliferating cells of
scar tissue.
[0012] Among the VP22 coupled proteins useful in step a) of the
method can be fusion proteins, or if desired they can be chemically
coupled proteins comprising a VP22 protein and a cell cycle
regulatory protein. Nucleic acids useful in step a) of the method
can be nucleic acids encoding VP22 fusion proteins.
[0013] Proteins which can be coupled to VP22 and which can usefully
regulate cell cycle progression according to a method of the
invention include, for example, inhibitors of cyclin-dependent
kinases (CKIs). Suitable such inhibitors include proteins which can
arrest cells at the G1/S or G2/M cell boundaries of the cell cycle,
e.g. proteins p27-kip1, p21-waf1/cip1, p15-ink4b, p16-ink4a,
p57-kip2 and p19-ARF. p27 is described for example by K Polyak et
al. in Cell (1994), 78, pp 59-66, and by J. A. Pietenpol et al. in
Cancer Research (1995), 55 (6), pp 1206-1210.
[0014] Thus an aspect of the invention includes a pharmaceutical
preparation of a coupling product between a protein with the
transport function of VP22 and a protein with the function of
regulating cell cycle progression, e.g. by inducing cell apoptosis
or arresting cells from the cell cycle. A further aspect of the
invention comprises the use of the preparation for contacting
proliferative cells to reduce their proliferative activity.
[0015] Other proteins which can usefully be coupled to VP22
according to further embodiments of the invention and which can
regulate cell cycle progression can be, for example, proteins which
under conditions of DNA damage induce cell apoptosis, e.g. p53, or
proteins which under conditions of DNA damage arrest cell growth,
e.g. a protein product of the GADD gene family, e.g. the product of
GADD45 or GADD153.
[0016] WO 98/32866 (Marie Curie Cancer Care: P 'O Hare et al.)
further describes proteins which can usefully be coupled to VP22,
e.g. p53, and also vectors expressing such coupled
polypeptides.
[0017] Further examples of proteins which can be coupled to VP22
and which can induce cell apoptosis include the following:
cytochrome c, members of the caspase protease family of proteins,
the apoptin protein, the bak protein and also the bax protein, and
any homologues or functional fragments thereof, particularly the
functional 19 amino acid domain of the bak and bax proteins, termed
the BH3 domain, and functional homologues thereof.
[0018] Amounts of VP22 coupled to a cell cycle regulatory protein
(or encoding polynucleotide) which can be usefully administered to
a patient in a method according to the invention range from about
0.001 micrograms per kg (weight of a subject to be treated) to
about 100 milligrams per kg.
[0019] Examples of drugs which can be used to induce cell cycle
arrest in examples of methods of the invention include
flavopiridol, taxol and nocodazole. Doses of taxol which can be
administered in a method of the invention can be for example, about
135 to about 175 milligrams per sq.m. (body area of a subject to be
treated), and can be given as an infusion through an in-line filter
over a time period of hours, e.g. 24 h. Taxol can be used in
combination with cisplatin (cisdiamminedichloroplatinum), which can
be given at a dosage of, e.g. 70-80 mg per sq.m., after
administration of taxol. Combination treatment with taxol followed
by cisplatin is especially useful as part of a therapy for ovarian
carcinoma.
[0020] Chemotherapeutic drugs which can be used to treat
proliferating cells in examples of methods of the invention, can be
for example, doxorubicin, etoposide, phelomycin D, paclitaxel,
curcumin, or camptothecin. Standard dosages of chemotherapeutic
drugs can usefully be given to a patient to be treated. For
example, for doxorubicin dosage is usually calculated on the basis
of body area, and doses which can usefully be administered as part
of the method of the invention are 60-70 mg per sq.m., e.g. 30-40
mg per sq.m., this can be administered as a single dose, by for
example intravenous administration, e.g. every three weeks.
[0021] DNA damaging agents which can be used to treat proliferating
cells in examples of methods of the invention can be for example,
DNA chelating agents, such as cisplatin. This can be given by
infusion over a period of hours, e.g. in doses upwards of 20 mg per
sq.m. (body area of a subject to be treated), e.g. 60-70 mg per
sq.m., e.g. 30-40 mg per sq.m., administered, for example, every
three weeks.
[0022] Agents which can sensitize a cell to DNA damage in examples
of methods of the invention include for example, inhibitors of
proteins which export DNA damaging agents from cells, e.g.
inhibitors of P glycoprotein (MDR protein), e.g. MDR antisense; and
also inhibitors of proteins which are involved in recognition of
DNA damage, e.g. inhibitors of proteins selected from: poly ADP
ribose polymerase (PARP), ataxia-telangiectasia (ATM) and DNA
protein kinase.
[0023] Use of a DNA damaging agent, for example cisplatin, to treat
proliferating cells in examples of methods of the invention is
particularly preferred when said proliferating cells are to be
exposed to VP22 coupled to a protein which under conditions of DNA
damage induces cell apoptosis, for example p53.
[0024] When proliferating cells are exposed to p53 it can also be
particularly useful to further expose the cells to the ARF protein,
which prevents export from the cell and subsequent degradation of
p53, or to a nucleic acid encoding the ARF protein.
[0025] When proliferating cells are exposed to a chemotherapeutic
drug according to an example of a method of the invention it can
also be particularly useful to further expose said cells to an
agent which can prevent export of the chemotherapeutic drug from
the cell, for example, an inhibitor of the multi-drug resistance
protein (MDR), e.g. an antisense molecule of the MDR protein.
[0026] According to an aspect of the invention, the VP22 coupled
polypeptides described herein, or the corresponding encoding
polynucleotides can be delivered to proliferating cells, by for
example, direct injection into target cells, such as a tumor cell
mass, or they can be delivered systemically.
[0027] The compositions can also be formulated using per se known
methods for topical delivery, e.g. to treat psoriasis, eczema or
skin cancer. Alternatively, they can be encapsulated into slow
release capsules suitable for oral delivery using methods known in
the art.
[0028] The VP22 coupled polypeptides or the corresponding encoding
polynucleotides can also be associated with other delivery systems,
for example they can be coupled to liposomes, such as cationic
liposomes, or they can be associated with condensing agents, such
as DNA condensing agents, e.g. hydrophilic polymers, e.g. protamine
sulphate, or e.g. lysine. They can then be delivered by e.g. direct
injection into the target cells, such as tumor cells, or
alternatively they can be delivered systemically, e.g. using a
catheter based approach, or they can be formulated for topical
delivery or oral delivery.
[0029] To enhance delivery to target cells the therapeutic
compositions described herein can also usefully comprise a
targeting molecule, e.g. a tumor targeting molecule, such as
transferrin or folate. The targeting molecule can be, for example,
coupled, e.g. by fusion, to VP22.
[0030] Alternatively, according to a further aspect of the
invention hyperproliferative cells can be exposed to VP22 fusion
polypeptides described herein by introducing an expression vector
encoding said fusion polypeptide into the target population of said
proliferating cells, e.g. by direct injection into the target site.
The expression vector can be for example, a recombinant virus
vector, such as an adenovirus vector, an adeno-associated virus, or
a herpesvirus vector. Particularly useful in this context are
defective herpesvirus vectors such as those described in
specifications: WO 92/05263 (Immunology Ltd: Inglis et al.), WO
96/26267 (Cantab Pharmaceuticals Research Ltd: Inglis et al.) and
WO 96/04395 (Lynxvale Ltd: Speck) and documents cited therein. When
the vector is a herpesvirus it can be useful to deliver from
1.times.10.sup.3 to 1.times.10.sup.8 pfu of virus, e.g. from
1.times.10.sup.4 to 1.times.10.sup.7 pfu. When the vector is an
adenovirus or an adeno-associated virus it can be useful to deliver
from 1.times.10.sup.3 to 1.times.10.sup.13 pfu of virus.
[0031] According to another aspect of the invention the
hyperproliferative cells can be exposed to VP22 coupled
polypeptides described herein by introducing into said cells
aggregated compositions comprising VP22 protein non-covalently
associated with oligonucleotides or polynucleotides. Such
non-covalently associated compositions can be produced by mixing
oligo- or polynucleotides with VP22 protein at preferred ratios,
e.g. of between 2:1 and 1:1 of protein to nucleotide. Oligo- or
polynucleotides suitable for forming part of the aggregates can
preferably comprise at least about 10 bases and in length and can
vary widely in size, they can be about 10 kilobases in size, or
e.g. about 10-100 bases in size, e.g. about 20 bases. The oligo- or
polynucleotide can encode a protein or peptide which it is desired
to introduce into the cell, for example, a cell cycle control
protein. Alternatively, the oligo--or polynucleotide can be
antisense, e.g. antisense to a protein which inhibits apoptosis,
such as the Bcl protein, or the oligo- or polynucleotide can have
the function of correcting splicing defects. The oligo- or
polynucleotides can also usefully be chimeroplasts which can
correct mutations, or they can be molecules which can form triple
helices and function to down-regulate gene expression. The oligo-
or polynucleotides can also be ribozymes which can be used to
inhibit target gene expression, for example they can be the
synthetic hammerhead ribozyme, or functional homologues or
modifications thereof, which can recognize and cleave c-myb RNA,
thereby inhibiting cell proliferation (Jarvis et al., J. Biol.
Chem., 1996, 271, 29107-29112).
[0032] When VP22 coupled polypeptides are delivered to
proliferating cells by introducing into said cells said aggregated
compositions of VP22 protein and oligonucleotides or
polynucleotides, the aggregated composition can optionally further
comprise a photosensitizing molecule, e.g. fluoroscein, rhodamine,
or TRITC, which can be linked to the 5' or 3' end of the synthetic
nucleotide. This can facilitate the dissociation of the aggregate
in the presence of irradiation, e.g. during phototherapy, for
example, as part of a treatment for skin cancer or psoriasis. It
can be especially preferred to use the dye BODIPY-630/650 (from
Molecular Probes, Oregon, USA) as the photosensitizing molecule
during phototherapy since it absorbs light of a higher wavelength,
e.g. about 630 nm and this penetrates body tissues better than
light of lower wavelength. Irradiation can be achieved, for
example, by introducing into a patient to be treated an endoscope
comprising laser optic lines for emitting radiation. Dissociation
of aggregates can also be facilitated in the absence of light by
introduction of a cleavage site, such as a protease site, or a
fusogenic peptide, e.g. the FLU fusion peptide.
[0033] Other examples of useful molecules which can promote
disassociation of aggregates in the presence of irradiation, e.g.
during phototherapy, include phthalocyanine-containing
chromophores, for example aluminum or zinc phthalocyanine. Such
molecules can be administered as part of a composition with the
aggregates, or they can be administered separately not forming part
of the composition, e.g. by direct injection at the same locus as
the aggregates or at a closely neighboring locus. It can be
especially useful to administer aluminum phthalocyanine to promote
disassociation of aggregates when the proliferating cells are tumor
cells, since aluminum phthalocyanine is known to be preferentially
absorbed by tumor cells. Aluminum phthalocyanine can promote
disassociation of aggregates by irradiation with light of a
wavelength of about 675 nm.
[0034] Alternatively, molecules can be used which can promote
disassociation of aggregates in the absence of light, for example
chloroquine and tamoxifen. It can be particularly useful to
administer tamoxifen when the proliferating cells are cancer cells,
e.g. breast cancer cells. The agents can usefully be administered
as part of a composition with the aggregates, or separately not
forming part of the composition, e.g. by direct injection at the
same locus as the aggregates or at a closely neighboring locus
[0035] Hyperproliferative cells can be exposed to an agent
according to step b) or step c) of the method of the invention by
either administration of said agent alone, or alternatively by
introducing said agent coupled to an amino acid sequence with the
transport function of VP22 protein. Where said agent is a
polypeptide or protein it can be useful to deliver the encoding
polynucleotide, e.g. as an aggregated composition. Said agents can
be delivered to target cells using delivery methods previously
described, for example, by systemic delivery, topical delivery, or
by direct injection into said target cells, or alternatively by use
of delivery systems, such as liposomes.
[0036] The therapeutic composition comprising VP22 protein or
encoding nucleic acid can be coupled or fused to more than one
non-VP22 protein or nucleic acid, to form a multivalent
composition.
[0037] Multivalent compositions which can be particularly useful to
induce cell apoptosis are compositions comprising VP22 and bax or
Bak and cytochrome c proteins, or functionally equivalent
homologues or fragments of these proteins, particularly for
example, the functional 19 amino acid domain of the bax protein,
termed the BH3 domain or functional homologues thereof, or encoding
nucleic acids. Also particularly useful are compositions comprising
VP22 and p53 and acf proteins, or functionally equivalent
homologues or fragments of these proteins, or encoding nucleic
acids.
[0038] Other examples of useful multivalent compositions are
compositions comprising VP22 coupled to more than one cell cycle
control protein or encoding nucleic acid, for example, to proteins
which induce apoptosis or which arrest cells from the cell cycle,
e.g. at the G0 stage of the cell cycle, for example by coupling
VP22 to more than one protein or functionally active peptide
fragment or encoding nucleic acid selected from: p27-kip1,
p21-waf1/cip1, p15-ink4b, p16-ink4a, p57-kip2 and p19-ARF, p53,
p18-ink4c. Examples of especially preferred fusions are: a fusion
comprising VP22 protein and p53 and p21-kip1 and/or p19-ARF
proteins, or encoding nucleic acids; and also a fusion comprising
VP22 and p53 and p16-ink4a and/or p27-kip1, or encoding nucleic
acids.
[0039] It can also be useful to couple VP22 to one or more cell
cycle control proteins and additionally to other proteins or
peptides, such as proteins or peptides which can function as cell
targeting molecules, e.g. which interact with receptors on surface
of malignant cells. For example, it can be useful to couple VP22 to
the folate or transferrin protein.
[0040] In another aspect of the invention, said multivalent
compositions can comprise aggregated compositions of non-covalently
associated VP22 protein and oligonucleotides or polynucleotides,
wherein more than one oligo- or polynucleotide is present.
Optionally, VP22 protein can be present in said aggregates as a
coupled or fusion protein, e.g. as a multivalent VP22 fusion
protein.
[0041] A composition which can be usefully administered in step a)
of the method of the invention is a fusion protein comprising VP22
coupled to the BH3 domain of the bak protein, which is a functional
homologue of the BH3 domain from the bax protein (EP Hollinger et
al., 1999, J. Biol. Chem., 274 (19), pp13298-13304) and can be made
as follows:
[0042] The `159-301` VP22 protein which consists of amino acids
159-301 of VP22 can be made in an E. coli pET expression system
from a plasmid expressing amino acids 159-301 of VP22 under control
of an IPTG sensitive promoter. If a his tag is desired for
purification purposes, then it is preferably placed at the C
terminus of the protein.
[0043] A double stranded oligonucleotide with the following
sequence corresponding to BH3 can be made and cloned into the Bam
H1 site of the `159-301` VP22 protein expression plasmid as
mentioned above using techniques known in the art:
1 5' GATCCTATGGGGCAGGTGGGACGGCAGCTCGCCATCATCGGGGAC
GACATCAACCGACGCTATCGG 5' GATCCCGATAGCGTCGGTTGATGTCGTCCCCG-
ATGATGGCGAGCTG CCGTCCCACCTGCCCCATG
[0044] The above strands are complementary such that the sequence
of the first strand from the seventh residue (adenine) in the 5' to
3' direction is complementary with the sequence of the second
strand from the second residue from the end (thymine) in the 3' to
5' direction.
[0045] BL21 E. coli cells can be transformed with this
BH3-`159-301` VP22 protein expression plasmid, and a single colony
transformant used to inoculate 3.2L of a suitable nutrient broth,
such as L nutrient broth (Oxoid) and which also contains
Kanamycin.
[0046] The recombinant bacteria expressing BH3-`159-301` VP22
protein can be induced by addition of IPTG (1 mM) to a logarithmic
phase culture, and the pellets harvested by centrifugation (6000
rpm, 4 degC., 20 min). After pelleting the cells can be resuspended
in 40 ml of cold lysis buffer containing: 50 mM sodium phosphate
(pH 8.0), 300 mM sodium chloride, 5 mM imidazole (pH 8.0), 5 mM
beta-mercaptoethanol, 1 microg/ml of leupeptin, 1 microg/ml
pepstatin and 1 mg/ml lysozyme.
[0047] The lysis mixture is incubated for 30 min with occasional
shaking, and is then sonicated on ice three times for 15 seconds
followed by addition of 0.1 NP-40. Dnase and Rnase are then added
to 10 microg/ml and incubated on ice for 20 min with occasional
shaking. The lysate is then drawn through a narrow gauge syringe
three times. This is followed by centrifugation of the lysate at
20,000 rpm for 15 min at 4 degC. The supernatant containing the
VP22-BH3 fusion protein is retained. The BH3-`159-301` VP22 fusion
protein can be purified as follows:
[0048] The protein can be enriched by ion exchange chromatography
on DEAE sepharose (Pharmacia) by using a batch method, in the
presence of lysis buffer comprising 50 mM sodium phosphate (pH
8.0), 300 mM sodium chloride, 5 mM imidazole (pH 8.0), 5 mM
beta-mercaptoethanol, 0.1% NP-40, and 1 microgram/ml leupeptin and
1 microgram/ml pepstatin.
[0049] The eluate is then further purified on nickel-NTA beads in a
batch method. Protein is bound to the beads at 4 degC. for 1 h. The
beads are then washed three times for 30 mins in wash buffer, which
has the same composition as lysis buffer except that it contains
10% glycerol, 0.1% NP-40, 40 mM imidazole (pH 8.0). Bound protein
is then eluted three times in 1 ml of eluate buffer each time. The
eluate buffer has the same composition as lysis buffer except that
it contains 10% glycerol, 0.1% NP-40, 500 mM imidazole (pH 8.0).
The eluate buffer can then be exchanged by PD-10 sephadex column
chromatography into PBS, 10% glycerol, 5 mM B-mercaptoethanol.
[0050] The BH3-`159-301` VP22 fusion protein can then be used in
the preparation of a sterile pharmaceutical formulation suitable
for administration to a patient and prepared by formulating the
BH3-`159-301`VP22 fusion protein with pharmaceutically acceptable
carrier material. The sterile pharmaceutical formulation can than
be administered to a patient, for example, by direct injection into
a tumor cell mass.
[0051] Alternatively, the BH3-`159-301` VP22 fusion protein can be
stored in PBS at -70 deg C., or it can be lyophilized prior to
storage at -70 deg C., and re-constituted prior to use.
[0052] The BH3-`159-301` VP22 fusion protein obtained by the method
described above can also be used in the formation of aggregated
compositions comprising non-covalently associated BH3-`159-301`
VP22 and oligo or poly-nucleotides. Such a composition can be made
as follows:
[0053] 22.5 microliters of BH3-`159-301` VP22 protein in PBS is
added to 2.5 microliters of PBS and 0.5 microliters of a FITC
labelled 20mer oligonucleotide (which happens to be a conveniently
available base sequence complementary to a segment of mRNA encoding
the intracellular-adhesion molecule, or ICAM) with a sequence as
follows:
[0054] 540 CCC CCA CCA CTT CCC CTC TC 3', and labeled at the 5' end
with FITC.
[0055] The final concentration of BH3-`159-301` VP22 fusion protein
is 18 micrograms per ml and the final concentration of
oligonucleotide is 500 nM. The mixture is then mixed and left at
room temperature for at least 10 minutes. It can then be used in
the preparation of a sterile pharmaceutical formulation suitable
for administration to a patient and prepared by formulating with
pharmaceutically acceptable carrier material. The sterile
pharmaceutical formulation can than be administered to a patient,
for example, by direct injection into a tumor cell mass.
[0056] Prior to, concurrently, or after administration of the
BH3-`159-301` VP22 protein, the patient can also be given an
infusion of an agent to further stimulate cell cycle arrest or cell
apoptosis, for example taxol, e.g. 175 mg per m.sup.2 given through
an in-line filter over a period of 24 h.
[0057] When the BH3-`159-301` VP22 protein is administered as an
aggregated composition as described above it can be particularly
useful to further subject the patient to photodynamic therapy after
administration of the aggregated composition. This can be achieved,
for example, by introducing into a patient an endoscope comprising
laser optic lines for local irradiation, and which emits light in
the range of about 350-850 nm, in the region of the site of
injection of the aggregates.
[0058] A p27-`159-301` VP22 fusion protein can be made in a method
analogous to that described for making a BH3-`159-301` VP22 fusion
protein, except that an oligonucleotide with a sequence
corresponding to the p27 sequence (GenBank Accession Number U10906)
is made and cloned into the Nde I and Bam H1 sites of the `159-301`
VP22 expression plasmid.
[0059] The p27-`159-301` VP22 fusion protein can then be used in
the preparation of a sterile pharmaceutical formulation suitable
for administration to a patient and prepared by formulating the
p27-`159-301` VP22 fusion protein with pharmaceutically acceptable
carrier material. The sterile pharmaceutical formulation can than
be administered to a patient, for example, by direct injection into
a tumor cell mass.
[0060] Alternatively, the p27-`159-301` VP22 fusion protein can be
stored in PBS at -70 deg C., or it can be lyophilized prior to
storage at -70 deg C., and re-constituted prior to use.
[0061] The p27-`159-301` VP22 fusion protein obtained by the method
described above can also be used in the formation of aggregated
compositions comprising non-covalently associated p27-`159-301`
VP22 and oligo or poly-nucleotides. Such a composition can be made
as follows:
[0062] 37 microliters of p27-`159-301` VP22 protein in PBS is added
to 463 microliters of PBS and 5 microliters of a FITC labeled ICAM
20mer oligonucleotide with a sequence as follows:
2 5' CCC CCA CCA CTT CCC CTC TC 3'
[0063] The final concentration of p27-`159-301` VP22 fusion protein
is 185 micrograms per millilitre and the final concentration of
oligonucleotide is 2.5 micromolar. The mixture is then mixed and
left at room temperature for at least 10 minutes. It can then be
used in the preparation of a sterile pharmaceutical formulation
suitable for administration to a patient and prepared by
formulating with pharmaceutically acceptable carrier material. The
sterile pharmaceutical formulation can than be administered to a
patient, for example, by direct injection into a tumor cell
mass.
[0064] Prior to, concurrently, or after administration of the
p27-`159-301` VP22 protein, the patient can also be given an
infusion of, an agent to further stimulate cell cycle arrest or
cell apoptosis, for example taxol, e.g. 175 mg per m.sup.2 given
through an in-line filter over a period of 24 h.
[0065] This example concerns preparation of an aggregated
composition comprising (i) a fragment of VP22, herein designated
VP22 159-301 protein (ii) and an oligonucleotide which is a 36mer
ribozyme as described by Jarvis et al., J. Biol. Chem. 1996, 271,
29107-29112, which can recognize and cleave c-myb and so inhibit
cell proliferation, and which is fluorescein labeled at the 5' end
and has the following sequence and can be obtained from Cruachem,
Glasgow, UK:
3 5' GUUUUCCCUGAU GAGGCCGAAAGGCCGAAAUUCUCC 3',
[0066] all nucleotides are 2'-O-methyl nucleotides with the
exception of the following: U at position U5 (i.e. the fifth U
residue counting from the 5' end of the sequence), G at positions
G2, G3 and G9, A at positions A1 and A8 are 2' hydroxyl
(ribo)nucleotides. The U at position U5 indicates 2'-O-allyl
uridine, the ribozyme described by Jarvis et al. Had a 2'-C-allyl
uridine linkage at this position (this being the only difference
between the ribozyme described here and that of Jarvis et al.).
5-phosphorothioate linkages are present at the 5' and 3' ends,
other linkages are phosphodiester.
[0067] Aggregates can be produced by adding the 36mer
oligonucleotide to the 159-301 protein solution in PBS as
previously described in example 1 so that the final concentrations
in 50 microliters of solution are: 18 micrograms per ml (or
alternatively 32 micrograms per ml) protein and 500 nM
oligonucleotide.
[0068] The formation of the aggregates of the invention can be
monitored by using microscopy e.g. phase contrast or fluorescence
microscopy, or by agarose gel electrophoresis of the
aggregates.
[0069] The aggregated composition produced can then be used as
previously mentioned in the preparation of a sterile pharmaceutical
formulation which can be administered to a patient, for example, by
direct injection into a tumor cell mass.
[0070] The present invention and disclosure extends to the methods
and compositions and the resulting products as described herein,
and to modifications and variations of the steps and features
mentioned in the present description, including all combinations
and subcombinations of the steps and features hereof, including
variations in the order and selection of the steps, and the
documents cited herein are hereby incorporated by reference in
their entirety for all purposes.
Sequence CWU 1
1
5 1 66 DNA synthetic construct 1 gatcctatgg ggcaggtggg acggcagctc
gccatcatcg gggacgacat caaccgacgc 60 tatcgg 66 2 65 DNA synthetic
construct 2 gatcccgata gcgtcggttg atgtcgtccc cgatgatggc gagctgccgt
cccacctgcc 60 ccatg 65 3 20 DNA synthetic construct 3 cccccaccac
ttcccctctc 20 4 20 DNA synthetic construct 4 cccccaccac ttcccctctc
20 5 36 RNA synthetic construct 5 guuuucccug augaggccga aaggccgaaa
uucucc 36
* * * * *