U.S. patent application number 10/774938 was filed with the patent office on 2004-07-15 for method for screening restriction endonucleases.
Invention is credited to Byrd, Devon R., Morgan, Richard D., Noren, Christopher J., Patti, Jay, Roberts, Richard J..
Application Number | 20040137576 10/774938 |
Document ID | / |
Family ID | 30772465 |
Filed Date | 2004-07-15 |
United States Patent
Application |
20040137576 |
Kind Code |
A1 |
Roberts, Richard J. ; et
al. |
July 15, 2004 |
Method for screening restriction endonucleases
Abstract
A method is provided for identifying a restriction endonuclease
that includes: screening a target DNA sequence for the presence of
known methylase sequence motifs, identifying any open reading
frames which lie close to the screened methylase sequence motif and
assaying the protein products of the open reading frames for
restriction endonuclease activity.
Inventors: |
Roberts, Richard J.;
(Wenham, MA) ; Byrd, Devon R.; (Germantown,
MD) ; Morgan, Richard D.; (Middleton, MA) ;
Patti, Jay; (Lynnfield, MA) ; Noren, Christopher
J.; (Boxford, MA) |
Correspondence
Address: |
Harriet M. Strimpel
New England Biolabs, Inc.
32 Tozer Road
Beverly
MA
01915
US
|
Family ID: |
30772465 |
Appl. No.: |
10/774938 |
Filed: |
February 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10774938 |
Feb 9, 2004 |
|
|
|
09577528 |
May 24, 2000 |
|
|
|
6689573 |
|
|
|
|
09577528 |
May 24, 2000 |
|
|
|
09486356 |
Feb 25, 2000 |
|
|
|
6383770 |
|
|
|
|
60135541 |
May 24, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/419; 435/456; 536/23.7 |
Current CPC
Class: |
C12N 9/22 20130101 |
Class at
Publication: |
435/069.1 ;
435/456; 435/419; 435/320.1; 536/023.7 |
International
Class: |
C12N 015/86; C12Q
001/68; C07H 021/04; C12N 005/04 |
Claims
What is claimed is:
1. A vector suitable for cloning a DNA sequence encoding a
cytotoxic protein wherein the vector comprises at least a first and
a second transcription promotor and is adapted to accept the DNA
sequence insert and wherein the first and second transcription
promoters are independently controllable.
2. The vector of claim 1, wherein the first transcription promotor
enables anti-sense strand transcription and the second
transcription promotor enables sense strand transcription.
3. The vector of claim 1, wherein the first transcription promotor
comprises .lambda. phage promotor and the second transcription
promotor comprises T7 RNA polymerase promotor.
4. The vector of claim 1, wherein the vector is pLT7K.
5. The vector of claim 1, wherein the independent control of the
first and second transcription promoters is achieved by
temperature, IPTG addition, or RNA polymerase inhibition.
6. The vector of claim 5 wherein the RNA polymerase inhibition is
achieved by bacteriophage T7 lysozyme expression, or utilization of
a T7 RNA polymerase negative E. coli strain.
7. An E. coli host cell transformed by the vector of any one of
claims 1, 2, 3, 4, 5 or 6.
8. A method for producing a recombinant cytotoxic protein, the
method comprising the steps of: (1) inserting a DNA sequence
encoding the cytotoxic protein into the vector of any one of claims
1, 2, 3, 4, 5, or 6; (2) transforming a host cell with the vector
of step (1) under conditions which disallow the expression of the
sense strand; (3) culturing the transformed host cell of step (2)
under conditions which disallow the expression of the sense strand;
(4) inducing the selective expression of the sense strand; and (5)
producing the recombinant cytotoxic protein.
9. The method of claim 8, wherein step (4) further comprises
inducing the selective expression of the sense strand by
temperature, IPTG addition, or RNA polymerase inhibition.
Description
RELATED APPLICATIONS
[0001] This Non-Provisional Application is a divisional application
of U.S. application Ser. No. 09/577,528 filed May 24, 2000, which
is a continuation-in-part application of U.S. application Ser. No.
09/486,356 filed Feb. 25, 2000 and claims priority from U.S.
Application No. 60/135,541 filed May 24, 1999, all of which are
hereby incorporated by reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a novel method for
screening and identifying restriction endonucleases based on the
proximity of their genes to the genes of their cognate methylases.
A similar method for identifying isoschizomers of known
endonucleases, which isoschizomers possess a desired physical
property is also provided. Related methods for producing and
cloning such endonucleases or other cytotoxic proteins are
provided, as are several novel M. jannaschii restriction
endonucleases.
[0003] Nucleases are a class of enzymes which degrade or cut
single- or double-stranded DNA. Restriction endonucleases are an
important class of nucleases which recognize and bind to particular
sequences of nucleotides (the `recognition sequence`) along the DNA
molecule. Once bound, they cleave both strands of the molecule
within, or to one side of, the recognition sequence. Different
restriction endonucleases recognize different recognition
sequences. Over two hundred restriction endonucleases with unique
specificities have been identified among the many hundreds of
bacterial and archaeal species that have been examined to date.
Some have also been found to be encoded by eukaryotic viruses.
[0004] It is thought that in nature, restriction endonucleases,
which comprise the first component of what are commonly referred to
as restriction-modification ("RM") systems, play a protective role
in the welfare of the host cell. They enable bacteria and archaea
to resist infection by foreign DNA molecules like viruses and
plasmids that would otherwise destroy or parasitize them. They
impart resistance by cleaving invading foreign DNA molecules when
the appropriate recognition sequence is present. The cleavage that
takes place disables many of the infecting genes and renders the
DNA susceptible to further degradation by non-specific
endonucleases.
[0005] A second component of these bacterial and archaeal
protective systems are the modification methylases. These enzymes
are complementary to the restriction endonucleases and they provide
the means by which bacteria and archaea are able to protect their
own DNA from cleavage and distinguish it from foreign, infecting
DNA. Usually, modification methylases recognize and bind to the
same nucleotide recognition sequence as the corresponding
restriction endonuclease, but instead of cleaving the DNA, they
chemically modify one or other of the nucleotides within the
sequence by the addition of a methyl group. Following methylation,
the recognition sequence is no longer bound or cleaved by the
restriction endonuclease. The DNA of the host cell is always fully
modified by virtue of the activity of the modification methylase.
It is therefore completely insensitive to the presence of the
endogenous restriction endonuclease. It is only unmodified, and
therefore identifiably foreign DNA, that is sensitive to
restriction endonuclease recognition and cleavage.
[0006] There are three kinds of restriction systems. The Type I
systems are complex. They recognize specific sequences, but cleave
randomly with respect to that sequence (Bickle, T. A., Nucleases
[eds. Linn, S. M., Lloyd, S. L., and Roberts, R. J.], Cold Spring
Harbor Laboratory Press, pp. 89-109, (1993)). The Type III enzymes,
of which only five have been characterized biochemically, recognize
specific sequences, cleave at a precise point away from that
sequence, but rarely give complete digestion (ibid). Neither of
these two kinds of systems are suitable for genetic engineering,
which is the sole province of the Type II systems. The latter
recognize a specific sequence and cleave precisely either within or
very close to that sequence. They typically only require Mg.sup.++
for their action.
[0007] The traditional approaches to screening for restriction
endonucleases, pioneered by Roberts et al. and others in the early
to mid 1970's (e.g. Smith, H. O. and Wilcox, K. W., J. Mol. Biol.
51:379-391 (1970); Kelly, T. J. Jr. and Smith, H. O., J. Mol. Biol.
51:393-409, (1970); Middleton, J. H. et al., J. Virol. 10:42-50
(1972); and Roberts, R. J. et al., J. Mol. Biol. 91:121-123,
(1975)), was to grow small cultures of individual strains, prepare
cell extracts and then test the crude cell extracts for their
ability to produce specific fragments on small DNA molecules (see
Schildkraut, I. S., "Screening for and Characterizing Restriction
Endonucleases", in Genetic Engineering, Principles and Methods,
Vol. 6, pp. 117-140, Plenum Press (1984)). Using this approach,
about 12,000 strains have been screened worldwide to yield the
current harvest of almost 3,000 restriction endonucleases (Roberts,
R. J. and Macelis, D., Nucl. Acids. Res. 26:338-350 (1998)).
Roughly, one in four of all strains examined, using a biochemical
approach, shows the presence of a Type II restriction enzyme.
[0008] Beginning in 1978, investigators in a number of laboratories
set about to clone the genes for some of the Type II restriction
systems (Szomolanyi, I. et al., Gene 10:219-225 (1980)). This
promised to be quite a successful enterprise because of the ease of
selecting for methylase genes (Mann, M. B. et al., Gene 3:97-112
(1978); Kiss, A. M. et al., Nucl. Acids. Res. 13:6403-6420 (1985)).
Basically, if an organism is known to contain a restriction system,
then a shotgun of the organism's DNA can be made and the resulting
mixed population of plasmids can be grown as a single, mixed
culture. This mixed population of plasmid DNA's is then isolated,
cleaved in vitro with the restriction enzyme, and only those
plasmids that have both received and expressed the corresponding
methylase gene, will survive the digestion. Upon retransformation,
any cells that grow are greatly enriched for the presence of the
methylase gene. Because the methylase and restriction enzyme genes
are usually adjacent, this method can yield both genes. Sometimes a
single round of selection is sufficient, but routinely two rounds
of selection yield the required methylase gene with high
efficiency. Only when expression of the methylase gene is poor or
coexpression of flanking sequences is lethal does the selection
fail. Various tricks and alternative cloning methods have been
developed to overcome such limitations (e.g. Brooks, J. E. et al.,
Nucl. Acids. Res. 17:979-997 (1989); Wilson, G. G. and Meda, M. M.,
U.S. Pat. No. 5,179,015 (1993)).
[0009] As the skilled artisan will appreciate restriction
endonucleases are cytotoxic products. In general, genes encoding
cytotoxic products are extremely difficult to clone, even when care
has been taken to remove sequences that might enable their
expression in the plasmid host. Generation of their mRNA can be due
to `read-through` transcription that originates at some point on
the plasmid other than the toxic locus. Absent an identifiable
Shine-Dalgarno (SD) consensus sequence upstream of an initiator
codon, translation of the toxic protein may be initiated by a
cryptic ribosome binding site (RBS) (by definition, not fitting the
SD consensus, and usually non-obvious), or abortive termination of
an upstream ribosome-mRNA complex. Long mRNA concatamers can be
generated from plasmid templates via `rolling circle
transcription`. This may increase and/or stabilize the mRNA of the
toxic allele, so that even rare translational initiation events can
generate enough protein to impact cell viability negatively.
[0010] Attempting to clone a toxic gene into a plasmid designed to
facilitate high expression is, in many cases, futile.
Transcriptional repressors are often employed to down-regulate
expression, and typically act by interfering with productive
transcription. This type of regulation is dependent upon: 1) the
molar ratio of repressor protein to its cognate binding site
(operator), and 2) the affinity of the repressor protein for the
operator sequence. In no case is it reasonable to expect 100% of
the operator sites to be occupied 100% of the time. Thus, some
expression of a cloned gene is unavoidable, creating a powerful
selective pressure against cells that faithfully replicate the
lethal gene. Those cells in which expression of the toxic gene has
been mutagenically inactivated survive.
[0011] Genes encoding cytotoxic products must be actively and
constitutively down-regulated, and any adventitious expression
eliminated at both the transcriptional and translational
levels.
[0012] This may be accomplished through the action of antisense
RNAs (asRNA). The asRNA base pairs with a segment of mRNA and
presumably inhibits translational initiation or elongation. The use
of opposing promoters to modulate expression of a gene encoding a
potentially toxic protein has been reported (O'Connor and Timmis,
J. Bacteriol. 169(10):4457-4462 (1987)). Their system employed the
endogenous E. coli RNA polymerase ("RNAP"), with the sense RNA
(sRNA) generated from the .lambda.-derived P.sub.L promoter, and
asRNA initiating at the E. coli P.sub.lac promoter. Operator
sequences for repressor proteins normally associated with these
promoters, namely cl and LacI, were also present on the high copy
plasmid (pUC8/18) backbone. A second copy of the LacI operator was
inserted between P.sub.L and the gene of interest. The alleles
encoding the cl857 and LacI repressor proteins were not part of the
plasmid, but were provided either from the chromosome (cl857
.lambda. prophage) or on the low copy plasmid pACYC 184 (lacI).
[0013] This approach to cloning a cytotoxic gene, however, suffers
from several shortcomings:
[0014] 1) a high copy replicon significantly raises the dosage of
the toxic allele, increasing the likelihood for undesired
expression;
[0015] 2) placement of operator sequences on a high copy replicon,
while the genes encoding the repressor proteins are present at
substantially lower copy number, does not provide optimal
repression;
[0016] 3) strong repression of gene expression and elective
induction of gene expression are mutually exclusive.
[0017] While the idea of using opposing promoters to modulate gene
expression has been previously demonstrated (Elledge and Davis,
Genes & Develop. 3:185-197 (1988)), it has not been
demonstrated as a successful method using a toxic gene. The
Elledge, et al. system relies upon conditional expression of a gene
encoding spectinomycin resistance. This approach proved to be a
useful genetic selection for genes encoding proteins capable of
exhibiting transcriptional repressor-like activity (Elledge et al.,
PNAS USA 86:3689-3693 (1989); Dorner and Schildkraut, Nucl. Acid.
Res. 22(6):1068-1074 (1994)). These studies showed that
transcriptional inactivation of a gene can be achieved with an
antisense promoter.
[0018] It is imperative that stable clones of desired loci
(including those encoding cytotoxic products) be established in the
context of an inducible expression system, such as an E. coli
expression system, for the following reasons:
[0019] a) to generate a physical archive of single genes encoding
potentially novel biochemical activities (as opposed to phage or
cosmid constructs containing many genes);
[0020] b) to allow for rapid and facile characterization and/or
manipulation of the entire allele;
[0021] c) and to move rapidly from discovery to production.
[0022] It would therefore be desirable to develop a method for
cloning genes encoding cytotoxic products, including restriction
endonucleases, or other genes which cannot be stably cloned by
traditional methods, in order to enable the generation of the
above-mentioned archive.
[0023] Nonetheless, as a result of current cloning methods, more
than 100 systems have been cloned and many have been sequenced
(Wilson, G. G., Nucl. Acids. Res. 19:2539-2566 (1991)). Several
conclusions have emerged. First, genes for restriction
endonucleases that recognize unique sequences are usually different
from one another and their sequences are unique within GenBank.
Typically, the only time when similarity has been found between
restriction enzyme gene sequences is when the two enzymes are
isoschizomers or have closely related recognition sequences; i.e.
they recognize exactly the same sequence, but come from different
microorganisms (e.g. Lubys, A. et al., Gene 141:85-89 (1994);
Withers, B. E. et al., Nucl. Acids. Res. 20:6267-6273 (1992)).
Second, among methylase gene sequences there is very strong
similarity between enzymes that form 5-methylcytosine (m5C), such
that they can readily be recognized by pattern matching algorithms
(Posfai, J. et al., Nucleic Acids. Res. 17:2421-2435 (1989);
Lauster, R. et al., J. Mol. Biol. 206:305-312 (1989)). The genes
for methylases that form N6-methyladenine (N6A) or
N4-methylcytosine (N4C) are also related to one another, but show
fewer well-conserved similarities. At least three subfamilies of
sequences can be recognized (Wilson, G. G., Meth. Enzymol.
216:259-279 (1992), Timinskas et al. Gene 157: 3-11 (1995)). In
this case, pattern matching algorithms do fairly well, but cannot
provide conclusive evidence whether a newly sequenced gene encodes
an N6A or an N4C methyltransferase. Third, and most significant,
for virtually all known RM systems that have so far been cloned,
the methylase gene and the restriction enzyme gene lie either
adjacent or extremely close to one another (Wilson, G. G., Nucl.
Acids. Res. 19:2539-2566 (1991)).
[0024] Within the last year, sequences have become available for
many complete bacterial and archaeal genomes, including:
Haemophilus influenzae (Fleischmann, R. D. et al., Science
269:496-512 (1995)), Mycoplasma genitalia (Fraser, C. M. et al.,
Science 270:397-403 (1995)), Methanococcus jannaschii (Bult, C. J.
et al., Science 273:1058-1073 (1996), Mycoplasma pneumoniae
(Himmelreich, R. et al., Nuc. Acids. Res. 24:4420-4449 (1996)) and
Synechocystis species (Kaneko, T. et al., DNA Res. 3:109-136
(1996)). H. influenzae and M. jannaschii were each known to encode
two Type II RM systems (Roberts, R. J. and Macelis, D. M., supra
(1998)). The complete sequences of their genomes have revealed a
remarkable fact. In each case, these genomes appear to contain
multiple RM systems many of which have never been detected
biochemically. The results of computer analysis of these sequences
is compared with the biochemical results shown in Table 1:
1TABLE 1 RM Systems RM Systems Dectected Detected Organisms by
Computer Biochemically H. influenzae 8 2 M. genitalia 2 not tested
M. jannaschii 12 2 M. pneumoniae 4 not tested Synechocystis species
4 not tested
[0025] As mentioned earlier, among Type II restriction enzymes
there are now more than two hundred different specificities
present. Table 2 shows the kind of sequence patterns that are
currently known to be recognized by restriction endonucleases. It
lists the number of specific examples of each presently in the
database, compared with the theoretical number based on all
possible sequence combinations.
[0026] In column 1 of this table, the pattern representation, n',
signifies the complement of n. Thus nnn'n' in the first entry is
used to represent the 16 possible tetranucleotide palindromes AATT,
ACGT, AGCT etc.
[0027] It is clear that for some types of patterns, such as the
simple hexanucleotide and tetranucleotide palindromes, we are very
close to having all possible such enzymes. However, for many of the
other patterns we are a long way away from the theoretically
possible number. This suggests that there are many more
specificities waiting to be discovered.
[0028] Accordingly, it would be desirable to provide an alternative
method for screening for restriction endonucleases which would
overcome the limitations associated with the traditional
biochemical methods described above. Such an alternative method
would facilitate the identification, characterization, and cloning
of heretofore unknown restriction endonucleases as well as
isoschizomers of known restriction endonucleases.
2TABLE 2 Sequence patterns recognized by Type II restriction
enzymes Specific Example Pattern Rec. Sequence Enzyme Observed
Possible nnn'n' AATT TspEI 14 16 nnnn'n'n' AACGTT AclI 55 64
nnnnn'n'n'n' ATTTAAAT SwaI 9 256 nnnnn ACGGC BcefI 18 1024 nnnnnn
ACCTGC BspMI 25 4096 nnNn'n' ACNGT Tsp4CI 7 16 nDnn'Hn' GDGCHC SduI
1 16 nKnnnn GKGCCC BmgI 1 1024 nMnn'Kn' CMGCKG NspBII 1 16
nnBNNNNNVn'n' GABNNNNNVTC Hin4I 1 16 nnMKn'n' GTMKAC AccI 1 16 nnnn
CCGC AciI 2 256 nnNNn'n' CCNNGG SecI 3 16 nnnNn'n'n' CCTNAGG SauI 3
64 nnnNnnn CACCTGC UbaEI 3 4096 nnnNNNn'n'n' CACNNNGTG DraIII 3 64
nnnNNNNn'n'n' GAANNNNTTC XmnI 3 64 nnnNNNNNn'n'n' CCANNNNNTGG PflMI
6 64 nnNNNNNNNn'n' CCNNNNNNNGG BsiYI 2 16 nnnNNNNNNn'n'n'
ACCNNNNNNGGT HgiEII 3 64 nnnnNNNNNn'n'n'n' GGCCNNNNNGGCC SfiI 1 256
nnNNNNNnnnn ACNNNNNCTCC BsaXI 2 4096 nnnNNNNNNNnn CGANNNNNNTGC BcgI
3 1024 nnnnNNNNNNnnn GAACNNNNNNTCC UbaDI 1 16384 nnnNNNNNNNNNn'n'n'
CCANNNNNNNNNTGG XcmI 1 64 nnNNNNnnnYn ACNNNNGTAYC BaeI 1 4096
nnnRnn CAARCA Tth111II 2 1024 nnnWn'n'n' ACCWGGT SexAI 4 64
nnRYn'n' ACRYGT AflIII 4 16 nnSn'n' CCSGG CauII 3 16 nnWn'n' CCWGG
EcoRII 4 16 nnWWn'n' CCWWGG StyI 1 16 nnYNNNNRn'n' CAYNNNNRTG MslI
1 16 nnYRn'n' CTYRAG SmlI 3 16 nRnn'Yn' GRCGYC AcyI 2 16
nRnnn'n'Yn' CRCCGGYG SgrAI 1 64 nWnn'Wn' GWGCWC HgiAI 1 16 nYnn'Rn'
CYCGRG AvaI 1 16 Rnn'Y RGCY CviJI 1 4 Rnnn'n'Y RAATTY ApoI 5 16
RnnNn'n'Y RGGNCCY DraII 1 16 RnnWn'n'Y RGGWCCY PpuMI 1 16 Wnnn'n'W
WCCGGW BetI 3 16 Ynnn'n'R YACGTR BsaAI 2 16 Ynnnnn CGGCCR GdiII 1
1024
SUMMARY OF THE INVENTION
[0029] In accordance with one embodiment of the present invention,
a novel method for screening for restriction endonucleases is
provided. This method has been successfully employed and may be
used to identify heretofore unknown restriction endonucleases as
well as isoschizomers of known restriction endonucleases, such
isoschizomers possessing a desired physical property, such as
thermostability. This novel method will also facilitate the
characterization, cloning and production of newly identified
restriction endonucleases and isoschizomers.
[0030] More specifically, in its broadest application the present
invention comprises the following steps:
[0031] (a) screening a target DNA sequence for the presence of
known DNA methylase sequences and motifs characteristic of DNA
methylases;
[0032] (b) identifying open reading frames which lie close to the
DNA methylase sequence of step (a); and
[0033] (c) analyzing the protein product of the open reading frame
of step (b) for endonuclease activity.
[0034] Once a new restriction endonuclease or isoschizomer has been
identified in accordance with the above-outlined methodology, the
restriction endonuclease so identified may be produced in
accordance with standard protein purification techniques or by
recombinant DNA techniques.
[0035] Several novel restriction endonucleases isolated from M.
jannaschii using the methods of the present invention are also
provided, including MjaII, which is a thermostable isoschizomer of
Sau96I, MjaIII, which is a thermostable isoschizomer of MboI, and
MjaIV, a new specificity recognizing GTNNAC.
[0036] Also provided by the present invention is a novel method for
stably cloning DNA sequences which might otherwise be unstable
because the products encoded are toxic. One example provided has a
stable, inducible clone encoding the normally toxic restriction
endonuclease PacI in the absence of a protective methylase.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 shows the agarose gel electrophoresis of DNAs
digested by the transcription/translation product of the MJ0984
open reading frame from M. jannaschii and BfaI (recognition
sequence CTAG). Lane 1:BstNI/pBR322 markers; Lane 2: bacteriophage
.lambda. DNA digested with BfaI; Lane 3: double digest of
bacteriophage .lambda. DNA with BfaI and the
transcription/translation product from MJ0984; Lane 4:
bacteriophage .lambda. DNA digested with the
transcription/translation product from MJ0984; Lane 5:
HindIII/bacteriophage .lambda. DNA markers.
[0038] FIG. 2 is the agarose gel electrophoresis of
R.Sf.LAMBDA.activity in coupled transcription/translation
reactions. Sf.LAMBDA. digests of Adenovirus-2 DNA (35,927 bp) were
carried out as described in the text. Lane 7: Uncut DNA. Lane 2:
DNA digested with 10 units purified SfiI (NEB). Lanes 3-7: DNA
digested with serially diluted reaction supernatant of in vitro
transcription/translation reaction without added T7 RNA polymerase.
Lanes 8-12: DNA digested with serially diluted reaction supernatant
of in vitro transcription/translation reaction with added T7 RNA
polymerase. Lanes 3 & 8: 3 .mu.l reaction supernatant. Lanes 4
& 9: 1 .mu.l reaction supernatant. Lanes 5 & 10: 0.3 .mu.l
reaction supernatant. Lanes 6 & 17: 0.1 .mu.l reaction
supernatant. Lanes 7 & 12: 0.03 .mu.l reaction supernatant. The
expected sizes of products from a complete Sf.LAMBDA. digestion are
16,284, 12,891, 5,739 and 1,023 bp.
[0039] FIG. 3 is a diagram depicting the vector pLT7K used in the
stable cloning of genes encoding cytotoxic proteins of Examples IX
and X.
DETAILED DESCRIPTION OF THE INVENTION
[0040] In accordance with one preferred embodiment of the present
invention, there is provided a novel method for identifying a
restriction endonuclease. The first step of this method is to
compile a database of DNA sequences that encode either a DNA
methylase or a restriction enzyme. This can be accomplished by
searching GenBank for coding sequences that carry the annotation
"methylase", "methyltransferase", "modification methylase",
"restriction endonuclease" or "restriction enzyme". All such
sequences are collected and used as the master database of
restriction enzyme and methylase gene sequences, the "RM sequence
database". If desired, and if available, then other DNA sequences
known to encode DNA methylases or restriction endonucleases, not
present in GenBank, can be included in this master collection.
[0041] The second step is to take the new target sequence, say that
of a bacterial genome, and compare each open reading frame present
in that sequence against the RM sequence database. Preferably, this
is accomplished using the program BLAST (Altschul, S. F., Gish, W.,
Miller, W., Myers, E. W. and Lipman, D. J. Mol. Biol. 215: 403-410
(1990)) or other comparable searching routines, such as FASTA
(Pearson, W. and Lipman, D. Proc. Natl. Acad. Sci. USA 85:
2444-2448 (1988)). Each time that a significant match is found
between an open reading frame in the target sequence and a known
gene in the RM sequence database, it is examined more carefully. If
the match is to a restriction endonuclease gene, then that open
reading frame is likely to encode a restriction enzyme and it can
be investigated biochemically as detailed below. Where the matches
are to DNA methylase genes the matches are examined to see if the
short sequence motifs characteristic of cytosine-5 methylases
(Posfai, J. et al., Nucleic Acids. Res. 17:2421-2435 (1989);
Lauster, R. et al., J. Mol. Biol. 206:305-312 (1989)) or those
characteristic of N4C- or N6A-methylases (Wilson, G. G., Meth.
Enzymol. 216:259-279 (1992), Timinskas et al. Gene 157: 3-11
(1995)) are present. If they are, then it is concluded that the new
open reading frame in the target sequence is likely to encode a DNA
methylase. Because DNA methylases and their cognate restriction
endonucleases have usually been found to be encoded close to one
another (Wilson, G. G., Nucl Acids. Res. 19:2539-2566 (1991)), it
is of particular interest to examine the open reading frames that
flank this methylase gene to see if they can be considered new
restriction enzyme gene candidates.
[0042] The open reading frames that flank the newly identified
methylase gene are preferably first checked to see if they have
homologs in the RM sequence database. If one shows even weak
similarity to a known restriction enzyme gene, then it is
considered to be a prime candidate to encode a new restriction
endonuclease of the same specificity and it can be characterized
biochemically as described below. If the flanking sequences show no
similarity to any sequence in the RM sequence database, then they
are compared with the entire GenBank database to see if a match can
be detected to some other sequence. Again BLAST can be used for
this purpose. If they show a match to some gene of known function,
that is not a methylase or a restriction enzyme, then they can be
eliminated as a prime candidate for the restriction enzyme gene,
although it cannot be rigorously excluded in the absence of direct
biochemical evidence. If both flanking genes have good matches in
GenBank, then the original methylase gene is considered to be an
orphan methylase (i.e., a methylase which is not associated with a
cognate restriction endonuclease) that does not form part of a
restriction/modification system. In some instances, however, (see,
Example VI), the restriction endonuclease gene may be separated
from its cognate methylase by an intervening ORF, thus
necessitating analysis of ORFs upstream and downstream from the ORF
flanking the methylase gene. In this situation, adjacent ORFs
greater than about 100 amino acids (approximately 300 nucleotides)
should be examined. If this does not yield any candidate genes, the
examination should continue upstream and downstream to the next ORF
of greater than about 100 amino acids. This process should continue
up to about 3 kb on either side of the methylase gene. If either
one or both flanking open reading frames are unique (i.e. have no
homologs in GenBank) then they become candidates for new
restriction enzyme genes.
[0043] Once an open reading frame has been identified that is a
candidate for a restriction enzyme gene, a purely in vitro
procedure is preferably used to prepare a small sample of the
protein product of that open reading frame followed by testing of
the protein product for restriction enzyme activity, again in
vitro. In one preferred embodiment, whole genomic DNA from the
microorganism is prepared, and two PCR primers are synthesized. One
primer corresponds to a region that lies downstream (3') of the
stop codon of the open reading frame, contains about 20 nucleotides
complementary to the coding strand and an additional 10-15
nucleotides that contain a restriction enzyme recognition site not
found in the gene itself, in case later cloning is required. This
primer which is typically 30-35 nucleotides long, and is designed
to copy the non-coding strand.
[0044] The second primer is designed to produce the coding strand.
This second primer contains, close to its 5' prime end, a
restriction enzyme recognition site not found in the gene, followed
by a promoter site for a polymerase such as T7 RNA polymerase, a
ribosome binding site appropriate for the translation system being
used in the later step, and positioned so that translation will
begin with the first start codon of the open reading frame that is
the candidate for the restriction enzyme gene. Typically, about 20
additional nucleotides are present at the 3' end of this primer
that correspond to the first few codons of the open reading
frame.
[0045] These two primers are then used in a standard amplification
procedure such as the polymerase chain reaction (PCR) so that a
linear piece of DNA is produced, which contains a T7 promoter, a
ribosome binding site, and the complete open reading frame that is
the candidate for the restriction enzyme gene. This PCR product is
used as a template for transcription in vitro by T7 RNA polymerase.
This results in the production of a large amount of RNA containing
the complete coding sequence for the candidate open reading frame.
Either with or without further purification the RNA template
produced is then used as a template for translation in vitro using
a standard commercial translation system.
[0046] One preferred method of assaying for the presence of
endonuclease activity is in vitro transcription-translation using
the rabbit reticulocyte system. Another preferred method of
assaying for such endonuclease activity is the E. coli S-30
transcription-translation system.
[0047] In accordance with the present invention, it has been found
that a particularly preferred method for assaying for thermophilic
endonuclease activity is the wheat germ based translational
system.
[0048] When assaying for endonuclease activity it is often
necessary to incubate the translation product and substrate DNA at
a temperature that mimics the normal living conditions of the
organism from which the gene originated. When assaying a
translation product of an ORF that was amplified from a
thermophilic organism's genomic DNA the assay is usually incubated
at temperatures ranging from 50.degree. C. to 80.degree. C. It was
found that at temperatures above 50.degree. C. the reticulocyte
translational mix begins to congeal and endonuclease activity is
hard to detect. Although thermophilic endonucleases have been
identified using reticulocyte based translations, the wheat germ
translation mix does not congeal when heated in the same way and
hence is a more practical assay particularly for thermophilic
endonucleases.
[0049] Following translation, during which time a small amount of
the protein product from the candidate open reading frame will have
been produced, the entire translation mix is assayed for the
presence of the restriction enzyme using well established
techniques. (Schildkraut, "Screening for and Characterizing
Restriction Endonucleases", in Genetic Engineering, Principals and
Methods, Vol 6, pp. 117-140, Plenum Press (1984)). This may be
accomplished, for example, by taking a small portion of the
translation mix and incubating it with several substrate DNAs such
as those from bacteriophage .lambda., bacteriophage T7,
Adenovirus-2, etc. that are likely to contain one or more
recognition sites for the restriction enzyme. Typically, the assays
are allowed to run from 30 minutes to 16 hours. The whole mix is
then applied to an agarose gel where DNA fragments separate
according to size. If a restriction enzyme is present in the
translation mix, then usually that restriction enzyme will cleave
one of the test substrate DNAs, leading to the banding pattern that
is typical of restriction endonucleases. If bands are detected,
then the specificity of the restriction enzyme can be determined
using standard procedures. (Schildkraut, supra (1984)).
[0050] Another preferred method for identifying the restriction
enzyme encoded by a candidate gene involves first cloning the
candidate open reading frame, together with its adjacent methylase
gene into an appropriate host cell such as E. coli. For this
purpose, PCR primers may be chosen so as to amplify the complete
coding sequences for both methylase and restriction enzyme genes.
These may be placed into a standard expression vector such as
pUC19, and the resulting transformants would be tested for
restriction endonuclease using standard procedures. Briefly, a
small sample of each clone is grown. The cells may be harvested and
sonicated to prepare a crude cell lysate. Following centrifugation
to remove cell debris, the supernatant may be tested for
restriction endonuclease activity by incubation of small samples
with various DNAs as described above.
[0051] It is conceivable that either the methylase gene and/or the
endonuclease gene might be lethal in the host cell, in which case
the frequency of transformants from the PCR product, would be
abnormally low. In those circumstances, another approach is
possible. Specifically, PCR may be used to amplify the methylase
gene in the absence of its flanking sequences, and this gene may be
cloned into an appropriate host cell such as E. coli. In this case,
the transformants may be tested for methylase activity using a
standard assay in which a crude extract from the clone and an
appropriate DNA substrate such as those from bacteriophage
.lambda., bacteriophage T7, Adenovirus-2, etc. would be incubated
with [.sup.3H]-S-adenosylmethionine. The incorporation of [.sup.3H]
into DNA may then be monitored by scintillation counting. The
successful cloning of an active methylase gene may be detected if
the crude extract can transfer .sup.3H counts into DNA. If
methylase clones are successfully obtained, then such clones may be
expected to protect the host E. coli DNA against the possible
deleterious action of the restriction endonuclease. An appropriate
host cell which harbors the methylase clone may then be used as a
recipient in a second cloning experiment, to obtain the
endonuclease gene. This may be obtained by its amplification by PCR
and cloning into a second compatible vector plasmid. As before,
transformants may be tested for the presence of active restriction
endonuclease.
[0052] The present invention also relates to multipurpose cloning
vectors and their use in cloning and/or in vitro and/or in vivo
transcription and/or translation of nucleic acid segments that may
be cytotoxic and/or may produce cytotoxic products.
[0053] (1) A nucleic acid segment constituting an ORF is isolated
and/or acquired by standard molecular biological methods. This may
be undertaken so as to either maintain, or selectively alter the
native sequence context of the coding region. The native sequence
of the first (ATG, GTG, or TTG), or last (TAA, TAG, TGA) codon may
be maintained or selectively altered in order to modulate
translational efficiency, and/or provide for translational
fusion.
[0054] In a preferred method, a nucleic acid segment (ORF) is
recombined by standard molecular cloning techniques into a plasmid
having the following properties:
[0055] i) oppositely oriented (convergent) transcriptional
promoters, providing for sense-, anti-sense, and/or bidirectional
transcription, flanking the inserted DNA segment. Preferably, the
promoters will be cognate substrates for nonidentical RNAPs, and
will not functionally substitute for RNAPs for which they are not
cognate substrates. To provide for transcription of a particular
strand of the inserted DNA segment, the vector preferably possesses
a promoter that is a substrate for a host cell RNAP, such as the E.
coli .sigma.70 RNAP promoter, .lambda.P.sub.L or P.sub.R. In
addition, to provide for transcription of the complementary strand
of the inserted DNA segment, the vector of the present invention
preferably possesses a promoter that is a substrate for a non-host
cell RNAP, such as bacteriophage T7 RNAP promoter, P.sub.T7.
[0056] ii) the opposing promoters will contain sequences
(operators) providing for binding of transcriptional repressor
proteins (repressors). Preferably, the operators will be cognate
ligands for nonidentical repressors, and will not functionally
substitute for repressors for which they are not cognate ligands.
To provide for transcriptional repression of a particular sequence
of the inserted DNA segment, the vector preferably possesses an
operator, such as O.sub.lac, that is a ligand for a repressor such
as E. coli LacI. In addition, to provide for transcriptional
repression of the complementary sequence of the inserted DNA
segment, the vector preferably possesses an operator, such as
O.sub.cl, that is a ligand for a repressor, such as bacteriophage
.lambda.cl857.
[0057] iii) to modify the degree of transcription of a particular
sequence of the inserted DNA segment, the cognate
operator:repressor binding interactions may be selectively and
independently manipulated. Preferably, conditions that affect one
operator:repressor binding interaction, will not detectably affect
the other, and vice versa. To alleviate transcriptional repression
via destabilization of an operator:repressor binding interaction,
such as O.sub.lac:P.sub.T7, a synthetic chemical compound, such as
isopropyl-thio-.beta.-D-galactopyran- oside (IPTG) is used. In
addition, to alleviate transcriptional repression via
destabilization of an operator:repressor binding interaction, such
as O.sub.cl:cl857, permissive and non-permissive temperatures are
employed.
[0058] iv) to provide for its selective maintenance in cultured
cells, the vector preferably possesses a genetic element specifying
an antibiotic resistance phenotype, such as a .beta.-lactamase
allele.
[0059] v) to provide for the persistence of a desired embodiment,
the vector preferably possesses genetic elements capable of
directing its episomal and/or intrachromosomal replication, such as
the replicative origin of pBR322 (Bolivar, et al., Gene, 2:95-113
(1977)).
[0060] One especially preferred plasmid is pLT7K (see FIG. 3). The
segment encoding replicative functions (encoded by rop and ori) is
derived from pBR322 (Bolivar, et al., supra (1977)). The gene
encoding .beta.-lactamase (bla) confers ampicillin resistance, and
has been altered to remove a recognition site for the PstI
restriction endonuclease. The gene encoding kanamycin resistance is
flanked by restriction sites suitable for cloning. The cl857 gene
encodes a mutant form of the repressor protein, cl857 (Horiuchi and
Inokuchi, Journal of Molecular Biology, 23(2):217-224 (1967)). The
cl857 protein conditionally binds to DNA sequences (the cl
operators, or O.sub.cl) that overlap P.sub.R (bacteriophage
.lambda. major rightward promoter). The lacI gene encodes a
repressor protein, LacI, that conditionally binds a DNA sequence
(the lac operator, or O.sub.lac) which has been constructed to
overlap P.sub.T7 (bacteriophage T7 RNA polymerase transcriptional
promoter). The segment containing .lambda. cl857 and P.sub.R was
subcloned from the pGW7 (Geoffrey Wilson, New England Biolabs,
Inc.) derivative, pJIH1 (gift of R. E. Webster, Duke
University).
[0061] All of the genetic elements mentioned above are specified by
sequences present on the plasmid. Transcription from P.sub.R
proceeds towards P.sub.T7, whereas transcription from P.sub.T7
proceeds towards P.sub.R. Transcription from P.sub.R is dependent
upon the endogenous E. coli RNA polymerase, whereas from P.sub.T7
it is dependent upon expression of an RNAP derived from
bacteriophage T7.
[0062] (2) The resulting construction is transformed into an
appropriate host cell such as E. coli strain under conditions
intended to disallow undesired expression of the insert DNA, as
specified in Example IX. Transformants are randomly selected for
small-scale plasmid DNA preparation. The plasmid DNA is analyzed by
restriction enzyme digestion for a banding pattern consistent with
the desired clone. A sampling of clones exhibiting the appropriate
restriction pattern is sequenced across the insertion site and
compared to the original database entry.
[0063] Clones that pass these examinations are transformed into an
E. coli strain carrying two distinct RNAPs whose relative
transcriptional efficiency can be simultaneously and independently
modulated in an elective manner. Transformation and colony
selection are carried out as above. Selected colonies are grown in
liquid culture conditions intended to disallow expression of the
insert DNA. Culture conditions may be subsequently altered so as to
favor expression of the insert DNA. (See, e.g., Example IX.)
[0064] In a particularly preferred embodiment, the cl857 protein,
which is a temperature sensitive mutant of the cl repressor, is
used to control P.sub.R-directed transcription by the host RNAP.
The degree of O.sub.cl occupation by cl857 can be modulated by the
temperature of the bacterial culture conditions. At
.about.30.degree. C. (permissive temperature), cl857 can bind
O.sub.cl and effectively repress transcription from P.sub.R.
However at .about.37.degree. C. (non-permissive), cl857 cannot
stably bind, and transcription from P.sub.R by the host RNAP is
enabled.
[0065] In one preferred embodiment, a plasmid host strain carrying
genetic elements allowing for elective induction of an exogenous
RNAP, such as E. coli strain ER2566 is used. ER2566 carries a gene
encoding T7 RNAP (T7g1) inserted into the chromosomal lacZ locus,
expression of which is repressed by LacI. Addition of IPTG to an
ER2566-pLT7(x) (wherein "x" designates a specific construction
derived from pLT7K) culture will: (1) alleviate LacI mediated
repression of the lac operon and promote expression of T7 RNAP by
the host RNAP; and (2) alleviate LacI occupation of the
plasmid-borne O.sub.lac site, thereby enabling transcription from
P.sub.T7 by T7 RNAP.
[0066] The O.sub.lac: LacI interaction is not significantly
affected by temperature, nor is the O.sub.cl: cl857 interaction
affected by the presence of IPTG. In the most preferred embodiment,
operator:repressor interactions such as these can be simultaneously
and independently manipulated, subsequently affecting
transcriptional efficiency from respective promoters, such as
P.sub.T7 and P.sub.R. Since the DNA sequences encoding the
repressor proteins and operators are in cis, the molar ratio of
repressor alleles to their respective operator sites is essentially
equivalent to their normal chromosomal ratio. Thus, one may expect
the desired repressor:operator interactions to quantitatively
reflect wild-type interactions.
[0067] The location and relative orientation of the plasmid-borne
repressor alleles enables very tight regulation of expression from
the desired promoter. For instance, in the unanticipated event that
LacI levels drop below some critical threshold for O.sub.lac
occupation (under culture conditions intended to favor expression
from P.sub.R, but not P.sub.T7), lad could be expressed by virtue
of readthrough transcription originating from P.sub.R, in addition
to its own promoter. This would increase the level of lad
transcript and concomitant expression of the LacI repressor
protein. The same scenario applies to cl857 expression from
P.sub.T7 (see FIG. 3). Thus, strong positive regulation of the
desired repressor:operator interaction has been built in to the
system.
[0068] If desired, expression can be further controlled by either
eliminating, or independently inhibiting either of the RNAPS. T7
RNAP, for example, can be physically excluded by using an E. coli
strain that does not encode it. If a T7 RNAP allele is present, its
adventitious expression can be mitigated by including a plasmid
encoding coliphage T7 lysozyme, such as pLysP (gift of W. F.
Studier, Brookhaven National Laboratory). T7 lysozyme interacts
stoichiometrically with T7 RNAP and prevents the polymerase from
effectively extending transcripts from PT7. Addition of IPTG to the
culture medium promotes the generation of sufficient amounts of T7
RNAP to overcome inhibition by T7 lysozyme. E. coli RNAP can be
inhibited by the addition of the antibiotic rifampicin to the
culture medium. T7 RNAP is not sensitive to rifampicin, nor is E.
coli RNAP known to be affected by either IPTG or T7 lysozyme. Thus,
transcription catalyzed by the respective RNAPs can be
simultaneously and independently modulated.
[0069] (3) Cultures are harvested by centrifugation and sonicated
to produce a crude lysate. Following centrifugation to remove cell
debris, the supernatant is tested for biochemical activity, as
appropriate. In the case of restriction endonuclease activity, the
supernatant is incubated with various DNAs as described above.
[0070] The stabilization of a nucleic acid segment in a vector such
as pLT7K allows for sequence verification, mutagenesis, and
expression. This solves the following shortcomings of in vitro
transcription/translation (txn/tln) of a comparatively ephemeral
PCR product:
[0071] (a) A negative result cannot be unambiguously interpreted as
the absence of a desired biochemical activity because: i) the lack
of an internal positive control precludes discrimination between a
technical failure and no activity; II) the protein may not be
sufficiently stable to survive the assay; III) the protein may not
be produced in sufficient quantity to generate a detectable signal
in the assay; iv) the protein may not have sufficient specific
activity to generate a detectable signal in the assay; v) the
protein may not be active in the txn/tln extract; vi) there may be
inactivating mutations in the genomic DNA from which the candidate
PCR product is amplified, and; VII) propagation of early PCR errors
may negatively affect signal detection in the assay;
[0072] (b) The PCR product is consumed as a function of the assay
and must be regenerated as needed, with two significant
consequences: i) it consumes genomic DNA (the source of all the
candidate loci), which can be problematic if the DNA is difficult
to obtain as has been the case for Methanococcus jannaschii; ii)
more importantly, the candidate ORF may not yield detectable
activity because of the accumulation of one or more down mutations
in its nucleic acid sequence. Even if such a mutation is
identified, it may only be mutable if within the sequence
encompassed by the PCR primers. If outside this region, ORF
sequences are essentially immutable, and the gene product, if any,
cannot be biochemically characterized with this approach.
[0073] In yet another preferred embodiment of the present
invention, the original microorganism from which the DNA sequence
has been obtained may be grown up, crude extracts prepared, and
tested for restriction endonuclease activity in the usual way
described above. In the event that restriction endonuclease
activity is found, then it may be related to the gene coding for it
in several ways. First, if methylase clones are active, then they
may be tested directly to see if the DNA from the cloned plasmid is
resistant to the action of the restriction endonuclease, suggesting
that they have matching specificities and so form part of the same
restriction-modification system. Alternatively, the endonuclease
may be purified to homogeneity, some N-terminal or other protein
sequence obtained, and the protein sequence compared with the
predicted protein sequence from the original sequenced gene.
[0074] The following Examples are given to illustrate embodiments
of the present invention, as it is presently preferred to practice.
It will be understood that these Examples are illustrative, and
that the invention described herein is not to be considered as
restricted thereto except as indicated in the appended claims.
[0075] The references cited above and below are herein incorporated
by reference.
EXAMPLE I
MjaI Restriction Endonuclease
[0076] The restriction endonuclease MjaI, from Methanococcus
jannaschii, has previously been characterized biochemically and
shown to recognize the sequence CTAG (Zerler, B., Myers, P. A.,
Escalante, H. and Roberts, R. J. cited in REBASE--see Roberts, R.
J. and Macelis, D. Nucl. Acids Res. 26: 338-350 (1998)), but the
gene had not been cloned. With the recent determination of the
complete sequence of the M. jannaschii genome (Bult et al. Science
273: 1058-1073 (1996)) the sequence was searched using the BLAST
program (Altschul, et al. J. Mol. Biol. 215: 403-410 (1990)) to
identify candidate restriction enzyme and methylase genes. In
brief, all open reading frames in the sequence were compared with
the RM sequence database that contained the published sequences of
all DNA methylases and restriction endonucleases that had been
compiled from entries in GenBank. Each match against an entry in
this database was recorded and the corresponding region of the M.
jannaschii genome was examined to determine if the hit could be
part of a restriction-modification system. Typically, most good
hits were between a known DNA methylase gene and an open reading
frame present in the M. jannaschii genome.
[0077] By using BLAST it was found that one open reading frame
(MJ0985) showed great similarity to a known DNA methylase gene,
encoding M.MthZI, a methylase which forms part of a
restriction-modification system in Methanobacterium
thermoformicicum that recognizes the sequence CTAG (Nolling, J. and
deVos, W. M., Nucl. Acids Res. 20: 5047-5052, (1992); Nolling, J.,
Van Eeden, et al., Nucl. Acids Res. 20: 6501-6507 (1992)). The
regions of similarity included the motifs characteristic of an N4C-
or N6A-methylase (Wilson, G. G., Meth. Enzymol. 216:259-279 (1992),
Timinskas et al. Gene 157:3-11 (1995)). Immediately adjacent to
this M. jannaschii putative methylase gene was another open reading
frame, MJ0984, that resembled the gene encoding the restriction
enzyme MthZI. This open reading frame, which had never previously
been investigated biochemically, was tested for its coding
potential using the method disclosed in accordance with the present
application. This Example documents the identification of an active
restriction endonuclease from a previously unknown DNA
sequence.
[0078] DNA from M. jannaschii, was a gift from G. Olson, University
of Illinois, Urbana. The open reading frame, MJ0984, predicted to
encode the MjaI restriction endonuclease comprised residues
4687-5355 of the GenBank entry U67541.
[0079] Primers were selected with the following sequences:
3 (SEQ ID NO:1) 5'-pGTTTAATACGACTCACTATAGGGTTAGGAGGTATTACAT
(A)TGGTGAAACTTATGAAAAAATTG-3'
[0080] Note that the marked (A) is a G in the original genome. It
was changed to an A to ensure a better translational start. This is
the start codon of the open reading frame. Sequences preceding the
(A) are not present in the genome, but contain the T7 RNA
polymerase promoter sequence and a good ribosome binding site.
4 (SEQ ID NO:2) 5'-pGTTGGATCCGCAAAAAAGAATAGGAATGGATTTTAATG-- 3'
[0081] These primers were first used to prepare an amplified sample
of the region of the M. jannaschii genome containing the MJ0984
open reading frame. The MJ0984 open reading frame was amplified
from genomic M. jannaschii DNA in three PCR reactions (80 .mu.l
each) that contained 0.4 mM each of the four dNTPs, 0.02 .mu.g M.
jannaschii genomic DNA, 0.4 .mu.M primer 1, 0.4 .mu.M primer 2, 1.2
units Vent.RTM. DNA polymerase and either 3 mM, 4.5 mM or 6 mM
MgSO.sub.4 in 1.times.NEB ThermoPol buffer. The reaction was heated
to 95.degree. C. for three minutes, and then 5 cycles of
amplification at 95.degree. C. for 30 seconds, followed by
52.degree. C. for 30 seconds, followed by 72.degree. C. for 45
seconds were performed, followed by 20 cycles at 95.degree. C. for
30 seconds, 62.degree. C. for 30 seconds and 72.degree. C. for 45
seconds. 10 .mu.l of each PCR reaction was analyzed by gel
electrophoresis, and a prominent band of the expected size was
observed in the 4.5 mM and 6 mM MgSO.sub.4 reactions. These two
reactions were combined, extracted with phenol/chloroform, washed
in an Amicon Microcon-100 microfiltration device by four serial
20-fold dilution and concentration steps into TE buffer and the
final 40 .mu.l of concentrated product was stored at 4.degree.
C.
[0082] The same primers, 1 and 2, were then used in a set of 24 PCR
reactions (100 .mu.l each) that contained 0.8 mM each of the four
dNTPs, 0.01 .mu.g pre-amplified M. jannaschii DNA described above,
0.5 .mu.M primer 1, 0.5 .mu.M primer 2, and 2 units Vent.RTM. DNA
polymerase (New England Biolabs, Inc., Beverly, Mass.) in
1.times.NEB ThermoPol Buffer. The reaction mix was heated at
95.degree. C. for three minutes, and then subjected to 25 rounds of
PCR, incubating at 95.degree. C. for 30 seconds, 46.degree. C. for
30 seconds, 72.degree. C. for 50 seconds. Finally the reaction was
incubated at 30.degree. C. for two minutes. The crude mixture from
the PCR reactions was then combined and purified. First a standard
phenol/chloroform extraction was carried out to remove protein and
the DNA was precipitated with isopropanol and then spun at 9,000
rpm for 7 mins in the microfuge through Microcon 50 filters. The
concentrated PCR product 300 .mu.g/ml was collected at 2,000 rpm
for 5 min. The product was checked on a 1% agarose gel.
[0083] The transcription and translation of the putative MjaI gene
was performed using a rabbit reticulocyte Protein Truncation Kit
(Boehringer Mannheim). The PCR product 0.4 .mu.g (2 .mu.l),
transcription mix (2.5 .mu.l) and 5.5 .mu.l of RNase free water
were incubated at 30.degree. C. for 30 min. The translation mix (40
.mu.l) was added and incubated at 30.degree. C. for 1 hr. The
transcription/translation mix was then tested for newly-formed
restriction enzyme activity corresponding to the formation of
MjaI.
[0084] Serial dilutions were performed by mixing 2 .mu.l, 1 .mu.l,
0.5 .mu.l, 0.25 .mu.l translation product per 20 .mu.l final
reaction volume in 1.times.NEB buffer 4 (50 mM potassium acetate,
20 mM Tris-acetate, 10 mM Magnesium acetate, 1 mM dithiothreitol,
100 .mu.g/ml BSA) containing 25 .mu.g/ml substrate DNA. The
reactions were incubated at 37.degree. C. overnight. The reactions
were run on a 1.0% agarose gel. As a positive control Bfa I (20
units, New England Biolabs, Inc.), an isoschizomer of MjaI, was
used to cut the substrate DNA under the same reaction conditions.
As a negative control the DNA was incubated with the
transcription/translation mix to which no template DNA (PCR
product) had been added.
[0085] The agarose gel results showed that the test DNA was
digested by the translation/transcription mix only when that mix
had been primed with PCR product from the putative MjaI-encoding
plasmid DNA. The banding pattern produced was identical to that
produced by BfaI (FIG. 1, lanes 2 and 4). A double digest between
MjaI and BfaI gave no additional bands (FIG. 1, lane 3). These
results allow the identification of the open reading frame present
in the starting plasmid as encoding MjaI restriction
endonuclease.
EXAMPLE II
HhaI Restriction Endonuclease
[0086] The genes encoding the restriction endonuclease and
methylase of the HhaI system have previously been cloned and
sequenced (U.S. Pat. No. 4,999,293). Examination of the sequence
showed a characteristic 5-methyl cytosine gene followed by an open
reading frame on the complementary strand that was known to be the
HhaI restriction endonuclease. This system was used as a test to
show that it would be possible to make a sufficient quantity of the
restriction enzyme in vitro to allow its detection using standard
procedures.
[0087] First, plasmid DNA encoding the HhaI restriction system was
prepared from E. coli NEB691 (New England Biolabs). The E. coli
cells containing the recombinant plasmid were incubated in 10 ml LB
in a roller at 37.degree. C. overnight. Cells were pelleted at
4,000 rpm for 30 sec at 4.degree. C. and the supernatant was
discarded. The pellet was resuspended in 1 ml 1.times.GTE (50 mM
glucose, 25 mM Tris.HCl, 10 mM EDTA, pH 8.0) and lysed by adding
0.2 M NaOH, 1% SDS (2 ml). The precipitate was spun for 3 min at
15,000 rpm at 4.degree. C. and the supernatant was transferred to a
clean centrifuge tube. Isopropanol was added to the supernatant and
it was incubated on ice for 10 min. The mixture was spun at 15,000
rpm for 5 min at 10.degree. C. and the supernatant was discarded.
The pellet was dried and resuspended in 100 .mu.g/ml pancreatic
RNase in 850 .mu.l 1.times.TE (10 mM Tris.HCl, 1 mM EDTA, pH 8.0).
The reaction was incubated at room temp. for 1 hour and spun at
14,000 rpm at 4.degree. C. for 5 min. The supernatant was discarded
and the pellet was resuspended in 100 .mu.l 1.times.TE. The product
was checked on a 1% agarose gel.
[0088] Primers were synthesized with the following sequences:
5 (SEQ ID NO:3) 5'-pTAATACGACTCACTATAGGGAATAATTTTGTTTTAACTT- TAA
GAAGGAGAATGAAAATGAATTGGAAAG-3' 5'-pCAATTATAAAGAAATAGCTGCC-3' (SEQ
ID NO:4)
[0089] These primers were used in a set of 24 PCR reactions (100
.mu.l each) that contained 0.8 mM each of the four dNTPs, 0.1 .mu.g
plasmid DNA, 0.5 .mu.M primer 3, 0.5 .mu.M primer 4, and 2 units
vent DNA polymerase in 1.times.NEB ThermoPol Buffer. The reaction
mix was heated at 95.degree. C. for three minutes, and then
subjected to 25 rounds of PCR, incubating at 95.degree. C. for 30
seconds, 46.degree. C. for 30 seconds, 72.degree. C. for 50
seconds. Finally the reaction was incubated at 30.degree. C. for
two minutes. The PCR reactions were then combined,
phenol/chloroform extracted and the DNA was precipitated and
resuspended in 1.times.TE at 300 .mu.g/ml.
[0090] The transcription and translation of the HhaI gene PCR
product was performed using a rabbit reticulocyte Protein
Truncation Kit (Boehringer Mannheim). The PCR product 0.6 .mu.g (2
.mu.l), transcription mix (2.5 .mu.l) and 5.5 .mu.l of RNase free
water were combined and incubated at 30.degree. C. for 30 min. The
translation mix (40 .mu.l) was added and incubated at 30.degree. C.
for 1 hr. The transcription/translation mix was then tested for
newly-formed restriction enzyme activity corresponding to the
formation of HhaI.
[0091] Serial dilutions were performed by mixing 2 .mu.l, 1 .mu.l,
0.5 .mu.l, and 0.25 .mu.l transcription/translation product per 20
.mu.l final reaction volume in 1.times.NEB buffer 4 containing 25
.mu.g/.mu.l substrate DNA. The reactions were incubated at
37.degree. C. for one hour. The reactions were analyzed on a 1.0%
agarose gel. As a positive control authentic Hha I (20 units, New
England Biolabs, Inc.) was used to cut the substrate DNA under the
same reaction conditions. As a negative control the DNA was
incubated with the transcription/translation mix to which no
template DNA (PCR product) had been added. The agarose gel results
showed that the substrate DNA was digested by the
translation/transcription mix only when that mix had been primed
with the HhaI endonuclease PCR product. The banding pattern
produced was identical to that produced by HhaI, thus demonstrating
the utility of the in vitro transciption/translation system to
product an active identifiable restriction endonuclease.
EXAMPLE III
A 2nd Putative New Restriction Endonuclease from M. jannaschii (ORF
1328-GTNNAC, MjaIV)
[0092] Another of the open reading frames that showed a good match
to a known methylase gene was MJ1328. This gene is similar to the
gene for M.HincII, which recognizes the sequence GTYRAC. The open
reading frame immediately preceding MJ1328 shows some low
similarity to the gene for the HincII restriction enzyme and so is
a good candidate for a new restriction enzyme of the same or
related specificity. This open reading frame, MJ1327, comprises
residues 1748-2485 of GenBank entry U67573. However, because M.
jannaschii is a thermophile that normally grows at high
temperatures, this new putative restriction enzyme encoded by the
open reading frame MJ1327 may be anticipated to work at much higher
temperatures than HincII, isolated from the mesophile Haemophilus
influenzae serotype c (Landy et al. Biochemistry 13: 449-456,
1974).
[0093] The ORF designated MJ1328 by TIGR (The Institute for Genomic
Research), which comprises residues 3148 to 4044 of GenBank entry
U67573, contains only the 3' portion of the believed methylase
gene, which complete methylase gene would be found from position
2472 to 4044 of GenBank sequence U67573, with a frameshift present
between positions 3148 and 3305. The 5' portion of this ORF, that
not contained in the TIGR designation, contains the methylase
motifs (GxGxF and NPPY), while the whole has homology to
M.HincII.
[0094] To characterize MJ1327, the ORF was PCR amplified from
genomic M. jannaschii DNA using the following two oligonucleotides
as primers:
[0095] forward (coding strand) primer, having a BamHI cloning site,
T7 promoter sequence, and NcoI cloning site:
6 (SEQ ID NO:7) 5'-GTTGGATCCTAATACGACTCACTATAGGAACAGACCACCA- TGGTG
GTAAAATTGGTTAATAAC-3'
[0096] reverse primer having a BamHI cloning site:
7 (SEQ ID NO:8) 5'-GTTGGATCCGATTGTAGAAAGATTTATCATTAATTC-3'
[0097] The PCR reaction was performed by combining: 20 .mu.l
10.times.NEB ThermoPol Buffer (NEB), 16 .mu.l dNTP solution (4 mM),
15 .mu.l forward primer (10 .mu.M), 15 .mu.l reverse primer (10
.mu.M), 135 .mu.l dH2O, 1.5 .mu.l M. jannaschii genomic DNA (100
ng) mixing,
[0098] then adding:
[0099] 4 .mu.l Vent.RTM. exo-DNA polymerase, 1 .mu.l Vent.RTM. DNA
polymerase, dividing into 5 tubes of 40 .mu.l each, adding 0.4,
0.8, 1.2, 1.6 .mu.l 100 mM MgSO4 solution to one tube each to
create reactions of 2, 3, 4, 5 and 6 mM Mg++ concentrations.
[0100] These five tubes were incubated at 95.degree. C.--2 min for
one cycle, 95.degree. C.--30 sec, 52.degree. C.--30 sec, 72.degree.
C.--1 min 15 sec for 5 cycles, then 95.degree. C.--30 sec,
58.degree. C.--30 sec, 72.degree. C.--1 min 15 sec for 27
cycles.
[0101] Product was observed in the 4 and 5 mM Mg++ reactions. The
product obtained was used as template and 15 more cycles of
amplification in a 500 .mu.l reaction as above was performed to
obtain a larger quantity of PCR product. The amplified DNA was
phenol/chloroform extracted and alcohol precipitated, then cleaved
with BamHI, phenol-chloroform extracted, alcohol precipitated,
resuspended in TE and ligated to pUC19 DNA previously cleaved with
BamHI and dephosphorylated. The ligated product was transformed
into E. coli ER2170 cells by electroporation, and the transformed
cells were grown in LB broth+100 .mu.g/ml ampicillin overnight. A
sample of these transformed cells, E. coli ER2170-pUC-MjaIV, was
deposited under the terms and conditions of the Budapest Treaty
with the American Type Culture Collection on Sep. 1, 1998 and
received ATCC Accession No. 98860.
[0102] The cells were then harvested by centrifugation, resuspended
in sonication buffer (20 mM Tris, 1 mM DTT, 0.1 mM EDTA, pH 7.5),
lysed by sonication and the extract was clarified by
centrifugation. This crude extract was assayed for restriction
activity using .lambda. DNA in NEBuffer 4. Specific cleavage of
.lambda. was observed and the restriction activity was purified by
passing the crude extract through a heparin-sepharose column and
step eluting the column with 0.5M and 1 M NaCl in sonication
buffer. The purified restriction activity was mapped on pBR322,
.phi.X174 and M13 mp18 DNAs, and the cleavage pattern was found to
be consistent with cleavage at the sequence 5'-GTNNAC-3'. This new
endonuclease was named MjaIV. The cleavage position within the
recognition sequence was determined by the primer extension method
using M13 mp18 and primer NEB #1224 and found to be
5'-GTN.dwnarw.NAC-3', cleaving between the 2 N residues to produce
blunt ends.
[0103] The HincII sequence, 5'-GTYRAC-3', originally postulated for
this restriction system, is a subset of the actual recognition
sequence of MjaIV, thus explaining the homology noted previously
between MJ1328 and the gene for M.HincII and MJ1327 and the gene
for HincII.R.
[0104] MjaIV methylase (ORF MJ1328 plus 5' end) will be put into an
appropriate vector and expressed in E. coli to protect the E. coli
host DNA from degradation by the MjaIV endonuclease, which will be
cloned into a strongly expressing, regulated vector, such as pET21
(T7) or pRRS. The MjaIV endonuclease may then be produced by
culturing the host carrying the gene for MjaIV, inducing with
appropriate conditions, harvesting the cells and purifying the
MjaIV endonuclease by a combination of standard protein
purification techniques.
EXAMPLE IV
A 3rd Putative New Restriction Endonuclease from M. jannaschii (ORF
1449-GGNCC, MjaII)
[0105] Another of the open reading frames that showed a good match
to a known methylase gene was MJ1448. This gene is quite similar to
the gene for M.MvaI, which recognizes the sequence CCWGG. At the
time of the original analysis, the open reading frames on both
sides of MJ1448 had no matches either to known restriction enzyme
genes or to any other open reading frames present in GenBank. One
of these was likely to be a restriction enzyme gene, and so both
were tested using the methods of Example I.
[0106] To test which of these open reading frames was the putative
new restriction enzyme, a detailed protocol similar to that of
Example I was employed. The segment of the genome of M. jannaschii
containing the open reading frame MJ1447 comprising residues
8643-9788 of GenBank entry U67585 was amplified using the following
PCR primers:
8 (SEQ ID NO:9) 5'-GTTTAATACGACTCACTATAGGGTTAGGAGGTATTACAT(- A)TG
ATAAAATTTGGAGAAGCAGTTTTG-3'
[0107] Note that the marked (A) is the start codon of the open
reading frame. Sequences preceding the (A) are not present in the
genome, but contain the T7 RNA polymerase promoter sequence and a
good ribosome binding site.
9 (SEQ ID NO:10) 5'-GTTGGATCCGTGTAAAGTTTTTTTGCTGGCTG-3'
[0108] The product of this open reading frame were tested in a
manner similar to that of Example I and was found not to be
enzymatically active at cleaving DNA.
[0109] The candidate ORF MJ1449 was identified as outlined above.
The segment of the genome of M. jannaschii, comprising residues
complementary to 11380-12492 in GenBank entry U67585, was amplified
by PCR using the following two oligonucleotides as primers:
10 (SEQ ID NO:11) 5'-CCTCCTCTAGAAGAAGGAGATATACCATGCCACTAAGT- AAAA
ATGTTATAG-3' (SEQ ID NO:12)
5'-GGAGGGATCCTCGAGCGCTTGACTGAATAGTTATTTTTGCAT
ATATTTATTGTATAATTC-3'
[0110] Using the protocol described in Examples IX and X below, ORF
MJ1449 was stably cloned in DH5.alpha.F' and the construction
designated pLT7-M1449. When transformed into ER2566P (where "P"
indicates the presence of pLysP), the protein expressed from this
construct exhibited an activity consistent with that of a
restriction endonuclease cleaving the sequence GGNCC, at an assay
temperature of 65.degree. C. A sample of these transformed cells,
E. coli ER2566P pLT7-M1449, was deposited under the terms and
conditions of the Budapest Treaty with the American Type Culture
Collection on Sep. 1, 1998 and received ATCC Accession No.
202168.
[0111] This activity was previously detected biochemically from
crude lysates of M. jannaschii, and designated R. MjaII, but the
gene was unknown. Induction of pLT7-M1449 at 37.degree. C. was
lethal, indicating that the protein is also active at this
temperature.
EXAMPLE V
Expression of R.Sf.LAMBDA. in a Coupled Transcription/Translation
System from E. coli
[0112] The restriction endonuclease SfiI from Streptomyces
fimbriatus, recognizing the octanucleotide sequence
5'-GGCCNNNN.dwnarw.NGGCC-3', (SEQ ID NO:13) has been cloned and
overexpressed in E. coli (U.S. Pat. No. 5,616,484). The
overexpression construct (Sfi4-2) consists of the Sf.LAMBDA. DNA
methyltransferase expressed on the vector pACYC184, under control
of its own promoter, and the Sf.LAMBDA. endonuclease expressed on a
pUC19 derivative containing a T7 promoter, such that the gene is
under control of either the Plac promoter or the T7 promoter.
Plasmid DNA was purified from a 4 liter culture of E. coli ER1451
(Elisabeth Raleigh, New England Biolabs, Inc., Beverly, Mass.)
harboring both plasmids using the alkaline lysis method followed by
isopycnic banding in two successive cesium chloride gradients to
remove all traces of contaminating chromosomal DNA.
[0113] An S-30 extract was prepared from a 10-liter culture of E.
coli strain D-10 (rna-10, relA1, spoT1, metB1; Gesteland, R. F., J.
Mol. Biol. 16:67 (1966)), an RNase I-deficient K-12 derivative, as
described (Ellman, et al., Methods Enzymol. 202:301-336
(1991)).
[0114] In vitro protein synthesis reactions (30 .mu.l final volume)
contained the following: 56.4 mM Tris-acetate, pH 7.4; 1.76 mM
dithiothreitol; 36 mM ammonium acetate; 72 mM potassium acetate;
9.7 mM calcium acetate; 6.7 mM magnesium acetate; 1.22 mM ATP (Na),
0.85 mM each of GTP (Na), CTP (Na), and UTP (Na); 27 mM potassium
phosphoenol pyruvate; 0.35 mM each of the 20 amino acids; 19 mg/ml
polyethylene glycol 8000; 35 mg/ml folinic acid; 27 mg/ml
pyridoxine-HCl; 27 mg/ml NADP; 27 mg/ml FAD; 11 mg/ml
p-aminobenzoic acid; 170 mg/ml E. coli tRNA; 100 .mu.g/ml Sfi4-2
plasmid DNA; 25000 U/ml T7 RNA polymerase (where indicated) and 8.5
.mu.l S-30 extract. Reactions were incubated at 37.degree. C. for 1
hour on a rotary shaker (200 rpm), cooled to 0.degree. C., and
centrifuged 1 minute to pellet precipitated proteins.
[0115] The reaction supernatants were then assayed for SfiI
activity in 25 .mu.I reactions containing 1 .mu.g Adenovirus-2
genomic DNA (35,937 bp) in NEBuffer 2 (10 mM Tris-HCl, pH 7.9, 50
mM NaCl, 10 mM MgCl.sub.2, 1 mM DTT), 100 .mu.g/ml BSA, and
three-fold serial dilutions (in NEBuffer 2) of the in vitro
reaction supernatant. Reactions were incubated at 50.degree. C. for
60 minutes and analyzed by agarose gel electrophoresis. As these
reactions did not contain S-adenosylmethionine, a necessary
cofactor for the Sf.LAMBDA. DNA methyltransferase (MTase), any
MTase synthesized in the translation reaction from the Sfi4-2 DNA
template would not be active during the endonuclease assay
reaction.
[0116] The results (FIG. 2) demonstrate complete cleavage of
Adenovirus-2 substrate DNA at the highest dilution tested (lane 12)
for the T7 polymerase-directed translation reaction (0.03 .mu.l of
reaction supernatant), corresponding to a yield of synthesized SfiI
activity of at least 33000 units per ml of in vitro translation
reaction. Assuming a specific activity of 20,000 units/mg and a
monomer molecular mass of 25 kDa, this corresponds to roughly 1,000
synthesized R.Sf.LAMBDA. molecules per molecule of input DNA
template. For the reaction without added T7 RNA polymerase, in
which transcription was presumably from the weaker E. coli
P.sub.lac promoter, the yield of Sf.LAMBDA. activity was roughly
10-fold lower (cf. lanes 5 and 12), or 3000 units per ml,
indicating that protein synthesis is transcription limited in this
system.
EXAMPLE VI
A new MboI Isoschizomer from M. jannaschii (ORF 600-GATC,
MjaIII)
[0117] The MJ600 ORF, comprising residues 5632 to 6504 of GenBank
entry U67508, was predicted to encode an isoschizomer of MboI on
the basis of homology to MboI and LlaII, as determined by the
method of Example I.
[0118] MJ600 was amplified and cloned in the same manner as MJ1327,
by the method of Example III, using as primers:
11 (forward) 5'-GTTGGATCCTAATACGACTCACTATAGGAACAGACCACCATG (SEQ ID
NO: 13) AATTTTGAATACATCATTAACAG-3' (reverse)
5'-GTTGGATCCAAATTGAATAATGGTATCATTCAC-3' (SEQ ID NO: 14)
[0119] and the restriction activity was found to cleave at
5'-GATC-3'. This confirms that this ORF encodes an isoschizomer of
MboI, as predicted. This isoschizomer, MjaIII, from the
thermostable organism M. jannaschii, can be expected to be
significantly more thermostable than MboI.
EXAMPLE VII
Expression of HindIII in a Coupled Transcription/Translation System
from E. coli
[0120] The genes encoding the restriction endonuclease and
methylase of the HindIII system have previously been cloned and
sequenced (U.S. Pat. No. 5,180,673). The present invention's
competence in identifying restriction endonucleases was further
demonstrated by the use of the following standard procedures to
make sufficient quantity of HindIII enzyme in vitro to allow its
detection.
[0121] First, plasmid DNA encoding the HindIII restriction system
was prepared from E. coli NEB 325 (New England Biolabs) by standard
methods.
[0122] Primers were synthesized with the following sequences:
12 (SEQ ID NO:15) 5'-CGAAATTAATACGACTCACTATAGGGAGACCACAACGG- TTAA
GGAGGTGACAAAATGAAGAAAAGTGCGTTAGAG-3' (SEQ ID NO:16)
5'-AAATGGATCCAGAATTATAAATACAGTCTATCATTAC-3'
[0123] These primers were used in a set of 5 PCR reactions (100
.mu.l each) that contained 0.2 mM each of the four dNTPs, 0.1 .mu.g
plasmid DNA, 0.5 .mu.M of each above mentioned primer, and 2 units
Vent.RTM. DNA polymerase in 1.times.NEB ThermoPol Buffer (10 mM
KCl, 20 mM Tris-HCl (pH 8.8 at 25.degree. C.), 10 mM
(NH.sub.4).sub.2SO.sub.4, 4 mM MgSO.sub.4, 0.1% Triton X-100). The
reaction mix was heated at 95.degree. C. for 30 seconds, 55.degree.
C. for 45 seconds, 72.degree. C. for 75 seconds for 20 cycles.
Finally, the reaction was incubated at 72.degree. C. for 10
minutes. The reactions were combined and phenol/chloroform
extracted. The DNA was concentrated and primer dimer products
partially removed by using a Microcon 50 device according to the
manufacturers instructions for 3 rounds of 20-fold concentration
and dilution. The purified PCR product was concentrated to 50
.mu.g/ml.
[0124] The transcription and translation of the HindIII gene was
performed using a rabbit reticulocyte Protein Truncation Test Kit
(Boehringer Mannheim). The PCR product (0.4 .mu.g (2 .mu.l)),
transcription mix (2.5 .mu.l) and RNase free water (5.5 .mu.l) were
combined and incubated at 30.degree. C. for 30 min. The translation
mix (40 .mu.l) was added and incubated at 30.degree. C. for 1 hr.
The transcription/translation reaction was then tested for newly
formed HindIII restriction enzyme activity.
[0125] Serial dilutions of the transcription/translation reaction
were performed in NEB buffer 2 (50 mM NaCl, 10 mM Tris-acetate, 10
mM MgCl.sub.2, 1 mM dithiothreitol, 100 .mu.g/ml BSA) containing 25
.mu.g/ml .lambda. phage substrate DNA using 1.6 .mu.l, 0.53 .mu.l,
0.17 .mu.l or 0.06 .mu.l transcription/translation reaction product
per 20 .mu.l final reaction volume in 1.times.NEB buffer 2
containing .lambda. DNA. The reactions were incubated at 37.degree.
C. for 14 hours. As a positive control, authentic HindIII (20
units, New England Biolabs, Inc.) was used to cut the substrate DNA
under the same reaction conditions. As a negative control, the DNA
was incubated with the transcription/translatio- n mix to which no
template DNA (PCR product) had been added.
[0126] HindIII restriction activity was clearly observed in the in
vitro transcription/translation reaction, demonstrating the
efficacy of the in vitro method described in the instant
application.
EXAMPLE VIII
In Vitro Transcription/Translation of PacI Restriction
Endonuclease
[0127] The gene encoding the PacI restriction endonuclease has
previously been cloned and sequenced (Richard D. Morgan, New
England Biolabs, Inc., unpublished observations). It has been
observed that clones of PacI are unstable in E. coli, presumably
due to the lack of a PacI methylase on these clones. The present
invention's competence in identifying restriction endonucleases was
further demonstrated by the use of the following standard
procedures to make sufficient quantity of PacI enzyme in vitro to
allow its detection and identification.
[0128] First, Pseudomonas alcaligenes genomic DNA was obtained from
NEB 585 (New England Biolabs, Inc., Beverly, Mass.). See also U.S.
Pat. No. 5,098,839.
[0129] Primers were synthesized with the following sequences:
13 (SEQ ID NO:17) 5'-GTTGGATCCTAATACGACTCACTATAGGAACAGACCAC- CATG
ACGCAATGTCCAAGGTG-3' (SEQ ID NO:18)
5'-GTTGGATCCGTCGACTTGGCAAAGCCCTCTTC-3'
[0130] These primers were used in a set of 8 PCR reactions (100
.mu.l each) that contained 0.2 mM each of the four dNTPs, 0.1 .mu.g
genomic DNA, 0.5 .mu.M of each above mentioned primer, and 2 units
Vent.RTM. DNA polymerase in 1.times.NEB ThermoPol Buffer (10 mM
KCl, 20 mM Tris-HCl (pH 8.8 at 25.degree. C.), 10 mM
(NH.sub.4).sub.2SO.sub.4, 4 mM MgSO.sub.4, 0.1% Triton X-100). The
reaction mix was heated at 95.degree. C. for 30 seconds, 57.degree.
C. for 30 seconds, 72.degree. C. for 65 seconds for 27 cycles. The
PCR reactions were combined and a standard phenol/chloroform
extraction was carried out to remove protein. The DNA was
concentrated and primer dimer products partially removed using an
Amicon Microcon-50 device as in Example VII.
[0131] The transcription of the PacI gene was performed using a
rabbit reticulocyte Protein Truncation Test Kit (Boehringer
Mannheim). The PCR product 0.4 .mu.g (2 .mu.l), transcription mix
(2.5 .mu.l) and 5.5 .mu.l of RNase free water were combined and
incubated at 30.degree. C. for 45 min. Transcription mix (8 .mu.l)
containing m.sup.7G(5')ppp(5')G 5' capped mRNA was added to 42
.mu.l of Ambion T/T Wheat Germ translation mix (11 .mu.l RNase free
water, 2.5 .mu.l 1 M KOAc, 3.5 .mu.l Amino Acid Mix, 25 .mu.l
Translation extract) and incubated at 27.degree. C. for 1 hr. The
transcription/translation reaction was then tested for newly formed
PacI restriction enzyme activity.
[0132] Substrate DNA was digested by the transcription/translation
mix only when that mix had been primed with PCR product from the
Pseudomonas alcaligenes genomic DNA. The lanes with primed
transcription/translation product produced banding patterns
identical to the lanes with authentic PacI, again demonstrating the
efficacy of the method described in the instant Application.
EXAMPLE IX
Stable Cloning of PacI Restriction Endonuclease
[0133] The restriction endonuclease PacI has been previously
characterized biochemically and shown to recognize the sequence
TTAATTAA. Despite repeated attempts, the gene has not been usefully
cloned due to the apparent lack of a cognate methylase, and the
inherent lethality of the gene product. The gene encoding PacI was
used as a test to show that it would be possible to: 1) establish a
stable clone of a gene encoding a lethal protein, and 2) show that
the expression of such a cloned gene could be electively modulated
using standard laboratory techniques.
[0134] Genomic DNA from Pseudomonas alcaligenes (NEB 585) was
prepared by standard methods.
[0135] Primers were synthesized with the following sequences:
14 (SEQ ID NO:19) 5'-CCTCCTCTAGAAGAAGGAGATATACCATGACGCAATGT- CCAA
GGTGCC-3' (SEQ ID NO:20)
5'-GGAGGGATCCTCGAGCGCTTGACTGAATAGTTAGG-3'
[0136] Approximately 0.5 .mu.g of the P. alcaligenes DNA was used
as template in a 100 .mu.l PCR reaction containing 0.2 mM each of
the four dNTPs, 100 pmol of each primer, 4 units of Vent.RTM. DNA
polymerase (VDpol) in 1.times.NEB ThermoPol Buffer. The reaction
mix was heated to 94.degree. C. for 2 minutes, and then subjected
to 25 cycles of PCR, incubating at 94.degree. C. for 1 minute,
58.degree. C. for 30 seconds, and 72.degree. C. for 30 seconds.
Finally the reaction was held at 72.degree. C. for five minutes.
10% of the reaction product was checked on a 1% agarose gel, and
the balance stored at -20.degree. C. until further use. The
reaction was subjected to standard phenol/chloroform/isoamyl
alcohol, then chloroform extractions to partition the protein and
the PacI amplicon (DNA product of the PCR reaction). The amplicon
was precipitated from the aqueous fraction by supplementing it with
sodium acetate (pH 5.2) to 0.3 M, addition of 2.5 volumes of
absolute ethanol, and storage at -20.degree. C. overnight. The
amplicon was recovered by centrifugation at 14,000 rpm at 4.degree.
C. for 20 minutes, at which point the supernatant was discarded.
After allowing the DNA pellet to dry, it was redissolved in 50
.mu.l of .delta. 0 mM Tris-HCl, pH 7.4.
[0137] Approximately 2 .mu.g of the amplicon was incubated for 2
hours at 37.degree. C. in a 50 .mu.l restriction endonuclease
reaction containing 1.0 mg/ml bovine serum albumin (BSA), 40 units
each of XbaI and XhoI, in 1.times.NEB buffer #2. 50 .mu.l of 10 mM
Tris-HCl, pH 7.4 was added to the reaction to make the volume 100
.mu.l. The reaction was subjected to phenol/chloroform and ethanol
precipitation as described above. The pellet was dissolved in 25
.mu.l of 10 mM Tris-HCl, pH 7.4. The resulting DNA preparation was
electrophoresed on a 1% agarose gel, the desired band excised, and
eluted from the agarose matrix. Approximately 0.5 .mu.g of pLT7K
was prepared in a similar manner. The eluates were mixed, then
subjected to phenol/chloroform and ethanol precipitation as
described above. The dry DNA mixture was dissolved in 20 .mu.l
1.times.NEB ligase buffer and incubated with 800 units of T4 DNA
ligase at 16.degree. C. overnight.
[0138] The ligation was subjected to phenol/chloroform and ethanol
precipitation as described above, and dissolved in 30 .mu.l of 10
mM Tris-HCl, pH 7.4. 10 .mu.l of this preparation was added to 85
.mu.l of electrocompetent E. coli strain DH5.alpha.F' (LTI) on ice.
Electroporation was done in a 0.1 cm cuvette chamber using a BioRad
Genepulser (model #1652102) set at 1.88 kvolts. The contents of the
cuvette were removed into a 1.5 ml tube containing 0.5 ml Luria
broth supplemented to 20 mM glucose (LB-glc) that had been
prewarmed to 42.degree. C. The tube was placed into a 40.degree. C.
shaker for approximately 45 minutes, at which point it was removed
to a 42.degree. C. heat block. Three fractions of the preparation
(2%, 20%, and 78%) were spread onto LB-glc agar plates (prewarmed
to 40.degree. C.) containing 100 .mu.g/ml ampicillin (LB-glc-Ap).
Plates were incubated at 40.degree. C. overnight.
[0139] The following day, ten transformant colonies were randomly
picked and dispersed into 5 ml of prewarmed LB-glc-Ap media. These
cultures were incubated overnight in a 40.degree. C. shaker, at
which point plasmid DNA was isolated by standard procedures.
Plasmid DNAs were screened by restriction digest. 7 out of the 10
selected clones had the desired construction:
[0140] P.sub.T7.fwdarw.PacI coding region.fwdarw.<-P.sub.R.
[0141] Putative positives were subjected to single-pass sequencing
reactions of the 5'-end of the insert. Five of the seven displayed
no deviation from the expected sequence, and a representative
clone, designated pLT7-Pac.3, was selected for further
characterization.
[0142] pLT7-Pac.3 was transformed into E. coli strain ER2566P using
a variation of a standard chemical method. Approximately 0.05 .mu.g
of plasmid DNA was incubated with 100 .mu.l of cells for 30 minutes
on ice. The mixture was warmed to 42.degree. C. for two minutes, at
which point 0.9 ml of LB-glc was added that had been prewarmed to
42.degree. C. The tube was placed into a 40.degree. C. shaker for
approximately 30 minutes, at which point it was removed to a
42.degree. C. heat block. Two fractions of the preparation (2% and
20%) were spread onto LB-glc agar plates (prewarmed to 40.degree.
C.) containing 100 .mu.g/ml ampicillin (LB-glc-Ap). Plates were
incubated at 40.degree. C. overnight. The following morning, three
transformant colonies were randomly picked and dispersed into 5 ml
of prewarmed LB-glc-Ap media. The cultures were incubated for
approximately 4 hours in a 40.degree. C. shaker, at which point 2.5
ml of each was added to 500 ml of prewarmed LB-glc-Ap media, and
incubated in a 40.degree. C. shaker until the culture had attained
an O.D..sub.600 nm of approximately 0.7. IPTG was added to a final
concentration of .about.0.8 mM, the shaker temperature was adjusted
to 30.degree. C., and the culture incubated for an additional 4
hours. Approximately 1 g of cells was recovered by centrifugation
(6000 rpm, 4.degree. C., 15 minutes) and stored at -70.degree. C.
overnight.
[0143] The cell pellet was suspended (on ice) in 20 ml of a buffer
(PacI core buffer) consisting of: 20 mM KPO.sub.4, pH 6.0; 50 mN
NaCl; 10 mM .beta.-mercaptoethanol; 0.1 mM EDTA; 5% glycerol. Cells
were lysed by the addition of Triton X-100 to 0.1%, lysozyme to 1
.mu.g/ml and, after warming briefly to 20.degree. C., alternating
sonication/cooling on ice. The preparation was clarified by
centrifugation (10,000 rpm, 20 minutes, 4.degree. C.), and the
supernatant removed to a fresh tube on ice.
[0144] The cleared lysate was applied to a heparin-sepharose column
that had been previously equilibrated with PacI core buffer. This
was followed by an 8 column-volume wash. The flow-through and the
wash fractions were collected and maintained on ice, as well as a
small amount of the cleared lysate. The column was developed with a
50 ml gradient from 0.05-1.0 M NaCl. 1.0 ml fractions were
collected and maintained on ice.
[0145] A low level of endonuclease activity consistent with that of
PacI was detected in fractions distributed across the elution
gradient. This indicated that the protein had bound poorly to the
column and suggested that the protocol employed here, which had
been optimized for P. alcaligenes lysates, was not optimal for E.
coli lysates. Accordingly, the crude lysate and column flow-through
were assayed for PacI activity, where it was clearly evident.
[0146] To test whether pLT7-Pac.3 would be stable and electively
inducible in a production-scale expression system, a 20 liter
culture was grown under conditions similar to those outlined above.
A fresh transformation of pLT7-Pac.3 into ER2566P was done as
outlined above. A colony was randomly selected, dispersed into 1
liter of media, and incubated in a 40.degree. C. shaker overnight.
This was used to inoculate a 20 liter fermenter run. At an
OD.sub.600 of .about.1.0, IPTG was added to a final concentration
of 0.3 mM, the temperature reduced to 30.degree. C., and incubation
continued for an additional 4 hours. 38 grams of cells were
harvested by continuous flow centrifugation and stored at
-70.degree. C. for 19 days. A sample of these transformed cells,
ER2566P-pLT7-Pac.3, was deposited under the terms and conditions of
the Budapest Treaty with the American Type Culture Collection on
Sep. 1, 1998 and received ATCC Accession No. 202169.
[0147] A clarified extract was prepared and partitioned over a
heparin-sepharose column with a 0.05-1.0 M NaCl gradient. This
procedure yielded >800 units of PacI endonuclease/g of wet
cells.
EXAMPLE X
Stable Cloning of NlaIII Restriction Endonuclease
[0148] Example IX illustrates that pLT7K enabled the establishment
of a stable clone encoding PacI endonuclease, and that expression
of this protein could be electively modulated. The octanucleotide
recognition sequence for PacI does not occur in pLT7K. It is
possible that the plasmid would be less stable if it were used to
clone a gene encoding a restriction endonuclease capable of
cleaving at one or more sites within the construct. Therefore, the
reliability of pLT7K was subjected to a high stringency test by
cloning the gene encoding restriction endonuclease NlaIII
(R.NlaIII), absent the use of the NlaIII cognate methyltransferase
(M.NlaIII).
[0149] R.NlaIII has been previously characterized biochemically and
shown to recognize the sequence CATG (U.S. Pat. No. 5,278,060).
[0150] The NlaIII restriction-modification system has also been
previously cloned and sequenced, and the genes encoding M.- and
R.NlaIII (nlaIIIM and nlaIIIR, respectively) identified (U.S. Pat.
No. 5,278,060). In vivo, plasmid-borne alleles of nlaIIIR exhibit
instability, even when M.NlaIII is expressed from a co-resident
plasmid. In the absence of the cognate methylase, an nlaIIIR clone
cannot be established using standard methods.
[0151] Using standard methods, plasmid DNA was prepared from cells
that produce both M.- and R.NlaIII from separate plasmids.
[0152] Primers were synthesized with the following sequences:
15 (SEQ ID NO:21) 5'-CCTCCTCTAGAAGAAGGAGATATACCATGAAAATCACA- AAAA
CAGAACT-3' (SEQ ID NO:22)
5'-GGAGGGATCCTCGAGCGCTTGACTGAATAGTCATCCGTTATCTTC
TTCATATAATTTC-3'
[0153] These primers were used to generate an nlaIIIR amplicon
containing sequences suitable for expression and directional
cloning into pLT7K. Using the protocol described above, a gene
encoding R. NlaIII was cloned into the pLT7 vector, with 87%
(13/15) recovery of the desired construct (designated pLT7-NlaIII).
The clone could be established and stably maintained in both DH5aF'
and ER2566P.
[0154] Addition of IPTG (to 1.0 mM) to 5 ml cultures of
ER2566P-pLT7-NlaIII resulted in rapid cessation of cell growth, as
compared to controls. One hour after IPTG addition, crude lysates
were prepared using standard methods. When assayed, an endonuclease
activity consistent with that of R.NlaIII was apparent.
[0155] Thus, pLT7K can be used to clone, maintain, and electively
express genes whose products are capable of destroying the
construct itself.
EXAMPLE XI
MjaV, A New Restriction Endonuclease from M. jannaschii Which
Recognizes 5'-GTAC-3'
[0156] The open reading frame MJ1498, which comprises residues 9251
to 10129 of GenBank entry U67590, was identified as a likely
methylase gene candidate, by virtue of its having amino acid
sequences characteristic of amino methyltransferases; VTSPPY (SEQ
ID NO: 24) and VLDPFMGIGST (SEQ ID NO:25). The flanking ORFs,
MJ1497 and MJ1499, were considered as possible endonuclease genes.
A match in the database for ORF MJ1497 made this ORF seem a less
likely candidate, but both MJ1497 and MJ1499 were PCR amplified
from genomic M. jannaschii DNA and cloned into the T7 expression
vector pAII17 in E. coli. Neither MJ1497 nor MJ1499 showed any
restriction activity in the pools of clones prepared. The MJ1498
putative methylase gene was PCR amplified from genomic M.
jannaschii DNA using the following two oligonucleotides as
primers:
[0157] forward (coding strand) BamHI cloning site, (NdeI cloning
site):
16 (SEQ ID NO:26) 5'-GTTGGATCCGTAATTAAGGAGGTAATTCATATGGAGAT- AAAT
AAAATCTAC-3'
[0158] reverse: SalI (EcoRI) cloning site:
17 (SEQ ID NO:27) 5'-GTTGAATCCGTCGACTATTTAAATAAATGCATC-3'
[0159] The PCR reaction was performed by combining:
[0160] 20 ul 10.times. ThermoPol Buffer (New England Biolabs,
Inc.)
[0161] 16 ul dNTP solution (4 mM)
[0162] 15 ul forward primer above (10 uM)
[0163] 15 ul reverse primer above (10 uM) 133 ul dH.sub.2O
[0164] 1.5 ul M. jannaschii genomic DNA
[0165] 4 ul Vent.RTM. exo-DNA polymerase
[0166] 1 ul Vent.RTM. DNA polymerase
[0167] This master reaction mix was divided into 5 tubes of 40 ul
each, to which were added 0.0, 0.4, 0.8, 1.2 and 1.6 ul of 100 mM
MgSO.sub.4 solution per tube to create reactions of 2, 3, 4, 5 and
6 mM Mg.sup.++ concentrations.
[0168] These five tubes were incubated 95.degree. C.--2 min for one
cycle, 95.degree. C.--30 sec, 48.degree. C.--30 sec, 72.degree.
C.--1 min for 5 cycles, then 95.degree. C.--30 sec, 58.degree.
C.--30 sec, 72.degree. C.--1 min for 25 additional cycles. The
amplified DNA was phenol/chloroform extracted, alcohol precipitated
and resuspended in TE buffer. A portion of the amplified DNA was
then cleaved with BamHI and Sa.LAMBDA., phenol-chloroform
extracted, alcohol precipitated and resuspended in TE. The cleaved
DNA was then ligated to vector pSYX20 DNA previously cleaved with
BamHI and Sa.LAMBDA. and gel purified. The ligated product was
transformed into E. coli ER2566 cells and the transformed cells
were grown overnight on LB plates containing 50 ug/ml kanamycin.
Individual transformants were examined and minipreps of several
clones containing the desired size insert were prepared. The cloned
DNA was digested with various restriction enzymes in an attempt to
find an enzyme which would cleave the pSYX20 vector but be unable
to cut the MJ1498 clone, thus demonstrating that the cloned MJ1498
ORF was functioning as a methyltransferase to protect the vector
DNA containing the MJ1498 gene against cleavage by that particular
restriction endonuclease. It was found that the clones of MJ1498
were not cleaved by the restriction endonuclease RsaI, indicating
that the methylase was protecting the GTAC sequence recognized by
RsaI against cleavage. This showed that MJ1498 was able to function
as a methyltransferase, as predicted, in E. coli. The
methyltransferase activity could be methylating at GTAC, or GTAC
could be a subset of the methyltransferase target sequence. To look
for a cognate restriction activity, it was observed that the orf
once removed from MJ1498, MJ1500, did not significantly match
anything in the database by BLAST search. The possibility that an
endonuclease might be one ORF removed from its cognate methylase
was strengthened by the observation that MJ598 is the methylase and
MJ600 is the endonuclease in the MjaIII system described above. The
MJ1500 ORF, which comprises residues 767 to 74 of GenBank sequence
U67591, was amplified from genomic M. jannaschii DNA using the
following two oligonucleotides as primers:
[0169] forward (coding strand) BamHI cloning site, T7 promotor,
kozak sequence:
18 (SEQ ID NO:28) 5'-GTTGGATCCTAATACGACTCACTATAGGAACAGACCACC- ATG
GATGATAAGAGCTACTATG-3'
[0170] reverse:
[0171] 5'-CATTAATATATAAATAAATACATAAAT-3' (SEQ ID NO: 29)
[0172] The PCR reaction was performed by combining:
[0173] 20 ul 10.times.PCR BUFFER II (PE)
[0174] 12 ul dNTP solution (4 mM)
[0175] 15 ul forward primer above (10 uM)
[0176] 15 ul reverse primer above (10 uM)
[0177] 1.5 ul M. jannaschii genomic DNA
[0178] 16 ul MgCl.sub.2 (25 mM stock) (PE)
[0179] 122 ul dH.sub.2O
[0180] 2 ul (10 u) AmpliTaq DNA polymerase (PE)
[0181] This master reaction mix was divided into 2 tubes of 100 ul
each, to which were added 0.0 and 8 ul of 25 mM MgCl.sub.2 solution
per tube to create reactions of 2 and 4 mM Mg.sup.++
concentrations.
[0182] These tubes were incubated at 95.degree. C. for 2 min for
one cycle, then 95.degree. C.--30 sec, 40.degree. C.--30 sec,
72.degree. C.--1 min for 5 cycles, followed by 95.degree. C.--30
sec, 48.degree. C.--30 sec, 72.degree. C.--1 min for 25 additional
cycles. The amplified DNA was phenol/chloroform extracted, alcohol
precipitated and resuspended in TE buffer at a concentration of 200
ug/ml. The amplified MJ1500 ORF was used for in vitro
transcription/translation reactions as described above in Example
I. The in vitro transcription/translation product was found to cut
DNA at the sequence GTAC, demonstrating that MJ1500 is the cognate
endonuclease to the MJ1498 methylase, and that this restriction
system recognizes the sequence 5'-GTAC-3'.
EXAMPLE XII
A Putative New Restriction Endonuclease from M. jannaschii (ORF
1200/1199--Not Yet Identified)
[0183] During the search of the M. jannaschii genome sequence, as
outlined in Example I, several open reading frames were identified
that appeared to encode DNA methylase genes and were candidates to
be part of Type II restriction-modification systems. One of these
was the open reading frame labelled MJ1200, which showed the
closest match to the known gene encoding the methylase M.DdeI. From
the characteristic motifs (Posfai, et al., Nucl. Acids Res.
17:2421-2435 (1989)); Lauster, et al. J. Mol. Biol. 206:305-312
(1989)) present in this gene it is predicted to encode a cytosine-5
DNA methylase. However, because the variable region of this
putative gene is not a good match for anything in the database it
is possible that it recognizes a new DNA sequence. Immediately
following this gene is an open reading frame that shows a good
match to a ribosomal protein (L24E), while preceding the gene is an
open reading frame (MJ1199) with no clear similarity to any other
open reading frame present in GenBank. This open reading frame,
MJ1199, is predicted to encode a new restriction enzyme and
comprises the complementary strand residues 9158-10258 of the
GenBank entry U67561.
[0184] To characterize the putative new restriction enzyme encoded
by MJ1199, a detailed protocol similar to that of Example I will be
employed. The segment of the genome of M. jannaschii containing the
open reading frame MJ1199 will be amplified by PCR using as primers
the following two oligonucleotides:
19 (SEQ ID NO:5) 5'-GTTTAATACGACTCACTATAGGGTTAGGAGGTATTACAT
(A)TGAGAAAAATGTTTATTTGTTTGC-3'
[0185] Note that the marked (A) is a G in the original genome. It
is changed to an A to ensure a better translational start. This is
the start codon of the open reading frame. Sequences preceding the
(A) are not present in the genome, but contain the T7 RNA
polymerase promoter sequence and a good ribosome binding site;
20 5'-GTTGGATCCGGAGATTCCTGAGGCATCTTTG-3' (SEQ ID NO:6)
[0186] The PCR-amplified segment will be subjected to in vitro
transcription/translation as detailed in Example I and the product
will be tested for restriction enzyme activity by incubating the
transcription/translation mix with various DNAs such as those of
bacteriophages .lambda. and T7 and Adenovirus-2. Incubations will
be at various temperatures, ranging from 30.degree. C. to
90.degree. C. and for various lengths of time. After incubation the
reactions will be examined by agarose gel electrophoresis to see if
banding patterns, characteristic of restriction enzyme digestion,
are present. If they are, then the new restriction enzyme will be
characterized as to its recognition sequence and cleavage site in
the usual way (Schildkraut, I. S., "Screening for and
Characterizing Restriction Endonucleases", in Genetic Engineering,
Principles and Methods, Vol. 6, pp. 117-140, Plenum Press (1984);
Roberts, R. J. and Halford, S. E. in Nucleases [Eds. Linn, S. M.,
Lloyd, R. S., Roberts, R. J.] Cold Spring Harbor Press, pp 35-88
(1993)).
Sequence CWU 1
1
29 1 63 DNA Methanococcus jannaschii 1 gtttaatacg actcactata
gggttaggag gtattacata tggtgaaact tatgaaaaaa 60 ttg 63 2 38 DNA
Methanococcus jannaschii 2 gttggatccg caaaaaagaa taggaatgga
ttttaatg 38 3 69 DNA Haemophilus haemolyticus 3 taatacgact
cactataggg aataattttg ttttaacttt aagaaggaga atgaaaatga 60 attggaaag
69 4 22 DNA Haemophilus haemolyticus 4 caattataaa gaaatagctg cc 22
5 64 DNA Methanococcus jannaschii 5 gtttaatacg actcactata
gggttaggag gtattacata tgagaaaaat gtttatttgt 60 ttgc 64 6 31 DNA
Methanococcus jannaschii 6 gttggatccg gagattcctg aggcatcttt g 31 7
63 DNA 'Axial Seamount' polynoid polychaete 7 gttggatcct aatacgactc
actataggaa cagaccacca tggtggtaaa attggttaat 60 aac 63 8 36 DNA
Bacillus amyloliquefaciens 8 gttggatccg attgtagaaa gatttatcat
taattc 36 9 66 DNA Methanococcus jannaschii 9 gtttaatacg actcactata
gggttaggag gtattacata tgataaaatt tggagaagca 60 gttttg 66 10 32 DNA
Methanococcus jannaschii 10 gttggatccg tgtaaagttt ttttgctggc tg 32
11 51 DNA Methanococcus jannaschii 11 cctcctctag aagaaggaga
tataccatgc cactaagtaa aaatgttata g 51 12 60 DNA Methanococcus
jannaschii 12 ggagggatcc tcgagcgctt gactgaatag ttatttttgc
atatatttat tgtataattc 60 13 13 DNA Streptomyces fimbriatus At
Position 5 through 9, "N" = G, A, C or T 13 ggccnnnnng gcc 13 14 65
DNA Methanococcus jannaschii 14 gttggatcct aatacgactc actataggaa
cagaccacca tgaattttga atacatcatt 60 aacag 65 15 33 DNA Haemophilus
influenzae 15 gttggatcca aattgaataa tggtatcatt cac 33 16 75 DNA
Pseudomonas alcaligenes 16 cgaaattaat acgactcact atagggagac
cacaacggtt aaggaggtga caaaatgaag 60 aaaagtgcgt tagag 75 17 37 DNA
Pseudomonas alcaligenes 17 aaatggatcc agaattataa atacagtcta tcattac
37 18 59 DNA Pseudomonas alcaligenes 18 gttggatcct aatacgactc
actataggaa cagaccacca tgacgcaatg tccaaggtg 59 19 32 DNA Pseudomonas
alcaligenes 19 gttggatccg tcgacttggc aaagccctct tc 32 20 48 DNA
Pseudomonas alcaligenes 20 cctcctctag aagaaggaga tataccatga
cgcaatgtcc aaggtgcc 48 21 35 DNA Neisseria lactamica 21 ggagggatcc
tcgagcgctt gactgaatag ttagg 35 22 49 DNA Neisseria lactamica 22
cctcctctag aagaaggaga tataccatga aaatcacaaa aacagaact 49 23 58 DNA
Methanococcus jannaschii 23 ggagggatcc tcgagcgctt gactgaatag
tcatccgtta tcttcttcat ataatttc 58 24 6 PRT Methanococcus jannaschii
24 Val Thr Ser Pro Pro Tyr 1 5 25 11 PRT Methanococcus jannaschii
25 Val Leu Asp Pro Phe Met Gly Ile Gly Ser Thr 1 5 10 26 51 DNA
Bacillus amyloliquefaciens 26 gttggatccg taattaagga ggtaattcat
atggagataa ataaaatcta c 51 27 33 DNA Streptomyces albus 27
gttgaatccg tcgactattt aaataaatgc atc 33 28 61 DNA Bacillus
amyloliquefaciens 28 gttggatcct aatacgactc actataggaa cagaccacca
tggatgataa gagctactat 60 g 61 29 27 DNA Bacillus amyloliquefaciens
29 cattaatata taaataaata cataaat 27
* * * * *