U.S. patent application number 10/769131 was filed with the patent office on 2004-07-22 for novel mammalian catecholamine receptor genes and uses.
This patent application is currently assigned to Oregon Health Sciences University, a non-profit organization. Invention is credited to Bunzow, James R., Grandy, David K..
Application Number | 20040142390 10/769131 |
Document ID | / |
Family ID | 32713832 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040142390 |
Kind Code |
A1 |
Bunzow, James R. ; et
al. |
July 22, 2004 |
Novel mammalian catecholamine receptor genes and uses
Abstract
The present invention relates to novel mammalian catecholamine
receptor proteins and genes that encode such proteins. The
invention is directed toward the isolation and characterization of
mammalian catecholamine receptor proteins. The invention
specifically provides isolated complementary DNA copies of mRNA
corresponding to rat and human homologues of a mammalian
catecholamine receptor gene. Also provided are recombinant
expression constructs capable of expressing the mammalian
catecholamine receptor genes of the invention in cultures of
transformed prokaryotic and eukaryotic cells, as well as such
cultures of transformed cells that synthesize the mammalian
catecholamine receptor proteins encoded therein. The invention also
provides methods for screening compounds in vitro that are capable
of binding to the mammalian catecholamine receptor proteins of the
invention, and further characterizing the binding properties of
such compounds in comparison with known catecholamine receptor
agonists and antagonists. Improved methods of pharmacological
screening are provided thereby.
Inventors: |
Bunzow, James R.; (Portland,
OR) ; Grandy, David K.; (Portland, OR) |
Correspondence
Address: |
Jason J. Derry, Ph.D.
McDonnell Boehnen Hulbert & Berghoff
32nd Floor
300 S. Wacker Drive
Chicago
IL
60606
US
|
Assignee: |
Oregon Health Sciences University,
a non-profit organization
Portland
OR
|
Family ID: |
32713832 |
Appl. No.: |
10/769131 |
Filed: |
January 30, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10769131 |
Jan 30, 2004 |
|
|
|
09659519 |
Sep 12, 2000 |
|
|
|
Current U.S.
Class: |
435/7.2 ;
435/320.1; 435/325; 435/69.1; 530/350; 536/23.2 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 14/723 20130101 |
Class at
Publication: |
435/007.2 ;
435/069.1; 435/320.1; 435/325; 530/350; 536/023.2 |
International
Class: |
G01N 033/53; G01N
033/567; C07H 021/04; C07K 014/705 |
Goverment Interests
[0001] This invention was made with government support under
National Institute of Health grants DA08562. The government has
certain rights to this invention.
Claims
What is claimed is:
1. A homogeneous composition of a mammalian catecholamine receptor
or derivative thereof having a molecular weight of about 39
kilodaltons and an amino acid sequence identified by SEQ ID NO:
2.
2. A homogeneous composition of a mammalian catecholamine receptor
or derivative thereof having a molecular weight of about 38
kilodaltons and an amino acid sequence identified by SEQ ID NO:
4.
3. A cell membrane preparation comprising a mammalian catecholamine
receptor or derivative thereof having a molecular weight of about
39 kilodaltons and an amino acid sequence identified by SEQ ID NO:
2.
4. A cell membrane preparation comprising a mammalian catecholamine
receptor or derivative thereof having a molecular weight of about
38 kilodaltons and an amino acid sequence identified by SEQ ID NO:
4.
5. A recombinant cell comprising a mammalian catecholamine receptor
or derivative thereof having a molecular weight of about 39
kilodaltons and an amino acid sequence identified by SEQ ID NO:
2.
6. A recombinant cell comprising a mammalian catecholamine receptor
or derivative thereof having a molecular weight of about 38
kilodaltons and an amino acid sequence identified by SEQ ID NO:
4.
7. A method of screening a compound for binding to a mammalian
catecholamine receptor in cells expressing the receptor, the method
comprising the steps of: (a) contacting a cell culture or cell
membrane with the compound, wherein the cell culture or cell
membrane comprises a mammalian catecholamine receptor having an
amino acid sequence identified by SEQ ID NO: 2 or SEQ ID NO: 4; and
(b) assaying the cell culture or cell membrane to determine whether
the compound binds to the mammalian catecholamine receptor.
8. The method of claim 7, wherein the cell culture comprises cells
that are transformed with a recombinant expression construct that
comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 2, wherein the cells of the transformed cell culture
express the receptor.
9. The method of claim 7, wherein the cell culture comprises cells
that are transformed with a recombinant expression construct that
comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 4, wherein the cells of the transformed cell culture
express the receptor.
10. A method of claim 7 comprising the additional step of: (c)
comparing binding of the compound with binding of additional
compounds that are known to bind to mammalian catecholamine
receptors, wherein said additional compounds comprise
naturally-occurring and synthetic receptor agonists and
antagonists.
11. A method of screening a compound for competitive binding to a
mammalian catecholamine receptor in cells expressing the receptor,
the method comprising the following steps: (a) contacting a cell
culture or cell membrane with the compound, wherein the cell
culture or cell membrane comprises a mammalian catecholamine
receptor having an amino acid sequence identified by SEQ ID NO: 2
or SEQ ID NO: 4; and (b) assaying the cell culture or cell membrane
in the presence and in the absence of an agonist for the receptor;
and (c) determining whether the compound competes with the agonist
for binding to the receptor.
12. The method of claim 11, wherein the cell culture comprises
cells that are transformed with a recombinant expression construct
that comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 2, wherein the cells of the transformed cell culture
express the receptor.
13. The method of claim 11, wherein the cell culture comprises
cells that are transformed with a recombinant expression construct
that comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 4, wherein the cells of the transformed cell culture
express the receptor.
14. The method of claim 11, wherein the compound is
detectably-labeled.
15. The method of claim 11, wherein the receptor agonist is
detectably-labeled.
16. The method of claim 11, wherein the mammalian catecholamine
receptor competitor is quantitatively characterized by assaying the
transformed cell culture with varying amounts of the competitor in
the presence of a detectably-labeled receptor agonist and measuring
the extent of competition with receptor binding thereby.
17. A method of screening a compound to determine if the compound
is an inhibitor of a mammalian catecholamine receptor in cells
expressing the receptor, the method comprising the following steps:
(a) contacting a cell culture or cell membrane with the compound,
wherein the cell culture or cell membrane comprises a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 2 or SEQ ID NO: 4; and (b) assaying the cell culture or
cell membrane to determine whether the compound is capable of
inhibiting catecholamine receptor binding by a receptor
agonist.
18. The method of claim 17, wherein the cell culture comprises
cells that are transformed with a recombinant expression construct
that comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 2, wherein the cells of the transformed cell culture
express the receptor.
19. The method of claim 17, wherein the cell culture comprises
cells that are transformed with a recombinant expression construct
that comprises a nucleotide sequence that encodes a mammalian
catecholamine receptor having an amino acid sequence identified by
SEQ ID NO: 4, wherein the cells of the transformed cell culture
express the receptor.
20. The method of claim 17, wherein the compound is
detectably-labeled.
21. The method of claim 17, wherein the receptor agonist is
detectably-labeled.
22. The method of claim 17, wherein the catecholamine receptor
inhibitor is quantitatively characterized by assaying the
transformed cell culture with varying amounts of the inhibitor in
the presence of a detectably-labeled catecholamine receptor agonist
and measuring the extent of inhibition of agonist binding thereby.
Description
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to catecholamine receptors from
mammalian species and the genes corresponding to such receptors.
Specifically, the invention relates to the isolation, cloning and
sequencing of complementary DNA (cDNA) copies of messenger RNA
(mRNA) encoding a novel mammalian catecholamine receptor gene. The
invention also relates to the construction of recombinant
expression constructs comprising cDNA of this novel catecholamine
receptor gene, said recombinant expression constructs being capable
of expressing catecholamine receptor protein in cultures of
transformed prokaryotic and eukaryotic cells. Production of the
receptor protein in such cultures is also provided. The invention
relates to the use of such cultures of such transformed cells to
produce homogeneous compositions of the novel catecholamine
receptor protein. The invention also provides cultures of such
cells producing this catecholamine receptor protein for the
characterization of novel and useful drugs. Antibodies against and
epitopes of this novel catecholamine receptor protein are also
provided by the invention.
[0004] 2. Background of the Invention
[0005] Catecholamines are a class of naturally-occurring amino acid
derivatives having a variety of physiological effects in the
peripheral and central nervous systems. The parent compound is
.beta.-phenylethylamine, and the catecholamines are derivatives of
this parent compound. In addition to the naturally-occurring
members of the class (epinephrine, norepinephrine and dopamine), a
large number of synthetic compounds having biological activity have
been developed and have utility as drugs (including albuterol,
isoproterenol, propranolol, phenylephrine, amphetamine and
methamphetamine). In the periphery, catecholamines are released by
the sympathetic nervous system and adrenal medulla and are involved
in integrating physiological responses to stress, while in the
central nervous system the catecholamines constitute some of the
most important neurotransmitter systems.
[0006] The effect of catecholamines are mediated through their
receptors and their associated cell signaling systems (reviewed in
Hoffman & Lefkowitz, 1982, Ann. Rev. Physiol. 44: 475-484;
Civelli et al., 1993, Ann. Rev. Pharm. & Tox. 33: 281-307).
These receptors are located in the plasma membrane of
catecholamine-sensitive cells. Structurally, they are characterized
by having a pattern of seven transmembrane domains (see, for
example, U.S. Pat. Nos. 5,422,265, 5,569,601, 5,594,108, 5,883,226,
5,880,260, 5,427,942 and 5,686,573). Functionally, certain of these
receptors interact with adenylate cyclase, either stimulating or
inhibiting the production of cyclic AMP thereby. These receptors
include the adrenergic receptors (the a-1, a-2, b-1, b-2, and b-3
adrenergic receptors) and the dopamine receptors (the D.sub.1-,
D.sub.2-, D.sub.3-, D4-, and D.sub.5- dopamine receptors).
[0007] For example, epinephrine (adrenaline) and norepinephrine, as
well as synthetic agonists of these catecholamines which mimic
their biological functions, and antagonists which block these
biological functions, exert their effects by binding to specific
recognition sites (membrane receptors) situated on the cell
membranes in the peripheral nervous system, Two principal classes
of adrenergic receptors have been defined, the alpha-adrenergic
receptors and the beta-adrenergic receptors. Five subtypes of
adrenergic receptors ( a-1, a-2, b-1, b-2, and b-3 adrenergic
receptors) have now been distinguished. The genes encoding these
receptors have been isolated and identified (Cotecchia et al.,
1988, Proc. Natl. Acad. Sci. USA 85: 7159-7163; Kobilka et al.,
1987, Science 238: 650-656; Frielle et al., 1987, Proc. Natl. Acad
Sci. USA 84: 7920-7924; Emorine et al., 1987, Proc. Natl. Acad.
Sci. USA 84: 6995-6999; Emorine et al., 1989, Science 245:
1118-1121). Analysis of these genes has made it possible to
recognize that they belong to a family of integral membrane
receptors exhibiting some homology (Dixon et al., 1998, Annual
Reports in Medicinal Chemistry, 221-223; Emorine et al., 1988,
Proc. NATO Adv. Res. Workshop), especially at portions of the seven
transmembrane regions that are coupled to regulatory proteins,
called G proteins, capable of binding molecules of guanosine
triphosphate (GTP).
[0008] These membrane receptors, after they have bound the
appropriate ligand (agonist or antagonist), are understood to
undergo a conformational change that induces an intracellular
signal that modifies the behavior of the target cell.
Beta-adrenergic receptors catalyze the activation of a class of G
proteins which in turn stimulates the activity of adenylate cyclase
when they bind with catecholamine agonists, whereas
alpha-adrenergic receptor antagonists act in competition with the
agonists for the binding to the receptor and prevent the activation
of adenylate cyclase. When adenylate cyclase is activated, it
catalyses the production of an intracellular mediator or second
messenger, especially cyclic AMP.
[0009] In the central nervous system, dopamine is a catecholamine
neurotransmitter modulates neuronal cells involved in movement
initiation, appetitive behavior, hormone release, and visual dark
adaptation. In the periphery dopamine plays a role in modulating
blood pressure and renal function (see generally Cooper et al.,
1978, THE BIOCHEMICAL BASIS OF NEUROPHARMACOLOGY, 3d ed., Oxford
University Press, New York, pp, 161-195). The diverse physiological
actions of dopamine are in turn mediated by its interaction with a
family of distinct dopamine receptors subtypes that are either
"D1-like" or "D2-like," which respectively stimulate and inhibit
the enzyme adenylate cyclase (Kebabian & Calne, 1979, Nature
277: 93-96). Alterations in the number or activity of these
receptors may be a contributory factor in disease states such as
Parkinson's disease (a movement disorder) and schizophrenia (a
behavioral disorder) and attention deficit hyperactivity disorder
(ADHD).
[0010] A great deal of information has accumulated regarding the
biochemistry of the D1 and D2 dopamine receptors, and methods have
been developed to solubilize and purify these receptor proteins
(see Senogles et al., 1986, Biochemistry 25: 749-753; Sengoles et
al., 1988, J. Biol. Chem. 263: 18996-19002; Gingrich et al., 1988,
Biochemistry 27: 3907-3912). The D1 dopamine receptor in several
tissues appears to be a glycosylated membrane protein of about 72
kD (Amlaiky et al., 1987, Mol. Pharmacol. 31: 129-134; Ninzik et
al., 1988, Biochemistry 27: 7594-7599). The D2 receptor can also be
glycosylated and has been suggested to have a higher molecular
weight of about 90-150 kD (Amlaiky & Caron, 1985, J. Biol.
Chem. 260: 1983-1986; Amlaiky & Caron, 1986, J. Neurochem. 47:
196-204; Jarvie et al., 1988, Mol. Pharmacol. 34: 91-97).
[0011] Dopamine receptors are primary targets in the clinical
treatment of psycho-motor disorders such as Parkinson's disease and
affective disorders such as schizophrenia (Seeman et al., 1987,
Neuropsychopharm. 1: 5-15; Seeman, 1987, Synapse 1: 152-333). Five
different dopamine receptor genes (D1, D2, D3, D4 and D5) and
various splice variants of their transcripts have been cloned as a
result of nucleotide sequence homology which exists between these
receptor genes (Bunzow et al. 1988, Nature 336: 783-787; Grandy et
al., 1989, Proc. Natl. Acad. Sci. USA 86: 9762-9766; Dal Toso et
al., 1989, EMBO J. 8: 4025-4034; Zhou et al., 1990, Nature 346:
76-80; Sunahara et al., 1990, Nature 346: 80-83; Sokoloff et al.,
1990, Nature 347: 146-151; Civelli et al., 1993, Annu. Rev.
Pharmacol. Toxicol. 33: 281-307; Van Tol et al., 1991, Nature 350:
610-4).
[0012] Catecholamine receptors are also targets for a host of
therapeutic agents for the treatment of shock, hypertension,
arrhythmias, asthma, migraine headache, and anaphylactic reactions,
and include antipsychotic drugs that are use to treat schizophrenia
and .beta.-blockers used to control high blood pressure.
[0013] The importance of catecholamine receptors, particularly in
the brain and central nervous system, has created the need for the
isolation of additional catecholamine receptors for the development
of therapeutic agents for the treatment of disorders, including
disorders of the CNS and most preferably treatment of disorders on
mental health such as psychosis, in which catecholamines and their
receptors have been implicated. There is also a need for developing
new tools that will permit identification of new drug lead
compounds for developing novel drugs. This is of particular
importance for psychoactive and psychotropic drugs, due to their
physiological importance and their potential to greatly benefit
human patients treated with such drugs. At present, few such
economical systems exist. Conventional screening methods require
the use of animal brain slices in binding assays as a first step.
This is suboptimal for a number of reasons, including interference
in the binding assay by non-specific binding of heterologous (i.e.,
non-receptor) cell surface proteins expressed by brain cells in
such slices; differential binding by cells other than neuronal
cells present in the brain slice, such as glial cells or blood
cells; and the possibility that putative drug binding behavior in
animal brain cells will differ from the binding behavior in human
brain cells in subtle but critical ways. The ability to synthesize
human catecholamine receptor molecules in vitro would provide an
efficient and economical means for rational drug design and rapid
screening of potentially useful compounds. For these and other
reasons, development of in vitro screening methods for psychotropic
drugs has numerous advantages and is a major research goal in the
pharmaceutical industry.
SUMMARY OF THE INVENTION
[0014] The present invention relates to the cloning, expression and
functional characterization of a mammalian catecholamine receptor
gene. The invention comprises nucleic acids having a nucleotide
sequence of a novel mammalian catecholamine receptor gene. The
nucleic acids provided by the invention comprise a complementary
DNA (cDNA) copy of the corresponding mRNA transcribed in vivo from
the catecholamine receptor genes of the invention. In one preferred
embodiment, the mammalian catecholamine receptor is a human
catecholamine receptor. In another preferred embodiment, the
mammalian catecholamine receptor is a rat (Rattus norvegicus)
catecholamine receptor. Also provided are the deduced amino acid
sequence of the cognate proteins of the cDNAs provided by the
invention, methods of making said cognate proteins by expressing
the cDNAs in cells transformed with recombinant expression
constructs comprising said cDNAs, and said recombinant expression
constructs and cells transformed thereby.
[0015] This invention in a first aspect provides nucleic acids,
nucleic acid hybridization probes, recombinant eukaryotic
expression constructs capable of expressing the catecholamine
receptors of the invention in cultures of transformed cells, and
such cultures of transformed eukaryotic cells that synthesize the
catecholamine receptors of the invention. In another aspect, the
invention provides homogeneous compositions of the catecholamine
receptor proteins of the invention, and membrane preparations from
cells expressing the catecholamine receptor proteins of the
invention, as well as antibodies against and epitopes of the
catecholamine receptor proteins of the invention. The invention in
another aspect provides methods for making said homogenous
preparations and membrane preparations using cells transformed with
the recombinant expression constructs of the invention and
expressing said catecholamine receptor proteins thereby. Methods
for characterizing the receptor and biochemical properties of these
receptor proteins and methods for using these proteins in the
development of agents having pharmacological uses related to these
receptors are also provided by the invention.
[0016] In a first aspect, the invention provides a nucleic acid
having a nucleotide sequence encoding a mammalian catecholamine
receptor. In a first preferred embodiment, the nucleic acid encodes
a human catecholamine receptor. In this embodiment of the
invention, the nucleotide sequence comprises 1125 nucleotides of
human catecholamine receptor cDNA comprising 1040 nucleotides of
coding sequence, 20 nucleotides of 5' untranslated sequence and 85
nucleotides of 3' untranslated sequence. In this embodiment of the
invention, the nucleotide sequence of the catecholamine receptor is
the nucleotide sequence depicted in FIG. 1 (SEQ ID No:1). The
sequence shown in FIG. 1 will be understood to represent one
specific embodiment of a multiplicity of nucleotide sequences that
encode the human catecholamine receptor amino acid sequence (SEQ ID
No.: 2) of the invention and that these different nucleotide
sequences are functionally equivalent and are intended to be
encompassed by the claimed invention. In addition, it will be
understood that different organisms and cells derived therefrom
express preferentially certain tRNAs corresponding to subsets of
the degenerate collection of tRNAs capable of encoding certain of
the naturally-occurring amino acids, and that embodiments of the
multiplicity of nucleotide sequences encoding the amino acid
sequence of the human, catecholamine receptor protein of the
invention that are optimized for expression in specific prokaryotic
and eukaryotic cells are also encompassed by the claimed invention.
Isolated nucleic acid derived from human genomic DNA and isolated
by conventional methods using the human cDNA provided by the
invention is also within the scope of the claimed invention.
Finally, it will be understood that allelic variations of the human
catecholamine receptor, including naturally occurring and in vitro
modifications thereof are within the scope of this invention. Each
such variant will be understood to have essentially the same amino
acid sequence as the sequence of the human catecholamine receptor
disclosed herein.
[0017] In a second preferred embodiment of this aspect of the
invention, the nucleic acid encodes the rat catecholamine receptor.
In this embodiment of the invention, the nucleotide sequence
includes 999 nucleotides of the rat catecholamine receptor cDNA
comprising the coding sequence. In this embodiment of the
invention, the nucleotide sequence of the catecholamine receptor is
the nucleotide sequence depicted in FIG. 2 (SEQ ID No:3). The
sequence shown in FIG. 2 will be understood to represent one
specific embodiment of a multiplicity of nucleotide sequences that
encode the rat catecholamine receptor amino acid sequence (SEQ ID
No.: 4) of the invention and that these different nucleotide
sequences are functionally equivalent and are intended to be
encompassed by the claimed invention. In addition, it will be
understood that different organisms and cells derived therefrom
express preferentially certain tRNAs corresponding to subsets of
the degenerate collection of tRNAs capable of encoding certain of
the naturally-occurring amino acids, and that embodiments of the
multiplicity of nucleotide sequences encoding the amino acid
sequence of the rat catecholamine receptor protein of the invention
that are optimized for expression in specific prokaryotic and
eukaryotic cells are also encompassed by the claimed invention.
Isolated nucleic acid derived from rat genomic DNA and isolated by
conventional methods using the rat cDNA provided by the invention
is also within the scope of the claimed invention. Finally, it will
be understood that allelic variations of the rat catecholamine
receptor, including naturally occurring and in vitro modifications
thereof are within the scope of this invention. Each such variant
will be understood to have essentially the same amino acid sequence
as the sequence of the human catecholamine receptor disclosed
herein.
[0018] Mammalian catecholamine receptor proteins corresponding to
the human and rat cDNAs of the invention are a second aspect of the
claimed invention. In a first embodiment, the mammalian
catecholamine receptor protein is a human catecholamine receptor
having a deduced amino acid sequence shown in FIG. 1 (SEQ ID
No.:2). In a second embodiment is provided said human catecholamine
receptor protein comprising a membrane preparation from a cell,
most preferably a recombinant cell, expressing a nucleic acid
encoding a human catecholamine of the invention. In a third
embodiment, the mammalian catecholamine receptor protein is a rat
catecholamine receptor having a deduced amino acid sequence shown
in FIG. 2 (SEQ ID No.:4). In a fourth embodiment is provided said
rat catecholamine receptor protein comprising a membrane
preparation from a cell, most preferably a recombinant cell,
expressing a nucleic acid encoding a rat catecholamine of the
invention.
[0019] As provided in this aspect of the invention is a homogeneous
composition of a mammalian catecholamine receptor having a
molecular weight of about 39 kD or derivative thereof that is a
human catecholamine receptor having an amino acid sequence shown in
FIG. 1 and identified by SEQ ID No.:2, said size being understood
to be the predicted size of the protein before any
post-translational modifications thereof. Also provided is a
homogeneous composition of a mammalian catecholamine receptor
having a molecular weight of about 38 kD or derivative thereof that
is a rat catecholarnine receptor having an amino acid sequence
shown in FIG. 2 and identified by SEQ ID No.:4, said size being
understood to be the predicted size of the protein before any
post-translational modifications thereof.
[0020] This invention provides both nucleotide and among acid
probes derived from the sequences herein provided. The invention
includes probes isolated from either cDNA or genomic DNA, as well
as probes made synthetically with the sequence information derived
therefrom. The invention specifically includes but is not limited
to oligonucleotide, nick-translated, random primed, or in vitro
amplified probes made using cDNA or genomic clone of the invention
encoding a mammalian catecholamine receptor or fragment thereof,
and oligonucleotide and other synthetic probes synthesized
chemically using the nucleotide sequence information of cDNA or
genomic clone embodiments of the invention.
[0021] It is a further object of this invention to provide such
nucleic acid hybridization probes to determine the pattern, amount
and extent of expression of the catecholamine receptor gene in
various tissues of mammals, including humans. It is also an object
of the present invention to provide nucleic acid hybridization
probes derived from the sequences of mammalian catecholamine
receptor genes of the invention to be used for the detection and
diagnosis of genetic diseases. It is an object of this invention to
provide nucleic acid hybridization probes derived from the nucleic
acid sequences of the mammalian catecholamine receptor genes herein
disclosed to be used for the detection of novel related receptor
genes.
[0022] The present invention also includes synthetic peptides made
using the nucleotide sequence information comprising the cDNA
embodiments of the invention. The invention includes either
naturally occurring or synthetic peptides which may be used as
antigens for the production of catecholamine receptor-specific
antibodies, or useful as competitors of catecholamine receptor
molecules for agonist, antagonist or drug binding, or to be used
for the production of inhibitors of the binding of agonists or
antagonists or analogues thereof to such catecholamine receptor
molecules.
[0023] The present invention also provides antibodies against and
epitopes of the mammalian catecholamine receptor molecules of the
invention. It is an object of the present invention to provide
antibodies that are immunologically reactive to the catecholamine
receptors of the invention. It is a particular object to provide
monoclonal antibodies against these catecholamine receptors.
Hybridoma cell lines producing such antibodies are also objects of
the invention. It is envisioned at such hybridoma cell lines may be
produced as the result of fusion between a non-immunoglobulin
producing mouse myeloma cell line and spleen cells derived from a
mouse immunized with a cell line which expresses antigens or
epitopes of a mammalian catecholamine receptor of the invention.
The present invention also provides hybridoma cell lines that
produce such antibodies, and can be injected into a living mouse to
provide an ascites fluid from the mouse that is comprised of such
antibodies. It is a further object of the invention to provide
immunologically-active epitopes of the mammalian catecholamine
receptor proteins of the invention. Chimeric antibodies
immunologically reactive against the catecholamine receptor
proteins of the invention are also within the scope of this
invention.
[0024] The present invention provides recombinant expression
constructs comprising a nucleic acid encoding a mammalian
catecholamine receptor of the invention wherein the construct is
capable of expressing the encoded catecholamine receptor in
cultures of cells transformed with the construct. A preferred
embodiment of such constructs comprises a human catecholamine
receptor cDNA depicted in FIG. 1 (SEQ ID No.:1), such constructs
being capable of expressing the human catecholamine receptor
encoded therein in cells transformed with the construct. Another
preferred embodiment of such constructs comprises a rat
catecholamine receptor cDNA depicted in FIG. 2 (SEQ ID No.:3), such
constructs being capable of expressing the human catecholamine
receptor encoded therein in cells transformed with the
construct.
[0025] The invention also provides prokaryotic and more preferably
eukaryotic cells transformed with the recombinant expression
constructs of the invention, each such cells being capable of and
indeed expressing the mammalian catecholamine receptor encoded in
the transforming construct, as well as methods for preparing
mammalian catecholamine receptor proteins using said transformed
cells.
[0026] The present invention also includes within its scope protein
preparations of prokaryotic and eukaryotic cell membranes
containing the catecholamine receptor protein of the invention,
derived from cultures of prokaryotic or eukaryotic cells,
respectively, transformed with the recombinant expression
constructs of the invention.
[0027] The invention also provides methods for screening compounds
for their ability to inhibit, facilitate or modulate the
biochemical activity of the mammalian catecholamine receptor
molecules of the invention, for use in the in vitro screening of
novel agonist and antagonist compounds. In preferred embodiments,
cells transformed with a recombinant expression construct of the
invention are contacted with such a compound, and the binding
capacity of the compounds, as well as the effect of the compound on
binding of other, known catecholamine receptor agonists and
antagonists, is assayed. Additional preferred embodiments comprise
quantitative analyses of such effects.
[0028] The present invention is also useful for the detection of
analogues, agonists or antagonists, known or unknown, of the
mammalian catecholamine receptors of the invention, either
naturally occurring or embodied as a drug. In preferred
embodiments, such analogues, agonists or antagonists may be
detected in blood, saliva, semen, cerebrospinal fluid, plasma,
lymph, or any other bodily fluid.
[0029] Specific preferred embodiments of the present invention will
become evident from the following more detailed description of
certain preferred embodiments and the claims.
DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 illustrates the nucleotide (SEQ ID No.:1) and amino
acid (SEQ ID No.:2) sequences of a human catecholamine
receptor.
[0031] FIG. 2 illustrates the nucleotide (SEQ ID No.:3) and amino
acid (SEQ ID No.:4) sequences of a rat catecholamine receptor.
[0032] FIG. 3 presents an amino acid sequence comparison between
the human catecholamine receptor protein of the invention and human
D1 dopamine receptor, human D2 dopamine receptor, rat serotonin 1c
receptor, rat a.sub.1-b adrenergic receptor, rat serotonin 4
receptor, rat serotonin 1a receptor, human a.sub.2-adrenergic
receptor, and human H-2 histamine receptor in the putative
transmembrane regions.
[0033] FIG. 4 is a photograph of an autoradiogram of Northern
analysis of total cellular RNA (20 .mu.g/lane) from human HEK293
cells expressing the human catecholamine receptor of the invention
after transformation with a recombinant expression construct.
[0034] FIG. 5A is a photograph of an ethidium bromide-stained and
ultraviolet light irradiated agarose gel containing DNA fragments
produced by RT-PCR of RNA from rat brain tissues. The PCR products
resolved on this gel are from the following rat brain regions, from
which cDNA was synthesized from oligo(dT)-primed total RNA: lane 1,
pituitary gland; lane 2, hindbrain; lane 3, midbrain; lane 4, locus
coeruleus; lane 5, hypothalamus; lane 6, striatum; lane 7,
olfactory bulb; lane 8, olfactory tubercle; lane 9, hippocampus;
lane 10, cortex; lane 11, cerebellum; lane 12, thalamus; lane 13,
1:100 dilution of human catecholamine plasmid DNA.
[0035] FIG. 5B is an autoradiogram of a nylon membrane containing
DNA fragments transferred from the agarose gel shown in FIG. 5A and
probed with .sup.32P-labeled nucleic acid prepared from the coding
sequence of the rat genomic clone encoding the rat catecholamine
receptor of the invention.
[0036] FIG. 6 is a photograph of an autoradiogram of Northern
analysis of RNA from various rat cell lines expressing the rat
catecholamine receptor of the invention after transfection with a
recombinant expression construct encoding the rat catecholamine
receptor. RNA shown in this gel was obtained from the following
cell lines: lane 1, LBP; lane 2, baby hamster kidney (BHK) cells;
lane 3, rat insulinoma (RIN5) cells; lane 4, AR42J rat pancreatic
tumor cell line; lane 5, CHW cells; lane 6, GH4 rat pituitary
cells; lane 7, GH3 rat pituitary cells; lane 8, AtT20 rat pituitary
cells; lane 9, PC 12 rat adrenal gland cells; lane 10, SK-N-MC
human neuroblastoma cells; lane 11, N4TG1 rat neuroblastoma cells;
lane 12, NB4 cells; lane 13, LCS cells; lane 14, R2C rat Ledig
cells.
[0037] FIG. 7 is a photograph of an autoradiogram of Northern
analysis of mRNA expressed in various cell lines expressing a
mammalian catecholamine receptor of the invention after
transfection with a recombinant expression construct encoding the
rat catecholamine receptor.
[0038] FIG. 8A is a photograph of an ethidium bromide-stained and
ultraviolet light irradiated agarose gel containing DNA fragments
produced by RT-PCR of RNA from rat tissues. The PCR products
resolved on this gel are from the following rat tissues: lane 1,
liver (oligo(dT) primed); lane 2, brain (dT); lane 3, spleen (dT);
lane 4, lung (dT); lane 5, heart (dT); lane 6, testis (dT); lane 7,
kidney (dT); lane 8, intestine (dT); lane 9, COS-7 cell
oligo(dT)-selected mRNA from cells transformed with the RC-RSV/rat
catecholamine receptor construct of the invention; lane 10,
striatum (dT); lane 11, midbrain (random primed; rp); lane 12,
olfactory tubercle (rp); lane 13, cortex (rp+dT); lane 14, midbrain
(dT); lane 15, olfactory tubercle (rp); lane 16, olfactory bulb
(dT); lane 17, hippocampus (dT); lane 18, midbrain (dT); lane 19,
thalamus (dT); lane 20, striatum (dT); lane 21, olfactory bulb
(dT); lane 22, water (negative control).
[0039] FIG. 8B is an autoradiogram of a nylon membrane containing
DNA fragments transferred from the agarose gel shown in FIG. 8A and
probed with .sup.32P-labeled nucleic acid prepared from the
full-length rat genomic clone encoding the rat catecholamine
receptor of the invention.
[0040] FIGS. 9A through 9D are photographs of fluorescence in situ
hybridization analysis of human chromosomes probed with a
fluorescently-labeled human artificial chromosome (BAC) containing
the human catecholamine receptor DNA (BAC obtained from Research
Genetics, Release IV of DNA pools, Catalog #96001; clone address:
plate 278, Row D, Column 22). FIG. 9E is a schematic diagram of
human chromosome 6 denoting the location of the human catecholamine
locus at 6q23.2.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0041] The term "mammalian catecholamine receptor" as used herein
refers to proteins consisting essentially of, and having
substantially the same biological activity as, the protein encoded
by the amino acid depicted in FIG. 1 (SEQ ID No.:2) and FIG. 2 (SEQ
ID No.: 4). This definition is intended to encompass natural
allelic variations in the disclosed catecholamine receptor. Cloned
nucleic acid provided by the present invention may encode
catecholamine receptor protein of any species of origin, including,
for example, mouse, rat, rabbit, cat, and human, but preferably the
nucleic acid provided by the invention encodes catecholamine
receptors of mammalian, most preferably rat and human, origin.
[0042] The nucleic acids provided by the invention comprise DNA or
RNA having a nucleotide sequence encoding a mammalian catecholamine
receptor. Specific embodiments of said nucleic acids are depicted
in FIG. 1 (SEQ ID No.:1) or FIG. 2 (SEQ ID No.: 3), and include any
nucleotide sequence encoding a mammalian catecholamine receptor
having an amino acid sequence as depicted in FIG. 1 (SEQ ID No.: 2)
or FIG. 2 (SEQ ID No.: 4). Nucleic hybridization probes as provided
by the invention comprise any portion of a nucleic acid of the
invention effective in nucleic acid hybridization under stringency
conditions sufficient for specific hybridization. Mixtures of such
nucleic acid hybridization probes are also within the scope of this
embodiment of the invention. Nucleic acid probes as provided herein
are useful for isolating mammalian species analogues of the
specific embodiments of the nucleic acids provided by the
invention. Nucleic acid probes as provided herein are also useful
for detecting mammalian catecholamine receptor gene expression in
cells and tissues using techniques well-known in the art, including
but not limited to Northern blot hybridization, in situ
hybridization and Southern hybridization to reverse
transcriptase-polymerase chain reaction product DNAs. The probes
provided by the present invention, including oligonucleotides
probes derived therefrom, are also useful for Southern
hybridization of mammalian, preferably human, genomic DNA for
screening for restriction fragment length polymorphism (RFLP)
associated with certain genetic disorders.
[0043] The production of proteins such as mammalian catecholamine
receptors from cloned genes by genetic engineering means is well
known in this art. The discussion which follows is accordingly
intended as an overview of this field, and is not intended to
reflect the full state of the art.
[0044] Nucleic acid encoding a catecholamine receptor may be
obtained, in view of the instant disclosure, by chemical synthesis,
by screening reverse transcripts of mRNA from appropriate cells or
cell line cultures, by screening genomic libraries from appropriate
cells, or by combinations of these procedures, in accordance with
known procedures as illustrated below. Screening of mRNA or genomic
DNA may be carried out with oligonucleotide probes generated from
the nucleic acid sequence information from mammalian catecholamine
receptor nucleic acid as disclosed herein. Probes may be labeled
with a detectable group such as a fluorescent group, a radioactive
atom or a chemiluminescent group in accordance with know procedures
and used in conventional hybridization assays, as described in
greater detail in the Examples below. In the alternative, mammalian
catecholamine receptor nucleic acid sequences may be obtained by
use of the polymerase chain reaction (PCR) procedure, using PCR
oligonucleotide primers corresponding to nucleic acid sequence
information derived from a catecholamine receptor as provided
herein. See U.S. Pat. No. 4,683,195 to Mullis et al. and U.S. Pat.
No. 4,683,202 to Mullis.
[0045] Mammalian catecholamine receptor protein may be synthesized
in host cells transformed with a recombinant expression construct
comprising a nucleic acid encoding the catecholamine receptor
nucleic acid, comprising genomic DNA or cDNA. Such recombinant
expression constructs can also be comprised of a vector that is a
replicable DNA construct. Vectors are used herein either to amplify
DNA encoding a catecholamine receptor and/or to express DNA
encoding a catecholamine receptor gene. For the purposes of this
invention, a recombinant expression construct is a replicable DNA
construct in which a nucleic acid encoding a catecholamine receptor
is operably linked to suitable control sequences capable of
effecting the expression of the catecholamine receptor in a
suitable host.
[0046] The need for such control sequences will vary depending upon
the host selected and the transformation method chosen. Generally,
control sequences include a transcriptional promoter, an optional
operator or enhancer sequence to control transcription, a sequence
encoding suitable mRNA ribosomal binding sites, and sequences which
control the termination of transcription and translation.
Amplification vectors do not require expression control domains.
All that is needed is the ability to replicate in a host, usually
conferred by an origin of replication, and a selection gene to
facilitate recognition of transformants. See, Sambrook et al.,
1990, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Press: New York).
[0047] Vectors useful for practicing the present invention include
plasmids, viruses (including phage and mammalian DNA and RNA
viruses), retroviruses, and integratable DNA fragments (i.e.,
fragments integratable into the host genome by homologous
recombination). The vector can replicate the gene of interest and
function independently of the host genome, or can, in some
instances, integrate into the genome itself. Suitable vectors will
contain replicon and control sequences which are derived from
species compatible with the intended expression host. A preferred
vector is RcRSV (obtained from Invitrogen, San Diego, Calif.).
Transformed host cells are cells which have been transformed or
transfected with recombinant expression constructs made using
recombinant DNA techniques and comprising nucleic acid encoding a
catecholamine receptor protein. Preferred host cells are HEK293
cells, COS-7 cells (Gluzman, 1981, Cell 23: 175-182) and Ltk.sup.-
cells. Transformed host cells may express the catecholamine
receptor protein, but host cells transformed for purposes of
cloning or amplifying nucleic acid hybridization probe DNA need not
express the receptor. When expressed, the catecholamine receptor of
the invention will typically be located in the host cell membrane.
Accordingly, the invention provides preparations of said cell
membranes comprising the catecholamine receptor protein of the
invention, as well as purified, homogeneous preparations of the
receptor protein itself. See, Sambrook et al., ibid.
[0048] Cultures of cells derived from multicellular organisms are a
desirable host for recombinant catecholamine receptor protein
synthesis. In principal, any higher eukaryotic cell culture is
useful, whether from vertebrate or invertebrate culture. However,
mammalian cells are preferred, as illustrated in the Examples.
Propagation of such cells in cell culture has become a routine
procedure. See Tissue Culture, Academic Press, Kruse &
Patterson, editors (1973). Examples of useful host cell lines are
human embryonic kidney (HEK) 293 cells, VERO and HeLa cells,
Chinese hamster ovary (CHO) cell lines, mouse Ltk.sup.- cell lines
and WI138, BHK, COS-7, CV, and MDCK cell lines. HEK293 cell, COS-7
cells and Ltk.sup.- cells are preferred.
[0049] The invention provides homogeneous compositions of mammalian
catecholamine receptor protein produced by transformed eukaryotic
cells as provided herein. Each such homogeneous composition is
intended to be comprised of a catecholamine receptor protein that
comprises at least 75%, more preferably at least 80%, and most
preferably at least 90% of the protein in such a homogenous
composition; in said homogeneous preparations, individual
contaminating protein species are expected to comprise less than
5%, more preferably less than 2% and most preferably less than 1%
of the preparation. The invention also provides membrane
preparations from cells expressing mammalian catecholamine receptor
protein as the result of transformation with a recombinant
expression construct, as described herein.
[0050] Mammalian catecholamine receptor proteins made from cloned
genes in accordance with the present invention may be used for
screening catecholamine analogues, or catecholamine receptor
agonists or antagonists of catecholamine binding, or for
determining the amount of such agonists or antagonists are present
in a solution of interest (e.g., blood plasma, cerebrospinal fluid
or serum). For example, host cells may be transformed with a
recombinant expression construct of the present invention, a
mammalian catecholamine receptor expressed in those host cells, and
the cells or membranes thereof used to screen compounds for their
effect on catecholamine receptor agonist binding activity. By
selection of host cells that do not ordinarily express a
catecholamine receptor, pure preparations of membranes containing
the receptor can be obtained.
[0051] The recombinant expression constructs of the present
invention are useful in molecular biology to transform cells which
do not ordinarily express a catecholamine receptor to thereafter
express this receptor. Such cells are useful as intermediates for
making cell membrane preparations useful for receptor binding
activity assays, which are in turn useful for drug screening. The
recombinant expression constructs of the present invention thus
provide a method for screening potentially useful drugs at
advantageously lower cost than conventional animal screening
protocols. While not completely eliminating the need for ultimate
in vivo activity and toxicology assays, the constructs and cultures
of the invention provide an important first screening step for the
vast number of potentially useful drugs synthesized, discovered or
extracted from natural sources each year.
[0052] The recombinant expression constructs of the present
invention are useful in molecular biology to detect, isolate,
characterize and identify novel endogenous catecholamine receptor
agonists and antagonists found in plasma, serum, lymph,
cerebrospinal fluid, seminal fluid, or other potential sources of
such compounds. This utility thereby enables rational drug design
of novel therapeutically-active drugs using currently-available
techniques (see Walters, "Computer-Assisted Modeling of Drugs", in
Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology,
Interpharm Press:Buffalo Grove, Ill., pp. 165-174).
[0053] The recombinant expression constructs of the present
invention may also be useful in gene therapy. Cloned genes of the
present invention, or fragments thereof, may also be used in gene
therapy carried out homologous recombination or site-directed
mutagenesis. See generally Thomas & Capecchi, 1987, Cell 51:
503-512; Bertling, 1987, Bioscience Reports 7: 107-112; Smithies et
al., 1985, Nature 317: 230-234.
[0054] Nucleic acid and oligonucleotide probes as provided by the
present invention are useful as diagnostic tools for probing
catecholamine receptor gene expression in tissues of humans and
other animals. For example, tissues are probed in situ with
oligonucleotide probes carrying detectable groups by conventional
autoradiographic or other detection techniques, to investigate
native expression of this receptor or pathological conditions
relating thereto. Further, chromosomes can be probed to investigate
the presence or absence of the corresponding catecholamine receptor
gene, and potential pathological conditions related thereto.
[0055] The invention also provides antibodies that are
immunologically reactive to the catecholamine receptor protein or
epitopes thereof provided by the invention. The antibodies provided
by the invention may be raised, using methods well known in the
art, in animals by inoculation with cells that express a
catecholamine receptor or epitopes thereof, cell membranes from
such cells, whether crude membrane preparations or membranes
purified using methods well known in the art, or purified
preparations of proteins, including fusion proteins, particularly
fusion proteins comprising epitopes of the catecholamine receptor
protein of the invention fused to heterologous proteins and
expressed using genetic engineering means in bacterial, yeast or
eukaryotic cells, said proteins being isolated from such cells to
varying degrees of homogeneity using conventional biochemical
methods. Synthetic peptides made using established synthetic
methods in vitro and optionally conjugated with heterologous
sequences of amino acids, are also encompassed in these methods to
produce the antibodies of the invention. Animals that are useful
for such inoculations include individuals from species comprising
cows, sheep, pigs, mice, rats, rabbits, hamsters, goats and
primates. Preferred animals for inoculation are rodents (including
mice, rats, hamsters) and rabbits. The most preferred animal is the
mouse.
[0056] Cells that can be used for such inoculations, or for any of
the other means used in the invention, include any cell line which
naturally expresses the catecholamine receptor provided by the
invention, or more preferably any cell or cell line that expresses
the catecholamine receptor of the invention, or any epitope
thereof, as a result of molecular or genetic engineering, or that
has been treated to increase the expression of an endogenous or
heterologous catecholamine receptor protein by physical,
biochemical or genetic means. Preferred cells are mammalian cells,
most preferably cells syngeneic with a rodent, most preferably a
mouse host, that have been transformed with a recombinant
expression construct of the invention encoding a catecholamine
receptor protein, and that express the receptor therefrom.
[0057] The present invention also provides monoclonal antibodies
that are immunologically reactive with an epitope derived from a
catecholamine receptor of the invention, or fragment thereof,
present on the surface of such cells. Such antibodies are made
using methods and techniques well known to those of skill in the
art. Monoclonal antibodies provided by the present invention are
produced by hybridoma cell lines, that are also provided by the
invention and that are made by methods well known in the art.
[0058] Hybridoma cell lines are made by fusing individual cells of
a myeloma cell line with spleen cells derived from animals
immunized with cells expressing a catecholamine receptor of the
invention, as described above. The myeloma cell lines used in the
invention include lines derived from myelomas of mice, rats,
hamsters, primates and humans. Preferred myeloma cell lines are
from mouse, and the most preferred mouse myeloma cell line is
P3X63-Ag8.653. The animals from whom spleens are obtained after
immunization are rats, mice and hamsters, preferably mice, most
preferably Balb/c mice. Spleen cells and myeloma cells are fused
using a number of methods well known in the art, including but not
limited to incubation with inactivated Sendai virus and incubation
in the presence of polyethylene glycol (PEG). The most preferred
method for cell fusion is incubation in the presence of a solution
of 45% (w/v) PEG-1450. Monoclonal antibodies produced by hybridoma
cell lines can be harvested from cell culture supernatant fluids
from in vitro cell growth; alternatively, hybridoma cells can be
injected subcutaneously and/or into the peritoneal cavity of an
animal, most preferably a mouse, and the monoclonal antibodies
obtained from blood and/or ascites fluid.
[0059] Monoclonal antibodies provided by the present invention are
also produced by recombinant genetic methods well known to those of
skill in the art, and the present invention encompasses antibodies
made by such methods that are immunologically reactive with an
epitope of an amino acid receptor of the invention. The present
invention also encompasses fragments, including but not limited to
F(ab) and F(ab)'.sub.2 fragments, of such antibody. Fragments are
produced by any number of methods, including but not limited to
proteolytic or chemical cleavage, chemical synthesis or preparation
of such fragments by means of genetic engineering technology. The
present invention also encompasses single-chain antibodies that are
immunologically reactive with an epitope of a catecholamine
receptor, made by methods known to those of skill in the art.
[0060] The present invention also encompasses an epitope of a
catecholamine receptor of the invention, comprised of sequences
and/or a conformation of sequences present in the receptor
molecule. This epitope may be naturally occurring, or may be the
result of chemical or proteolytic cleavage of a receptor molecule
and isolation of an epitope-containing peptide or may be obtained
by chemical or in vitro synthesis of an epitope-containing peptide
using methods well known to those skilled in the art. The present
invention also encompasses epitope peptides produced as a result of
genetic engineering technology and synthesized by genetically
engineered prokaryotic or eukaryotic cells.
[0061] The invention also includes chimeric antibodies, comprised
of light chain and heavy chain peptides immunologically reactive to
a catecholamine receptor-derived epitope. The chimeric antibodies
embodied in the present invention include those that are derived
from naturally occurring antibodies as well as chimeric antibodies
made by means of genetic engineering technology well known to those
of skill in the art.
[0062] The Examples which follow are illustrative of specific
embodiments of the invention, and various uses thereof. They set
forth for explanatory purposes only, and are not to be taken as
limiting the invention.
EXAMPLE 1
Isolation of a Mammalian Catecholamine Receptor Probe by Random PCR
Amplification of Rat Insulinoma cDNA Using Degenerate
Oligonucleotide Primers
[0063] In order to clone novel mammalian G-protein coupled
receptors, cDNA prepared from total cellular RNA obtained from a
rat pancreatic tumor cell line (AR42J (ATCC Accession No. CRL-1492)
was used as template for a polymerase chain reaction (PCR)-based
random cloning experiment. PCR was performed using a pair of
degenerate oligonucleotide primers corresponding to a consensus
sequence of the third and sixth transmembrane regions of known
G-coupled receptors. PCR products obtained in this experiment were
characterized by nucleotide sequencing. A full length clone was
obtained by screening a rat genomic library using a cloned PCR
product encoding a novel G-protein coupled receptor as deduced by
nucleotide sequencing and comparison with a sequence database
(GenBank).
[0064] The PCR amplification experiments were performed as follows.
Total RNA was isolated from AR42J cells by the guanidinium
thiocyanate method (Chirgwin et al., 1979, Biochemistry 18:
5294-5299). First-strand cDNA was prepared from this RNA using
standard techniques (see Sambrook et al., 1990, Molecular Cloning:
A laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor
Laboratory, N.Y.) using murine reverse transcriptase (BRL,
Gaithersburg, Md.) and oligo-dT priming (Sambrook et al., ibid.).
The rat cDNA preparation was then subjected to 35 cycles of PCR
amplification using 500 picomoles of degenerate oligonucleotide
primers having the following sequence:
[0065] Primer III (sense):
1
GAGTCGACCTGTG(C/T)G(C/T)(C/G)AT(C/T)(A/G)CIIT(G/T)GAC(C/A)G(C/G)T-
AC (SEQ ID NO:5)
[0066] and
[0067] Primer VI (antisense):
2 CAGAATTCAG(T/A)AGGGCAICCAGCAGAI(G/C)(G/A)(T/C)GAA (SEQ ID
NO:6)
[0068] in 30 .mu.L of a solution containing 50 mM Tris-HCl (pH
8.3), 2.5 mM MgCl.sub.2, 0.01% gelatin, 250 .mu.M each dNTP, and
2.5 units of Taq polymerase (Saiki et al., 1988, Science 239:
487-491). Each PCR amplification cycle consisted of incubations at
94.degree. C. for 90 sec (denaturation), 50.degree. C. for 90 sec
(annealing), and 72.degree. C. for 120 sec (extension) for 35
cycles.
[0069] Amplified products of the PCR reaction were separated on a
1.0% agarose gel (see Sambrook et al., ibid.), and fragments
ranging in size from 400 basepairs (bps) to 750 bp were subcloned
in the plasmid vector pBluescript (Stratagene, LaJolla, Calif.).
Plasmid DNA from these clones was purified and the nucleotide
sequence of the insert cDNA determined by the dideoxynucleotide
chain termination method (Sanger et al., 1977, Proc. Natl. Acad.
Sci. USA 74: 5463-5467) using Sequenase.RTM. (U.S. Biochemical
Corp., Cleveland, Ohio). PCR products were identified by screening
the GenBank database and identified a cloned fragment having a high
degree of homology to known catecholamine receptors, as well as
containing sequence motifs that are common to the G-protein coupled
family of receptors, but that was not identical to any
previously-identified catecholamine receptor sequence.
EXAMPLE 2
Isolation of a Novel Mammalian Catecholamine Receptor cDNA
[0070] The cloned PCR product obtained in Example 1 was used to
isolate a full-length clone from a rat genomic DNA library
(obtained from Clonetech, Palo Alto, Calif.) as follows.
[0071] The 0.4 kb DNA fragment generated by PCR which has high
homology to the known catecholamine receptors was .sup.32P-labeled
using the random priming technique (Stratagene, San Diego Calif.).
This probe was used to screen a rat genomic library which had been
transferred to nylon membranes (Gene Screen Plus, NEN, Boston
Mass.). Hybridization was performed in 50% formamide, 5.times.SSC,
1% SDS, 5.times. Denhardt' solution, and salmon sperm DNA (50
.mu.g/mL) with the radioactive probe at 2.times.10.sup.6 cpm/mL at
37.degree. C. for overnight. The nylon filters were then washed as
follows: at room temperature in a solution of 2.times.SSC/0.1% SDS
for 10 minutes, followed by a wash at 55.degree. C. in a solution
of 2.times.SSC/0.1% SDS for 15 minutes, and finally a wash at
55.degree. C. in a solution of 0.5.times.SSC/0.1% SDS for 5
minutes. Filters were then exposed to XOMAT X-ray film (Kodak)
overnight. Filter hybridization was performed in duplicate to
confirm positive signals. Secondary and tertiary screens were
performed until single homogenous clones were isolated.
[0072] This isolated genomic clone was then subjected to nucleotide
sequence analysis. Nucleotide sequence analysis performed
essentially as described in Example 1, and revealed the sequence of
the rat catecholamine receptor shown in FIG. 2 (SEQ ID No.: 3). The
putative protein product of the gene is also shown in FIG. 2 (SEQ
ID No:4). The sequence was found to have an open reading frame
comprising 996 nucleotides encoding a protein 332 amino acids in
length, and having a predicted molecular weight of about 38 kD
kilodaltons prior to post-translational modification. The sequence
immediately 5' to the proposed initiation codon was found to
contain several translation termination codons in-frame with the
open reading frame, supporting the assignment of the translation
start site. Predicted transmembrane domains (using the algorithm of
Eisenberg et al. (1984, J. Molec. Biol. 179: 125-142)) are boxed
and identified by Roman numerals (I-VII), and two sites of possible
N-linked glycosylation are identified in the amino-terminal portion
of the protein with solid triangles. Surprisingly, no potential
protein phosphorylation sites were found in predicted cytoplasmic
loops, unlike other known G-protein coupled receptors. On the basis
of this analysis, this cloned nucleic acid was determined to be a
novel mammalian catecholamine receptor.
[0073] Comparison of the amino acid sequence of the novel receptor
with the amino acid sequences of other known mammalian
catecholamine receptors supported this conclusion. The predicted
amino acid sequences of the transmembrane domains of the novel
catecholamine receptor were compared with the corresponding
sequences in human D1 dopamine receptor, human D2 dopamine
receptor, rat serotonin 1c receptor, rat a1-b adrenergic receptor,
rat serotonin 4 receptor, rat serotonin 1a receptor, human a-2
adrenergic receptor, and human H-2 histamine receptor; the results
of these comparisons are shown in FIG. 3 (Probst et al., 1992, DNA
Cell Biology 11: 1-20). Overbars indicate predicted transmembrane
regions I through VII in the protein product of the genes. Amino
acid residues that are found in common between the different
mammalian catecholamine receptors are presented in boldface.
[0074] A more detailed comparison of these amino acid sequences are
quantified in Table I, showing the percentage extent of homology in
pairwise fashion between the different catecholamine receptors.
3 TABLE I Receptor % Identity human D1 dopamine 40 human D2
dopamine 37 rat a1-b adrenergic 37 rat serotonin 1c 35 rat a1
adrenergic 35 rat serotonin 4 35 rat serotonin 1a 34 human a2
adrenergic 33 human H-2 histamine 33
[0075] Comparisons are made individually at each transmembrane
domain (TMI-TMVII), as an average over all transmembrane domains
(TM avg) and as the average degree of amino acid sequence homology
for each protein as a whole (avg/all). These result support the
conclusion that the novel mammalian receptor disclosed herein is a
catecholamine receptor. In addition, the certain amino acid
residues in other G-protein coupled receptors (such as Asp.sup.103
in TM III) were also found in the novel cloned receptor described
herein. These data are consistent with the fact that the
catecholamine receptors have a significantly higher homology to the
novel receptor disclosed herein than any other members of the
G-protein coupled receptor family. The sequence DRY (amino acids
120-123 in the human sequence and amino acids 119-122 in the rat
sequence) is conserved in the majority of G-protein coupled
receptors. Expression of this receptor in a rat insulinoma suggests
that catecholamines may play a role in pancreatic cell
function.
EXAMPLE 3
Construction of a Recombinant Expression Constructs, DNA
Transfection and Functional Expression of the Novel Mammalian
Catecholamine Receptor
[0076] In order to biochemically characterize the novel mammalian
(rat) catecholamine receptor described in Example 2, and to confirm
that it encodes a novel catecholamine receptor, the rat cDNA was
cloned into a mammalian expression construct (pRcRSVneo, obtained
from Invitrogen, San Diego, Calif.), the resulting recombinant
expression construct transfected into COS-7 cells (for transient
expression assays) and human embryonic kidney cells (HEK293) for
stable expression assays, and cell membranes (COS-7) or cell lines
(HEK293) were generated that expressed the receptor protein in
cellular membranes at the cell surface. Such cells and membranes
isolated from such cells were used for biochemical characterization
experiments described below.
[0077] The entire coding region of the receptor DNA insert was
amplified using PCR as described above with primers specific for
flanking sequences; such PCR primers advantageously contained
restriction enzyme digestion recognition sites at the 5' termini
such that digestion with said restriction enzymes allowed facile
cloning of the receptor cDNA into the RcRSV neo mammalian
expression construct. PCR products generated in this way were
subcloned in to the RcRSV vector using conventional techniques (see
Sambrook et al., ibid.) and the orientation of the inserted cDNA
confirmed by restriction enzyme digestion analysis of
insert-containing subclones. Such recombinant expression constructs
were introduced into COS-7 cells using the calcium-phosphate
precipitation technique (Chen & Okayama, 1987, Molec. Cell.
Biol. 7: 2745-2752), the transfected cells allowed to express the
receptor for between 24-96 hours, and then cell membranes
containing the receptor were isolated. Such membranes were
harvested from cells grown on 15 cm plates by pelleting the cells
at 20,000 rpm in a solution of 50 mM Tris-HCl (pH 7.4). The protein
concentration was adjusted to 15-80 .mu.g/sample for each of the
binding studies described below.
[0078] These recombinant expression constructs were also introduced
into HEK293 cells using the calcium-phosphate precipitation
technique, and stably-transfected clones were selected by growth in
the mammalian neomycin analog G418 (Grand Island Biological Co.,
Long Island, N.Y.), as the vector RcRSV contains a functional copy
of a bacterial neomycin resistance gene. Stable cell lines were
then selected for membrane binding studies based on mRNA expression
levels of individual neomycin-resistant transfected clones
determined by Northern analysis (see Sambrook et al., ibid.). Cell
membranes were prepared and used as described above for COS-7 cell
transfectants.
[0079] Expression of the catecholamine receptor gene in transfected
cells was verified by Northern blot analysis of individual
transfectants, performed using conventional techniques. Total
cellular was extracted from transfected cells using and RNA Easy
kit (obtained from Qiagen, Valencia, Calif.). For Northern
hybridization, 10 .mu.g of total cellular RNA was subjected to
electrophoresis in a 1.2% agarose gel using HEPES/EDTA buffer (pH
7.8) overnight. The electrophoresed RNA was then transferred to a
GeneScreen Plus membrane (New England Nuclear, Boston, Mass.) by
capillary transfer, and fixed to the membrane by baking at
85.degree. C. for 1 h. The membrane was then prehybridized
overnight at 37.degree. C. in the following buffer: 50% formamide,
1% sodium dodecyl sulfate (SDS), 5.times.SSC (where 1.times.SSC is
0.15M NaCl/0.015M sodium citrate, pH 7), 50 .mu.g/mL denatured
salmon sperm DNA, and 5.times.P-buffer (comprising 0.25M Tris, pH
7.5, 0.5% sodium pyrophosphate, 0.5% SDS, 1% bovine serum albumin,
1% polyvinylpyrrolidone and 1% Ficoll (400,000 MW)). After
prehybridization, .sup.32P-labeled DNA prepared from the
full-length genomic receptor clone described above was added at a
concentration of 3.times.10.sup.6 cpm/mL and the membrane
hybridized overnight at 37.degree. C. The hybridized membrane was
then washed using the following high-stringency washing conditions:
10 min at room temperature in a wash solution of 2.times.SSC/1%
SDS; 10 min at 60.degree. C. in 2.times.SSC/ 1% SDS; and finally 5
min at 60.degree. C. in 0.5.times.SC/1% SDS, where the washing
solutions were changed between each washing step. The washed
membrane was then exposed overnight to X-ray film (X-omat, Kodak,
Rochester, N.Y.).
[0080] The results of these experiments are shown in FIG. 4. As
shown in the photograph, the transfected catecholamine receptor is
expressed in transfected HEK293 cells.
[0081] Specific binding assays using a variety of catecholamine
receptor agonists and antagonists were performed on membranes from
both transient and stable transfectants. Ligand binding experiments
were performed essentially as described in Bunzow et al. (1988,
Nature 336: 783-787). In binding experiments, increasing amounts of
membrane protein (from 15-80 .mu.g) was incubated with each of the
radioactively-labeled catecholamine agonist or antagonist to be
tested for 120 min at 22.degree. C. in a total volume of 1 mL.
EXAMPLE 4
Distribution of Catecholamine Receptor Expression in Mammalian Cell
Lines, Rat Brain and Peripheral Tissues
[0082] The distribution of mRNA corresponding to expression of the
catecholamine receptor gene in various regions of the rat brain was
determined by reverse transcription/polymerase chain reaction
(RT-PCR) performed as follows. Total RNA from various rat brain
sections was isolated using the RNA Easy kit (Qiagen) described in
Example 3 and converted to single-stranded cDNA using reverse
transcriptase (BRL, Gaithersburg, Md.) primed by oligo dT or random
primers or a combination of both these primers. PCR was then
performed using the 5' sense primer (TCT CTG AGT GAT GCA TCT TTG;
SEQ ID No. 7) corresponding to the 5' extent of the receptor coding
sequence and either an antisense primer (AGC AGT GCT CAA CTG TTC
TCA CCA TGC; SEQ ID No.: 8) having its 3' end at nucleotide residue
243 of the SEQ ID No. 3 (resulting in a PCR product of about 250 bp
in length) or an antisense primer (GCA CGA TTA ATT GAC CTC GCT TG;
SEQ ID No.: 9) having its 3' end at nucleotide residue 650 of the
SEQ ID No. 3 (resulting in a PCR product of about 650 bp in
length). Using either primer pair, PCR was performed for 35 cycles,
wherein one cycle consisted of incubations at 94.degree. C. for 90
sec (denaturation), 55.degree. C. for 90 sec (annealing), and
72.degree. C. for 120 sec (extension).
[0083] The resulting fragments were resolved from 30 .mu.L reaction
mixture using 1% agarose gel electrophoresis and visualized by
ethidium bromide staining and UV illumination. The fragments were
then transferred onto a nylon membrane (GeneScreen Plus, NEN) by
capillary transfer and hybridized under high stringency conditions
as described above with a .sup.32P-labeled probe prepared from the
full-length rat genomic clone encoding the novel catecholamine
receptor of the invention as described herein. Hybridized fragments
were detected using a phosphoimager (Molecular Devices, Mountain
View, Calif.).
[0084] The results of these experiments are shown in FIGS. 5A and
5B. FIG. 5A shows a photograph of an ethidium bromide stained 1%
agarose gel viewed under ultraviolet light illumination. PCR
product (10 .mu.L of a 30 .mu.L reaction mixture) was
electrophoresed as described above, and bands specific for the
predicted fragments of the rat catecholamine receptor of the
invention (250 or 650 bp) were detected. FIG. 5B shows the results
of the hybridization assay, which results in greater sensitivity of
detection of PCR-amplified fragments. These results indicated that
the catecholamine receptor was expressed strongly in midbrain and
olfactory tubercle, less strongly in the olfactory bulb, moderately
in the striatum and weakly in the hypothalamus.
[0085] Northern analysis of total RNA was performed as described in
Example 2 above to detect catecholamine receptor expression in
various established mammalian cell lines. These results are shown
in FIG. 6. Expression of the catecholamine receptor gene of the
invention was detected only in rat insulinoma cell line RIN5, while
the AR42J cell line from which the cloned cDNA was obtained did not
show a signal in this experiment, indicating it was present only at
low levels and could not be detected in a Northern blot prepared
from total cellular RNA (i.e., not having been enriched for
mRNA,for example, by selection with oligo(dT)).
[0086] The results of RT-PCR analysis performed on mRNA obtained
from various rat tissues as described above are shown in FIG. 8A,
and hybridization analysis of these results is shown in FIG. 8B to
increase detection of PCR-amplified fragments. These results
indicated the following pattern of catecholamine receptor
expression in these tissues:
olfactory tubercle>intestine.gtoreq.midbrain, cortex,
spleen>heart, kidney
[0087] The receptor was also expressed at detectable levels in
lung, transfected COS cells, and olfactory bulb. These results are
consistent with known patterns of catecholamine receptor expression
in olfactory tubercle and midbrain.
EXAMPLE 5
Cloning the Human Catecholamine Receptor Gene
[0088] The novel mammalian catecholamine receptor cDNA obtained in
Example 2 was used to isolate a partial genomic clone from a
library of human genomic DNA cloned in lambda EMBL3 (obtained from
Clontech, Palo Alto, Calif.) as follows. The full-length rat
receptor cDNA (.about.1 kb in length) was .sup.32P-labeled by the
random priming technique a kit obtained from Stratagene (San Diego,
Calif.) according to the manufacturer's instructions. This probe
was then used to screen the human genomic library which had been
plated and then transferred to nylon membranes (Gene Screen Plus,
NEN, Boston, Mass.). Hybridization was performed in a solution of
50% formamide, 5.times.SSC, 1% SDS, 5.times. Denhardt solution, and
salmon sperm DNA (50 micrograms/mL) with the radioactive probe at
2.times.10.sup.6 cpm/mL and at a temperature of 37.degree. C.
overnight. The nylon filters were then washed at room temperature
in a solution of 2.times.SSC/0.1% SDS for 10 minutes, followed by a
wash at 55.degree. C. in a solution of 2.times.SSC/0.1% SDS for 15
minutes, and finally awash at 55.degree. C. in a solution of
0.5.times.SSC/0.1% SDS for 5 minutes. Filters were then exposed to
XOMAT X-ray film (Kodak) overnight at -80.degree. C. Filter
hybridization was performed in duplicate to confirm positive
signals. Secondary and tertiary screens were performed until single
homogenous clones were identified.
[0089] Individual genomic clones were then isolated and the
nucleotide sequence determined. The nucleotide sequence analysis,
performed essentially as described in Example 1, revealed that the
longest insert contained a partial N-terminal sequence of the human
homologue of the rat catecholamine receptor. Based on this
information a set of oligonucleotide primers were synthesized
having the following sequence:
[0090] Primer VII (sense):
4 5' TTGACAGCCCTCAGGAATGATG 3' (SEQ. ID: NO:10)
[0091] and
[0092] Primer VIII (antisense):
5 5' ATGGAAAATGGAGGCTGAGCTCAG 3' (SEQ. ID NO:11)
[0093] These primers were then used to identify a bacterial
artificial chromosome (BAC) clone encoding the entire human
catecholamine receptor gene. Pools of BAC DNA obtained from
Research Genetics (Release IV, Catalogue #96011) were subjected to
PCR in a 30 micoliter solution that contained primers VII and VIII
in addition to 50 mM Tris-HCl (pH 8.3), 2.5 mM MgCl.sub.2, 0.01%
gelatin, 250 .mu.M each dNTP, and 2.5 units of Taq polymerase
(Saiki et al., 1988, Science 239: 487-491). Each PCR amplification
cycle consisted of incubations at 94.degree. C. for 90 sec
(denaturation), 50.degree. C. for 90 sec (annealing), and
72.degree. C. for 120 sec (extension) for 35 cycles.
[0094] Amplified products of the PCR reaction were separated on a
1.0% agarose gel (see Sambrook et al., ibid.). Fragments of the
expected size (630 bp) were subcloned into the plasmid vector
pBluescript (Stratagene, LaJolla, Calif.) and sequence analysis of
the inserts confirmed that the BAC contained the human
catecholamine receptor gene of interest. To obtain the complete DNA
sequence of the novel human catecholamine receptor gene sense
oligonucleotide primers were designed based on the sequence
information obtained from the BAC and EMBL3 clones. The resulting
sequence information was then used in the design of additional
primers. This process was repeated until the end of the coding
region was reached.
[0095] Consistent with its rat homologue the novel human
catecholamine receptor is encoded by a single coding exon. The
sequence of the human receptor is presented in FIG. 1.
Interestingly, the open reading frame of the human homologue of the
catecholamine receptor gene is 21 bases longer than the rat (1017
vs 996, respectively) which translates into a human receptor that
is 339 amino acids long compared to a receptor of 332 amino acids
in the rat (shown in FIG. 2). A comparison between the primary
amino acid sequences of the human and rat receptors is presented in
FIG. 3.
EXAMPLE 6
Chromosomal Mapping of the Genomic Locus of the Human Catecholamine
Receptor Gene
[0096] The chromosomal locus of the human catecholamine receptor
gene of the invention was mapped by fluorescence in situ
hybridization as follows.
[0097] BAC DNA encoding the human catecholamine receptor described
in Example 5 was nick-translated using digoxigenin-11-UTP for use
as a probe for in situ chromosomal mapping to localize the gene.
This fluorescently labeled DNA was hybridized in situ to denatured
human metaphase chromosomes for 16 hours. Signal was detected in
the presence of DAPI (4,6-diamidino-2phenylindole) counter staining
and the chromosome was identified by sequential G-banding. The
hybridization signal appeared to be consistent with a chromosomal
location on the distal long arm of chromosome 6. By alignment of
the hybridized metaphases with an ideogram of chromosome 6 (at the
400 band stage), the human catecholamine receptor gene was assigned
to the locus 6q23.
[0098] The results of these experiments are shown in FIGS. 9A
through 9D, and a schematic representation of these results is
shown in FIG. 9E. As can be seen in these Figures, the human
catecholamine receptor gene corresponding to the cDNA provided by
the invention was mapped to human chromosome 6, specifically at
6q23.2.
EXAMPLE7
Detection of MAP Kinase Pathway Stimulation by the Human
Catecholamine Receptor Gene
[0099] It has been determined that G-protein coupled receptors are
capable of stimulating the MAP (microtubule-associated protein)
kinase assay in mammalian cells. The recognition of this role of
G-protein coupled receptors has facilitated the development of an
assay for testing the response of G-protein coupled receptors to
potential ligands in vitro, thereby simplifying characterization of
said receptors.
[0100] In this assay, activation of the pathway by ligand binding
to receptor results in increased phosphorylation of mammalian
transcription factor Elk by the MK kinase. The phosphorylated Elk
transcription factor then binds to promoters containing
cis-sequences responsive to this transcription factor.
Transcription factor binding results in increase transcription of
sequences operatively linked and under the transcriptional control
of such Elk-responsive promoters. Most advantageously, reporter
genes, such as .beta.-galactosidase or firefly luciferase are
operatively linked to such Elk-responsive promoters, thereby
permitting ligand binding to a receptor to be linked with
expression of the reporter gene.
[0101] HEK293 cells were transfected with the full-length human
clone encoding the catecholamine receptor of the invention
contained in the pcDNA 3.1 expression vector (Invitrogen), wherein
the first 22 nucleotides of the 5' untranslated region is followed
by an initiation codon (ATG, Met), followed by nucleotides encoding
an 8-amino acid FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; SEQ
ID No.: 12), followed by a nucleotide sequence encoding the 21
amino acids of the human D2 receptor (as disclosed in co-owned U.S.
Pat. No. 5,880,260, issued Mar. 9, 1999, incorporated by reference
in its entirety herein) that follow the Met initiation codon in the
native D2 sequence, which is followed by the complete sequence of
the human catecholamine receptor; this construct was termed
H2-3pcDNA3.1.
[0102] Control cells were transfected with pcDNA3.1 without the rat
catecholamine receptor sequences. All cells were also
co-transfected with 2 additional constructs: one (elk-gal) that
encoded the yeast transcription factor gal under the
transcriptional control of an Elk-responsive promoter; and another
encoding firefly luciferase under the transcriptional control of a
gal-responsive promoter. In cells containing the rat
catecholamine-encoding construct, ligand binding to the receptor
expressed thereby activated the map kinase (MK) pathway, which
results in phosphorylation of the endogenous Elk transcription
factor. In its phosphorylated state, Elk interacts with the elk DNA
binding site and leads to activation of transcription of the gal
gene contained in the elk-gal plasmid. In turn, transcription of
the luciferase gene is activated in the co-transfected luciferase
construct. Luciferase transcription was quantified using a
luminometer, and gave an indirect measure of MK activation by each
ligand. The results of these experiments as shown in Table II,
showing the fold stimulation for each potential ligand compared
with cells incubated in the absence of the ligand.
6 TABLE II Ligand H2-3 pcDNA3.1 pcDNA3.1 Dopamine 1.21 1.04
Serotonin 1.22 1 Norepinephrine 1.69 1.3 Clonidine.sup.1 1.47 1.07
SKF82958.sup.2 2.52 0.79 ADTN67.sup.3 1.93 0.78 Quinpirole.sup.3
2.14 0.6 .sup.1.alpha..sub.2-adrenergic and imidazoline receptor
agonist .sup.2D1 dopamine receptor agonist .sup.3a-2 adrenergic
receptor agonist
[0103] These results indicate that the cloned rat genomic DNA
disclosed herein encodes a receptor that is specifically activated
by drugs that target certain catecholamine receptors. However, the
profile for this activation does not correspond to that for any of
the known catecholamine receptors, indicating that this is a novel,
brain-specific, catecholamine-binding receptor having a unique
pharmacology useful thereby as a therapeutic target.
[0104] It should be understood that the foregoing disclosure
emphasizes certain specific embodiments of the invention and that
all modifications or alternatives equivalent thereto are within the
spirit and scope of the invention as set forth in the appended
claims.
Sequence CWU 1
1
12 1 1125 DNA Homo Sapiens CDS (21)..(1037) 1 ctaattgaca gccctcagga
atg atg ccc ttt tgc cac aat ata att aat att 53 Met Met Pro Phe Cys
His Asn Ile Ile Asn Ile 1 5 10 tcc tgt gtg aaa aac aac tgg tca aat
gat gtc cgt gct tcc ctg tac 101 Ser Cys Val Lys Asn Asn Trp Ser Asn
Asp Val Arg Ala Ser Leu Tyr 15 20 25 agt tta atg gtg ctc ata att
ctg acc aca ctc gtt ggc aat ctg ata 149 Ser Leu Met Val Leu Ile Ile
Leu Thr Thr Leu Val Gly Asn Leu Ile 30 35 40 gtt att gtt tct ata
tca cac ttc aaa caa ctt cat acc cca aca aat 197 Val Ile Val Ser Ile
Ser His Phe Lys Gln Leu His Thr Pro Thr Asn 45 50 55 tgg ctc att
cat tcc atg gcc act gtg gac ttt ctt ctg ggg tgt ctg 245 Trp Leu Ile
His Ser Met Ala Thr Val Asp Phe Leu Leu Gly Cys Leu 60 65 70 75 gtc
atg cct tac agt atg gtg aga tct gct gag cac tgt tgg tat ttt 293 Val
Met Pro Tyr Ser Met Val Arg Ser Ala Glu His Cys Trp Tyr Phe 80 85
90 gga gaa gtc ttc tgt aaa att cac aca agc acc gac att atg ctg agc
341 Gly Glu Val Phe Cys Lys Ile His Thr Ser Thr Asp Ile Met Leu Ser
95 100 105 tca gcc tcc att ttc cat ttg tct ttc atc tcc att gac cgc
tac tat 389 Ser Ala Ser Ile Phe His Leu Ser Phe Ile Ser Ile Asp Arg
Tyr Tyr 110 115 120 gct gtg tgt gat cca ctg aga tat aaa gcc aag atg
aat atc ttg gtt 437 Ala Val Cys Asp Pro Leu Arg Tyr Lys Ala Lys Met
Asn Ile Leu Val 125 130 135 att tgt gtg atg atc ttc att agt tgg agt
gtc cct gct gtt ttt gca 485 Ile Cys Val Met Ile Phe Ile Ser Trp Ser
Val Pro Ala Val Phe Ala 140 145 150 155 ttt gga atg atc ttt ctg gag
cta aac ttc aaa ggc gct gaa gag ata 533 Phe Gly Met Ile Phe Leu Glu
Leu Asn Phe Lys Gly Ala Glu Glu Ile 160 165 170 tat tac aaa cat gtt
cac tgc aga gga ggt tgc ctc gtc ttc ttt agc 581 Tyr Tyr Lys His Val
His Cys Arg Gly Gly Cys Leu Val Phe Phe Ser 175 180 185 aaa ata tct
ggg gta ctg acc ttt atg act tct ttt tat ata cct gga 629 Lys Ile Ser
Gly Val Leu Thr Phe Met Thr Ser Phe Tyr Ile Pro Gly 190 195 200 tct
att atg tta tgt gtc tat tac aga ata tat ctt atc gct aaa gaa 677 Ser
Ile Met Leu Cys Val Tyr Tyr Arg Ile Tyr Leu Ile Ala Lys Glu 205 210
215 cag gca aga tta att agt gat gcc aat cag aag ctc caa att gga ttg
725 Gln Ala Arg Leu Ile Ser Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu
220 225 230 235 gaa atg aaa aat gga att tca caa agc aaa gaa agg aaa
gct gtg aag 773 Glu Met Lys Asn Gly Ile Ser Gln Ser Lys Glu Arg Lys
Ala Val Lys 240 245 250 aca ttg ggg att gtg atg gga gtt ttc cta ata
tgc tgg tgc cct ttc 821 Thr Leu Gly Ile Val Met Gly Val Phe Leu Ile
Cys Trp Cys Pro Phe 255 260 265 ttt atc tgt aca gtc atg gac cct ttt
ctt cac tca att att cca cct 869 Phe Ile Cys Thr Val Met Asp Pro Phe
Leu His Ser Ile Ile Pro Pro 270 275 280 act ttg aat gat gta ttg att
tgg ttt ggc tac ttg aac tct aca ttt 917 Thr Leu Asn Asp Val Leu Ile
Trp Phe Gly Tyr Leu Asn Ser Thr Phe 285 290 295 aat cca atg gtt tat
gca ttt ttc tat cct tgg ttt aga aaa gca ctg 965 Asn Pro Met Val Tyr
Ala Phe Phe Tyr Pro Trp Phe Arg Lys Ala Leu 300 305 310 315 aag atg
atg ctg ttt ggt aaa att ttc caa aaa gat tca tcc agg tgt 1013 Lys
Met Met Leu Phe Gly Lys Ile Phe Gln Lys Asp Ser Ser Arg Cys 320 325
330 aaa tta ttt ttg gaa ttg agt tca tagaattatt atattttact
gttttgcaaa 1067 Lys Leu Phe Leu Glu Leu Ser Ser 335 tcggttgatg
atcatattta tgaacacaac ataacgaacc acatgcacca accacatg 1125 2 339 PRT
Homo Sapiens 2 Met Met Pro Phe Cys His Asn Ile Ile Asn Ile Ser Cys
Val Lys Asn 1 5 10 15 Asn Trp Ser Asn Asp Val Arg Ala Ser Leu Tyr
Ser Leu Met Val Leu 20 25 30 Ile Ile Leu Thr Thr Leu Val Gly Asn
Leu Ile Val Ile Val Ser Ile 35 40 45 Ser His Phe Lys Gln Leu His
Thr Pro Thr Asn Trp Leu Ile His Ser 50 55 60 Met Ala Thr Val Asp
Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser 65 70 75 80 Met Val Arg
Ser Ala Glu His Cys Trp Tyr Phe Gly Glu Val Phe Cys 85 90 95 Lys
Ile His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Phe 100 105
110 His Leu Ser Phe Ile Ser Ile Asp Arg Tyr Tyr Ala Val Cys Asp Pro
115 120 125 Leu Arg Tyr Lys Ala Lys Met Asn Ile Leu Val Ile Cys Val
Met Ile 130 135 140 Phe Ile Ser Trp Ser Val Pro Ala Val Phe Ala Phe
Gly Met Ile Phe 145 150 155 160 Leu Glu Leu Asn Phe Lys Gly Ala Glu
Glu Ile Tyr Tyr Lys His Val 165 170 175 His Cys Arg Gly Gly Cys Leu
Val Phe Phe Ser Lys Ile Ser Gly Val 180 185 190 Leu Thr Phe Met Thr
Ser Phe Tyr Ile Pro Gly Ser Ile Met Leu Cys 195 200 205 Val Tyr Tyr
Arg Ile Tyr Leu Ile Ala Lys Glu Gln Ala Arg Leu Ile 210 215 220 Ser
Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu Glu Met Lys Asn Gly 225 230
235 240 Ile Ser Gln Ser Lys Glu Arg Lys Ala Val Lys Thr Leu Gly Ile
Val 245 250 255 Met Gly Val Phe Leu Ile Cys Trp Cys Pro Phe Phe Ile
Cys Thr Val 260 265 270 Met Asp Pro Phe Leu His Ser Ile Ile Pro Pro
Thr Leu Asn Asp Val 275 280 285 Leu Ile Trp Phe Gly Tyr Leu Asn Ser
Thr Phe Asn Pro Met Val Tyr 290 295 300 Ala Phe Phe Tyr Pro Trp Phe
Arg Lys Ala Leu Lys Met Met Leu Phe 305 310 315 320 Gly Lys Ile Phe
Gln Lys Asp Ser Ser Arg Cys Lys Leu Phe Leu Glu 325 330 335 Leu Ser
Ser 3 999 DNA Rattus norvegicus CDS (1)..(996) 3 atg cat ctt tgc
cac aat agc gcg aat att tcc cac acg aac agg aac 48 Met His Leu Cys
His Asn Ser Ala Asn Ile Ser His Thr Asn Arg Asn 1 5 10 15 tgg tca
agg gat gtc cgt gct tca ctg tac agc tta ata tca ctc ata 96 Trp Ser
Arg Asp Val Arg Ala Ser Leu Tyr Ser Leu Ile Ser Leu Ile 20 25 30
att cta acc act ctg gtt ggc aac tta ata gta atc att tcg ata tcc 144
Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Val Ile Ile Ser Ile Ser 35
40 45 cac ttc aag caa att cac acg ccc aca aat tgg ctc ctt cat tcc
atg 192 His Phe Lys Gln Ile His Thr Pro Thr Asn Trp Leu Leu His Ser
Met 50 55 60 gcc gtt gtc gac ttt ctg ctg ggc tgt ctg gtc atg ccc
tac agc atg 240 Ala Val Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro
Tyr Ser Met 65 70 75 80 gtg aga aca gtt gag cac tgc tgg tac ttt ggg
gaa ctc ttc tgc aaa 288 Val Arg Thr Val Glu His Cys Trp Tyr Phe Gly
Glu Leu Phe Cys Lys 85 90 95 ctt cac acc agc act gat atc atg ctg
agc tcg gca tcc att ctc cac 336 Leu His Thr Ser Thr Asp Ile Met Leu
Ser Ser Ala Ser Ile Leu His 100 105 110 cta gcc ttc att tcc att gac
cgc tac tat gct gtg tgc gac cct tta 384 Leu Ala Phe Ile Ser Ile Asp
Arg Tyr Tyr Ala Val Cys Asp Pro Leu 115 120 125 aga tac aaa gcc aag
atc aat ctc gcc gcc att ttt gtg atg atc ctc 432 Arg Tyr Lys Ala Lys
Ile Asn Leu Ala Ala Ile Phe Val Met Ile Leu 130 135 140 att agc tgg
agc ctt cct gct gtt ttt gca ttt ggg atg atc ttc ctg 480 Ile Ser Trp
Ser Leu Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu 145 150 155 160
gag ctg aac tta gaa gga gtt gag gag cag tat cac aat cag gtc ttc 528
Glu Leu Asn Leu Glu Gly Val Glu Glu Gln Tyr His Asn Gln Val Phe 165
170 175 tgc ctg cgc ggc tgt ttt cta ttc ttc agt aaa gta tct ggg gta
ctg 576 Cys Leu Arg Gly Cys Phe Leu Phe Phe Ser Lys Val Ser Gly Val
Leu 180 185 190 gca ttc atg acg tct ttc tat ata cct ggg tct gtt atg
tta ttt gtt 624 Ala Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met
Leu Phe Val 195 200 205 tac tat gag ata tat ttc ata gct aaa gga caa
gcg agg tca att aat 672 Tyr Tyr Glu Ile Tyr Phe Ile Ala Lys Gly Gln
Ala Arg Ser Ile Asn 210 215 220 cgt gca aac ctt caa gtt gga ttg gaa
ggg gaa agc aga gcg cca caa 720 Arg Ala Asn Leu Gln Val Gly Leu Glu
Gly Glu Ser Arg Ala Pro Gln 225 230 235 240 agc aag gaa aca aaa gcc
gcg aaa acc tta ggg atc atg gtg ggc gtt 768 Ser Lys Glu Thr Lys Ala
Ala Lys Thr Leu Gly Ile Met Val Gly Val 245 250 255 ttc ctc ctg tgc
tgg tgc ccg ttc ttt ttc tgc atg gtc ctg gac cct 816 Phe Leu Leu Cys
Trp Cys Pro Phe Phe Phe Cys Met Val Leu Asp Pro 260 265 270 ttc ctg
ggc tat gtt atc cca ccc act ctg aat gac aca ctg aat tgg 864 Phe Leu
Gly Tyr Val Ile Pro Pro Thr Leu Asn Asp Thr Leu Asn Trp 275 280 285
ttc ggg tac ctg aac tct gcc ttc aac ccg atg gtt tat gcc ttt ttc 912
Phe Gly Tyr Leu Asn Ser Ala Phe Asn Pro Met Val Tyr Ala Phe Phe 290
295 300 tat ccc tgg ttc aga aga gcg ttg aag atg gtt ctc ttc ggt aaa
att 960 Tyr Pro Trp Phe Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys
Ile 305 310 315 320 ttc caa aaa gat tca tct agg tct aag tta ttt ttg
taa 999 Phe Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu 325 330 4
332 PRT Rattus norvegicus 4 Met His Leu Cys His Asn Ser Ala Asn Ile
Ser His Thr Asn Arg Asn 1 5 10 15 Trp Ser Arg Asp Val Arg Ala Ser
Leu Tyr Ser Leu Ile Ser Leu Ile 20 25 30 Ile Leu Thr Thr Leu Val
Gly Asn Leu Ile Val Ile Ile Ser Ile Ser 35 40 45 His Phe Lys Gln
Ile His Thr Pro Thr Asn Trp Leu Leu His Ser Met 50 55 60 Ala Val
Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser Met 65 70 75 80
Val Arg Thr Val Glu His Cys Trp Tyr Phe Gly Glu Leu Phe Cys Lys 85
90 95 Leu His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Leu
His 100 105 110 Leu Ala Phe Ile Ser Ile Asp Arg Tyr Tyr Ala Val Cys
Asp Pro Leu 115 120 125 Arg Tyr Lys Ala Lys Ile Asn Leu Ala Ala Ile
Phe Val Met Ile Leu 130 135 140 Ile Ser Trp Ser Leu Pro Ala Val Phe
Ala Phe Gly Met Ile Phe Leu 145 150 155 160 Glu Leu Asn Leu Glu Gly
Val Glu Glu Gln Tyr His Asn Gln Val Phe 165 170 175 Cys Leu Arg Gly
Cys Phe Leu Phe Phe Ser Lys Val Ser Gly Val Leu 180 185 190 Ala Phe
Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met Leu Phe Val 195 200 205
Tyr Tyr Glu Ile Tyr Phe Ile Ala Lys Gly Gln Ala Arg Ser Ile Asn 210
215 220 Arg Ala Asn Leu Gln Val Gly Leu Glu Gly Glu Ser Arg Ala Pro
Gln 225 230 235 240 Ser Lys Glu Thr Lys Ala Ala Lys Thr Leu Gly Ile
Met Val Gly Val 245 250 255 Phe Leu Leu Cys Trp Cys Pro Phe Phe Phe
Cys Met Val Leu Asp Pro 260 265 270 Phe Leu Gly Tyr Val Ile Pro Pro
Thr Leu Asn Asp Thr Leu Asn Trp 275 280 285 Phe Gly Tyr Leu Asn Ser
Ala Phe Asn Pro Met Val Tyr Ala Phe Phe 290 295 300 Tyr Pro Trp Phe
Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys Ile 305 310 315 320 Phe
Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu 325 330 5 35 DNA
Artificial oligonucleotide primer 5 gagtcgacct gtgygysaty
rcaatkgacm gstac 35 6 33 DNA Artificial oligonucleotide primer 6
cagaattcag wagggcaacc agcagaasry gaa 33 7 21 DNA Artificial
oligonucleotide primer 7 tctctgagtg atgcatcttt g 21 8 27 DNA
Artificial oligonucleotide primer 8 agcagtgctc aactgttctc accatgc
27 9 23 DNA Artificial oligonucleotide primer 9 gcacgattaa
ttgacctcgc ttg 23 10 22 DNA Artificial oligonucleotide primer 10
ttgacagccc tcaggaatga tg 22 11 24 DNA Artificial oligonucleotide
primer 11 atggaaaatg gaggctgagc tcag 24 12 8 PRT Artificial FLAG
sequence 12 Asp Tyr Lys Asp Asp Asp Asp Lys 1 5
* * * * *