U.S. patent application number 10/690184 was filed with the patent office on 2004-07-22 for methods for treating or preventing infections from coagulase-negative staphylococci.
Invention is credited to Davis, Stacey, Foster, Timothy J., Hartford, Orla, Hook, Magnus A.O., McCrea, Kirk, Ni Eidhin, Deirdre.
Application Number | 20040141997 10/690184 |
Document ID | / |
Family ID | 26794747 |
Filed Date | 2004-07-22 |
United States Patent
Application |
20040141997 |
Kind Code |
A1 |
Foster, Timothy J. ; et
al. |
July 22, 2004 |
Methods for treating or preventing infections from
coagulase-negative staphylococci
Abstract
Methods for treating or preventing infections from
coagulase-negative staphylococci using proteins and polypeptides
from coagulase-negative staphylococcal bacteria such as S.
epidermidis, including proteins designated SdrF, SdrG and SdrH, and
their effective fragments such as their respective A domains, are
provided. Methods are also provided wherein antibodies that
recognize the SdrG protein or its ligand binding A region are used
to treat or prevent staphylococcal infection, and these methods can
also be utilized to prevent the formation of infections on
indwelling medical devices.
Inventors: |
Foster, Timothy J.; (Dublin,
IE) ; McCrea, Kirk; (Houston, TX) ; Hook,
Magnus A.O.; (Houston, TX) ; Davis, Stacey;
(Houston, TX) ; Ni Eidhin, Deirdre; (Dublin,
IE) ; Hartford, Orla; (Duleek, IE) |
Correspondence
Address: |
STITES & HARBISON PLLC
1199 NORTH FAIRFAX STREET
SUITE 900
ALEXANDRIA
VA
22314
US
|
Family ID: |
26794747 |
Appl. No.: |
10/690184 |
Filed: |
October 21, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10690184 |
Oct 21, 2003 |
|
|
|
09386962 |
Aug 31, 1999 |
|
|
|
6635473 |
|
|
|
|
60117119 |
Jan 25, 1999 |
|
|
|
60098443 |
Aug 31, 1998 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
514/44R |
Current CPC
Class: |
C07K 14/31 20130101;
A61K 39/00 20130101; A61P 9/00 20180101; A61P 31/04 20180101; A61P
17/02 20180101; A61P 19/00 20180101; A61K 2039/505 20130101; G01N
33/56938 20130101; C07K 16/1271 20130101 |
Class at
Publication: |
424/190.1 ;
514/044 |
International
Class: |
A61K 048/00; A61K
039/02 |
Claims
What is claimed is:
1. A method of treating or preventing a coagulase-negative
staphylococcal infection in a patient comprising administering to
the patient a sufficient amount of the Staphylococcus epidermidis
SdrG fibrinogen binding protein to inhibit fibrinogen binding.
2. The method of claim 1, wherein the infection is selected from
the group consisting of septicemia, osteomyelitis or
endocarditis.
3. The method of claim 1, wherein the SdrG protein has the amino
acid sequence of SEQ ID NO: 10.
4. The method of claim 1, wherein the SdrG protein is encoded by a
nucleic acid having the sequence of SEQ ID NO: 7.
5. The method of claim 1, wherein the SdrG fibrinogen binding
protein is administered in the form of a pharmaceutical composition
comprising the SdrG protein in an amount effective to inhibit
fibrinogen binding and a pharmaceutically acceptable carrier.
6. A method of treating or preventing a coagulase-negative
staphylococcal infection in a patient comprising administering to
the patient a sufficient amount of a polypeptide comprised of the
ligand binding A region of the fibrinogen binding SdrG protein from
Staphylococcus epidermidis to inhibit the binding of
coagulase-negative staphylococci to fibrinogen.
7. The method of claim 6, wherein the polypeptide has the amino
acid sequence of amino acids 32 to 961 of SEQ ID NO:10.
8. The method of claim 6, wherein the polypeptide is encoded by a
nucleic acid having the sequence of nucleotides 102 to 2894 in SEQ
ID NO:7.
9. The method of claim 6, wherein the polypeptide is administered
in the form of a pharmaceutical composition comprising the
polypeptide in an amount effective to inhibit fibrinogen binding
and a pharmaceutically acceptable carrier.
10. A method of treating or preventing a coagulase-negative
staphylococci infection in a patient comprising administering to
the patient a sufficient amount of an antibody which can bind to
the SdrG protein of S. epidermidis to inhibit binding of
coagulase-negative staphylococci to fibrinogen.
11. The method of claim 10, wherein the SdrG protein has the amino
acid sequence of SEQ ID NO: 10.
12. The method of claim 10, wherein the SdrG protein is encoded by
a nucleic acid having the sequence of SEQ ID NO: 7.
13. The method of claim 10, wherein antibody is administered in the
form of a pharmaceutical composition comprising the antibody in an
amount effective to inhibit fibrinogen binding and a
pharmaceutically acceptable carrier.
14. A method of treating or preventing a coagulase-negative
staphylococci infection in a patient comprising administering to
the patient a sufficient amount of an antibody which can bind to
the ligand binding A region of the SdrG protein of S. epidermidis
to inhibit binding of coagulase-negative staphylococci to
fibrinogen.
15. The method of claim 14, wherein the ligand binding A region has
the amino acid sequence of amino acids 32 to 961 of SEQ ID
NO:10.
16. The method of claim 14, wherein the ligand binding A region is
encoded by a nucleic acid having the sequence of nucleotides 102 to
2894 in SEQ ID NO:7.
17. The method of claim 14, wherein antibody is administered in the
form of a pharmaceutical composition comprising the antibody in an
amount effective to inhibit fibrinogen binding and a
pharmaceutically acceptable carrier.
18. A method of reducing coagulase-negative staphylococcal
infection of an indwelling medical device comprising coating the
medical device with a sufficient amount of the Staphylococcus
epidermidis SdrG fibrinogen binding protein to inhibit fibrinogen
binding to the device.
19. The method of claim 18 wherein the medical device is selected
from the group consisting of vascular grafts, vascular stents,
intravenous catheters, artificial heart valves, and cardiac assist
devices.
20. A method of inducing an immunological response comprising
administering to a patient an immunologically effective amount of
the Staphylococcus epidermidis SdrG fibrinogen binding protein.
21. A method of inducing an immunological response comprising
administering to a patient an immunologically effective amount of
the ligand binding A region of the Staphylococcus epidermidis SdrG
fibrinogen binding protein.
22. A method of identifying compounds that inhibit
coagulase-negative staphylococci comprising combining the compound
with the Staphylococcus epidermidis SdrG fibrinogen binding protein
or with the ligand binding A region of the Staphylococcus
epidermidis SdrG fibrinogen binding protein and measuring the
binding of the protein to a binding molecule, wherein the compound
inhibits coagulase-negative staphylococci if binding to the binding
molecule is inhibited.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a divisional application of U.S.
application Ser. No. 09/386,962, filed Aug. 31, 1999, and claims
the benefit of U.S. Provisional Applications Serial No. 60/117,119,
filed Jan. 25, 1999, and Serial No. 60/098,443, filed Aug. 31,
1998.
FIELD OF THE INVENTION
[0002] The present invention is in the fields of microbiology and
molecular biology and more particularly is in the field of
biological products for the prevention, treatment or diagnosis of
coagulase negative staphylococcal infections in man and
animals.
BACKGROUND OF THE INVENTION
[0003] Staphylococci are Gram-positive spherical cells, usually
arranged in grape-like irregular clusters. Some are members of the
normal flora of the skin and mucous membranes of humans, others
cause suppuration, abscess formation, a variety of pyogenic
infections, and even fatal septicemia. Pathogenic staphylococci
often hemolyze blood, coagulate plasma, and produce a variety of
extracellular enzymes and toxins. The most common type of food
poisoning is caused by a heat-stable staphylococcal enterotoxin.
The genus Staphylococcus has at least 30 species. The three main
species of clinical importance are Staphylococcus aureus,
Staphylococcus epidermidis, and Staphylococcus saprophyticus.
Staphylococcus aureus is coagulase-positive, which differentiates
it from the other species. S. aureus is a major pathogen for
humans. Almost every person has some type of S. aureus infection
during a lifetime, ranging in severity from food poisoning or minor
skin infections to severe life-threatening infections.
[0004] The coagulase-negative staphylococci are normal human flora
which sometimes cause infection, often associated with implanted
devices, especially in very young, old and immunocompromised
patients. Approximately 75% of the infections caused by
coagulase-negative staphylococci are due to S. epidermidis.
Infections due to Staphylococcus warneri, Staphylococcus hominis,
and other species are less common. S. saprophyticus is a relatively
common cause of urinary tract infections in young women. The
staphylococci produce catalase, which differentiates them from the
streptococci.
[0005] Both Staphylococcus aureus and Staphylococcus epidermidis
have a characteristic propensity for invading skin and adjacent
tissues at the site of prosthetic medical devices, including
intravascular catheters, cerebrospinal fluid shunts, hemodialysis
shunts, vascular grafts, and extended wear contact lenses. Within
48 to 72 hours, relatively large numbers of staphylococci are
demonstrable at the site of insertion of these foreign bodies.
(Archer, G. L., in Remington, J. S., et al., Current Clinical
Topics in Infectious Diseases, McGraw-Hill, NY, 25-46, 1986.)
[0006] Staphylococcus epidermidis is a generally avirulent
commensal organism of the human skin, and is the principal
etiologic agent of infections of peripheral and central venous
catheters, prosthetic heart valves, artificial joints, and other
prosthetic devices. It has been demonstrated that S. epidermidis
cells attach and proliferate on the inner or outer surfaces of
catheters, irrespective of their composition--whether polyethylene,
polyvinylchloride, polyvinylfluoride or polyester based.
[0007] Initial localized infections of indwelling medical devices
can lead to more serious invasive infections such as septicemia,
osteomyelitis, and endocarditis. Vascular catheters are thought to
become infected when microorganisms gain access to the device, and
hence the bloodstream, by migration from the skin surface down the
transcutaneous portion of the catheter. In infections associated
with medical devices, plastic and metal surfaces become coated with
host plasma and matrix proteins such as fibrinogen, vitronectin and
fibronectin shortly after implantation. S. epidermidis bacteremia
can result in an excess hospital stay of 8 days, which is quite
expensive.
[0008] Although the virulence of coagulase-negative staphylococci
is enhanced in the presence of a foreign body, the microbial
factors that permit these normal skin commensals to become
nosocomial pathogens have not been well characterized. The ability
of coagulase-negative S. epidermidis to adhere to these proteins is
of crucial importance for initiating infection. As adherence is
believed to be the critical first step in the pathogenesis of
coagulase-negative staphylococcal foreign-body infections,
attention has focused on surface properties of these organisms that
might mediate adherence to, and then colonization of, polymeric
prosthetic materials.
[0009] A number of factors influence an organism's ability to
adhere to prosthetic material. These include characteristics of the
microorganism and the biomaterial, and the nature of the
surrounding environment. The initial attraction between the
organism and the host is influenced by nonspecific forces such as
surface charge, polarity, Van der Waal forces and hydrophobic
interactions. The critical stage of adherence involves specific
interactions between cell surface adhesins and immobilized host
proteins. To date, investigation concerning the adherence of S.
epidermidis to biomaterials has concerned itself primarily with the
role of the extracellular polysaccharide or glycocalyx, also known
as slime. Despite intensive study, however, the proposed role of
slime in the pathogenesis of disease or even its composition remain
debated. (Drewry et al., Clin. Microbiol 28:1292-1296, 1990)
Currently, extracellular slime is thought to play a role in the
later stages of adherence and persistence of infection. It may
serve as an ion exchange resin to optimize a local nutritional
environment, prevent penetration of antibiotics into the
macro-colony or protect bacteria from phagocytic host defense
cells. Peters et al. have shown by electron microscopy studies that
extracellular polysaccharide appears in the later stages of
attachment and is not present during the initial phase of
adherence. (J. Infect. Dis., 65146:479-482, 1982) Hogt et al.
demonstrated that removal of the extracellular slime layer by
repeated washing does not diminish the ability of S. epidermidis to
adhere to biomaterials. (J. Gen. Microbiol. 129:2959-2968,
1983)
[0010] Thus far, study of exopolysaccharide has lent little to
prevention of initial adherence by the bacteria. Several other
studies have identified other potential adhesins of S. epidermidis
including the polysaccharide adhesin (PS/A) observed by Tojo et al.
(J. Infect. Dis. 157:713-722, 1988) and the slime associated
antigen (SAA) of Christensen et al. (Infect Immun, 58:2906-2911,
1990).
[0011] It has been demonstrated that PS/A is a complex mixture of
monosaccharide adhesins which blocks adherence of PS/A producing
strains of S. epidermidis. In an animal model of endocarditis
antibodies directed against PS/A were protective. However, it is
not clear whether this protective effect was specific, related to
anti-adhesive effects of the antibody or due to a more generalized
increase in the efficiency of opsonophagocytosis of blood borne
bacteria. It has been hypothesized that each adhesin functions in
different stages of the adherence process with one or more of these
adhesins responsible for initial attraction while others are needed
for aggregation in the macro-colonies.
[0012] Despite many studies, factors involved in the initial
adherence of S. epidermidis to biomaterials remain largely unknown.
Further unknown is a practical method for preventing the first
stage of infection, adherence or adhesion. Therefore, a great need
remains for the discovery and characterization of bacterial adhesin
proteins and the genes that encode them.
[0013] Accordingly, it is an object of the present invention to
provide cell-wall associated extracellular matrix binding proteins
of coagulase-negative staphylococci.
[0014] It is a further object of the present invention to provide
coagulase-negative staphylococcal surface proteins that are able to
inhibit staphylococcal adhesion to the immobilized extracellular
matrix or host cells present on the surface of implanted
biomaterials.
[0015] It is a further object of the present invention to provide a
coagulase-negative staphylococci vaccine, to generate antisera and
antibodies to coagulase-negative staphylococcal proteins, and to
isolate antibodies to coagulase-negative staphylococci.
[0016] It is a further object of the present invention to provide
improved materials and methods for detecting and differentiating
coagulase-negative staphylococcal organisms in clinical and
laboratory settings.
[0017] It is a further object of the invention to provide nucleic
acid probes and primers specific for coagulase-negative
staphylococci.
[0018] It is a further object of the invention to provide methods
for detecting, diagnosing, treating or monitoring the progress of
therapy for bacterial infections that are sensitive and specific
for coagulase-negative staphylococci.
[0019] These and other objects, features and advantages of the
present invention will become apparent after a review of the
following detailed description of the disclosed embodiments and the
appended claims.
SUMMARY OF THE INVENTION
[0020] Isolated proteins from coagulase-negative staphylococci and
their corresponding amino acid and nucleic acid sequences are
provided. The proteins are designated SdrF, SdrG and SdrH. The DNA
sequence of sdrF and the amino acid sequence of the protein SdrF
(in bold) are shown in FIG. 2 along with their flanking sequences.
The DNA sequence of sdrG and the amino acid sequence of the protein
SdrG (in bold) are shown in FIG. 3 along with their flanking
sequences. Finally, the SdrH coding region including DNA and amino
acid sequence is shown in FIG. 4.
[0021] It has also been discovered that in the A region of SdrF and
SdrG there is highly conserved amino acid sequence that can be used
to derive a consensus TYTFTDYVD (SEQ ID NO:16) motif. The motif can
be used in multicomponent vaccines to impart broad spectrum
immunity to bacterial infections, and also can be used to produce
monoclonal or polyclonal antibodies that impart broad spectrum
passive immunity. In an alternative embodiment, any combination of
the variable sequence motif derived from the Sdr protein family,
(T) (Y) (T) (F) (T) (D/N) (Y) (V) (D), can be used to impart
immunity or to induce protective antibodies. The proteins, or
antigenic portions thereof, are used to produce antibodies for the
diagnosis of coagulase-negative staphylococcal bacterial infections
or for the development of anti-coagulase-negative staphylococcal
vaccines for active or passive immunization. When administered to a
wound or used to coat polymeric biomaterials in vitro and in vivo,
both the protein and antibodies thereof are also useful as blocking
agents to prevent or inhibit the binding of coagulase-negative
staphylococci to the wound site or to any biomaterials. The SdrF,
SdrG and SdrH proteins are further useful as scientific research
tools to understand of the mechanisms of bacterial pathology and
the development of antibacterial therapies.
[0022] The sdrF, sdrG and sdrH gene sequences are useful as nucleic
acid probes for the detection and identification of
coagulase-negative staphylococcal cell surface proteins. The
nucleic acid sequences may also be inserted into a vector and
placed in a microorganism for the production of recombinant SdrF,
SdrG and SdrH proteins. The amino acid sequences of these Sdr
proteins are useful as well, for example, in the production of
synthetic SdrF, SdrG and SdrH proteins or portions thereof, such as
consensus or variable sequence amino acid motifs.
[0023] Antisera and antibodies raised against the SdrF, SdrG and
SdrH proteins or portions thereof, such as consensus or variable
sequence amino acid motifs, and vaccines or other pharmaceutical
compositions containing the proteins are also provided herein.
[0024] In addition, diagnostic kits containing nucleic acid
molecules, the proteins, antibodies or antisera raised against
SdrF, SdrG and SdrH or portions thereof, such as consensus or
variable sequence amino acid motifs, and the appropriate reagents
for reaction with a sample are also provided.
[0025] In a first embodiment of this invention the polynucleotide
comprises a region encoding SdrF polypeptides comprising the
sequence set out in FIG. 2, or a variant thereof.
[0026] In accordance with this aspect of the invention there is
provided an isolated nucleic acid molecule encoding a mature
polypeptide expressible by the Staphylococcus epidermidis strain
9491.
[0027] In a second embodiment of this invention the polynucleotide
comprises a region encoding SdrG polypeptides comprising the
sequence set out in FIG. 3, or a variant thereof.
[0028] In accordance with this aspect of the invention there is
provided an isolated nucleic acid molecule encoding a mature
polypeptide expressible by the Staphylococcus epidermidis strain
K28.
[0029] In a third embodiment of this invention the polynucleotide
comprises a region encoding SdrH polypeptides comprising the
sequence set out in FIG. 4, or a variant thereof.
[0030] In accordance with this aspect of the invention there is
provided an isolated nucleic acid molecule encoding a mature
polypeptide expressible by the Staphylococcus epidermidis strain
9491.
[0031] In a fourth embodiment of the invention there is a novel
protein from Staphylococcus epidermidis comprising the SdrF amino
acid sequence as shown in FIG. 2, or a variant thereof.
[0032] In a fifth embodiment of the invention there is a novel
protein from Staphylococcus epidermidis comprising the SdrG amino
acid sequence as shown in FIG. 3, or a variant thereof.
[0033] In a sixth embodiment of the invention there is a novel
protein from Staphylococcus epidermidis comprising the SdrH amino
acid sequence as shown in FIG. 4, or a variant thereof.
[0034] In accordance with the fourth, fifth and sixth embodiments
of the invention there are provided isolated nucleic acid molecules
encoding SdrF, SdrG or SdrH proteins, particularly Staphylococcus
epidermidis proteins, including mRNAs, cDNAs, genomic DNAs. Further
embodiments of this aspect of the invention include biologically,
diagnostically, prophylactically, clinically or therapeutically
useful variants thereof, and compositions comprising the same.
[0035] In a seventh embodiment of the invention, there is provided
the use of a polynucleotide of the invention for therapeutic or
prophylactic purposes, in particular genetic immunization.
[0036] In an eighth embodiment of the invention are variants of
SdrF, SdrG or SdrH polypeptide or portions thereof, such as
consensus or variable sequence amino acid motifs, encoded by
naturally occurring alleles of the sdrF, sdrG or sdrH gene.
[0037] In accordance with this embodiment of the invention there
are provided novel polypeptides of Staphylococcus epidermidis
referred to herein as SdrF, SdrG or SdrH or portions thereof, such
as consensus or variable sequence amino acid motifs, as well as
biologically, diagnostically, prophylactically, clinically or
therapeutically useful variants thereof, and compositions
comprising the same.
[0038] In a ninth embodiment of the invention, there are provided
methods for producing the aforementioned SdrF, SdrG or SdrH
polypeptides or portions thereof, such as consensus or variable
sequence amino acid motifs.
[0039] In a tenth embodiment of the invention, there are provided
antibodies against SdrF, SdrG or SdrH polypeptides or
polynucleotides or portions thereof, such as consensus or variable
sequence amino acid motifs or the nucleic acids which encode such
motifs.
[0040] In an eleventh embodiment of the invention there are
provided polynucleotides that hybridize to SdrF, SdrG or SdrH
polynucleotide sequences or portions thereof, such as consensus or
variable sequence amino acid motifs, particularly under stringent
conditions.
[0041] In a twelfth embodiment of the invention there are provided
compositions comprising an SdrF, SdrG or SdrH polynucleotide or a
SdrF, SdrG or SdrH polypeptide or portions thereof, such as
consensus or variable sequence amino acid motifs, for
administration to a cell or to a multicellular organism.
[0042] Various changes and modifications within the spirit and
scope of the disclosed invention will become readily apparent to
those skilled in the art from reading the following descriptions
and from reading the other parts of the present disclosure.
BRIEF DESCRIPTION OF THE FIGURES
[0043] FIG. 1 is a representation of the SdrG protein of S.
epidermidis strain K28. The regions are labeled along the top of
the construct, with the number of amino acids found in each region
of the protein disclosed immediately below the corresponding region
in the drawing.
[0044] FIG. 2 is the DNA sequence of sdrF (SEQ ID No. 1) and the
amino acid sequence of the SdrF protein (in bold) along with their
flanking sequences (SEQ ID Nos. 2-6).
[0045] FIG. 3 is the DNA sequence of sdrG (SEQ ID No. 7) and the
amino acid sequence of the SdrG protein (in bold) along with their
flanking sequences (SEQ ID No. 8-12).
[0046] FIG. 4 is the DNA sequence of the sdrH (SEQ ID No. 13)
coding region along with the amino acid sequence of the SdrH
protein (SEQ ID No. 14).
[0047] FIG. 5 shows the relationships between the Sdr proteins of
S. aureus and S. epidermidis as follows: FIG. 5A is a schematic
representation of previously described S. aureus Sdr proteins; FIG.
5B is a schematic representation of SdrF, SdrG, and SdrH showing
the relative position and/or size of their signal sequences (S),
region As (A), region B repeats (B.sub.n), SD-repeat region (SD),
region C(C) (SdrH only), and wall/membrane spanning regions (WM);
and FIG. 5C represents the C-terminal amino acid sequences of SdrF,
SdrG, and SdrH showing the positions of the SD repeats, LPXTG motif
(underlined), hydrophobic membrane-spanning regions (bold), and
charged terminal residues.
[0048] FIG. 6 illustrates the prevalence of the sdr genes in S.
epidermidis strains and shows Southern blots containing S.
epidermidis genomic DNA hybridizing to DNA probes encoding the: (A)
the SD-repeat region; (B) the SdrH region A; (C) the SdrG region A;
and (D) the SdrG and SdrF region As. Strains are as follows: lane
1, ATCC14990; lane 2, KH11; lane 3, K28; lane 4, RP62a; lane 5,
TU3298; lane 6, 9142; lane 7 1457; lane 8, 8400; lane 9, N910308;
lane 10, N910160; lane 11, N910102; lane 12, N910173; lane 13,
N910191; lane 14, N910231; lane 15, N950249. Strain 9491 is not
shown. Kilobases (kb) size markers are shown at the left of panels
A-D.
[0049] FIG. 7 shows the recombinant Sdr region A proteins and the
specificity of their respective antisera as evidenced by: (A)
Coomassie-stained SDS-PAGE of purified proteins used to raise
rabbit polyclonal antisera. Lanes 1 and 2, histidine-tagged SdrFA
and SdrGA, respectively; lane 3, GST-tagged SdrHA; (B) Left panel:
Reactivity of pooled anti-SdrFA, -SdrGA, and -SdrHA antisera to E.
coli lysates expressing GST-tagged SdrFA (lane 1), SdrGA (lane 2),
and SdrHA (lane 3). Middle and right panels: Reactivity of
anti-SdrFA and -SdrGA antisera, respectively, to the same proteins;
and (C) Left panel: Reactivity of anti-histidine monoclonal
antibody to E. coli lysates expressing histidine-tagged SdrFA (lane
1), SdrGA (lane 2) and full-length SdrH (lane 3). Right panel:
Reactivity of anti-SdrHA antiserum to the same proteins. Kilodalton
(kDa) size markers are shown at the left of panels A, B, and C.
[0050] FIG. 8 depicts immunoblot analyses of Sdr protein expression
in S. epidermidis, including: (A) Reactivity of anti-SdrFA antisera
to a lysate of S. epidermidis 9491. Lane 1, immune antiserum; lane
2, preimmune antiserum; and lane 3, SdrFA-absorbed immune
antiserum; (B) Reactivity of anti-SdrGA immune (lane 1), preimmune
(lane 2), and SdrGA-absorbed immune (lane 3) antisera to a lysate
of S. epidermidis strain K28; and (C) Reactivity of anti-SdrHA
immune (lane 1) and SdrHA-absorbed immune (lane 2) antisera to a
lysate of S. epidermidis 9491. kDa size markers are shown to the
left of A, B, and C.
[0051] FIG. 9 shows the genetic analysis of SdrH protein size
variation among S. epidermidis strains, including: (A) Reactivity
of anti-SdrHA antiserum to different S. epidermidis strain lysates
which reveal strain variations in the molecular mass of SdrH. Lane
1-3: Strains 9491, 8400, and KH11, respectively; and (B) PCR
products representing DNA encoding the SdrH SD-repeat regions
(lanes 1-3) or the region Cs (lanes 4-6) of the same strains. kDa
and kb size markers are shown at the left of A and B,
respectively.
[0052] FIG. 10 represents analyses of Sdr proteins in cell-wall
extracts and protoplasts, including: (A) Reactivity of anti-SdrFA
antiserum to S. epidermidis strain 9491 lysates (lane 1), cell-wall
extracts (lane 2), and purified protoplasts (lane 3); and (B) and
(C) Reactivity of anti-SdrGA and -SdrHA antisera, respectively, to
the same samples. KDa size markers are shown at the left of A, B,
and C.
[0053] FIG. 11 shows the reactivity of IgG from patients
convalescing from S. epidermidis infections to recombinant SdrFA
(open bars), SdrGA (gray bars), and SdrHA (black bars) coated in an
ELISA microtiter plate. Pooled IgG from two-year-old children was
used as a comparative control. Error bars reflect standard
deviations.
DETAILED DESCRIPTION OF THE INVENTION
[0054] Isolated Sdr proteins and their corresponding amino acid and
nucleic acid sequences are described herein. The proteins are
designated SdrF, SdrG, and SdrH. The DNA sequence of sdrF and the
amino acid sequence of the protein SdrF (in bold) are shown in FIG.
2 along with their flanking sequences. The DNA sequence of sdrG and
the amino acid sequence of the protein SdrG (in bold) are shown in
FIG. 3 along with their flanking sequences. Finally, the SdrH
coding region including DNA and amino acid sequence is shown in
FIG. 4.
[0055] The SdrF, SdrG, and SdrH proteins are related in primary
sequence and structural organization to the extracellular
matrix-binding Sdr family of proteins from Staphylococcus aureus
and are localized on the cell surface. The SdrF, SdrG, and SdrH
proteins are cell wall-associated proteins, with a signal sequence
at the N-terminus and an LPXTG (SEQ ID NO:17) motif, a hydrophobic
domain and positively charged residues at the C-terminus. Each also
has an SD repeat containing region R of sufficient length to allow
efficient expression of the ligand binding domain region A on the
cell surface. With the A region of the SdrF, SdrG, and SdrH
proteins located on the cell surface, the proteins can interact
with proteins in plasma, the extracellular matrix or with molecules
on the surface of host cells. SdrG, for example, binds the
N-terminal one-half of the beta chain of fibrinogen.
[0056] The disclosed extracellular matrix-binding proteins share a
unique dipeptide repeat region (region R) including predominately
aspartate and serine residues. This DS repeat is encoded by 18
nucleotide repeats with the consensus GAY TCN GAY TCN GAY AGY, with
TCN as the first and second serine codons and AGY as the third
serine codon. The R region is near the C-terminus of the proteins
and typically contains between 40 and 300 DS residues, or more
particularly, greater than 60, 80, 100, 120, 150, 200 or 250
repeating units, of which greater than 90, 95 or even 98% are the
amino acids D or S. The R region DS repeat varies in length between
proteins, and while the region R itself does not bind extracellular
matrix proteins, the R region enables the presentation of the
binding regions of the protein on the cell surface of S. aureus.
Thus, probes to the consensus DNA encoding the DS repeat (see
above) can be used to identify other genes encoding different
binding proteins essential to the attachment of S. aureus to host
tissues. Antibodies to an R region can also be used to identify
such additional binding proteins.
[0057] It has been discovered that in the A region of SdrF and SdrG
there is highly conserved amino acid sequence that can be used to
derive a consensus TYTFTDYVD (SEQ ID NO:16) motif. The motif can be
used in multicomponent vaccines to impart broad spectrum immunity
to bacterial infections, and also can be used to produce monoclonal
or polyclonal antibodies that impart broad spectrum passive
immunity. In an alternative embodiment, any combination of the
variable sequence motif derived from the Sdr protein family, (T)
(Y) (T) (F) (T) (D/N) (Y) (V) (D), can be used to impart immunity
or to induce protective antibodies.
[0058] It has further been discovered that SdrG has an open reading
frame of 2736 nucleotides that encode a protein of 913 amino acid
residues. The protein has a signal sequence of 30 amino acids, a
ligand binding A region of 542 amino acids, and two repeated motifs
termed B regions. B1 is 113 amino acids and B2 is 110 amino acids,
and the R region is 77 amino acids. B regions contain EF hand
motifs that signify Ca++binding, and are similar to those found in
other Ca++binding proteins such as calmodulin and troponin. An
additional more degenerate form of the EF hand motif was found in
the A region of SdrG between the residues 459-471. A significant
decrease in the binding of SdrG A to Fibrinogen was noted in the
presence of EDTA, demonstrating a metal-ion dependence for
binding.
[0059] I. Definitions
[0060] The terms "SdrF protein", "SdrG protein" and "SdrH protein"
are defined herein to include SdrF, SdrG, and SdrH subdomains, and
active or antigenic fragments of SdrF, SdrG, and SdrH proteins,
such as consensus or variable sequence amino acid motifs.
[0061] As used herein, "pg" means picogram, "ng" means nanogram,
"ug" or ".mu.g" mean microgram, "mg" means milligram, "ul" or
".mu.l" mean microliter, "ml" means milliliter, "l" means
liter.
[0062] "Active fragments" of SdrF, SdrG, and SdrH proteins are
defined herein as peptides or polypeptides capable of blocking the
binding of coagulase-negative staphylococci to immobilized or
soluble host proteins.
[0063] The term "adhesin" as used herein includes naturally
occurring and synthetic or recombinant proteins and peptides which
can bind to extracellular matrix proteins and/or mediate adherence
to host cells.
[0064] The term "amino acid" as used herein includes naturally
occurring and synthetic amino acids and includes, but is not
limited to, alanine, valine, leucine, isoleucine, proline,
phenylalanine, tryptophan, methionine, glycine, serine, threonine,
cysteine, tyrosine, asparagine, glutamate, aspartic acid, glutamic
acid, lysine, arginine, and histidine.
[0065] An "antibody" is any immunoglobulin, including antibodies
and fragments thereof, that binds a specific epitope. The term as
used herein includes monoclonal antibodies, polyclonal, chimeric,
single chain, bispecific, simianized, and humanized antibodies as
well as Fab fragments, including the products of an Fab
immunoglobulin expression library.
[0066] The phrase "antibody molecule" in its various grammatical
forms as used herein contemplates both an intact immunoglobulin
molecule and an immunologically active portion of an immunoglobulin
molecule.
[0067] "Antigenic fragments" of SdrF, SdrG, and SdrH proteins are
defined herein as peptides or polypeptides capable of producing an
immunological response.
[0068] As used herein, an "antigenically functional equivalent"
protein or peptide is one that incorporates an epitope that is
immunologically cross-reactive with one or more epitopes of the
particular proteins disclosed. Antigenically functional
equivalents, or epitopic sequences, may be first designed or
predicted and then tested, or may simply be directly tested for
cross-reactivity.
[0069] A "cell line" is a clone of a primary cell that is capable
of stable growth in vitro for many generations.
[0070] A "clone" is a population of cells derived from a single
cell or common ancestor by mitosis.
[0071] A DNA "coding sequence" is a double-stranded DNA sequence
which is transcribed and translated into a polypeptide in vivo when
placed under the control of appropriate regulatory sequences. The
boundaries of the sequence are determined by a start codon at the
5' (amino) terminus and a translation stop codon at the 3'
(carboxyl) terminus. A coding sequence can include, but is not
limited to, prokaryotic sequences, cDNA from eukaryotic mRNA,
genetic DNA sequences from eukaryotic (e.g., mammalian) DNA, and
even synthetic DNA sequences. A polyadenylation signal and
transcription termination sequence will usually be located 3' to
the coding sequence.
[0072] "DNA molecule" refers to the polymeric form of
deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in
either its single stranded form, or a double stranded helix. This
term refers only to the primary and secondary structure of the
molecule, and does not limit it to any particular tertiary forms.
Thus, this term includes double-stranded DNA found, inter alia, in
linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure of
particular double-stranded DNA molecules, sequences may be
described herein according to the normal convention of giving only
the sequence in the 5' to 3' direction along the nontranscribed
strand of DNA (i.e., the strand having a sequence homologous to the
mRNA.
[0073] Transcriptional and translational control sequences are "DNA
regulatory sequences", such as promoters, enhancers,
polyadenylation signals, terminators, and the like, that provide
for the expression of a coding sequence in a host cell.
[0074] An "expression control sequence" is a DNA sequence that
controls and regulates the transcription and translation of another
DNA sequence. A coding sequence is "under the control" of
transcriptional and translational control sequences in a cell when
RNA polymerase transcribes the coding sequence into mRNA, which is
then translated into the protein encoded by the coding
sequence.
[0075] As used herein, the term "extracellular matrix proteins," or
ECM, refers to four general families of macromolecules, collagens,
structural glycoproteins, proteoglycans and elastins, including
fibronectin, and fibrinogen, that provide support and modulate
cellular behavior.
[0076] As used herein, a "host cell" is a cell which has been
transformed or transfected, or is capable of transformation or
transfection by an exogenous polynucleotide sequence.
[0077] "Identity," as known in the art, is a relationship between
two or more polypeptide sequences or two or more polynucleotide
sequences, as determined by comparing the sequences. In the art,
"identity" also means the degree of sequence relatedness between
polypeptide or polynucleotide sequences, as the case may be, as
determined by the match between strings of such sequences.
[0078] "Identity" and "similarity" can be readily calculated by
known methods (Computational Molecular Biology, Lesk, A. M., ed.,
Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D. W., ed., Academic Press, New York,
1993). While there exist a number of methods to measure identity
and similarity between two sequences, both terms are well known to
skilled artisans. Methods commonly employed to determine identity
or similarity between sequences include, but are not limited to
those disclosed in Carillo, H., and Lipman, D., SIAM J. Applied
Math., 48:1073 (1988). Preferred methods to determine identity are
designed to give the largest match between the sequences tested.
Methods to determine identity and similarity are codified in
publicly available computer programs. Preferred computer program
methods to determine identity and similarity between two sequences
include, but are not limited to, GCG program package (Devereux et
al., Nucleic Acids Research 12(1): 387, 1984), BLASTP, BLASTN, and
FASTA (Atschul et al., J. Molec. Biol. 215: 403-410, 1990). The
BLAST X program is publicly available from NCBI and other sources
(BLAST Manual, Altschul et al., NCBI NLM NIH Bethesda, Md. 20894;
Altschul et al., J. Mol. Biol. 215: 403-410, 1990).
[0079] By "immunologically effective amount" is meant an amount of
a peptide composition that is capable of generating an immune
response in the recipient animal. This includes both the generation
of an antibody response (B cell response), and/or the stimulation
of a cytotoxic immune response (T cell response). The generation of
such an immune response will have utility in both the production of
useful bioreagents, e.g., CTLs and, more particularly, reactive
antibodies, for use in diagnostic embodiments, and will also have
utility in various prophylactic or therapeutic embodiments.
[0080] As used herein, the term "in vivo vaccine" refers to
immunization of animals with proteins so as to elicit a humoral and
cellular response that protects against later exposure to the
pathogen.
[0081] The term "isolated" is defined herein as free from at least
some of the components with which it naturally occurs. "Isolated"
as used herein also means altered "by the hand of man" from its
natural state, i.e., if it occurs in nature, it has been changed or
removed from its original environment, or both. For example, a
polynucleotide or a polypeptide naturally present in a living
organism is not "isolated," but the same polynucleotide or
polypeptide separated from the coexisting materials of its natural
state is "isolated", as the term is employed herein.
[0082] The term "ligand" is used to include molecules, including
those within host tissues, to which pathogenic bacteria attach.
[0083] The phrase "monoclonal antibody" in its various grammatical
forms refers to an antibody having only one species of antibody
combining site capable of immunoreacting with a particular
antigen.
[0084] The term "oligonucleotide," as used herein is defined as a
molecule comprised of two or more nucleotides, preferably more than
three. Its exact size will depend upon many factors which, in turn,
depend upon the ultimate function and use of the
oligonucleotide.
[0085] As used herein, the phrase "pharmaceutically acceptable"
refers to molecular entities and compositions that are
physiologically tolerable and do not typically produce an
unacceptable allergic or similar untoward reaction when
administered to a human.
[0086] "Polynucleotide(s)" generally refers to any
polyribonucleotide or polydeoxyribonucleotide, which may be
unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide(s)"
include, without limitation, single- and double-stranded DNA, DNA
that is a mixture of single- and double-stranded regions or
single-, double- and triple-stranded regions, single- and
double-stranded RNA, and RNA that is mixture of single- and
double-stranded regions, hybrid molecules comprising DNA and RNA
that may be single-stranded or, more typically, double-stranded, or
triple-stranded, or a mixture of single- and double-stranded
regions. In addition, "polynucleotide" as used herein refers to
triple-stranded regions comprising RNA or DNA or both RNA and DNA.
The strands in such regions may be from the same molecule or from
different molecules. The regions may include all of one or more of
the molecules, but more typically involve only a region of some of
the molecules. One of the molecules of a triple-helical region
often is an oligonucleotide. As used herein, the term
"polynucleotide(s)" includes DNAs or RNAs as described above that
contain one or more modified bases. Thus, DNAs or RNAs with
backbones modified for stability or for other reasons are
"polynucleotide(s)" as that term is intended herein. Moreover, DNAs
or RNAs comprising unusual bases, such as inosine, or modified
bases, such as tritylated bases, to name just two examples, are
polynucleotides as the term is used herein. It will be appreciated
that a great variety of modifications have been made to DNA and RNA
that serve many useful purposes known to those of skill in the art.
The term "polynucleotide(s)" as it is employed herein embraces such
chemically, enzymatically or metabolically modified forms of
polynucleotides, as well as the chemical forms of DNA and RNA
characteristic of viruses and cells, including, for example, simple
and complex cells. "Polynucleotide(s)" embraces short
polynucleotides often referred to as oligonucleotide(s).
[0087] "Polypeptide(s)" refers to any peptide or protein comprising
two or more amino acids joined to each other by peptide bonds or
modified peptide bonds. "Polypeptide(s)" refers to both short
chains, commonly referred to as peptides, oligopeptides and
oligomers and to longer chains generally referred to as proteins.
Polypeptides may contain amino acids other than the 20 genetically
encoded amino acids. "Polypeptide(s)" include those modified either
by natural processes, such as processing and other
post-translational modifications, but also by chemical modification
techniques which are well known to the art. Such modifications are
well described in basic texts and in more detailed monographs, as
well as in a voluminous research literature, and they are well
known to those of skill in the art. It will be appreciated that the
same type of modification may be present in the same or varying
degree at several sites in a given polypeptide. Also, a given
polypeptide may contain many types of modifications. Modifications
can occur anywhere in a polypeptide, including the peptide
backbone, the amino acid side-chains and the amino or carboxyl
termini. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphatidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formulation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic processing, phosphorylation, prenylation, racemization,
glycosylation, lipid attachment, sulfation, gamma-carboxylation of
glutamic acid residues, hydroxylation and ADP-ribosylation,
selenoylation, sulfation, transfer-RNA mediated addition of amino
acids to proteins such as arginylation, and ubiquitination. See,
for instance Seifter et al., Meth. Enzymol. 182:626-646, 1990 and
Rattan et al., Ann. N.Y. Acad. Sci. 663: 48-62, 1992. Polypeptides
may be branched or cyclic, with or without branching. Cyclic,
branched and branched circular polypeptides may result from
post-translational natural processes and may be made by entirely
synthetic methods, as well.
[0088] The term "primer" as used herein refers to an
oligonucleotide, whether occurring naturally as in a purified
restriction digest or produced synthetically, which is capable of
acting as a point of initiation of synthesis when placed under
conditions in which synthesis of a primer extension product, which
is complementary to a nucleic acid strand, is induced, i.e., in the
presence of nucleotides and an inducing agent such as a DNA
polymerase and at a suitable temperature and pH. The primer may be
either single-stranded or double-stranded and must be sufficiently
long to prime the synthesis of the desired extension product in the
presence of the inducing agent. The exact length of the primer will
depend upon many factors, including temperature, source of primer
and use of the method. For example, for diagnostic applications,
depending on the complexity of the target sequence, the
oligonucleotide primer typically contains 15-25 or more
nucleotides, although it may contain fewer nucleotides.
[0089] The primers herein are selected to be substantially
complementary to different strands of a particular target DNA
sequence. This means that the primers must be sufficiently
complementary to hybridize with their respective strands.
Therefore, the primer sequence need not reflect the exact sequence
of the template. For example, a noncomplementary nucleotide
fragment may be attached to the 5' end of the primer, with the
remainder of the primer sequence being complementary to the strand.
Alternatively, noncomplementary bases or longer sequences can be
interspersed into the primer, provided that the primer sequence has
sufficient complementarity with the sequence of the strand to
hybridize therewith and thereby form the template for the synthesis
of the extension product.
[0090] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. For purposes of defining
the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription initiation site and extends upstream
(5' direction) to include the minimum number of bases or elements
necessary to initiate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site (conveniently defined by mapping with
nuclease SI), as well as protein binding domains (consensus
sequences) responsible for the binding of RNA polymerase.
Eukaryotic promoters will often, but not always, contain "TATA"
boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno
sequences in addition to the -10 and -35 consensus sequences.
[0091] A "replicon" is a genetic element (e.g., plasmid,
chromosome, virus) that functions as an autonomous unit of DNA
replication in vivo; i.e., capable of replication under its own
control.
[0092] As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes, each of which
cuts double-stranded DNA at or near a specific palindromic
nucleotide sequence.
[0093] A "signal sequence" can be included before the coding
sequence. This sequence encodes a signal peptide, N-terminal to the
polypeptide, that communicates to the host cell to direct the
polypeptide to the cell surface or secrete the polypeptide into the
media, and this signal peptide is clipped off by the host cell
before the protein leaves the cell. Signal sequences can be found
associated with a variety of proteins native to prokaryotes and
eukaryotes.
[0094] A cell has been "transformed" by exogenous or heterologous
DNA when such DNA has been introduced inside the cell. The
transforming DNA may or may not be integrated (covalently linked)
into chromosomal DNA making up the genome of the cell. In
prokaryotes, yeast, and mammalian cells for example, the
transforming DNA may be maintained on an episomal element such as a
plasmid. With respect to eukaryotic cells, a stably transformed
cell is one in which the transforming DNA has become integrated
into a chromosome so that it is inherited by daughter cells through
chromosome replication. This stability is demonstrated by the
ability of the eukaryotic cell to establish cell lines or clones
comprised of a population of daughter cells containing the
transforming DNA.
[0095] "Variant(s)" as the term is used herein, is a polynucleotide
or polypeptide that differs from a reference polynucleotide or
polypeptide respectively, but retains essential properties. A
typical variant of a polynucleotide differs in nucleotide sequence
from another, reference polynucleotide. Changes in the nucleotide
sequence of the variant may or may not alter the amino acid
sequence of a polypeptide encoded by the reference polynucleotide.
Nucleotide changes may result in amino acid substitutions,
additions, deletions, fusions or truncations in the polypeptide
encoded by the reference sequence, as discussed below. A typical
variant of a polypeptide differs in amino acid sequence from
another, reference polypeptide. Generally, differences are limited
so that the sequences of the reference polypeptide and the variant
are closely similar overall and, in many regions, identical. A
variant and reference polypeptide may differ in amino acid sequence
by one or more substitutions, additions or deletions in any
combination. A substituted or inserted amino acid residue may or
may not be one encoded by the genetic code. A variant of a
polynucleotide or polypeptide may be a naturally occurring such as
an allelic variant, or it may be a variant that is not known to
occur naturally. Non-naturally occurring variants of
polynucleotides and polypeptides may be made by mutagenesis
techniques, by direct synthesis, and by other recombinant methods
known to skilled artisans.
[0096] A "vector" is a replicon, such as plasmid, phage or cosmid,
to which another DNA segment may be attached so as to bring about
the replication of the attached segment.
[0097] II. Nucleic Acid and Amino Acid Sequences
[0098] The nucleic acid sequences encoding SdrF, SdrG, and SdrH (as
shown in FIGS. 2-4, respectively) or portions thereof, such as
consensus or variable sequence amino acid motifs, are useful for
the production of recombinant proteins or as nucleic acid probes
for the detection of coagulase-negative staphylococci proteins in a
sample or specimen with high sensitivity and specificity. The
probes can be used to detect the presence of coagulase-negative
staphylococci in the sample, diagnose infection with the disease,
quantify the amount of coagulase-negative staphylococci in the
sample, or monitor the progress of therapies used to treat the
infection. The nucleic acid and amino acid sequences can also be
useful as laboratory research tools to study the organism and the
disease or to develop therapies and treatments for the disease.
[0099] It will be understood by those skilled in the art that the
SdrF, SdrG, or SdrH proteins are also encoded by sequences
substantially similar to the nucleic acid sequences provided in the
Sequence Listing. Two DNA sequences are "substantially similar"
when approximately 70% or more (preferably at least about 80%, and
most preferably at least about 90 or 95%) of the nucleotides match
over the defined length of the DNA sequences. Sequences that are
substantially homologous can be identified by comparing the
sequences using standard software available in sequence data banks,
or in a Southern hybridization experiment under, for example,
stringent conditions as defined for that particular system.
Defining appropriate hybridization conditions is within the skill
of the art. See, e.g., Maniatis et al., Molecular Cloning: A
Laboratory Manual, 1982; DNA Cloning, Vols. I & II, supra;
Nucleic Acid Hybridization, [B. D. Hames & S. J. Higgins eds.
(1985)]. By "substantially similar" is further meant a DNA sequence
which, by virtue of the degeneracy of the genetic code, is not
identical with that shown in any of the sequences shown in FIGS.
2-4, but which still encodes the same amino acid sequence; or a DNA
sequence which encodes a different amino acid sequence that retains
the activities of the proteins, either because one amino acid is
replaced with a similar amino acid, or because the change (whether
it be substitution, deletion or insertion) does not affect the
active site of the protein. Two amino acid sequences or two nucleic
acid sequences are "substantially similar" when approximately 70%
or more (preferably at least about 80%, and more preferably at
least about 90% or 95%) of the amino acids match over the defined
length of the sequences.
[0100] Modification and changes may be made in the structure of the
peptides of the present invention and DNA segments which encode
them and still obtain a functional molecule that encodes a protein
or peptide with desirable characteristics. The following is a
discussion based upon changing the amino acids of a protein to
create an equivalent, or even an improved, second generation
molecule. The amino acid changes may be achieved by changing the
codons of the DNA sequence, according to Table 1. It should be
understood by one skilled in the art that the codons specified in
Table 1 are for RNA sequences. The corresponding codons for DNA
have a T substituted for U. In keeping with standard nomenclature
(J. Biol. Chem., 243:3552-3559, 1969), abbreviations for amino acid
residues are further shown in Table 1.
1TABLE 1 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine
Cys C UGC UGU Aspartic acid Asp D GAC GAU GAC GAU Glutamic acid Glu
E GAA GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GCG GGG GGU
Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K
AAA AAG Leucine Leu L UUA UUG CUA CUC CUG GUU Methionine Met M AUG
Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine
Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S
AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val
V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
[0101] For example, certain amino acids may be substituted for
other amino acids in a protein structure without appreciable loss
of interactive binding capacity with structures such as, for
example, antigen-binding regions of antibodies or binding sites on
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid sequence substitutions can
be made in a protein sequence, and, of course, its underlying DNA
coding sequence, and nevertheless obtain a protein with like
properties. It is thus contemplated by the inventors that various
changes may be made in the peptide sequences of the disclosed
compositions, or corresponding DNA sequences which encode said
peptides without appreciable loss of their biological utility or
activity.
[0102] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte and Doolittle, J. Mol Biol,
157(1):105-132, 1982, incorporate herein by reference). It is
accepted that the relative hydropathic character of the amino acid
contributes to the secondary structure of the resultant protein,
which in turn defines the interaction of the protein with other
molecules, for example, enzymes, substrates, receptors, DNA,
antibodies, antigens, and the like. Each amino acid has been
assigned a hydropathic index on the basis of its hydrophobicity and
charge characteristics (Kyte and Doolittle, supra, 1982), these
are: isoleucine (+4.5); valine (+4.2); leucine (+3.8);
phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9);
alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8);
tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine
(-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5);
asparagine (-3.5); lysine (-3.9); and arginine (4.5).
[0103] It is known in the art that certain amino acids may be
substituted by other amino acids having a similar hydropathic index
or score and still result in a protein with similar biological
activity, i.e., still obtain a biological functionally equivalent
protein. In making such changes, the substitution of amino acids
whose hydropathic indices are within .+-.2 is preferred, those
which are within .+-.1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred. It is also understood
in the art that the substitution of like amino acids can be made
effectively on the basis of hydrophilicity. U.S. Pat. No.
4,554,101, incorporated herein by reference, states that the
greatest local average hydrophilicity of a protein, as governed by
the hydrophilicity of its adjacent amino acids, correlates with a
biological property of the protein.
[0104] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+1.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4). It is understood that an
amino acid can be substituted for another having a similar
hydrophilicity value and still obtain a biologically equivalent,
and in particular, an immunologically equivalent protein. In such
changes, the substitution of amino acids whose hydrophilicity
values are within .+-.2 is preferred, those which are within .+-.1
are particularly preferred, and those within .+-.0.5 are even more
particularly preferred.
[0105] As outlined above, amino acid substitutions are generally
therefore based on the relative similarity of the amino acid
side-chain substituents, for example, their hydrophobicity,
hydrophilicity, charge, size, and the like. Exemplary substitutions
which take various of the foregoing characteristics into
consideration are well known to those of skill in the art and
include: arginine and lysine; glutamate and aspartate; serine and
threonine; glutamine and asparagine; and valine, leucine and
isoleucine.
[0106] The polypeptides of the present invention can be can be
chemically synthesized. The synthetic polypeptides are prepared
using the well known techniques of solid phase, liquid phase, or
peptide condensation techniques, or any combination thereof, and
can include natural and unnatural amino acids. Amino acids used for
peptide synthesis may be standard Boc (N.sup.a-amino protected
N.sup.a-t-butyloxycarbonyl) amino acid resin with the standard
deprotecting, neutralization, coupling and wash protocols of the
original solid phase procedure of Merrifield (J. Am. Chem. Soc.,
85:2149-2154, 1963), or the base-labile N.sup.a-amino protected
9-fluorenylmethoxycarbonyl (Fmoc) amino acids first described by
Carpino and Han (J. Org. Chem., 37:3403-3409, 1972). Both Fmoc and
Boc N.sup.a-amino protected amino acids can be obtained from Fluka,
Bachem, Advanced Chemtech, Sigma, Cambridge Research Biochemical,
Bachem, or Peninsula Labs or other chemical companies familiar to
those who practice this art. In addition, the method of the
invention can be used with other N.sup.a-protecting groups that are
familiar to those skilled in this art. Solid phase peptide
synthesis may be accomplished by techniques familiar to those in
the art and provided, for example, in Stewart and Young, 1984,
Solid Phase Synthesis, Second Edition, Pierce Chemical Co.,
Rockford, Ill.; Fields and Noble, 1990, Int. J. Pept Protein Res.
35:161-214, or using automated synthesizers, such as sold by ABS.
Thus, polypeptides of the invention may comprise D-amino acids, a
combination of D- and L-amino acids, and various "designer" amino
acids (e.g., .beta.-methyl amino acids, C.alpha.-methyl amino
acids, and N.alpha.-methyl amino acids, etc.) to convey special
properties. Synthetic amino acids include ornithine for lysine,
fluorophenylalanine for phenylalanine, and norleucine for leucine
or isoleucine. Additionally, by assigning specific amino acids at
specific coupling steps, .alpha.-helices, .beta. turns, .beta.
sheets, .gamma.-turns, and cyclic peptides can be generated.
[0107] In a further embodiment, subunits of peptides that confer
useful chemical and structural properties will be chosen. For
example, peptides comprising D-amino acids will be resistant to
L-amino acid-specific proteases in vivo. In addition, the present
invention envisions preparing peptides that have more well defined
structural properties, and the use of peptidomimetics and
peptidomimetic bonds, such as ester bonds, to prepare peptides with
novel properties. In another embodiment, a peptide may be generated
that incorporates a reduced peptide bond, i.e.,
R.sub.1--CH.sub.2--NH--R.sub.2, where R.sub.1 and R.sub.2 are amino
acid residues or sequences. A reduced peptide bond may be
introduced as a dipeptide subunit. Such a molecule would be
resistant to peptide bond hydrolysis, e.g., protease activity. Such
peptides would provide ligands with unique function and activity,
such as extended half-lives in vivo due to resistance to metabolic
breakdown or protease activity. Furthermore, it is well known that
in certain systems constrained peptides show enhanced functional
activity (Hruby, Life Sciences, 31:189-199, 1982); (Hruby et al.,
Biochem J., 268:249-262, 1990).
[0108] The following non-classical amino acids may be incorporated
in the peptide in order to introduce particular conformational
motifs: 1,2,3,4-tetrahydroisoquinoline-3-carboxylate (Kazmierski et
al., J. Am. Chem. Soc., 113:2275-2283, 1991);
(2S,3S)-methyl-phenylalanine, (2S,3R)-methyl-phenylalanine,
(2R,3S)-methyl-phenylalanine and (2R,3R)-methyl-phenylalanine
(Kazmierski and Hruby, Tetrahedron Lett., 1991);
2-aminotetrahydronaphthalene-2-carboxylic acid (Landis, Ph.D.
Thesis, University of Arizona, 1989);
hydroxy-1,2,3,4-tetrahydroisoquinol- ine-3-carboxylate (Miyake et
al, J. Takeda Res. Labs., 43:53-76, 1989); .beta.-carboline (D and
L) (Kazmierski, Ph.D. Thesis, University of Arizona, 1988); HIC
(histidine isoquinoline carboxylic acid) (Zechel et al, Int. J.
Pep. Protein Res., 43, 1991); and HIC (histidine cyclic urea)
(Dharanipragada).
[0109] The following amino acid analogs and peptidomimetics may be
incorporated into a peptide to induce or favor specific secondary
structures: LL-Acp (LL-3-amino-2-propenidone-6-carboxylic acid), a
.beta.-turn inducing dipeptide analog (Kemp et al., J. Org. Chem.,
50:5834-5838 (1985); .beta.-sheet inducing analogs (Kemp et al.,
Tetrahedron Lett., 29:5081-5082, 1988); .beta.-turn inducing
analogs (Kemp et al., Tetrahedron Lett., 29:5057-5060, 1988);
alpha-helix inducing analogs (Kemp et al., Tetrahedron Lett.,
29:4935-4938, 1988); .gamma.-turn inducing analogs (Kemp et al., J.
Org. Chem., 54:109:115, 1989); and analogs provided by the
following references: Nagai and Sato, Tetrahedron Lett., 26:647-650
(1985); DiMaio et al., J. Chem. Soc. Perkin Trans., p. 1687 (1989);
also a Gly-Ala turn analog (Kahn et al., Tetrahedron Lett.,
30:2317, 1989); amide bond isostere (Jones et al., Tetrahedron
Lett., 29:3853-3856, 1989); tetrazole (Zabrocki et al., J. Am.
Chem. Soc., 110:5875-5880, 1988); DTC (Samanen et al., Int. J.
Protein Pep. Res., 35:501:509, 1990); and analogs taught in Olson
et al., (J. Am. Chem. Sci., 112:323-333, 1990) and Garvey et al.,
(J. Org. Chem., 56:436, 1990). Conformationally restricted mimetics
of beta turns and beta bulges, and peptides containing them, are
described in U.S. Pat. No. 5,440,013, issued Aug. 8, 1995 to
Kahn.
[0110] Also provided herein are sequences of nucleic acid molecules
that selectively hybridize with nucleic acid molecules encoding the
fibrinogen-binding proteins or portions thereof, such as consensus
or variable sequence amino acid motifs, from coagulase-negative
staphylococcal bacteria such as S. epidermidis described herein or
complementary sequences thereof. By "selective" or "selectively" is
meant a sequence which does not hybridize with other nucleic acids.
This is to promote specific detection of sdrF, sdrG, or sdrH.
Therefore, in the design of hybridizing nucleic acids, selectivity
will depend upon the other components present in a sample. The
hybridizing nucleic acid should have at least 70% complementarity
with the segment of the nucleic acid to which it hybridizes. As
used herein to describe nucleic acids, the term "selectively
hybridizes" excludes the occasional randomly hybridizing nucleic
acids, and thus, has the same meaning as "specifically
hybridizing". The selectively hybridizing nucleic acids of the
invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, and
99% complementarity with the segment of the sequence to which they
hybridize.
[0111] The invention contemplates sequences, probes and primers
which selectively hybridize to the encoding DNA or the
complementary, or opposite, strand of DNA as those specifically
provided herein. Specific hybridization with nucleic acid can occur
with minor modifications or substitutions in the nucleic acid, so
long as functional species-specific hybridization capability is
maintained. By "probe" is meant nucleic acid sequences that can be
used as probes or primers for selective hybridization with
complementary nucleic acid sequences for their detection or
amplification, which probes can vary in length from about 5 to 100
nucleotides, or preferably from about 10 to 50 nucleotides, or most
preferably about 18-24 nucleotides. Therefore, the terms "probe" or
"probes" as used herein are defined to include "primers". Isolated
nucleic acids are provided herein that selectively hybridize with
the species-specific nucleic acids under stringent conditions and
should have at least 5 nucleotides complementary to the sequence of
interest as described by Sambrook et al., 1989. MOLECULAR CLONING:
A LABORATORY MANUAL, 2nd ed. Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.
[0112] If used as primers, the composition preferably includes at
least two nucleic acid molecules which hybridize to different
regions of the target molecule so as to amplify a desired region.
Depending on the length of the probe or primer, the target region
can range between 70% complementary bases and full complementarity
and still hybridize under stringent conditions. For example, for
the purpose of diagnosing the presence of the S. epidermidis, the
degree of complementarity between the hybridizing nucleic acid
(probe or primer) and the sequence to which it hybridizes (e.g.,
coagulase-negative staphylococcal DNA from a sample) is at least
enough to distinguish hybridization with a nucleic acid from other
bacteria.
[0113] The nucleic acid sequences encoding SdrF, SdrG, or SdrH
proteins or portions thereof, such as consensus or variable
sequence amino acid motifs, can be inserted into a vector, such as
a plasmid, and recombinantly expressed in a living organism to
produce recombinant SdrF, SdrG, or SdrH proteins or fragments
thereof. For example, DNA molecules producing recombinant SdrF,
SdrG, and SdrH have been produced in plasmids in accordance with
the present invention.
[0114] Recombinant proteins are produced by methods well known to
those skilled in the art. A cloning vector, such as a plasmid or
phage DNA is cleaved with a restriction enzyme, and the DNA
sequence encoding the SdrF, SdrG, or SdrH protein or fragments
thereof, such as consensus or variable sequence amino acid motifs,
is inserted into the cleavage site and ligated. The cloning vector
is then inserted into a host to produce the protein or fragment
encoded by the SdrF, SdrG, or SdrH encoding DNA. Suitable hosts
include bacterial hosts such as Escherichia coli, Bacillus
subtilis, yeasts and other cell cultures. Production and
purification of the gene product may be achieved and enhanced using
known molecular biology techniques.
[0115] III. Uses of Sdr Nucleic Acids
[0116] Methods of using the nucleic acids described herein to
detect and identify the presence of coagulase-negative
staphylococci are provided. The methods are useful for diagnosing
coagulase-negative staphylococcal infections and other associated
diseases such as catheter related infections, biomaterial related
infections, upper respiratory tract infections (such as otitis
media, bacterial tracheitis, acute epiglottitis, thyroiditis),
lower respiratory infections (such as emphysema, lung abscess),
cardiac (such as infective endocarditis), gastrointestinal (such as
secretory diarrhea, splenic abscess, retroperitoneal abscess),
central nervous system (such as cerebral abscess), ocular (such as
blepharitis, conjunctivitis, keratitis, endophthalmitis, preseptal
and orbital cellulitis, darcryocystitis), kidney and urinary tract
(such as epididymitis, intrarenal and perinephric abscess, toxic
shock syndrome), skin (such as impetigo, folliculitis, cutaneous
abscesses, cellulitis, wound infection, bacterial myositis, bone
and joint (such as septic arthritis, osteomyelitis), bovine
mastitis, and canine pyoderma.
[0117] The method involves the steps of obtaining a sample
suspected of containing coagulase-negative staphylococci. The
sample may be taken from an individual, for example, from one's
blood, saliva, tissues, bone, muscle, cartilage, or skin. The cells
can then be lysed, and the DNA extracted, precipitated and
amplified. Detection of DNA from coagulase-negative staphylococci
is achieved by hybridizing the amplified DNA with a probe for
coagulase-negative staphylococci that selectively hybridizes with
the DNA as described above in the Detailed Description of the
Invention. Detection of hybridization is indicative of the presence
of coagulase-negative staphylococci.
[0118] Preferably, detection of nucleic acid (e.g. probes or
primers) hybridization can be facilitated by the use of detectable
moieties. For example, the probes can be labeled with biotin and
used in a streptavidin-coated microtiter plate assay. Other
detectable moieties include radioactive labeling, enzyme labeling,
and fluorescent labeling, for example.
[0119] DNA may be detected directly or may be amplified
enzymatically using polymerase chain reaction (PCR) or other
amplification techniques prior to analysis. RNA or cDNA can be
similarly detected. Increased or decrease expression of sdrF, sdrG,
or sdrH can be measured using any of the methods well known in the
art for the quantification of nucleic acid molecules, such as, for
example, amplification, PCR, RT-PCR, RNase protection, Northern
blotting, and other hybridization methods.
[0120] Diagnostic assays for SdrF, SdrG, or SdrH proteins or
portions thereof, such as consensus or variable sequence amino acid
motifs, or anti-- SdrF, SdrG, or SdrH antibodies may also be used
to detect the presence of a Staphylococcus epidermidis infection.
Assay techniques for determining protein or antibody levels in a
sample are well known to those skilled in the art and include
methods such as radioimmunoasssay, Western blot analysis and ELISA
assays.
[0121] IV. Uses of Sdr Protein or Antibody
[0122] The isolated, recombinant or synthetic proteins, or
antigenic portions thereof (including epitope-bearing fragments),
or fusion proteins thereof can be administered to animals as
immunogens or antigens, alone or in combination with an adjuvant,
for the production of antibodies reactive with SdrF, SdrG, or SdrH
proteins or portions thereof, such as consensus or variable
sequence amino acid motifs. In addition, the proteins can be used
to screen antibodies or antisera for hyperimmune patients from whom
can be derived specific antibodies having a very high affinity for
the proteins.
[0123] Antibodies to SdrF, SdrG, or SdrH or to fragments thereof,
such as consensus or variable sequence amino acid motifs, can be
used to impart passive immunity are useful for the specific
detection of coagulase-negative staphylococci proteins, for the
prevention of a coagulase-negative staphylococcal infection, for
the treatment of an ongoing infection or for use as research tools.
The term "antibodies" as used herein includes monoclonal,
polyclonal, chimeric, single chain, bispecific, simianized, and
humanized or primatized antibodies as well as Fab fragments,
including the products of an Fab immunoglobulin expression library.
Generation of any of these types of antibodies or antibody
fragments is well known to those skilled in the art.
[0124] Monoclonal antibodies are generated by methods well known to
those skilled in the art. The preferred method is a modified
version of the method of Kearney et al., J. Immunol. 123:1548-1558
(1979), which is incorporated by reference herein. Briefly, animals
such as mice or rabbits are inoculated with the immunogen in
adjuvant, and spleen cells are harvested and mixed with a myeloma
cell line, such as P3X63Ag8,653. The cells are induced to fuse by
the addition of polyethylene glycol. Hybridomas are chemically
selected by plating the cells in a selection medium containing
hypoxanthine, aminopterin and thymidine (HAT). Hybridomas are
subsequently screened for the ability to produce anti-SdrF, SdrG,
or SdrH monoclonal antibodies. Hybridomas producing antibodies are
cloned, expanded and stored frozen for future production.
[0125] Techniques for the production of single chain antibodies are
known to those skilled in the art and described in U.S. Pat. No.
4,946,778 and can be used to produce single chain antibodies to the
proteins described herein. Phage display technology may be used to
select antibody genes having binding activities for SdrF, SdrG, or
SdrH, or antigenic portions thereof, such as consensus or variable
sequence amino acid motifs, from PCR-amplified genes of lymphocytes
from humans screened for having antibodies to SdrF, SdrG, or SdrH
or naive libraries. Bispecific antibodies have two antigen binding
domains wherein each domain is directed against a different
epitope.
[0126] Any of the above described antibodies may be labeled
directly with a detectable label for identification and
quantification of coagulase-negative staphylococci. Labels for use
in immunoassays are generally known to those skilled in the art and
include enzymes, radioisotopes, and fluorescent, luminescent and
chromogenic substances, including colored particles such as
colloidal gold or latex beads. Suitable immunoassays include
enzyme-linked immunosorbent assays (ELISA).
[0127] Alternatively, the antibody may be labeled indirectly by
reaction with labeled substances that have an affinity for
immunoglobulin. The antibody may be conjugated with a second
substance and detected with a labeled third substance having an
affinity for the second substance conjugated to the antibody. For
example, the antibody may be conjugated to biotin and the
antibody-biotin conjugate detected using labeled avidin or
streptavidin. Similarly, the antibody may be conjugated to a hapten
and the antibody-hapten conjugate detected using labeled
anti-hapten antibody. These and other methods of labeling
antibodies and assay conjugates are well known to those skilled in
the art.
[0128] Antibodies to the extracellular matrix-binding proteins
SdrF, SdrG, SdrH or portions thereof, such as consensus or variable
sequence amino acid motifs, may also be used in production
facilities or laboratories to isolate additional quantities of the
proteins, such as by affinity chromatography. For example,
antibodies to the fibrinogen-binding protein SdrG may be used to
isolate additional amounts of fibrinogen.
[0129] The proteins, or active fragments thereof, and antibodies to
the proteins are useful for the treatment and diagnosis of
coagulase-negative staphylococci bacterial infections as described
above with regard to diagnosis method, or for the development of
anti-coagulase-negative staphylococci vaccines for active or
passive immunization. Further, when administered as pharmaceutical
composition to a wound or used to coat medical devices or polymeric
biomaterials in vitro and in vivo, both the proteins and the
antibodies are useful as blocking agents to prevent or inhibit the
binding of coagulase-negative staphylococci to the wound site or
the biomaterials themselves. Preferably, the antibody is modified
so that it is less immunogenic in the patient to whom it is
administered. For example, if the patient is a human, the antibody
may be "humanized" by transplanting the complimentarity determining
regions of the hybridoma-derived antibody into a human monoclonal
antibody as described by Jones et al., Nature 321:522-525 (1986) or
Tempest et al. Biotechnology 9:266-273 (1991) and as mentioned
above.
[0130] Medical devices or polymeric biomaterials to be coated with
the antibodies, proteins and active fragments described herein
include, but are not limited to, staples, sutures, replacement
heart valves, cardiac assist devices, hard and soft contact lenses,
intraocular lens implants (anterior chamber or posterior chamber),
other implants such as corneal inlays, kerato-prostheses, vascular
stents, epikeratophalia devices, glaucoma shunts, retinal staples,
scleral buckles, dental prostheses, thyroplastic devices,
laryngoplastic devices, vascular grafts, soft and hard tissue
prostheses including, but not limited to, pumps, electrical devices
including stimulators and recorders, auditory prostheses,
pacemakers, artificial larynx, dental implants, mammary implants,
penile implants, cranio/facial tendons, artificial joints, tendons,
ligaments, menisci, and disks, artificial bones, artificial organs
including artificial pancreas, artificial hearts, artificial limbs,
and heart valves; stents, wires, guide wires, intravenous and
central venous catheters, laser and balloon angioplasty devices,
vascular and heart devices (tubes, catheters, balloons),
ventricular assists, blood dialysis components, blood oxygenators,
urethral/ureteral/urinary devices (Foley catheters, stents, tubes
and balloons), airway catheters (endotracheal and tracheostomy
tubes and cuffs), enteral feeding tubes (including nasogastric,
intragastric and jejunal tubes), wound drainage tubes, tubes used
to drain the body cavities such as the pleural, peritoneal,
cranial, and pericardial cavities, blood bags, test tubes, blood
collection tubes, vacutainers, syringes, needles, pipettes, pipette
tips, and blood tubing.
[0131] It will be understood by those skilled in the art that the
term "coated" or "coating", as used herein, means to apply the
protein, antibody, or active fragment to a surface of the device,
preferably an outer surface that would be exposed to
coagulase-negative staphylococcal infection. The surface of the
device need not be entirely covered by the protein, antibody or
active fragment.
[0132] V. Pharmaceutical Compositions
[0133] Immunological compositions, including vaccines, and other
pharmaceutical compositions containing the SdrF, SdrG, or SdrH
proteins or portions thereof, such as consensus or variable
sequence amino acid motifs, are included within the scope of the
present invention. One or more of the SdrF, SdrG, or SdrH proteins,
or active or antigenic fragments thereof, or fusion proteins
thereof can be formulated and packaged, alone or in combination
with other antigens, using methods and materials known to those
skilled in the art for vaccines. The immunological response may be
used therapeutically or prophylactically and may provide antibody
immunity or cellular immunity, such as that produced by T
lymphocytes.
[0134] The immunological compositions, such as vaccines, and other
pharmaceutical compositions can be used alone or in combination
with other blocking agents to protect against human and animal
infections caused by or exacerbated by coagulase-negative
staphylococci. In particular, the compositions can be used to
protect humans against endocarditis, toxic shock syndrome,
osteomyelitis, epididymitis, cellulitis or many other infections.
The compositions may also protect humans or ruminants against
mastitis caused by coagulase-negative staphylococci infections. The
vaccine can further be used to protect other species of animals,
for example canine and equine animals, against similar
coagulase-negative staphylococcal infections.
[0135] To enhance immunogenicity, the proteins may be conjugated to
a carrier molecule. Suitable immunogenic carriers include proteins,
polypeptides or peptides such as albumin, hemocyanin, thyroglobulin
and derivatives thereof, particularly bovine serum albumin (BSA)
and keyhole limpet hemocyanin (KLH), polysaccharides,
carbohydrates, polymers, and solid phases. Other protein derived or
non-protein derived substances are known to those skilled in the
art. An immunogenic carrier typically has a molecular mass of at
least 1,000 Daltons, preferably greater than 10,000 Daltons.
Carrier molecules often contain a reactive group to facilitate
covalent conjugation to the hapten. The carboxylic acid group or
amine group of amino acids or the sugar groups of glycoproteins are
often used in this manner. Carriers lacking such groups can often
be reacted with an appropriate chemical to produce them.
Preferably, an immune response is produced when the immunogen is
injected into animals such as mice, rabbits, rats, goats, sheep,
guinea pigs, chickens, and other animals, most preferably mice and
rabbits. Alternatively, a multiple antigenic peptide comprising
multiple copies of the protein or polypeptide, or an antigenically
or immunologically equivalent polypeptide may be sufficiently
antigenic to improve immunogenicity without the use of a
carrier.
[0136] The SdrF, SdrG, or SdrH protein or portions thereof, such as
consensus or variable sequence amino acid motifs, or combination of
proteins may be administered with an adjuvant in an amount
effective to enhance the immunogenic response against the
conjugate. At this time, the only adjuvant widely used in humans
has been alum (aluminum phosphate or aluminum hydroxide). Saponin
and its purified component Quil A, Freund's complete adjuvant and
other adjuvants used in research and veterinary applications have
toxicities which limit their potential use in human vaccines.
However, chemically defined preparations such as muramyl dipeptide,
monophosphoryl lipid A, phospholipid conjugates such as those
described by Goodman-Snitkoff et al. J. Immunol. 147:410-415 (1991)
and incorporated by reference herein, encapsulation of the
conjugate within a proteoliposome as described by Miller et al., J.
Exp. Med. 176:1739-1744 (1992) and incorporated by reference
herein, and encapsulation of the protein in lipid vesicles such as
Novasome.TM. lipid vesicles (Micro Vescular Systems, Inc., Nashua,
N.H.) may also be useful.
[0137] The term "vaccine" as used herein includes DNA vaccines in
which the nucleic acid molecule encoding SdrF, SdrG, or SdrH, or
antigenic portions thereof, such as any consensus or variable
sequence amino acid motif, in a pharmaceutical composition is
administered to a patient. For genetic immunization, suitable
delivery methods known to those skilled in the art include direct
injection of plasmid DNA into muscles (Wolff et al., Hum. Mol.
Genet. 1:363, 1992), delivery of DNA complexed with specific
protein carriers (Wu et al., J. Biol. Chem. 264:16985, 1989),
coprecipitation of DNA with calcium phosphate (Benvenisty and
Reshef, Proc. Natl. Acad. Sci. 83:9551, 1986), encapsulation of DNA
in liposomes (Kaneda et al., Science 243:375, 1989), particle
bombardment (Tang et al., Nature 356:152, 1992 and Eisenbraun et
al., DNA Cell Biol. 12:791, 1993), and in vivo infection using
cloned retroviral vectors (Seeger et al., Proc. Natl. Acad. Sci.
81:5849, 1984).
[0138] In another embodiment, the invention is a polynucleotide
which comprises contiguous nucleic acid sequences capable of being
expressed to produce a gene product upon introduction of said
polynucleotide into eukaryotic tissues in vivo. The encoded gene
product preferably either acts as an immunostimulant or as an
antigen capable of generating an immune response. Thus, the nucleic
acid sequences in this embodiment encode an immunogenic epitope,
and optionally a cytokine or a T-cell costimulatory element, such
as a member of the B7 family of proteins.
[0139] There are several advantages to immunization with a gene
rather than its gene product. The first is the relative simplicity
with which native or nearly native antigen can be presented to the
immune system. Mammalian proteins expressed recombinantly in
bacteria, yeast, or even mammalian cells often require extensive
treatment to ensure appropriate antigenicity. A second advantage of
DNA immunization is the potential for the immunogen to enter the
MHC class I pathway and evoke a cytotoxic T cell response.
Immunization of mice with DNA encoding the influenza A
nucleoprotein (NP) elicited a CD8.sup.+ response to NP that
protected mice against challenge with heterologous strains of flu.
(Montgomery, D. L. et al., Cell Mol Biol, 43(3):285-92, 1997 and
Ulmer, J. et al., Vaccine, 15(8):792-794, 1997.)
[0140] Cell-mediated immunity is important in controlling
infection. Since DNA immunization can evoke both humoral and
cell-mediated immune responses, its greatest advantage may be that
it provides a relatively simple method to survey a large number of
S. epidermidis genes for their vaccine potential.
[0141] VI. Methods of Administration and Dosage of Pharmaceutical
Compositions
[0142] Pharmaceutical compositions containing the SdrF, SdrG, or
SdrH proteins or portions thereof, such as consensus or variable
sequence amino acid motifs, nucleic acid molecules, antibodies, or
fragments thereof may be formulated in combination with a
pharmaceutical carrier such as saline, dextrose, water, glycerol,
ethanol, other therapeutic compounds, and combinations thereof. The
formulation should be appropriate for the mode of administration.
The compositions are useful for interfering with, modulating, or
inhibiting binding interactions between coagulase-negative
staphylococci and fibrinogen on host cells.
[0143] The amount of expressible DNA or transcribed RNA to be
introduced into a vaccine recipient will have a very broad dosage
range and may depend on the strength of the transcriptional and
translational promoters used. In addition, the magnitude of the
immune response may depend on the level of protein expression and
on the immunogenicity of the expressed gene product. In general,
effective dose ranges of about 1 ng to 5 mg, 100 ng to 2.5 mg, 1
.mu.g to 750 .mu.g, and preferably about 10 .mu.g to 300 .mu.g of
DNA is administered directly into muscle tissue. Subcutaneous
injection, intradermal introduction, impression through the skin,
and other modes of administration such as intraperitoneal,
intravenous, or inhalation delivery are also suitable. It is also
contemplated that booster vaccinations may be provided. Following
vaccination with a polynucleotide immunogen, boosting with protein
immunogens such as the SdrH gene product is also contemplated.
[0144] The polynucleotide may be "naked", that is, unassociated
with any proteins, adjuvants or other agents which affect the
recipient's immune system. In this case, it is desirable for the
polynucleotide to be in a physiologically acceptable solution, such
as, but not limited to, sterile saline or sterile buffered saline.
Alternatively, the DNA may be associated with liposomes, such as
lecithin liposomes or other liposomes known in the art, as a
DNA-liposome mixture, or the DNA may be associated with an adjuvant
known in the art to boost immune responses, such as a protein or
other carrier. Agents which assist in the cellular uptake of DNA,
such as, but not limited to, calcium ions, may also be used. These
agents are generally referred to herein as transfection
facilitating reagents and pharmaceutically acceptable carriers.
Techniques for coating microprojectiles coated with polynucleotide
are known in the art and are also useful in connection with this
invention. For DNA intended for human use it may be useful to have
the final DNA product in a pharmaceutically acceptable carrier or
buffer solution. Pharmaceutically acceptable carriers or buffer
solutions are known in the art and include those described in a
variety of texts such as Remington's Pharmaceutical Sciences.
[0145] It is recognized by those skilled in the art that an optimal
dosing schedule for a DNA vaccination regimen may include as many
as five to six, but preferably three to five, or even more
preferably one to three administrations of the immunizing entity
given at intervals of as few as two to four weeks, to as long as
five to ten years, or occasionally at even longer intervals.
[0146] Suitable methods of administration of any pharmaceutical
composition disclosed in this application include, but are not
limited to, topical, oral, anal, vaginal, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal and
intradermal administration.
[0147] For topical administration, the composition is formulated in
the form of an ointment, cream, gel, lotion, drops (such as eye
drops and ear drops), or solution (such as mouthwash). Wound or
surgical dressings, sutures and aerosols may be impregnated with
the composition. The composition may contain conventional
additives, such as preservatives, solvents to promote penetration,
and emollients. Topical formulations may also contain conventional
carriers such as cream or ointment bases, ethanol, or oleyl
alcohol.
[0148] In a preferred embodiment, a vaccine is packaged in a single
dosage for immunization by parenteral (i.e., intramuscular,
intradermal or subcutaneous) administration or nasopharyngeal
(i.e., intranasal) administration. The vaccine is most preferably
injected intramuscularly into the deltoid muscle. The vaccine is
preferably combined with a pharmaceutically acceptable carrier to
facilitate administration. The carrier is usually water or a
buffered saline, with or without a preservative. The vaccine may be
lyophilized for resuspension at the time of administration or in
solution.
[0149] Microencapsulation of the protein will give a controlled
release. A number of factors contribute to the selection of a
particular polymer for microencapsulation. The reproducibility of
polymer synthesis and the microencapsulation process, the cost of
the microencapsulation materials and process, the toxicological
profile, the requirements for variable release kinetics and the
physicochemical compatibility of the polymer and the antigens are
all factors that must be considered. Examples of useful polymers
are polycarbonates, polyesters, polyurethanes, polyorthoesters,
polyamides, poly (D,L-lactide-co-glycolide) (PLGA) and other
biodegradable polymers. The use of PLGA for the controlled release
of antigen is reviewed by Eldridge et al., CURRENT TOPICS IN
MICROBIOLOGY AND IMMUNOLOGY, 146:59-66 (1989).
[0150] The preferred dose for human administration is from 0.01
mg/kg to 10 mg/kg, preferably approximately 1 mg/kg. Based on this
range, equivalent dosages for heavier body weights can be
determined. The dose should be adjusted to suit the individual to
whom the composition is administered and will vary with age, weight
and metabolism of the individual. The vaccine may additionally
contain stabilizers or pharmaceutically acceptable preservatives,
such as thimerosal (ethyl(2-mercaptobenzoate-S)mercury sodium salt)
(Sigma Chemical Company, St. Louis, Mo.).
[0151] VII. Protein-Label Conjugates
[0152] When labeled with a detectable biomolecule or chemical, the
fibrinogen-binding proteins described herein are useful for
purposes such as in vivo and in vitro diagnosis of staphylococcal
infections or detection of coagulase-negative staphylococci.
Laboratory research may also be facilitated through use of such Sdr
protein-label conjugates. Various types of labels and methods of
conjugating the labels to the proteins are well known to those
skilled in the art. Several specific labels are set forth below.
The labels are particularly useful when conjugated to a protein
such as an antibody or receptor.
[0153] For example, the protein can be conjugated to a radiolabel
such as, but not restricted to, .sup.32P, .sup.3H, .sup.14C,
.sup.35S, .sup.125I, or .sup.131I. Detection of a label can be by
methods such as scintillation counting, gamma ray spectrometry or
autoradiography.
[0154] Bioluminescent labels, such as derivatives of firefly
luciferin, are also useful. The bioluminescent substance is
covalently bound to the protein by conventional methods, and the
labeled protein is detected when an enzyme, such as luciferase,
catalyzes a reaction with ATP causing the bioluminescent molecule
to emit photons of light.
[0155] Fluorogens may also be used to label proteins. Examples of
fluorogens include fluorescein and derivatives, phycoerythrin,
allo-phycocyanin, phycocyanin, rhodamine, and Texas Red. The
fluorogens are generally detected by a fluorescence detector.
[0156] The protein can alternatively be labeled with a chromogen to
provide an enzyme or affinity label. For example, the protein can
be biotinylated so that it can be utilized in a biotin-avidin
reaction, which may also be coupled to a label such as an enzyme or
fluorogen. For example, the protein can be labeled with peroxidase,
alkaline phosphatase or other enzymes giving a chromogenic or
fluorogenic reaction upon addition of substrate. Additives such as
5-amino-2,3-dihydro-1,4-phthalaz- inedione (also known as
Luminol.sup.a) (Sigma Chemical Company, St. Louis, Mo.) and rate
enhancers such as p-hydroxybiphenyl (also known as p-phenylphenol)
(Sigma Chemical Company, St. Louis, Mo.) can be used to amplify
enzymes such as horseradish peroxidase through a luminescent
reaction; and luminogeneic or fluorogenic dioxetane derivatives of
enzyme substrates can also be used. Such labels can be detected
using enzyme-linked immunoassays (ELISA) or by detecting a color
change with the aid of a spectrophotometer. In addition, proteins
may be labeled with colloidal gold for use in immunoelectron
microscopy in accordance with methods well known to those skilled
in the art.
[0157] The location of a ligand in cells can be determined by
labeling an antibody as described above and detecting the label in
accordance with methods well known to those skilled in the art,
such as immunofluorescence microscopy using procedures such as
those described by Warren and Nelson (Mol. Cell. Biol., 7:
1326-1337, 1987).
[0158] VIII. Therapeutic Applications
[0159] In addition to the therapeutic compositions and methods
described above, the SdrF, SdrG, or SdrH proteins or portions
thereof, such as consensus or variable sequence amino acid motifs,
nucleic acid molecules or antibodies are useful for interfering
with the initial physical interaction between a pathogen and
mammalian host responsible for infection, such as the adhesion of
bacteria, particularly Gram-negative bacteria, to mammalian
extracellular matrix proteins on in-dwelling devices or to
extracellular matrix proteins in wounds; to block SdrF, SdrG, or
SdrH protein-mediated mammalian cell invasion; to block bacterial
adhesion between mammalian extracellular matrix proteins and
bacterial SdrF, SdrG, or SdrH proteins or portions thereof, such as
consensus or variable sequence amino acid motifs, that mediate
tissue damage; and, to block the normal progression of pathogenesis
in infections initiated other than by the implantation of
in-dwelling devices or surgical techniques.
[0160] IX. Screening Methods
[0161] The SdrF, SdrG, or SdrH proteins, or fragments thereof, such
as consensus or variable sequence amino acid motifs, are useful in
a method for screening compounds to identify compounds that inhibit
coagulase-negative staphylococci binding to host molecules. In
accordance with the method, the compound of interest is combined
with one or more of the SdrF, SdrG, or SdrH proteins or fragments
thereof and the degree of binding of the protein to fibrinogen or
other extracellular matrix proteins is measured or observed. If the
presence of the compound results in the inhibition of
protein-fibrinogen binding, for example, then the compound may be
useful for inhibiting coagulase-negative staphylococci in vivo or
in vitro. The method could similarly be used to identify compounds
that promote interactions of coagulase-negative staphylococci with
host molecules.
[0162] The method is particularly useful for identifying compounds
having bacteriostatic or bacteriocidal properties.
[0163] For example, to screen for coagulase-negative staphylococci
agonists or antagonists, a synthetic reaction mixture, a cellular
compartment (such as a membrane, cell envelope or cell wall)
containing one or more of the SdrF, SdrG, or SdrH proteins, or
fragments thereof, such as consensus or variable sequence amino
acid motifs, and a labeled substrate or ligand of the protein is
incubated in the absence or the presence of a compound under
investigation. The ability of the compound to agonize or antagonize
the protein is shown by a decrease in the binding of the labeled
ligand or decreased production of substrate product. Compounds that
bind well and increase the rate of product formation from substrate
are agonists. Detection of the rate or level of production of
product from substrate may be enhanced by use of a reporter system,
such as a calorimetric labeled substrate converted to product, a
reporter gene that is responsive to changes in SdrF, SdrG, or SdrH
nucleic acid or protein activity, and binding assays known to those
skilled in the art. Competitive inhibition assays can also be
used.
[0164] Potential antagonists include small organic molecules,
peptides, polypeptides and antibodies that bind to a SdrF, SdrG, or
SdrH nucleic acid molecules or proteins or portions thereof, such
as consensus or variable sequence amino acid motifs, and thereby
inhibit their activity or bind to a binding molecule (such as
fibrinogen) to prevent the binding of the SdrF, SdrG, or SdrH
nucleic acid molecules or proteins to its ligand. For example, a
compound that inhibits SdrF, SdrG, or SdrH activity may be a small
molecule that binds to and occupies the binding site of the SdrF,
SdrG, or SdrH protein, thereby preventing binding to cellular
binding molecules, to prevent normal biological activity. Examples
of small molecules include, but are not limited to, small organic
molecules, peptides or peptide-like molecules. Other potential
antagonists include antisense molecules. Preferred antagonists
include compounds related to and variants or derivatives of SdrF,
SdrG, or SdrH proteins or portions thereof, such as consensus or
variable sequence amino acid motifs.
[0165] The nucleic acid molecules described herein may also be used
to screen compounds for antibacterial activity.
[0166] X. Detection Kits for Coagulase-Negative Staphylococci
[0167] The invention further contemplates a kit containing one or
more sdrF, sdrG, or sdrH-specific nucleic acid probes, which can be
used for the detection of coagulase-negative staphylococci or
coagulase-negative staphylococcal Sdr proteins or portions thereof,
such as consensus or variable sequence amino acid motifs, in a
sample or for the diagnosis of coagulase-negative staphylococcal
infections. Such a kit can also contain the appropriate reagents
for hybridizing the probe to the sample and detecting bound
probe.
[0168] In an alternative embodiment, the kit contains antibodies
specific to one or more SdrF, SdrG, or SdrH protein or peptide
portions thereof, such as consensus or variable sequence amino acid
motifs, which can be used for the detection of coagulase-negative
staphylococci.
[0169] In yet another embodiment, the kit contains one or more
SdrF, SdrG, or SdrH-proteins, or active fragments thereof, which
can be used for the detection of coagulase-negative staphylococci
organisms or antibodies to coagulase-negative staphylococcal Sdr
proteins in a sample.
[0170] The kits described herein may additionally contain equipment
for safely obtaining the sample, a vessel for containing the
reagents, a timing means, a buffer for diluting the sample, and a
calorimeter, reflectometer, or standard against which a color
change may be measured.
[0171] In a preferred embodiment, the reagents, including the
protein or antibody, are lyophilized, most preferably in a single
vessel. Addition of aqueous sample to the vessel results in
solubilization of the lyophilized reagents, causing them to react.
Most preferably, the reagents are sequentially lyophilized in a
single container, in accordance with methods well known to those
skilled in the art that minimize reaction by the reagents prior to
addition of the sample.
EXAMPLES
[0172] The following examples are included to demonstrate preferred
embodiments of the present invention. It should be appreciated by
those of skill in the art that the techniques disclosed in the
examples which follow represent techniques discovered by the
inventors to function well in the practice of the invention, and
thus can be considered to constitute preferred modes for its
practice. However, those of skill in the art should, in light of
the present disclosure, appreciate that many changes can be made in
the specific embodiments which are disclosed and still obtain a
like or similar result without departing from the spirit and scope
of the invention.
Example 1
[0173] Identification of Sdr Encoding Genes in Coagulase Negative
Staphylococci
[0174] Five genes (clfA, clfB, sdrC, sdrD, sdrE) have been
identified in Staphylococcus aureus that contain the dipeptide
aspartic acid and serine (DS), encoded by an 18 bp repeat motif GAY
TCN GAY TCN GAY AGY, where Y=pyrimidines and N=any base. This
family of proteins has been named the Sdr's for serine-aspartic
acid repeat. All of the 5 S. aureus sdr genes encode proteins that
contain features that characterize them as surface associated
proteins in Gram positive bacteria; namely at the N-terminus there
is a secretory signal and at the C-terminus there are (i) several
positive charged residues that serve as a stop signal for protein
secretion, (ii) a hydrophobic transmembrane region and (iii) a
wall-spanning region with an LPXTG motif that is required for
accurate sorting and correct protein orientation in the cell wall.
To identify novel genes that encode cell surface proteins in
coagulase negative staphylococci we used the DS coding region of
clfA as a gene probe to determine if homologs exist within various
coagulase negative staphylococcal species. The coagulase negative
staphylococcal species that we characterized were (1) S.
lugdunensis, (2) S. haemolyticus, (3) S. schleiferi and (4) S.
epidermidis. Each strain is listed below.
[0175] Ten strains each of S. epidermidis, S. lugdunensis, S.
schleiferi and S. haemolyticus were obtained from Jerome Etienne
(Lyon, France). In addition, Dr. Timothy Foster's strain collection
contained S. epidermidis strains donated from other researchers.
Southern hybridization analysis using genomic DNA isolated from all
coagulase-negative staphylococcal strains was performed.
Chromosomal DNA was cleaved with HindIII and the DS coding region
of clfA was DIG-labeled (Boehringer) and used as a probe. Southern
hybridization analysis of all ten S. lugdunensis strains revealed
that a single HindIII fragment, of 9 kb, hybridized to the DS
coding region of clfA. Analysis of S. haemolyticus strains with the
DS-coding sequence of clfA revealed different sized fragments. Out
of the ten strains tested, six strains gave a strongly hybridizing
band between 18 kb and 10 kb. The possibility exists that more than
one DS coding region is present on the HindIII fragment. After
longer exposure of the autoradiogram, the four remaining strains
showed weak hybridization to the DS coding region of clfA. The clfA
probe did not detect a DS coding region in the genomic DNA from S.
schleiferi. All S. epidermidis strains characterized revealed at
least two HindIII fragments that hybridized to the DS coding region
of clfA.
[0176] Strains Tested:
[0177] S. lugdunensis Strains
[0178] 1. S. lugdunensis N940113
[0179] 2. S. lugdunensis N940164
[0180] 3. S. lugdunensis N940135
[0181] 4. S. lugdunensis N950232
[0182] 5. S. lugdunensis N920143
[0183] 6. S. lugdunensis N930432
[0184] 7. S. lugdunensis N940084
[0185] 8. S. lugdunensis N940025
[0186] 9. S. lugdunensis N910319
[0187] 10. S. lugdunensis N910320
[0188] S. epidermidis Strains
[0189] 1. S. epidermidis ATCC1499O (Kloos)
[0190] 2. S. epidermidis KH11
[0191] 3. S. epidermidis K28
[0192] 4. S. epidermidis TU3298
[0193] 5. S. epidermidis 9142
[0194] 6. S. epidermidis 1457
[0195] 7. S. epidermidis 8400
[0196] 8. S. epidermidis RP62a
[0197] 9. S. epidermidis N910102
[0198] 10. S. epidermidis N910173
[0199] 11. S. epidermidis N910191
[0200] 12. S. epidermidis N910231
[0201] 13. S. epidermidis N910249
[0202] 14. S. epidermidis N910275
[0203] 15. S. epidermidis N950190
[0204] 16. S. epidermidis N950329
[0205] 17. S. epidermidis N910308
[0206] 18. S. epidermidis N910160
[0207] S. haemolyticus Strains
[0208] 1. S. haemolyticus N97061
[0209] 2. S. haemolyticus N960512
[0210] 3. S. haemolyticus N910106
[0211] 4. S. haemolyticus N91024
[0212] 5. S. haemolyticus N920160
[0213] 6. S. haemolyticus N910287
[0214] 7. S. haemolyticus N92018
[0215] 8. S. haemolyticus N930100
[0216] 9. S. haemolyticus N950252
[0217] 10. S. haemolyticus N93016
[0218] S. schleiferi Strains
[0219] 1. S. schleiferi JCM7430
[0220] 2. S. schleiferi N920247
[0221] 3. S. schleiferi N910245
[0222] 4. S. schleiferi N910017
[0223] 5. S. schleiferi N960518
[0224] 6. S. schleiferi N950242
[0225] 7. S. schleiferi N920162
[0226] 8. S. schleiferi N92017
[0227] 9. S. schleiferi N930047
[0228] 10. S. schleiferi N920260
[0229] sdrF Homologues in Other S. epidermidis Strains
[0230] 17 strains of S. epidermidis were examined for the presence
of the sdrF gene by Southern hybridization. Chromosomal DNA of the
individual strains was cleaved with HindIII and probed with a
region A coding sequence of sdrF as a probe. This DNA probe was
DIG-labeled by PCR using pC5 (described further below in Example 2)
as a template. The sdrF gene was present on a HindIII fragment that
varied from 4-10 kb and was present in 12 out of 16 strains tested.
Using the region R coding sequence of clfA as a probe also
identified a band of the same size indicating that sdrF homologues
in other S. epidermidis strains also contain region R coding
sequence.
[0231] sdrG Homologues in Other S. epidermidis Strains
[0232] 16 strains of S. epidermidis were tested for the presence of
the sdrG gene using a probe designed to the region A coding
sequence of sdrG. Southern hybridization analysis revealed that
sdrG was present on a 16 kb HindIII fragment and was present in all
S. epidermidis strains examined. The primer sequence used for
amplification of region A coding sequence of sdrG is as
follows:
2 F1-sdrG: 5' GATGATGAATTATCAGAC 3' (SEQ ID No. 21) R.-sdrG: 5'
CAGGAGGCAAGTCACCTTG 3' (SEQ ID No. 22)
[0233] (encompassing coordinates 195 to 1795 of sdrG)
[0234] DS-Coding Region Homologues in S. epidermidis Strains
[0235] Chromosomal DNA was cleaved with HindIII and the DS-coding
region of clfA was DIG labeled (Boehringer) and used a probe.
Southern hybridization analysis revealed at least two HindIII
fragments that hybridized to the DS-coding region of clfA. Ten
strains hybridized to three HindIII fragments.
Example 2
[0236] Studies of the Sdr Genes in Coagulase Negative
Staphylococci, and Identification, Isolation, Sequencing and
Expression of SdrF, SdrG and SdrH
[0237] Overview
[0238] Staphylococcus epidermidis strains can express three
different cell surface-associated proteins that contain
serine-aspartate dipeptide repeats. Proteins SdrF and SdrG are
similar in sequence and structural organization to the Sdr proteins
of S. aureus. They comprise 625 and 548 residue unique region As at
their N termini, respectively, followed by a variable number of
110-119 residue region B repeats, an SD repeat region, and
C-terminal LPXTG motifs and hydrophobic domains characteristic of
surface proteins that are covalently anchored to peptidoglycan. In
contrast, SdrH has a short 60 residue region A at the N terminus,
followed by a SD repeat region, a unique 277 residue region C, and
a C-terminal hydrophobic domain. SdrH lacks an LPXTG motif. DNA
encoding each region A of SdrF, SdrG and SdrH was cloned into
expression vectors in E. coli, and recombinant protein was
expressed and purified. Specific antisera were raised in rabbits
and used to identify the Sdr proteins expressed by S. epidermidis.
Only SdrF was released from lysostaphin-generated protoplasts of
cells grown to late exponential phase. SdrG and SdrH remained
associated with the protoplast fraction and were thus not sorted
and linked to peptidoglycan. In Southern hybridization analyses,
the sdrG and sdrH genes were present in all sixteen strains tested,
while sdrF was present in twelve strains. Antisera from fifteen
patients that had recovered from S. epidermidis infections
contained antibodies that reacted with recombinant region As of
SdrF, SdrG and SdrH, suggesting that these proteins are expressed
during infection.
[0239] Background
[0240] S. epidermidis is a common inhabitant of human skin and a
frequent cause of foreign-body infections. Pathogenesis is
facilitated by the ability of the organism to first adhere to, and
subsequently form biofilms on, indwelling medical devices such as
artificial valves, orthopedic devices, and intravenous and
peritoneal dialysis catheters. Device-related infections jeopardize
the success of medical treatment and significantly increase patient
morbidity (11).
[0241] Adherence of S. epidermidis to synthetic surfaces has been
correlated with both surface hydrophobicity and cell-surface
proteins. (2, 13). Protease treatment of S. epidermidis has been
shown to reduce hydrophobicity and adherence (24), and a monoclonal
antibody reactive to a 220 kDa cell-surface protein of S.
epidermidis was able to partially block bacterial attachment to
polystyrene (30). Polysaccharide expressed by the ica operon is
crucial in formation of biofilm. One group suggested that the
polysaccharide adhesin (PS/A) is sufficient for both adhesion and
cell-cell interaction associated with the accumulation phase of
biofilm formation. Another view is that adherence is mediated by a
surface-associated protein while the polysaccharide is responsible
only for the accumulation phase (5, 12, 19).
[0242] Like S. epidermidis, S. aureus can also adhere to
medical-implant devices but this attachment is predominantly
mediated by bacterial receptors specific for host fibrinogen and
fibronectin that coat biomaterial surfaces shortly after
implantation. S. aureus adhesins that mediate these interactions
include the fibrinogen-binding proteins, ClfA and ClfB, and the
fibronectin-binding proteins, FnbpA and FnbpB [reviewed in (3)].
Although S. epidermidis has the potential to interact with
fibrinogen, fibronectin, vitronectin, and laminin (6, 25, 29),
little is known of the specific adhesins mediating these
interactions or of how these interactions influence bacterial
adherence to biomaterials coated with host proteins.
[0243] The fibrinogen-binding clumping factor protein (or ClfA) of
S. aureus (FIG. 1A) is distinguished by the presence of a
serine-aspartate (SD) dipeptide repeat region (referred to as
region R in previous studies) located between a ligand-binding
region A and C-terminal sequences and associated with attachment to
the cell-wall (16, 17). The SD-repeat region is predicted to span
the cell wall and extend the ligand-binding region from the surface
of the bacteria (4). ClfA is the predecessor of a SD-repeat (Sdr)
protein family found in S. aureus. Additional members include ClfB
(a second fibrinogen-binding clumping factor), SdrC, SdrD, and SdrE
(FIG. 5A) (8, 21). SdrC, SdrD, and SdrE proteins contain additional
repeats, termed region B repeats, located between the region A and
SD repeats. Each B repeat is 110-113 amino acids in length and
contains a putative Ca.sup.2+-binding, EF-hand motif. Ca binding
has been shown to be required for the structural integrity of the
region B repeats (9). The functions of SdrC, SdrD, and SdrE are
unknown, but the proteins are hypothesized to interact with host
matrix molecules via their region As.
[0244] This example describes three Sdr proteins expressed by S.
epidermidis. Two have sequence similarity to, and the same
structural organization, as the Sdr proteins of S. aureus, while
SdrH is distinct. The genes encoding these proteins are prevalent
among S. epidermidis strains. The presence of antibodies reactive
to each Sdr region A in convalescent patient antisera suggest that
the proteins are expressed during infection.
[0245] Materials and Methods
[0246] Bacterial Strains and Growth Conditions.
[0247] E. coli XL-1 Blue or JM109 were used as recombinant host
strains. Strains XL-1 Blue or TOPP 3 (Stratagene, La Jolla, Calif.)
cells were used for protein expression. Bacteria were routinely
grown in Luria broth or agar (Gibco BRL, Gaithersburg, Md.)
supplemented with 100 .mu.g ml.sup.-1 ampicillin (USB, Cleveland,
Ohio). S. epidermidis strains (Table 2) were grown in tryptic soy
broth (TSB) or agar (TSA) (Difco, Detroit, Mich.).
[0248] Cloning and Sequencing of the Sdr Genes
[0249] The sdrF gene was cloned from S. epidermidis strain 9491.
HindIII-DNA fragments ranging from 6.5 to 7.5 kb in length were
isolated from an agarose gel and ligated into a pBluescript SK+
cloning vector (Stratagene) digested with HindIII and treated with
calf-intestine alkaline phosphatase (CIAP) (Promega, Madison,
Wis.). One recombinant plasmid, pC5, was identified by PCR
screening (27) with primers directed toward DNA encoding the
SD-repeat region of ClfA (P3 and P4 primers, Table 3).
[0250] The sdrG gene was cloned from a % Gem.RTM.-11 library of S.
epidermidis strain K-28 generated with DNA that had been partially
digested with Sau3A and ligated into the half-site XhoI arms of
.lambda.Gem.RTM.-11 (Promega). After packaging, a positive phage,
designated E6-2, was identified by hybridization of a DNA probe
representing the ClfA SD-repeat region. A SacI-KpnI DNA fragment
from E6-2 was then subcloned into the E. coli plasmid vector, pZero
(Invitrogen, Carlsbad, Calif.). This clone was then mapped with
restriction endonucleases, and a 3.5 kb EcoRI-KpnI fragment
containing DNA with homology to that encoding SD-repeat amino acids
sequence was subcloned into pUC18 (Amersham Pharmacia Biotech,
Piscataway, N.J.) to create pE6-2.
[0251] The sdrH gene was cloned as follows. HindIII fragments
obtained from S. epidermidis strain 9491 genomic DNA were size
fractionated on a 5-20% sucrose gradient. DNA from fractions
containing 1.5-2.5 kb fragments were ligated into pBluescript
digested with HindIII and dephosphorylated with CIAP (Promega). E.
coli transformants containing the ligated products were screened by
colony-blot hybridization with a DIG-labeled (Boehringer Mannheim,
Indianapolis, Ind.) probe made to DNA encoding the ClfA SD-repeat
region.
[0252] Automated dideoxy-DNA sequencing was performed on both
strands of cloned DNA. In most cases, extension of DNA sequence on
a given clone was achieved with primer walking. This method,
however, could not cover the length of repeat DNA encoding the
SD-repeats of SdrF. Therefore, this region of DNA was excised from
pC5 with Sau3A, ligated into pBluescript, and used as a template
for the construction of exonuclease deletion derivatives
(Erase-a-base System, Promega). Appropriate deletions on both
strands (not shown) were identified by PCR screening and
restriction mapping.
3TABLE 2 S. epidermidis strains used in this study Strains Comments
and properties Source or reference 9491 SdrF and SdrH prototype
strain ATCC strain ATCC14990 Reference strain W. Kloos KH11 P.
Vaudaux K28 SdrG prototype strain P. Vaudaux RP62a TU3298
Transformable strain F. Gotz 9142 Biofilm former D. Mack 1457 D.
Mack 8400 N910308 Reference strain, Lyon, France J. Etienne N910160
Reference strain, Lyon, France J. Etienne N910102 Reference strain,
Lyon, France J. Etienne N910173 Reference strain, Lyon, France J.
Etienne N910191 Reference strain, Lyon, France J. Etienne N910231
Reference strain, Lyon, France J. Etienne N910249 Reference strain,
Lyon, France J. Etienne
[0253]
4TABLE 3 Primers used in PCR amplification for DNA probes and
protein expression constructs Regions Vector Template amplified
Sequence destination DNA clfA SD F: GCCGGATCCCCAATTCCAGAGGATTCA Na
pCF48 repeat (SEQ ID No. 23) R: GCCAAGCTTATTGTTAGAACCTGACTC (SEQ ID
No. 24) SD repeats P3: GATTCAGATAGCCATTC (SEQ ID No. 25) Na sdr P4:
CTGAGTCACTGTCTGAG (SEQ ID No. 26) clones sdrF region A F:
CCCGGATCCGCTGAAGACAATCAATTAG pQE30 strain (SEQ ID No. 27) 9491 R:
CCCAAGCTTAATTATCCCCCTGTGCTG (SEQ ID No. 28) sdrG region A F:
CCCGGATCCGAGGAGAATACAGTACAAGA- CG pQE30 strain (SEQ ID No. 29) K28
R: CCCGGTACCTAGTTTTTCAGGAGGCAAGTCACC (SEQ ID No. 30) sdrH full F:
CCCGGATCCGAAGGTAATCATCCTATTGAC pQE30 strain length (SEQ ID No. 31)
9491 R: CCCAAGCTTACTTTTTTCTTCTAAAGATATAT- AGTCC (SEQ ID No. 32)
sdrF region A F: same as above pGEX-2T strain R:
CCCGAATTCAATTATCCCCCTGTGCTGTTG 9491 (SEQ ID No. 33) sdrG region A
F: same as above pGEX-2T strain R:
CCCGAATTCTAGTTTTTCAGGAGGCAAGTCACC K28 (SEQ ID No. 34) sdrH region A
F: GGCGGATCCGAAGGTAATCATCCTATTG pGEX-KG strain (SEQ ID No. 35) 9491
R: GGCAAGCTTCTAAATATGTGTCATTTTC (SEQ ID No. 36) na not applicable
underline restriction endonuclease site used for cloning
[0254] Southern Hybridizations
[0255] Southern blot transfers and hybridizations have been
described elsewhere (8). DNA probes were made from PCR products
encoding the SD-repeat region of ClfA or each region A of SdrF,
SdrG, and SdrH (Table 3). PCR products were generated with Taq DNA
polymerase (Gibco BRL), and probes were digoxigenin (Boehringer
Mannheim) or fluorescein (Amersham) labeled.
[0256] Protein Expression and Purification for Antisera
Production
[0257] DNA encoding recombinant SdrF, SdrG, or SdrH region A was
obtained by PCR amplification of genomic template DNA from S.
epidermidis strains 9491 or K28 with appropriate primers (Table 3).
The SdrF region A construct lacked the terminal residue, proline.
PCR utilized Pfu DNA polymerase (Stratagene); specifications have
been previously described (7). PCR products were digested with
appropriate restriction endonucleases and ligated into the
expression vectors pQE30 (Qiagen, Valencia, Calif.) to generate
histidine-tagged proteins, or pGEX-2T (Pharmacia) or pGEX-KG to
generate GST-tagged proteins. Proteins were expressed in E. coli by
growing 4 liters of recombinant organisms to an optical density
(OD.sub.600) of 0.5 and inducing with 0.3 mM
isopropyl-1-thio-.beta.-D-galactoside (IPTG) (Gibco BRL) for two
hours. The cells were harvested in PBS (150 mM NaCl, 4.3 mM
Na.sub.2HPO.sub.4, 1 mM NaH.sub.2PO.sub.4) and frozen at
-80.degree. C. E. coli were passed through a French press and the
supernatants of these lysates were filtered through a 0.45 .mu.m
membrane. Soluble histidine-tagged proteins, present in the
supernatants, were initially purified by metal-chelating
chromatography. The supernatants were applied to a 5 ml
Ni.sup.2+-charged HiTrap chelating column (Pharmacia Biotech Inc.)
and bound proteins were eluted with 200 ml linear gradients of
0-200 mM imidazole in 4 mM Tris-HCl, 100 mM NaCl, pH 7.9 at a flow
rate of 5 ml/min. Fractions containing recombinant proteins were
identified by SDS-PAGE (see below), pooled, and dialyzed against 25
mM Tris-HCl, pH 8.0. Dialyzed proteins were concentrated and
further purified by ion-exchange chromatography by applying the
samples to a 5 ml HiTrap Q column (Pharmacia Biotech Inc.) and
eluting bound proteins with 200 ml linear gradients of 0-0.5 M NaCl
in 25 mM Tris-HCl, pH 8.0 at a flow rate of 5 ml/min. Fractions
containing purified recombinant proteins were identified by
SDS-PAGE. GST-tagged proteins were purified from E. coli lysates
obtained as described above. Lysates were passed through 10 ml
glutathione-agarose columns under gravity flow and washed with five
column volumes of PBS. Proteins were eluted from the columns with
freshly prepared 5 mM reduced glutathione (Sigma) in 50 mM
Tris-HCl, pH 8.0. Purified proteins were used to raise antisera in
New Zealand White rabbits using standard protocols issued by HTI
Bioproducts (Romano, Calif.) or by the Biological Core Facility at
the National University of Ireland (Dublin, Ireland).
[0258] SDS-PAGE and Western Blot Transfer
[0259] SDS-PAGE utilized trycine gels containing 10% acrylamide
(28). Separated proteins were transferred to PVDF membrane
(Immobilon-P, Millipore, Bedford, Mass.) with a semi-dry transfer
cell (Bio-Rad Laboratories, Hercules, Calif.). All protein samples
were heat denatured under reducing conditions. Purified proteins (1
.mu.g each) were subjected to SDS-PAGE and stained with Coomassie
brilliant blue. E. coli lysates or lysate fractions were obtained
as follows: IPTG induced, recombinant E. coli were grown to an
OD.sub.600 of 2.0, washed and resuspended to original volume in PBS
and prepared for SDS-PAGE. 10 .mu.l of each preparation was loaded
into individual wells of acrylamide gels. S. epidermidis strains
were grown to early stationary phase in TSB containing 1.25 U per
10 ml of the endoproteinase inhibitor .alpha..sub.2-Macroglobulin
(Boehringer Mannheim). The cells were adjusted to an OD.sub.600 of
2, washed, and resuspended in one half the original volume.
Protease inhibitors (4 mM phenylmethylsulphonyl fluoride, 1 mM
N-ethyl-maleimide, and 25 mM aminohexanoic acid) and DNAse (10
.mu.g ml.sup.-1) were added prior to lysostaphin (100 .mu.g
ml.sup.-1) and lysozyme (100 .mu.g ml.sup.-1). Enzymatic digestions
were performed for 30 min. at 37.degree. C. with shaking.
Separation of cell-wall proteins from protoplasts utilized the same
conditions in the presence of 30% raffinose. S. epidermidis lysates
or lysate fractions were treated as those for E. coli and 30 .mu.l
aliquots of samples were placed into wells of acrylamide gels.
[0260] Immunoassays
[0261] Western immunoassays were performed as follows: Western
blots were incubated in PBS containing 1% non-fat dry milk for 1
hr. The blots were then incubated with antisera (diluted in
PBS-milk) for 1 hr. Monoclonal, anti-histidine antibody (Clonetech,
Palo Alto, Calif.) was diluted to 1:3000. Anti-SdrFA antisera
(immune, preimmune, and antigen-absorbed) were diluted to 1:30,000;
anti-SdrGA antisera were diluted to 1:2000, and anti-SdrHA antisera
were diluted to 1:1000. Antisera absorptions have been previously
described (14). Briefly, anti-SdrFA and anti-SdrGA antisera were
extensively absorbed, respectively, with GST-tagged SdrGA and SdrFA
proteins present in insoluble fractions of induced E. coli that had
been sonicated and then centrifuged. This procedure was used to
remove potential cross-reactive antibodies present in each
antiserum. Removal of immunoreactive anti-SdrFA, -SdrGA, and -SdrHA
antibodies was accomplished by absorbing each antiserum with E.
coli lysates containing, respectively, GST-tagged SdrFA, SdrGA, and
SdrHA. Following antisera incubation, Western blots were washed
three times with PBS and incubated with a 1:2000 dilution of goat,
anti-rabbit or anti-mouse IgG conjugated to alkaline phosphatase
(Bio-Rad Laboratories) for 30 min. The blots were then washed and
developed in chromogenic substrate (150 .mu.g ml.sup.-1
5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt and 300 .mu.g
ml.sup.-1 p-nitro blue tetrazolium chloride in bicarbonate buffer)
(Bio-Rad) for 10-15 min.
[0262] Reactivity of convalescent patient IgG to recombinant
proteins has been previously described (1). Antisera from fifteen
individuals recovering from S. epidermidis infections were
collected and IgG was purified using protein-A sepharose
chromatography. An enzyme-linked immunosorbent assay (ELISA) was
used to demonstrate reactivity of IgG (2 .mu.g per well) to
recombinant proteins (1 .mu.g per well of histidine-tagged SdrFA or
SdrGA, or GST-tagged SdrHA) coated on microtiter plates.
[0263] Results
[0264] Identification of the sdrF, sdrG, and sdrH Genes.
[0265] Preliminary Southern hybridization analysis of S.
epidermidis DNA revealed the presence of several loci hybridizing
with DNA encoding the SD repeats of the S. aureus Sdr protein
family (unpublished observations). To further define these loci, we
cloned three DNA fragments from S. epidermidis strains 9491 and
K28. Two clones, pC5 and pC28, were obtained from strain 9491 by
direct ligation of HindIII-DNA fragments into E. coli plasmid
vectors. A third clone, E6-2, was obtained from a kGem.RTM.-11
genomic library made from strain K28. A segment of the E6-2 insert
DNA was subcloned into an E. coli plasmid vector to form pE6-2.
pC5, pE6-2, and pC28 were found to have 6.8, 6.0, and 2.0 kb DNA
inserts, respectively (not shown).
[0266] DNA sequence analysis revealed the presence of single open
reading frames (ORF) in each plasmid. The ORFs, designated sdrF,
sdrG, and sdrH, were 5199, 2793, and 1461 base pairs (bp) in
length, respectively. A leucine, rather than a methionine, codon is
predicted to act as a translational start codon for sdrG. A
potential ribosome binding site (GGAG) (SEQ ID No. 37) was
identified 7-12 bp 5' of each ORF. DNA sequences of 500-1000 bp
flanking the sdrF, sdrG, and sdrH ORFs were not similar, suggesting
that they are not tandemly linked like the sdrC, sdrD, and sdrE
genes of S. aureus (data not shown).
[0267] The Deduced Amino Acids Sequences of SdrF, SdrG, and
SdrH.
[0268] The amino acid structural organization of the S. epidermidis
SdrF and SdrG proteins are similar to the S. aureus Sdr proteins
and thus have features typical of cell-surface proteins that are
covalently anchored to the peptidoglycan of Gram-positive bacteria.
These cell-surface features include positively-charged residues at
the extreme C terminus preceded by a hydrophobic membrane spanning
region, and an LPXTG (SEQ ID No. 17) motif. The SD repeat regions
are located N-terminal of the LPXTG (SEQ ID No. 17) motif and are
proposed to traverse the cell wall (4, 10). SdrF and SdrG contain
predicted signal sequences at their N-termini (52 and 50 residues,
respectively) and residues associated with cell wall linkage at
their C-termini (FIGS. 5B, 5C). The SD-repeat regions of SdrF and
SdrG (see below) end seven and thirteen residues, respectively,
proximal to the LPXTG motifs. The SD-repeat regions of SdrF and
SdrG contain 558 and 56 residues, respectively (FIG. 5B). The
dipeptide composition of SdrG does not diverge from serine and
aspartate, whereas in SdrF, 26 alanine residues occur within the
SD-repeat region. The predicted molecular masses of the mature
proteins (with loss of the signal sequences) are 179 kDa for SdrF
and 97.6 kDa for SdrG.
[0269] The Sdr proteins of S. aureus each possess a structurally
distinct, known or putative ligand-binding domain at their N
terminus called region A (8, 16, 21). The N termini of mature SdrF
and SdrG possess 625 and 548 amino acid region As, respectively.
Pairwise comparisons reveal that the amino acid sequences of SdrF
and SdrG region As are 22% identical to each other and 20-35%
(mean=23%) identical to the region As of the S. aureus Sdr
proteins.
[0270] Amino acid sequence motifs have been reported in the region
As of S. aureus Sdr proteins, and these include a putative
Ca.sup.2+-binding EF-hand motif in ClfA, a cation-coordinating
MIDAS motif in ClfB, and a common Sdr protein motif, TYTFTDYVD (SEQ
ID No. 16), of unknown function (8, 23). The region As of SdrF and
SdrG both contain a TYTFTDYVD (SEQ ID No. 16) motif, and an EF-hand
motif (DYSEYEDVTNDDY) (SEQ ID No. 38) was found in the region A of
SdrG.
[0271] Three Sdr proteins of S. aureus (SdrC, SdrD, and SdrE)
contain variable numbers of 110-113 amino acid segments called
region B repeats (FIG. 5A), and each repeat contains a putative
Ca.sup.2+-binding EF-hand motif (8, 9). Likewise, SdrF contains
four region B repeats (of 119, 110, 111, and 111 residues), and
SdrG contains two region B repeats (of 113 and 111 residues) (FIG.
5B). Each repeat contains a putative EF-hand motif with a consensus
sequence of DX(N/D)X(D/N)GXX(D/N/G)XX(E/D). The region B repeats of
SdrF and SdrG have 43-85% (mean=55%) identity with each other and
39-73% (mean=54%) identity to the region B repeats found in the S.
aureus Sdr proteins.
[0272] The structural organization of SdrH at the amino acid
sequence level is considerably different than that of SdrF and
SdrG. Following a potential 30 residue signal sequence at its N
terminus, SdrH has a unique 60 residue stretch (region A) followed
by a 120-residue SD-repeat region and a 277-residue segment, region
C, that contains a hydrophobic sequence at its C terminus but lacks
an appropriately placed LPXTG motif. The sequence LGVTG, however,
occurs within the hydrophobic region. (FIGS. 1B, 1C). SdrH
contained no region B repeats. The region A and region C of SdrH
have no amino acid sequence similarities with other known Sdr
proteins or protein sequences from various databases. Motifs common
to other Sdr proteins were not found. The mature molecular mass of
SdrH is predicted to be 50.5 kDa.
[0273] Together, these result suggest that S. epidermidis has the
capacity to express two proteins related to the S. aureus Sdr
protein family, as well as a third Sdr protein with novel
structure.
[0274] Distribution of sdrF, sdrG, and sdrH in S. epidermidis
Strains.
[0275] In Southern hybridization analysis, a DNA probe representing
the encoding region of the ClfA SD-repeats hybridized to several
genomic HindIII fragments in sixteen S. epidermidis strains (FIG.
6A). Three hybridizing fragments were observed in most strains,
presumably representing the sdrF, sdrG, and sdrH genes. To confirm
this and determine the frequency of the genes within these strains,
additional analyses were performed with probes specific for DNA
encoding each region A. The sdrH probe hybridized to fragments
between 1.8-6.5 kb in all strains (FIG. 6B). The sdrG probe
hybridized to a 16-kb fragment in all strains examined (FIG. 6C).
In addition, the probe hybridized to HindIII fragments of 3.4 kb in
four of the sixteen strains (KH11, K28, RP62a, and N910102). The
same 3.4 kb fragments, however, did not hybridize with a probe
specific for DNA encoding SD-repeats (FIG. 6A), suggesting the
presence of a gene with similarity to the sdrG region A that lacks
a SD-repeat region. FIG. 6D shows a Southern blot probed with both
sdrG and sdrF region A DNA. The sdrF probe hybridized to
HindIII-DNA fragments between 4.5 kb and 10 kb in twelve out of
sixteen strains (strains K28, RP62a, N910173, and N910191 lacked a
hybridizing band). These results suggest that the sdrF, sdrG, and
sdrH genes are prevalent in S. epidermidis strains. Expression of
SdrF, SdrG, and SdrH in S. epidermidis.
[0276] Immunologic methods were used to determine if SdrF, SdrG,
and SdrH are expressed by S. epidermidis. Specific rabbit antisera
were raised to recombinant fusion proteins representing different
region As (designated SdrFA, SdrGA, and SdrHA). SdrFA and SdrGA
were fused to polyhistidine (His.sub.n), and SdrHA was fused to GST
(FIG. 7A). Monospecificity of the antisera was confirmed against a
panel of recombinant proteins containing different protein fusions.
Specifically, antisera raised to His.sub.n-SdrFA and -SdrGA did
not, respectively, cross react with GST-SdrGA and -SdrFA (FIG. 7B).
In addition, these same antisera did not cross react to GST-SdrHA
(FIG. 7B). Antiserum raised to GST-SdrHA reacted to a full-length,
His.sub.n-SdrH protein but not to His.sub.n-SdrFA or -SdrGA
proteins (FIG. 7C).
[0277] The region A-specific antisera were used to identify native
SdrF, SdrG, and SdrH in lysates of their cognate S. epidermidis
strains by Western immunoblotting. The anti-SdrFA antiserum reacted
with a ca 230 kDa band from strain 9491 (FIG. 8A). This band was
not present with Western blots reacted with preimmune antiserum or
with anti-SdrFA antiserum that had been absorbed with E. coli
lysates expressing a GST-SdrFA fusion protein (FIG. 8A). The
anti-SdrGA antiserum reacted to a 170 kDa band in a lysate of S.
epidermidis strain K28. This band was not present with preimmune
antiserum or with anti-SdrGA antiserum that had been absorbed with
an E. coli lysate expressing a GST-SdrGA fusion protein (FIG. 8B).
Antiserum to SdrHA recognized a 75 kDa band in strain 9491, and
this reactivity could be removed by absorbing the antiserum with
recombinant SdrH present in an E. coli lysate (FIG. 8C). The
apparent molecular masses of the anti-SdrFA, -SdrGA, and -SdrHA
immunoreactive bands are larger than the masses predicted from the
deduced amino acid sequences (179, 97, and 50 kDa, respectively).
Decreased migration on SDS-PAGE has been previously noted for two
S. aureus Sdr proteins, ClfA and ClfB, where up to a 50-100%
increase in predicted mass was observed. The acidic nature of the
Sdr proteins has been suggested to account for these
observations.
[0278] Differences in Molecular Mass of SdrH in S. epidermidis
Strains.
[0279] Western immunoblot analysis, different strains of S.
epidermidis possessed SdrH with apparent molecular masses that
varied between 60 and 75 kDa (FIG. 9A). Variations in the molecular
mass of ClfA has been previously correlated with the length of the
SD-repeat region (15). PCR analysis of the sdrH genes from the S.
epidermidis strains used above revealed that variations in the size
of DNA encoding the SD-repeat regions correlated with the different
masses of the SdrH proteins on Western blots. In contrast, PCR
products of DNA encoding the region C of each SdrH were similar in
size (FIG. 9B).
[0280] Analyses of SdrF, SdrG, and SdrH in Cell Wall Extracts and
Protoplasts.
[0281] The presence of a LPXTG motif in both SdrF and SdrG suggests
that these proteins are anchored in the cell wall and would
therefore be present in cell-wall extracts of lysostaphin-treated
S. epidermidis. Western blot analyses of early stationary phase,
lysostaphin-digested S. epidermidis strain 9491 with anti-SdrFA
antiserum revealed the presence of the 230 kDa SdrF band in both
the whole-cell lysate and the cell-wall extract but not in the
protoplast fraction (FIG. 10A). In contrast, analysis of the same
samples with anti-SdrGA antiserum revealed the presence of SdrG
(170 kDa) in the lysate and protoplast fraction but not in the
cell-wall extract (FIG. 10B). Similar results were observed with
blots containing lysostaphin-treated strain K28 (not shown).
Further analysis of 9491 lysostaphin fractions with anti-SdrHA
antiserum revealed an immunoreactive band in both the cell-wall
lysate and protoplast fraction (FIG. 10C). These results suggest
that, under these in vitro conditions, SdrF is localized and
anchored to the cell wall, and that SdrG (despite its LPXTG motif)
and SdrH are either associated with the cytoplasmic membrane or
located inside the cell.
[0282] Reactivity of Convalescent Patient Antisera to SdrF, SdrG,
and SdrH.
[0283] Recently, IgG from patients recovering from S. aureus
infections has been shown to react with the fibronectin binding
protein (FnbpA), suggesting that FnbpA is expressed by S. aureus
during infection (1). Here, IgG purified from the antisera of
fifteen patients recovering from various S. epidermidis infections
was tested by ELISA for reactivity with the recombinant SdrF, SdrG,
and SdrH region A proteins. FIG. 11 shows that IgG from patients'
antisera had a higher titer to SdrFA, SdrGA, and SdrHA compared to
that of IgG purified from pooled children antisera. The patients'
IgG was often more reactive with SdrGA and SdrHA than with SdrFA.
These results suggest that the Sdr proteins are expressed during S.
epidermidis infection in humans.
[0284] Discussion
[0285] S. epidermidis infections in humans are associated with
foreign-body devices that become rapidly coated with matrix
proteins when introduced into the patient (26). Although mechanisms
(encoded by the ica operon) have been proposed to mediate adherence
and biofilm formation on uncoated polymer surfaces, specific
factors mediating adherence to surfaces coated with host proteins
have been poorly defined. The presence of Sdr proteins in S.
epidermidis suggest that S. epidermidis may bind protein-coated
matrix devices in a manner similar to S. aureus which utilizes ClfA
and ClfB to mediate adherence to prosthetic devices coated with
fibrinogen (21, 31). In this regard, a recombinant protein,
expressed from cloned S. epidermidis DNA and similar to SdrG, has
been shown to bind fibrinogen (22).
[0286] The S. epidermidis Sdr proteins may play a role in
pathogenic processes apart from initial adherence. Experiments
showing that proteolytic cleavage of the fibronectin-binding
protein, Fnbp, from the surface of S. aureus produces a soluble,
active protein, and this cleavage has been proposed to initiate
release and dissemination of S. aureus from solid-phase fibronectin
(18). Analogously, native SdrF and SdrG undergo rapid degradation
in in vitro culture conditions in the absence of protease
inhibitors (unpublished observations), and this proteolysis may
provide a mechanism by which the bacteria can be detached from a
substrate.
[0287] SdrF fractionates with cell-wall anchored proteins released
by lysostaphin digestion, suggesting that it is present on the cell
surface. In contrast, SdrG, which contains an LPXTG, cell-wall
sorting motif similar to SdrF, was found only in the protoplast
fraction. The apparent lack of SdrG in the cell-wall fraction may
be influenced by the bacterial growth phase or by proteolytic
enzymes expressed during various growth phases. For instance, SdrG
was found to be absent or diminished in lysates of strain K28 in
early exponential phase. In addition, a number of S. epidermidis
strains grown to late stationary phase did contain SdrG in the
cell-wall extracts while other strains (including K28 and 9491)
contained only potential degradation products of SdrG (unpublished
results). Further studies are warranted to detail the regulation of
SdrG anchorage to the cell wall and localization at the cell
surface. Similarly, additional studies are required for SdrH, which
contains features of cell-wall proteins but lacks a clear LPXTG
motif.
[0288] As mentioned above, a protein similar to SdrG (designated
Fbe) has been identified as a S. epidermidis protein capable of
binding fibrinogen (22). Fbe was reported to have a region A
directly adjacent to a SD-repeat region, but structures similar to
region B repeats were not described. We have found that Fbe
contains two region B repeats with 99% amino acids identity to the
region B repeats of SdrG (unpublished results). In the reported
sequence of Fbe, these repeats begin at amino acid 601 and end at
the beginning of the SD-repeats. The original region A of Fbe was
reported to contain a minimal fibrinogen-binding region between
residues 269-599. With respect to the newly identified region B
repeats, the minimal fibrinogen-binding region would be positioned
at the extreme C terminus of region A. This is similar to ClfA
which contains a minimal fibrinogen-binding region at its C
terminus (McDevitt, 1995). The region As of Fbe and SdrG are 93%
identical in amino acid sequence, and the predicted minimal-binding
regions are 98% identical.
[0289] SdrH is unique among the eight described members of the Sdr
protein family (from S. aureus and S. epidermidis) in that it
possesses a divergent putative domain organization. The position of
the SD-repeat region at the N terminus, a novel region C, and the
lack of definitive cell-wall association sequences suggest that
this protein functions differently than the known Sdr MSCRAMMs.
Further studies on the bacterial localization and ligand-binding
potential of SdrH are in progress.
[0290] The SD-repeat regions of SdrF and SdrG represent the longest
and shortest SD repeats (558 and 56 residues, respectively) of the
eight known Sdr proteins. Although the SD-repeats do not
participate in fibrinogen binding, wild-type levels of functional
ClfA expression were found to require a SD-repeat region with more
than 40 residues (72 residues from the end of region A to the LPXTG
motif) (4). This expanse of amino acids was postulated to span the
cell wall and present a functional region A. Although SdrG contains
73 residues from the end of the region B repeats to the LPXTG
motif, the two region B repeats may also affect the structure and
function of the ligand-binding region A. The purpose of an
extremely large SD-repeat region in SdrF is unknown. Given the
interaction of the SD-repeat region with the cell wall, the
differences in length of the SD-repeat regions between SdrF and
SdrG may be associated with the localization differences observed
in cell-wall fractions of these proteins. Variations in the length
of SD-repeats in SdrH have been described. The SdrH protein from
strain KH11 (the smallest SdrH observed) was found by DNA sequence
analysis to contain 64 residues (unpublished results). The role of
the SD repeats in SdrH is unknown but we speculate that this
region, like other Sdr proteins, may be partially associated with
the cell wall.
[0291] Genes encoding Sdr proteins of S. epidermidis are present in
most of the clinical isolates examined to date. These strains were
isolated from a broad range of disease outcomes in patients of
diverse geographic locations. In addition, patients recovering from
a variety of S. epidermidis infections have SdrF-, SdrG-, and
SdrH-reactive IgG in their antisera. Similar traits have been
observed for the five reported Sdr proteins of S. aureus [(8, 17)
and unpublished results]. These studies suggest that the Sdr
proteins are important constituents in S. epidermidis infectivity
and growth. Interestingly, loci with homology to DNA encoding
SD-repeat regions are also prevalent in strains of S. haemolyticus,
S. lugdunensis, and S. intermedius, additional staphylococci
capable of producing disease in humans and other mammals
(unpublished results).
REFERENCES CITED IN EXAMPLE 2
[0292] 1. Casolini, F., L. Visai, D. Joh, P. G. Conaldi, A.
Toniolo, M. Hook, and P. Speziale. 1998. Antibody response to
fibronectin-binding adhesin FnbpA in patients with Staphylococcus
aureus infections. Infect Immun. 66:5433-5442.
[0293] 2. Fleer, A., and J. Verhoef. 1989. An evaluation of the
role of surface hydrophobicity and extracellular slime in the
pathogenesis of foreign-body-related infections due to
coagulase-negative staphylococci. J Invest Surg. 2:391-6.
[0294] 3. Foster, T. J., and M. Hook. 1998. Surface protein
adhesins of Staphylococcus aureus. Trends Microbiol. 6:484-488.
[0295] 4. Hartford, O., P. Francois, P. Vaudaux, and T. J. Foster.
1997. The dipeptide repeat region of the fibrinogen-binding protein
(clumping factor) is required for functional expression of the
fibrinogen-binding domain on the Staphylococcus aureus cell
surface. Mol Microbiol. 25:1065-1076.
[0296] 5. Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom,
D. Mack, and F. Gotz. 1996. Molecular basis of intercellular
adhesion in the biofilm-forming Staphylococcus epidermidis. Mol
Microbiol. 20:1083-1091.
[0297] 6. Herrmann, M., P. E. Vaudaux, D. Pittet, R. Auckenthaler,
P. D. Lew, F. Schumacher-Perdreau, G. Peters, and F. A. Waldvogel.
1988. Fibronectin, fibrinogen, and laminin act as mediators of
adherence of clinical staphylococcal isolates to foreign material.
J Infect Dis. 158:693-701.
[0298] 7. Joh, H. J., K. House-Pompeo, J. M. Patti, S.
Gurusiddappa, and M. Hook. 1994. Fibronectin receptors from
Gram-positive bacteria: Comparison of active sites. Biochem.
33:6086-6092.
[0299] 8. Josefsson, E., K. W. McCrea, D. Ni Eidhin, D. O'Connell,
Cox. J., M. Hook, and T. J. Foster. 1998. Three new members of the
serine-aspartate repeat protein multigene family of Staphylococcus
aureus. Microbiology. 144:3387-3395.
[0300] 9. Josefsson, E., D. O'Connell, T. J. Foster, I. Durussel,
and J. A. Cox. 1998. The binding of calcium to the B-repeat segment
of SdrD, a cell surface protein of Staphylococcus aureus. J Biol.
Chem. 273:31145-31152.
[0301] 10. Kehoe, M. A. 1994. Cell-Wall-Associated Proteins in
Gram-Positive Bacteria. In J. M. Ghuysen, and R. Hakenbeck (ed.),
Bacterial Cell Wall. p.217-61.
[0302] 11. Kloos, W. E., and T. L. Bannerman. 1994. Update on
clinical significance of coagulase-negative staphylococci. Clin
Microbiol Rev. 7:117-140.
[0303] 12. Mack, D., M. Nedelmann, A. Krokotsch, A. Schwarzkopf, J.
Heesemann, and R. Laufs. 1994. Characterization of transposon
mutants of biofilm-producing Staphylococcus epidermidis impaired in
the accumulative phase of biofilm production: genetic
identification of a hexosamine-containing polysaccharide
intercellular adhesin. Infect Immun. 62:3244-3253.
[0304] 13. Martin, M. A., M. A. Pfaller, R. M. Massanari, and R. P.
Wenzel. 1989. Use of cellular hydrophobicity, slime production, and
species identification markers for the clinical significance of
coagulase-negative staphylococcal isolates. Am J Infect Control.
17:130-135.
[0305] 14. McCrea, K. W., W. J. Watson, J. R. Gilsdorf, and C. F.
Marrs. 1997. Identification of two minor subunits in the pilus of
Haemophilus influenzae. J Bacteriol. 179:4227-4231.
[0306] 15. McDevitt, D., and T. J. Foster. 1995. Variation in the
size of the repeat region of the fibrinogen receptor (clumping
factor) of Staphylococcus aureus strains. Microbiology.
141:937-43.
[0307] 16. McDevitt, D., P. Francois, P. Vaudaux, and T. J. Foster.
1995. Identification of the ligand-binding domain of the
surface-located fibrinogen receptor (clumping factor) of
Staphylococcus aureus. Mol Microbiol. 16:895-907.
[0308] 17. McDevitt, D., P. Francois, P. Vaudaux, and T. J. Foster.
1994. Molecular characterization of the clumping factor (fibrinogen
receptor) of Staphylococcus aureus. Mol Microbiol. 11:237-248.
[0309] 18. McGavin, M. J., C. Zahradka, K. Rice, and J. E. Scott.
1997. Modification of the Staphylococcus aureus fibronectin binding
phenotype by V8 protease. Infect Immun. 65:2621-2628.
[0310] 19. McKenney, D., J. Hubner, E. Muller, Y. Wang, D. A.
Goldmann, and G. B. Pier. 1998. The ica locus of Staphylococcus
epidermidis encodes production of the capsular
polysaccharide/adhesin. Infect Immun. 66:4711-4720.
[0311] 20. Moreillon, P., J. M. Entenza, P. Francioli, D. McDevitt,
T. J. Foster, P. Francois, and P. Vaudaux. 1995. Role of
Staphylococcus aureus coagulase and clumping factor in pathogenesis
of experimental endocarditis. Infect Immun. 63:4738-4743.
[0312] 21. Ni Eidhin, D., S. Perkins, P. Francois, P. Vaudaux, M.
Hook, and T. J. Foster. 1998. Clumping factor B (ClfB), a new
surface-located fibrinogen-binding adhesin of Staphylococcus
aureus. Mol Microbiol. 30:245-257.
[0313] 22. Nilsson, M., L. Frykberg, J. I. Flock, L. Pei, M.
Lindberg, and B. Guss.
[0314] 1998. A fibrinogen-binding protein of Staphylococcus
epidermidis. Infect Immun. 66:2666-2673.
[0315] 23. O'Connell, D. P., T. Nanavaty, D. McDevitt, S.
Gurusiddappa, M. Hook, and T. J. Foster. 1998. The
fibrinogen-binding MSCRAMM (clumping factor) of Staphylococcus
aureus has a Ca.sup.2+-dependent inhibitory site. J Biol Chem.
273:6821-6829.
[0316] 24. Pascual, A., A. Fleer, N. A. Westerdaal, and J. Verhoef.
1986. Modulation of adherence of coagulase-negative staphylococci
to Teflon catheters in vitro. Eur J Clin Microbiol. 5:518-22.
[0317] 25. Paulsson, M., A. Ljungh, and T. Wadstrom. 1992. Rapid
identification of fibronectin, vitronectin, laminin, and collagen
cell surface binding proteins on coagulase-negative staphylococci
by particle agglutination assays. J Clin Microbiol.
30:2006-2012.
[0318] 26. Pitt, W. G., B. R. Young, K. Park, and S. L. Cooper.
1988. Plasma protein adsorption: in vitro and ex vivo observations.
Macromol. Chem. Macromol. Symp. 17:435-465. (Abstract).
[0319] 27. Rapley, R., and M. Walker. 1992. PCR screening of DNA
cloned into polylinker-containing vectors with M13 sequencing
primers. Biotechniques. 12:516.
[0320] 28. Schgger, H., and G. von Jagow. 1987. Tricine-sodium
dodecyl sulfate-polyacrylamide gel electrophoresis for the
separation of proteins in the range from 1 to 100 kDa. Anal
Biochem. 166:368-79.
[0321] 29. Switalski, L. M., C. Ryden, K. Rubin, A. Ljungh, M.
Hook, and T. Wadstrom. 1983. Binding of fibronectin to
Staphylococcus strains. Infect Immun. 42:628-633.
[0322] 30. Timmerman, C. P., A. Fleer, J. M. Besnier, L. De Graaf,
F. Cremers, and J. Verhoef. 1991. Characterization of a
proteinaceous adhesin of Staphylococcus epidermidis which mediates
attachment to polystyrene. Infect Immun. 59:4187-4192.
[0323] 31. Vaudaux, P. E., P. Francois, R. A. Proctor, D. McDevitt,
T. J. Foster, R. M. Albrecht, D. P. Lew, H. Wabers, and S. L.
Cooper. 1995. Use of adhesion-defective mutants of Staphylococcus
aureus to define the role of specific plasma proteins in promoting
bacterial adhesion to canine arteriovenous shunts. Infect Immun.
63:585-590.
* * * * *