U.S. patent application number 10/745509 was filed with the patent office on 2004-07-22 for oligonucleotides and assemblies thereof useful in the detection of the presence or absence of target nucleic acid sequences in a sample.
Invention is credited to Alajem, Sara, Reinhartz, Avraham, Waksman, Michal.
Application Number | 20040142369 10/745509 |
Document ID | / |
Family ID | 23784560 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040142369 |
Kind Code |
A1 |
Alajem, Sara ; et
al. |
July 22, 2004 |
Oligonucleotides and assemblies thereof useful in the detection of
the presence or absence of target nucleic acid sequences in a
sample
Abstract
Oligonucoleotides useful in the detection of a nucleic acid
target sequence in a sample.
Inventors: |
Alajem, Sara; (Kfar Hanagid,
IL) ; Reinhartz, Avraham; (Gan Yavne, IL) ;
Waksman, Michal; (Gan Yavne, IL) |
Correspondence
Address: |
SOL SHEINBEIN
c/o ANTHONY CASTORINA
SUITE 207
2001 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Family ID: |
23784560 |
Appl. No.: |
10/745509 |
Filed: |
December 29, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10745509 |
Dec 29, 2003 |
|
|
|
09727480 |
Dec 4, 2000 |
|
|
|
09727480 |
Dec 4, 2000 |
|
|
|
09449545 |
Nov 29, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/24.3 |
Current CPC
Class: |
C12Q 1/6823 20130101;
C12Q 2525/301 20130101; C12Q 2525/131 20130101; C12Q 1/6823
20130101 |
Class at
Publication: |
435/006 ;
536/024.3 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
What is claimed is:
1. An oligonucleotide or assembly of oligonucleotides useful in
detecting a presence or an absence of a target nucleic acid
sequence in a sample, the oligonucleotide or assembly of
oligonucleotides comprising: (a) a first region and a second
region, at least a portion of said first region and at least a
portion of said second region each being capable of hybridizing
under predetermined hybridization conditions with the target
nucleic acid sequence; and (b) a third region and a fourth region,
said third region and said fourth region being linked to said first
region and said second region, respectively, a first portion and a
second portion of said oligonucleotide or assembly of
oligonucleotides being capable of forming a first duplex structure
therebetween under said predetermined hybridization conditions;
said first, second, third and fourth regions of the oligonucleotide
or assembly of oligonucleotides being selected such that upon
hybridization under said predetermined hybridization conditions of
said first region and said second region with said target nucleic
acid sequence, said first duplex structure dissociates and a
portion of said third region and a portion of said fourth region
form a second duplex structure therebetween, said second duplex
structure including a nucleic acid cleaving agent recognition
sequence which is absent from said first duplex structure and
which, when cleaved, indicates hybridization of the oligonucleotide
or assembly of oligonucleotides to the target nucleic acid sequence
and therefore indicates the presence of the target nucleic acid in
the sample.
2. The oligonucleotide or assembly of oligonucleotides of claim 1,
wherein said first portion and said second portion of said
oligonucleotide or assembly of oligonucleotides being capable of
forming said first duplex structure therebetween under said
predetermined hybridization conditions are derived from said third
and forth regions, respectively.
3. The oligonucleotide or assembly of oligonucleotides of claim 1,
wherein said first, second, third and fourth regions of the
oligonucleotide or assembly of oligonucleotides are further
selected such that following cleavage of said nucleic acid cleaving
agent recognition sequence, said first and second regions
dissociate from the target nucleic acid sequence, thereby enabling
recycling of the target nucleic acid sequence.
4. The oligonucleotide or assembly of oligonucleotides of claim 1,
further comprising at least one detection moiety linked to the
oligonucleotide or assembly of oligonucleotides in a manner so as
to enable detection of cleavage of said nucleic acid cleaving agent
recognition sequence.
5. The oligonucleotide or the assembly of oligonucleotides of claim
4, wherein said at least one detection moiety is selected from the
group consisting of at least one directly detectable detection
moiety and at least one indirectly detectable detection moiety.
6. The oligonucleotide or the assembly of oligonucleotides of claim
5, wherein said at least one directly detectable detection moiety
is selected from the group consisting of a fluorescent moiety and a
radioactive moiety and further wherein said at least one indirectly
detectable detection moiety is selected from the group consisting
of at least one member of a binding pair and at least one member of
a chemically interacting pair.
7. The oligonucleotide or the assembly of oligonucleotides of claim
6, wherein said at least one member of said binding pair is
selected from the group consisting of an antibody, an antigen, an
epitope, a ligand, a receptor, biotin, avidin, streptavidin, an ion
and a chelator, and further wherein said at least one member of
said chemically interacting pair is selected from the group
consisting of an enzyme, a catalyst and a substrate.
8. The oligonucleotide or the assembly of oligonucleotides of claim
5, wherein said at least one detection moiety includes a resonantly
interacting pair of detection moieties, said resonantly interacting
pair of detection moieties including a first detection moiety and a
second detection moiety, whereas said first detection moiety and
said second detection moiety are selected such that at least one of
said first detection moiety and said second detection moiety is
capable of producing a detectable signal when in a non-interacting
distance from the other detection moiety, so that a signal is
produceable by one of said first detection moiety and said second
detection moiety upon cleavage of said nucleic acid recognition
sequence.
9. The oligonucleotide or the assembly of oligonucleotides of claim
8, wherein said first and second detection moieties form a
fluorescence resonance energy transfer pair.
10. The oligonucleotide or the assembly of oligonucleotides of
claim 8, wherein said first detection moiety is a fluorescer and
further wherein said second detection moiety is a quencher of said
fluorescer.
11. The oligonucleotide or the assembly of oligonucleotides of
claim 10, wherein said fluorescer is EDANS and further wherein said
quencher is DABSYL.
12. The oligonucleotide or assembly of oligonucleotides of claim 1,
comprising a single oligonucleotide.
13. The oligonucleotide or assembly of oligonucleotides of claim 1,
comprising a pair of oligonucleotides.
14. A method of detecting a presence or an absence of a target
nucleic acid sequence in a sample, the method comprising the steps
of: (a) contacting the sample with an oligonucleotide or assembly
of oligonucleotides under predetermined hybridization conditions so
as to form a reaction mixture, said oligonucleotide or assembly of
oligonucleotides including: (i) a first region and a second region,
at least a portion of said first region and at least a portion of
said second region each being capable of hybridizing with the
target nucleic acid sequence; and (ii) a third region and a fourth
region, said third region and said fourth region being linked to
said first region and said second region, respectively, a first
portion and a second portion of said oligonucleotide or assembly of
oligonucleotides being capable of forming a first duplex structure
therebetween under said predetermined hybridization conditions;
said first, second, third and fourth regions of the oligonucleotide
or assembly of oligonucleotides being selected such that upon
hybridization under said predetermined hybridization conditions of
said first region and said second region with said target nucleic
acid sequence, said first duplex structure dissociates and a second
portion of said third region and a second portion of said fourth
region form a second duplex structure therebetween, said second
duplex structure including a nucleic acid cleaving agent
recognition sequence which is absent from said first duplex
structure; (b) adding a nucleic acid cleaving agent to said
reaction mixture, such that, if the target nucleic acid sequence is
present in the sample, said nucleic acid cleaving agent recognition
sequence is formed and cleaved by said cleaving agent; and (c)
monitoring cleavage of said nucleic acid cleaving agent recognition
sequence by said nucleic acid cleaving agent; wherein cleavage of
said nucleic acid cleaving agent recognition sequence by said
nucleic acid cleaving agent indicates hybridization of the
oligonucleotide or assembly of oligonucleotides to the target
nucleic acid sequence and therefore the presence of the target
nucleic acid in the sample.
15. The method of claim 14, wherein said first portion and said
second portion of said oligonucleotide or assembly of
oligonucleotides being capable of forming said first duplex
structure therebetween under said predetermined hybridization
conditions are derived from said third and forth regions,
respectively.
16. The method of claim 14, wherein said first, second, third and
fourth regions of the oligonucleotide or assembly of
oligonucleotides are further selected such that following cleavage
of said nucleic acid cleaving agent recognition sequence, said
first and second regions dissociate from the target nucleic acid
sequence, thereby enabling recycling of the target nucleic acid
sequence.
17. The method of claim 14, wherein said oligonucleotide or the
assembly of oligonucleotides includes at least one detection moiety
linked thereto in a manner so as to enable detection of cleavage of
said nucleic acid cleaving agent recognition sequence.
18. The method of claim 17, wherein said at least one detection
moiety is selected from the group consisting of at least one
directly detectable detection moiety and at least one indirectly
detectable detection moiety.
19. The method of claim 18, wherein said at least one directly
detectable detection moiety is selected from the group consisting
of a fluorescent moiety and a radioactive moiety and further
wherein said at least one indirectly detectable detection moiety is
selected from the group consisting of at least one member of a
binding pair and at least one member of a chemically interacting
pair.
20. The method of claim 19, wherein said at least one member of
said binding pair is selected from the group consisting of an
antibody, an antigen, an epitope, a ligand, a receptor, biotin,
avidin, streptavidin, an ion and a chelator, and further wherein
said at least one member of said chemically interacting pair is
selected from the group consisting of an enzyme, a catalyst and a
substrate.
21. The method of claim 18, wherein said at least one detection
moiety includes a resonantly interacting pair of detection
moieties, said resonantly interacting pair of detection moieties
including a first detection moiety and a second detection moiety,
whereas said first detection moiety and said second detection
moiety are selected such that at least one of said first detection
moiety and said second detection moiety is capable of producing a
detectable signal when in a non-interacting distance from the other
detection moiety, so that a signal is produceable by one of said
first detection moiety and said second detection moiety upon
cleavage of said nucleic acid recognition sequence.
22. The method of claim 21, wherein said first and second detection
moieties form a fluorescence resonance energy transfer pair.
23. The method of claim 21, wherein said first detection moiety is
a fluorescer and further wherein said second detection moiety is a
quencher of said fluorescer.
24. The method of claim 23, wherein said fluorescer is EDANS and
further wherein said quencher is DAB SYL.
25. The method of claim 14, wherein the oligonucleotide or assembly
of oligonucleotides comprising a single oligonucleotide.
26. The method of claim 14, wherein the oligonucleotide or assembly
of oligonucleotides comprising a pair of oligonucleotides.
27. An oligonucleotide system useful for detecting a presence or an
absence of a target nucleic acid sequence in a sample comprising at
least a first oligonucleotide and a second oligonucleotide, each of
said first oligonucleotide and said second oligonucleotide
including a first region being capable of hybridizing with the
target nucleic acid sequence under predetermined hybridization
conditions, each of said first oligonucleotide and said second
oligonucleotide further including a second region, wherein upon
hybridization, at least a portion of said second regions of said
first oligonucleotide and said second oligonucleotide form a duplex
structure including a nucleic acid cleaving agent recognition
sequence, said second regions of said first oligonucleotide and
said second oligonucleotide being selected such that in a presence
of a nucleic acid cleaving agent recognizing said nucleic acid
cleaving agent recognition sequence, only said first
oligonucleotide is cleavable by said nucleic acid cleaving
agent.
28. The oligonucleotide system of claim 27, wherein said first and
second regions of said first and second oligonucleotides are
selected such that upon cleavage of said first oligonucleotide,
said first region of said first oligonucleotide dissociates from
the target nucleic acid sequence.
29. The oligonucleotide system of claim 28, wherein said first
region of said second oligonucleotide is selected such that under
said predetermined hybridization conditions and following
dissociation of said first oligonucleotide, said first region of
said second oligonucleotide remains hybridized to the target
nucleic acid sequence, thereby allowing recycling of the target
nucleic acid sequence with respect to said first
oligonucleotide.
30. The oligonucleotide system of claim 27, wherein at least one
nucleotide or internucleotidic bond of said second oligonucleotide
which forms a part of said nucleic acid cleaving agent recognition
sequence is a modified or analogous nucleotide or internucleotidic
bond, selected so as to prevent cleavage of said second
oligonucleotide by said nucleic acid cleaving agent.
31. The oligonucleotide system of claim 27, wherein said duplex
structure is formed in part by self annealing of a portion of said
second region of said first oligonucleotide.
32. The oligonucleotide system of claim 27, wherein said second
regions of said first and second oligonucleotides are selected such
that said nucleic acid cleaving agent recognition sequence is
characterized by a nick replacing an internucleotidic bond
cleavable by said nucleic acid cleaving agent.
33. The oligonucleotide system of claim 27, further comprising at
least one detection moiety linked to the oligonucleotide system in
a manner so as to enable detection of cleavage of said nucleic acid
cleaving agent recognition sequence.
34. The oligonucleotide system of claim 33, wherein said at least
one detection moiety is selected from the group consisting of at
least one directly detectable detection moiety and at least one
indirectly detectable detection moiety.
35. The oligonucleotide system of claim 34, wherein said at least
one directly detectable detection moiety is selected from the group
consisting of a fluorescent moiety and a radioactive moiety and
further wherein said at least one indirectly detectable detection
moiety is selected from the group consisting of at least one member
of a binding pair and at least one member of a chemically
interacting pair.
36. The oligonucleotide system of claim 35, wherein said at least
one member of said binding pair is selected from the group
consisting of an antibody, an antigen, an epitope, a ligand, a
receptor, biotin, avidin, streptavidin, an ion and a chelator, and
further wherein said at least one member of said chemically
interacting pair is selected from the group consisting of an
enzyme, a catalyst and a substrate.
37. The oligonucleotide system of claim 34, wherein said at least
one detection moiety includes a resonantly interacting pair of
detection moieties, said resonantly interacting pair of detection
moieties including a first detection moiety and a second detection
moiety, whereas said first detection moiety and said second
detection moiety are selected such that at least one of said first
detection moiety and said second detection moiety is capable of
producing a detectable signal when in a non-interacting distance
from the other detection moiety, so that a signal is produceable by
one of said first detection moiety and said second detection moiety
upon cleavage of said nucleic acid recognition sequence.
38. The oligonucleotide system of claim 37, wherein said first and
second detection moieties form a fluorescence resonance energy
transfer pair.
39. The oligonucleotide system of claim 37, wherein said first
detection moiety is a fluorescer and further wherein said second
detection moiety is a quencher of said fluorescer.
40. The oligonucleotide system of claim 39, wherein said fluorescer
is EDANS and further wherein said quencher is DABSYL.
41. A method of detecting a presence or an absence of a target
nucleic acid sequence in a sample, the method comprising the steps
of: (a) contacting the sample with an oligonucleotide system under
hybridization conditions so as to form a reaction mixture, said
oligonucleotide system including at least a first oligonucleotide
and a second oligonucleotide, each of said first oligonucleotide
and said second oligonucleotide including a first region being
capable of hybridizing under predetermined hybridization conditions
with the target nucleic acid sequence, each of said first
oligonucleotide and said second oligonucleotide further including a
second region, wherein upon hybridization under said predetermined
hybridization conditions, at least a portion of said second regions
of said first oligonucleotide and said second oligonucleotide form
a duplex structure including a nucleic acid cleaving agent
recognition sequence, said second regions of said first
oligonucleotide and said second oligonucleotide being selected such
that in a presence of a nucleic acid cleaving agent recognizing
said nucleic acid cleaving agent recognition sequence, only said
first oligonucleotide is cleavable by said nucleic acid cleaving
agent; (b) adding said nucleic acid cleaving agent to said reaction
mixture, such that, if the target nucleic acid sequence is present
in the sample, said nucleic acid cleaving agent recognition
sequence is cleaved by said nucleic acid cleaving agent; and (c)
monitoring cleavage of said nucleic acid cleaving agent recognition
sequence by said nucleic acid cleaving agent; wherein cleavage of
said nucleic acid cleaving agent recognition sequence by said
nucleic acid cleaving agent indicates hybridization of the
oligonucleotide system to the target nucleic acid sequence and
therefore the presence of the target nucleic acid in the
sample.
42. The method of claim 41, wherein detecting a presence or an
absence of said cleavage is effected by monitoring the presence or
absence of specific cleavage products.
43. The method of claim 41, wherein said first and second regions
of said first and second oligonucleotides are selected such that
upon cleavage of said first oligonucleotide, said first region of
said first oligonucleotide dissociates from the target nucleic acid
sequence.
44. The method of claim 43, wherein said first region of said
second oligonucleotide is selected such that under said
predetermined hybridization conditions and following dissociation
of said first oligonucleotide, said first region of said second
oligonucleotide remains hybridized to the target nucleic acid
sequence, thereby allowing recycling of the target nucleic acid
sequence with respect to said first oligonucleotide.
45. The method of claim 41, wherein at least one nucleotide or
internucleotidic bond of said second oligonucleotide which forms a
part of said nucleic acid cleaving agent recognition sequence is a
modified or analogous nucleotide or internucleotidic bond, selected
so as to prevent cleavage of said second oligonucleotide by said
nucleic acid cleaving agent.
46. The method of claim 41, wherein said duplex structure is formed
in part by self annealing of a portion of said second region of
said first oligonucleotide.
47. The method of claim 41, wherein said second regions of said
first and second oligonucleotides are selected such that said
nucleic acid cleaving agent recognition sequence is characterized
by a nick replacing an internucleotidic bond cleavable by said
nucleic acid cleaving agent.
48. The method of claim 41, wherein said oligonucleotide sequence
further comprising at least one detection moiety linked to the
oligonucleotide system in a manner so as to enable detection of
cleavage of said nucleic acid cleaving agent recognition
sequence.
49. The method of claim 48, wherein said at least one detection
moiety is selected from the group consisting of at least one
directly detectable detection moiety and at least one indirectly
detectable detection moiety.
50. The method of claim 49, wherein said at least one directly
detectable detection moiety is selected from the group consisting
of a fluorescent moiety and a radioactive moiety and further
wherein said at least one indirectly detectable detection moiety is
selected from the group consisting of at least one member of a
binding pair and at least one member of a chemically interacting
pair.
51. The method of claim 50, wherein said at least one member of
said binding pair is selected from the group consisting of an
antibody, an antigen, an epitope, a ligand, a receptor, biotin,
avidin, streptavidin, an ion and a chelator, and further wherein
said at least one member of said chemically interacting pair is
selected from the group consisting of an enzyme, a catalyst and a
substrate.
52. The method of claim 49, wherein said at least one detection
moiety includes a resonantly interacting pair of detection
moieties, said resonantly interacting pair of detection moieties
including a first detection moiety and a second detection moiety,
whereas said first detection moiety and said second detection
moiety are selected such that at least one of said first detection
moiety and said second detection moiety is capable of producing a
detectable signal when in a non-interacting distance from the other
detection moiety, so that a signal is produceable by one of said
first detection moiety and said second detection moiety upon
cleavage of said nucleic acid recognition sequence.
53. The method of claim 52, wherein said first and second detection
moieties form a fluorescence resonance energy transfer pair.
54. The method of claim 52, wherein said first detection moiety is
a fluorescer and further wherein said second detection moiety is a
quencher of said fluorescer.
55. The method of claim 54, wherein said fluorescer is EDANS and
further wherein said quencher is DABSYL.
56. An oligonucleotide system useful for detecting a presence or an
absence of a target nucleic acid sequence in a sample comprising at
least a first oligonucleotide and a second oligonucleotide, each of
said first oligonucleotide and said second oligonucleotide
including a first region being complementary or substantially
complementary to the target nucleic acid sequence, each of said
first oligonucleotide and said second oligonucleotide further
including a second region, said second regions of said first and
second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween said second regions form a duplex structure including
a nucleic acid cleaving agent recognition sequence, wherein under
predetermined hybridization conditions said first region of said
first oligonucleotide is stably hybridizable with said target
nucleic acid sequence only if said first region of said second
oligonucleotide is stably hybridizable with said nucleic acid
target sequence.
57. The oligonucleotide system of claim 56, wherein under said
predetermined hybridization conditions said second regions of said
first and second oligonucleotides are substantially
non-hybridizable with one another per se.
58. The oligonucleotide system of claim 56, wherein said second
regions of said first oligonucleotide and said second
oligonucleotide are selected such that in a presence of a nucleic
acid cleaving agent recognizing said nucleic acid cleaving agent
recognition sequence, only said first oligonucleotide is cleavable
by said nucleic acid cleaving agent.
59. The oligonucleotide system of claim 58, wherein said first and
second regions of said first and second oligonucleotides are
selected such that under said predetermined hybridization
conditions and upon cleavage of said first oligonucleotide, said
first region of said first oligonucleotide dissociates from the
target nucleic acid sequence.
60. The oligonucleotide system of claim 58, wherein at least one
nucleotide or internucleotidic bond of said second oligonucleotide
which forms a part of said nucleic acid cleaving agent recognition
sequence is a modified or analogous nucleotide or internucleotidic
bond, selected so as to prevent cleavage of said second
oligonucleotide by said nucleic acid cleaving agent.
61. The oligonucleotide system of claim 58, wherein said duplex
structure is formed in part by self annealing of a portion of said
second region of said first oligonucleotide.
62. The oligonucleotide system of claim 58, wherein said second
regions of said first and second oligonucleotides are selected such
that said nucleic acid cleaving agent recognition sequence is
characterized by a nick replacing an internucleotidic bond
cleavable by said nucleic acid cleaving agent.
63. The oligonucleotide system of claim 56, further comprising at
least one detection moiety linked to the oligonucleotide system in
a manner so as to enable detection of cleavage of said nucleic acid
cleaving agent recognition sequence.
64. The oligonucleotide system of claim 63, wherein said at least
one detection moiety is selected from the group consisting of at
least one directly detectable detection moiety and at least one
indirectly detectable detection moiety.
65. The oligonucleotide system of claim 64, wherein said at least
one directly detectable detection moiety is selected from the group
consisting of a fluorescent moiety and a radioactive moiety and
further wherein said at least one indirectly detectable detection
moiety is selected from the group consisting of at least one member
of a binding pair and at least one member of a chemically
interacting pair.
66. The oligonucleotide system of claim 65, wherein said at least
one member of said binding pair is selected from the group
consisting of an antibody, an antigen, an epitope, a ligand, a
receptor, biotin, avidin, streptavidin, an ion and a chelator, and
further wherein said at least one member of said chemically
interacting pair is selected from the group consisting of an
enzyme, a catalyst and a substrate.
67. The oligonucleotide system of claim 64, wherein said at least
one detection moiety includes a resonantly interacting pair of
detection moieties, said resonantly interacting pair of detection
moieties including a first detection moiety and a second detection
moiety, whereas said first detection moiety and said second
detection moiety are selected such that at least one of said first
detection moiety and said second detection moiety is capable of
producing a detectable signal when in a non-interacting distance
from the other detection moiety, so that a signal is produceable by
one of said first detection moiety and said second detection moiety
upon cleavage of said nucleic acid recognition sequence.
68. The oligonucleotide system of claim 67, wherein said first and
second detection moieties form a fluorescence resonance energy
transfer pair.
69. The oligonucleotide system of claim 67, wherein said first
detection moiety is a fluorescer and further wherein said second
detection moiety is a quencher of said fluorescer.
70. The oligonucleotide system of claim 68, wherein said fluorescer
is EDANS and further wherein said quencher is DABSYL.
71. A method of detecting a presence or an absence of a target
nucleic acid sequence in a sample, the method comprising the steps
of: (a) contacting the sample with an oligonucleotide system so as
to form a reaction mixture, said oligonucleotide system including
at least a first oligonucleotide and a second oligonucleotide, each
of said first oligonucleotide and said second oligonucleotide
including a first region being complementary or substantially
complementary to the target nucleic acid sequence, each of said
first oligonucleotide and said second oligonucleotide further
including a second region, said second regions of said first and
second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween said second regions form a duplex structure including
a nucleic acid cleaving agent recognition sequence, wherein under
said predetermined hybridization conditions said first region of
said first oligonucleotide is stably hybridizable with said target
nucleic acid sequence only if said first region of said second
oligonucleotide is stably hybridizable with said nucleic acid
target sequence; (b) adding a nucleic acid cleaving agent to said
reaction mixture, such that, if the target nucleic acid sequence is
present in the sample, said nucleic acid cleaving agent recognition
sequence is cleaved by said nucleic acid cleaving agent; and (c)
monitoring cleavage of said nucleic acid cleaving agent recognition
sequence by said nucleic acid cleaving agent; wherein cleavage of
said nucleic acid cleaving agent recognition sequence by said
nucleic acid cleaving agent indicates hybridization of the
oligonucleotide system to the target nucleic acid sequence and
therefore the presence of the target nucleic acid in the
sample.
72. The method of claim 71, wherein detecting a presence or an
absence of said cleavage is effected by monitoring the presence or
absence of specific cleavage products.
73. The method of claim 71, wherein said first and second regions
of said first and second oligonucleotides are selected such that
under said predetermined hybridization conditions and upon cleavage
of said first oligonucleotide, said first region of said first
oligonucleotide dissociates from the target nucleic acid
sequence.
74. The method of claim 71, wherein at least one nucleotide or
internucleotidic bond of said second oligonucleotide which forms a
part of said nucleic acid cleaving agent recognition sequence is a
modified or analogous nucleotide or internucleotidic bond, selected
so as to prevent cleavage of said second oligonucleotide by said
nucleic acid cleaving agent.
75. The method of claim 71, wherein said duplex structure is formed
in part by self annealing of a portion of said second region of
said first oligonucleotide.
76. The method of claim 71, wherein said second regions of said
first and second oligonucleotides are selected such that said
nucleic acid cleaving agent recognition sequence is characterized
by a nick replacing an internucleotidic bond cleavable by said
nucleic acid cleaving agent.
77. The method of claim 71, wherein said oligonucleotide sequence
further comprising at least one detection moiety linked to the
oligonucleotide system in a manner so as to enable detection of
cleavage of said nucleic acid cleaving agent recognition
sequence.
78. The method of claim 77, wherein said at least one detection
moiety is selected from the group consisting of at least one
directly detectable detection moiety and at least one indirectly
detectable detection moiety.
79. The method of claim 78, wherein said at least one directly
detectable detection moiety is selected from the group consisting
of a fluorescent moiety and a radioactive moiety and further
wherein said at least one indirectly detectable detection moiety is
selected from the group consisting of at least one member of a
binding pair and at least one member of a chemically interacting
pair.
80. The method of claim 79, wherein said at least one member of
said binding pair is selected from the group consisting of an
antibody, an antigen, an epitope, a ligand, a receptor, biotin,
avidin, streptavidin, an ion and a chelator, and further wherein
said at least one member of said chemically interacting pair is
selected from the group consisting of an enzyme, a catalyst and a
substrate.
81. The method of claim 78, wherein said at least one detection
moiety includes a resonantly interacting pair of detection
moieties, said resonantly interacting pair of detection moieties
including a first detection moiety and a second detection moiety,
whereas said first detection moiety and said second detection
moiety are selected such that at least one of said first detection
moiety and said second detection moiety is capable of producing a
detectable signal when in a non-interacting distance from the other
detection moiety, so that a signal is produceable by one of said
first detection moiety and said second detection moiety upon
cleavage of said nucleic acid recognition sequence.
82. The method of claim 81, wherein said first and second detection
moieties form a fluorescence resonance energy transfer pair.
83. The method of claim 81, wherein said first detection moiety is
a fluorescer and further wherein said second detection moiety is a
quencher of said fluorescer.
84. The method of claim 83, wherein said fluorescer is EDANS and
further wherein said quencher is DABSYL.
85. An oligonucleotide system useful for detecting a presence or an
absence of a target nucleic acid sequence in a sample comprising at
least a first oligonucleotide and a second oligonucleotide, each of
said first oligonucleotide and said second oligonucleotide
including a first region being complementary or substantially
complementary to the target nucleic acid sequence, each of said
first oligonucleotide and said second oligonucleotide further
including a second region, said second regions of said first and
second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween said second regions form a duplex structure including
a nucleic acid cleaving agent recognition sequence, wherein under
predetermined hybridization conditions said first regions of said
first oligonucleotide and said second oligonucleotide are stably
hybridizable with said target nucleic acid sequence, and said
second regions of said first oligonucleotide and said second
oligonucleotide are stably hybridizable therebetween only when said
first oligonucleotide, said second oligonucleotide and said target
nucleic acid sequence are co-annealed.
86. A method of detecting a presence or an absence of a target
nucleic acid sequence in a sample, the method comprising the steps
of: (a) contacting the sample with an oligonucleotide system so as
to form a reaction mixture, said oligonucleotide system including
at least a first oligonucleotide and a second oligonucleotide, each
of said first oligonucleotide and said second oligonucleotide
including a first region being complementary or substantially
complementary to the target nucleic acid sequence, each of said
first oligonucleotide and said second oligonucleotide further
including a second region, said second regions of said first and
second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween said second regions form a duplex structure including
a nucleic acid cleaving agent recognition sequence, wherein under
predetermined hybridization conditions said first regions of said
first oligonucleotide and said second oligonucleotide are stably
hybridizable with said target nucleic acid sequence, and said
second regions of said first oligonucleotide and said second
oligonucleotide are stably hybridizable therebetween only when said
first oligonucleotide, said second oligonucleotide and said target
nucleic acid sequence are co-annealed; (b) adding a nucleic acid
cleaving agent to said reaction mixture, such that, if the target
nucleic acid sequence is present in the sample, said nucleic acid
cleaving agent recognition sequence is cleaved by said nucleic acid
cleaving agent; and (c) monitoring cleavage of said nucleic acid
cleaving agent recognition sequence by said nucleic acid cleaving
agent; wherein cleavage of said nucleic acid cleaving agent
recognition sequence by said nucleic acid cleaving agent indicates
hybridization of the oligonucleotide system to the target nucleic
acid sequence and therefore the presence of the target nucleic acid
in the sample.
Description
[0001] This is a continuation-in-part of U.S. patent application
Ser. No. 09/449,545, filed Nov. 29, 1999.
FIELD AND BACKGROUND OF THE INVENTION
[0002] The present invention relates to oligonucleotide probes and
methods for the detection of target nucleic acid sequences in a
sample. More particularly, the present invention relates to
oligonucleotide probes which are internally cleavable when
hybridized to target nucleic acid sequences, such cleavage leading
to both signal generation and amplification by recycling.
[0003] The identification of a target nucleic acid sequence is of
great importance in both biological research and medical
diagnostics. Detection of a target sequence can be used to identify
and/or type a specific DNA or RNA molecule and to uncover
mutations.
[0004] Numerous methods and techniques exist in the art with which
detection and/or identification of a target sequence can be
effected. For example, polynucleotide sequencing methods can be
used to determine the nucleotide sequence of a target DNA or RNA
molecule. The methods typically used for sequencing include the
Sanger dideoxy method, see, e.g., Sanger et al. (1977) Proc. Natl.
Acad. Sci. USA, 74:5463-5467, or the Maxam and Gilbert method, see,
e.g., Maxam et al., (1980) Methods in Enzymology, 65:499-559.
[0005] The polymerase chain reaction (PCR) can also be used to
detect the presence of a target sequence in a sample. PCR utilizes
oligonucleotide primers which specifically bind regions within the
target sequence to amplify the target nucleic acid sequence, the
generation of amplification products is indicative of the presence
of the target sequence.
[0006] Another approach to target nucleic acid identification
involves hybridizing an oligonucleotide probe to the target nucleic
acid sequence wherein hybridization is indicative of the presence
thereof.
[0007] An oligonucleotide probe binds to a target nucleic acid by
forming hydrogen bonds between bases in the target and the
oligonucleotide. Common B-DNA has conventional adenine-thymine
(A-T) and guanine-cytosine (G-C) Watson and Crick base pairs with
two and three hydrogen bonds formed therebetween, respectively.
Conventional hybridization technology is based upon the capability
of sequence-specific DNA or RNA oligonucleotide probes to bind to a
complementary target nucleic acid via Watson-Crick hydrogen bonds.
However, other types of internucleotide hydrogen bonding patterns
are known wherein atoms not involved in Watson-Crick base pairing
to a first nucleotide can form hydrogen bonds to another
nucleotide. For example, thymine (T) can bind to an AT Watson-Crick
base pair via hydrogen bonds to the adenine, thereby forming a T-AT
base triad. Hoogsteen (1959, Acta Crystallographica 12:822) first
described the alternate hydrogen bonds present in T-AT and C-GC
base triads. More recently, G-TA base triads, wherein guanine can
hydrogen bond with a central thymine, have been observed (Griffin
et al., 1989, Science 245:967-971).
[0008] Oligonucleotide probes which can bind to a target nucleic
acid with both Watson-Crick and non-Watson-Crick hydrogen bonds
form extremely stable complexes with the target nucleic acid and as
such have a variety of research and diagnostic utilities.
[0009] For example, oligonucleotides can be used as probes for
target nucleic acids that are immobilized onto a filter or
membrane, or are present in tissues, e.g. as described in Sambrook
et al. (1989, Molecular Cloning: A Laboratory Manual, Vols. 1-3,
Cold Spring Harbor Press, NY). However, the utility of linear
oligonucleotide probes is frequently limited by their poor binding
stability and selectivity.
[0010] Another example includes solution phase detection methods.
Several solution-phase detection methods, sometimes referred to as
homogeneous assays, are known. The term "homogeneous" is used in
the art to refer to methods performed without separating
unhybridized oligonucleotide probes from probe-target hybrids.
These methods often rely upon the fact that the fluorescence of
many fluorescent labels can be affected by the conformation of the
oligonucleotide probe or by the immediate chemical environment.
[0011] U.S. Pat. No. 5,876,930 to Livak et al. discloses a method
for identifying a target nucleic acid sequence. The method utilizes
an oligonucleotide probe which includes a fluorescent reporter
molecule and a quencher molecule capable of quenching the
fluorescence of the reporter molecule. The oligonucleotide probe
according to this method is constructed such that the probe exists
in at least one single-stranded conformation when unhybridized,
where the quencher molecule is near enough to the reporter molecule
to quench the fluorescence of the reporter molecule. The
oligonucleotide probe also exists in at least one conformation when
hybridized to a target nucleic acid where the quencher molecule is
not positioned close enough to the reporter molecule to quench the
fluorescence of the reporter molecule. By adopting these hybridized
and unhybridized conformations, the reporter molecule and quencher
molecule on the probe exhibit different fluorescence signal
intensities when the probe is hybridized and unhybridized. As a
result, this method enables to determine the presence of a specific
target nucleic acid sequence based on a change in the fluorescence
intensity of the reporter molecule, the quencher molecule, or a
combination thereof. The limitation of this approach is that no
signal amplification is enabled, resulting in inability of
detecting low target concentrations. In addition, this method is
inherently characterized by a high background signal.
[0012] U.S. Pat. No. 5,925,517 to Tyagi et al. discloses
unimolecular and bimolecular hybridization probes for the detection
of nucleic acid target sequences. The probes include a target
complement sequence, an affinity pair holding the probe in a closed
conformation in the absence of target sequence, and either a label
pair that interacts when the probe is in the closed conformation
or, for certain unimolecular probes, a non-interactive label.
Hybridization of the target and target complement sequences shifts
the probe to an open conformation. The shift is detectable due to
reduced interaction of the label pair or by detecting a signal from
a non-interactive label. Certain unimolecular probes can
discriminate between target and non-target sequences differing by
as little as one nucleotide. The limitation of this approach is
that no signal amplification is enabled, resulting in inability of
detecting low target concentrations. In addition, this method is
inherently characterized by a high background signal.
[0013] U.S. Pat. No. 5,866,336 to Nazarenko et al. describes
labeled nucleic acid amplification oligonucleotides, which can be
linear or hairpin primers or blocking oligonucleotides. The
oligonucleotides disclosed by Nazarenko are labeled with donor
and/or acceptor moieties of molecular energy transfer pairs. The
moieties can be fluorophores, such that fluorescent energy emitted
by the donor is absorbed by the acceptor. The acceptor may be a
fluorophore that fluoresces at a wavelength different from the
donor moiety, or it may be a quencher. These oligonucleotides are
configured so that a donor moiety and an acceptor moiety are
incorporated into the amplification product. The invention also
provides methods and kits for directly detecting amplification
products employing the nucleic acid amplification primers. When
labeled linear primers are used, treatment with exonuclease or by
using specific temperature eliminates the need for separation of
unincorporated primers. This "closed-tube" format greatly reduces
the possibility of carryover contamination with amplification
products, provides for high throughput of samples, and may be
totally automated.
[0014] U.S. Pat. No. 4,766,062 to Diamond et al. describes a
diagnostic reagent containing a complex of a probe polynucleotide
bound via purine/pyrimidine hydrogen bonding to a labeled
polynucleotide. The probe contains a target binding region capable
of binding to a target sequence of a biological sample. U.S. Pat.
No. 4,766,062 further describes a method in which contact with a
sample containing the target nucleotide sequence causes binding,
initially between the target and a single-stranded portion of the
target binding region. Thereafter the labeled polynucleotide is
displaced from the complex by branch migration of into the binding
region. Determination of displaced labeled polynucleotide gives a
value which is a function of the presence and concentration of
target nucleotide sequence in the sample.
[0015] U.S. Pat. No. 5,451,503 to Hogan et al., which is discussed
in more detail in the preferred embodiments section that follows,
teaches of nucleic acid hybridization probes having at least one
nucleic acid strand which has at least two separate target specific
regions that hybridize to a target nucleic acid sequence, and at
least two distinct arm regions that do not hybridize with the
target nucleic acid but possess complementary regions that are
capable of hybridizing with one another. These regions are designed
such that, under appropriate hybridization conditions, the
complementary arm regions will not hybridize to one another in the
absence of the target nucleic acid; but, in the presence of target
nucleic acid the target-specific regions of the probe will anneal
to the target nucleic acid, and the complementary arm regions will
anneal to one another, thereby forming a branched nucleic acid
structure which is useful for target nucleic acid sequence
detection.
[0016] Although the above mentioned methods are less complicated to
perform than simple oligonucleotide probe detection methods such as
that described by Sambrook et al. in which oligonucleotide probes
are used to target nucleic acids that are immobilized onto a filter
or membrane, some limitations still apply. For example, a method
which is simple to perform such as that described by Livak et al.
can yield false positive results since hybridization to non-target
sequences will also yield, in some cases, a positive result.
[0017] In general, the above methods are characterized by low
signal and high background. Hogan et al. teaches signal
amplification by template recycling and background reduction by
appropriate selection of the length of the arm regions of the
oligonucleotides employed thereby. Methods which are aimed at
producing more accurate results are oftentimes more complicated to
perform. However, as is further shown and exemplified hereinunder,
improved methods for signal amplification an background reduction
are still required.
[0018] Thus, the present invention discloses novel oligonucleotides
utilizable in a homogeneous detection method of target nucleic acid
sequences, which method depends on the generation of a specific
cleavage site in a hybridized, conformationaly changed
oligonucleotide, and as such the present invention provides a
simple method of target nucleic acid detection while retaining a
high level of specificity.
SUMMARY OF THE INVENTION
[0019] According to one aspect of the present invention there is
provided an oligonucleotide or assembly of oligonucleotides useful
in detecting a presence or an absence of a target nucleic acid
sequence in a sample, the oligonucleotide or assembly of
oligonucleotides comprising (a) a first region and a second region,
at least a portion of the first region and at least a portion of
the second region each being capable of hybridizing under
predetermined hybridization conditions with the target nucleic acid
sequence; and (b) a third region and a fourth region, the third
region and the fourth region being linked to the first region and
the second region, respectively, a first portion and a second
portion of the oligonucleotide or assembly of oligonucleotides
being capable of forming a first duplex structure therebetween
under the predetermined hybridization conditions; the first,
second, third and fourth regions of the oligonucleotide or assembly
of oligonucleotides being selected such that upon hybridization
under the predetermined hybridization conditions of the first
region and the second region with the target nucleic acid sequence,
the first duplex structure dissociates and a portion of the third
region and a portion of the fourth region form a second duplex
structure therebetween, the second duplex structure including a
nucleic acid cleaving agent recognition sequence which is absent
from the first duplex structure and which, when cleaved, indicates
hybridization of the oligonucleotide or assembly of
oligonucleotides to the target nucleic acid sequence and therefore
indicates the presence of the target nucleic acid in the
sample.
[0020] According to another aspect of the present invention there
is provided a method of detecting a presence or an absence of a
target nucleic acid sequence in a sample, the method comprising the
steps of (a) contacting the sample with an oligonucleotide or
assembly of oligonucleotides under predetermined hybridization
conditions so as to form a reaction mixture, the oligonucleotide or
assembly of oligonucleotides including (i) a first region and a
second region, at least a portion of the first region and at least
a portion of the second region each being capable of hybridizing
with the target nucleic acid sequence; and (ii) a third region and
a fourth region, the third region and the fourth region being
linked to the first region and the second region, respectively, a
first portion and a second portion of the oligonucleotide or
assembly of oligonucleotides being capable of forming a first
duplex structure therebetween under the predetermined hybridization
conditions; the first, second, third and fourth regions of the
oligonucleotide or assembly of oligonucleotides being selected such
that upon hybridization under the predetermined hybridization
conditions of the first region and the second region with the
target nucleic acid sequence, the first duplex structure
dissociates and a second portion of the third region and a second
portion of the fourth region form a second duplex structure
therebetween, the second duplex structure including a nucleic acid
cleaving agent recognition sequence which is absent from the first
duplex structure; (b) adding a nucleic acid cleaving agent to the
reaction mixture, such that, if the target nucleic acid sequence is
present in the sample, the nucleic acid cleaving agent recognition
sequence is formed and cleaved by the cleaving agent; and (c)
monitoring cleavage of the nucleic acid cleaving agent recognition
sequence by the nucleic acid cleaving agent; wherein cleavage of
the nucleic acid cleaving agent recognition sequence by the nucleic
acid cleaving agent indicates hybridization of the oligonucleotide
or assembly of oligonucleotides to the target nucleic acid sequence
and therefore the presence of the target nucleic acid in the
sample.
[0021] According to further features in preferred embodiments of
the invention described below, the first portion and the second
portion of the oligonucleotide or assembly of oligonucleotides
being capable of forming the first duplex structure therebetween
under the predetermined hybridization conditions are derived from
the third and forth regions, respectively.
[0022] According to still further features in the described
preferred embodiments the first, second, third and fourth regions
of the oligonucleotide or assembly of oligonucleotides are further
selected such that following cleavage of the nucleic acid cleaving
agent recognition sequence, the first and second regions dissociate
from the target nucleic acid sequence, thereby enabling recycling
of the target nucleic acid sequence.
[0023] According to still another aspect of the present invention
there is provided an oligonucleotide system useful for detecting a
presence or an absence of a target nucleic acid sequence in a
sample comprising at least a first oligonucleotide and a second
oligonucleotide, each of the first oligonucleotide and the second
oligonucleotide including a first region being capable of
hybridizing with the target nucleic acid sequence under
predetermined hybridization conditions, each of the first
oligonucleotide and the second oligonucleotide further including a
second region, wherein upon hybridization, at least a portion of
the second regions of the first oligonucleotide and the second
oligonucleotide form a duplex structure including a nucleic acid
cleaving agent recognition sequence, the second regions of the
first oligonucleotide and the second oligonucleotide being selected
such that in a presence of a nucleic acid cleaving agent
recognizing the nucleic acid cleaving agent recognition sequence,
only the first oligonucleotide is cleavable by the nucleic acid
cleaving agent.
[0024] According to an additional aspect of the present invention
there is provided a method of detecting a presence or an absence of
a target nucleic acid sequence in a sample, the method comprising
the steps of (a) contacting the sample with an oligonucleotide
system under hybridization conditions so as to form a reaction
mixture, the oligonucleotide system including at least a first
oligonucleotide and a second oligonucleotide, each of the first
oligonucleotide and the second oligonucleotide including a first
region being capable of hybridizing under predetermined
hybridization conditions with the target nucleic acid sequence,
each of the first oligonucleotide and the second oligonucleotide
further including a second region, wherein upon hybridization under
the predetermined hybridization conditions, at least a portion of
the second regions of the first oligonucleotide and the second
oligonucleotide form a duplex structure including a nucleic acid
cleaving agent recognition sequence, the second regions of the
first oligonucleotide and the second oligonucleotide being selected
such that in a presence of a nucleic acid cleaving agent
recognizing the nucleic acid cleaving agent recognition sequence,
only the first oligonucleotide is cleavable by the nucleic acid
cleaving agent; (b) adding the nucleic acid cleaving agent to the
reaction mixture, such that, if the target nucleic acid sequence is
present in the sample, the nucleic acid cleaving agent recognition
sequence is cleaved by the nucleic acid cleaving agent; and (c)
monitoring cleavage of the nucleic acid cleaving agent recognition
sequence by the nucleic acid cleaving agent; wherein cleavage of
the nucleic acid cleaving agent recognition sequence by the nucleic
acid cleaving agent indicates hybridization of the oligonucleotide
system to the target nucleic acid sequence and therefore the
presence of the target nucleic acid in the sample.
[0025] According to further features in preferred embodiments of
the invention described below, the first and second regions of the
first and second oligonucleotides are selected such that upon
cleavage of the first oligonucleotide, the first region of the
first oligonucleotide dissociates from the target nucleic acid
sequence.
[0026] According to still further features in the described
preferred embodiments the first region of the second
oligonucleotide is selected such that under the predetermined
hybridization conditions and following dissociation of the first
oligonucleotide, the first region of the second oligonucleotide
remains hybridized to the target nucleic acid sequence, thereby
allowing recycling of the target nucleic acid sequence with respect
to the first oligonucleotide.
[0027] According to yet an additional aspect of the present
invention there is provided an oligonucleotide system useful for
detecting a presence or an absence of a target nucleic acid
sequence in a sample comprising at least a first oligonucleotide
and a second oligonucleotide, each of the first oligonucleotide and
the second oligonucleotide including a first region being
complementary or substantially complementary to the target nucleic
acid sequence, each of the first oligonucleotide and the second
oligonucleotide further including a second region, the second
regions of the first and second oligonucleotides being
complementary or substantially complementary and being selected
such that upon annealing therebetween the second regions form a
duplex structure including a nucleic acid cleaving agent
recognition sequence, wherein under predetermined hybridization
conditions the first region of the first oligonucleotide is stably
hybridizable with the target nucleic acid sequence only if the
first region of the second oligonucleotide is stably hybridizable
with the nucleic acid target sequence.
[0028] According to still an additional aspect of the present
invention there is provided a method of detecting a presence or an
absence of a target nucleic acid sequence in a sample, the method
comprising the steps of (a) contacting the sample with an
oligonucleotide system so as to form a reaction mixture, the
oligonucleotide system including at least a first oligonucleotide
and a second oligonucleotide, each of the first oligonucleotide and
the second oligonucleotide including a first region being
complementary or substantially complementary to the target nucleic
acid sequence, each of the first oligonucleotide and the second
oligonucleotide further including a second region, the second
regions of the first and second oligonucleotides being
complementary or substantially complementary and being selected
such that upon annealing therebetween the second regions form a
duplex structure including a nucleic acid cleaving agent
recognition sequence, wherein under the predetermined hybridization
conditions the first region of the first oligonucleotide is stably
hybridizable with the target nucleic acid sequence only if the
first region of the second oligonucleotide is stably hybridizable
with the nucleic acid target sequence; (b) adding a nucleic acid
cleaving agent to the reaction mixture, such that, if the target
nucleic acid sequence is present in the sample, the nucleic acid
cleaving agent recognition sequence is cleaved by the nucleic acid
cleaving agent; and (c) monitoring cleavage of the nucleic acid
cleaving agent recognition sequence by the nucleic acid cleaving
agent; wherein cleavage of the nucleic acid cleaving agent
recognition sequence by the nucleic acid cleaving agent indicates
hybridization of the oligonucleotide system to the target nucleic
acid sequence and therefore the presence of the target nucleic acid
in the sample.
[0029] According to further features in preferred embodiments of
the invention described below, under the predetermined
hybridization conditions the second regions of the first and second
oligonucleotides are substantially non-hybridizable with one
another per se.
[0030] According to still further features in the described
preferred embodiments the second regions of the first
oligonucleotide and the second oligonucleotide are selected such
that in a presence of a nucleic acid cleaving agent recognizing the
nucleic acid cleaving agent recognition sequence, only the first
oligonucleotide is cleavable by the nucleic acid cleaving
agent.
[0031] According to still further features in the described
preferred embodiments the first and second regions of the first and
second oligonucleotides are selected such that under the
predetermined hybridization conditions and upon cleavage of the
first oligonucleotide, the first region of the first
oligonucleotide dissociates from the target nucleic acid
sequence.
[0032] According to still further features in the described
preferred embodiments at least one nucleotide or internucleotidic
bond of the second oligonucleotide which forms a part of the
nucleic acid cleaving agent recognition sequence is a modified or
analogous nucleotide or internucleotidic bond, selected so as to
prevent cleavage of the second oligonucleotide by the nucleic acid
cleaving agent.
[0033] According to still further features in the described
preferred embodiments the duplex structure is formed in part by
self annealing of a portion of the second region of the first
oligonucleotide.
[0034] According to still further features in the described
preferred embodiments the second regions of the first and second
oligonucleotides are selected such that the nucleic acid cleaving
agent recognition sequence is characterized by a nick replacing an
internucleotidic bond cleavable by the nucleic acid cleaving
agent.
[0035] According to yet a further aspect of the present invention
there is provided an oligonucleotide system useful for detecting a
presence or an absence of a target nucleic acid sequence in a
sample comprising at least a first oligonucleotide and a second
oligonucleotide, each of the first oligonucleotide and the second
oligonucleotide including a first region being complementary or
substantially complementary to the target nucleic acid sequence,
each of the first oligonucleotide and the second oligonucleotide
further including a second region, the second regions of the first
and second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween the second regions form a duplex structure including a
nucleic acid cleaving agent recognition sequence, wherein under
predetermined hybridization conditions the first regions of the
first oligonucleotide and the second oligonucleotide are stably
hybridizable with the target nucleic acid sequence, and the second
regions of the first oligonucleotide and the second oligonucleotide
are stably hybridizable therebetween only when the first
oligonucleotide, the second oligonucleotide and the target nucleic
acid sequence are co-annealed.
[0036] According to still a further aspect of the present invention
there is provided a method of detecting a presence or an absence of
a target nucleic acid sequence in a sample, the method comprising
the steps of (a) contacting the sample with an oligonucleotide
system so as to form a reaction mixture, the oligonucleotide system
including at least a first oligonucleotide and a second
oligonucleotide, each of the first oligonucleotide and the second
oligonucleotide including a first region being complementary or
substantially complementary to the target nucleic acid sequence,
each of the first oligonucleotide and the second oligonucleotide
further including a second region, the second regions of the first
and second oligonucleotides being complementary or substantially
complementary and being selected such that upon annealing
therebetween the second regions form a duplex structure including a
nucleic acid cleaving agent recognition sequence, wherein under
predetermined hybridization conditions the first regions of the
first oligonucleotide and the second oligonucleotide are stably
hybridizable with the target nucleic acid sequence, and the second
regions of the first oligonucleotide and the second oligonucleotide
are stably hybridizable therebetween only when the first
oligonucleotide, the second oligonucleotide and the target nucleic
acid sequence are co-annealed; (b) adding a nucleic acid cleaving
agent to the reaction mixture, such that, if the target nucleic
acid sequence is present in the sample, the nucleic acid cleaving
agent recognition sequence is cleaved by the nucleic acid cleaving
agent; and (c) monitoring cleavage of the nucleic acid cleaving
agent recognition sequence by the nucleic acid cleaving agent;
wherein cleavage of the nucleic acid cleaving agent recognition
sequence by the nucleic acid cleaving agent indicates hybridization
of the oligonucleotide system to the target nucleic acid sequence
and therefore the presence of the target nucleic acid in the
sample.
[0037] The present invention successfully addresses the
shortcomings of the presently known configurations by providing
oligonucleotides or assemblies of oligonucleotides which enable the
simple and efficient detection of target nucleic acid sequences
while reducing the reaction order or the background signal
generation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The invention is herein described, by way of example only,
with reference to the accompanying drawings. With specific
reference now to the drawings in detail, it is stressed that the
particulars shown are by way of example and for purposes of
illustrative discussion of the preferred embodiments of the present
invention only, and are presented in the cause of providing what is
believed to be the most useful and readily understood description
of the principles and conceptual aspects of the invention. In this
regard, no attempt is made to show structural details of the
invention in more detail than is necessary for a fundamental
understanding of the invention, the description taken with the
drawings making apparent to those skilled in the art how the
several forms of the invention may be embodied in practice.
[0039] In the drawings:
[0040] FIG. 1 is a schematic depiction demonstrating the steps of a
detection method according to one preferred aspect of the present
invention.
[0041] FIG. 2 depicts the structure of a single oligonucleotide and
a nucleotide assembly of the present invention when hybridized to a
target nucleic acid sequence.
[0042] FIGS. 3a-b depict the domain structure and regions of a
paired oligonucleotide (FIG. 3a) and a looped oligonucleotide (FIG.
3b) according to the present invention showing the melting
temperature (Tm) and free energy (.DELTA.G) of the target
hybridizing (first and second regions) and stem forming regions
(third and fourth regions).
[0043] FIG. 4 is a restriction map showing the regions of the
various CMV-DNA preparations (1-8) derived from a 263 bp CMV-DNA
template fragment and which were used as target nucleic acid
sequences while reducing the present invention to practice. Arrows
indicate the site of enzymatic cleavage. A=AflII; D=DdeI; F=Fnu4HI;
H=HaeIII.
[0044] FIGS. 5a-e are photographs of 12.5% native polyacrylamide
gels depicting the effects of stem and arms regions on
hybridization of paired biotinylated oligonucleotide probes to
CMV-DNA. The biotinylated oligonucleotides were visualized as
described in the Examples section that follows. The number at the
bottom of each lane represents the hybridization incubation
temperature. Asterisk--biotin tag.
[0045] FIG. 6 is a photograph of a 12.5% native polyacrylamide gel
depicting the effect of arm region length on recycling of CMV-DNA
by paired oligonucleotide probes. Pair 2 and pair 3 were incubated
in the presence (+) or absence (-) of template DNA. Following the
hybridization step, 0.17 unit/.mu.l of BstBI was added to each tube
and cleavage was allowed to proceed for 2 h. Biotinylated fragments
were visualized as described in the Examples section that follows.
Asterisk--biotin tag.
[0046] FIG. 7 is a photograph of a 12.5% native polyacrylamide gel
depicting chromatographic separation of a single looped
oligonucleotide probe, either prehybridized with template DNA (+)
or not (-) and either cleaved by TaqI (T) and BstBI (B) or not (H).
Asterisk--biotin tag.
[0047] FIGS. 8a-b are photographs of 12.5% native polyacrylamide
gels depicting chromatographic separation of a hybridized and
non-hybridized looped biotinylated oligonucleotide reacted with a
long double stranded target DNA (p.CMV-263.ds, Table 1) (FIG. 8a)
or a shorter double stranded target DNA (p.CMV-2.st, Table 1) (FIG.
8b). The biotinylated oligonucleotide was visualized as described
in the Examples section that follows. The number at the top of each
lane represents the hybridization incubation temperature.
Asterisk--biotin tag.
[0048] FIGS. 9a-b are photographs of 12.5% native polyacrylamide
gels depicting chromatographic separation of looped biotinylated
oligonucleotides reacted with either single stranded target DNA
(antisense CMV-2.st, Table 1) or with ds target DNA of the same
length (syn.CMV-2.st, Table 1). The biotinylated oligonucleotide
and hybridization products were visualized as described in the
Examples section that follows. Asterisk--biotin tag.
[0049] FIGS. 10a-c are photographs of 12.5% polyacrylamide gels
depicting chromatographic separation of a looped oligonucleotide
probe following hybridization with decreasing concentrations of
single stranded target DNA and following enzymatic cleavage. The
assay consisted of two identical sets of seven tubes, each
supplemented with decreasing amounts of single stranded CMV target
DNA (35 nucleotide long) (antisense CMV-2.st, Table 1). The molar
ratio between antisense CMV-2.st and the looped oligonucleotide
probes was 1:1, 1:4, 1:10, 1:40, 1:100, 1:400 in tubes 1 to 6,
respectively. No CMV-DNA was added to tube number 7. FIG. 10a
represents samples at the end of a hybridization step. FIG. 10b
represents samples following cleavage of the oligonucleotide for
two hours and separation under denaturing conditions to detect
single stranded biotinylated fragments. FIG. 10c represents samples
identical to that of FIG. 10b but separated on a native gel, to
detect both double stranded and single stranded fragments.
Biotinylated fragments were visualized as described in the Examples
section that follows. Asterisk--biotin tag.
[0050] FIGS. 11a-c illustrate the effect of long and short
oligonucleotide anchors on cleaved-product accumulation. A 12.5%
polyacrylamide gel electrophoresis of target and probe members
following cleavage was blotted onto a membrane (FIG. 11a) which was
scanned and analyzed. FIGS. 11b-c illustrate the cleavage
efficiency (FIG. 11b) and the increase in cleavage of the amplifier
oligonucleotide member (FIG. 11c) when longer anchor members are
utilized.
[0051] FIG. 12 is a graph illustrating amplifier cleavage product
as a function of target DNA concentration; amplification factors
are presented to the right of each data point. The Inset
illustrates a 15% denaturing polyacrylamide gel separation of
samples containing 0, 2 amol, 20 amol, 200 amol, 2 fmol and 20 fmol
of the target.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0052] The present invention is of oligonucleotides and method
employing same which can be used for the detection of target
nucleic acid sequences. Specifically, the present invention can be
used to detect the presence or absence of a specific target nucleic
acid sequence by utilizing oligonucleotide probes which when
annealed to the template sequence(s) form an intrinsic (endogenous)
cleavage site therebetween. Subsequent cleavage of this cleavage
site leads to the generation of a detectable signal and may also
dissociate one or more of the oligonucleotide(s) from the target
nucleic acid sequence, and as such allows template recycling and
signal amplification.
[0053] The principles and operation of the oligonucleotides and
methods according to the present invention may be better understood
with reference to the drawings and accompanying descriptions.
[0054] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details set forth in the following
description or exemplified by the Examples. The invention is
capable of other embodiments or of being practiced or carried out
in various ways. Also, it is to be understood that the phraseology
and terminology employed herein is for the purpose of description
and should not be regarded as limiting.
[0055] As used herein the terms "oligonucleotide" and "probe" and
the phrase "oligonucleotide probe" are used interchangeably to
refer to a single stranded nucleic acid molecule or assembly of
single stranded nucleic acid molecules which can exhibit one or
more partial double stranded conformations. Such molecule(s) can be
used according to the present invention for the detection of the
presence or absence of a single stranded or a double stranded
(following appropriate denaturation) target nucleic acid sequence
as is further described herein.
[0056] As used throughout, the term "template" or the phrase
"target nucleic acid sequence" refer to a nucleic acid template
which is either naturally in a single stranded form, such as
messenger RNA, or is denatured into a single stranded form, such as
DNA. The target nucleic acid sequence according to the present
invention can be in a crude, partially purified or purified form
and may have varying degree of complexity depending on its origin.
As used herein a specific target nucleic acid sequence may differ
from another specific target nucleic acid sequence by even a single
nucleotide, e.g., a point mutation, or by a plurality of
nucleotides.
[0057] As herein the phrase "complementary or substantially
complementary" refers to sequences that may base pair under
predetermined hybridization conditions of temperature and ionic
strength and/or the presence of template. "Substantially
complementary" refers to at least 50% complementary, preferably, at
least 60% complementary, more preferably, at least 70%
complementary, still preferably, at least 80% complementary,
advantageously, between 90% and 100% complementary.
[0058] As is further detailed hereinunder, to enable detection, the
oligonucleotide or oligonucleotides assembly of the present
invention are preferably tagged with a detection moiety or
moieties. It will be appreciated however, and it is further
detailed hereinbelow, that detection according to the present
invention can also be effected without the incorporation of such
detection moieties onto these oligonucleotide(s).
[0059] The following paragraphs describe oligonucleotide probes
which are taught by the prior art yet are used in accordance with
the teachings of the present invention with certain restrictions to
be further emphasized below, which restrictions result in far
superior detection of target nucleic acids due to signal
amplification and/or reduction of background signal.
[0060] Thus, according to one aspect of the present invention there
is provided an oligonucleotide or an assembly of oligonucleotides
useful for detecting the presence or absence of a target nucleic
acid sequence in a sample. The oligonucleotide or the assembly of
oligonucleotides according to this aspect of the present invention
is capable of forming a duplex structure intrinsic to the
oligonucleotide or the assembly of oligonucleotides upon
hybridization with the target nucleic acid sequence, meaning that
the duplex structure formed as a result of template hybridization
includes only sequences contributed by the oligonucleotide or the
assembly of oligonucleotides.
[0061] The duplex structure thus formed includes a nucleic acid
cleaving agent recognition sequence (site), such that subsequent
cleavage of this site is detectable, e.g., via the production of a
detectable signal. The specifics of a detection reaction including
preferred conditions and solutions and preferred target nucleic
acid sequence-oligonucleotide(s) ratios, and the like, are further
described throughout the Examples section that follows in context
of a variety of particular oligonucleotide(s) which correspond to
the above criteria.
[0062] A typical configuration of the oligonucleotide or the
assembly of oligonucleotides of the present invention, includes a
first region and a second region. At least a portion of the first
region and at least a portion of the second region are each
independently complementary to at least a portion of the target
nucleic acid sequence. That is to say that portions of the target
nucleic acid sequence can co-hybridize to at least a portion of the
first region and at least a portion of the second region at the
same time. Thus, at least a portion of the first region and at
least a portion of the second region hybridize to different,
typically adjacent, subregions of the target nucleic acid
sequence.
[0063] The oligonucleotide or the assembly of oligonucleotides of
this aspect of the present invention further include a third region
and a fourth region which are respectively linked either directly
or through a spacer region of say 1-6 nucleotide bases to the first
region and the second region, preferably through a covalent
phosphodiester bond or an analog thereof.
[0064] The third and fourth regions are configured such that upon
hybridization of the first region and the second region with the
target nucleic acid sequence, at least a portion of the third
region and at least a portion of the fourth region anneal to form a
duplex structure therebetween. This duplex structure includes a
nucleic acid cleaving agent recognition sequence which is described
in more detail hereinbelow and in the Examples section that
follows.
[0065] Cleavage of the recognition sequence by an appropriate
nucleic acid cleaving agent leads to the separation of at least a
portion of at least one of the third and the fourth regions from
the first and the second regions, respectively.
[0066] As is further detailed hereinbelow, this cleavage and
separation, which occurs according to the present invention
substantially only or preferably in cases in which the
oligonucleotide or the assembly of oligonucleotides hybridize with
the target nucleic acid sequence, is used to detect the presence of
that specific target nucleic acid sequence.
[0067] It will be appreciated that since the first and second
regions of the oligonucleotide or assembly of oligonucleotides is
responsible for hybridizing to a specific template nucleic acid
sequence, these regions are synthesized accordingly to recognize
and anneal to the target nucleic acid sequence. As such, when
synthesizing probes according to the teachings of the present
invention, the first and second regions must be designed in
accordance with the specific target nucleic acid sequence targeted
to be detected. On the other hand, since the third and fourth
regions are responsible for forming the intrinsic duplex and the
cleaving agent recognition sequence, these regions are typically
universal and as such can be utilized by many specific
oligonucleotides of the present invention. However, there are cases
in which the "universal" third and fourth regions can not be used
with a target specific first and second regions. For example, when
such use is not energetically favorable or when the cleaving agent
recognition sequence included within the duplex is also present in
the first and/or the second regions when hybridized to the target.
Under such circumstances, the third and fourth regions must be
suitably redesigned.
[0068] According to one embodiment of the present invention the
assembly of oligonucleotides is a bi-molecular oligonucleotide
including two oligonucleotide molecules, such that a first
oligonucleotide of the assembly includes the above mentioned first
and third regions and further such that a second oligonucleotide of
the assembly includes the above mentioned second and fourth
regions.
[0069] According to another embodiment of the present invention a
single oligonucleotide molecule is employed. In this case, the
third and fourth regions are linked therebetween, preferably via a
covalent phosphodiester bond, such that a stem and loop structure
is formed by the third and fourth regions when at least a portion
of the third region and at least a portion of the fourth region
anneal to form the duplex described above.
[0070] According to another embodiment of the present invention,
both the first and the second regions of the oligonucleotide
dissociate from the target nucleic acid sequence upon separation of
at least a portion of the third and fourth regions from the first
region and the second region. In this case, cleavage and subsequent
separation of either the third or fourth regions, or both, leads to
the dissociation of the first and/or second regions from the target
nucleic acid sequence. This dissociation allows a second identical
oligonucleotide molecule to hybridize to the target nucleic acid
sequence and go through a similar process of cleavage and
separation.
[0071] It will be appreciated that in the case of a bimolecular
probe in which the third and fourth regions are not attached
therebetween, separation thereof from the first and second regions,
respectively, following cleavage is not interdependent.
[0072] As so far described, the above oligonucleotide probes which
are further described and their use exemplified in Example 3 under
"Paired probes--First generation" and in Example 6 under "Single
probes--First generation" are similar in structure and function to
the oligonucleotide probes described by Hogan et al., (U.S. Pat.
No. 5,451,503).
[0073] Although these oligonucleotide probe configurations can be
utilized for detection of target nucleic acid sequences they still
suffer from several inherent limitations, such as, for example, low
signal generation and template independent cleavage and signal
generation.
[0074] Thus, while reducing the present invention to practice, the
inventors experimented with various oligonucleotide probe
configurations in efforts to traverse the limitations inherent to
the oligonucleotide probes described hereinabove and in U.S. Pat.
No. 5,451,503.
[0075] As is further described in Examples 3-6 below, the
experimentation conducted by the inventors of the present invention
yielded novel probe configurations which (i) enable to
substantially reduce template independent cleavage; (ii) reduce the
reaction order; and (iii) allow for template recycling and signal
amplification.
[0076] Thus, according to a presently preferred aspect of the
present invention, and as specifically described in Example 6 of
the Examples section which follows (see the "Looped probe variants"
and "Blocked probes" sections), there is provided a single
oligonucleotide or a bi-molecular oligonucleotide probe
(oligonucleotide system or assembly) which are configured so as to
form a first duplex structure devoid of the nucleic acid cleaving
agent recognition sequence when not hybridized with the target
nucleic acid sequence, while following hybridization form a second
duplex structure which includes a nucleic acid cleaving agent
recognition sequence.
[0077] This feature of this aspect of the present invention is
enabled by designing the probe such that following hybridization
with the target sequence, the first duplex structure is less
favored energetically then a second duplex structure. This ensures
that the first duplex structure is only formed in the absence of
the target nucleic acid sequence. As is further detailed and
exemplified in Example 6, the formation of this first duplex
structure which is devoid of the nucleic acid cleaving agent
recognition sequence substantially reduces background signal
generated by target independent duplex and cleavage site formation
which can occur when utilizing the probes described in, for
example, U.S. Pat. No. 5,451,503.
[0078] As is further detailed in Examples 3-4 of the Examples
section which follows, a preferred bimolecular oligonucleotide
probe of the present invention, is configured such that template
hybridization of a first oligonucleotide member of the bimolecular
probe is dependent on preceding template hybridization of a second
oligonucleotide member of the bimolecular probe which preferably
serves as a non recycled or permanent anchor.
[0079] As such, and according to another presently preferred aspect
of the present invention, there is provided a bi-molecular probe
which is configured such that the target complementary region of
one of its oligonucleotide members is selected so as to allow
hybridization thereof only following hybridization of the other
oligonucleotide member to the target, to thereby reduce the overall
reaction order by a single unit or close to a single unit. It will
be appreciated in this respect that the oligonucleotide that is
selected to stably hybridize with the target is recycled along with
the target. No further hybridization/dissociation thereof is
required to maintain hybridization/dissociation of the other
oligonucleotide and thereby the reaction order is reduced, its
specificity increased and the signal generated is amplified. In
addition, such a configuration reduced to a great extent single
stranded target depletion due to target reassociation.
[0080] According to a preferred embodiment of the present
invention, the bi-molecular probe is designed such that following
hybridization of both oligonucleotide members, only the first
oligonucleotide member of the bi-molecular oligonucleotide probe is
cleaved by the cleaving agent (see SpltRE and ModRE/MutRE of
Example 3). As a result of this cleavage, only this oligonucleotide
member is dissociated from the template while the other uncleaved
oligonucleotide member remains anchored to the template and is
recycled therewith so as to effect reaction order reduction.
[0081] Preferably, in this case, the target complementary region of
the non-cleavable oligonucleotide member is selected having a
melting temperature higher than that of the cleavable
oligonucleotide member so as to allow this member to remain
hybridized with the template following dissociation of the first
oligonucleotide member.
[0082] To enable single member cleavage, the bi-molecular
oligonucleotide assemblies of the present invention can be
configured such that a portion of the duplex structure is formed by
self annealing of a portion of the cleavable oligonucleotide member
which does not participate in target hybridization (see FIG. 1).
The portion of the duplex structure formed can then include at
least a portion of the cleaving agent recognition sequence thus
allowing cleavage of only the oligonucleotide of the bi-molecular
oligonucleotide assembly which forms such self annealing while the
other oligonucleotide serves as an anchor similar to that described
hereinabove. In this case, the cleavable duplex is designed to
include a nick replacing one of the internucleotidic bonds
cleavable by the cleaving agent.
[0083] Alternatively, the cleaving agent recognition sequence in
the non-cleavable oligonucleotide can include at least one modified
nucleotide or internucleotidic bond, thus blocking cleavage of a
desired strand of the duplex.
[0084] Still alternatively, an endonuclease characterized by single
strand nicking activity of double stranded DNA (as opposed to
complete, double nick restriction activity) can be employed,
provided that the oligonucleotides include the appropriate
recognition sequence. An examples of such an endonuclease is
N.BstNBI distributed by New England Biolabs.
[0085] For example, any one of several modificants some of which
are further listed hereinbelow can be employed either during or
following synthesis of the oligonucleotide so as to construct a
cleaving agent recognition sequence which is recognized by a
specific cleaving agent but which is cleaved in only one strand of
the duplex. In the case of an endonuclease cleaving agent, the
recognition sequence of the uncleavable strand can include
methylation or acetylation on one or more of the nucleotides
included within the recognition sequence, such that a specific
endonuclease recognizes and binds with the double stranded
recognition sequence but only cleaves (nicks) the unmodified
strand.
[0086] In another embodiment of the present invention the reaction
order of a bi-molecular oligonucleotide probe is maintained,
however, the oligonucleotide members of the probe are selected so
as to, a great extent, reduce a level of bi-molecular interactions
between the oligonucleotide members between themselves or any of
the members and the target nucleic acid sequence. As a result, both
the level of background is significantly reduced and template
recycling following cleavage is also achieved, resulting in far
improved and specific detection.
[0087] The following paragraphs describe several aspects of the
present invention which are clearly distinct from and are clearly
advantageous over the prior art, U.S. Pat. No. 5,451,503, in
particular, in that each provides (i) signal amplification by
reducing reaction order; (ii) signal amplification by template
recycling; and/or (iii) reduced background by prevention of
template independent cleavage.
[0088] Thus, according to one aspect of the present invention there
is provided an oligonucleotide or assembly of oligonucleotides
useful in detecting a presence or an absence of a target nucleic
acid sequence in a sample. The oligonucleotide or assembly of
oligonucleotides according to this aspect of the present invention
comprising a first region and a second region. At least a portion
of the first region and at least a portion of the second region
each is capable of hybridizing under predetermined hybridization
conditions with the target nucleic acid sequence. The
oligonucleotide or assembly of oligonucleotides according to this
aspect of the present invention further comprising a third region
and a fourth region. The third region and the fourth region being
linked to the first region and the second region, respectively. A
first portion and a second portion of the oligonucleotide or
assembly of oligonucleotides are selected capable of forming a
first duplex structure therebetween under the predetermined
hybridization conditions. Preferably, the first portion and the
second portion of the oligonucleotide or assembly of
oligonucleotides are capable of forming the first duplex structure
therebetween under the predetermined hybridization conditions are
derived from the third and forth regions, respectively. In any
case, the first, second, third and fourth regions of the
oligonucleotide or assembly of oligonucleotides of this aspect of
the present invention are selected such that upon hybridization
under the predetermined hybridization conditions of the first
region and the second region with the target nucleic acid sequence,
the first duplex structure dissociates and a portion of the third
region and a portion of the fourth region form a second duplex
structure therebetween. The second duplex structure includes a
nucleic acid cleaving agent recognition sequence which is absent
from the first duplex structure and which, when cleaved, indicates
hybridization of the oligonucleotide or assembly of
oligonucleotides to the target nucleic acid sequence and therefore
indicates the presence of the target nucleic acid in the sample. As
a result, background signal associated with template independent
cleavage is reduced to a great extent. In a preferred embodiment of
this aspect of the present invention the first, second, third and
fourth regions of the oligonucleotide or assembly of
oligonucleotides are further selected such that following cleavage
of the nucleic acid cleaving agent recognition sequence, the first
and second regions dissociate from the target nucleic acid
sequence, thereby enabling recycling of the target nucleic acid
sequence and signal amplification.
[0089] According to another aspect of the present invention there
is provided an oligonucleotide system useful for detecting a
presence or an absence of a target nucleic acid sequence in a
sample. The oligonucleotide system according to this aspect of the
invention comprising at least a first oligonucleotide and a second
oligonucleotide, each of which includes a first region capable of
hybridizing with the target nucleic acid sequence under
predetermined hybridization conditions. Each of the first
oligonucleotide and the second oligonucleotide further includes a
second region, wherein upon hybridization, at least a portion of
the second regions of the first and second oligonucleotides form a
duplex structure which includes a nucleic acid cleaving agent
recognition sequence, whereby the second regions of the first
oligonucleotide and the second oligonucleotide are selected such
that in the presence of a nucleic acid cleaving agent recognizing
the nucleic acid cleaving agent recognition sequence, only the
first oligonucleotide is cleavable by the nucleic acid cleaving
agent. In this case, selecting the second oligonucleotide having
sufficient stability to hybridize with the target nucleic acid
sequence in the absence of the first oligonucleotide would result
in reduction of the reaction order, contributing to an increase in
signal formation. Thus, preferably, the first and second regions of
the first and second oligonucleotides are selected such that upon
cleavage of the first oligonucleotide, the first region of the
first oligonucleotide dissociates from the target nucleic acid
sequence. Still preferably, the first region of the second
oligonucleotide is selected such that under the predetermined
hybridization conditions and following dissociation of the first
oligonucleotide, the first region of the second oligonucleotide
remains hybridized to the target nucleic acid sequence, thereby
allowing recycling of the target nucleic acid sequence with respect
to the first oligonucleotide.
[0090] According to yet an additional aspect of the present
invention there is provided an oligonucleotide system useful for
detecting a presence or an absence of a target nucleic acid
sequence in a sample. The oligonucleotide system comprising at
least a first oligonucleotide and a second oligonucleotide, each of
which includes a first region which is complementary or
substantially complementary to the target nucleic acid sequence and
each of which further includes a second region, the second regions
are complementary or substantially complementary and are selected
such that upon annealing therebetween they form a duplex structure
which includes a nucleic acid cleaving agent recognition sequence,
whereby under predetermined hybridization conditions the first
region of the first oligonucleotide is stably hybridizable with the
target nucleic acid sequence only if the first region of the second
oligonucleotide is stably hybridizable with the nucleic acid target
sequence, to thereby reduce the reaction order, reduce the
background signal and increase the specificity. Template recycling
is enabled in this case by selecting the other oligonucleotide such
that following restriction thereof, it is released from the target.
Preferably, under the predetermined hybridization conditions the
second regions of the first and second oligonucleotides are
substantially non-hybridizable with one another per se, so as to
further reduce the background signal. Still preferably, the second
regions of the first oligonucleotide and the second oligonucleotide
are selected such that in the presence of a nucleic acid cleaving
agent recognizing the nucleic acid cleaving agent recognition
sequence, only the first oligonucleotide is cleavable by the
nucleic acid cleaving agent. Advantageously, the first and second
regions of the first and second oligonucleotides are selected such
that under the predetermined hybridization conditions and upon
cleavage of the first oligonucleotide, the first region of the
first oligonucleotide dissociates from the target nucleic acid
sequence. Still advantageously, at least one nucleotide or
internucleotidic bond of the second oligonucleotide which forms a
part of the nucleic acid cleaving agent recognition sequence is a
modified or analogous nucleotide or internucleotidic bond, selected
so as to prevent cleavage of the second oligonucleotide by the
nucleic acid cleaving agent. Optionally, the duplex structure is
formed in part by self annealing of a portion of the second region
of the first oligonucleotide. Preferably, the second regions of the
first and second oligonucleotides are selected such that the
nucleic acid cleaving agent recognition sequence is characterized
by a nick replacing an internucleotidic bond cleavable by the
nucleic acid cleaving agent.
[0091] According to yet a further aspect of the present invention
there is provided an oligonucleotide system useful for detecting a
presence or an absence of a target nucleic acid sequence in a
sample. The oligonucleotide system comprising at least a first
oligonucleotide and a second oligonucleotide, each of which
includes a first region selected complementary or substantially
complementary to the target nucleic acid sequence and each of which
further includes a second region, the second regions are
complementary or substantially complementary and are selected such
that upon annealing therebetween the second regions form a duplex
structure which includes a nucleic acid cleaving agent recognition
sequence, whereby under predetermined hybridization conditions the
first regions of the first oligonucleotide and the second
oligonucleotide are stably hybridizable with the target nucleic
acid sequence, and the second regions of the first oligonucleotide
and the second oligonucleotide are stably hybridizable therebetween
only when the first oligonucleotide, the second oligonucleotide and
the target nucleic acid sequence are co-annealed, so as to allow
template recycling and background signal reduction.
[0092] The general principle of a target nucleic acid detection
method according to one preferred aspect of the present invention
is exemplified by FIG. 1.
[0093] In a first step (marked as A), oligonucleotides 13 and 15 of
oligonucleotide system 12 are incubated with a target nucleic acid
sequence 14 under predetermined hybridization conditions.
Oligonucleotide 13 includes a fluorescer-quencher pair 17 which
when separated beyond a non-interacting distance lead to the
generation of a detectable signal.
[0094] In a second step (marked as B), hybridization between
oligonucleotides 13 and 15 and target 14 takes place. Such
hybridization can be either sequential or simultaneous depending on
the sequence and length of each region of oligonucleotides 13 and
15. For example, regions 16 and 18, of oligonucleotide 15 and
regions 20 and 22 of oligonucleotide 13 can be selected such that
hybridization of region 20 to target 14 is dependent upon preceding
hybridization of region 16 to target 14.
[0095] In any case, in a third step (as indicated by C), the duplex
structure including a cleaving agent recognition sequence, which
according to this aspect is formed in part by self annealing of
region 22 of oligonucleotide 13 and is thus nicked on one strand
(as indicated by 26), is cleaved by a cleaving agent 24 (further
described hereinbelow). Thus, only region 22 is cleaved by cleaving
agent 24 (indicated by 28) leading to the release of a portion of
region 22 and subsequent dissociation of region 20 from target
14.
[0096] As a result of the cleavage, region 22 is separated from
region 20 thus leading to the separation between the fluorescer and
quencher and the generation of a detectable signal.
[0097] Since oligonucleotide 15 is not cleaved and since it remains
hybridized to target 14 it therefor recycles therewith, thus
reducing the reaction order of the target nucleic acid detection
method according to this aspect of the present invention.
[0098] As is shown in FIG. 1, according to a presently preferred
embodiment of the present invention, for any of its aspects, all
reaction ingredients are premixed as opposed to their stepwise
addition. In some embodiments this calls for heat stability of the
restriction enzyme employed, such as Bstb1 or Taq1.
[0099] Thus, the above described aspects of the present invention
provide oligonucleotide probes or assemblies which are useful in
detection of target sequences and yet are devoid of the limitations
inherent to prior art oligonucleotide probes such as those
described in U.S. Pat. No. 5,451,503.
[0100] According to one preferred embodiment of the present
invention the cleaving agent is a chemical agent.
[0101] According to another preferred embodiment of the present
invention the cleaving agent is a nuclease including but not
limited to, an endonuclease, an exonuclease or a ribonuclease.
Preferably the nuclease is selected thermostable such that it can
be used in the temperature range used for oligonucleotide-target
sequence hybridization.
[0102] According to another preferred embodiment of the present
invention the nuclease is an endonuclease capable of recognizing
and cleaving a recognition sequence, formed by for example, a
DNA-DNA or DNA-RNA hybrid.
[0103] The recognition sequence is typically a palindromic sequence
at least 4 base pairs long and typically not more than 8 base pairs
long. Endonucleases which recognize longer stretches of nucleotides
or endonucleases which cleave at a site which is remote to the
recognition sequence can also be utilized by the present invention.
Normally, a specific endonuclease will recognize a specific base
pair sequence, bind to it and cleave one or both strands of the
duplex nucleic acid sequence depending on the cleaving agent used
and the nucleotides forming each strand of the cleaving agent
recognition sequence.
[0104] It will be appreciated, however, that several endonucleases
exhibit cleaving characteristics which change according to the
conditions or concentration of the endonuclease employed. This
includes the so called "star" activity of endonucleases, wherein
under suboptimal conditions some endonucleases cleave sequences in
addition to the specific sequences which are typically cleaved
thereby. Thus, endonucleases must be carefully selected, although,
as will be appreciated by one ordinarily skilled in the art, at
times, sub-optimal/non-recommended conditions are preferred in
order to allow concomitant cleavage, hybridization and
dissociation.
[0105] It will be appreciated that in order to design an
oligonucleotide or an assembly of oligonucleotides which form the
duplex structure and as such the cleaving agent recognition
sequence only when hybridized to the target nucleic acid sequence
or sequences, several parameters and considerations must be taken
into account. First, oligonucleotides of the present invention must
be able to hybridize to a target nucleic acid sequences at
hybridization conditions which allow differentiation between nearly
identical targets which for example vary in sequence by as little
as one nucleotide. Thus, for example, a mutated form of a gene
containing a single point mutation can be differentiated and
detected. Second, at least some of the oligonucleotides must be
synthesized with target hybridizing regions which are long enough
to allow hybridization but yet short enough to dissociate from
target following cleavage of the stem and to minimize overall
complexity of the molecule and as such the chances of undesirable
secondary structures formation. In addition, the target-specific
arms should not contain a cleaving agent recognition site. Third,
the regions which are responsible for the duplex structure
formation must be designed in both the single oligonucleotide and
the assembly of oligonucleotides such that the duplex structure is
formed substantially only or preferably following hybridization of
the oligonucleotide or the assembly of oligonucleotides to the
target nucleic acid sequence. Otherwise a high background signal
resultant from cleavage of target non-hybridized oligonucleotides
will be produced. Furthermore, the cleavage recognition sequence
must be chosen in accordance with preferred assay conditions and
length of stem. In addition, the stem should not interact with the
target specific arms. These and other considerations are further
discussed in detail in the Examples section that follows.
[0106] The oligonucleotide or the assembly of oligonucleotides of
the present invention can be DNA, RNA or PNA, or chimeric mixtures
or derivatives or modified versions thereof, so long as it is still
capable of hybridizing to the target nucleic acid sequence, and
still capable of forming a nucleic acid cleaving agent recognition
sequence cleavable in at least one strand by the cleaving agent.
The oligonucleotides can be modified at the base moiety, sugar
moiety, or phosphate backbone, and may include other appending
groups or labels, so long as it is still capable of functioning as
a detecting oligonucleotide according to the teachings of the
present invention. In addition, an oligonucleotide may also include
non-hybridizing moieties interposed between hybridizing moieties
thereof
[0107] Thus, an oligonucleotide according to the present invention
includes nucleotides or nucleotide analogs hybridizable with the
naturally occurring nucleobases and in addition may also include
non-hybridizing moieties.
[0108] For example, the oligonucleotide or assembly of
oligonucleotides may comprise at least one modified base moiety
such as, but not limited to 5-fluorouracil, 5-bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine,
4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomet-
hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N-6-isopente- nyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0109] Examples of modified sugar moieties incorporatable into the
oligonucleotide or the assembly of oligonucleotides of the present
invention include but are not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
[0110] Examples of modified phosphate backbone incorporatable into
the oligonucleotide or the assembly of oligonucleotides of the
present invention include but are not limited to, a
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
[0111] The oligonucleotides or the assembly of oligonucleotides of
the present invention may be derived by standard methods known in
the art, e.g., by de novo chemical synthesis of polynucleotides
using an automated DNA synthesizer (such as is commercially
available from Biosearch, Applied Biosystems, etc.) and standard
phosphoramidite chemistry.
[0112] A preferable method for synthesizing oligonucleotides is
conducted using an automated DNA synthesizer by methods known in
the art. As examples, phosphorothioate oligonucleotides may be
synthesized by the method of Stein et al. (1988, Nucl. Acids Res.
16:3209-3221), methylphosphonate oligonucleotides can be prepared
by use of controlled pore glass polymer supports (Sarin et al.,
1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. Once the
desired oligonucleotide is synthesized, it is cleaved from the
solid support on which it was synthesized and treated, by methods
known in the art, to remove any protecting groups present. The
oligonucleotide may then be purified by any method known in the
art, including extraction, gel purification and column
chromatography. The concentration of the synthesized
oligonucleotide can then be verified by methods well known in the
art.
[0113] It will be appreciated that the oligonucleotides of the
present invention can also be linked to a solid support either
following synthesis or by directly synthesizing the
oligonucleotides on an appropriate solid support. It will be
appreciated that when linked to a solid support the
oligonucleotides preferably include a spacer such that a linked
oligonucleotide or an assembly of linked oligonucleotides can
function as described hereinabove without suffering from spatial
limitations, which can limit the oligonucleotides from hybridizing
to a target nucleic acid sequence and forming the intrinsic duplex
structure.
[0114] As already mentioned hereinabove, the oligonucleotide or the
assembly of oligonucleotides according to the present invention
preferably include at least one detection moiety linked to the
oligonucleotide or the assembly of oligonucleotides in a manner so
as to enable detection of the separation of the region or regions
of the oligonucleotide or assembly of oligonucleotides.
[0115] Oligonucleotides of the invention may be labeled with
moieties during chemical synthesis of the oligonucleotide or the
label may be attached after synthesis by methods known in the
art.
[0116] According to one preferred embodiment of the present
invention a detection moiety is a directly detectable detection
moiety or indirectly detectable detection moiety. Examples of
directly detectable detection moieties include a radioactive ion,
such as .sup.32P, .sup.35S, .sup.3H, and the like, or a fluorescer
(examples of fluorescers are listed hereinbelow). In this case,
cleavage can be detected by simply monitoring the formation and
accumulation of cleavage products via various fractionation
techniques or chromatography and electrophoresis techniques which
can include for example, column chromatography, gel chromatography
or gel electrophoresis.
[0117] Examples of indirectly detectable detection moieties include
members of binding and/or chemically interacting pairs such as, but
are not limited to, an antibody, an antigen, an epitope, a ligand,
a receptor, an ion, a chelator, and the like. These detection
moiety types can also be detected using chromatography or
electrophoresis but produce detectable signals only when a
particular chemical reaction is conducted, such as an enzymatic
reaction. Such detection moieties are preferably selected heat
stable, so as to survive the denaturing and hybridization steps of
the detection reaction. For example, an oligonucleotide may be
indirectly labeled by incorporating therein a nucleotide covalently
linked to a hapten or to a molecule such as biotin, to which a
labeled avidin molecule may be bound, or digoxygenin, to which a
labeled anti-digoxygenin antibody may be bound. As is further
exemplified in the Examples section that follows, and while
reducing the present invention to practice, a biotin labeled
oligonucleotide was detected via a streptavidin conjugated enzyme
by using conventional gel electrophoresis.
[0118] In addition, indirectly detectable moieties can also be used
in affinity columns in which a hybridized oligonucleotide-target
sequence bound to the column is only released upon cleavage. Such
oligonucleotides are labeled during or following synthesis as
mentioned hereinabove
[0119] According to a preferred embodiment of the present invention
an oligonucleotide or an assembly of oligonucleotides can also be
labeled with at least one pair of resonantly interacting detection
moieties. For example, a first detection moiety and a second
detection moiety of a pair can each be linked to an oligonucleotide
or an assembly of oligonucleotides flanking the cleavage
recognition sequence, such that upon cleavage of the recognition
sequence by the cleaving agent separation of these moieties occurs.
The detection moieties are selected such that at least one of these
moieties is capable of producing a detectable signal when separated
to a non-interacting distance from the other detection moiety.
[0120] Examples of resonantly interacting pairs of detection
moieties which can be used while implementing the present
invention, include, but are not limited to, a fluorescer and a
quencher and any other type of fluorescent resonant energy transfer
(FRET) pairs (for reference, see for example, "Fluorescence
resonance energy transfer" by Paul R. Selvin, 1995, Methods in
Enzymol. Vol. 246, Chap. 13, pp. 300; and "Handbook of fluorescent
probes and research chemicals" by Richard P. Haugland, sixth ed.
Molecular probes. Specific examples of molecules which can be used
in fluorescent resonant energy transfer are listed hereinbelow.
[0121] The optimal distance between a first and a second detection
moieties of a pair when linked to the oligonucleotide probe will be
that distance wherein the emissions of the first moiety are
absorbed by the second moiety. This optimal distance varies with
the specific moieties used, and is defined by Forster Radius.
Forster Radius (Ro) is the distance between a donor and acceptor
that allows quenching of 50% of the excited donor molecules by the
quencher. Ro may be defined for any given FRET pair, and may be
used as the guideline for designing a FRET-labeled probe.
[0122] One of ordinary skill in the art can easily determine, using
art-known techniques of spectrophotometry, which fluorophores will
make suitable donor-acceptor FRET pairs. For example, FAM (which
has an emission maximum of 525 nm) is a suitable donor for TA RA,
ROX, and R6G (all of which have an excitation maximum of 514 nm) in
a FRET pair. Additional examples to moieties which can be used
include but are not limited to,
4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid acridine
and derivatives such as, acridine, acridine isothiocyanate,
5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS),
4-amino-N-.sub.--3-vinylsulfonyl)phenyl!naphthalimide-3,5,
disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide,
anthranilamide and Brilliant Yellow; coumarin and derivatives such
as, coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120),
7-amino-4-trifluoromethylco- uluarin (Coumaran 151), cyanosine
4',6-diaminidino-2-phenylindole (DAPI),
5',5"-dibromopyrogallolsulfonephthalein (Bromopyrogallol Red),
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin,
diethylenetriamine pentaacetate,
4,4'-diisothiocyanatodihydro-stilbene-2,- 2'-disulfonic acid,
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, 5-dimethylamino
naphthalene-1-sulfonyl chloride (DNS, dansyl chloride),
4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL) and
4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin
and derivatives such as, eosin and eosin isothiocyanate; erythrosin
and derivatives such as, erythrosin B and erythrosin isothiocyanate
ethidium; fluorescein and derivatives: such as,
5-carboxyfluorescein (FAM),
5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF),
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE),
fluorescein, fluorescein isothiocyanate, QFITC (XRITC),
fluorescamine, IR144, IR1446, Malachite Green isothiocyanate,
4-methylumbelliferone, ortho cresolphthalein, nitrotyrosine,
pararosaniline, Phenol Red, B-phycoerythrin and o-phthaldialdehyde;
pyrene and derivatives such as, pyrene, pyrene butyrate,
succinimidyl 1-pyrene butyrate and Reactive Red 4 (Cibacron .RT.
Brilliant Red 3B-A); rhodamine and derivatives such as,
6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine
rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B,
rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B,
sulforhodamine 101, sulforhodamine 101, (Texas Red),
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl
rhodamine, tetramethyl rhodamine isothiocyanate (TRITC),
riboflavin, rosolic acid and terbium chelate derivatives
[0123] Oligonucleotides are preferably modified during synthesis,
such that a modified T-base is introduced into a designated
position by the use of Amino-Modifier C6 dT (Glen Research), and a
primary amino group is incorporated on the modified T-base, as
described by Ju et al. (1995, Proc. Natl. Acad. Sci., USA
92:4347-4351). These modifications may be used for subsequent
incorporation of fluorescent dyes into designated positions of the
oligonucleotides.
[0124] It will be appreciated that although the use of a single
detection moiety or a pair of detection moieties for detection of
the separation resultant from the cleavage is preferred by the
present invention, such detection can also be effected in
oligonucleotides and assemblies of oligonucleotides which are
untagged by such moieties. In this case the resultant cleavage
products can be specifically detected by various chromatographic
techniques such as HPLC and the like or electrophoretic
techniques.
[0125] Thus, the present invention provides oligonucleotides and
assemblies of oligonucleotides which are useful in methods for
nucleic acid target detection. The oligonucleotides of the present
invention are particularly advantageous over prior art designs for
target sequence detection in that following the production of a
detectable signal the oligonucleotides of the present invention or
portions thereof dissociate from the target nucleic acid. This
dissociation allows additional oligonucleotides to hybridize with
the target and to subsequently produce additional detectable
signals. Thus, if excess amounts of oligonucleotides are used,
target recycling is enabled and signal amplification generated.
[0126] In addition, the oligonucleotides or assembly of
oligonucleotides described hereinabove are advantageous over prior
art designs in that they substantially reduce background signals
associated with target independent cleavage.
[0127] Furthermore, since restriction and thus generation of a
signal is independent of the type and sequence of the target
polynucleotide the oligonucleotide probes of the present invention
can include a universal structure at the cleavage region which
facilitates their synthesis and applicability. An added benefit to
target independent cleavage is that the probes of the present
invention can be used to detect both DNA and RNA target
sequences
[0128] Finally, since the present invention is an isothermal
procedure, it facilitates detection of target sequences via an easy
and relatively inexpensive procedure.
[0129] Additional objects, advantages, and novel features of the
present invention will become apparent to one ordinarily skilled in
the art upon examination of the following examples, which are not
intended to be limiting. Additionally, each of the various
embodiments and aspects of the present invention as delineated
hereinabove and as claimed in the claims section below finds
experimental support in the following examples.
EXAMPLES
[0130] Reference is now made to the following examples, which
together with the above descriptions, illustrate the invention in a
non limiting fashion.
[0131] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Cell Biology: A Laboratory Handbook"
Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in
Immunology" Volumes I-III Coligan J. E., ed. (1994);
"Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid
Hybridization" Hames, B. D., and Higgins S. J., eds. (1985);
"Transcription and Translation" Hames, B. D., and Higgins S. J.,
eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986);
"Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical
Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in
Enzymology" Vol. 1-317 Academic Press.
Example 1
Materials and General Methods
[0132] Oligonucleotides:
[0133] Following careful design, the oligonucleotides and
oligonucleotide assemblies described hereinbelow were acquired from
Biotechnology General Ltd., Israel or Genset, France. The
prediction of structure and thermodynamic stability of the
oligonucleotides, at different assay conditions, was performed
using the Gene runner software, version 3.00. FIG. 2 summarizes the
secondary structures and features of all of the oligonucleotides
synthesized and tested while reducing the present invention to
practice.
[0134] PCR Reactions:
[0135] PCR reactions were conducted using the Programmable Thermal
Controller PTC-100.TM. (MJ Research, Inc.). The DNA utilized as
template in the PCR reactions was prepared from whole-cell lysate
of human embryo fibroblast (HEF) cells infected with cyto-megalo
virus (CMV, ATCC strain AD169).
[0136] Restriction Endonucleases and Carrier DNA:
[0137] Restriction enzymes used for template DNA and
oligonucleotide probes cleavage were purchased from New England
BioLabs, Inc., USA. Carrier DNA preparations (tRNA. salmon sperm
DNA and human placental DNA) were purchased from Sigma Israel,
Ltd.
[0138] Hybridization and Cleavage Assays:
[0139] Comparative hybridization assays performed at a temperature
range of 44.degree. C.-66.degree. C. were conducted in the
Stratagene Robocycler/gradient 96 Temperature Cycler.
[0140] CMV-DNA was incubated with oligonucleotide probe(s) in the
presence of 50 to 200 mM NaCl, 10 mM MgCl.sub.2 and 10 mM Tris-HCl.
Reactions were conducted at pH of 7.8 or 8.5 in a final volume of
25 .mu.l. Concentration of salts, molar ratios of oligonucleotide
probe(s) to target DNA and temperature of the assay varied
according to the specific requirements of each assay, as is further
detailed hereinunder.
[0141] For determination of CMV-dependent cleavage of the probe(s),
restriction enzymes were added as well. Restriction reactions were
stopped using gel-loading buffer containing EDTA, and were stored
at 4.degree. C. until electrophoresed. Evaluation of
CMV-independent cleavage of the oligonucleotide probes (background
cleavage) was performed in the absence of CMV-DNA. As an additional
control for CMV-independent cleavage, enzymatic digestion of
oligonucleotide probes was attempted in the presence of
non-relevant PCR products, tRNA, salmon sperm DNA or human
placental DNA. DNA-dependent cleavage of the probe was not detected
in any of these negative control experiments. Determination of
maximal hybridization efficiency was performed in the absence of
enzyme, using non-denaturing gel electrophoresis. The salt
concentration was changed to affect both hybridization stringency
and enzyme activity.
[0142] Assays were conducted at temperatures selected within the
range of 44.degree. C. to 66.degree. C. In general, and as shown
for the paired-probe (FIG. 3a) and looped probe (FIG. 3b), the
temperature of the assay was selected as follows: (i) 5-30.degree.
C. higher than the Tm of the oligonucleotide stem (duplex forming
region), preferably 10-15.degree. C. higher, so as to allow
target-dependent stem-formation; (ii) 10.degree. C. below to
25.degree. C. above the Tm of each of the target-specific arms
(target DNA hybridizing regions) of the oligonucleotide probes,
preferably 5-10.degree. C. above the Tm of the individual
target-specific arms, so as to allow dissociation of probes from
the target nucleic acid following enzymatic cleavage; (iii)
0-40.degree. C. below to 5.degree. C. above the Tm of the
full-length hybrid, preferably 10-20.degree. C. below, to encourage
hybrid formation in the presence of target nucleic acid sequences;
and (iv) 25.degree. C. below to 10.degree. C. above the restriction
enzyme's optimal temperature, so as to allow between 30-100%
enzymatic activity.
[0143] Detection:
[0144] Reaction products were analyzed by gel electrophoresis in
native and urea containing (denaturing) polyacrylamide gels. Gel
analysis was conducted using the Xcell.TM. Mini-cell gel
electrophoresis apparatus using Polyacrylamide purchased from Serva
Electrophoresis, GmbH, (Cat. No. 10680). Southern blotting was
performed using blotting modules and disposable plastic cassettes
(Novex, USA) and Hybond-N+ or NX nylon membranes (Amersham,
UK).
[0145] For determination of single strand confirmation, samples
were boiled prior to loading on gels and 7 M urea was added to both
the gel and gel-loading buffer. For determination of hybrids and
secondary structures, native electrophoresis conditions were
employed. Gels were then transferred onto Hybond-N+ or NX nylon
membranes and the DNA was immobilized to the membranes by UV
irradiation. The membranes were incubated with
streptavidin-conjugated alkaline-phosphatase and the biotinylated
reactants were then visualized using the BCIP/NBT substrate.
[0146] Target Nucleic Acid Sequences:
[0147] It will be appreciated that any target nucleic acid sequence
is detectable providing a dedicated hybridizable oligonucleotide
probe is prepared according to the teachings of the present
invention so as to allow its detection.
[0148] Homologues of arbitrarily chosen regions of CMV-DNA were
detected in the NCBI database using the BLAST algorithm. Homologous
sequences were detected in various organisms, including human,
pathogens and other organisms. The longest sequences contained 17
base pairs. The melting temperature (Tm) of the CMV-homologous
sequence that shared the highest degree of homology with the
CMV-DNA was 50.degree. C. The region of the oligonucleotides
according to the present invention which is complementary to the
target nucleic acid (i.e., the arm) was synthesized to include
sequences which are only in part homologous to the CMV homologous
sequences mentioned above. This ensured that each arm of the
oligonucleotide probe has a lower Tm when hybridized with these
non-CMV sequences. Furthermore, each of the two target-specific
arms was designed to have Tm values above 50.degree. C. Since the
reaction temperature is above 50.degree. C., none of the
target-specific arms alone can form a stable hybrid with the
target-polynucleotide sequence. Since the Tm value of the two arms
together is higher than the Tm of each arm alone, and is also
higher than the reaction temperature, both arms are needed for
hybridization with the double stranded CMV DNA sequence. Therefore,
recognition of non-CMV-DNA by a probe that is only partially
complementary to these sequences is highly unlikely under the above
described assay conditions. Indeed, when human placental DNA or
salmon sperm DNA were used as control target DNA instead of
CMV-DNA, hybridization of probes to the control DNA was not
detected (paired probes) or slightly detected (looped probes),
however, in both cases neither the hybridization of the CMV-DNA to
the probes nor DNA dependent probe cleavage was substantially
affected.
Example 2
Target Nucleic Acids
[0149] CMV-DNA Preparations:
[0150] A 263 base pair fragment (SEQ ID NO:1) derived from the CMV
genome (VRL Accession No. X17403) was used as a template for
Various CMV-DNA preparations which were used as a target DNA
sequence (FIG. 4). The main features of the various preparations
are listed in Table 1 and are further detailed hereinbelow.
[0151] PCR amplified double stranded CMV-DNA (p.CMV-263.ds): This
unique CMV fragment was amplified using 5'-AGACCTTCATGCAGATCTCC-3'
(sense CMV-PCR primer, SEQ ID NO:2) as a sense primer and
5'-GGTGCTCACGCACATTGATC-3' (antisense CMV-PCR primer, SEQ ID NO:3)
as an antisense primer, along with a DNA preparation from
whole-cell lysate of CMV-infected HEF cells as a PCR template. The
PCR reaction included a first denaturing step of 5 minutes at
94.degree. C., followed by thirty cycles of 1 minute at 94.degree.
C.; 30 seconds at 58.degree. C.; 30 seconds at 72.degree. C. and a
final extension step of 5 minutes at 72.degree. C.
1TABLE 1 The main features of various CMV-DNA preparations utilized
as a target DNA sequence in oligonucleotide hybridization reactions
Length Designation, and SEQ ID Prep. (bp) Strand Synthesis Remarks
NO: 1 263 ds PCR p.CMV-263.ds 1 2 263 ss, Asymmetric PCR
p.CMV.263.ss Includes 4 antisense a fair amount of ds as well 3 50
ds PCR + DdeI p.CMV-1.ds 5 4 35 ds PCR + HaeIII/ p.CMV-2.st.ds 6
Fnu4HI 5 59 ds PCR + HaeIII/AflII p.CMV-2.lg.ds 7 6 36 ss, sense
Seq as for Prep. 3 sense CMV-2.st 8 Biotinylated at 5'-end 7 36 ss,
Seq as for Prep. 3 antisense CMV-2.st 9 antisense 8 36 ds Seq as
for Prep. 3 syn. CMV-2st.ds 10 Biotinylated at 5'-end of sense 1:1
mixture of preparations 6 and 7 9 Viral ds g. CMV-1/2.st/2.lg n.a.
DNA CMV-infected HEF genomic DNA Treated with DdeI; HaeIII + Fnu4HI
or HaeIII + AflII Prep = preparation; ss = single stranded; ds =
double stranded; n.a. = not applicable
[0152] PCR amplified single strand antisense CMV-DNA
(p.CMV-263.ss): The antisense strand was amplified using the same
PCR program, template and primers that were used for amplification
of the double stranded DNA, with the exception that the antisense
primer was added in 20-fold excess over the sense primer and the
PCR program was run for 40 cycles. The final PCR product was
enriched with a single stranded CMV antisense strand (263 bp), but
contained double stranded DNA (263 bp) as well.
[0153] Cleaved PCR amplified double stranded CMV-DNA (p. CMV-1,
2.st, 2.lg. ds): As shown in FIG. 4 the PCR amplified double
stranded CMV fragment (263 bp) was digested using either DdeI
(preparation 3), HaeIII+Fnu4HI (preparation 4) or AflII+HaeIII
(preparation 5) to produce restriction fragments which match the
exact sequence hybridizable by the arms of the various
oligonucleotide probes. Since these CMV restriction fragments (50,
35 and 61 bp) are considerably shorter than the 263 bp PCR product,
the various oligonucleotide probes better competed for the native
CMV sense strand for hybridization than the antisense CMV strand,
and as such prevented self-annealing of the double stranded
CMV-DNA.
[0154] Synthetic single stranded and double stranded CMV-DNA
(sense/antisense CMV-2 st and syn. CMV-2 st. ds): Two complementary
single stranded CMV-DNA fragments were chemically synthesized. A
synthetic biotinylated sense strand (SEQ ID NO:8) and a synthetic
complementary non-biotinylated antisense strand (SEQ ID NO:9) were
added in equimolar concentrations to yield a synthetic double
stranded CMV-fragment (SEQ ID NO:10 These synthetic double stranded
DNA sequences were synthesized to match the size of most probe
arms. Since the exact concentration of each of the synthetic
strands is known, a quantitative measure could be determined for a
reaction. In addition, the non-biotinylated antisense strand can be
used separately in order to improve probe-DNA hybridization, since
the complexity introduced by self-annealing of the two strands of
the double stranded CMV-DNA is not a factor. Furthermore, the
biotinylated sense strand enabled monitoring of the complexity
introduced into a reaction by self-annealing of the two strands of
the double stranded CMV-DNA.
[0155] Enzymatically digested viral/human DNA mixture (g. CMV-1, 2.
st, 2 lg): DNA preparation from whole-cell lysate of CMV-infected
human embryo fibroblast (HEF) cells was digested to completion by
DdeI, HaeIII+Fnu4HI or HaeI+AflII.
[0156] Five main categories of oligonucleotide probes have been
designed and studied while reducing the present invention to
practice and are referred to herein as the paired probes, the
bivalent probes, the single probes, the blocked probes and the
ModRE/MutRe probes. FIG. 2 summarizes the main features of these
probe categories.
EXAMPLE 3
Bi-molecular-Paired Probes
[0157] Paired probes--First generation: In paired oligonucleotide
probes (bi-molecular oligonucleotide assemblies) each
oligonucleotide member of the pair contains an arm which is
designed to specifically recognize a portion of the target
sequence. However, each arm is preferably selected sufficiently
short so as to prohibit the formation of a stable hybrid with the
target sequence on its own. The concomitant hybridization of the
arms of both oligonucleotide members of the pair to the target DNA
allows the formation of a double stranded stem (11-18 bp long)
between the two oligonucleotide members. This stem is essential for
the stabilization of the hybridization between the arms of both
oligonucleotide members and the target DNA. In addition, this stem
is designed to provide cleavable restriction sites which are formed
as a result of the stem structure formation. The specifics are
further detailed hereinbelow.
[0158] Effects of stem and arms regions on hybridization of paired
probes to CMV-DNA: One picomole (pm) of either both members of
three different paired probes (FIGS. 5b, 5c and 5e (pair 1 and 2,
and SpltRE, respectively, Table 2), one of which is biotinylated,
or of the biotinylated member of different paired probes (FIG. 5a
(biotinylated oligonucleotide member of pair 1 and 2, Table 2) and
5d (biotinylated oligonucleotide member of spltRE, Table 2)) and
500 femtomoles (fm) double stranded CMV-DNA (p.CMV-1.ds for 5a-c,
p.CMV-2.lg, for 5d-e, see Table 1 above) were added into 96-well
plates. The hybridization assays were conducted at 200 mM NaCl,
pH=8.5, at a final volume of 25 .mu.l. Reaction mixtures were
covered with mineral oil and the plates were heated to 95.degree.
C. for 10 minutes so as to allow strand separation in the
Robocycler/gradient 96 Temperature Cycler (Stratagene). The plates
were then transferred to a temperature gradient block in which each
column of the plates was incubated at a different temperature,
starting at 44.degree. C. and ending at 66.degree. C., at 2.degree.
C. increments. Following 1 hour incubation, a 10 .mu.l aliquot
taken from each sample was analyzed by a 12% polyacrylamide native
gel. Biotinylated conformants were visualized as described
hereinabove under Example 1. The results are presented in FIGS.
5a-e.
[0159] As can clearly be seen in FIGS. 5a-e, hybridization of each
paired-probe to CMV-DNA, as is evident by the slow migrating bands,
depends on the presence of both oligonucleotide members of the pair
in the reaction. Hybridization of a biotinylated oligonucleotide in
the absence of its paired oligonucleotide member is not observed
even though the Tm of the target-specific arm thereof is far higher
than the reaction temperature (e.g., FIGS. 5a and 5d). With the
addition of the non-biotinylated oligonucleotide member (FIGS. 5b,
5c and 5e) hybridization is observed, suggesting that stem
formation is crucial for hybridization of the oligonucleotide
members of the paired probes with the CMV-DNA. In addition, it was
observed that for oligonucleotide pairs in which the Tm of the
target-specific arms was kept constant, but in which the Tm of the
stem region was reduced from 58.degree. C. (FIG. 5b) to 42.degree.
C. (FIG. 5c), the efficiency of hybridization at high temperatures
was considerably lower. Furthermore, it was observed that elevation
of the Tm of the non-biotinylated target-specific arm from
61.degree. C. (FIGS. 5b-c) to 87.degree. C. (FIG. 5e) may
compensate for a low stem Tm, and thus enable hybridization even
when the Tm value of the stem is as low as 12.degree. C.
2TABLE 2 Bi molecular Paired probes Pair No. Sequence 5'-3' SEQ ID
NO. 1 b-TGGTTATCAGAGGCCGCTTAAAAT- TCGAAGGGTTCAC 11
GTGAACCCTTCGAATTCACAGCATCACACTAGTCTCC 12 2
b-TGGTTATCAGAGGCCGCTTAAAATTCGAAGGG 13
CCCTTCGAATTCACAGCATCACACTAGTCTCC 14 3
b-GGCTTGGTTATCAGAGGCCGCTTAAAATTCGAAGGG 15
CCCTTCGAATTCACAGCATCACACTAGTCTCCTCTAA 16 4
b-TGGTTATCAGAGGCCGCTTAAAATTCGAAGGGTTCACGA 17
TCGTGAACCCTTCGAATTCACAGCATCACACTAGTCTCC 18 spltRE-5'
b-CAGCATCACACTAGTCTCCAGCTAGTTCGACGCGCCACGCGTC 19 spltRE-3'
GAACTAGCTACTCTAAGACATAGCAGCACAGCACCCGACAGAACTCACTTAAG 20 b = 5'
biotinylation
[0160] Efficiency of cleavage of various paired-probes at different
temperatures: The stem structure of each paired probe of paired
probes 1-4 listed in Table 2 was designed to include two
restriction sites, one for BstBI and the other for TaqI. Table 3
below summarizes the efficiency of cleavage of the paired-probes
1-4 of Table 2 above at different temperatures by these enzymes. As
can clearly be seen, the cleavage efficiency of BstB1 and TaqI
restriction enzymes increases with longer stems. When the stem
region is too long specificity is lost due to template-independent
stem formation. However, if the reaction temperature is elevated,
stem stabilization again depends on hybridization of the
paired-probe to the CMV-DNA template, leading to reduction in
template-independent cleavage. Thus, designing probes with shorter
stem regions cleavage is CMV-dependent at lower temperatures,
increasing the temperature to 65.degree. C., a temperature still
optimal for enzyme cleavage, inhibits stem formation for these
paired probes, and as such no cleavage is observed. Table 3 also
demonstrates the importance of the target-specific arm length. As
can be seen, pair 2 is cleaved more efficiently than pair 3
although the two pairs have the same stem. A possible explanation
for that is that the shorter arms in pair 2 dissociate more easily
from the CMV-DNA following cleavage, thereby allowing better
recycling of the target, and higher percentage of intact probe is
converted to its cleaved form.
3TABLE 3 Features and cleavage efficiency of four paired probes in
the presence or absence of target DNA Efficiency of cleavage of
various pairs at different temperatures Temperature Paired
51.degree. C. 56.degree. C. 59.degree. C. 65.degree. C. probe Probe
features* RE -CMV +CMV -CMV +CMV -CMV +CMV -CMV +CMV 1 stem: 16 bp,
Bstb1 50% 60% 50% 70% N.D N.D 0% 25% 55.degree. C. Arms: b-19 bp,
Taq1 30% 40% 40% 50% N.D N.D 10% 20% 67.degree. C./19 bp,
58.degree. C. 2 stem: 11 bp, Bstb1 10% 10% 5% 30% 0% 40% 0% 0%
39.degree. C. arms: b-19 bp, Taq1 10% 10% 10% 70% 5% 30% 0% 0%
67.degree. C./19 bp, 58.degree. C. 3 stem: 11 bp, 39.degree. C.
Bstb1 5% 5% 0% 10% 0% 0% 0% 0% arms: 23 bp, 75.degree. C. Taq1 5%
5% 10% 10% 5% 10% 0% 0% 24 bp, 64.degree. C. 4 stem: 18 bp,
63.degree. C. Bstb1 80% 80% 80% 85% N.D N.D 20% 40% arms: 19 bp,
67.degree. C. Taq1 50% 50% 50% 60% N.D N.D N.D N.D 19 bp,
58.degree. C. b = 5' biotinylation; RE = Restriction Enzyme; B =
BstBI; T = TaqI.
[0161] FIG. 6 demonstrates the importance of target-specific arm
length. Paired probes 2, 3 or both, each at a concentration of 100
nM were incubated in the presence (+) or absence (-) of
approximately 100 nm single stranded enriched CMV-DNA (263 bp). An
initial hybridization step was conducted at pH 7.8, 60.degree. C.,
for 15 minutes, in a volume of 30 .mu.l. Following the initial
hybridization step, 0.17 units/.mu.l of BstBI was added to each
tube and cleavage was allowed to proceed for 2 hours. Eight .mu.l
aliquots were analyzed on a 15% acrylamide-urea gel. Biotinylated
fragments were visualized as described under Example 1 above.
Length (bp) and Tm (.degree. C.) of stem and arms of pair 2 and 3
are listed in Table 3 above.
[0162] As can be seen from FIG. 6, pair 2 was cleaved in the
presence of CMV-DNA (lane 2) while pair 3 was cleaved to a much
lesser extent (lane 4). However in the presence of pair 3 the
cleavage of pair 2 was blocked (lane 6). Thus, it seems that
accessibility of pair 2 to the template is blocked by pair 3. Pair
3 inhibits the hybridization of pair 2 to the target DNA due to its
longer CMV-specific arm sequence. In addition, recycling of
relevant DNA could not occur because cleavage of pair 3 did not
result in dissociation of the probe-CMV-DNA hybrid complex. The
hybrid was kept intact even after enzymatic cleavage and the
accessibility of pair 2 to the DNA was blocked. Thus, template
recycling and as such signal amplification has clearly been
demonstrated with the paired probes designed according to the
teachings of the present invention.
[0163] Paired probes--second generation: The design of the second
generation of paired probes was aimed to increase the efficiency of
CMV-dependent cleavage by either directing the reaction so as to
prefer stem formation over stem dissociation or by reducing the
number of interactions needed for the formation of double stranded
stems or in other words, reducing the reaction order. Thus, the
non-biotinylated oligonucleotide member of the paired-probe was
elongated to allow permanent hybridization with the target DNA, and
the restriction recognition site of this strand was rendered
cleavage resistant. Thus, the non-biotinylated oligonucleotide
member of the paired-probe should be recycled along with the
CMV-DNA to which it is hybridized. Two approaches were tested:
split restriction site probes (SpItRE) and modified restriction
site probes ("MutRE or ModRe"). In both cases the restriction site
was flanked by at least five base pairs on each side, so as to
allow better contact of the restriction enzymes with their
restriction sites, so as to increase cleavage efficiency. The
structure of the second generation of paired probes is depicted in
FIG. 2.
[0164] Split Restriction site probes (SpltRE): In the SpltRE paired
probe the 3'-arm of the non-biotinylated oligonucleotide member was
elongated to allow permanent hybridization with the target DNA
(p.CMV-2.lg, 41 bases long, Tm=90.degree. C.). The 5'-end of this
oligonucleotide member participates in stem formation, but
contributes only two of the bases forming the TaqI site (5'-GA-3').
The other two bases forming the recognition site, including the
cleavage site itself (5'-T/C-3'), are missing in this strand. As a
result, the non-biotinylated oligonucleotide member serves as an
anchor on the target DNA for the biotinylated oligonucleotide
member. The rest of the nucleotides that are needed to complete the
split restriction site are present on the biotinylated
oligonucleotide member. The biotinylated oligonucleotide member
contains a CMV specific 5'-arm that is similar in length and Tm to
that of the first generation of paired probes (19 base long,
Tm=63.degree. C.). This arm is therefore expected to dissociate
from the target DNA following enzymatic cleavage. On its 3'-end,
the biotinylated oligonucleotide member is designed to fold and
create a stable intramolecular hairpin structure (6 base long,
Tm=87.degree. C.) that contributes the two bases needed for site
recognition by TaqI (5'-T/C-3'). These are the nucleotides that are
missing on the 5'-end of the non-biotinylated member of the paired
probe. Similar to the first generation of paired probes, the enzyme
recognizes and cleaves the full restriction site (5'-T/CGA-3') in a
double strand configuration only when the two members of the paired
probe hybridize. However, in this case only the biotinylated member
of the pair is cleaved, while the non-biotinylated member remains
uncleaved and hybridized to the target template. It is therefore
expected that the complex of the elongated oligonucleotide
hybridized to the target DNA will be recycled by the biotinylated
oligonucleotide, when present in excess in the reaction
mixture.
[0165] Modified restriction site probes (MutRE/ModRe): By
introducing a modification at the recognition site of the
non-biotinylated half of the paired probe, enzymatic cleavage of
the modified strand can be prevented. A 5'-T/CGA-3' to 5'-T/CTA-3'
and a 5'-T/CGA-3' to 5'-T/CG(N.sup.6-methyl)- A modifications were
introduced on the non-biotinylated oligonucleotide members of
paired probes, at the recognition site of TaqI/BstBI to yield 5
MutRE probes (SEQ ID NOs:21-25). Similarly to the SpltRE design,
the MutRe paired probe approach benefits from a higher
concentration of the reactants throughout the incubation and as
such should result in a higher efficiency of product formation.
[0166] The two concepts outlined hereinabove (spltRE/ModRE and
elongated target specific arm) were tested separately, however both
can be co-applied to the same probe. The nature of hybridization of
a probe pair to the target DNA and the dissociation of the cleaved
biotinylated arm from the DNA, may be studied using a
modified/elongated oligonucleotide members of a paired probe. For
example, the elongated/Modified oligonucleotide member of the
paired-probes may be combined with various biotinylated
oligonucleotide members having different arm lengths and Tm values.
In such combinatorial reactions, hybridization efficiency may be
studied either independently (using native gels, as shown, for
example, in FIG. 5) or along with cleavage efficiency (using
denaturing gels, as shown, for example, in FIG. 6).
EXAMPLE 4
Second Generation Paired Probes--Experimental Results
[0167] The non-biotinylated oligonucleotide member of a
paired-probe was elongated to allow permanent hybridization with
the target DNA (termed herein anchor primer). The 5'-end of this
oligonucleotide member participates in stem formation, but
contributes only four out of six bases (5'-CGAA-3') of a BstBI
recognition site (5'-TTCGAA-3'). The other two bases forming the
recognition site (TT), including the cleavage site itself (T/C) are
missing from this strand. As a result, the non-biotinylated
oligonucleotide member is a non-cleavable target-hybridized anchor
which serves to orient hybridization of the biotinylated
oligonucleotide member to the target DNA.
[0168] The remaining portion of the recognition sequence is present
on the 3' biotinylated oligonucleotide member which contains a CMV
specific 5'-arm. This arm is designed so as to dissociate from the
target DNA following cleavage. On it's 3'-end, the biotinylated
oligonucleotide member is designed to fold and create a stable
intramolecular hairpin structure (6 base long, Tm=87.degree. C.)
that contributes the two bases needed for site recognition by BstBI
(5'-TT-3'). These are the two nucleotides that are missing from the
5'-end of the non-biotinylated member of the paired probe.
[0169] Similar to the first generation of paired probes, the
restriction endonuclease recognizes and cleaves the full
restriction site (5'-TT/CGAA-3') only when the two members of the
paired probe hybridize to form the double stranded restriction
site. However, in this case only the biotinylated member of the
pair is cleaved and released from the target while the
non-biotinylated member remains uncleaved and anchored to the
target DNA with which it is recycled.
[0170] Various anchor (stably hybridized) and amplifier primers
were synthesized (Genosys England) in order to test the effect of
short and long anchor sequences on the accumulation of the cleaved
amplifier (Tables 4-5).
4TABLE 4 Primer Sequence (5' to 3') Target TTGTATGATGACCA (SEQ ID
NO: 42) Long Anchor CGAATT/TGACCTTGTACTCATTACACATTGTTTCCACACAT (SEQ
ID NO: 43) Short Anchor CGAATT/TGACCTTGTACTCATTACACAT (SEQ ID NO:
44) Amplifier 1 b-TGGTCATCATACAAGCGTCACTAG/AATTCGAACGGTTTTTTTCCGTT
(SEQ ID NO: 45) Amplifier 2 b-CATCATACAAGCGTCACTAG/AATTCGAACGGTTT-
TTTTCCGTT (SEQ ID NO: 46) Amplifier 3
b-ATACAAGCGTCACTAG/AATTCGAACGGTTTTTTTCCGTT (SEQ ID NO: 47) Bold
sequence represents the stem part of the primer; b = 5'
biotinylation.
[0171]
5 TABLE 5 Primer Orientation Length (nuc.) Arm Length Target
Antisense 59 n.r. Long Anchor Sense 41 35 Short Anchor Sense 28 22
Amplifier 1 Sense 47 24 Amplifier 2 Sense 43 20 Amplifier 3 Sense
39 16 Hybridization Tms between the primers and the target DNA are
calculated. n.r. = not relevant
[0172] The amplification reaction was conducted as described under
Example 1 above. Briefly, 50 nM of target DNA, 50 nM of short or
long anchor oligonucleotide and 250 nM of each amplifier
oligonucleotide (primers 1, 2, or 3) were mixed together in
reaction buffer (10 mM Tris-HCl, 10 mM MgCl.sub.2, 50 mM NaCl, pH
7.9) at a final volume of 30 .mu.l. One drop of mineral oil was
added and the temperature was raised to 95.degree. C. for 5 minutes
for effecting denaturation. The reaction mixtures were then
incubated at 65.degree. C. for 15 minutes, a BstBI restriction
enzyme was added to a final concentration of 1 unit/.mu.l and the
reaction mixtures were kept under the same conditions for an
additional hour. Sample analysis and detection were conducted as
described under Example 1. The cleavage products were separated in
a 12.5% polyacrylamide gel and blotted onto a membrane (FIG. 11a)
which was scanned and analyzed using Kodak Digital Science 1D
software; the results are summarized in FIGS. 11b-c.
[0173] When using the long anchor, a higher accumulation of the
cleavage product is observed with all three amplifiers (FIG. 11a).
These results show that the use of a long anchor with a higher arm
Tm (19.degree. C. higher than first generation bimolecular probes)
leads to a significantly higher amplifier cleavage and dissociation
(FIG. 11b). As can be seen in FIG. 11c, the use of the long Anchor
has increased cleavage from 2.3 to 6.9 times depending on the
amplifier used.
[0174] Thus, the second generation bi-molecular probe of the
present invention having an anchored uncleavable oligonucleotide
member is particularly advantageous for target sequence
identification since cleavage and dissociation of only one
oligonucleotide member reduces the reaction order thus dramatically
increasing reaction cycling rate and therefore signal
generation.
Example 5
Recycling in Second Generation Paired Probes--Experimental
Results
[0175] Recycling level of the second generation paired probes was
determined by measuring the amount of product (cleaved-amplifier)
molecules accumulated versus the amount of the target molecules
present in the reaction. Thus, in order to determine the level of
recycling, different concentrations of target DNA (0, 0.5 pM, 5 pM,
50 pM, 500 pM, and 5,000 pM) having the following sequence:
5'-TTGTATGATGACCA-3' (SEQ ID NO:48) were added to a buffered (Tris
HCl, 10 mM, pH=7.9) assay solution containing 10 mM MgCl.sub.2, 50
mM NaCl and 50 nM of the long anchor oligonucleotide (Tables 4 and
5). The resulting reaction mixtures were preheated at 95.degree. C.
for five minutes and thereafter incubated at 65.degree. C. for ten
minutes so as to allow for saturation by hybridization of the
target DNA with the anchor oligonucleotide. Then, amplifier 1
oligonucleotide (Table 4 and 5) was added to each reaction at a
final concentration of 250 nM and incubation was continued for
additional 15 minutes thus completing a tri-molecular
target-anchor-amplifier hybridization. BstBI endonuclease was added
to reaction at a final concentration of 1 unit/.mu.l. The samples
were incubated for an additional hour so as to allow cleavage of
the amplifier oligonucleotide.
[0176] Samples containing known amounts of a biotinylated
oligonucleotide fragment, identical in length and sequence to the
cleavage product of the amplifier
(biotin-5'-TTTCATCATAAAAGCGTCACTAGAATT-3' (SEQ ID NO:49) were
electrophoresed through a 15% denaturing polyacrylamide gel in the
presence of urea and served to create a standard curve. Four .mu.l
samples (containing 0, 2 amol, 20 amol, 200 amol, 2 fmol and 20
fmol of target, FIG. 12, inset) were co-electrophoresed therewith.
The gel was blotted onto a nylon membrane and detection of biotin
was as described under Example 1. The blot was then scanned and
analyzed using the Kodak Digital Science ID software. Based on the
results, an amplification factor was calculated as the molar ratio
between product and target. The amplification factors calculated
for each of the target concentrations are shown in FIG. 12. About
50 fmol of product was detected with as little as 20 amol of
target-DNA, showing about 2,500-fold amplification. The results
shown in FIG. 12 prove that recycling of target DNA indeed occurs
in a wide range of target concentrations.
Example 6
Single Molecule Probes
[0177] Single probes-First generation: In order to reduce the
number of interactions needed for the formation of a double
stranded stem, single molecule oligonucleotide probes (Table 6,
FIG. 2) were designed. In single molecule probes the stem is formed
by intramolecular interactions. The first set of single molecule
probes recognized a sequence of 32-43 nucleotides on the CMV (each
arm 16-23 base long) and had stems 10-16 bp long.
6TABLE 6 Single molecule probes No. Sequence 5'-3' SEQ ID NO: 1
b-TTATCAGAGGCCGCTTGAAAATTCGAAT- TGACCA 26
AGAATTCGAATTCACAGCATCACACTAGTC 2
b-GTTATCAGAGGCCACTTGAAAATTCGAATTGACC 27 AAGAATTCGAATTCACAGCATCACA-
CTAGTC 3 b-TGGTTATCAGAGGCCGCTTGTTATAATCGAATAA 28
ATGGAGGAAGATTAATTCGAATATAAGCCAGCATCA CACTAGTCTCCTC 4
b-TGGTTATCAGAGGCCGCTTGTTATATTCGAATAA 29
ATGACCGAGGAGGAAGATTAATTCGAATATAAGCCA GCATCACACTAGTCTCCTC b = 5'
biotinylation.
[0178] The Tm of the stem or arm regions of the various single
molecule probes was modified by the introduction of mismatches into
these sequences, so as to render them "substantially
complementary". However, the Tm of the stem was too high in all
cases (Tm=65-92.degree. C.) and resulted in high background
cleavage of the free probe in the absence of target DNA.
[0179] Computer analysis of the target DNA sequence recognized by
the first generation of single molecule probes suggested that this
particular sequence might be unsuitable for this type of single
molecule probes. First, the CMV-specific arms of the probe tend to
form dimers. Second, the selected target sequence dictates a high
Tm (Tm=82.degree. C.) which encourage self-annealing of the ds
target DNA. Finally, the primary structure of the single stranded
target DNA enabled a stable self-folded configuration that could
interfere with probe hybridization.
[0180] As shown in FIG. 7, to test the ability of the first
generation single molecule probes to detect a target DNA template
the single molecule probe 1 (Table 6) was incubated at 55.degree.
C. in 600 mM NaCl in the presence (+, lanes 1-3) and absence (-,
lanes 4-6) of p.CMV-1.ss (single stranded enriched, 263 bp, see
Table 1 above). The reaction mixtures were incubated for 15
minutes, following which the reaction mixtures were diluted to a
final concentration of 100 mM NaCl, 100 nM probe and 42 nM single
stranded enriched CMV-DNA (263). Following dilution, either TaqI
(T) or BstBI (B) were added to a final concentration of 0.17
units/.mu.l and enzymatic restrictions were allowed to proceed for
2 hours at 65.degree. C. Thereafter, aliquots of 12 .mu.l were
taken for denaturing gel analysis. In addition, hybridization
reactions (H) were incubated for 2 hours at 55.degree. C. and 600
mM NaCl, in the absence of restriction enzymes, and 2 .mu.l
aliquots of which were also analyzed on 8% native gel. In both
cases, the visualization of biotinylated fragments was conducted as
described under Example 1.
[0181] The results are presented in FIG. 7. As is clearly evident,
a considerable portion of the probe was cleaved in the absence of
CMV-DNA. Furthermore, the presence of target DNA did not increase
the cleavage efficiency, suggesting that the formation of a stable
stem was independent of target DNA hybridization for this probe
type. However, the reduction of the hybrid concentration upon
addition of enzymes suggests that the hybrid may serve as a
substrate for the enzymes.
[0182] Looped probes: Based on the results obtained from the first
generation of single molecule probes, a second generation of single
molecule probes was designed. In these probes the intramolecular
stem formation in the absence of target DNA is considerably
reduced. FIG. 2 depicts the structure of a hybridized second
generation looped probe.
[0183] The stems of the second-generation single molecule probes
were designed to have a lower Tm and a higher accessibility to the
enzymes as compared to the stems of the first generation single
molecule probes. In these probes, only a four to six base pair
sequence of the stem region forms a true double helix. These base
pairs include the recognition site of TaqI (T/CGA) (in the case of
six bp the 4-bp RE-site is flanked by a single base pair on each
side). The true double helix region of this stem was flanked by
pseudo double helix (base pairing between either C-A or G-T rather
than G-C and A-T as in normal double helix). The length of the
whole stem (sum of both real and pseudo double helices) was
calculated to be long enough (15 bp) to enable the probe to serve
as a substrate for TaqI. The Tm of the stem was manipulated by
changing the length of a poly-A loop formed upon stem formation.
The six looped probe variants varied in the size of the pseudo
double helix, the size of the poly A loop (4-21 base long), the Tm
of the stem region (Tm=44-53.degree. C.) and overall stem length
(10-15 base long).
[0184] In addition to the changes in the stem region, the target
sequence for these new probes was changed from p.CMV-1 to p.CMV-2
which overlapped to some degree with the sequence of p.CMV-1. The
sequence recognized by the biotinylated, 5'-arm of the looped
probes overlaps with the sequence recognized by the
non-biotinylated, 3'-arm of the first generation single molecule
probes. The non-biotinylated, 3'-arm of the looped probes
recognizes the sequence that lies immediately downstream to the
region recognized by the biotinylated arm of this probe. In the
looped probes the two arms had the same Tm and were identical in
all six variants.
7TABLE 7 Looped probes No. Sequence 5'-3' SEQ ID NO: 1
b-CAGCATCACACTAGTCTCTACTCGAGCAAAAAA 30
AAAAAAAAAAAAAAAACACTCGAGCGCTCTAAGAC ATAGCAGCA 2
b-AGCATCACACTAGTCTCTACACACACATCGAGC 31 ATTCGACACACACACGCTCTAAGACA-
TAGCAGCA 3 b-CAGCATCACACTAGTCTCTACACTCGAGCACAC 32
AAAAAAAAAAAACACACTCGAGCACGCTCTAAGAC ATAGCAGCA 4
b-CAGCATCACACTAGTCTCTACTCGAGCACACAC 33 AAAAAAAAAAAACACACACTCGAGCG-
CTCTAAGAC ATAGCAGCA 5 b-CAGCATCACACTAGTCTCTACACACC- TCGAGCA 34
AAAAAAAAAAAAAAAAAAAAACACTCGAGACACAC GCTCTAAGACATAGCAGCA 6
b-CAGCATCACACTAGTCTCTACACTCGAGCACAC 35
AAAAAAAAAAAAAAAACACACTCGAGCACGCTCTA AGACATAGCAGCA b = 5'
biotinylation.
[0185] To test the efficiency of hybridization of a looped probe to
double stranded-CMV-DNA, different lengths fragments of CMV-DNA
were employed in separate hybridization reactions.
[0186] Approximately 1 pm of loop 3 (Table 7) and 500 fm of a 263
bp double stranded CMV-DNA fragment were added to a 12-well row of
a 96-well plate. One pm of the loop 3 probe and 500 fm of a 35 bp
double stranded CMV-DNA fragment were added to another 12-well row
of the same plate. The hybridization assay was conducted as
described hereinabove, with the exception that 100 ng/.mu.l of tRNA
was added as a carrier. Reactions were covered with mineral oil and
the plates were heated to 95.degree. C. for 10 minutes to allow
strand separation. The plate was then transferred to a temperature
gradient block in which each column of the plate was incubated at
different temperature, ranging from 44.degree. C. to 66.degree. C.,
at 2.degree. C. increments. Following incubation in the temperature
gradient block, 10 .mu.l aliquots of each sample were analyzed by a
12% native polyacrylamide gel. Biotinylated fragments were
visualized as previously described in Example 1. The results are
shown in FIGS. 8a-b.
[0187] At the range of temperatures tested (44.degree. C. to
66.degree. C.), no hybridization with the 263 bp double stranded
CMV fragment was observed (FIG. 8b), whereas efficient
hybridization of the probe was observed with the 35 bp double
stranded CMV-DNA fragment at temperatures up to 58.degree. C. (FIG.
8a). These results suggest that target length-dependent reannealing
may affect probe hybridization efficiency at high temperatures. To
overcome reannealing of the target DNA, higher probe concentration
and lower reaction temperatures should be employed. However, as is
shown in the next experiment, such problems are traversed when a
single stranded target DNA template is used.
[0188] The efficiency of hybridization of the loop 2 probe (Table
7) to either a single stranded DNA fragment or a double stranded
DNA fragment was also examined. The results are presented in FIGS.
9a-b.
[0189] Approximately 1 pm of looped probe 2 and 500 fm of either a
double stranded (FIG. 9a) or a single stranded (FIG. 9b) synthetic
CMV-DNA fragment (syn.CMV-2st.ds or antisense CMV-2.st,
respectively) were incubated in 200 mM NaCl in a final volume of 25
.mu.l. The single stranded CMV-DNA preparation (antisense CMV-2.st)
is a synthetic, non-biotinylated, antisense strand that perfectly
matches the size of the target-specific arms of the loop 2 probe.
The double stranded CMV-DNA preparation (syn.CMV-2st.ds), is a 1:1
mixture of this antisense strand with a biotinylated sense strand
of the same CMV-DNA sequence (sense CMV-2.st). The following
hybridization conditions were employed: 1 h at 44.degree. C. (lane
1); 1 h at 44.degree. C. followed by 10 minutes at 95.degree. C.
(lane 2); 1 h at 44.degree. C. followed by 10 minutes at 95.degree.
C. and 1 h at 68.degree. C. (lane 3); 1 h at 68.degree. C. (lane
4). As can be seen from FIGS. 9a-b, when the looped probe was
incubated only with antisense CMV-2.st strand (FIG. 9b), the hybrid
was stable at both 44.degree. C. and 68.degree. C., and could
reform at 68.degree. C., following a 10 minute heating at
95.degree. C. (lane 3). In the presence of the complementary strand
of the target DNA (sense CMV-2.st, FIG. 9a), the loop-antisense
hybrid formed at 44.degree. C. (lane 1) and remained stable
following 10 minutes incubation at 95.degree. C. (lane 2). However,
when prolonged incubation times at 68.degree. C. were exercised, no
stable hybrid was formed (lanes 3 and 4). This in spite of the fact
that the probe was present in a 20-fold excess over the double
stranded target DNA. Thus, it was concluded from these results that
at a given concentration ratio between a target DNA and a probe, a
lower reaction temperature is required to enable the looped probe
to efficiently hybridize with the target DNA in the presence of
both strands.
[0190] To further analyze the efficiency of hybridization of looped
probes to template DNA the extent of probe hybridization and
cleavage was analyzed at various single stranded template DNA
concentrations. The results are shown in FIGS. 10a-c.
[0191] This assay consisted of two identical sets of seven tubes,
each tube containing 500 fm of the loop 5 probe (Table 7) and
decreasing amounts of a single stranded 35 bp CMV-DNA fragment
(antisense CMV-2.st) in a final volume of 25 .mu.l. The molar ratio
between antisense CMV-2.st and the probe was 1:1, 1:4, 1:10, 1:40,
1:100, 1:400 in tubes 1 to 6, respectively. No CMV-DNA was added to
tube number 7. The assay was conducted in the presence of 100
ng/.mu.l tRNA as a carrier, at pH=8.5 and 200 mM NaCl. The tubes
were incubated at 53.degree. C. to allow probe-DNA hybridization.
From one set of tubes, 10 .mu.l aliquots of each sample were
analyzed by a 12% polyacrylamide native gel (FIG. 10a). At the end
of the hybridization step, TaqI was added to each tube of the
second set of tubes, to a final concentration of 0.15 u/.mu.l and
the samples were incubated for 2 hours. A 10 .mu.l aliquot from
each sample of the second set of tubes was analyzed on a 15%
polyacrylamide denaturing gel containing 7 M urea (FIG. 10b), so as
to detect the single stranded biotinylated fragments. The same
samples were also analyzed by a 12% native gel, to detect both
double stranded and single stranded strand fragments (FIG.
10c).
[0192] As shown in FIGS. 10a-c, CMV-dependent probe cleavage can be
detected with as little as 50 fm of DNA. Furthermore, the
efficiency of probe cleavage was not reduced upon 4 or 10-fold
reduction in hybrid concentration, suggesting the presence of probe
amplification. This conclusion is further substantiated, when the
same reaction mixes are loaded on a native 12% acrylamide gel, as
shown in FIG. 10c. Under these conditions, cleavage products
exhibiting lower gel mobility were detected. This result suggests
that the cleaved probe products stay attached to the CMV-DNA.
However, in the presence of high free-probe concentrations, the
cleaved probe products hybridized to the CMV-DNA are replaced by
the intact probe, indicating that recycling of the target DNA
indeed occurs. Thus, this experiment proves that template recycling
and signal amplification can be achieved using looped probes
synthesized according to the teachings of the present
invention.
[0193] Looped probe variants: Variants of the looped probes
included changes to the stem and loop regions so as to reduce
CMV-DNA independent cleavage and to allow better recognition,
association and stem cleavage by the restriction enzymes utilized.
Several approaches can be undertaken in order to reduce CMV-DNA
independent cleavage: A loop region can be generated which assumes
the loop and stem configuration in the presence of target DNA and
folds to block the restriction site in the absence of template DNA.
The stem region can be shortened to four bp only, thus reducing
template independent stem formation. Several approaches can be
undertaken in order to enhance cleavage efficiency: The base
portion of the pseudo double helix can be closed below the
restriction site by a real duplex (two bp long), to form a
pseudo-duplex/bulge loop, 10 bp in length. The restriction site can
be placed in between two pseudo-duplex/bulge loops, each seven bp
long. A nucleotide of the restriction site can be modified on one
strand only, in which case loss of stability caused by this
modification can be compensated for by increasing the stem length.
Finally, CMV-DNA dependent cleavage may be enhanced by the addition
of a real duplex (three bp long) on each side of the restriction
site, and replacement of the poly A loop with a pseudo duplex
loop.
[0194] Blocked probes: The blocked probes are characterized by the
ability of the unhybridized probe to fold so as to form an
intrinsic, non-restriction site containing, duplex structure (SEQ
ID NOs:36-37) (see FIG. 2). A blocked probe is stable due to the
high Tm of the intramolecular interactions of this duplex
structure. When so folded, the probe may hybridize to a target
molecule, however, only part of the non-biotinylated arm will be
available for this hybridization, and therefore such a target-probe
hybrid would be unstable. Thus, a stable hybrid state must be
favored energetically such that the driving force for a
configurational change of this probe would be a reduction in its
energy state. For the full-length arm to be available for
hybridization with the target DNA, the non-restriction site
containing, duplex structure, should dissociate. Such a
dissociation would cause a temporary loss of stability of the probe
(e.g., Tm shift form Tm=52.degree. C./69.degree. C. to
Tm=41.degree. C./64.degree. C., respectively), however,
hybridization with a target should be able to compensate for this
loss of stability.
Example 7
Bivalent Probes (BIV)
[0195] As shown in FIG. 2, the bivalent probes are paired probes
designed to co-recognize two target DNA sequences. Each
oligonucleotide member of the pair has a stem sequence flanked by
one target recognition arm on each end. Each oligonucleotide member
is biotinylated on its 5'-end. This probe design aims at further
stabilizing stem formation and at increasing the dependency of stem
formation on the presence of the target DNA. The BIV probes may be
used to detect either two identical single strand sequences (BIV1),
two complementary strands of a given double strand sequence (BIV2),
two regions of the same polynucleotide or two non-related single
strand sequences (BIV3). A BIV 3 probe targeting either an
antisense/sense CMV-2 mixture, CMV-6 (SEQ ID NO:38) or the
p.CMV-263.ds sequence was designed and synthesized. The probe
comprises 5'-b -CAGCATCACACTAGTCTCAATTCGAAGCGGATGACCATG TACGG-3'
(SEQ ID NO:39) and 5'-b-CACTAGTGACGCTTGTATCGCTTCG
AATTCTCTAAGACATAGCAGCA-3' (SEQ ID NO:40).
[0196] Co-detection of two identical single-strands (BIV1): For
detection of two identical single strands each member of the
bivalent probe includes one arm which recognizes the 3'-end of a
target sequence and one arm which recognizes the 5'-end of the
target sequence. Since with BIV1 probes twice as many target
molecules are needed for a stable stem to be formed, the
sensitivity of the assay may be reduced. However, since both
members of the pair are labeled, the cleavage of each pair will
produce two labeled cleavage products, thus compensating for the
increased need for target molecules.
[0197] Co-detection of two complementary strands of a given double
strand sequence (BIV2): For detection of two complementary strands
of a double stranded sequence, the 5'-arm of one member of the
bivalent probe and the 3'-arm of the second member are designed so
as to hybridize with the antisense strand of a target sequence,
while the other arms of both members are designed to recognize the
sense strand of the same target DNA. The advantage of this design
over the paired probes described above is that the BIV2 probes may
compete with the reannealing reaction of a double stranded target
DNA, which results in an increased sensitivity of the assay.
[0198] Co-detection of two non-related single strands (BIV3): BIV3
allows the detection of two independent single stranded sequences,
and as such presents two new detection options. First, two
non-adjacent sequences of the same target DNA may be co-detected,
thus increasing the specificity of the assay and reducing false
positives without the need for an increase in DNA concentration.
Alternatively, one probe-pair can be used to recognize two
independent target molecules. For this purpose, the 5'-arm of one
member of the bivalent probe and the 3'-arm of the second member
are designed so as to recognize one target, while the other arms of
both members are designed so as to recognize a second, independent
target DNA.
Example 8
Fluorescent Detection Strategies
[0199] As detailed hereinabove, the detection of a probe and of
restriction products thereof was effected using biotinylated probes
and colorimetric methods. Although this method of detection is
suitable for detecting various hybridization configuration when
combined with gel separation, it detects both the hybridized and
non-hybridized probe and as such is not suitable for diagnostic
purposes. To provide suitable diagnostic detection several methods
can be used.
[0200] For example, a fluorescent reporter dye and a quencher group
which flank the restriction site of the same strand can be used.
The quencher is capable of capturing the energy emitted by the
fluorescent group, and as such, as long as the two groups are close
enough to each other no fluorescence will be emitted when the
fluorescent group is excited. In order to allow intra-probe
hybridization and formation of a double stranded stem in the
presence of the target DNA, the fluorescent reporter dye and the
quencher group can be positioned on the ends of the stem region, on
the sequence between first and third regions in both single and
bi-molecular probes and on the loop in single molecule probes or on
the end of the stem region in bi-molecular probes. At these
positions the effect of the dyes on hybridization is minimized (see
FIGS. 3a-b). For efficient cleavage of the stem by a restriction
endonuclease a spacer of 4-18 bases is needed between the
fluorescent reporter dye and a quencher group, depending on the
restriction enzyme being used. Upon enzymatic cleavage, the
fluorescent reporter dye and a quencher group separate from each
other and become dispersed in solution. As a consequence, the
energy transfer from the fluorescent group to the quencher does not
exist, and fluorescence may be detected.
[0201] Since fluorescence may be detected as the reaction proceeds,
a real-time measurement of the amplification is possible. The
intensity and rate of fluorescence increase, may allow estimation
of the number of target molecules present in the mixture and the
rate of amplification. This in turn implies that probes synthesized
according to the teachings of the present invention can also be
used as complementary reagent for real-time follow up of PCR
assays, in which target detection is typically performed only after
amplification has been completed. Furthermore, since the signals
generated by these probes is self amplified, the probes may
increase the sensitivity of a PCR assay and allow reduction in the
number of thermal cycles required for target detection.
[0202] Many fluorescent/quencher combinations may be utilized by
the probes of the present invention. Combinations in which the
donor is from the xanthene group of dyes, including fluoresceins,
and the quencher is from the rhodamine group of dyes (6-FAM and
TAMRA, for example) are commonly used in the art. CyS and ROX are
another pair of dyes that can be used. Using this pair a 20-fold
change in fluorescence in the presence of target can be
experienced.
[0203] Non-fluorescent quenchers such as DABSYL and QSF-7 can also
be used, these quenchers allow a higher degree of flexibility in
choosing the fluorescent dyes. The choice of dye-pair requires that
the quencher will absorb the energy of the fluorescent dye when the
two are in close proximity. It is preferable that the increase in
fluorescence upon dye separation would be as large as possible
(3-20 fold increase in fluorescence was reported for various energy
transfer systems). When only one fluorescent dye is used, a dye
with the highest fluorescence intensity (usually having a broad
emission spectrum) should be chosen. If two probes that carry the
same fluorescent/quencher groups are designed for the detection of
two distinct regions of the same target, sensitivity of the assay
may be increased. Alternatively, two or more probes that are
targeted to different targets can also be used providing that
different combination of fluorescent/quencher dyes are utilized.
However, in case when two or more fluorescent dyes are used, the
sensitivity of the assay may be compromised in order to distinguish
among the fluorescence of the various dyes. This may be done by
detection of narrower emission spectrums, in which the fluorescence
of the various dyes would not overlap.
Example 9
Fluorescence Detection of Target DNA
[0204] A 25 or 250 fm sample of a 50-bp segment derived from CMV
(p.CMV-1) was used as a target DNA template. The sequence of the
DNA template was as follows: 5'-TCAGGCTTGGTTATCAGAGGCCGCT
TGGCCAGCATCACA CTAGTCTCCTC-3' (SEQ ID NO:41).
[0205] A paired probe was covalently labeled with a 6-FAM
fluorescent group on the 5'-end of the oligonucleotide member that
corresponds to the 3'-region of the target sequence. 10 bases
downstream to the FAM group, a QSY-7 quencher group was covalently
attached to a thymidine residue at the base of the stem of the
paired probe 2 (sequence in Table 2).
[0206] The assay was conducted in the presence of 200 mM NaCl, 10
mM Tris pH-7.8, and 10 mM MgCl.sub.2, at 62.degree. C., in a final
volume of 25 .mu.l.
[0207] The samples were boiled for 5 minutes to allow strand
separation, and then cooled to 62.degree. C., for 15 minutes to
allow hybridization of the probe to its complementary sequence on
the target DNA. Following probe hybridization TaqI endonuclease was
added in a final concentration of 0.17 u/.mu.l to allow probe
digestion. Following a 2 h incubation period, the reactions were
stopped with 10 mM EDTA.
[0208] FAM fluorescence was measured using a fluorometer having
xenon arc lamp and grating monochromators for controlling
excitation and emission wavelengths (496 nm and 516 nm,
respectively). Samples taken prior to the addition of the enzymes
were used as a blank. The difference in fluorescence in the
presence of CMV-DNA and in its absence, indicated CMV-dependent
cleavage of the probe, and thus, the amount of CMV-DNA may also be
estimated.
[0209] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable
subcombination.
[0210] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims. All
publications, patents and patent applications mentioned in this
specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention.
* * * * *