U.S. patent application number 10/220554 was filed with the patent office on 2004-07-08 for identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury.
Invention is credited to Itescu, Silviu.
Application Number | 20040131585 10/220554 |
Document ID | / |
Family ID | 24349821 |
Filed Date | 2004-07-08 |
United States Patent
Application |
20040131585 |
Kind Code |
A1 |
Itescu, Silviu |
July 8, 2004 |
Identification and use og human bone marrow-derived endothelial
progenitor cells to improve myocardial function after ischemic
injury
Abstract
The present invention provides a method of stimulating
vasculogenesis of myocardial infarct damaged tissue in a subject
comprising: (a) removing stem cells from a location in the subject;
(b) recovering endothelial progenitor cells in the stem cells; (c)
introducing the endothelial progenitor cells from step (b) into a
different location in the subject such that the precursors migrate
to and stimulate revascularization of the tissue. The stem cells
may be removed directly or by mobilization. The endothelial
progenitor cells may be expanded before introduction into the
subject. The present invention further provides a method of
inducing angiogenesis in peri-infarct tissue. The present invention
further provides a method of selectively increasing the trafficking
of human bone marrow-derived endothelial cell precursors to the
site of tissue damaged by ischemic injury which comprises: (a)
administering endothelial progenitor cells to a subject; (b)
administering chemokines to the subject so as to thereby attract
endothelial cell precursors to the ischemic tissue. The present
invention provides a method of stimulating vasculogenesis or
angiogenesis of myocardial infarct damaged tissue in a subject
comprising injecting allogeneic stem cells into a subject. The
present invention further provides a method of improving myocardial
function in a subject that has suffered a myocardial infarct
comprising any of the instant methods. The present invention
further provides a method of improving myocardial function in a
subject that has suffered a myocardial infarct comprising injecting
G-CSF or anti-CXCR4 antibody into the subject in order to mobilize
endothelial progenitor cells.
Inventors: |
Itescu, Silviu; (New York,
NY) |
Correspondence
Address: |
John P White
Cooper & Dunham
1185 Avenue of the Americas
New York
NY
10036
US
|
Family ID: |
24349821 |
Appl. No.: |
10/220554 |
Filed: |
March 4, 2003 |
PCT Filed: |
June 5, 2001 |
PCT NO: |
PCT/US01/18399 |
Current U.S.
Class: |
424/85.1 ;
424/93.7 |
Current CPC
Class: |
C12N 2501/21 20130101;
A61P 9/10 20180101; A61P 9/00 20180101; C07K 14/52 20130101; C07K
16/24 20130101; A61K 38/193 20130101; A61P 7/02 20180101; A61P
25/28 20180101; A61P 3/10 20180101; A61P 43/00 20180101; A61K
2039/505 20130101; A61P 7/04 20180101; A61K 38/195 20130101; A61P
35/00 20180101; A61P 9/08 20180101; C07K 16/2866 20130101; A61K
35/44 20130101; C12N 5/0692 20130101; A61P 9/04 20180101 |
Class at
Publication: |
424/085.1 ;
424/093.7 |
International
Class: |
A61K 045/00; A61K
038/19; A61K 038/20 |
Claims
1. A method of stimulating vasculogenesis in ischemia-damaged
tissue of a subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering endothelial progenitor
cells from the stem cells removed in step (a); and (c) introducing
the endothelial progenitor cells from step (b) into a different
location within the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
2. The method of claim 1, wherein the endothelial progenitor cells
are autologous.
3. The method of claim 1, wherein subsequent to step (b), but
before step (c), the endothelial progenitor cells are expanded by
contacting them with a growth factor.
4. The method of claim 3, wherein the growth factor is specific
for, or primarily has effects upon endothelial cells.
5. The method of claim 3, wherein the growth factor is a
cytokine.
6. The method of claim 5, wherein the cytokine is VEGF, PGF, G-CSF,
IGF, M-CSF, or GM-CSF.
7. The method of claim 3, wherein the growth factor is a
chemokine.
8. The method of claim 7, wherein the chemokine is
Interleukin-8.
9. The method of claim 3, wherein the endothelial progenitor cells
are separated from other stem cells before expansion.
10. The method of claim 1, wherein the ischemia-damaged tissue is
myocardium.
11. The method of claim 1, wherein the subject has suffered a
myocardial infarct.
12. The method of claim 1, wherein the ischemia-damaged tissue is
nervous system tissue.
13. The method of claim 1, wherein the subject has suffered a
cerebral ischemic event.
14. The method of claim 1, wherein the subject is deemed at risk
from a cerebral ischemic event.
15. The method of claim 1, wherein the stem cells are removed from
the subject's bone marrow.
16. The method of claim 15, wherein the removal of the stem cells
from the bone marrow is effected by aspiration from the subject's
bone marrow.
17. The method of claim 1, wherein the removal of the stem cells
from the subject is effected by a method comprising: (a)
introducing a growth factor into the subject to mobilize the stem
cells into the subject's blood; and (b) removing a sample of blood
containing the stem cells from the subject.
18. The method of claim 17, wherein the growth factor is introduced
into the subject subcutaneously, orally, intravenously or
intramuscularly.
19. The method of claim 17, wherein the growth factor is a
chemokine that induces mobilization.
20. The method of claim 19, wherein the chemokine is
Interleukin-8.
21. The method of claim 17, wherein the growth factor is a
cycokine.
22. The method of claim 21, wherein the cytokine is G-CSF, M-CSF,
or GM-CSF.
23. The method of claim 1, wherein the endothelial progenitor cells
are recovered based upon their expression of CD117.
24. The method of claim 1, wherein the endothelial progenitor cells
are recovered based upon their expression of a GATA-2 activated
gene product.
25. The method of claim 1, wherein the endothelial progenitor cells
are recovered based upon their expression of one or more of CD34,
VEGF-R, Tie-2, GATA-3 or AC133.
26. The method of claim 1, wherein the subject has suffered or is
suffering from one or more of the following: myocardial infarction,
chronic heart failure, ischemic heart disease, coronary artery
disease, diabetic heart disease, hemorrhagic stroke, thrombotic
stroke, embolic stroke, limb ischemia, or another disease in which
tissue is rendered ischemic.
27. A method of treating acute myocardial infarct comprising the
method of claim 1, wherein the subject is suffering acute
myocardial infarct.
28. The method of claim 1, wherein step (a) occurs prior to the
subject suffering ischemia-damaged tissue and wherein step (c)
occurs after the subject has suffered ischemia-damaged tissue.
29. The method of claim 1, wherein the endothelial progenitor cells
are frozen for a period of time between steps (b) and (c).
30. The method of claim 3, wherein the endothelial progenitor cells
are frozen for a period of time after being expanded but before
step (c) is performed.
31. The method of claim 1, wherein the endothelial progenitor cells
are introduced into the subject by injection directly into the
peripheral circulation, heart muscle, left ventricle, right
ventricle, coronary artery, cerebro-spinal fluid, neural tissue,
ischemic tissue, or post-ischemic tissue.
32. The method of claim 1, further comprising administering to the
subject one or more of the following: an inhibitor of Plasminogen
Activator Inhibitor, Angiotensin Converting Enzyme Inhibitor or a
beta blocker, wherein such administration occurs prior to,
concomitant with, or following step (c).
33. A method of stimulating angiogenesis in peri-infarct tissue in
a subject comprising: (a) removing stem cells from a location
within the subject; (b) recovering endothelial progenitor cells
from the stem cells removed in step (a); (c) expanding the
endothelia progenitor cells recovered in step (b) by contacting the
progenitor cells with a growth factor; and (d) introducing the
expanded endothelial progenitor cells from step (c) into a
different location in the subject such that the endothelial
progenitor cells stimulate angiogenesis in peri-infarct tissue in
the subject.
34. A method of selectively increasing the trafficking of
endothelial progenitor cells to ischemia-damaged tissue in a
subject comprising administering to the subject endothelial
progenitor cells and a chemokine so as to thereby attract the
endothelial progenitor cells to the ischemia-damaged tissue.
35. The method of claim 34, wherein the endothelial progenitor
cells have been derived from the subject's bone marrow.
36. The method of claim 34, wherein the chemokine is a CXC
chemokine.
37. The method of claim 36, wherein the CXC chemokine is
Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
38. The method of claim 34, wherein the chemokine is a CC
chemokine.
39. The method of claim 38, wherein the CC chemokine is RANTES,
EOTAXIN, MCP-1, MCP-2, MCP-3, or MCP-4.
40. The method of claim 34, wherein the chemokine is administered
to the subject by injection into the subject's peripheral
circulation, heart muscle, left ventricle, right ventricle, a
coronary artery, spinal fluid, neural tissue, ischemic tissue, or
post-ischemic tissue.
41. The method of claim 34, wherein the endothelial progenitor
cells are human cells.
42. The method of claim 34, wherein the ischemia-damaged tissue is
myocardium.
43. The method of claim 34, wherein the ischemia-damaged tissue is
neural tissue.
44. The method of claim 34, wherein the endothelial progenitor
cells express CD117.
45. The method of claim 34, wherein the endothelial progenitor
cells express at least one of CD34, GATA-2, GATA-3 or AC133.
46. The method of claim 34, wherein the chemokine is administered
to the subject by injection into the subject's peripheral
circulation, heart muscle, left ventricle, right ventricle,
coronary arteries, cerebro-spinal fluid, neural tissue, ischemic
tissue, or post-ischemic tissue.
47. The method of claim 1, 33 or 34, wherein the subject is
mammalian.
48. The method of claim 47, wherein the subject is human.
49. A method of increasing trafficking of endothelial progenitor
cells or angioblasts to ischemia-damaged tissue in a subject
comprising inhibiting any interaction between Stromal-Derived
Factor-1 and CXCR4.
50. The method of claim 49, wherein interaction between
Stromal-Derived Factor-1 (SDF-1)and CXCR4 is inhibited by
administration of an anti-SDF-1 or an anti-CXCR4 monoclonal
antibody to the subject.
51. The method of claim 50, further comprising administering to the
subject an Angiotensin Converting Enzyme Inhibitor, an
AT.sub.1-receptor blocker, or a beta blocker.
52. A method of reducing trafficking of endothelial progenitor
cells to bone marrow in a subject comprising inhibiting production
of Stromal-Derived Factor-1 in the subject's bone marrow.
53. The method of claim 52, wherein SDF-1 production is inhibited
by administration of an anti-SDF-1 or anti-CXCR4 monoclonal
antibody to the subject.
54. A method for treating a cancer in a subject comprising
administering to the subject a monoclonal antibody directed against
an epitope of a specific chemokine produced by proliferating cells
associated with the cancer so as to reduce trafficking of
endothelial progenitor cells to such proliferating cells and
thereby treat the cancer in the subject.
55. A method for treating a cancer in a subject comprising
administering to the subject a monoclonal antibody directed against
an epitope of a specific receptor located on an endothelial
progenitor cell, for a chemokine produced by proliferating cells
associated with the cancer, so as to reduce trafficking of the
endothelial progenitor cell to such proliferating cells and thereby
treat the cancer in the subject.
56. The method of claim 55, wherein the receptor is CXCR1, CXCR2 or
VEGF-R.
57. A method for treating a tumor in a subject comprising
administering to the subject an antagonist to a specific receptor
on an endothelial progenitor cell so as to reduce the progenitor
cell's ability to induce vasculogenesis in the subject's tumor and
thereby treat the tumor.
58. A method for treating a tumor in a subject comprising
administering to the subject an antagonist to a specific receptor
on an endothelial progenitor cell so as to reduce the progenitor
cell's ability to induce angiogenesis in the subject's tumor and
thereby treat the tumor.
59. The method of claim 57 or 58, wherein the receptor is a CD117
receptor.
60. The method of claim 54, 55, 57, or 58, wherein the subject is
mammalian.
61. The method of claim 60, wherein the subject is human.
62. A method for expressing a gene of interest in an endothelial
progenitor cell or a mast progenitor cell which comprises inserting
into the cell a vector comprising a promoter containing a GATA-2
motif and the gene of interest.
63. The method of claim 62, wherein the vector is inserted into the
cell by transfection.
64. The method of claim 62 wherein the promoter is a
preproendothelin-1 promoter.
65. The method of claim 64, wherein the promoter is of mammalian
origin.
66. The method of claim 65, wherein the promoter is of human
origin.
67. A composition comprising an amount of a monoclonal antibody
directed against an epitope of a specific chemokine produced by a
cancer effective to reduce trafficking of endothelial progenitor
cells to the cancer, and a pharmaceutically acceptable carrier.
68. A method of treating an abnormality in a subject wherein the
abnormality is treated by the expression of a GATA-2 activated gene
product in the subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering endothelial progenitor
cells from the stem cells removed in step (a); (c) recovering those
endothelial progenitor cells recovered in step (b) that express
GATA-2; (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and (e)
introducing the cells expressing a GATA-2 activated gene product
from step (d) into a different location in the subject such as to
treat the abnormality.
69. A method of treating an abnormality in a subject wherein the
abnormality is treated by the expression of a GATA-2 activated gene
product in the subject comprising: (a) removing stem cells from a
location within the subject; (b) recovering mast progenitor cells
from the stem cells removed in step (a); (c) recovering those mast
progenitor cells recovered in step (b) that express GATA-2; (d)
inducing the cells recovered in step (c) as expressing GATA-2 to
express a GATA-2 activated gene product; and (e) introducing the
cells expressing a GATA-2 activated gene product from step (d) into
a different location in the subject such as to treat the
abnormality
70. The method of claims 68 or 69, wherein the abnormality is
ischemia-damaged tissue.
71. The method of claims 68 or 69, wherein the gene product is
proendothelin.
72. The method of claims 68 or 69, wherein the gene product is
endothelin.
73. A method of improving myocardial function in a subject that has
suffered a myocardial infarct comprising: (a) removing stem cells
from a location in the subject; (b) recovering cells that express
CD117 from the stem cells; and (c) introducing the recovered cells
into a different location in the subject such that the cells
improve myocardial function in the subject.
74. The method of any of claims 68, 69, or 73, wherein the subject
is of mammalian origin.
75. The method of claim 74, wherein the mammal is of human
origin.
76. A method of stimulating vasculogenesis in ischemia-damaged
tissue in a subject comprising: (a) obtaining allogeneic stem
cells; (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and (c) introducing the endothelial
progenitor cells recovered in step (b) into the subject such that
the endothelial progenitor cells stimulate vasculogenesis in the
subject's ischemia-damaged tissue.
77. The method of claim 76, wherein the allogeneic stem cells are
obtained from embryonic, fetal or cord blood sources.
78. A method of stimulating angiogenesis in ischemia-damaged tissue
in a subject comprising: (a) obtaining allogeneic stem cells; (b)
recovering endothelial progenitor cells in the stem cells removed
in step (a); and (c) introducing the endothelial progenitor cells
recovered in step (b) into the subject such that the endothelial
progenitor cells stimulate angiogenesis in the subject's
ischemia-damaged tissue.
79. The method of claim 78, wherein the allogeneic stem cells are
obtained from embryonic, fetal or cord blood sources.
80. A method of improving myocardial function in a subject that has
suffered a myocardial infarct comprising injecting G-CSF into the
subject in order to mobilize endothelial progenitor cells.
81. A method of improving myocardial function in a subject that has
suffered a myocardial infarct comprising injecting anti-CXCR4
antibody into the subject.
82. The method of claim 81 further comprising introducing
endothelial progenitor cells into the subject.
83. The method of claim 82 further comprising introducing G-CSF
into the subject in order to mobilize endothelial progenitor
cells.
84. An endothelial progenitor cell that expresses CD117.
85. An endothelial progenitor cell that expresses one or more of
the group consisting of GATA-2, GATA-3, CD34, AC133, CD34 and
CD117.
86. The endothelial progenitor cell of claim 85, wherein the
progenitor cell is derived from bone marrow.
87. A method of expanding an endothelial progenitor cell population
comprising contacting an endothelial progenitor cell with a
cytokine.
88. The method of claim 87, wherein the cytokine is selected from
the group consisting of G-CSF, GM-CSF, M-CSF, VEGF, and FGF.
89. A method of expanding an endothelial progenitor cell population
comprising contacting an endothelial progenitor cell with a
chemokine.
90. The method of claim 89, wherein the chemokine is a CC
chemokine.
91. The method of claim 90, wherein the CC chemokine is selected
from the group consisting of RANTES, EOTAXIN, MCP-1, MCP-2, MCP-3,
and MCP-4.
92. A method of identifying bone marrow-derived endothelial
progenitor cells comprising recovering progenitor cells based on
their expression of CD117.
93. A method of identifying bone marrow-derived endothelial
progenitor cells comprising recovering progenitor cells based on
their expression of any or all of the group consisting of GATA-2,
GATA-3, CD34, AC133, CD34 and CD117.
94. The method of claim 1, wherein the removal of the stem cells
from the subject is effected by a method comprising; (a) eliciting
production of growth factor in the subject to mobilize the stem
cells into the subject's blood; and (b) removing a sample of blood
containing the stem cells from the subject.
95. The method of claim 94, wherein the growth factor production is
elicited by a gene therapy technique.
96. A method of selectively increasing the trafficking of
endothelial progenitor cells to ischemia-damaged tissue in a
subject comprising eliciting chemokine production in the subject so
as to thereby attract the endothelial progenitor cells to the
ischemia-damaged tissue.
97. The method of claim 96, wherein the chemokine production is
elicited by a gene therapy technique.
98. The method of claim 97, further comprising administering
endothelial progenitor cells to the subject.
Description
[0001] This application is a continuation-in-part and claims
priority of U.S. Ser. No. 09/587,441, filed Jun. 5, 2000, the
contents of which are hereby incorporated by reference.
[0002] Throughout this application, various references are referred
to within parentheses. Disclosures of these publications in their
entireties are hereby incorporated by reference into this
application to more fully describe the state of the art to which
this invention pertains. Full bibliographic citation for these
references may be found at the end of this application, preceding
the claims.
BACKGROUND OF THE INVENTION
[0003] Left ventricular remodeling after myocardial infarction is a
major cause of subsequent heart failure and death. The capillary
network cannot keep pace with the greater demands of the
hypertrophied but viable myocardium, resulting in myocardial death
and fibrous replacement. The first series of experiments of the
present invention, described below, show that human adult bone
marrow contains endothelial cell precursors with phenotypic and
functional characteristics of embryonic hemangioblasts, and that
these can be mobilized, expanded, and used to induce infarct bed
vasculogenesis after experimental myocardial infarction. The
neo-angiogenesis results in significant and sustained increase in
viable myocardial tissue, reduction in collagen deposition, and
improved myocardial function. The use of cytokine-mobilized
autologous human bone marrow-derived angioblasts for
revascularization of myocardial infarct tissue, alone or in
conjunction with currently used therapies, offers the potential to
significantly reduce morbidity and mortality associated with left
ventricular remodeling post-myocardial infarction.
[0004] Although prompt reperfusion within a narrow time window has
significantly reduced early mortality from acute myocardial
infarction, post-infarction heart failure is increasing and
reaching epidemic proportions (1). Left ventricular remodeling
after myocardial infarction, characterized by expansion of the
initial infarct area, progressive thinning of the wall surrounding
the infarct, and dilation of the left ventricular lumen, has been
identified as a major prognostic factor for subsequent heart
failure (2,3). This process is accompanied by transcription of
genes normally expressed only in the fetal state, rapid and
progressive increase in collagen secretion by cardiac fibroblasts,
deposition of fibrous tissue in the ventricular wall, increased
wall stiffness, and both diastolic and systolic dysfunction (4,5).
Hypoxia directly stimulates collagen secretion by cardiac
fibroblasts, while inhibiting DNA synthesis and cellular
proliferation (6). In animal models, late reperfusion following
experimental myocardial infarction at a point beyond myocardial
salvage significantly benefits remodeling (7). Moreover, the
presence of a patent infarct related artery is consistently
associated with survival benefits in the post-infarction period in
humans (8). This appears to be due to adequate reperfusion of the
infarct vascular bed which modifies the ventricular remodeling
process and prevents abnormal changes in wall motion (9).
[0005] Successful reperfusion of non-cardiac tissues rendered
ischemic in experimental animal models has recently been
demonstrated by use of either circulating or bone marrow-derived
cellular elements (10-13). Although the precise nature of these
cells was not defined in these studies, the presence of precursor
cells in both adult human circulation and bone marrow which have
the capability to differentiate into functional endothelial cells,
a process termed vasculogenesis (14-16), has been shown. In the
pre-natal period, precursor cells derived from the ventral
endothelium of the aorta in human and lower species have been shown
to give rise to cellular elements involved in both the processes of
vasculogenesis and hematopoiesis (17,18). These cells have been
termed embryonic hemangioblasts, are characterized by expression of
CD34, CD117 (stem cell factor receptor), Flk-1 (vascular
endothelial cell growth factor receptor-2, VEGFR-2), and Tie-2
(angiopoietin receptor), and have been shown to have high
proliferative potential with blast colony formation in response to
VEGF (19-22). The subsequent proliferation and differentiation of
embryonic hemangioblasts to adult-type pluripotent stem cells
appears to be related to co-expression of the GATA-2 transcription
factor, since GATA-2 knockout embryonic stem cells have a complete
block in definitive hematopoiesis and seeding of the fetal liver
and bone marrow (23). Moreover, the earliest precursor of both
hematopoietic and endothelial cell lineage to have diverged from
embryonic ventral endothelium has been shown to express VEGF
receptors as well as GATA-2 and alpha4-integrins (24). The first
series of experiments of the present invention shows that GATA-2
positive stem cell precursors are also present in adult human bone
marrow, demonstrate properties of hemangioblasts, and can be used
to induce vasculogenesis, thus preventing remodeling and heart
failure in experimental myocardial infarction.
[0006] Growth of new vessels from pre-existing mature endothelium
has been termed angiogenesis, and can be regulated by many factors
including certain CXC chemokines (47-50). In contrast,
vasculogenesis is mediated by bone marrow-derived endothelial
precursors (51-53) with phenotypic characteristics of embryonic
angioblasts and growth/differentiation properties regulated by
receptor tyrosine kinases such as vascular endothelial growth
factor (VEGF) (54-57). Therapeutic vasculogenesis (58-61) has the
potential to improve perfusion of ischemic tissues, however the
receptor/ligand interactions involved in selective trafficking of
endothelial precursors to sites of tissue ischemia are not known.
The second series of experiments of the present invention,
described below, show that vasculogenesis can develop in infarcted
myocardium as a result of interactions between CXC receptors on
human bone marrow-derived angioblasts and ELR-positive CXC
chemokines induced by ischemia, including IL-8 and Gro-alpha.
Moreover, redirected trafficking of angioblasts from the bone
marrow to ischemic myocardium can be achieved by blocking
CXCR4/SDF-1 interactions, resulting in increased vasculogenesis,
decreased myocardial death and fibrous replacement, and improved
cardiac function. The results of the experiments indicate that CXC
chemokines, including IL-8, Gro-alpha, and stromal-derived factor-1
(SDF-1), play a central role in regulating vasculogenesis in the
adult human, and suggest that manipulating interactions between CXC
chemokines and their receptors on bone marrow-derived angioblasts
can lead to optimal therapeutic vasculogenesis and salvage of
ischemic tissues. The third series of experiments, described below,
show that CC chemokines also play a role in mediating angioblast
chemotaxis to ischemic myocardium.
[0007] The angiogenic response during wound repair or inflammation
is thought to result from changes in adhesive interactions between
endothelial cells in pre-existing vasculature and extracellular
matrix which are regulated by locally-produced factors and which
lead to endothelial cell migration, proliferation, reorganization
and microvessel formation (70). The human CXC chemokine family
consists of small (<10 kD) heparin-binding polypeptides that
bind to and have potent chemotactic activity for endothelial cells.
Three amino acid residues at the N-terminus (Glu-Leu-Arg, the ELR
motif) determine binding of CXC chemokines such as IL-8 and
Gro-alpha to CXC receptors 1 and 2 on endothelial cells (49,71),
thus promoting endothelial chemotaxis and angiogenesis (47-48). In
contrast, CXC chemokines lacking the ELR motif bind to different
CXC receptors and inhibit growth-factor mediated angiogenesis
(49-72). Although SDF-1, an ELR-negative CXC chemokine, is a potent
inducer of endothelial chemotaxis through interactions with CXCR4
(73), its angiogenic effects appear to be limited to the developing
gastrointestinal tract vascular system (50).
[0008] Vasculogenesis first occurs during the pre-natal period,
with haemangioblasts derived from the human ventral aorta giving
rise to both endothelial and haematopoietic cellular elements
(74,75). Similar endothelial progenitor cells have recently been
identified in adult human bone marrow (51-53), and shown to have
the potential to induce vasculogenesis in ischemic tissues (59-61).
However, the signals from ischemic sites required for
chemoattraction of such bone marrow-derived precursors, and the
receptors used by these cells for selective trafficking to these
sites, are unknown. Following myocardial infarction a process of
neoangiogenesis occurs (62,63), but is insufficient to sustain
viable tissue undergoing compensatory hypertrophy, leading to
further cell death, expansion of the initial infarct area, and
collagen replacement (64-66). This process, termed remodeling,
results in progressive heart failure (67-69). In the experiments
described below, a nude rat model of myocardial infarction was used
to investigate whether CXC chemokines containing the ELR motif
regulate migration of human bone marrow-derived angioblasts to
sites of tissue ischemia. Moreover, since selective bone marrow
homing and engraftment of haematopoietic progenitors depends on
CXCR4 binding to SDF-1 expressed constitutively in the bone marrow
(76-78), whether interruption of CXCR4/SDF-1 interactions could
redirect trafficking of human bone marrow-derived angioblasts to
sites of tissue ischemia, thereby augmenting therapeutic
vasculogenesis, was examined. The results of the experiments
indicate that CXC chemokines, including IL-8, Gro-alpha, and SDF-1,
play a central role in regulating human adult bone marrow-dependent
vasculogenesis. Further, the fourth series of experiments described
below show that stem cells can induce angiogenesis in peri-infarct
tissue.
SUGARY OF THE INVENTION
[0009] This invention provides a method of stimulating
vasculogenesis in ischemia-damaged tissue of a subject
comprising:
[0010] (a) removing stem cells from a location within the
subject;
[0011] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and
[0012] (c) introducing the endothelial progenitor cells from step
(b) into a different location within the subject such that the
endothelial progenitor cells stimulate vasculogenesis in the
subject's ischemia-damaged tissue.
[0013] This invention also provides the instant method, wherein
subsequent to step (b), but before step (c), the endothelial
progenitor cells are expanded by contacting them with a growth
factor.
[0014] This invention also provides the instant method, wherein the
growth factor is a cytokine.
[0015] This invention also provides the instant method, wherein the
cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF.
[0016] This invention also provides the instant method, wherein the
growth factor is a chemokine.
[0017] This invention also provides the instant method, wherein the
chemokine is Interleukin-8.
[0018] This invention also provides the instant method, wherein the
endothelial progenitor cells are separated from other stem cells
before expansion.
[0019] This invention also provides the instant method, wherein the
ischemia-damaged tissue is myocardium.
[0020] This invention also provides the instant method, wherein the
ischemia-damaged tissue is nervous system tissue.
[0021] This invention also provides the instant method, wherein the
stem cells are removed from the subject's bone marrow.
[0022] This invention also provides the instant method, wherein the
removal of the stem cells from the bone marrow is effected by
aspiration from the subject's bone marrow.
[0023] This invention also provides the instant method, wherein the
removal of the stem cells from the subject is effected by a method
comprising:
[0024] (a) introducing a growth factor into the subject to mobilize
the stem cells into the subject's blood; and
[0025] (b) removing a sample of blood containing the stem cells
from the subject.
[0026] This invention also provides the instant method, wherein the
growth factor is introduced into the subject subcutaneously,
orally, intravenously or intramuscularly.
[0027] This invention also provides the instant method, wherein the
growth factor is a chemokine that induces mobilization.
[0028] This invention also provides the instant method, wherein the
chemokine is Interleukin-8.
[0029] This invention also provides the instant method, wherein the
growth factor is a cytokine.
[0030] This invention also provides the instant method, wherein the
cytokine is G-CSF, M-CSF, or GM-CSF.
[0031] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of CD117.
[0032] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of a GATA-2 activated gene product.
[0033] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of one or more of CD34, VEGF-R, Tie-2, GATA-3 or
AC133.
[0034] This invention also provides the instant method, wherein the
subject has suffered or is suffering from one or more of the
following: myocardial infarction, chronic heart failure, ischemic
heart disease, coronary artery disease, diabetic heart disease,
hemorrhagic stroke, thrombotic stroke, embolic stroke, limb
ischemia, or another disease in which tissue is rendered
ischemic.
[0035] This invention also provides the instant method, wherein
step (a) occurs prior to the subject suffering ischemia-damaged
tissue and wherein step (c) occurs after the subject has suffered
ischemia-damaged tissue.
[0036] This invention also provides the instant method, wherein the
endothelial progenitor cells are frozen for a period of time
between steps (b) and (c).
[0037] This invention also provides the instant method, wherein the
endothelial progenitor cells are frozen for a period of time after
being expanded but before step (c) is performed.
[0038] This invention also provides the instant method, wherein the
endothelial progenitor cells are introduced into the subject by
injection directly into the peripheral circulation, heart muscle,
left ventricle, right ventricle, coronary artery, cerebro-spinal
fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
[0039] This invention also provides the instant method, further
comprising administering to the subject one or more of the
following: an inhibitor of Plasminogen Activator Inhibitor,
Angiotensin Converting Enzyme Inhibitor or a beta blocker, wherein
such administration occurs prior to, concomitant with, or following
step (c).
[0040] This invention also provides a method of stimulating
angiogenesis in peri-infarct tissue in a subject comprising:
[0041] (a) removing stem cells from a location within a
subject;
[0042] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a);
[0043] (c) expanding the endothelial progenitor cells recovered in
step (b) by contacting the progenitor cells with a growth factor;
and
[0044] (d) introducing the expanded endothelial progenitor cells
from step (c) into a different location in the subject such that
the endothelial progenitor cells stimulate angiogenesis in
peri-infarct tissue in the subject.
[0045] This invention also provides a method of selectively
increasing the trafficking of endothelial progenitor cells to
ischemia-damaged tissue in a subject comprising:
[0046] (a) administering endothelial progenitor cells to a subject;
and
[0047] (b) administering a chemokine to the subject so as to
thereby attract the endothelial progenitor cells to the
ischemia-damaged tissue.
[0048] This invention also provides the instant method, wherein the
chemokine is administered to the subject prior to administering the
endothelial progenitor cells.
[0049] This invention also provides the instant method, wherein the
chemokine is administered to the subject concurrently with the
endothelial progenitor cells.
[0050] This invention also provides the instant method, wherein the
chemokine is administered to the subject after administering the
endothelial progenitor cells.
[0051] This invention also provides the instant method, wherein the
chemokine is a CXC chemokine.
[0052] This invention also provides the instant method, wherein the
CXC chemokine is selected from the group consisting of
Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
[0053] This invention also provides the instant method, wherein the
chemokine is a CC chemokine.
[0054] The method of claim 34, wherein the CC chemokine is selected
from the group consisting of RANTES, EOTAXIN, MCP-1, MCP-2, MCP-3,
or MCP-4.
[0055] This invention also provides the instant method, wherein the
chemokine is administered to the subject by injection into the
subject's peripheral circulation, heart muscle, left ventricle,
right ventricle, coronary arteries, cerebro-spinal fluid, neural
tissue, ischemic tissue, or post-ischemic tissue.
[0056] This invention also provides a method of increasing
trafficking of endothelial progenitor cells to ischemia-damaged
tissue in a subject comprising inhibiting any interaction between
Stromal-Derived Factor-1 and CXCR4.
[0057] This invention also provides the instant method, wherein
interaction between Stromal-Derived Factor-1 (SDF-1)and CXCR4 is
inhibited by administration of an anti-SDF-1 or an anti-CXCR4
monoclonal antibody to the subject.
[0058] This invention also provides the instant method, further
comprising administering to the subject an angiotensin converting
enzyme inhibitor, an AT.sub.1-receptor blocker, or a beta
blocker.
[0059] This invention also provides a method of reducing
trafficking of endothelial progenitor cells to bone marrow in a
subject comprising inhibiting production of Stromal-Derived
Factor-1 in the subject's bone marrow.
[0060] This invention also provides the instant method, wherein
SDF-1 production is inhibited by administration of an anti-SDF-1 or
anti-CXCR4 monoclonal antibody to the subject.
[0061] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific chemokine
produced by proliferating cells associated with the cancer so as to
reduce trafficking of endothelial progenitor cells to such
proliferating cells and thereby treat the cancer in the
subject.
[0062] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific receptor located
on an endothelial progenitor cell, for a chemokine produced by
proliferating cells associated with the cancer, so as to reduce
trafficking of the endothelial progenitor cell to such
proliferating cells and thereby treat the cancer in the
subject.
[0063] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce vasculogenesis in
the subject's tumor and thereby treat the tumor.
[0064] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce angiogenesis in the
subject's tumor and thereby treat the tumor.
[0065] This invention also provides the instant method, wherein the
receptor is a CD117 receptor.
[0066] This invention also provides a method for expressing a gene
of interest in an endothelial progenitor cell or a mast progenitor
cell which comprises inserting into the cell a vector comprising a
promoter containing a GATA-2 motif and the gene of interest.
[0067] This invention also provides the instant method, wherein the
vector is inserted into the cell by transfection.
[0068] This invention also provides the instant method, wherein the
promoter is a preproendothelin-1 promoter.
[0069] This invention also provides the instant method, wherein the
promoter is of mammalian origin.
[0070] This invention also provides the instant method, wherein the
promoter is of human origin.
[0071] This invention provides a composition comprising an amount
of a monoclonal antibody directed against an epitope of a specific
chemokine produced by a cancer effective to reduce trafficking of
endothelial progenitor cells to the cancer, and a pharmaceutically
acceptable carrier.
[0072] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0073] (a) removing stem cells from a location within the
subject;
[0074] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a);
[0075] (c) recovering those endothelial progenitor cells recovered
in step (b) that express GATA-2;
[0076] (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and
[0077] (e) introducing the cells expressing a GATA-2 activated gene
product from step (d) into a different location in the subject such
as to treat the abnormality.
[0078] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0079] (a) removing stem cells from a location within the
subject;
[0080] (b) recovering mast progenitor cells from the stem cells
removed in step (a);
[0081] (c) recovering those mast progenitor cells recovered in step
(b) that express GATA-2;
[0082] (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and
[0083] (e) introducing the cells expressing a GATA-2 activated gene
product from step (d) into a different location in the subject such
as to treat the abnormality
[0084] This invention provides the instant method, wherein the
abnormality is ischemia-damaged tissue.
[0085] This invention provides the instant method, wherein the gene
product is proendothelin.
[0086] This invention provides the instant method, wherein the gene
product is endothelin.
[0087] This invention provides the a method of improving myocardial
function in a subject that has suffered a myocardial infarct
comprising:
[0088] (a) removing stem cells from a location in the subject;
[0089] (b) recovering cells that express CD117 from the stem cells;
and
[0090] (c) introducing the recovered cells into a different
location in the subject such that the cells improve myocardial
function in the subject.
[0091] This invention provides the instant methods, wherein the
subject is of mammalian origin.
[0092] This invention provides the instant method, wherein the
mammal is of human origin.
[0093] This invention also provides a method of stimulating
vasculogenesis in ischemia-damaged tissue in a subject
comprising:
[0094] (a) obtaining allogeneic stem cells;
[0095] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and
[0096] (c) introducing the endothelial progenitor cells recovered
in step (b) into the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
[0097] This invention provides the instant method, wherein the
allogeneic stem cells are obtained from embryonic, fetal or cord
blood sources.
[0098] This invention provides a method of stimulating angiogenesis
in ischemia-damaged tissue in a subject comprising:
[0099] (a) obtaining allogeneic stem cells;
[0100] (b) recovering endothelial progenitor cells in the stem
cells removed in step (a); and
[0101] (c) introducing the endothelial progenitor cells recovered
in step (b) into the subject such that the endothelial progenitor
cells stimulate angiogenesis in the subject's ischemia-damaged
tissue.
[0102] This invention provides the instant method, wherein the
allogeneic stem cells are obtained from embryonic, fetal or cord
blood sources.
[0103] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting G-CSF into the subject in order to
mobilize endothelial progenitor cells.
[0104] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting anti-CXCR4 antibody into the
subject.
[0105] This invention also provides the instant method further
comprising introducing endothelial progenitor cells into the
subject.
[0106] This invention also provides the instant method further
comprising introducing G-CSF into the subject in order to mobilize
endothelial progenitor cells.
BRIEF DESCRIPTION OF THE FIGURES
[0107] FIG. 1. G-CSF Mobilizes Two Human Bone Marrow-Derived
Populations Expressing VEGF Receptors: One With Characteristics Of
Mature Endothelial Cells. And A Second With Characteristics Of
Embryonic Angioblasts.
[0108] A-D depicts four-parameter flow cytometric phenotype
characterization of G-CSF mobilized bone marrow-derived cells
removed by leukopharesis from a representative human donor adult
(25). Only live cells were analyzed, as defined by 7-AAD staining.
For each marker used, shaded areas represent background log
fluorescence relative to isoytpe control antibody.
[0109] A. Following immunoselection of mononuclear cells (25),
>95% of live cells express CD34.
[0110] B. The CD34+CD117.sup.dim subset contains a population with
phenotypic characteristics of mature, vascular endothelium.
[0111] C. The CD34+CD117.sup.bright subset contains a population
expressing markers characteristic of primitive hemangioblasts
arising during waves of murine and human embryogenesis.
[0112] D. CD34+CD117.sup.bright cells co-expressing GATA-2 and
GATA-3 also express AC133, another marker which defines
hematopoietic cells with angioblast potential.
[0113] FIG. 2. Bone Marrow-Derived Angioblasts (BA) Have Greater
Proliferative Activity In Response To Both VEGF And Ischemic Serum
Than Bone Marrow-Derived Endothelial Cells (BMEC).
[0114] Depicted is the response of single-donor CD34-positive human
cells sorted by a fluorescent GATA-2 mAb and cultured for 96 hours
in RPMI with 20% normal rat serum, ischemic rat serum or 20 ng/ml
VEGF. The numbers of CD117.sup.brightGATA-2.sup.pos and
CD117.sup.dim GATA-2.sup.neg cells were quantitated by both
[.sup.3H] thymidine uptake and by flow cytometry.
[0115] A. In comparison to culture in normal serum, the
proliferative responses to either VEGF or ischemic serum were
significantly higher for CD117.sup.brightGATA-2.sup.pos BA relative
to CD117.sup.dimGATA-2.sup.neg- BMEC from the same donor (both
p<0.01).
[0116] B. The population expanded by culture with either VEGF or
ischemic serum and characterized by multiparameter flow cytometric
analysis as CD117.sup.brightGATA-2.sup.pos consisted of large blast
cells, as demonstrated by high forward scatter (fsc).
[0117] C. The expanded population of CD117.sup.brightGATA-2.sup.pos
cells did not demonstrate increased surface expression of mature
endothelial cell markers after culture with VEGF in comparison to
culture with normal medium, indicating blast proliferation without
differentiation.
[0118] FIG. 3. Highly Purified Human Bone Marrow-Derived CD34 Cells
Differentiate Into Endothelial Cells After in Vitro Culture.
[0119] Culture of highly-purified CD34+ human cells for 7 days in
endothelial growth medium results in outgrowth of cells with
morphologic and characteristic features of mature endothelial cell
monolayers. The majority of the monolayers (>90%)
demonstrate:
[0120] A. Exuberant cobblestone pattern of cellular proliferation
and growth;
[0121] B. Uniform uptake of DiI-labeled acetylated LDL;
[0122] C. CD34 expression, as measured by immunofluorescence using
a fluorescein-conjugated mAb;
[0123] D. Factor VIII expression, as measured by immunoperoxidase
using a biotin-conjugated mAb; and
[0124] E. Expression of eNOS, determined by in situ hybridization
using a specific probe.
[0125] FIG. 4. In vivo migratory and proliferative characteristics
of bone marrow- and peripheral vasculature-derived human cells
after induction of myocardial ischemia.
[0126] A-C. Intravenous injection of 2.times.10.sup.6 DiI-labeled
human CD34-enriched cells (>95% CD34 purity), CD34-negative
cells (<5% CD34 purity), or saphenous vein endothelial cells
(SVEC), into nude rats after coronary artery ligation and
infarction. Each human cellular population caused a similar degree
of infiltration in infarcted rat myocardium at 48 hours.
[0127] D. A sham procedure, with no human cells found in the
non-infarcted rat heart.
[0128] E. Measurement of human GATA-2 mRNA expression in the bone
marrow and heart of infarcted rats receiving either CD34-positive
cells (>95% CD34 purity), CD34-negative cells (<5% CD34
purity), normalized for total human RNA measured by GAPDH
expression. GATA-2 mRNA in ischemic tissue is expressed as the fold
increase above that present under the same experimental condition
in the absence of ischemia. Bone marrow from ischemic rats
receiving either CD34+ or CD34- cells contained similar levels of
human GATA-2 mRNA, and showed a similar fold induction in GATA-2
mRNA expression after ischemia. In contrast, ischemic hearts of
rats receiving CD34+ cells contained much higher levels of human
GATA-2 mRNA than those receiving CD34- cells. Moreover, the degree
of increase in GATA-2 mRNA expression after infarction was 2.6-fold
higher for hearts infiltrated by CD34+ cells compared with CD34-
cells, indicating that GATA-2+ cells within the CD34+ fraction
selectively traffic to ischemic myocardium.
[0129] F. Consecutive sections of a blood vessel within the infarct
bed of a nude rat two weeks after injection of human CD34+ cells.
The vessel incorporates human endothelial cells, as defined by
co-expression of DiI, HLA class I as measured by immunofluorescence
using a fluorescein-conjugated mAb, and factor VIII, as measured by
immunoperoxidase using a biotin-conjugated mAb.
[0130] FIG. 5. Injection of G-CSF Mobilized Human CD34+ Cells Into
Rats With Acute Infarction Improves Myocardial Function.
[0131] A-D compares the functional effects of injecting
2.times.10.sup.6 G-CSF mobilized human CD34+ (>95% purity)
cells, CD34- (<5% purity) cells, peripheral saphenous vein
cells, or saline, into infarcted rat myocardium.
[0132] A. Although left ventricular ejection fraction (LVEF) was
severely depressed in each group of recipients after LAD ligation,
only injection of G-CSF mobilized adult human CD34+ cells was
accompanied by significant, and sustained, LVEF recovery
(p<0.001). LVEF recovery was calculated as the mean %
improvement between LVEF after LAD ligation and pre-infarct
LVEF.
[0133] B. Similarly, although left ventricular end-systolic area
(LVAS) was markedly increased in each group of recipients after LAD
ligation, only injection of G-CSF mobilized adult human CD34+ cells
was accompanied by significant, and sustained, reduction in LVAs
(p<0.001) Reduction in LVAs was calculated as the mean %
improvement between LVAs after LAD ligation and pre-infarct
LVAs.
[0134] C. Representative echocardiographic examples from each group
are shown. At 48 hours after LAD ligation, diastolic function is
severely compromised in each rat.
[0135] At two weeks after injection, diastolic function is improved
only in the rat receiving CD34+ cells. This effect persists at 15
weeks.
[0136] D. At 15 weeks post-infarction, rats injected with CD34+
cells demonstrated significantly less reduction in mean cardiac
index relative to normal rats than each of the other groups
(p<0.001).
[0137] FIG. 6. Injection Of G-CSF Mobilized Human CD34+ Cells Into
Rats With Acute Infarction Induces Neo-Angiogenesis And. Modifies
The Process Of Myocardian Remodeling.
[0138] A-D depicts infarcted rat myocardium at two weeks post-LAD
ligation from representative experimental and control animals
stained with either hematoxylin and eosin (A,B) or immunoperoxidase
following binding of anti-factor VIII mAb (C,D). E,F depicts Mason
trichrome stain of infarcted rat myocardium from representative
control and experimental animals at 15 weeks post-LAD ligation. G
depicts between-group differences in % scar/normal left ventricular
tissue at 15 weeks.
[0139] A. Infarct zone of rat injected with human CD34+ cells
demonstrates significant increase in microvascularity and
cellularity of granulation tissue, numerous capillaries
(arrowheads), feeding vessels (arrow), and decrease in matrix
deposition and fibrosis (x200).
[0140] B. In-contrast, infarct zone of control rat injected with
saline shows a myocardial scar composed of paucicellular, dense
fibrous tissue (arrows) (x200).
[0141] C. Ischemic myocardium of rat injected with human CD34+
cells demonstrates numerous factor VIII-positive interstitial
angioblasts (arrows), and diffuse increase in factor VIII-positive
capillaries (arrowheads) (x400).
[0142] D. Ischemic myocardium of rat injected with saline does not
contain factor VIII-positive angioblasts (arrows), and demonstrates
only focal areas of granulation tissue with factor VIII positive
vascularity (arrowheads) (x400).
[0143] E. Trichrome stain of rat myocardium at 15 weeks
post-infarction in rat injected with saline (x25). The collagen
rich myocardial scar in the anterior wall of the left ventricle
(ant.) stains blue and viable myocardium stains red. Focal islands
of collagen deposition (blue) are also present in the posterior
wall of the left ventricle (post). There is extensive loss of
anterior wall myocardial mass, with collagen deposition and scar
formation extending almost through the entire left ventricular wall
thickness, causing aneurysmal dilatation and typical EKG
abnormalities (persistent ST segment elevation).
[0144] F. In contrast, trichrome stain of rat myocardium at 15
weeks post-infarction in rat receiving highly purified CD34+ cells
(x25) demonstrates significantly reduced infarct zone size together
with increased mass of viable myocardium within the anterior wall
(ant.) and normal EKG. Numerous vessels are evident at the junction
of the infarct zone and viable myocardium. There is no focal
collagen deposition in the left ventricular posterior wall
(post).
[0145] G. Rats receiving CD34+ cells had a significant reduction in
mean size of scar tissue relative to normal left ventricular
myocardium compared with each of the other groups (p<0.01).
Infarct size, involving both epicardial and endocardial regions,
was measured with a planimeter digital image analyzer and expressed
as a percentage of the total ventricular circumference at a given
slice. For each animal, final infarct size was calculated as the
average of 10-15 slices.
[0146] FIG. 7. Human Adult Bone Marrow-Derived Endothelial
Precursor Cells Infiltrate Ischemic Myocardium, Inducing Infarct
Bed Neoangiogenesis And Preventing Collagen Deposition.
[0147] A. Four-parameter flow cytometric phenotypic
characterization of G-CSF mobilized bone marrow-derived cells
removed by leukopheresis from a representative human donor adult.
Only live cells were analyzed, as defined by 7-AAD staining. For
each marker used, shaded areas represent background log
fluorescence relative to isotype control antibody. The
CD34+CD117.sup.bright subset contains a population expressing
markers characteristic of primitive haemangioblasts arising during
waves of murine and human embryogenesis, but not markers of mature
endothelium. These cells also express CXC chemokine receptors.
[0148] B. DiI-labeled human CD34-enriched cells (>98% CD34
purity) injected intravenously into nude rats infiltrate rat
myocardium after coronary artery ligation and infarction but not
after sham operation at 48 hours.
[0149] C. The myocardial infarct bed at two weeks post-LAD ligation
from representative rats receiving 2.0.times.10.sup.6 G-CSF
mobilized human bone marrow-derived cells at 2%, 40%, or 98% CD34+
purity, and stained with either Masson's trichrome or
immunoperoxidase. The infarct zones of rats receiving either 2% or
40% pure CD34+ cells show myocardial scars composed of
paucicellular, dense fibrous tissue stained blue (x400). In
contrast, the infarct zone of the rat injected with 98% pure human
CD34+ cells demonstrates significant increase in microvascularity
and cellularity of granulation tissue, numerous capillaries, and
minimal matrix deposition and fibrosis (x400). Moreover,
immunoperoxidase staining following binding of anti-factor VIII mAb
shows that the infarct bed of the rat injected with 98% pure CD34+
cells demonstrates markedly increased numbers of factor
VIII-positive capillaries, which are not seen in either of the
other animals (x400).
[0150] FIG. 8. Migration Of Human Bone Marrow-Derived Endothelial
Precursor Cells To The Site Of Infarction Is Dependent On
Interactions Between CXCR1/2 And IL-8/Gro-Alpha Induced By
Myocardial Ischemia.
[0151] A,B. Time-dependent increase in rat myocardial IL-8 and
Gro-alpha mRNA expression relative to GAPDH from rats undergoing
LAD ligation.
[0152] C. IL-8, Gro-alpha, and GAPDH mRNA expression at baseline,
12 hours and 48 hours after LAD ligation from a representative
animal.
[0153] D. Time-dependent measurement of rat IL-8/Gro-alpha protein
in serum of rats undergoing LAD ligation. Migration of CD34+ human
bone marrow-derived cells to ischemic rat myocardium is inhibited
by mAbs against either rat IL-8 or the IL-8/Gro chemokine family
receptors CXCR1 and CXCR2 (all p<0.01), but not against VEGF or
its receptor Flk-1 (results are expressed as mean .+-. sem of three
separate experiments).
[0154] FIG. 9. CXC Chemokines Directly Induce Chemotaxis Of Bone
Marrow-Derived Human CD34+ Cells To Rat Myocardium.
[0155] A and B depict results of in vitro chemotaxis of 98% pure
human CD34+ cells to various conditions using a 48-well chemotaxis
chamber (Neuro Probe, Md.). Chemotaxis is defined as the number of
migrating cells per high power field (hpf) after examination of 10
hpf per condition tested.
[0156] A. IL-8 induces chemotaxis in a dose-dependent manner
(results are expressed as mean .+-. sem of three separate
experiments).
[0157] B. Chemotaxis is increased in response to IL-8 and SDF-1
alpha/beta, but not VEGF or SCF.
[0158] C. Representative fluorescence microscopy demonstrating
increased infiltration of intravenously-injected DiI-labeled human
CD34+ cells (98% purity) into rat heart after intracardiac
injection with IL-8 compared with saline injection.
[0159] D. Intracardiac injection of IL-8 at 1 mg/ml significantly
increases in vivo chemotaxis of DiI-labeled human CD34+ cells (98%
purity) into rat heart in comparison with injection of saline, VEGF
or stem cell factor (SCF), p<0.01 (results are expressed as mean
.+-. sem of three separate experiments).
[0160] FIG. 10. Blocking CXCR4/SDF-1 Interactions Redirects
Intravenously Injected Human CD34+ Angioblasts From Bone Marrow To
Ischemic Myocardium.
[0161] A. Depicted is the response of single-donor CD34-positive
human cells cultured for 96 hours in RPMI with 20% normal rat
serum, ischemic rat serum or 20 ng/ml VEGF.
[0162] The numbers of CD117.sup.brightGATA-2.sup.pos cells were
quantitated by both [.sup.3H] thymidine uptake and by flow
cytometry. Ischemic serum induced a greater proliferative response
of CD117.sup.brightGATA-2.sup.pos cells compared with each of the
other conditions (both p<0.01).
[0163] B. The proportion of human CD34+ cells in rat bone marrow
2-14 days after intravenous injection is significantly increased
after ischemia induced by LAD ligation (results are expressed as
mean .+-. sem of bone marrow studies in three animals at each time
point).
[0164] C,D. Effects of mAbs against CXCR4, SDF-1 or anti-CD34 on
trafficking of human CD34+ cells to rat bone marrow and myocardium
following LAD ligation. Co-administration of anti-CXCR4 or
anti-SDF-1 significantly reduced trafficking of 98% pure CD34+
cells to rat bone marrow at 48 hours and increased trafficking to
ischemic myocardium (results are expressed as mean .+-. sem of bone
marrow and cardiac studies performed in three LAD-ligated animals
at 48 hours after injection).
[0165] FIG. 11. Redirected Trafficking Of Human CD34+ Angioblasts
To The Site Of Infarction Prevents Remodeling And Improves
Myocardial Function.
[0166] A,B. The effects of human CD34+ cells on reduction in LVAs
(A) and improvement in LVEF (B) after myocardial infarction.
Whereas injection of 2.0.times.10.sup.6 human cells containing 98%
CD34+ purity significantly improved LVEF and reduced LVAs (both
p<0.0l), injection of 2.0.times.10.sup.6 human cells containing
2% and 40% CD34+ purity did not have any effect on these parameters
in comparison to animals receiving saline. However,
co-administration of anti-CXCR4 together with 40% pure CD34+ cells
significantly improved LVEF and reduced LVAs (both p<0.0l), to
levels approaching use of cells with 98% purity.
[0167] C. Sections of rat hearts stained with Masson's trichrome at
15 weeks after LAD ligation and injection of 2.0.times.10.sup.6
human cells containing 2%, 40%, or 98% CD34+ purity. Hearts of rats
receiving 2% and 40% pure CD34+ cells had greater loss of anterior
wall mass, collagen deposition (blue), and septal hypertrophy
compared with hearts of rats receiving 98% pure CD34+ cells.
Co-administration of anti-CXCR4 mAb together with 40% pure CD34+
cells increased left ventricular wall mass and reduced collagen
deposition.
[0168] D. Shows the mean proportion of scar/normal left ventricular
myocardium in rats receiving >98% pure CD34+ cells or 40% pure
CD34+ cells together with anti-CXCR4 mAb is significantly reduced
in comparison to rats receiving 2% and 40% pure CD34+ cells
(p<0.01) (results are expressed as mean i sem of three separate
experiments).
[0169] FIG. 12. Culture of CD34+CD117.sup.bright angioblasts with
serum from LAD-ligated rats increases surface expression of CCR1
and CCR2, while surface expression of CCR3 and CCR5 remains
unchanged.
[0170] FIG. 13. Infarcted myocardium demonstrate a time-dependent
increase in mRNA expression of several CCR-binding chemokines.
[0171] FIG. 14. Co-administration of blocking mabs against MCP-1,
MCP-3, and RANTES, or against eotaxin, reduced myocardial
trafficking of human angioblasts by 40-60% relative to control
antibodies (p<0.01).
[0172] FIG. 15. Intracardiac injection of eotaxin into
non-infarcted hearts induced 1.5-1.7 fold increase in CD34+
angioblast trafficking whereas injection of the growth factors VEGF
and stem cell factor had no effect on chemotaxis despite increasing
angioblast proliferation (not shown).
DETAILED DESCRIPTION OF THE INVENTION
[0173] As used herein, and unless stated otherwise, each of the
following terms shall have the definition set forth below.
[0174] As used herein, "BMEC" is defined as bone marrow-derived
endothelial cells.
[0175] As used herein, vasculogenesis is defined as the creation of
new blood vessels from cells that are "pre-blood" cells such as
bone marrow-derived endothelial cell precursors.
[0176] As used herein, mobilization is defined as inducing bone
marrow-derived endothelial cell precursors to leave the bone marrow
and enter the peripheral circulation. One of skill is aware that
mobilized stem cells may be removed from the body by
leukopheresis.
[0177] As used herein, ischemia is defined as inadequate blood
supply (circulation) to a local area due to blockage of the blood
vessels to the area.
[0178] As used herein, cytokine is defined as a factor that causes
cells to grow or activate.
[0179] As used herein, chemokine is defined as a factor that causes
cells to move to a different area within the body.
[0180] As used herein, ischemic heart disease is defined as any
condition in which blood supply to the heart is decreased.
[0181] As used herein, "angiogenesis" is defined as the creation of
blood vessels from pre-existing blood vessel cells.
[0182] As used herein, ischemic heart disease is defined as any
condition in which blood supply to the heart is decreased.
[0183] As used herein, "VEGF" is defined as vascular endothelial
growth factor. "VEGF-R" is defined as vascular endothelial growth
factor receptor. "FGF" is defined as fibroblast growth factor.
"IGF" is defined as Insulin-like growth factor. "SCF" is defined as
stem cell factor. "G-CSF" is defined as granulocyte colony
stimulating factor. "M-CSF" is defined as macrophage colony
stimulating factor. "GM-CSF" is defined as granulocyte-macrophage
colony stimulating factor. "MCP" is defined as monocyte
chemoattractant protein.
[0184] As used herein, "CXC" chemokine refers to the structure of
the chemokine. Each "C" represents a cysteine and "X" represents
any amino acid.
[0185] As used herein, "CC" chemokine refers to the structure of
the chemokine. Each "C" represents a cysteine.
[0186] As used herein, "recovered" means detecting and obtaining a
cell based on the recoverable cell being a cell that binds a
detectably labeled antibody directed against a specific marker on a
cell including, but not limited to, CD117, GATA-2, GATA-3, and
CD34.
[0187] As described herein, the chemokine administered to the
subject could be in the protein form or nucleic acid form.
[0188] This invention provides a method of stimulating
vasculogenesis in ischemia-damaged tissue of a subject
comprising:
[0189] (a) removing stem cells from a location within the
subject;
[0190] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and
[0191] (c) introducing the endothelial progenitor cells from step
(b) into a different location within the subject such that the
endothelial progenitor cells stimulate vasculogenesis in the
subject's ischemia-damaged tissue.
[0192] In a further embodiment the endothelial progenitors are
frozen for a period of time in between steps (b) and (c) In one
embodiment the ischemia-damaged tissue is myocardium. In another
embodiment the ischemia-damaged tissue is nervous system
tissue.
[0193] In one embodiment the endothelial progenitors are expanded
by contacting the endothelial progenitors with a growth factor
subsequent to step (b), but before step (c). In a further
embodiment the growth factor is a cytokine. In further embodiments
the cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF. In another
embodiment the growth factor is a chemokine. In a further
embodiment the chemokine is Interleukin-8. In one embodiment the
endothelial progenitors are separated from other stem cells before
expansion. In a further embodiment the endothelial progenitors are
frozen for a period of time after expansion but before step
(c).
[0194] In one embodiment step (a) occurs prior to the subject
suffering ischemia-damaged tissue and wherein step (c) occurs after
the subject has suffered ischemia-damaged tissue.
[0195] In one embodiment the stem cells are removed directly from
the subject's bone marrow. In a further embodiment the stem cells
are removed by aspiration from the subject's bone marrow. In one
embodiment the stem cells are removed from the subject by a method
comprising:
[0196] a) introducing a growth factor into the subject to mobilize
the stem cells into the subject's blood; and
[0197] b) subsequently removing a sample of blood containing stem
cells from the subject.
[0198] In a further embodiment the growth factor is introduced
subcutaneously, orally, intravenously or intramuscularly. In one
embodiment the growth factor is a chemokine that induces
mobilization. In a further embodiment the chemokine is
Interleukin-8. In one embodiment the growth factor is a cytokine.
In a further embodiment the cytokine is G-CSF, M-CSF, or
GM-CSF.
[0199] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of CD117.
[0200] This invention also provides the instant method, wherein the
endothelial progenitor cells are recovered based upon their
expression of a GATA-2 activated gene product. In one embodiment
the gene product is selected from the following group:
preproendothelin-1, big endothelin, endothelin-1.
[0201] In one embodiment the endothelial progenitors express
GATA-2, and the endothelial progenitors are recovered as such by
detection of intracellular GATA-2 expression or GATA-2 activity in
those cells.
[0202] In one embodiment the subject has suffered or is suffering
from one or more of the following: myocardial infarction, chronic
heart failure, ischemic heart disease, coronary artery disease,
diabetic heart disease, hemorrhagic stroke, thrombotic stroke,
embolic stroke, limb ischemia or another, disease in which tissue
is rendered ischemic.
[0203] In one embodiment the endothelial progenitors are introduced
into the subject by injection directly into the peripheral
circulation, heart muscle, left ventricle, right ventricle,
coronary artery, cerebro-spinal fluid, neural tissue, ischemic
tissue or post-ischemic tissue.
[0204] In one embodiment the method further comprises administering
to the subject one or more of the following: an inhibitor of
Plasminogen Activator Inhibitor, Angiotensin Converting Enzyme
Inhibitor or a beta blocker, wherein such administration occurs
prior to, concomitant with, or following step (c).
[0205] This invention also provides a method of stimulating
angiogenesis in peri-infarct tissue in a subject comprising:
[0206] (a) removing stem cells from a location within a
subject;
[0207] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a);
[0208] (c) expanding the endothelial progenitor cells recovered in
step (b) by contacting the progenitor cells with a growth factor;
and
[0209] (d) introducing the expanded endothelial progenitor cells
from step (c) into a different location in the subject such that
the endothelial progenitor cells stimulate angiogenesis in
peri-infarct tissue in the subject.
[0210] This invention also provides a method of selectively
increasing the trafficking of endothelial progenitor cells to
ischemia-damaged tissue in a subject comprising:
[0211] (a) administering endothelial progenitor cells to a subject;
and
[0212] (b) administering a chemokine to the subject so as to
thereby attract the endothelial progenitor cells to the
ischemia-damaged tissue.
[0213] In one embodiment the chemokine is administered to the
subject prior to administering the endothelial progenitors. In an
alternative embodiment the chemokine is administered to the subject
concurrently with the endothelial progenitors. In an alternative
embodiment the chemokine is administered to the subject after
administering the endothelial progenitors. In one embodiment the
chemokine is a CXC chemokine. In a further embodiment the CXC
chemokine is selected from the group consisting of Interleukin-8,
Gro-Alpha, or Stromal-Derived Factor-1. In one embodiment the
chemokine is a CC chemokine. In a further embodiment the CC
chemokine is selected from the group consisting of RANTES, EOTAXIN,
MCP-1, MCP-2, MCP-3, or MCP-4.
[0214] In one embodiment the chemokine is administered to the
subject by injection into peripheral circulation, heart muscle,
left ventricle, right ventricle, coronary arteries, cerebro-spinal
fluid, neural tissue, ischemic tissue or post-ischemic tissue.
[0215] This invention also provides a method of increasing
trafficking of endothelial progenitor cells to ischemia-damaged
tissue in a subject comprising inhibiting any interaction between
Stromal-Derived Factor-1 and CXCR4.
[0216] In one embodiment the interaction between Stromal-Derived
Factor-1 (SDF-1)and CXCR4 is inhibited by administration of an
anti-SDF-1 or an anti-CXCR4 monoclonal antibody to the subject. In
one embodiment the instant method further comprises administering
to the subject ACE inhibitor, AT-receptor blocker, or beta blocker.
ng enzyme inhibitor, an AT.sub.1-receptor blocker, or a beta
blocker.
[0217] This invention also provides a method of reducing
trafficking of endothelial progenitor cells to bone marrow in a
subject comprising inhibiting production of Stromal-Derived
Factor-1 in the subject's bone marrow. In one embodiment the SDF-1
production is inhibited by administration of an anti-SDF-1 or
anti-CXCR4 monoclonal antibody to the subject.
[0218] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific chemokine
produced by proliferating cells associated with the cancer so as to
reduce trafficking of endothelial progenitor cells to such
proliferating cells and thereby treat the cancer in the
subject.
[0219] This invention also provides a method for treating a cancer
in a subject comprising administering to the subject a monoclonal
antibody directed against an epitope of a specific receptor located
on an endothelial progenitor cell, for a chemokine produced by
proliferating cells associated with the cancer, so as to reduce
trafficking of the endothelial progenitor cell to such
proliferating cells and thereby treat the cancer in the
subject.
[0220] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce vasculogenesis in
the subject's tumor and thereby treat the tumor.
[0221] This invention also provides a method for treating a tumor
in a subject comprising administering to the subject an antagonist
to a specific receptor on an endothelial progenitor cell so as to
reduce the progenitor cell's ability to induce angiogenesis in the
subject's tumor and thereby treat the tumor.
[0222] This invention also provides a method for expressing a gene
of interest in an endothelial progenitor cell or a mast progenitor
cell which comprises inserting into the cell a vector comprising a
promoter containing a GATA-2 motif and the gene of interest.
[0223] This invention also provides the instant method, wherein the
vector is inserted into the cell by transfection.
[0224] This invention also provides the instant method, wherein the
promoter is a preproendothelin-1 promoter.
[0225] This invention also provides the instant method, wherein the
promoter is of mammalian origin.
[0226] This invention also provides the instant method, wherein the
promoter is of human origin.
[0227] This invention provides a composition comprising an amount
of a monoclonal antibody directed against an epitope of a specific
chemokine produced by a cancer effective to reduce trafficking of
endothelial progenitor cells to the cancer, and a pharmaceutically
acceptable carrier.
[0228] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0229] (a) removing stem cells from a location within the
subject;
[0230] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a);
[0231] (c) recovering those endothelial progenitor cells recovered
in step (b) that express GATA-2;
[0232] (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and
[0233] (e) introducing the cells expressing a GATA-2 activated gene
product from step (d) into a different location in the subject such
as to treat the abnormality.
[0234] In one embodiment the abnormality is ischemia-damaged
tissue. In one embodiment the gene product is proendothelin. In one
embodiment the gene product is endothelin. In one embodiment the
subject is a mammal. In a further embodiment the mammal is a
human
[0235] This invention provides a method of treating an abnormality
in a subject wherein the abnormality is treated by the expression
of a GATA-2 activated gene product in the subject comprising:
[0236] (a) removing stem cells from a location within the
subject;
[0237] (b) recovering mast progenitor cells from the stem cells
removed in step (a);
[0238] (c) recovering those mast progenitor cells recovered in step
(b) that express GATA-2;
[0239] (d) inducing the cells recovered in step (c) as expressing
GATA-2 to express a GATA-2 activated gene product; and
[0240] (e) introducing the cells expressing a GATA-2 activated gene
product from step (d) into a different location in the subject such
as to treat the abnormality
[0241] In one embodiment the abnormality is ischemia-damaged
tissue. In one embodiment the gene product is proendothelin. In one
embodiment the gene product is endothelin. In one embodiment the
subject is a mammal. In a further embodiment the mammal is a
human
[0242] This invention provides the a method of improving myocardial
function in a subject that has suffered a myocardial infarct
comprising:
[0243] (a) removing stem cells from a location in the subject;
[0244] (b) recovering cells that express CD117 from the stem cells;
and
[0245] (c) introducing the recovered cells into a different
location in the subject such that the cells improve myocardial
function in the subject.
[0246] In one embodiment the subject is a mammal. In a further
embodiment the mammal is a human.
[0247] This invention also provides a method of stimulating
vasculogenesis in ischemia-damaged tissue in a subject
comprising:
[0248] (a) obtaining allogeneic stem cells;
[0249] (b) recovering endothelial progenitor cells from the stem
cells removed in step (a); and
[0250] (c) introducing the endothelial progenitor cells recovered
in step (b) into the subject such that the endothelial progenitor
cells stimulate vasculogenesis in the subject's ischemia-damaged
tissue.
[0251] In alternative embodiments the allogeneic stem cells are
removed from embryonic, fetal or cord blood sources.
[0252] This invention provides a method of stimulating angiogenesis
in ischemia-damaged tissue in a subject comprising:
[0253] (a) obtaining allogeneic stem cells;
[0254] (b) recovering endothelial progenitor cells in the stem
cells removed in step (a); and
[0255] (c) introducing the endothelial progenitor cells recovered
in step (b) into the subject such that the endothelial progenitor
cells stimulate angiogenesis in the subject's ischemia-damaged
tissue.
[0256] In alternative embodiments the allogeneic stem cells are
removed from embryonic, fetal or cord blood sources.
[0257] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting G-CSF into the subject in order to
mobilize endothelial progenitor cells.
[0258] This invention also provides a method of improving
myocardial function in a subject that has suffered a myocardial
infarct comprising injecting anti-CXCR4 antibody into the subject.
In one embodiment the method further comprises introducing
endothelial progenitors into the subject. In one embodiment the
method further comprises introducing G-CSF into the subject in
order to mobilize endothelial progenitors.
[0259] This invention will be better understood by reference to the
Experimental Details which follow, but those skilled in the art
will readily appreciate that the specific experiments detailed are
only illustrative of the invention as described more fully in the
claims which follow thereafter.
EXPERIMENTAL DETAILS
First Series of Experiments
Experimental Procedures and Results
[0260] 1. Mobilization and Identification of Bone Marrow-derived
Cells
[0261] Following G-CSF mobilization, 60-80% of highly purified
human CD34 cells (>90% positive) co-expressed the stem cell
factor receptor CD117, FIG. 1a, of which 15-25% expressed CD117
brightly and 75-85% expressed CD117 dimly. By quadruple parameter
analysis, two populations of CD34 cells were recovered which
expressed VEGFR-2 (Flk-1), one accounting for 20-30% of
CD117.sup.dim cells and expressing high levels of VEGFR-2, and a
second accounting for 10-15% of CD117.sup.bright cells and
expressing lower levels of VEGFR-2, FIG. 1b. The VEGFR-2 positive
cells within the CD34+CD117.sup.dim
[0262] population, but not those within the CD34+CD117.sup.bright
subset, displayed phenotypic characteristics of mature, vascular
endothelium, including high level expression of Tie-2, ecNOS, vWF,
E-selectin (CD62E), and ICAM (CD54). In contrast, as shown in FIG.
1c, the VEGFR-2 positive cells within the CD34+CD117.sup.dim
subset, but not those within the CD34+CD117.sup.dim subset,
expressed markers characteristic of primitive hemangioblasts
arising during waves of murine and human embryogenesis, including
GATA-2, GATA-3, and low levels of Tie-2. Moreover, CD117.sup.bright
cells which co-expressed GATA-2 and GATA-3 were also strongly AC133
positive, another marker which has recently been suggested to
define a hematopoietic population with angioblast potential (2),
figure id. However, since AC133 expression was also detected on a
subset of CD117.sup.dim cells which was negative for GATA-2 and
GATA-3, we conclude that identification of an embryonic bone-marrow
derived angioblast (BA) phenotype requires concomitant expression
of GATA-2, GATA-3, and CD117.sup.bright in addition to AC133. Thus,
G-CSF treatment mobilizes into the peripheral circulation a
prominent population of mature, bone marrow-derived endothelial
cells (BMEC), and a smaller bone marrow-derived population with
phenotypic characteristics of embryonic angioblasts (BA).
[0263] 2. Expansion of Bone Marrow-derived Cells
[0264] Since the frequency of circulating endothelial cell
precursors in animal models has been shown to be increased by
either VEGF (27) or regional ischemia (10-13), we next compared the
proliferative responses of BA and BMEC to VEGF and to factors in
ischemic serum (28). As shown in FIG. 2a, following culture for 96
hours with either VEGF or ischemic serum,
CD117.sup.brightGATA-2.sup.pos BA demonstrated significantly higher
proliferative responses relative to CD117.sup.dimGATA-2.sup.neg
BMEC from the same donor. For VEGF, BA showed 2.9-fold increase in
proliferation above baseline compared with 1.2-fold increase for
BMEC, p<0.0l, while for ischemic serum from Lew rats with
myocardial infarction BA showed 4.3-fold increase in proliferation
above normal serum compared with 1.7-fold increase for BMEC,
p<0.01. Culture with either VEGF or ischemic serum greatly
expanded the BA population of large blast cells, FIG. 2b, which
continued to express immature markers, including GATA-2, GATA-3,
and CD117.sup.bright, but not markers of mature endothelial cells,
FIG. 2c, indicating blast proliferation without differentiation.
Following culture of CD34-positive monolayers on fibronectin in
endothelial growth medium for 7 days (29), an exuberant cobblestone
pattern of proliferation was seen, FIG. 3a, with the majority of
the adherent monolayers (>95%) having features characteristic of
endothelial cells, FIG. 3b-e, including uniform uptake of
acetylated LDL, and co-expression of CD34, factor VIII, and eNOS.
Since the BMEC population had low proliferative responses to VEGF
or cytokines in ischemic serum, the origin of the exuberant
endothelial cell outgrowth in culture is most likely the BA
population defined by surface expression for GATA-2, GATA-3, and
CD117.sup.bright.
[0265] 3. In vivo Migration of Bone Marrow-derived CD34+ Cells to
Sites of Regional Ischemia
[0266] Next we compared the in vivo migratory and proliferative
characteristics of bone marrow- and peripheral vasculature-derived
human cells after induction of regional ischemia. As shown in FIG.
4a-c, intravenous injection of 2.times.10.sup.6 DiI-labeled human
CD34-positive cells (>95% CD34. purity), CD34-negative cells
(<5% CD34 purity), or saphenous vein endothelial cells (SVEC),
into nude rats after coronary artery ligation and infarction
resulted in similar degree of infiltration in rat myocardium at 48
hours (30) The trafficking was specifically directed to the infarct
area since few DiI-labeled cells were detected in unaffected areas
of hearts with regional infarcts, not shown, and neither G-CSF
mobilized CD34+ cells nor mature human endothelial cells
infiltrated normal myocardium, FIG. 4d. Although similar numbers of
CD34+ and CD34- cells-migrated to ischemic myocardium, the
proportional increase in human GATA-2 mRNA expression in ischemic
myocardium relative to normal myocardium (31) was 2.6-fold greater
following injection of highly CD34-enriched cells compared with
CD3430 cells (p<0.001), FIG. 4e. Moreover, blood vessels which
incorporated human endothelial cells, as defined by co-expression
of DiI, HLA class I, and factor VII, could be detected two weeks
after injection of human CD34+ cells, but not after injection of
CD34- cells or SVEc, FIG. 4f. Together, these results indicate that
adult bone marrow-derived hilman CD34+ cells contain a population
which selectively responds to in vivo signals from sites of
regional ischemia with augmented migration, localization, and
endothelial differentiation.
[0267] 4. Effects of Injection of G-CSF mobilized Human CD34+ Cells
Into Infarcted Rat Myocardium
[0268] We next compared the functional effects of injecting G-CSF
mobilized human CD34+ (>95%) cells, CD34- (<5%) cells,
peripheral saphenous vein cells, or saline, into infarcted rat
myocardium. After ILAD ligation, left ventricular function was
severely depressed in each group of recipients, with left
ventricular ejection fraction (LVEF) being reduced by means of
25-43% and left ventricular end-systolic area being increased by
means of 44-90%, FIG. 5 a and b. Remarkably, within two weeks of
injecting G-CSF mobilized adult human CD34+ cells, LVEF recovered
by a mean of 22.+-.6% (p<0.001), FIG. 5a. This effect was
long-lived, and increased by the end of follow-up, 15 weeks, to
34.+-.4%. In contrast, injection of G-CSF mobilized human CD34-
cells, saphenous vein endothelial cells, or saline, had no effect
on LVEF. In a parallel fashion, injection of G-CSF mobilized human
CD34+ cells reduced left ventricular end-systolic area by a mean of
26.+-.8% by 2 weeks and 37.+-.6% by 15 weeks, whereas none of the
other recipient groups demonstrated such effect (p<0.001), FIG.
5b. Representative echocardiographic examples for each group are
shown in FIG. 5c. Moreover, at 15 weeks post-infarction mean
cardiac index in rats injected with CD34+ cells was only reduced by
26.+-.8% relative to normal rats, whereas mean cardiac index for
each of the other groups was reduced by 48-59% (p<0.001), FIG.
5d.
[0269] Histologic examination at two weeks post-infarction (33)
revealed that injection of CD34+ cells was accompanied by
significant increase in microvascularity and cellularity of
granulation tissue, and decrease in matrix deposition and fibrosis
within the infarct zone in comparison to controls, FIG. 6a and b.
Moreover, ischemic myocardium of rats injected with human CD34+
cells contained significantly greater numbers of factor
VIII-positive interstitial angioblasts and capillaries in
comparison to ischemic myocardium of control rats, FIG. 6c and d.
Quantitation of capillary numbers demonstrated a significant
increase in neo-angiogenesis within the infarct zone of rats who
received CD34+ cells (mean number of factor VIII-positive
capillaries per high power field 92.+-.5 vs 51.+-.4 in saline
controls, p<0.01), but not within normal myocardium (36.+-.2 vs
37.+-.3 capillaries per high power field). No increase in capillary
numbers were observed in ischemic rat myocardium infiltrated with
CD34- cells or SVEC. At 15 weeks post-infarction, rats receiving
highly purified CD34+ cells demonstrated significantly reduced
infarct zone sizes together with increased mass of viable
myocardium within the anterior free wall compared to each of the
other groups, FIG. 6e and f. Numerous vessels were evident at the
junction of the infarct zone and viable myocardium in tissues
infiltrated with CD34+ cells. Whereas collagen deposition and scar
formation extended almost through the entire left ventricular wall
thickness in controls, with aneurysmal dilatation and typical EKG
abnormalities, the infarct scar extended only to 20-50% of the left
ventricular wall thickness in rats receiving CD34+ cells. Moreover,
pathological collagen deposition in the non-infarct zone was
markedly reduced in rats receiving CD34+ cells. Overall, the mean
proportion of scar/normal left ventricular myocardium was 13% in
rats receiving CD34+ cells compared with 36-45% for each of the
other groups (p<0.01), FIG. 6g.
Discussion
[0270] The experiments described above demonstrate that
neo-angiogenesis of the infarct bed by human bone marrow-derived
endothelial cell precursors prevents scar development, maintains
viable myocardium, and improves ventricular function in a rodent
model of myocardial ischemia. Following infarction, the viable
myocardial tissue bordering the infarct zone undergoes a
significant degree of hypertrophy (5,34-35). Although
neoangiogenesis within the infarcted tissue appears to be an
integral component of the remodeling process (36,37), under normal
circumstances the capillary network cannot keep pace with tissue
growth and is unable to support the greater demands of the
hypertrophied, but viable, myocardium which subsequently undergoes
apoptosis due to inadequate oxygenation and nutrient supply. The
development of neoangiogenesis within the myocardial infarct scar
appears to require activation of latent collagenase and other
proteinases following plasminogen activation by urokinase-type
plasminogen activator (u-PA) expressed on infiltrating leukocytes
(38). The importance of bone marrow-derived endothelial precursors
in this process has been demonstrated in u-PA-/-mice where
transplantation of bone marrow from cogenic wild-type strains
restored defective myocardial revascularization post-infarction
(38). Since u-PA mRNA transcription and proteolytic activity in
human mononuclear cells and tumor cell lines is significantly
increased by the colony stimulating factors G-CSF, M-CSF, and
GM-CSF (39-41), this provides a rationale for in vivo or ex vivo
use of these cytokines to mobilize and differentiate large numbers
of human adult bone marrow-derived angioblasts for therapeutic
revascularization of the infarct zone.
[0271] Cell surface and RNA expression of the transcription factor
GATA-2 appears to selectively identify human adult bone
marrow-derived angioblasts capable of responding to signals from
ischemic sties by proliferating and migrating to the infarct zone,
and subsequently participating in the process of neo-angiogenesis.
Of particular interest, GATA-2 is a co-factor for endothelial cell
transcription of preproendothelin-1 (ppET-1) (42), the precursor
molecule of the potent vasoconstrictor and hypertrophic autocrine
peptide ET-1. Since ppET-1 transcription is also increased by
angiotensin II (43), produced as a result of activation of the
renin-angiotensin neurohormonal axis following myocardial
infarction, the angioblasts infiltrating the infarct bed may be
secreting high levels of ET-1 due to the synergistinc actions of
angiotensin II surface receptor .signalling and GATA-2
transactivation. The observation that newly-formed vessels within
the infarct scar have thicker walls, lower vasodilator responses to
stronger vasoactive substances than vessels within normal
myocardium (44) are consistent with effects of increased autocrine
ET-1 activity, and support the possibility that neo-angiogenic
vasculature is derived from infiltrating GATA-2 positive
angioblasts.
[0272] Together, the results of the above-described experiments
indicate that injection of G-CSF mobilized adult human CD34+ cells
with phenotypic and functional properties of embryonic
hemangioblasts can stimulate neo-angiogenesis in the infarct
vascular bed, thus reducing collagen deposition and scar formation
in myocardial infarction. Although the degree of reduction in
myocardial remodeling as a result of neoangiogenesis was striking,
further augmentation in myocardial function might be achieved by
combining infusion of human angioblasts with ACE inhibition or
AT.sub.1-receptor blockade to reduce angiotensin II-dependent
cardiac fibroblast proliferation, collagen secretion, and
plasminogen activator-inhibitor (PAI) production (45, 46). The use
of cytokine-mobilized autologous human bone-marrow angioblasts for
revascularization of myocardial infarct tissue, in conjunction with
currently used therapies (47-49), offers the potential to
significantly reduce morbidity and mortality associated with left
ventricular remodeling post-myocardial infarction.
Second Series of Experiments
Methods
[0273] 1. Purification of Cytokine-mobilized Human CD34+ Cells
[0274] Single-donor leukopheresis products were removed from humans
treated with recombinant G-CSF 10 mg/kg (Amgen, Calif.) sc daily
for four days. Mononuclear cells were separated by Ficoll-Hypaque,
and highly-purified CD34+ cells (>98% positive) were removed
using magnetic beads coated with anti-CD34 monoclonal antibody
(mAb) (Miltenyi Biotech Ltd, Calif.). Purified CD34 cells were
stained with fluorescein-conjugated mAbs against CD34, CD117,
VEGFR-2, Tie-2, GATA-2, GATA-3, AC133, vWF, eNOS, CD54, CD62E,
CXCR1, CXCR2, CXCR4, and analyzed by four-parameter fluorescence
using FACScan (Becton Dickinson, Calif.).
[0275] 2. Proliferative Studies of Human Endothelial
Progenitors
[0276] Single-donor CD34-positive cells were cultured for 96 hours
in RPMI with either 20% normal rat serum, ischemic rat serum or 20
ng/ml VEGF, then pulsed with [.sup.3H] thymidine (Amersham Life
Science Inc, IL, USA) (1 mlCi/well) and uptake was measured in an
LK Betaplate liquid scintillation counter (Wallace, Inc.,
Gaithersburg, Md.). The proportion of
CD117.sup.brightGATA-2.sup.pos cells after 96 hours of culture in
each condition was also quantitated by flow cytometry.
[0277] 3. Chemotaxis of Human Bone Marrow-derived Endothelial
Progenitors
[0278] Highly-purified CD34+ cells (>98% positive) were plated
in 48-well chemotaxis chambers fitted with membranes (8 mm pores)
(Neuro Probe, Md.). After incubation for 2 hours at 37.degree.,
chambers were inverted and cells were cultured for 3 hours in
medium containing IL-8 at 0.2, 1.0 and 5.0 mg/ml, SDF-1 alpha/beta
1.0 mg/ml, VEGF and SCF. The membranes were fixed with methanol and
stained with Leukostat (Fischer Scientific, Illinois). Chemotaxis
was calculated by counting migrating cells in 10 high-power
fields.
[0279] 4. Animals, Surgical procedures, Injection of Human Cells,
and Quantitation of Cellular Migration Into Tissues
[0280] Rowett (rnu/rnu) athymic nude rats (Harlan Sprague Dawley,
Indianapolis, Ind.) were used in studies approved by the "Columbia
University Institute for Animal Care and Use Committee". After
anesthesia, a left thoracotomy was performed, the pericardium was
opened, and the left anterior descending (LAD) coronary artery was
ligated. Sham-operated rats had a similar surgical procedure
without having a suture placed around the coronary artery. 48 hours
after LAD ligation 2.0.times.10.sup.6 DiI-labeled human CD34+ cells
(>95%, 40%, <2% purity) removed from a single donor after
G-CSF mobilization were injected into the tail vein in the presence
or absence of mAbs with known inhibitory activity against CXCR1,
CXCR2, CXCR4, CD34, rat IL-8 (ImmunoLaboratories, Japan) and rat
SDF-1.RTM. & D Systems, Minnesota), or isotype control
antibodies. Control animals received saline after LAD ligation.
Each group consisted of 6-10 rats. Quantitation of myocardial
infiltration after injection of human cells was performed by
assessment of DiI fluorescence in hearts from rats sacrificed 2
days after injection (expressed as number of DiI-positive cells per
high power field, minimum 5 fields examined per sample).
Quantitation of rat bone marrow infiltration by human cells was
performed in 12 rats at baseline, days 2, 7, and 14 by flow
cytometric and RT-PCR analysis of the proportion of HLA class
I-positive cells relative to the total rat bone marrow
population.
[0281] 5. Analyses of Myocardial Function
[0282] Echocardiographic studies were performed at baseline, 48
hours after LAD ligation, and at 2, 6 and 15 weeks after injection
of cells or saline, using a high frequency liner array transducer
(SONOS 5500, Hewlett Packard, Andover, Mass.). 2D images were
removed at mid-papillary and apical levels. End-diastolic (EDV) and
end-systolic (ESV) left ventricular volumes were removed by
bi-plane area-length method, and % left ventricular ejection
fraction (LVEF) was calculated as [(EDV-ESV)/EDV] x100. Left
ventricular area at the end of systole (LVAs) was measured by
echocardiography at the level of the mitral valve. LVEF recovery
and reduction in LVAs were calculated as the mean improvement
between the respective values for each at different time points
after LAD ligation relative to pre-infarct values.
[0283] 6. Histology and Immunohistochemistry
[0284] Histologic studies were performed on explanted rat hearts at
2 and 15 weeks after injection of human cells or saline. Following
excision, left ventricles from each experimental animal were sliced
at 10-15 transverse sections from apex to base. Representative
sections were put into formalin for histological examination,
stained freshly with anti-factor VIII mAb using immunoperoxidase
technique to quantitate capillary density, or stained with Masson
trichrome and mounted. The lengths of the infarcted surfaces,
involving both epicardial and endocardial regions, were measured
with a planimeter digital image analyzer and expressed as a
percentage of the total ventricular circumference. Final infarct
size was calculated as the average of all slices from each
heart.
[0285] 7. Measurement of Rat CXC Chemokine mRNA and Protein
Expression
[0286] Poly(A)+ mRNA was extracted by standard methods from the
hearts of 3 normal and 12 LAD-ligated rats. RT-PCR was used to
quantify myocardial expression of rat IL-8 and Gro-alpha mRNA at
baseline and at 6, 12, 24 and 48 hours after LAD ligation after
normalizing for total rat RNA as measured by GAPDH expression.
After priming with oligo (dT) 15-mer and random hexamers, and
reverse transcribed with Monoley murine lymphotrophic virus reverse
transcriptase (Invitroaen, Carlsbad, Calif., USA), cDNA was
amplified in the polymerase chain reaction (PCR) using Taq
polymerase (Invitrogen, Carlsbad, Calif., USA), radiolabeled
dideoxy-nucleotide ([.alpha..sup.32p]-ddATP: 3,000 Ci/mmol,
Amersham, Arlington Heights, Ill.), and primers for rat IL-8,
Gro-alpha and GAPDH (Fisher Genosys, Calif.). Primer pairs
(sense/antisense) for rat IL-8, Gro-alpha AND GAPDH were,
gaagatagattgcaccgatg (SEQ ID NO:1)/catagcctctcacatttc (SEQ ID
NO:2), gcgcccgtccgccaatgagctgcgc (SEQ ID
NO:3)/cttggggacacccttcagcatcttttgg (SEQ ID NO:4), and
ctctacccacggcaagttcaa (SEQ ID NO:5)/gggatgaccttgcccacagc (SEQ ID
NO:6), respectively. The labeled samples were loaded into 2%
agarose gels, separated by electrophoresis, and exposed for
radiography for 6 h at -70.degree.. Serum levels of rat
IL-8/Gro-alpha were measured at baseline and at 6, 12, 24 and 48
hours after LAD ligation in four rats by a commercial ELISA using
polyclonal antibodies against the rat IL-8/Gro homologue CINC
(ImmunoLaboratories, Japan). The amount of protein in each serum
sample was calculated according to a standard curve of optical
density (OD) values constructed for known levels of rat
IL-8/Gro-alpha protein.
Experimental Procedures and Results
[0287] 1. Selective Trafficking of Endothelial Precursors
[0288] Following immunoselection of G-CSF mobilized human CD34
cells to >98% purity, 60-80% co-expressed the stem cell factor
receptor CD117. -By quadruple parameter analysis, FIG. 7a, 10-15%
of CD117.sup.bright cells were found to express a phenotype
characteristic of embryonic angioblasts, with low level surface
expression of VEGFR-2 and Tie-2, as well as the transcription
factors GATA-2 and GATA-3, and AC133, recently shown to identify
endothelial precursors (79). These cells did not express markers of
mature endothelial cells such as vWF, eNOS and E-selectin, but were
positive for the CXC chemokine receptors 1, 2, and 4. Intravenous
injection of 2.times.10.sup.6 DiI-labeled human CD34+ cells
(>98%, 40%, and 2% purity) into LAD-ligated Rowett nude rats was
accompanied at 48 hours by dense infiltration of rat myocardium,
FIG. 7b. The trafficking of these cells was specifically directed
to the infarct area since few DiI-labeled cells were detected in
unaffected areas of hearts with regional infarcts, not shown, and
DiI-labeled cells did not infiltrate myocardium from sham-operated
rats, FIG. 7b. By two weeks post-injection, rats receiving >98%
pure human CD34+ cells demonstrated increased infarct bed
microvascularity and reduced matrix deposition and fibrosis, FIG.
7c. The number of factor VIII-positive capillaries per high power
field was over three-fold higher in the infarct bed of rats
receiving 2.times.10.sup.6 cells containing >98% pure CD34+
purity than in the analogous region in rats receiving
2.times.10.sup.6 cells containing either 2% or 40% CD34+ purity,
p<0.01, FIG. 7c. Moreover, the majority of these capillaries
were of human origin since they expressed HLA class I molecules
(not shown). Thus, although various populations of human bone
marrow-derived cells migrate to the infarct bed, vasculogenesis
appears to require selective trafficking of a critical number of
endothelial precursors.
[0289] 2. Effects of Ischemia on CXC Chemokine Production by
Infarcted Myocardium
[0290] Since human leukocyte chemotaxis and tissue infiltration is
regulated by interactions between specific chemokines and CXC cell
surface receptors, we next investigated the effects of ischemia on
CXC chemokine production by infarcted rat myocardium. As shown in
FIG. 8a-c, infarcted myocardium demonstrated a time-dependent
increase in mRNA expression of the CXCR1/2-binding ELR-positive
chemokines IL-8 and Gro-alpha, with maximal expression at 6-12
hours after LAD ligation. In comparison to non-infarcted
myocardium, tissues after LAD ligation expressed 7.2-7.5 fold
higher mRNA levels of these ELR-positive pro-angiogenic chemokines
after normalizing for total mRNA content (p<0.001). Moreover,
serum IL-8 levels increased by 8-10 fold within 6-12 hours after
LAD ligation (p<0.001), and remained elevated at 48 hours, FIG.
8d. Co-administration of blocking mAbs against either IL-8 and
Gro-alpha, or against the surface receptors for these
pro-angiogenic chemokines, CXCR1 or CXCR2, reduced myocardial
trafficking of human angioblasts by 40-60% relative to control
antibodies (p<0.01), FIG. 8e.
[0291] 3. Chemotactic Responses of Human Bone Marrow-derived CD34+
Angioblasts to Chemokines.
[0292] In subsequent experiments we directly measured in vitro and
in vivo chemotactic responses of human bone marrow-derived CD34+
angioblasts to IL-8. As shown in FIG. 9a, in vitro chemotaxis of
human CD34+ cells was induced by IL-8 in a dose-dependent manner,
with concentrations between 0.2-5 .mu./ml. The ELR- chemokine
SDF-1, produced constitutively by bone marrow stromal cells,
induced a similar degree of chemotaxis of CD34+ cells at
concentrations similar to IL-8, FIG. 9b. In contrast, chemotaxis
was not induced by the growth factors VEGF or stem cell factor
(SCF). Moreover, intracardiac injection of IL-8 at 1 .mu.g/ml into
non-infarcted hearts induced in vivo chemotaxis of CD34+ cells,
FIG. 9c, whereas neither VEGF nor SCF, used as controls, had any
chemotactic effect in vivo, FIG. 9d. Together, these results
indicate that increased tissue expression of ELR-positive
chemokines augments vasculogenesis in vivo by inducing chemotaxis
of bone marrow-derived endothelial precursor cells to sites of
tissue ischemia.
[0293] 4. Interruption of CXCR4/SDF-1 Interactions to Redirect
Trafficking of Human CD34-Positive Cells from Bone Marrow to
Myocardium.
[0294] In addition to augmenting trafficking of intravenously
injected human CD34+ angioblasts to damaged myocardium, ischemic
serum from LAD-ligated rats caused rapid expansion of the
circulating CD34+CD117.sup.bright angioblast population and
concomitantly increased trafficking of these cells to the bone
marrow. As shown in FIG. 10a, culture for 2 days with either VEGF
or ischemic serum increased proliferation of CD34+CD117.sup.bright
angioblasts by 2.8 and 4.3 fold, respectively (p<0.01).
Moreover, as shown in FIG. 10b, bone marrow front ischemic rats
after LAD ligation contained 5-8 fold higher levels of human
CD34+CD117.sup.bright angioblasts compared with bone marrow from
normal rats 2-14 days after intravenous injection of
2.times.10.sup.6 human CD34-positive cells (>95% purity),
(p<0.001). Since SDF-1 is constitutively expressed by bone
marrow stromal cells and preferentially promotes bone marrow
migration of circulating CD34+ cells which are actively cycling
(80), we investigated whether the increased homing of human
CD34+CD117.sup.bright angioblasts to ischemic rat bone marrow was
due to heightened SDF-1/CXCR4 interactions. As shown in FIG. 10c,
co-administration of mabs against either human CXCR4 or rat SDF-1
significantly inhibited migration of intravenously administered
CD34+ human angioblasts to ischemic rat bone marrow by compared
with anti-CD34 control antibody (both p<0.001). Moreover,
co-administration of mAbs against either human CXCR4 or rat SDF-1
increased trafficking of CD34+ human angioblasts to ischemic rat
myocardium by a mean of 24% and 17%, respectively (both
p<0.001), FIG. 10d. By two weeks, the myocardial infarct bed of
rats receiving human CD34+ cells in conjunction with anti-CXCR4 mAb
demonstrated >3-fold increase in microvascularity compared with
those receiving CD34+ cells in conjunction with isotype control
antibody. These results indicate that although intravenously
injected CD34+ angioblasts traffick to infarcted myocardium and
induce vasculogenesis in response to augmented production of ELR+
chemokines, the efficiency of this process is significantly reduced
by concomitant angioblast migration to the bone marrow in response
to SDF-1. Interruption of CXCR4/SDF-1 interactions redirects
trafficking of the expanded, cycling population of human
CD34-positive cells from bone marrow to myocardium after
infarction, increasing infarct bed neoangiogenesis.
[0295] 5. Improvement in Myocardial Function
[0296] Although left ventricular function was severely depressed
after LAD ligation, injection of >98% pure CD34+ cells was
associated with significant recovery in left ventricular size and
function within two weeks, and these effects persisted for the
entire 15 week period of follow-up, FIG. 11a and b. In rats
receiving >98% pure CD34+ cells, left ventricular end-systolic
area decreased by a mean of 37.+-.6% by 15 weeks compared to
immediately post-infarction, FIG. 11a, and left ventricular
ejection fraction (LVEF) recovered by a mean of 34.+-.4% by 15
weeks (p<0.001), FIG. 11b (p<0.001). Improvement in these
parameters depended on the number of CD34+ cells injected, since
intravenous injection of 2.times.10.sup.6 G-CSF mobilized human
cells containing 2% or 40% CD34+ purity did not significantly
improve myocardial function despite similar degrees of trafficking
to ischemic myocardium, FIGS. 11a and b. However, co-administration
of anti-CXCR4 mAb together with G-CSF mobilized human bone
marrow-derived cells containing 40% CD34+ purity significantly
improved LVEF recovery and reduced LVAs, to levels seen with
>98% CD34+ purity. By trichrome stain, significant differences
in left ventricular mass and collagen deposition were observed
between the groups, FIG. 11c. In rats receiving 2.times.10.sup.6
human cells containing 2% CD34- purity, the left ventricular
anterior wall was completely replaced by fibrous tissue and marked
compensatory septal hypertrophy was present. Similar changes were
seen in hearts of rats receiveng 2.times.10.sup.6 human cells
containing 40% CD34 purity. In contrast, in hearts of rats
receiving 2.times.10.sup.6 human cells containing 98% CD34 purity
significantly greater anterior wall mass was maintained, with
normal septal size and minimal collagen deposition. Of particular
interest, hearts of rats receiving 2.times.10.sup.6 human cells
containing 40% purity together with anti-CXCR4 mAb demonstrated
similar increase in anterior myocardial wall mass, decrease in
septal hypertrophy, and reduction in collagen deposition. Overall,
the mean proportion of fibrous scar/normal left ventricular
myocardium was 13% and 21%, respectively, in rats receiving >98%
pure CD34+ cells or 40% pure CD34+ cells together with anti-CXCR4
mAb, compared with 36-45% for rats receiving 2% and 40% pure CD34+
cells (p<0.01), FIG. 11d. Thus, augmentation of infarct bed
vasculogenesis by increasing selective trafficking of a critical
number of endothelial precursors leads to further prevention of the
remodeling process, salvage of viable myocardium, and improvement
in cardiac function.
Discussion
[0297] This study demonstrates that ELR+ chemokines produced by
ischemic tissues regulate the development of compensatory
vasculogenesis at ischemic sites by producing a chemoattractant
gradient for bone marrow-derived endothelial cell precursors.
Although both the ELR+ CXC chemokine IL-8 and the ELR- CXC
chemokine SDF-1 demonstrate similar effects on chemotaxis of CD34+
endothelial precursors, as well as on mature endothelium (73), when
expressed at different extravascular sites they impart opposing
biological effects on directional egress of endothelial
progenitors, and consequently on tissue neovascularization. By
understanding these interactions we were able to manipulate and
augment the chemotactic properties of a specific subset of human
bone marrow-derived CD34+ cells in order to increase myocardial
trafficking, induce infarct bed vasculogenesis, reduce
post-ischemic ventricular remodeling, and improve myocardial
function.
[0298] Since migration of bone marrow-derived progenitors through
basement membrane is dependent on secretion of proteolytic enzymes
such as metalloproteinase-9 (MMP-9, Gelatinase B) (81),
intracardiac metalloproteinase activity may be a critical
determinant of angioblast extravasation from the circulation and
transendothelial migration into the infarct zone. IL-8 induces
rapid release (within 20 minutes) of the latent form of MMP-9 from
intracellular storage granules in neutrophils (82-83), and
increases serum MMP-9 levels by up to 1,000-fold following
intravenous administration in vivo in non-human primates (84).
Since IL-8 significantly increases MMP-9 expression in bone marrow
progenitors (81), and neutralizing antibodies against MCP-9 prevent
mobilization of these cells (85), the results of our steady suggest
that angioblast infiltration and subsequent infarct bed
vasculogenesis may result from IL-8-dependent increases in MMP-9
secretion.
[0299] Activation of latent MMP-9 and concomitant development of
neoangiogenesis within murine myocardial infarct scar tissue has
been shown to depend on urokinase-type plasminogen activator (u-PA)
co-expressed by bone marrow progenitors infiltrating the infarct
bed (81). Transcription and proteolytic activity of u-PA in human
cells is significantly increased by G-CSF and other colony
stimulating factors (86-88). Since IL-8-induced chemotaxis and
progenitor mobilization require the presence of additional signals
delivered through functional G-CSF receptors (89), it is possible
that increased u-PA activity is required for IL-8 mediated
trafficking of angioblasts to sites of ischemia. This would explain
the limited extent of infarct bed neoangiogenesis observed normally
after myocardial infarction (62,63) despite high levels of IL-8
production, and provides a rationale for in vivo or ex vivo
administration of colony stimulating factors to mobilize and
differentiate human bone marrow-derived angioblasts for use in
therapeutic revascularization of ischemic tissues.
[0300] Constitutive production of the CXC chemokine SDF-1 by bone
marrow stromal cells appears to be essential for bone marrow homing
and engraftment of haematopoietic progenitors (76-78). In addition,
expression of SDF-1 in non-haematopoietic tissues plays a role in
the developing vascular system since SDF-1-/- mice have defects in
both vascularization of the gastrointestinal tract (50) and
ventricular septum formation (90). Since bone marrow-derived
endothelial precursors express CXCR4 (80) and demonstrate
chemotactic responses to SDF-1, as shown here, induced expression
of SDF-1 at non-haematopoietic sites during embryogenesis or
following tissue injury may be an important element in the process
of tissue neovascularization (91). Our ability to redirect
trafficking of human bone marrow-derived angioblasts to sites of
tissue ischemia by interruption of CXCR4/SDF-1 interactions argues
strongly that SDF-1 is a biologically active chemotactic factor for
human endothelial precursors, and that it may have pro-angiogenic
activity if expressed at non-haematopoietic sites. Future studies
will address whether increased expression and localization of SDF-1
and other chemokines at the sites of tissue ischemia might be
synergistic with ELR+ CXC chemokines in augmenting vasculogenesis.
Together, the results of this study indicate that CXC chemokines,
including IL-8, Gro-alpha, and SDF-1, play a central role in
regulating human bone marrow-dependent vasculogenesis, and that
manipulation of interactions between these chemokines and their
receptors on autologous human bone marrow-derived angioblasts can
enhance the potential efficacy of therapeutic vasculogenesis
following tissue ischemia.
Third Series of Experiments
Experimental Procedures and Results
[0301] 1. Myocardial Ischemia Induces Production Of CC Chemokines
and Increases Human CD34+ Angioblast Expression Of CC Chemokine
Receptors
[0302] Since human mononuclear cell chemotaxis and tissue
infiltration is regulated by interactions between cell surface
receptors with specific chemokine ligands, the effects of ischemia
on angioblast CC chemokine receptor expression and on kinetics of
CC chemokine production by infarcted rat myocardium were
investigated. As shown in FIG. 12, culture of CD34+CD117.sup.bright
angioblasts with serum from LAD-ligated rats increased surface
expression of CCR1 and CCR2, while surface expression of CCR3 and
CCR5 remained unchanged.
[0303] As shown in FIG. 13, infarcted myocardium demonstrated a
time-dependent increase in mRNA expression of several CCR-binding
chemokines. Infarcted myocardium was found to express over 8-fold
higher levels of the CCR2-binding CC chemokine MCP-1, and
3-3.5-fold higher mRNA levels of MCP-3 and RANTES, as well as the
CCR3-binding chemokine eotaxin, after normalizing for total mRNA
content (all p<0.001). This pattern of gene expression appeared
to be relatively specific since every infarcted tissue studied
demonstrated increased expression of these CC chemokines and none
demonstrated induced expression of the CCRS-binding CC chemokines
MIP-1 alpha or MIP-lbeta.
[0304] 2. Trafficking Of Human CD34+ Angioblasts to Ischemic
Myocardium is Regulated by Induced Expression of CC and CXC
Chemokines
[0305] Next investigated was whether human angioblast trafficking
to ischemic myocardium was related to the induced expression of the
CC chemokines identified above. Co-administration of blocking mAbs
against MCP-1, MCP-3, and RANTES, or against eotaxin, reduced
myocardial trafficking of human angioblasts by 40-60% relative to
control antibodies (p<0.01), FIG. 14. To prove that CC
chemokines mediate angioblast chemotaxis to ischemic myocardium, we
measured in vivo angioblast chemotaxis in response to eotaxin. As
shown in FIG. 15, intracardiac injection of eotaxin into
non-infarcted hearts induced 1.5-1.7 fold increase in CD34+
angioblast trafficking whereas injection of the growth factors VEGF
and stem cell factor had no effect on chemotaxis despite increasing
angioblast proliferation (not shown).
[0306] Fourth Series of Experiments
[0307] Determination of Myocyte Size. Myocyte size was measured in
normal rat hearts and in the infarct zone, peri-infarct rim and
distal areas of infarct tissue sections stained by trichrome. The
transverse and longitudinal diameters (mm) of 100-200 myocytes in
each of 10-15 high-powered fields were measured at 400.times. using
Image-Pro Plus software.
[0308] Measurement of Myocyte Apoptosis by DNA End-Labeling of
Paraffin Tissue Sections.
[0309] For in situ detection of apoptosis at the single cell level
we used the TUNEL method of DNA end-labeling mediated by
dexynucleotidyl transferase (TdT) (Boehringer Mannheim, Mannheim,
Germany). Rat myocardial tissue sections were removed from
LAD-ligated rats at two weeks after injection of either saline or
CD34+ human cells, and from healthy rats as negative controls.
Briefly, tissues were deparaffinized, digested with Proteinase K,
and incubated with TdT and fluorescein-labeled dUTP in a humid
atmosphere for 60 minutes at 37.degree. C. After incubation for 30
minutes with an antibody specific for fluorescein conjugated
alkaline phosphatase the TUNEL stain was visualized in which nuclei
with DNA fragmentation stained blue.
[0310] 1. Neoangiogenesis Protects Hypertrophied Myocardium Against
Apoptosis.
[0311] The mechanism by which induction of neo-angiogenesis
resulted in improved cardiac function was investigated. Results
showed that two weeks after LAD ligation the myocytes in the
peri-infarct rim of saline controls had 4distorted appearance,
irregular shape, and similar diameter 4to myocytes from rats
without infarction (0.020 mm +/-0.002 4vs 0.019 mm +/-0.001). In
contrast, the myocytes at the peri-infarct rim of rats who received
CD34+ cells had regular, oval shape, and were significantly larger
than myocytes from control rats (diameter 0.036 mm +/-0.004 vs
0.019 mm +/-0.001, p<0.01). By concomitant staining for the
myocyte-specific marker desmin and DNA end-labeling, 6-fold lower
numbers of apoptotic myocytes were detected in infarcted left
ventricles of rats injected with CD34+ cells compared with saline
controls (apoptotic index 1.2+0.6 vs 7.1+0.7, p<0.01). These
differences were particularly evident within the peri-infarct rim,
where the small, irregularly-shaped myocytes in the saline-treated
controls had the highest index of apoptotic nuclei. In addition,
whereas apoptotic myocytes extended throughout 75-80% of the left
ventricular wall in saline controls, apoptotic myocytes were only
detectable for up to 20-25% of the left ventricle distal to the
infarct zone in rats injected with CD34+ cells. Together, these
results indicate that the infarct zone vasculogenesis and
peri-infarct angiogenesis induced by injection of CD34+ cells
prevented an eccentrically-extending pro-apoptotic process evident
in saline controls, enabling survival of hypertrophied myocytes
within the peri-infarct zone and improving myocardial function.
[0312] 2. Early Neoangiogenesis Prevents Late Myocardial
Remodeling.
[0313] The last series of experiments showed the degree of
peri-infarct rim myocyte apoptosis at two weeks in control and
experimental groups (saline vs CD34+ cells) compared with
progressive myocardial remodeling over the ensuing four months.
Despite similar initial reductions in LVEF and increases in LVAS,
by two weeks the mean proportion of collagenous deposition or scar
tissue/normal left ventricular myocardium, as defined by Massonis
trichrome stain, was 3% in rats receiving CD34+ cells compared with
12% for those receiving saline. By 15 weeks post-infarction, the
mean proportion of scar/normal left ventricular myocardium was 13%
in rats receiving CD34+ cells compared with 36-45% for each of the
other groups studied (saline, CD34-, SVEC) (p<0.01). Rats
receiving CD34+ cells demonstrated significantly increased mass of
viable myocardium within the anterior free wall which comprised
myocytes exclusively of rat origin, expressing rat but not human
MHC molecules, confirming intrinsic myocyte salvage rather than
myocyte regeneration from human stem cell precursors. Whereas
collagen deposition and scar formation extended almost through the
entire left ventricular wall thickness in controls, with aneurysmal
dilatation and typical EKG abnormalities, the infarct scar extended
only to 20-50% of the left ventricular wall thickness in rats
receiving CD34+ cells. Moreover, pathological collagen deposition
in the non-infarct zone was markedly reduced in rats receiving
CD34+ cells. Together, these results indicate that the reduction in
peri-infarct myocyte apoptosis observed at two weeks resulted in
prolonged survival of hypertrophied, but viable, myocytes and
prevented myocardial replacement with collagen and fibrous tissue
by 15 weeks.
Discussion
[0314] The observation that proliferating capillaries at the
peri-infarct rim and between myocytes were of rat origin shows that
in addition to vasculogenesis human angioblasts or other
co-administered bone-marrow derived elements may be a rich source
of pro-angiogenic factors, enabling additional induction of
angiogenesis from pre-existing vasculature.
References
[0315] 1. Mahon N G, et al. Heart 1999;81:478-82.
[0316] 2. Pfeffer J M, Pfeffer M A, Fletcher P J, Braunwald E. Am J
Physiol 1991; 260:H1'406-14.
[0317] 3. White H D, et al. Circulation 1987; 76:44-51.
[0318] 4. Colucci W S. Am J Cardiol 1997;80(11A):15L-25L.
[0319] 5. Ravichandran L V and Puvanakrishnan R. Biochem Intl
1991;24:405-414.
[0320] 6. Agocha A, Lee H-W, Eghali-Webb M. J Mol Cell Cardiol
1997;29:2233-2244.
[0321] 7. Hochman J S and Choo H. Circulation 1987;75:299-306.
[0322] 8. White H D, et al. Circulation 1994;89:61-67.
[0323] 9. Nidorf S M, Siu S C, Galambos G, Weyman A E, Picard M H.
J Am Coll Cardiol 1992;20:307-313.
[0324] 10. Asahara T, et al. Science 1997;275:964-967.
[0325] 11. Takahashi T, et al. Nat Med 1999,5:434-438.
[0326] 12. Asahara T, et al. Circ Res 1999;85:221-228.
[0327] 13. Kalka C, et al. Proc Natl Acad Sci USA
2000;97:3422-3427.
[0328] 14. Rafii S, et al. Blood 1994;84:10-19.
[0329] 15. Shi Q, et al. Blood 1998;92:362-367.
[0330] 16. Lin Y, Weisdorf D J, Solovey A, Hebbel R P. J Clin
Invest 2000;105:71-77.
[0331] 17. Tavian M, et al. Blood 1996;87:67-72.
[0332] 18. Jaffredo T, Gautier R, Eichmann A, Dieterlen-Lievre F.
Development 1998;125:4575-4583.
[0333] 19. Kennedy M, et al., Nature 1997;386:488-493.
[0334] 20. Choi K, Kennedy M, Kazarov A, Papadimitriou, Keller G.
Development 1998;125:725-732.
[0335] 21. Elefanty A G, Robb L, Birner R, Begley C G. Blood
1997;90:1435-1447.
[0336] 22. Labastie M-C, Cortes F, Romeo P-H, Dulac C, Peault B.
Blood 1998;92:3624-3635.
[0337] 23. Tsai F Y, et al. Nature 1994;371:221-225.
[0338] 24. Ogawa M, et al. Blood 1999;93:1168-1177.
[0339] 25. Peichev M, et al. Blood. 2000;95:952-8.
[0340] 26. Asahara T, et al. EMBO J 1999; 18:3964-3972.
[0341] 27. Karam R, Healy B P, Wicker P. Circulation
1990;81:238-246.
[0342] 28. Olivetti G, Capasso J M, Meggs L G, Sonnenblick E H,
Anversa P. Circ Res 1991;68:856-869.
[0343] 29. Braunwald E and Pfeffer M A. Am J Cardiol
1991;68(supplD):1-6D.
[0344] 30. Nelissen-Vrancken H, Debets J, Snoeckx L, Daemen M,
Smits J. Circulation 1996;93:349-355.
[0345] 31. Kalkman E A J, et al. Cardiovasc Res 1996.
[0346] 32. Heymans S, et al. Nat Med 1999;5:1135-1142.
[0347] 33. Hart P H, et al. Blood 1991;77:841-848.
[0348] 34. Stacey K J, et al. Mol Cell Biol 1995;15:3430-3441.
[0349] 35. Pei X-H, et al. Clin Exp Metastasis 1998;16:551-558.
[0350] 36. McEwan P E, Gray G A, Sherry L, Webb D J, Kenyon C J.
Circulation 1998;98:2765-2773.
[0351] 37. Kawano H, et al. Circulation 2000;101:1130-1137.
[0352] 38. Chua B H, Chua C C, Diglio C A, Siu B B. Biochim Biophys
Acta 1993;1178:201-206.
[0353] 39. Ito H, et al. J Clin Invest 1993;92:398-403.
[0354] 40. Rossi A P, Sacchetto A, Cesari M, Pessina A C.
Cardiovasc Res 1999;43:300-307.
[0355] 41. Dorfman D M, Wilson D B, Bruns G A, Orkin S H. J Biol
Chem 1992; 267:1279-85.
[0356] 42. Tasaka K, Kitazumi K. Gen Pharmacol 1994;25:1059-69.
[0357] 43. Kalkman E A J, van Haren P, Saxena P R, Schoemaker R G.
J Mol Cell Cardiol 1997;29:1487-1497.
[0358] 44. Pfeffer M A, et al. N Engl J Med 1992;327:669-677.
[0359] 45. The SOLVD investigators. N Engl J Med
1991;325:293-302.
[0360] 46. Pitt B, et al. Lancet 1997;349:747-752.
[0361] 47. Strieter, R M. et al. Interleukin-8: a corneal factor
that induces neovascularization. Am. J. Pathol. 141,1279-1284
(1992).
[0362] 48. Koch, A E. et al. Interleukin-8 (IL-8) as a
macrophage-derived mediator of angiogenesis. Science, 258:1798-1801
(1992).
[0363] 49. Strieter, R M, et al The functional role of the ELR
motif in CXC chemokine-mediated angiogenesis. J. Biol. Chem. 270,
27348-27357 (1995).
[0364] 50. Tachibana, K. et al. The chemokine receptor CXCR4 is
essential for vascularization of the gastrointestinal tract. Nature
393, 591-594 (1998).
[0365] 51. Rafii S, et al. Isolation and characterization of human
bone marrow microvascular endothelial cells:
[0366] hematopoietic progenitor cell adhesion. Blood 84, 10-19
(1994).
[0367] 52. Shi, Q. et al. Evidence for circulating bone
marrow-derived endothelial cells. Blood 92, 362-367 (1998)
[0368] 53. Lin, Y., Weisdorf, D. J., Solovey, A., Hebbel, R. P.
Origins of circulating endothelial cells and endothelial outgrowth
from blood. J. Clin. Invest. 105, 71-77 (2000).
[0369] 54. Kennedy, M. et al. A common precursor for primitive
erythropoiesis and definitive haematopoiesis. Nature 386, 488-493
(1997).
[0370] 55. Choi, K., Kennedy, M., Kazarov, A., Papadimitriou,
Keller, G. A common precursor for hematopoietic and endothelial
cells. Development 125, 725-732 (1998).
[0371] 56. Elefanty, A. G., Robb, L., Birner, R., Begley, C. G.
Hematopoietic-specific genes are not induced during in vitro
differentiation of scl-null embryonic stem cells. Blood 90,
1435-1447 (1997).
[0372] 57. Labastie, M. C., Cortes, F., Romeo, P. H., Dulac, C.,
Peault, B. Molecular identity of hematopoietic precursor cells
emerging in the human embryo. Blood 92, 3624-3635 (1998).
[0373] 58. Folkman, J. Therapeutic angiogenesis in ischemic limbs.
Circulation 97, 108-110 (1998).
[0374] 59. Asahara, T. et al. Isolation of putative progenitor
cells for endothelial angiogenesis. Science 275, 964-967
(1997).
[0375] 60. Takahashi, T. et al. Ischemia- and cytokine-induced
mobilization of bone marrow-derived endothelial progenitor cells
for neovascularization. Nat. Med. 5, 434-438 (1999).
[0376] 61. Kalka, C. et al. Transplantation of ex vivo expanded
endothelial progenitor cells for therapeutic neovascularization.
Proc. Natl. Acad. Sci. USA 97, 3422-3427 (2000).
[0377] 62. Nelissen-Vrancken, H. J., Debets, J. J., Snoeckx L. H.,
Daemen, M. J., Smits, J. F. Time-related normalization of maximal
coronary flow in isolated perfused hearts of rats with myocardial
infarction. Circulation 93, (2) 349-355 (1996).
[0378] 63. Kalkman, E. A. et al. Determinants of coronary reserve
in rats subjected to coronary artery ligation or aortic banding.
Cardiovasc. Res. 32, (6) 1088-1095 (1996).
[0379] 64. Colucci, W. S. Molecular and cellular mechanisms of
myocardial failure. Am. J. Cardiol. 80 (11A), 15L-25L (1997).
[0380] 65. Ravichandran, L. V. and Puvanakrishnan, R. In vivo
labeling studies on the biosynthesis and degradation of collagen in
experimental myocardial myocardial infarction. Biochem. Intl. 24,
405-414 (1991).
[0381] 66. Agocha, A., Lee, H. W., Eghali-Webb, M. Hypoxia
regulates basal and induced DNA synthesis and collagen type I
production in human cardiac fibroblasts: effects of TGF-beta,
thyroid hormone, angiotensis II and basic fibroblast growth factor.
J. Mol. Cell. Cardiol. 29, 2233-2244 (1997).
[0382] 67. Mahon, N. G. et al. Hospital mortality of acute
myocardial infarction in the thrombolytic era. Heart 81, 478-482
(1999).
[0383] 68. Pfeffer, J. M., Pfeffer, M. A., Fletcher, P. J.,
Braunwald, E. Progressive ventricular remodeling in rat with
myocardial infarction. Am. J. Physiol. 260, H1406-414 (1991).
[0384] 69. White, H. D. et al. Left ventricular end systolic volume
as the major determinant of survival after recovery from myocardial
infarction. Circulation 76, 44-51 (1987).
[0385] 70. Folkman J. Angiogenesis in cancer, vascular, rheumatoid
and other disease. Nat. Med. 1:27 (1995).
[0386] 71. Murdoch C, Monk P N, Finn A. Cxc chemokine receptor
expression on human endothelial cells. Cytokine 11,704-12
(1999).
[0387] 72. Angiolillo, A L, et al. Human interferon-inducible
protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med
182,155-62 (1995).
[0388] 73. Feil C, Augustin H G. Endothelial cells differentially
express functional CXC-chemokine receptor-4 (CXCR-4/fusin) under
the control of autocrine activity and exogenous cytokines. Biochem
Biophys Res Commun 247, 38-45 (1998).
[0389] 74. Tavian, M. et al. Aorta-associated CD34 hematopoietic
cells in the early human embryo. Blood 87, 67-72 (1996).
[0390] 75. Jaffredo, T., Gautier, R., Eichmann, A.,
Dieterlen-Lievre, F. Intraaortic hemopoietic cells are derived from
endothelial cells during ontogeny. Development 125, 4575-4583
(1998).
[0391] 76. Mohle R, Bautz F, Rafii S, Moore M A, Brugger W, Kanz L.
The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic
progenitors and leukemic cells and mediates transendothelial
migration induced by stromal cell-derived factor-1. Blood 91,
4523-30 (1998).
[0392] 77. Imai, K. et al. Selective secretion of chemoattractants
for haemopoietic progenitor cells by bone marrow endothelial cells:
a possible role in homing of haemopoietic progenior cells to bone
marrow. Br J Haematol 106, 905-11 (1999).
[0393] 78. Peled, A. et al. Dependence of human stem cell
engraftment and repopulation of NOD/SCID mice on CXCR4. Science
283, 845-88 (1999).
[0394] 79. Peichev M, et al. Expression of VEGFR-2 and AC133 by
circulating human CD34(+) cells identifies a population of
functional endothelial precursors. Blood 95, 952-8 (2000).
[0395] 80. Voermans C, Gerritsen W R, von dem Borne A E, van der
Schoot C E. Increased migration of cord blood-derived CD34+ cells,
as compared to bone marrow and mobilized peripheral blood CD34+
cells across uncoated or fibronectin-coated filters. Exp. Hematol.
27, 1806-14 (2000).
[0396] 81. Janowska-Wieczorek, A. et al. Growth factors and
cytokines upregulate gelatinase expression in bone marrow CD34+
cells and their transmigration through reconstituted basement
membrane. Blood 93, 3379-3390 (1999).
[0397] 82. Masure, S., Proost, P., Van Damme, J., Opdenakker, M D.
Purification and identification of 91-kDa neutrophil gelatinase.
Release by the activating peptide interleukin-8. Eur. J. Biochem.
198,391-398 (1991).
[0398] 83. Pugin, J. et al. Human neutrophils secrete gelatinase B
in vitro and in vivo in response to endotoxin and proinflammatory
mediators. Am. J. Respir. Cell. Mol. Biol. 20, 458-464 (1999).
[0399] 84. Pruijt J F, et al. Prevention of interleukin-8-induced
mobilization of hematopoietic progenitor cells in rhesus monkeys by
inhibitory antibodies against the metalloproteinase gelatinase B
(MMP-9). Proc Natl Acad Sci USA. 96, 10863-10868 (1999).
[0400] 85. Heymans, S. et al. Inhibition of plasminogen activators
or matrix metalloproteinases prevents cardiac rupture but impairs
therapeutic angiogenesis and causes cardiac failure. Nat. Med. 5,
1135-1142 (1999).
[0401] 86. Hart, P. H. et al. Activation of human monocytes by
granulocyte-macrophage colony-stimulating factor: increased
urokinase-type plasminogen activator activity. Blood 77, 841-848
(1991).
[0402] 87. Stacey, K. J., Fowles, L. F., Colman, M. S., Ostrowski,
M. C., Hume, D. A. Regulation of urokinase-type plasminogen
activator gene transcription by macrophage colony-stimulating
factor. Mol. Cell. Biol. 15, 3430-3441 (1995).
[0403] 88. Pei, X. H. et al. G-CSF increases secretion of
urokinase-type plasminogen activator by human lung cancer cells.
Clin. Exp. Metastasis 16, 551-558 (1998).
[0404] 89. Semerad, C L, et al. A role for G-CSF receptor
signalling in the regulation of hematopoietic cell function but not
lineage commitment or differentiation. Immunity 11, 153-161
(1999).
[0405] 90. Nagasawa, T., et al. Defects of B-cell lymphopoiesis and
bone-marrow myelopoiesis in mice lacking the CXC chemokine
PBSF/SDF-1. Nature 382, 635-638 (1996).
[0406] 91. Rempel S A, Dudas S, Ge S, Gutierrez J A. Identification
and localization of the cytokine SDF1 and its receptor, CXC
chemokine receptor 4, to regions of necrosis and angiogenesis in
human glioblastoma, ClinCancerRes 6, 102-11 (2000).
Sequence CWU 1
1
6 1 20 DNA ARTIFICIAL SEQUENCE misc_feature ()..() PRIMER 1
gaagatagat tgcaccgatg 20 2 18 DNA ARTIFICIAL SEQUENCE misc_feature
()..() PRIMER 2 catagcctct cacatttc 18 3 25 DNA ARTIFICIAL SEQUENCE
misc_feature ()..() PRIMER 3 gcgcccgtcc gccaatgagc tgcgc 25 4 28
DNA ARTIFICIAL SEQUENCE misc_feature ()..() PRIMER 4 cttggggaca
cccttcagca tcttttgg 28 5 21 DNA ARTIFICIAL SEQUENCE misc_feature
()..() PRIMER 5 ctctacccac ggcaagttca a 21 6 20 DNA ARTIFICIAL
SEQUENCE misc_feature ()..() PRIMER 6 gggatgacct tgcccacagc 20
* * * * *