U.S. patent application number 10/738455 was filed with the patent office on 2004-07-01 for kv6.2, a voltage-gated potassium channel subunit.
This patent application is currently assigned to ICAgen, Incorporated. Invention is credited to Jegla, Timothy J..
Application Number | 20040126849 10/738455 |
Document ID | / |
Family ID | 30002526 |
Filed Date | 2004-07-01 |
United States Patent
Application |
20040126849 |
Kind Code |
A1 |
Jegla, Timothy J. |
July 1, 2004 |
Kv6.2, a voltage-gated potassium channel subunit
Abstract
The invention provides isolated nucleic acid and amino acid
sequences of Kv6.2, antibodies to Kv6.2, methods of detecting
Kv6.2, methods of screening for voltage-gated potassium channel
activators and inhibitors using biologically active Kv6.2, and kits
for screening for activators and inhibitors of voltage gated
potassium channels comprising Kv6.2.
Inventors: |
Jegla, Timothy J.; (San
Diego, CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
ICAgen, Incorporated
4222 Emperor Boulevard, Suite 350
Durham
NC
27703
|
Family ID: |
30002526 |
Appl. No.: |
10/738455 |
Filed: |
December 16, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10738455 |
Dec 16, 2003 |
|
|
|
09719919 |
Feb 22, 2001 |
|
|
|
6680180 |
|
|
|
|
09719919 |
Feb 22, 2001 |
|
|
|
PCT/US99/14945 |
Jun 30, 1999 |
|
|
|
60091466 |
Jul 1, 1998 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 435/6.16; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/705
20130101 |
Class at
Publication: |
435/069.1 ;
435/320.1; 435/325; 530/350; 536/023.5; 435/006 |
International
Class: |
C12Q 001/68; C07H
021/04; C07K 014/705 |
Claims
What is claimed is:
1. An isolated nucleic acid encoding a polypeptide monomer
comprising an alpha subunit of a heteromeric potassium channel, the
polypeptide monomer: (i) having the ability to form, with at least
one additional Kv alpha subunit, a heteromeric potassium channel
having the characteristic of voltage gating; (ii) having a monomer
subunit association region that has greater than about 70% amino
acid sequence identity to a Kv6.2 subunit association region; and
(iii) specifically binding to polyclonal antibodies generated
against SEQ ID NO:1 or SEQ ID NO:17.
2. The isolated nucleic acid of claim 1, wherein the nucleic acid
encodes human Kv6.2.
3. The isolated nucleic acid of claim 1, wherein the nucleic acid
encodes mouse Kv6.2.
4. The isolated nucleic acid of claim 1, wherein the nucleic acid
encodes SEQ ID NO:1 or SEQ ID NO:17.
5. The isolated nucleic acid sequence of claim 1, wherein the
nucleic acid has a nucleotide sequence of SEQ ID NO:2 or SEQ ID
NO:18.
6. The isolated nucleic acid of claim 1, wherein the nucleic acid
is amplified by primers that selectively hybridize under stringent
hybridization conditions to the same sequence as the primer sets
selected from the group consisting of:
3 ATGCCCATGTCTTCCAGAGACAGG, (SEQ ID NO:3)
GATGTCTAGAGGGAGTTACATGTAGCG (SEQ ID NO:4) and
GGCACTACGCATCCTCTACGTAATGCGC, (SEQ ID NO:5)
GATGATGGCCCACCAATAGGATGCGG (SEQ ID NO:6) and
ATGCCCATGCCTTCCAGAGACGG, (SEQ ID NO:7) TTACATGTGCATGATAGGCAAGGCTG
(SEQ ID NO:8) and GTCCAGGCCCAAGACAAGTGTCAG, (SEQ ID NO:9)
GGGAGAAGGTGTGGAAGATAGACG. (SEQ ID NO:10)
7. The isolated nucleic acid of claim 1, wherein the nucleic acid
encodes a polypeptide monomer having a molecular weight of about
between 53 kDa to about 65 kDa.
8. An isolated nucleic acid encoding a polypeptide monomer
comprising an alpha subunit of a heteromeric potassium channel, the
polypeptide monomer: (i) having the ability to form, with at least
one additional Kv alpha subunit, a heteromeric potassium channel
having the characteristic of voltage gating; (ii) having an S4-S6
region that has greater than about 85% amino acid sequence identity
to a Kv6.2 S4-S6 region and (iii) specifically binding to
polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID
NO:17.
9. An isolated nucleic acid encoding a polypeptide monomer that
specifically hybridizes under stringent conditions to SEQ ID NO:2
or SEQ ID NO:18.
10. The isolated nucleic acid of claim 1 or 8, wherein said nucleic
acid selectively hybridizes under moderately stringent
hybridization conditions to a nucleotide sequence of SEQ ID NO:2 or
SEQ ID NO:18.
11. An isolated polypeptide monomer comprising an alpha subunit of
a heteromeric potassium channel, the polypeptide monomer: (i)
having the ability to form, with at least one additional Kv alpha
subunit, a heteromeric potassium channel having the characteristic
of voltage gating; (ii) having a monomer subunit association region
that has greater than 70% amino acid sequence identity to a Kv6.2
subunit association region; and (iv) specifically binding to
polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID
NO:17.
12. The isolated polypeptide monomer of claim 11, wherein the
polypeptide monomer has an amino acid sequence of human Kv6.2.
13. The isolated polypeptide monomer of claim 11, wherein the
polypeptide monomer has an amino acid sequence of mouse Kv6.2.
14. The isolated polypeptide monomer of claim 11, wherein the
polypeptide monomer has an amino acid sequence of SEQ ID NO:1 or
SEQ ID NO:17.
15. An isolated polypeptide monomer comprising an alpha subunit of
a heteromeric potassium channel, the polypeptide monomer: (i)
having the ability to form, with at least one additional Kv alpha
subunit, a heteromeric potassium channel having the characteristic
of voltage gating; (ii) having an S4-S6 region that has greater
than 85% amino acid sequence identity to a Kv6.2 S4-S6 region; and
(iii) specifically binding to polyclonal antibodies generated
against SEQ ID NO:1 or SEQ ID NO:17.
16. An antibody that selectively binds to the polypeptide monomer
of claim 11 or 15.
17. An antibody of claim 16, wherein the polypeptide monomer has an
amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17.
18. An expression vector comprising the nucleic acid of claim
1.
19. A host cell transfected with the vector of claim 18.
20. A method for identifying a compound that increases or decreases
ion flux through a heteromeric voltage-gated potassium channel, the
method comprising the steps of: (i) contacting the compound with a
eukaryotic host cell or cell membrane in which has been expressed a
polypeptide monomer comprising an alpha subunit of a heteromeric
potassium channel, the polypeptide monomer: (a) having the ability
to form, with at least one additional Kv alpha subunit, a
heteromeric potassium channel having the characteristic of voltage
gating; (b) having a monomer subunit association region that has
greater than 70% amino acid sequence identity to a Kv6.2 subunit
association region; and (c) specifically binding to polyclonal
antibodies generated against SEQ ID NO:1 or SEQ ID NO:17; and (ii)
determining the functional effect of the compound upon the cell or
cell membrane expressing the potassium channel.
21. The method of claim 20, wherein the increased or decreased flux
of ions is determined by measuring changes in current or
voltage.
22. The method of claim 20, wherein the potassium channel monomer
polypeptide is recombinant.
23. The method of claim 20, wherein the potassium channel monomer
polypeptide is human Kv6.2.
24. The method of claim 20, wherein the potassium channel monomer
polypeptide is mouse Kv6.2.
25. The method of claim 20, wherein the potassium channel monomer
polypeptide has an amino acid sequence of SEQ ID NO:1 or SEQ ID
NO:17.
26. A method for identifying a compound that increases or decreases
ion flux through a heteromeric voltage-gated potassium channel, the
method comprising the steps of: (i) contacting the compound with a
eukaryotic host cell or cell membrane in which has been expressed a
polypeptide monomer comprising an alpha subunit of a heteromeric
potassium channel, the polypeptide monomer: (a) having the ability
to form, with at least one additional Kv alpha subunit, a
heteromeric potassium channel having the characteristic of voltage
gating; (b) having an S4-S6 region that has greater than 85% amino
acid sequence identity to a Kv6.2 S4-S6 region; and (c)
specifically binding to polyclonal antibodies generated against SEQ
ID NO:1 or SEQ ID NO:17; and (ii) determining the functional effect
of the compound upon the cell or cell membrane expressing the
potassium channel.
27. A method of detecting the presence of Kv6.2 in mammalian
tissue, the method comprising the steps of: (i) isolating a
biological sample; (ii) contacting the biological sample with a
Kv6.2-specific reagent that selectively associates with Kv6.2; and,
(iii) detecting the level of Kv6.2-specific reagent that
selectively associates with the sample.
28. The method of claim 27, wherein the Kv6.2-specific reagent is
selected from the group consisting of: Kv6.2 specific antibodies,
Kv6.2 specific oligonucleotide primers, and Kv6.2 nucleic acid
probes.
29. The method of claim 27, wherein the sample is from a human.
30. In a computer system, a method of screening for mutations of
human Kv6.2 genes, the method comprising the steps of: (i) entering
into the computer a first nucleic acid sequence encoding an
voltage-gated potassium channel polypeptide monomer having a
nucleotide sequence of SEQ ID NO:2, SEQ ID NO:18, and
conservatively modified versions thereof; (ii) comparing the first
nucleic acid sequence with a second nucleic acid sequence having
substantial identity to the first nucleic acid sequence; and (iii)
identifying nucleotide differences between the first and second
nucleic acid sequences.
31. The method of claim 30, wherein the second nucleic acid
sequence is associated with a disease state.
32. In a computer system, a method for identifying a
three-dimensional structure of Kv6.2 polypeptide monomers, the
method comprising the steps of: (i) entering into the computer
system an amino acid sequence of at least 25 amino acids of a
potassium channel polypeptide monomer or at least 75 nucleotides of
a gene encoding the polypeptide monomer, the polypeptide monomer
having an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17, and
conservatively modified versions thereof; and (ii) generating a
three-dimensional structure of the polypeptide monomer encoded by
the amino acid sequence.
33. The method of claim 32, wherein said amino acid sequence is a
primary structure and wherein said generating step includes the
steps of: (i) forming a secondary structure from said primary
structure using energy terms determined by the primary structure;
and (ii) forming a tertiary structure from said secondary structure
using energy terms determined by said secondary structure.
34. The method of claim 33, wherein said generating step further
includes the step of forming a quaternary structure from said
tertiary structure using anisotropic terms encoded by the tertiary
structure.
35. The method of claim 31, further comprising the step of
identifying regions of the three-dimensional structure of a Kv6.2
potassium channel protein that bind to ligands and using the
regions to identify ligands that bind to the potassium channel
protein.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Ser. No.
60/091,466, filed Jul. 1, 1998, herein incorporated by reference in
its entirety.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] Not applicable.
FIELD OF THE INVENTION
[0003] The invention provides isolated nucleic acid and amino acid
sequences of Kv6.2, antibodies to Kv6.2, methods of detecting
Kv6.2, methods of screening for voltage-gated potassium channel
activators and inhibitors using biologically active Kv6.2, and kits
for screening for activators and inhibitors of voltage gated
potassium channels comprising Kv6.2.
BACKGROUND OF THE INVENTION
[0004] Potassium channels are involved in a number of physiological
processes, including regulation of heartbeat, dilation of arteries,
release of insulin, excitability of nerve cells, and regulation of
renal electrolyte transport. Potassium channels are thus found in a
wide variety of animal cells such as nervous, muscular, glandular,
immune, reproductive, and epithelial tissue. These channels allow
the flow of potassium in and/or out of the cell under certain
conditions. For example, the outward flow of potassium ions upon
opening of these channels makes the interior of the cell more
negative, counteracting depolarizing voltages applied to the cell.
These channels are regulated, e.g., by calcium sensitivity,
voltage-gating, second messengers, extracellular ligands, and
ATP-sensitivity.
[0005] Potassium channels are made by alpha subunits that fall into
8 families, based on predicted structural and functional
similarities (Wei et al., Neuropharmacology 35(7):805-829 (1997)).
Three of these families (Kv, Eag-related, and KQT) share a common
motif of six transmembrane domains and are primarily gated by
voltage. Two other families, CNG and SK/IK, also contain this motif
but are gated by cyclic nucleotides and calcium, respectively. The
three other families of potassium channel alpha subunits have
distinct patterns of transmembrane domains. Slo family potassium
channels, or BK channels have seven transmembrane domains (Meera et
al., Proc. Natl. Acad. Sci. U.S.A. 94(25):14066-71 (1997)) and are
gated by both voltage and calcium or pH (Schreiber et al., J. Biol.
Chem. 273:3509-16 (1998)). Another family, the inward rectifier
potassium channels (Kir), belong to a structural family containing
2 transmembrane domains (see, e.g., Lagrutta et al., Jpn. Heart. J.
37:651-660 1996)), and an eighth functionally diverse family (TP,
or "two-pore") contains 2 tandem repeats of this inward rectifier
motif.
[0006] Potassium channels are typically formed by four alpha
subunits, and can be homomeric (made of identical alpha subunits)
or heteromeric (made of two or more distinct types of alpha
subunits). In addition, potassium channels made from Kv, KQT and
Slo or BK subunits have often been found to contain additional,
structurally distinct auxiliary, or beta, subunits. These beta
subunits do not form potassium channels themselves, but instead
they act as auxiliary subunits to modify the functional properties
of channels formed by alpha subunits. For example, the Kv beta
subunits are cytoplasmic and are known to increase the surface
expression of Kv channels and/or modify inactivation kinetics of
the channel (Heinemann et al., J. Physiol. 493:625-633 (1996); Shi
et al., Neuron 16(4):843-852 (1996)). In another example, the KQT
family beta subunit, minK, primarily changes activation kinetics
(Sanguinetti et al., Nature 384:80-83 (1996)).
[0007] The Kv superfamily of voltage-gated potassium channels
includes both heteromeric and homomeric channels that are typically
composed of four subunits (see, e.g., Salinas et al., J. Biol.
Chem. 272:8774-8780 (1997); Salinas et al., J. Biol. Chem
272:24371-24379 (1997); Post et al., FEBS Letts. 399:177-182
(1996)). Voltage-gated potassium channels have been found in a wide
variety of tissues and cell types and are involved in processes
such as neuronal integration, cardiac pacemaking, muscle
contraction, hormone section, cell volume regulation, lymphocyte
differentiation, and cell proliferation (see, e.g., Salinas et al.,
J. Biol. Chem. 39:24371-24379 (1997)). Some alpha subunits of the
Kv superfamily, of which the channels are composed, have been
cloned and expressed, e.g., Kv5.1, Kv6.1 (Drewe et al., J.
Neurosci. 12:538-548 (1992); Post et al., FEBS Letts. 399:177-182
(1996)); Kv8.1 (Hugnot et al., EMBO J. 15:3322-3331 (1996)); and
Kv9.1 and 9.2 (Salinas et al., J. Biol. Chem. 39:24371-24379
(1997)). Expression patterns of some of these genes has also been
examined (see, e.g., Verma-Kurvari et al., Mol. Brain. Res.
46:54-62 (1997); Maletic-Savatic et al., J. Neurosci. 15:3840-3851
(1995); Du et al., Neurosci. 84:37-48 (1998)).
SUMMARY OF THE INVENTION
[0008] The present invention thus provides for the first time
Kv6.2, a polypeptide monomer that is an alpha subunit of an
heteromeric voltage-gated potassium channel. Kv6.2 has not been
previously cloned or identified, and the present invention provides
the nucleotide and amino acid sequences for mouse and human
Kv6.2.
[0009] In one aspect, the present invention provides an isolated
nucleic acid encoding a polypeptide monomer comprising an alpha
subunit of a heteromeric potassium channel, the polypeptide
monomer: (i) having the ability to form, with at least one
additional Kv alpha subunit, a heteromeric potassium channel having
the characteristic of voltage gating; (ii) having a monomer subunit
association region that has greater than 70% amino acid sequence
identity to a Kv6.2 subunit association region; and (iii)
specifically binding to polyclonal antibodies generated against SEQ
ID NO:1 or SEQ ID NO:17.
[0010] In one aspect, the present invention provides an isolated
nucleic acid encoding a polypeptide monomer comprising an alpha
subunit of a heteromeric potassium channel, the polypeptide
monomer: (i) having the ability to form, with at least one
additional Kv alpha subunit, a heteromeric potassium channel having
the characteristic of voltage gating; (ii) having an S4-S6 region
that has greater than 85% amino acid sequence identity to a Kv6.2
S4-S6 region; and (iii) specifically binding to polyclonal
antibodies generated against SEQ ID NO:1 or SEQ ID NO:17.
[0011] In one embodiment, the nucleic acid encodes mouse or human
Kv6.2. In another embodiment, the nucleic acid encodes SEQ ID NO:1
or SEQ ID NO:17. In another embodiment, the nucleic acid has a
nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:18.
[0012] In one embodiment, the nucleic acid is amplified by primers
that selectively hybridize under stringent hybridization conditions
to the same sequence as the primer sets selected from the group
consisting of:
1 ATGCCCATGTCTTCCAGAGACAGG, (SEQ ID NO:3)
GATGTCTAGAGGGAGTTACATGTAGCG (SEQ ID NO:4) and
GGCACTACGCATCCTCTACGTAATGCGC, (SEQ ID NO:5)
GATGATGGCCCACCAATAGGATGCGG (SEQ ID NO:6) and
ATGCCCATGCCTTCCAGAGACGG, (SEQ ID NO:7) TTACATGTGCATGATAGGCAAGGCTG
(SEQ ID NO:8) and GTCCAGGCCCAAGACAAGTGTCAG, (SEQ ID NO:9)
GGGAGAAGGTGTGGAAGATAGACG. (SEQ ID NO:10)
[0013] In one embodiment, the nucleic acid encodes a polypeptide
monomer having a molecular weight of between about 53 kDa to about
65 kDa. In one embodiment, the nucleic acid selectively hybridizes
under moderately stringent hybridization conditions to a nucleotide
sequence of SEQ ID NO:2 or SEQ ID NO:18.
[0014] In another aspect, the present invention provides an
isolated nucleic acid encoding a polypeptide monomer, wherein the
nucleic acid specifically hybridizes under highly stringent
conditions to SEQ ID NO:2 or SEQ ID NO:18.
[0015] In another aspect, the present invention provides an
isolated polypeptide monomer comprising an alpha subunit of a
heteromeric potassium channel, the potassium channel: (i) having
the ability to form, with at least one additional Kv alpha subunit,
a heteromeric potassium channel having the characteristic of
voltage gating; (ii) having a monomer subunit association region
that has greater than 70% amino acid sequence identity to amino
acids a Kv6.2 subunit association region; and (iv) specifically
binding to polyclonal antibodies generated against SEQ ID NO:1 or
SEQ ID NO:17.
[0016] In another aspect, the present invention provides an
isolated polypeptide monomer comprising an alpha subunit of a
heteromeric potassium channel, the potassium channel: (i) having
the ability to form, with at least one additional Kv alpha subunit,
a heteromeric potassium channel having the characteristic of
voltage gating; (ii) having an S4-S6 region that has greater than
85% amino acid sequence identity to a Kv6.2 S4-S6 region; and (iv)
specifically binding to polyclonal antibodies generated against SEQ
ID NO:1 or SEQ ID NO:17.
[0017] In one embodiment, the polypeptide monomer has an amino acid
sequence of mouse or human Kv6.2. In another embodiment, the
polypeptide monomer has an amino acid sequence of SEQ ID NO:1 or
SEQ ID NO:17.
[0018] In another aspect, the present invention provides an
antibody that selectively binds to the polypeptide monomer
described above.
[0019] In another aspect, the present invention provides an
expression vector comprising the nucleic acid encoding the
polypeptide monomer described above.
[0020] In another aspect, the present invention provides a host
cell transfected with the expression vector described above.
[0021] In another aspect, the present invention provides a method
for identifying a compound that increases or decreases ion flux
through an voltage-gated potassium channel, the method comprising
the steps of: (i) contacting the compound with a eukaryotic host
cell or cell membrane in which has been expressed a polypeptide
monomer comprising an alpha subunit of a heteromeric potassium
channel, the polypeptide monomer: (a) having the ability to form,
with at least one additional Kv alpha subunit, a heteromeric
potassium channel having the characteristic of voltage gating; (b)
having a monomer subunit association region that has greater than
70% amino acid sequence identity to a Kv6.2 subunit association
region; and (c) specifically binding to polyclonal antibodies
generated against SEQ ID NO:1 or SEQ ID NO:17; and (ii) determining
the functional effect of the compound upon the cell or cell
membrane expressing the potassium channel.
[0022] In another aspect, the present invention provides a method
for identifying a compound that increases or decreases ion flux
through an voltage-gated potassium channel, the method comprising
the steps of: (i) contacting the compound with a eukaryotic host
cell or cell membrane in which has been expressed a polypeptide
monomer comprising an alpha subunit of a heteromeric potassium
channel, the polypeptide monomer: (a) having the ability to form,
with at least one additional Kv alpha subunit, a heteromeric
potassium channel having the characteristic of voltage gating; (b)
having an S4-S6 region that has greater than 85% amino acid
sequence identity to a Kv6.2 S4-S6 region as measured using a
sequence comparison algorithm; and (c) specifically binding to
polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID
NO:17; and (ii) determining the functional effect of the compound
upon the cell or cell membrane expressing the potassium
channel.
[0023] In one embodiment, the increased or decreased flux of ions
is determined by measuring changes in current or voltage. In
another embodiment, the polypeptide monomer polypeptide is
recombinant.
[0024] In another embodiment, the present invention provides a
method of detecting the presence of Kv6.2 in mammalian tissue, the
method comprising the steps of: (i) isolating a biological sample;
(ii) contacting the biological sample with a Kv6.2-specific reagent
that selectively associates with Kv6.2; and, (iii) detecting the
level of Kv6.2-specific reagent that selectively associates with
the sample.
[0025] In one embodiment, the Kv6.2-specific reagent is selected
from the group consisting of: Kv6.2 specific antibodies, Kv6.2
specific oligonucleotide primers, and Kv6.2 nucleic acid probes. In
another embodiment, the sample is from a human.
[0026] In another aspect, the present invention provides, in a
computer system, a method of screening for mutations of Kv6.2
genes, the method comprising the steps of: (i) entering into the
computer a first nucleic acid sequence encoding an voltage-gated
potassium channel protein having a nucleotide sequence of SEQ ID
NO:2 or SEQ ID NO:18, and conservatively modified versions thereof;
(ii) comparing the first nucleic acid sequence with a second
nucleic acid sequence having substantial identity to the first
nucleic acid sequence; and (iii) identifying nucleotide differences
between the first and second nucleic acid sequences.
[0027] In one embodiment, the second nucleic acid sequence is
associated with a disease state.
[0028] In another aspect, the present invention provides, in a
computer system, a method for identifying a three-dimensional
structure of Kv6.2 polypeptides, the method comprising the steps
of: (i) entering into the computer system an amino acid sequence of
at least 25 amino acids of a potassium channel monomer or at least
75 nucleotides of a gene encoding the polypeptide, the polypeptide
having an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17, and
conservatively modified versions thereof; and (ii) generating a
three-dimensional structure of the polypeptide encoded by the amino
acid sequence.
[0029] In one embodiment, the amino acid sequence is a primary
structure and wherein said generating step includes the steps of:
(i) forming a secondary structure from said primary structure using
energy terms determined by the primary structure; and (ii) forming
a tertiary structure from said secondary structure using energy
terms determined by said secondary structure. In another
embodiment, the generating step includes the step of forming a
quaternary structure from said tertiary structure using anisotropic
terms determined by the tertiary structure. In another embodiment,
the methods further comprises the step of identifying regions of
the three-dimensional structure of the protein that bind to ligands
and using the regions to identify ligands that bind to the
protein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1. Amino acid alignment of the human and mouse Kv6.2
genes. Identical residues are shaded and gaps in the alignment are
indicated by dashes. Amino acid residue numbers are given at the
left margin. Human and mouse Kv6.2 are 80% identical overall on the
amino acid level.
[0031] FIG. 2. Expression of Kv6.2 genes in Xenopus oocytes. (A)
Currents recorded from an ooycte injected with cRNA from the mouse
Kv6.2 gene. Voltage steps used were from a resting potential of -90
mV and ranged from -80 mV to +20 mV in 20 mV increments. Neither
mouse or human Kv6.2 gave rise to outward voltage-gated potassium
currents under these conditions. (B-D) Currents recorded from
oocytes injected with cRNA for the human Kv2.1 gene alone (B), for
a coinjection with human Kv2.1 and mouse Kv6.2 (C), and for a
coinjection of human Kv2.1 and human Kv6.2; Identical voltage steps
were applied to each egg. Resting potential in each case was -90 mV
and the voltage steps ranged from -80 mV to +20 mV in 20 mV
increments. Note both Kv6.2/Kv2.1 heteromers activate at more
hyperpolarized voltages than Kv2.1 homomers. Also note that the
deactivation of the heteromers is much slower than that seen for
Kv2.1 homomers. The amount of Kv2.1 cRNA used in (B) was one eighth
of that used in (C) and (D). Both Kv6.2 genes consistently cause a
reduction in the size of the Kv2.1 current.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0032] The present invention provides for the first time a nucleic
acid encoding Kv6.2, identified and cloned from mouse and human
tissue. This polypeptide monomer is a member of the "Kv"
superfamily of potassium channel monomers. Members of this family
are polypeptide monomers that are subunits of voltage-gated
potassium channels having six transmembrane regions (K=potassium,
v=voltage-gated). Voltage-gated potassium channels have significant
roles in maintaining the resting potential and in controlling
excitability of a cell.
[0033] The invention also provides methods of screening for
activators and inhibitors of voltage-gated potassium channels that
contain a Kv6.2 subunit. Such modulators of voltage-gated channel
activity are useful for treating CNS disorders such as migraines,
hearing and vision problems, psychotic disorders, seizures, and as
neuroprotective agents (e.g., to prevent stroke).
[0034] Furthermore, the invention provides assays for Kv6.2
activity where Kv6.2 acts as a direct or indirect reporter
molecule. Such uses of Kv6.2 as a reporter molecule in assay and
detection systems have broad applications, e.g., Kv6.2 can be used
as a reporter molecule to measure changes in potassium
concentration, membrane potential, current flow, ion flux,
transcription, signal transduction, receptor-ligand interactions,
second messenger concentrations, in vitro, in vivo, and ex vivo. In
one embodiment, Kv6.2 can be used as an indicator of current flow
in a particular direction (e.g., outward or inward potassium flow),
and in another embodiment, Kv6.2 can be used as an indirect
reporter via attachment to a second reporter molecule such as green
fluorescent protein.
[0035] Finally, the invention provides for methods of detecting
Kv6.2 nucleic acid and protein expression, allowing investigation
of the channel diversity provided by Kv6.2 and the
regulation/modulation of heteromeric channel activity provided by
Kv6.2, as well as diagnosis of disease involving abnormal ion flux,
including diagnosis of CNS disease such as migraines, hearing and
vision problems, seizures and psychotic disorders.
[0036] Functionally, Kv6.2 is an alpha subunit of an voltage-gated
potassium channel. Typically, such voltage-gated channels are
heteromeric or homomeric and contain four subunits or monomers each
with six transmembrane domains. Voltage-gated potassium channels
comprising Kv6.2 are typically heteromeric and may contain one or
more subunits of Kv6.2 along with one or more other subunits from
the Kv superfamily, e.g., Kv 2.1 and Kv 2.2. The presence of Kv6.2
in an voltage-gated potassium channel modulates the activity of the
heteromeric channel and thus enhances channel diversity. For
example, when Kv6.2 associates with another monomer, the resulting
channel may have a distinct single channel conductance as well as
altered kinetic properties, e.g., changes in activation or
inactivation rates and changes in voltages and thresholds for
activation. For example, FIG. 2 shows a hyperpolarized shift in
activation voltages by about 20 mV, and a dramatic slowing of
deactivation in channels comprising Kv6.2 and Kv2.1 as compared to
channels comprising only Kv2.1. Channel diversity is also enhanced
with alternatively spliced forms of Kv6.2.
[0037] Structurally, the nucleotide sequence of mouse Kv6.2 (SEQ ID
NO:2 encodes a polypeptide monomer of approximately 506 amino acids
with a predicted molecular weight of approximately 58 kDa (SEQ ID
NO:1) and a predicted range of 53-63 kDa. The nucleotide sequence
of human Kv6.2 (SEQ ID NO:18) encodes a polypeptide monomer of
approximately 519 amino acids with a predicted molecular weight of
approximately 60 kDa (SEQ ID NO:17) and a predicted range of 55-65
kDa. In particular, the amino acid sequence of Kv6.2 has a "subunit
association" region (approximately amino acids 70 to 182, see,
e.g., amino acids 70-182 of SEQ ID NO:1, mouse Kv6.2) that has a
conserved amino acid sequence. Related Kv6.2 genes from other
species and/or Kv6 family members share at least about 70% amino
acid identity in this region. The amino acid sequence of Kv6.2 also
has a conserved S4-S6 region (approximately amino acids 326466,
see, e.g., amino acids 326466 of SEQ ID NO 1, mouse Kv6.2). Related
Kv6.2 genes from other species and/or Kv6 family members share at
least about 85% amino acid identity in this region.
[0038] The present invention also provide polymorphic variants of
the Kv6.2 depicted in SEQ ID NO:1: variant #1, in which a aspartate
residue is substituted for the glutamate residue at amino acid
position 484; variant #2, in which a valine residue is substituted
for the leucine residue at amino acid position 174; and variant #3,
in which a serine residue is substituted for the alanine residue at
amino acid position 195.
[0039] The present invention also provide polymorphic variants of
the Kv6.2 depicted in SEQ ID NO:17: variant #1, in which a leucine
residue is substituted for the methionine residue at amino acid
position 501; variant #2, in which a serine residue is substituted
for the alanine residue at amino acid position 148; variant #3, in
which a valine residue is substituted for the isoleucine residue at
amino acid position 508; and variant #4, in which a phenylalanine
residue is substituted for the tyrosine residue at amino acid
position 17.
[0040] Specific regions of the Kv6.2 nucleotide and amino acid
sequence may be used to identify polymorphic variants, interspecies
homologs, and alleles of Kv6.2. This identification can be made in
vitro, e.g., under stringent hybridization conditions and
sequencing, or by using the sequence information in a computer
system for comparison with other nucleotide sequences, or using
antibodies raised against Kv6.2. Typically, identification of
polymorphic variants and alleles of Kv6.2 is made by comparing the
amino acid sequence (or the nucleic acid sequenc encoding the amino
acid sequence) of the subunit association region (approximately
amino acids 70-182 of mouse Kv6.2, see SEQ ID NO:1 for example) or
the S4-S6 region (approximately amino acids 326-466 of mouse Kv6.2,
see SEQ ID NO:1 for example). Amino acid identity of approximately
at least 70% or above, preferably 80%, 85%, most preferably 90-95%
or above in the subunit association region or the S4-S6 region
typically demonstrates that a protein is a polymorphic variant,
interspecies homolog, or allele of Kv6.2. Sequence comparison can
be performed using any of the sequence comparison algorithms
discussed below. Antibodies that bind specifically to the subunit
association region of Kv6.2 can also be used to identify alleles,
interspecies homologs, and polymorphic variants.
[0041] Polymorphic variants, interspecies homologs, and alleles of
Kv6.2 are confirmed by co-expressing the putative Kv6.2 polypeptide
monomer and examining whether the monomer forms a heteromeric
voltage-gated potassium channel, when co-expressed with another
member of the Kv family such as Kv 2.1 or 2.2. This assay is used
to demonstrate that a protein having about 70% or greater,
preferably 75, 80, 85, 90, or 95% or greater amino acid identity to
the "subunit association" region of Kv6.2 shares the same
functional characteristics as Kv6.2 and is therefore a species of
Kv6.2. This assay is also used to demonstrate that a protein having
about 85% or greater, preferably 90%, 95% or greater amino acid
identity to the "S4-S6" region of Kv6.2 shares the same functional
characteristics as Kv6.2 and is therefore a species of Kv6.2.
Typically, Kv6.2 having the amino acid sequence of SEQ ID NO:1 or
SEQ ID NO:17 is used as a positive control in comparison to the
putative Kv6.2 protein to demonstrate the identification of a
polymorphic variant or allele of Kv6.2.
[0042] Kv6.2 nucleotide and amino acid sequence information may
also be used to construct models of a heteromeric voltage-gated
potassium channels in a computer system. These models are
subsequently used to identify compounds that can activate or
inhibit heteromeric voltage-gated potassium channels comprising
Kv6.2. Such compounds that modulate the activity of channels
comprising Kv6.2 can be used to investigate the role of Kv6.2 in
modulation of channel activity and in channel diversity.
[0043] The isolation of biologically active Kv6.2 for the first
time provides a means for assaying for inhibitors and activators of
heteromeric voltage-gated potassium channels that comprise Kv6.2
subunits. Biologically active Kv6.2 is useful for testing
inhibitors and activators of voltage-gated potassium channels
comprising subunits of Kv6.2 and other Kv members using in vivo and
in vitro expression that measure, e.g., changes in voltage or
current. Such activators and inhibitors identified using an
voltage-gated potassium channel comprising at least one Kv6.2
subunit can be used to further study voltage gating, channel
kinetics and conductance properties of heteromeric channels. Such
activators and inhibitors are useful as pharmaceutical agents for
treating diseases involving abnormal ion flux, e.g., CNS disorders,
as described above. Methods of detecting Kv6.2 and expression of
channels comprising Kv6.2 are also useful for diagnostic
applications for diseases involving abnormal ion flux, e.g., CNS
disorders and other disorders. For example, chromosome localization
of the gene encoding Kv6.2 can be used to identify diseases caused
by and associated with Kv6.2. Methods of detecting Kv6.2 are also
useful for examining the role of Kv6.2 in channel diversity and
modulation of channel activity.
II. Definitions
[0044] As used herein, the following terms have the meanings
ascribed to them unless specified otherwise.
[0045] The phrase "voltage-gated" activity or "voltage-gating"
refers to a characteristic of a potassium channel composed of
individual polypeptide monomers or subunits. Generally, the
probability of a voltage-gated potassium channel opening increases
as a cell is depolarized. Voltage-gated potassium channels
primarily allow efflux of potassium because they have greater
probabilities of being open at membrane potentials more positive
than the membrane potential for potassium (E.sub..kappa.) in
typical cells. E.sub..kappa., or the membrane potential for
potassium, depends on the relative concentrations of potassium
found inside and outside the cell membrane, and is typically
between -60 and -100 mV for mammalian cells. E.sub..kappa. is the
membrane potential at which there is no net flow of potassium ion
because the electrical potential (i.e., voltage potential driving
potassium influx is balanced by the concentration gradient ( the
[K.sup.+] potential) directing potassium efflux. This value is also
known as the "reversal potential" or the "Nernst" potential for
potassium. Some voltage-gated potassium channels undergo
inactivation, which can reduce potassium efflux at higher membrane
potentials. Potassium channels can also allow potassium influx in
certain instances when they remain open at membrane potentials
negative to E.sub..kappa. (see, e.g., Adams & Nonner, in
Potassium Channels, pp. 40-60 (Cook, ed., 1990)). The
characteristic of voltage gating can be measured by a variety of
techniques for measuring changes in current flow and ion flux
through a channel, e.g., by changing the [K.sup.+] of the external
solution and measuring the activation potential of the channel
current (see, e.g., U.S. Pat. No. 5,670,335), by measuring current
with patch clamp techniques or voltage clamp under different
conditions, and by measuring ion flux with radiolabeled tracers or
voltage-sensitive dyes under different conditions.
[0046] "Homomeric channel" refers to an Kv6.2 channel composed of
identical alpha subunits, whereas "heteromeric channel" refers to
an Kv6.2 channel composed of at least one Kv alpha subunit plus at
least one other different type of alpha subunit from the Kv family,
e.g., Kv2.1. Both homomeric and heteromeric channels can include
auxiliary beta subunits. Typically, the channel is composed of four
alpha subunits and the channel can be heteromeric or homomeric.
[0047] A "beta subunit" is a polypeptide monomer that is an
auxiliary subunit of a potassium channel composed of alpha
subunits; however, beta subunits alone cannot form a channel (see,
e.g., U.S. Pat. No. 5,776,734). Beta subunits are known, for
example, to increase the number of channels by helping the alpha
subunits reach the cell surface, change activation kinetics, and
change the sensitivity of natural ligands binding to the channels.
Beta subunits can be outside of the pore region and associated with
alpha subunits comprising the pore region. They can also contribute
to the external mouth of the pore region.
[0048] The phrase "subunit association region" refers to the region
of Kv6.2 that structurally identifies this particular protein
(approximately amino acids 70-182 of mouse Kv6.2, see SEQ ID NO:1).
This region can be used to identify Kv6.2 polymorphic variants and
Kv6.2 alleles of Kv6.2, through amino acid sequence identity
comparison using a sequence comparison algorithm such as PILEUP.
The subunit association region is described in Shen et al., Neuron
11:67-76 (1993); Yu et al., Neuron 16:441-453 (1996); Xu et al., J.
Biol. Chem. 270:24761-24768 (1995); Shen & Pfaffinger, Neuron
14:625-633 (1995); Kreusch et al., Nature 392:945-948 (1998); and
Li et al., Science 257:1225-1230 (1992).
[0049] The phrase "S4-S6 region" (S4 to S6 region) refers to the
region of Kv6.2 that structurally identifies this particular
protein (approximately amino acids 326-466 of mouse Kv6.2, see SEQ
ID NO:1). This region can be used to identify Kv6.2 polymorphic
variants and Kv6.2 alleles of Kv6.2; through amino acid sequence
identity comparison using a sequence comparison algorithm such as
PILEUP. S4-S6 comprises three transmembrane regions: S4, S5, the
pore domain, and S6 and is involved in voltage-gating and ion
conduction (see, e.g., Ackerman & Clapham, New Engl. J. Med.
336:1575-1586 (1997); Jan & Jan, Annu. Rev. Neurosci. 20:91-123
(1997)).
[0050] "Kv6.2" refers to a polypeptide that is a subunit or monomer
of an voltage-gated potassium channel, a member of the Kv6 family,
and a member of the Kv superfamily of potassium channel monomers.
When Kv6.2 is part of a potassium channel, preferably a heteromeric
potassium channel, the channel has voltage-gated activity. The term
Kv6.2 therefore refers to polymorphic variants, alleles, mutants,
and interspecies homologs that: (1) have a subunit association
region that has greater than about 70% amino acid sequence
identity, preferably about 75, 80, 85, 90 or 95% amino acid
sequence identity, to a Kv6.2 subunit association region; (2) have
an S4-S6 region that has greater than about 85% amino acid sequence
identity, preferably about 90 or 95% amino acid sequence identity,
to a Kv6.2 S4-S6 region (3) bind to antibodies raised against an
immunogen comprising an amino acid sequence selected from the group
consisting of SEQ ID NO:1, SEQ ID NO:17, the subunit association
region, the S4-S6 region, and conservatively modified variants
thereof; (4) specifically hybridize under stringent hybridization
conditions to a sequence selected from the group consisting of SEQ
ID NO:2, SEQ ID NO:18, a nucleic acid encoding the subunit
association region, a nucleic acid encoding the S4-S6 region, and
conservatively modified variants thereof; or (5) are amplified by
primers that specifically hybridize under stringent hybridization
conditions to the same sequence as a primer set consisting of SEQ
ID NO:3 and SEQ ID NO:4 or SEQ ID NO:5 and SEQ ID NO:6 or SEQ ID
NO:7 and SEQ ID NO:8 or SEQ ID NO:9 and SEQ ID NO:10.
[0051] The phrase "functional effects" in the context of assays for
testing compounds affecting a channel comprising Kv6.2 includes the
determination of any parameter that is indirectly or directly under
the influence of the channel. It includes changes in ion flux and
membrane potential, and also includes other physiologic effects
such as increases or decreases of transcription or hormone
release.
[0052] "Determining the functional effect" refers to examining the
effect of a compound that increases or decreases ion flux on a cell
or cell membrane in terms of cell and cell membrane function. The
ion flux can be any ion that passes through a channel and analogues
thereof, e.g., potassium, rubidium, sodium. Preferably, the term
refers to the functional effect of the compound on the channels
comprising Kv6.2, e.g., changes in ion flux including
radioisotopes, current amplitude, membrane potential, current flow,
transcription, protein binding, phosphorylation, dephosphorylation,
second messenger concentrations (cAMP, cGMP, Ca.sup.2+, IP.sub.3)
and other physiological effects such as hormone and
neurotransmitter release, as well as changes in voltage and
current. Such functional effects can be measured by any means known
to those skilled in the art, e.g., patch clamping,
voltage-sensitive dyes, whole cell currents, radioisotope efflux,
inducible markers, and the like.
[0053] "Inhibitors," "activators" or "modulators" of voltage-gated
potassium channels comprising Kv6.2 refer to inhibitory or
activating molecules identified using in vitro and in vivo assays
for Kv6.2 channel function. Inhibitors are compounds that decrease,
block, prevent, delay activation, inactivate, desensitize, or down
regulate the channel. Activators are compounds that increase, open,
activate, facilitate, enhance activation, sensitize or up regulate
channel activity. Such assays for inhibitors and activators include
e.g., expressing Kv6.2 in cells or cell membranes and then
measuring flux of ions through the channel and determining changes
in polarization (i.e., electrical potential). Alternatively, cells
expressing endogenous Kv6.2 channels can be used in such assays. To
examine the extent of inhibition, samples or assays comprising an
Kv6.2 channel are treated with a potential activator or inhibitor
and are compared to control samples without the inhibitor. Control
samples (untreated with inhibitors) are assigned a relative Kv6.2
activity value of 100%. Inhibition of channels comprising Kv6.2 is
achieved when the Kv6.2 activity value relative to the control is
about 90%, preferably 50%, more preferably 25-0%. Activation of
channels comprising Kv6.2 is achieved when the Kv6.2 activity value
relative to the control is 110%, more preferably 150%, most
preferably at least 200-500% higher or 1000% or higher.
[0054] "Biologically active" Kv6.2 refers to Kv6.2 that has the
ability to form a potassium channel having the characteristic of
voltage-gating tested as described above.
[0055] The terms "isolated," "purified," or "biologically pure"
refer to material that is substantially or essentially free from
components that normally accompany it as found in its native state.
Purity and homogeneity are typically determined using analytical
chemistry techniques such as polyacrylamide gel electrophoresis or
high performance liquid chromatography. A protein that is the
predominant species present in a preparation is substantially
purified. In particular, an isolated Kv6.2 nucleic acid is
separated from open reading frames that flank the Kv6.2 gene and
encode proteins other than Kv6.2. The term "purified" denotes that
a nucleic acid or protein gives rise to essentially one band in an
electrophoretic gel. Particularly, it means that the nucleic acid
or protein is at least 85% pure, more preferably at least 95% pure,
and most preferably at least 99% pure.
[0056] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form. The term encompasses nucleic acids containing
known nucleotide analogs or modified backbone residues or linkages,
which are synthetic, naturally occurring, and non-naturally
occurring, which have similar binding properties as the reference
nucleic acid, and which are metabolized in a manner similar to the
reference nucleotides. Examples of such analogs include, without
limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2-O-methyl
ribonucleotides, peptide-nucleic acids (PNAs).
[0057] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608
(1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The
term nucleic acid is used interchangeably with gene, cDNA, mRNA,
oligonucleotide, and polynucleotide.
[0058] A particular nucleic acid sequence also implicitly
encompasses "splice variants." Similarly, a particular protein
encoded by a nucleic acid implicitly encompasses any protein
encoded by a splice variant of that nucleic acid. "Splice
variants," as the name suggests, are products of alternative
splicing of a gene. After transcription, an initial nucleic acid
transcript may be spliced such that different (alternate) nucleic
acid splice products encode different polypeptides. Mechanisms for
the production of splice variants vary, but include alternate
splicing of exons. Alternate polypeptides derived from the same
nucleic acid by read-through transcription are also encompassed by
this definition. Any products of a splicing reaction, including
recombinant forms of the splice products, are included in this
definition. An example of potassium channel splice variants is
discussed in Leicher, et al., J. Biol. Chem. 273(52):35095-35101
(1998).
[0059] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer.
[0060] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an c carbon that is bound to a hydrogen, a carboxyl
group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
[0061] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0062] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid which encodes a polypeptide is implicit in each described
sequence.
[0063] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles of the invention.
[0064] The following eight groups each contain amino acids that are
conservative substitutions for one another:
[0065] 1) Alanine (A), Glycine (G);
[0066] 2) Aspartic acid (D), Glutamic acid (E);
[0067] 3) Asparagine (N), Glutamine (Q);
[0068] 4) Arginine (R), Lysine (K);
[0069] 5) Isoleucine (I), Leucine (L), Methionine (M), Valine
(V);
[0070] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
[0071] 7) Serine (S), Threonine (T); and
[0072] 8) Cysteine (C), Methionine (M)
[0073] (see, e.g., Creighton, Proteins (1984)).
[0074] Macromolecular structures such as polypeptide structures can
be described in terms of various levels of organization. For a
general discussion of this organization, see, e.g., Alberts et al.,
Molecular Biology of the Cell (3.sup.rd ed., 1994) and Cantor and
Schimmel, Biophysical Chemistry Part I. The Conformation of
Biological Macromolecules (1980). "Primary structure" refers to the
amino acid sequence of a particular peptide. "Secondary structure"
refers to locally ordered, three dimensional structures within a
polypeptide. These structures are commonly known as domains.
Domains are portions of a polypeptide that form a compact unit of
the polypeptide and are typically 50 to 350 amino acids long.
Typical domains are made up of sections of lesser organization such
as stretches of .beta.-sheet and .alpha.-helices. "Tertiary
structure" refers to the complete three dimensional structure of a
polypeptide monomer. "Quaternary structure" refers to the three
dimensional structure formed by the noncovalent association of
independent tertiary units. Anisotropic terms are also known as
energy terms.
[0075] A "label" is a composition detectable by spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For
example, useful labels include .sup.32P, fluorescent dyes,
electron-dense reagents, enzymes (e.g., as commonly used in an
ELISA), biotin, digoxigenin, or haptens and proteins for which
antisera or monoclonal antibodies are available (e.g., the
polypeptide of SEQ ID NO:1 can be made detectable, e.g., by
incorporating a radiolabel into the peptide, and used to detect
antibodies specifically reactive with the peptide).
[0076] As used herein a "nucleic acid probe or oligonucleotide" is
defined as a nucleic acid capable of binding to a target nucleic
acid of complementary sequence through one or more types of
chemical bonds, usually through conmplementary base pairing,
usually through hydrogen bond formation. As used herein, a probe
may include natural (i.e., A, G, C, or T) or modified bases
(7-deazaguanosine, inosine, etc.). In addition, the bases in a
probe may be joined by a linkage other than a phosphodiester bond,
so long as it does not interfere with hybridization. Thus, for
example, probes may be peptide nucleic acids in which the
constituent bases are joined by peptide bonds rather than
phosphodiester linkages. It will be understood by one of skill in
the art that probes may bind target sequences lacking complete
complementarity with the probe sequence depending upon the
stringency of the hybridization conditions. The probes are
preferably directly labeled as with isotopes, chromophores,
lumiphores, chromogens, or indirectly labeled such as with biotin
to which a streptavidin complex may later bind. By assaying for the
presence or absence of the probe, one can detect the presence or
absence of the select sequence or subsequence.
[0077] A "labeled nucleic acid probe or oligonucleotide" is one
that is bound, either covalently, through a linker or a chemical
bond, or noncovalently, through ionic, van der Waals,
electrostatic, or hydrogen bonds to label such that the presence of
the probe may be detected by detecting the presence of the label
bound to the probe.
[0078] The term "recombinant" when used with reference, e.g., to a
cell, or nucleic acid, protein, or vector, indicates that the cell,
nucleic acid, protein or vector, has been modified by the
introduction of a heterologous nucleic acid or protein or the
alteration of a native nucleic acid or protein, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
[0079] A "promoter" is defined as an array of nucleic acid control
sequences that direct transcription of a nucleic acid. As used
herein, a promoter includes necessary nucleic acid sequences near
the start site of transcription, such as, in the case of a
polymerase II type promoter, a TATA element. A promoter also
optionally includes distal enhancer or repressor elements, which
can be located as much as several thousand base pairs from the
start site of transcription. A "constitutive" promoter is a
promoter that is active under most environmental and developmental
conditions. An "inducible" promoter is a promoter that is active
under environmental or developmental regulation. The term "operably
linked" refers to a functional linkage between a nucleic acid
expression control sequence (such as a promoter, or array of
transcription factor binding sites) and a second nucleic acid
sequence, wherein the expression control sequence directs
transcription of the nucleic acid corresponding to the second
sequence.
[0080] The term "heterologous" when used with reference to portions
of a nucleic acid indicates that the nucleic acid comprises two or
more subsequences that are not found in the same relationship to
each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged to make a new functional nucleic acid, e.g., a
promoter from one source and a coding region from another source.
Similarly, a heterologous protein indicates that the protein
comprises two or more subsequences that are not found in the same
relationship to each other in nature (e.g., a fusion protein).
[0081] An "expression vector" is a nucleic acid construct,
generated recombinantly or synthetically, with a series of
specified nucleic acid elements that permit transcription of a
particular nucleic acid in a host cell. The expression vector can
be part of a plasmid, virus, or nucleic acid fragment. Typically,
the expression vector includes a nucleic acid to be transcribed
operably linked to a promoter.
[0082] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same (i.e., 70% identity, preferably 75%, 80%, 85%, 90%, or 95%
identity over a specified region such as the Kv6.2 subunit
association region or the S4-S6 region), when compared and aligned
for maximum correspondence over a comparison window, or designated
region as measured using one of the following sequence comparison
algorithms or by manual alignment and visual inspection. Such
sequences are then said to be "substantially identical." This
definition also refers to the compliment of a test sequence.
Preferably, the identity exists over a region that is at least
about 25 amino acids or nucleotides in length, or more preferably
over a region that is 50-100 amino acids or nucleotides in
length.
[0083] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identities for the
test sequences relative to the reference sequence, based on the
program parameters.
[0084] A "comparison window", as used herein, includes reference to
a segment of any one of the number of contiguous positions selected
from the group consisting of from 20 to 600, usually about 50 to
about 200, more usually about 100 to about 150 in which a sequence
may be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally aligned.
Methods of alignment of sequences for comparison are well-known in
the art. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection (see, e.g., Current Protocols in
Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0085] One example of a useful algorithm is PILEUP. PILEUP creates
a multiple sequence alignment from a group of related sequences
using progressive, pairwise alignments to show relationship and
percent sequence identity. It also plots a tree or dendogram
showing the clustering relationships used to create the alignment.
PILEUP uses a simplification of the progressive alignment method of
Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method
used is similar to the method described by Higgins & Sharp,
CABIOS 5:151-153 (1989). The program can align up to 300 sequences,
each of a maximum length of 5,000 nucleotides or amino acids. The
multiple alignment procedure begins with the pairwise alignment of
the two most similar sequences, producing a cluster of two aligned
sequences. This cluster is then aligned to the next most related
sequence or cluster of aligned sequences. Two clusters of sequences
are aligned by a simple extension of the pairwise alignment of two
individual sequences. The final alignment is achieved by a series
of progressive, pairwise alignments. The program is run by
designating specific sequences and their amino acid or nucleotide
coordinates for regions of sequence comparison and by designating
the program parameters. Using PILEUP, a reference sequence is
compared to other test sequences to determine the percent sequence
identity relationship using the following parameters: default gap
weight (3.00), default gap length weight (0.10), and weighted end
gaps. PILEUP can be obtained from the GCG sequence analysis
software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids
Res. 12:387-395 (1984).
[0086] Another example of algorithm that is suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J.
Mol. Biol. 215:403-410 (1990), respectively. Software for
performing BLAST analyses is publicly available through the
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold (Altschul et al., supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
extended in both directions along each sequence for as far as the
cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always >0) and N
(penalty score for mismatching residues; always <0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) or 10, M=5, N--4 and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a
wordlength of 3, and expectation (E) of 10, and the BLOSUM62
scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA 89;10915 (1989)) alignments (B) of 50, expectation (E) of 10,
M=5, N=-4, and a comparison of both strands.
[0087] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin &
Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One
measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide or amino
acid sequences would occur by chance. For example, a nucleic acid
is considered similar to a reference sequence if the smallest sum
probability in a comparison of the test nucleic acid to the
reference nucleic acid is less than about 0.2, more preferably less
than about 0.01, and most preferably less than about 0.001.
[0088] An indication that two nucleic acid sequences or
polypeptides are substantially identical is that the polypeptide
encoded by the first nucleic acid is immunologically cross reactive
with the antibodies raised against the polypeptide encoded by the
second nucleic acid, as described below. Thus, a polypeptide is
typically substantially identical to a second polypeptide, for
example, where the two peptides differ only by conservative
substitutions. Another indication that two nucleic acid sequences
are substantially identical is that the two molecules or their
complements hybridize to each other under stringent conditions, as
described below. Yet another indication that two nucleic acid
sequences are substantially identical is that the same primers can
be used to amplify the sequence.
[0089] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule only
to a particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture
(e.g., total cellular or library DNA or RNA).
[0090] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will hybridize to its target
subsequence, typically in a complex mixture of nucleic acid, but to
no other sequences. Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Probes, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be about 5-10.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength pH. The T.sub.m is the temperature (under
defined ionic strength, pH, and nucleic concentration) at which 50%
of the probes complementary to the target hybridize to the target
sequence at equilibrium (as the target sequences are present in
excess, at T.sub.m, 50% of the probes are occupied at equilibrium).
Stringent conditions will be those in which the salt concentration
is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M
sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the
temperature is at least about 30.degree. C. for short probes (e.g.,
10 to 50 nucleotides) and at least about 60.degree. C. for long
probes (e.g., greater than 50 nucleotides). Stringent conditions
may also be achieved with the addition of destabilizing agents such
as formamide. For high stringency hybridization, a positive signal
is at least two times background, preferably 10 times background
hybridization. Exemplary high stringency or stringent hybridization
conditions include: 50% formamide, 5.times.SSC and 1% SDS incubated
at 42.degree. C. or 5.times.SSC and 1% SDS incubated at 65.degree.
C., with a wash in 0.2.times.SSC and 0.1% SDS at 65.degree. C.
[0091] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides that they encode are substantially identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cased, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency.
[0092] "Antibody" refers to a polypeptide comprising a framework
region from an immunoglobulin gene or fragments thereof that
specifically binds and recognizes an antigen. The recognized
immunoglobulin genes include the kappa, lambda, alpha, gamma,
delta, epsilon, and mu constant region genes, as well as the myriad
immunoglobulin variable region genes. Light chains are classified
as either kappa or lambda. Heavy chains are classified as gamma,
mu, alpha, delta, or epsilon, which in turn define the
immunoglobulin classes, IgG, IgM, IgA, IgD and IgE,
respectively.
[0093] An exemplary immunoglobulin (antibody) structural unit
comprises a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kDa) and one "heavy" chain (about 50-70 kDa). The N-terminus of
each chain defines a variable region of about 100 to 110 or more
amino acids primarily responsible for antigen recognition. The
terms variable light chain (V.sub.L) and variable heavy chain
(V.sub.H) refer to these light and heavy chains respectively.
[0094] Antibodies exist, e.g., as intact immunoglobulins or as a
number of well-characterized fragments produced by digestion with
various peptidases. Thus, for example, pepsin digests an antibody
below the disulfide linkages in the hinge region to produce
F(ab)'.sub.2, a dimer of Fab which itself is a light chain joined
to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be
reduced under mild conditions to break the disulfide linkage in the
hinge region, thereby converting the F(ab)'.sub.2 dimer into an
Fab' monomer. The Fab' monomer is essentially Fab with part of the
hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill will appreciate that
such fragments may be synthesized de novo either chemically or by
using recombinant DNA methodology. Thus, the term antibody, as used
herein, also includes antibody fragments either produced by the
modification of whole antibodies, or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv) or
those identified using phage display libraries (see, e.g.,
McCafferty et al., Nature 348:552-554 (1990))
[0095] For preparation of monoclonal or polyclonal antibodies, any
technique known in the art can be used (see, e.g., Kohler &
Milstein, Nature 256:495-497 1975); Kozbor et al., Immunology Today
4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc. (1985)). Techniques for the
production of single chain antibodies (U.S. Pat. No. 4,946,778) can
be adapted to produce antibodies to polypeptides of this invention.
Also, transgenic mice, or other organisms such as other mammals,
may be used to express humanized antibodies. Alternatively, phage
display technology can be used to identify antibodies and
heteromeric Fab fragments that specifically bind to selected
antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990);
Marks et al., Biotechnology 10:779-783 (1992)).
[0096] An "anti-Kv6.2" antibody is an antibody or antibody fragment
that specifically binds a polypeptide encoded by the Kv6.2 gene,
cDNA, or a subsequence thereof.
[0097] A "chimeric antibody" is an antibody molecule in which (a)
the constant region, or a portion thereof, is altered, replaced or
exchanged so that the antigen binding site (variable region) is
linked to a constant region of a different or altered class,
effector function and/or species, or an entirely different molecule
which confers new properties to the chimeric antibody, e.g., an
enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the
variable region, or a portion thereof, is altered, replaced or
exchanged with a variable region having a different or altered
antigen specificity.
[0098] The term "immunoassay" is an assay that uses an antibody to
specifically bind an antigen. The immunoassay is characterized by
the use of specific binding properties of a particular antibody to
isolate, target, and/or quantify the antigen.
[0099] The phrase "specifically (or selectively) binds" to an
antibody or "specifically (or selectively) immunoreactive with,"
when referring to a protein or peptide, refers to a binding
reaction that is determinative of the presence of the protein in a
heterogeneous population of proteins and other biologics. Thus,
under designated immunoassay conditions, the specified antibodies
bind to a particular protein at least two times the background and
do not substantially bind in a significant amount to other proteins
present in the sample. Specific binding to an antibody under such
conditions may require an antibody that is selected for its
specificity for a particular protein. For example, polyclonal
antibodies raised to Kv6.2, having the sequence of SEQ ID NO:1 or
SEQ ID NO:17, encoded by SEQ NO:2 or SEQ ID NO:18, splice variants,
or portions thereof, can be selected to obtain only those
polyclonal antibodies that are specifically immunoreactive with
Kv6.2 and not with other proteins, except for polymorphic variants,
orthologs, and alleles of Kv6.2. This selection may be achieved by
subtracting out antibodies that cross-react with molecules such as
Kv6.1, other Kv6.2 orthologs, and with other Kv6 family members or
other Kv superfamily members. A variety of immunoassay formats may
be used to select antibodies specifically immunoreactive with a
particular protein. For example, solid-phase ELISA immunoassays are
routinely used to select antibodies specifically immunoreactive
with a protein (see, e.g., Harlow & Lane, Antibodies, A
Laboratory Manual (1988) for a description of immunoassay formats
and conditions that can be used to determine specific
immunoreactivity). Typically a specific or selective reaction will
be at least twice background signal or noise and more typically
more than 10 to 100 times background.
[0100] The phrase "selectively associates with" refers to the
ability of a nucleic acid to "selectively hybridize" with another
as defined above, or the ability of an antibody to "selectively (or
specifically) bind to a protein, as defined above.
[0101] By "host cell" is meant a cell that contains an expression
vector and supports the replication or expression of the expression
vector. Host cells may be prokaryotic cells such as E. coli, or
eukaryotic cells such as yeast, insect, amphibian, or mammalian
cells such as CHO, HeLa and the like, e.g., cultured cells,
explants, and cells in vivo.
[0102] "Biological sample" as used herein is a sample of biological
tissue or fluid that contains Kv6.2 or nucleic acid encoding Kv6.2
protein. Such samples include, but are not limited to, tissue
isolated from humans. Biological samples may also include sections
of tissues such as frozen sections taken for histologic purposes. A
biological sample is typically obtained from a eukaryotic organism,
preferably eukaryotes such as fungi, plants, insects, protozoa,
birds, fish, reptiles, and preferably a mammal such as rat, mice,
cow, dog, guinea pig, or rabbit, and most preferably a primate such
as chimpanzees or humans.
III. Isolating the Gene Encoding Kv6.2
[0103] A. General Recombinant DNA Methods
[0104] This invention relies on routine techniques in the field of
recombinant genetics. Basic texts disclosing the general methods of
use in this invention include Sambrook et al., Molecular Cloning, A
Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and
Expression: A Laboratory Manual (1990); and Current Protocols in
Molecular Biology (Ausubel et al., eds., 1994)).
[0105] For nucleic acids, sizes are given in either kilobases (kb)
or base pairs (bp). These are estimates derived from agarose or
acrylamide gel electrophoresis, from sequenced nucleic acids, or
from published DNA sequences. For proteins, sizes are given in
kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are
estimated from gel electrophoresis, from sequenced proteins, from
derived amino acid sequences, or from published protein
sequences.
[0106] Oligonucleotides that are not commercially available can be
chemically synthesized according to the solid phase phosphoramidite
triester method first described by Beaucage & Caruthers,
Tetrahedron Letts. 22:1859-1862 (1981), using an automated
synthesizer, as described in Van Devanter et. al., Nucleic Acids
Res. 12:6159-6168 (1984). Purification of oligonucleotides is by
either native acrylamide gel electrophoresis or by anion-exchange
HPLC as described in Pearson & Reanier, J. Chrom. 255:137-149
(1983).
[0107] The sequence of the cloned genes and synthetic
oligonucleotides can be verified after cloning using, e.g., the
chain termination method for sequencing double-stranded templates
of Wallace et al., Gene 16:21-26 (1981).
[0108] B. Cloning Methods for the Isolation of Nucleotide Sequences
Encoding Kv6.2
[0109] In general, the nucleic acid sequences encoding Kv6.2 and
related nucleic acid sequence homologs are cloned from cDNA and
genomic DNA libraries or isolated using amplification techniques
with oligonucleotide primers. For example, Kv6.2 sequences are
typically isolated from human nucleic acid (genomic or cDNA)
libraries by hybridizing with a nucleic acid probe or
polynucleotide, the sequence of which can be derived from SEQ ID
NO:2 or SEQ ID NO:18, preferably from the region encoding the
subunit association region or the S4-S6 region. A suitable tissue
from which Kv6.2 RNA and cDNA can be isolated is brain tissue such
as whole brain.
[0110] Amplification techniques using primers can also be used to
amplify and isolate Kv6.2 from DNA or RNA. The following primers
can also be used to amplify a sequence of Kv6.2:
2 ATGCCCATGTCTTCCAGAGACAGG, (SEQ ID NO:3)
GATGTCTAGAGGGAGTTACATGTAGCG (SEQ ID NO:4) and
GGCACTACGCATCCTCTACGTAATGGGC, (SEQ ID NO:5)
GATGATGGCCCACCAATAGGATGCGG (SEQ ID NO:6) and
ATGCCCATGCCTTCCAGAGACGG, (SEQ ID NO:7) TTACATGTGCATGATAGGCAAGGCTG
(SEQ ID NO:8) and GTCCAGGCCCAAGACAAGTGTCAG, (SEQ ID NO:9)
GGGAGAAGGTGTGGAAGATAGACG. (SEQ ID NO:10)
[0111] These primers can be used, e.g., to amplify either the full
length sequence or a probe of one to several hundred nucleotides,
which is then used to screen a human library for full-length
Kv6.2.
[0112] Nucleic acids encoding Kv6.2 can also be isolated from
expression libraries using antibodies as probes. Such polyclonal or
monoclonal antibodies can be raised using the sequence of SEQ ID
NO:1, SEQ ID NO:17, or an immunogenic portion thereof.
[0113] Kv6.2 polymorphic variants, orthologs, and alleles that are
substantially identical to the subunit association region or the
S4-S6 region of Kv6.2 can be isolated using Kv6.2 nucleic acid
probes and oligonucleotides under stringent hybridization
conditions, by screening libraries. Alternatively, expression
libraries can be used to clone Kv6.2 and Kv6.2 polymorphic
variants, orthologs, and alleles by detecting expressed homologs
immunologically with antisera or purified antibodies made against
Kv6.2 or portions thereof (e.g., the subunit association region or
the S4-S6 region of Kv6.2), which also recognize and selectively
bind to the Kv6.2 homolog.
[0114] To make a cDNA library, one should choose a source that is
rich in Kv6.2 mRNA, e.g., tissue such as whole brain. The mRNA is
then made into cDNA using reverse transcriptase, ligated into a
recombinant vector, and transfected into a recombinant host for
propagation, screening and cloning. Methods for making and
screening cDNA libraries are well known (see, e.g., Gubler &
Hoffman, Gene 25:263-269 (1983); Sambrook et al., supra; Ausubel et
al., supra).
[0115] For a genomic library, the DNA is extracted from the tissue
and either mechanically sheared or enzymatically digested to yield
fragments of about 12-20 kb. The fragments are then separated by
gradient centrifugation from undesired sizes and are constructed in
bacteriophage lambda vectors. These vectors and phage are packaged
in vitro. Recombinant phage are analyzed by plaque hybridization as
described in Benton & Davis, Science 196:180-182 (1977). Colony
hybridization is carried out as generally described in Grunstein et
al., Proc. Natl. Acad. Sci. USA, 72:3961-3965 (1975).
[0116] An alternative method of isolating Kv6.2 nucleic acid and
its homologs combines the use of synthetic oligonucleotide primers
and amplification of an RNA or DNA template (see U.S. Pat. Nos.
4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and
Applications (Innis et al., eds, 1990)). Methods such as polymerase
chain reaction (PCR) and ligase chain reaction (LCR) can be used to
amplify nucleic acid sequences of Kv6.2 directly from mRNA, from
cDNA, from genomic libraries or cDNA libraries. Degenerate
oligonucleotides can be designed to amplify Kv6.2 homologs using
the sequences provided herein. Restriction endonuclease sites can
be incorporated into the primers. Polymerase chain reaction or
other in vitro amplification methods may also be useful, for
example, to clone nucleic acid sequences that code for proteins to
be expressed, to make nucleic acids to use as probes for detecting
the presence of Kv6.2 encoding mRNA in physiological samples, for
nucleic acid sequencing, or for other purposes. Genes amplified by
the PCR reaction can be purified from agarose gels and cloned into
an appropriate vector.
[0117] Gene expression of Kv6.2 can also be analyzed by techniques
known in the art, e.g., reverse transcription and amplification of
mRNA, isolation of total RNA or poly A.sup.+ RNA, northern
blotting, dot blotting, in situ hybridization, RNase protection,
high density polynucleotide array technology and the like.
[0118] Synthetic oligonucleotides can be used to construct
recombinant Kv6.2 genes for use as probes or for expression of
protein. This method is performed using a series of overlapping
oligonucleotides usually 40-120 bp in length, representing both the
sense and nonsense strands of the gene. These DNA fragments are
then annealed, ligated and cloned. Alternatively, amplification
techniques can be used with precise primers to amplify a specific
subsequence of the Kv6.2 gene. The specific subsequence is then
ligated into an expression vector.
[0119] The gene for Kv6.2 is typically cloned into intermediate
vectors before transformation into prokaryotic or eukaryotic cells
for replication and/or expression. These intermediate vectors are
typically prokaryote vectors, e.g., plasmids, or shuttle
vectors.
[0120] C. Expression in Prokaryotes and Eukaryotes
[0121] To obtain high level expression of a cloned gene, such as
those cDNAs encoding Kv6.2, one typically subclones Kv6.2 into an
expression vector that contains a strong promoter to direct
transcription, a transcription/translation terminator, and if for a
nucleic acid encoding a protein, a ribosome binding site for
translational initiation. Suitable bacterial promoters are well
known in the art and described, e.g., in Sambrook et al. and
Ausubel et al, supra. Bacterial expression systems for expressing
the Kv6.2 protein are available in, e.g., E. coli, Bacillus sp.,
and Salmonella (Palva et al., Gene 22:229-235 (1983); Mosbach et
al., Nature 302:543-545 (1983). Kits for such expression systems
are commercially available. Eukaryotic expression systems for
mammalian cells, yeast, and insect cells are well known in the art
and are also commercially available.
[0122] Selection of the promoter used to direct expression of a
heterologous nucleic acid depends on the particular application.
The promoter is preferably positioned about the same distance from
the heterologous transcription start site as it is from the
transcription start site in its natural setting. As is known in the
art, however, some variation in this distance can be accommodated
without loss of promoter function.
[0123] In addition to the promoter, the expression vector typically
contains a transcription unit or expression cassette that contains
all the additional elements required for the expression of the
Kv6.2 encoding nucleic acid in host cells. A typical expression
cassette thus contains a promoter operably linked to the nucleic
acid sequence encoding Kv6.2 and signals required for efficient
polyadenylation of the transcript, ribosome binding sites, and
translation termination. Additional elements of the cassette may
include enhancers and, if genomic DNA is used as the structural
gene, introns with functional splice donor and acceptor sites.
[0124] In addition to a promoter sequence, the expression cassette
should also contain a transcription termination region downstream
of the structural gene to provide for efficient termination. The
termination region may be obtained from the same gene as the
promoter sequence or may be obtained from different genes.
[0125] The particular expression vector used to transport the
genetic information into the cell is not particularly critical. Any
of the conventional vectors used for expression in eukaryotic or
prokaryotic cells may be used. Standard bacterial expression
vectors include plasmids such as pBR322 based plasmids, pSKF,
pET23D, and fusion expression systems such as GST and LacZ. Epitope
tags can also be added to recombinant proteins to provide
convenient methods of isolation, e.g., c-myc.
[0126] Expression vectors containing regulatory elements from
eukaryotic viruses are typically used in eukaryotic expression
vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors
derived from Epstein-Barr virus. Other exemplary eukaryotic vectors
include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5,
baculovirus pDSVE, and any other vector allowing expression of
proteins under the direction of the CMV promoter, SV40 early
promoter, SV40 later promoter, metallothionein promoter, murine
mammary tumor virus promoter, Rous sarcoma virus promoter,
polyhedrin promoter, or other promoters shown effective for
expression in eukaryotic cells.
[0127] Some expression systems have markers that provide gene
amplification such as thymidine kinase and dihydrofolate reductase.
Alternatively, high yield expression systems not involving gene
amplification are also suitable, such as using a baculovirus vector
in insect cells, with a Kv6.2 encoding sequence under the direction
of the polyhedrin promoter or other strong baculovirus
promoters.
[0128] The elements that are typically included in expression
vectors also include a replicon that functions in E. coli, a gene
encoding antibiotic resistance to permit selection of bacteria that
harbor recombinant plasmids, and unique restriction sites in
nonessential regions of the plasmid to allow insertion of
eukaryotic sequences. The particular antibiotic resistance gene
chosen is not critical, any of the many resistance genes known in
the art are suitable. The prokaryotic sequences are preferably
chosen such that they do not interfere with the replication of the
DNA in eukaryotic cells, if necessary.
[0129] Standard transfection methods are used to produce bacterial,
mammalian, yeast or insect cell lines that express large quantities
of Kv6.2 protein, which are then purified using standard techniques
(see, e.g., Colley et al., J. Biol. Chem. 264:17619-17622 (1989);
Guide to Protein Purification, in Methods in Enzymology, vol. 182
(Deutscher, ed., 1990)). Transformation of eukaryotic and
prokaryotic cells are performed according to standard techniques
(see, e.g., Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss
& Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds,
1983).
[0130] Any of the well-known procedures for introducing foreign
nucleotide sequences into host cells may be used. These include the
use of calcium phosphate transfection, polybrene, protoplast
fusion, electroporation, liposomes, microinjection, plasma vectors,
viral vectors and any of the other well known methods for
introducing cloned genomic DNA, cDNA, synthetic DNA or other
foreign genetic material into a host cell (see, e.g., Sambrook et
al., supra). It is only necessary that the particular genetic
engineering procedure used be capable of successfully introducing
at least one gene into the host cell capable of expressing
Kv6.2.
[0131] After the expression vector is introduced into the cells,
the transfected cells are cultured under conditions favoring
expression of Kv6.2, which is recovered from the culture using
standard techniques identified below.
IV. Purification of Kv6.2 Polypeptides
[0132] Either naturally occurring or recombinant Kv6.2 can be
purified for use in functional assays. Naturally occurring Kv6.2
monomers can be purified, e.g., from human tissue such as whole
brain, and any other source of a Kv6.2 homolog. Recombinant Kv6.2
monomers can be purified from any suitable expression system.
[0133] The Kv6.2 monomers may be purified to substantial purity by
standard techniques, including selective precipitation with such
substances as ammonium sulfate; column chromatography,
inununopurification methods, and others (see, e.g., Scopes, Protein
Purification: Principles and Practice (1982); U.S. Pat. No.
4,673,641; Ausubel et al., supra; and Sambrook et al., supra).
[0134] A number of procedures can be employed when recombinant
Kv6.2 monomers are being purified. For example, proteins having
established molecular adhesion properties can be reversible fused
to the Kv6.2 monomers. With the appropriate ligand, the Kv6.2
monomers can be selectively adsorbed to a purification column and
then freed from the column in a relatively pure form. The fused
protein is then removed by enzymatic activity. Finally the Kv6.2
monomers could be purified using immunoaffinity columns.
[0135] A. Purification of Kv6.2 Monomers from Recombinant
Bacteria
[0136] Recombinant proteins are expressed by transformed bacteria
in large amounts, typically after promoter induction; but
expression can be constitutive. Promoter induction with IPTG is a
one example of an inducible promoter system. Bacteria are grown
according to standard procedures in the art. Fresh or frozen
bacteria cells are used for isolation of protein.
[0137] Proteins expressed in bacteria may form insoluble aggregates
("inclusion bodies"). Several protocols are suitable for
purification of the Kv6.2 monomers inclusion bodies. For example,
purification of inclusion bodies typically involves the extraction,
separation and/or purification of inclusion bodies by disruption of
bacterial cells, e.g., by incubation in a buffer of 50 mM TRIS/HCL
pH 7.5, 50 mM NaCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.1 mM ATP, and 1 mM
PMSF. The cell suspension can be lysed using 2-3 passages through a
French Press, homogenized using a Polytron (Brinkman Instruments)
or sonicated on ice. Alternate methods of lysing bacteria are
apparent to those of skill in the art (see, e.g., Sambrook et al.,
supra; Ausubel et al., supra).
[0138] If necessary, the inclusion bodies are solubilized, and the
lysed cell suspension is typically centrifuged to remove unwanted
insoluble matter. Proteins that formed the inclusion bodies may be
renatured by dilution or dialysis with a compatible buffer.
Suitable solvents include, but are not limited to urea (from about
4 M to about 8 M), formamide (at least about 80%, volume/volume
basis), and guanidine hydrochloride (from about 4 M to about 8 M).
Some solvents which are capable of solubilizing aggregate-forming
proteins, for example SDS (sodium dodecyl sulfate), 70% formic
acid, are inappropriate for use in this procedure due to the
possibility of irreversible denaturation of the proteins,
accompanied by a lack of immunogenicity and/or activity. Although
guanidine hydrochloride and similar agents are denaturants, this
denaturation is not irreversible and renaturation may occur upon
removal (by dialysis, for example) or dilution of the denaturant,
allowing re-formation of immunologically and/or biologically active
protein. Other suitable buffers are known to those skilled in the
art. Human Kv6.2 monomers are separated from other bacterial
proteins by standard separation techniques, e.g., with Ni-NTA
agarose resin.
[0139] Alternatively, it is possible to purify the Kv6.2 monomers
from bacteria periplasm. After lysis of the bacteria, when the
Kv6.2 monomers are exported into the periplasm of the bacteria, the
periplasmic fraction of the bacteria can be isolated by cold
osmotic shock in addition to other methods known to skill in the
art. To isolate recombinant proteins from the periplasm, the
bacterial cells are centrifuged to form a pellet. The pellet is
resuspended in a buffer containing 20% sucrose. To lyse the cells,
the bacteria are centrifuged and the pellet is resuspended in
ice-cold 5 mM MgSO.sub.4 and kept in an ice bath for approximately
10 minutes. The cell suspension is centrifuged and the supernatant
decanted and saved. The recombinant proteins present in the
supernatant can be separated from the host proteins by standard
separation techniques well known to those of skill in the art.
[0140] B. Standard Protein Separation Techniques for Purifying the
Kv6.2 Monomers
[0141] Solubility Fractionation
[0142] Often as an initial step, particularly if the protein
mixture is complex, an initial salt fractionation can separate many
of the unwanted host cell proteins (or proteins derived from the
cell culture media) from the recombinant protein of interest. The
preferred salt is ammonium sulfate. Ammonium sulfate precipitates
proteins by effectively reducing the amount of water in the protein
mixture. Proteins then precipitate on the basis of their
solubility. The more hydrophobic a protein is, the more likely it
is to. precipitate at lower ammonium sulfate concentrations. A
typical protocol includes adding saturated ammonium sulfate to a
protein solution so that the resultant ammonium sulfate
concentration is between 20-30%. This concentration will
precipitate the most hydrophobic of proteins. The precipitate is
then discarded (unless the protein or interest is hydrophobic) and
ammonium sulfate is added to the supernatant to a concentration
known to precipitate the protein of interest. The precipitate is
then solubilized in buffer and the excess salt removed if
necessary, either through dialysis or diafiltration. Other methods
that rely on solubility of proteins, such as cold ethanol
precipitation, are well known to those of skill in the art and can
be used to fractionate complex protein mixtures.
[0143] Size Differential Filtration
[0144] The molecular weight of the Kv6.2 monomers can be used to
isolated it from proteins of greater and lesser size using
ultrafiltration through membranes of different pore size (for
example, Amicon or Millipore membranes). As a first step, the
protein mixture is ultrafiltered through a membrane with a pore
size that has a lower molecular weight cut-off than the molecular
weight of the protein of interest. The retentate of the
ultrafiltration is then ultrafiltered against a membrane with a
molecular cut off greater than the molecular weight of the protein
of interest. The recombinant protein will pass through the membrane
into the filtrate. The filtrate can then be chromatographed as
described below.
[0145] Column Chromatography
[0146] The Kv6.2 monomers can also be separated from other proteins
on the basis of its size, net surface charge, hydrophobicity, and
affinity for ligands. In addition, antibodies raised against
proteins can be conjugated to column matrices and the proteins
immunopurified. All of these methods are well known in the art. It
will be apparent to one of skill that chromatographic techniques
can be performed at any scale and using equipment from many
different manufacturers (e.g., Pharmacia Biotech).
V. Immunological Detection of Kv6.2
[0147] In addition to the detection of Kv6.2 genes and gene
expression using nucleic acid hybridization technology, one can
also use immunoassays to detect the Kv6.2 monomers. Immunoassays
can be used to qualitatively or quantitatively analyze the Kv6.2
monomers. A general overview of the applicable technology can be
found in Harlow & Lane, Antibodies: A Laboratory Manual
(1988).
[0148] A. Antibodies to Kv6.2 monomers
[0149] Methods of producing polyclonal and monoclonal antibodies
that react specifically with the Kv6.2 monomers are known to those
of skill in the art (see, e.g., Coligan, Current Protocols in
Immunology (1991); Harlow & Lane, supra; Goding, Monoclonal
Antibodies: Principles and Practice (2d.ed. 1986); and Kohler &
Milstein, Nature 256:495-497 (1975). Such techniques include
antibody preparation by selection of antibodies from libraries of
recombinant antibodies in phage or similar vectors, as well as
preparation of polyclonal and monoclonal antibodies by immunizing
rabbits or mice (see, e.g., Huse et al., Science 246:1275-1281
(1989); Ward et al., Nature 341:544-546 (1989)).
[0150] A number of immunogens comprising portions of Kv6.2 monomers
may be used to produce antibodies specifically reactive with Kv6.2
monomers. For example, recombinant Kv6.2 monomers or an antigenic
fragment thereof, such as the subunit association region or the
S4-S6 region, can be isolated as described herein. Recombinant
protein can be expressed in eukaryotic or prokaryotic cells as
described above, and purified as generally described above.
Recombinant protein is the preferred immunogen for the production
of monoclonal or polyclonal antibodies. Alternatively, a synthetic
peptide derived from the sequences disclosed herein and conjugated
to a carrier protein can be used an immunogen. Naturally occurring
protein may also be used either in pure or impure form. The product
is then injected into an animal capable of producing antibodies.
Either monoclonal or polyclonal antibodies may be generated, for
subsequent use in immunoassays to measure the protein.
[0151] Methods of production of polyclonal antibodies are known to
those of skill in the art. An inbred strain of mice (e.g., BALB/C
mice) or rabbits is immunized with the protein using a standard
adjuvant, such as Freund's adjuvant, and a standard immunization
protocol. The animal's immune response to the immunogen preparation
is monitored by taking test bleeds and determining the titer of
reactivity to the beta subunits. When appropriately high titers of
antibody to the immunogen are obtained, blood is collected from the
animal and antisera are prepared. Further fractionation of the
antisera to enrich for antibodies reactive to the protein can be
done if desired (see Harlow & Lane, supra).
[0152] Monoclonal antibodies may be obtained by various techniques
familiar to those skilled in the art. Briefly, spleen cells from an
animal immunized with a desired antigen are immortalized, commonly
by fusion with a myeloma cell (see Kohler & Milstein, Eur. J.
Immunol. 6:511-519 (1976)). Alternative methods of immortalization
include transformation with Epstein Barr Virus, oncogenes, or
retroviruses, or other methods well known in the art. Colonies
arising from single immortalized cells are screened for production
of antibodies of the desired specificity and affinity for the
antigen, and yield of the monoclonal antibodies produced by such
cells may be enhanced by various techniques, including injection
into the peritoneal cavity of a vertebrate host. Alternatively, one
may isolate DNA sequences which encode a monoclonal antibody or a
binding fragment thereof by screening a DNA library from human B
cells according to the general protocol outlined by Huse et al.,
Science 246:1275-1281 (1989).
[0153] Monoclonal antibodies and polyclonal sera are collected and
titered against the immunogen protein in an immunoassay, for
example, a solid phase immunoassay with the immunogen immobilized
on a solid support. Typically, polyclonal antisera with a titer of
10.sup.4 or greater are selected and tested for their cross
reactivity against non-Kv proteins or other Kv6 family members such
as Kv6.1 or other Kv superfamily members, using a competitive
binding immunoassay. Specific polyclonal antisera and monoclonal
antibodies will usually bind with a K.sub.d of at least about 0.1
mM, more usually at least about 1 .mu.M, preferably at least about
0.1 .mu.M or better, and most preferably, 0.01 .mu.M or better.
[0154] Once the specific antibodies against a Kv6.2 are available,
the Kv6.2 can be detected by a variety of immunoassay methods. For
a review of immunological and immunoassay procedures, see Basic and
Clinical Immunology (Stites & Terr eds., 7.sup.th ed. 1991).
Moreover, the immunoassays of the present invention can be
performed in any of several configurations, which are reviewed
extensively in Enzyme Immunoassay (Maggio, ed., 1980); and Harlow
& Lane, supra.
[0155] B. Immunological Binding Assays
[0156] The Kv6.2 can be detected and/or quantified using any of a
number of well recognized immunological binding assays (see, e.g.,
U.S. Pat. Nos. 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For
a review of the general immunoassays, see also Methods in Cell
Biology: Antibodies in Cell Biology, volume 37 (Asai, ed. 1993);
Basic and Clinical Immunology (Stites & Terr, eds., 7.sup.th
ed. 1991). Immunological binding assays (or immunoassays) typically
use an antibody that specifically binds to a protein or antigen of
choice (in this case the Kv6.2 or an antigenic subsequence
thereof). The antibody (e.g., anti-Kv6.2) may be produced by any of
a number of means well known to those of skill in the art and as
described above.
[0157] Immunoassays also often use a labeling agent to specifically
bind to and label the complex formed by the antibody and antigen.
The labeling agent may itself be one of the moieties comprising the
antibody/antigen complex. Thus, the labeling agent may be a labeled
Kv6.2 polypeptide or a labeled anti-Kv6.2 antibody. Alternatively,
the labeling agent may be a third moiety, such a secondary
antibody, which specifically binds to the antibody/Kv6.2 complex (a
secondary antibody is typically specific to antibodies of the
species from which the first antibody is derived). Other proteins
capable of specifically binding immunoglobulin constant regions,
such as protein A or protein G may also be used as the label agent.
These proteins exhibit a strong non-immunogenic reactivity with
immunoglobulin constant regions from a variety of species (see,
e.g., Kronval et al., J. Immunol. 111:1401-1406 (1973); Akerstrom
et al., J. Immunol. 135:2589-2542 (1985)). The labeling agent can
be modified with a detectable moiety, such as biotin, to which
another molecule can specifically bind, such as streptavidin. A
variety of detectable moieties are well known to those skilled in
the art.
[0158] Throughout the assays, incubation and/or washing steps may
be required after each combination of reagents. Incubation steps
can vary from about 5 seconds to several hours, preferably from
about 5 minutes to about 24 hours. However, the incubation time
will depend upon the assay format, antigen, volume of solution,
concentrations, and the like. Usually, the assays will be carried
out at ambient temperature, although they can be conducted over a
range of temperatures, such as 10.degree. C. to 40.degree. C.
[0159] Non-Competitive Assay Formats
[0160] Immunoassays for detecting the Kv6.2 in samples may be
either competitive or noncompetitive. Noncompetitive immunoassays
are assays in which the amount of antigen is directly measured. In
one preferred "sandwich" assay, for example, the anti-Kv6.2 subunit
antibodies can be bound directly to a solid substrate on which they
are immobilized. These immobilized antibodies then capture Kv6.2
present in the test sample. The Kv6.2 monomers are thus immobilized
and then bound by a labeling agent, such as a second Kv6.2 antibody
bearing a label. Alternatively, the second antibody may lack a
label, but it may, in turn, be bound by a labeled third antibody
specific to antibodies of the species from which the second
antibody is derived. The second or third antibody is typically
modified with a detectable moiety, such as biotin, to which another
molecule specifically binds, e.g., streptavidin, to provide a
detectable moiety.
[0161] Competitive Assay Formats
[0162] In competitive assays, the amount of the Kv6.2 present in
the sample is measured indirectly by measuring the amount of known,
added (exogenous) Kv6.2 displaced (competed away) from an
anti-Kv6.2 antibody by the unknown Kv6.2 present in a sample. In
one competitive assay, a known amount of the Kv6.2 is added to a
sample and the sample is then contacted with an antibody that
specifically binds to the Kv6.2. The amount of exogenous Kv6.2
bound to the antibody is inversely proportional to the
concentration of the Kv6.2 present in the sample. In a particularly
preferred embodiment, the antibody is immobilized on a solid
substrate. The amount of Kv6.2 bound to the antibody may be
determined either by measuring the amount of Kv6.2 present in a
Kv6.2/antibody complex, or alternatively by measuring the amount of
remaining uncomplexed protein. The amount of Kv6.2 may be detected
by providing a labeled Kv6.2 molecule.
[0163] A hapten inhibition assay is another preferred competitive
assay. In this assay the known Kv6.2 is immobilized on a solid
substrate. A known amount of anti-Kv6.2 antibody is added to the
sample, and the sample is then contacted with the immobilized
Kv6.2. The amount of anti-Kv6.2 antibody bound to the known
immobilized Kv6.2 is inversely proportional to the amount of Kv6.2
present in the sample. Again, the amount of immobilized antibody
may be detected by detecting either the immobilized fraction of
antibody or the fraction of the antibody that remains in solution.
Detection may be direct where the antibody is labeled or indirect
by the subsequent addition of a labeled moiety that specifically
binds to the antibody as described above.
[0164] Cross-Reactivity Determinations
[0165] Immunoassays in the competitive binding format can also be
used for crossreactivity determinations for Kv6.2. For example, a
protein have at least a partial sequence of SEQ ID NO:1 or SEQ ID
NO:17, or a protein at least partially encoded by SEQ ID NO:2 or
SEQ ID NO:18 or an immunogenic region thereof, such as the subunit
association region or the S4-S6 region, can be immobilized to a
solid support. Other proteins such as other Kv6 family members,
e.g., Kv6.1 or Kv 6.2 orthologs, are added to the assay so as to
compete for binding of the antisera to the immobilized antigen. The
ability of the added proteins to compete for binding of the
antisera to the immobilized protein is compared to the ability of
the Kv6.2 having a sequence of SEQ ID NO:1 or SEQ ID NO:17 to
compete with itself. The percent crossreactivity for the above
proteins is calculated, using standard calculations. Those antisera
with less than 10% crossreactivity with each of the added proteins
listed above are selected and pooled. The cross-reacting antibodies
are optionally removed from the pooled antisera by immunoabsorption
with the added considered proteins, e.g., distantly related
homologs.
[0166] The immunoabsorbed and pooled antisera are then used in a
competitive binding immunoassay as described above to compare a
second protein, thought to be perhaps an allele, ortholog, or
polymorphic variant of Kv6.2, to the immunogen protein. In order to
make this comparison, the two proteins are each assayed at a wide
range of concentrations and the amount of each protein required to
inhibit 50% of the binding of the antisera to the immobilized
protein is determined. If the amount of the second protein required
to inhibit 50% of binding is less than 10 times the amount of the
protein encoded by Kv6.2 that is required to inhibit 50% of
binding, then the second protein is said to specifically bind to
the polyclonal antibodies generated to the respective Kv6.2
immunogen.
[0167] Other Assay Formats
[0168] Western blot (immunoblot) analysis is used to detect and
quantify the presence of the Kv6.2 in the sample. The technique
generally comprises separating sample proteins by gel
electrophoresis on the basis of molecular weight, transferring the
separated proteins to a suitable solid support, (such as a
nitrocellulose filter, a nylon filter, or derivatized nylon
filter), and incubating the sample with the antibodies that
specifically bind Kv6.2. The anti-Kv6.2 antibodies specifically
bind to Kv6.2 on the solid support. These antibodies may be
directly labeled or alternatively may be subsequently detected
using labeled antibodies (e.g., labeled sheep anti-mouse
antibodies) that specifically bind to the anti-Kv6.2
antibodies.
[0169] Other assay formats include liposome immunoassays (LIA),
which use liposomes designed to bind specific molecules (e.g.,
antibodies) and release encapsulated reagents or markers. The
released chemicals are then detected according to standard
techniques (see Monroe et al., Amer. Clin. Prod. Rev. 5:34-41
(1986)).
[0170] Reduction of Non-Specific Binding
[0171] One of skill in the art will appreciate that it is often
desirable to minimize non-specific binding in immunoassays.
Particularly, where the assay involves an antigen or antibody
immobilized on a solid substrate it is desirable to minimize the
amount of non-specific binding to the substrate. Means of reducing
such non-specific binding are well known to those of skill in the
art. Typically, this technique involves coating the substrate with
a proteinaceous composition. In particular, protein compositions
such as bovine serum albumin (BSA), nonfat powdered milk, and
gelatin are widely used with powdered milk being most
preferred.
[0172] Labels
[0173] The particular label or detectable group used in the assay
is not a critical aspect of the invention, as long as it does not
significantly interfere with the specific binding of the antibody
used in the assay. The detectable group can be any material having
a detectable physical or chemical property. Such detectable labels
have been well-developed in the field of immunoassays and, in
general, most any label useful in such methods can be applied to
the present invention. Thus, a label is any composition detectable
by spectroscopic, photochemical, biochemical, immunochemical,
electrical, optical or chemical means. Useful labels in the present
invention include magnetic beads (e.g., DYNABEADS.TM.), fluorescent
dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, and
the like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S,
.sup.14C, or .sup.=P), enzymes (e.g., horse radish peroxidase,
alkaline phosphatase and others commonly used in an ELISA), and
calorimetric labels such as colloidal gold or colored glass or
plastic beads (e.g., polystyrene, polypropylene, latex, etc.).
[0174] The label may be coupled directly or indirectly to the
desired component of the assay according to methods well known in
the art. As indicated above, a wide variety of labels may be used,
with the choice of label depending on sensitivity required, ease of
conjugation with the compound, stability requirements, available
instrumentation, and disposal provisions.
[0175] Non-radioactive labels are often attached by indirect means.
Generally, a ligand molecule (e.g., biotin) is covalently bound to
the molecule. The ligand then binds to another molecules (e.g.,
streptavidin) molecule, which is either inherently detectable or
covalently bound to a signal system, such as a detectable enzyme, a
fluorescent compound, or a chemiluminescent compound. The ligands
and their targets can be used in any suitable combination with
antibodies that recognize Kv6.2, or secondary antibodies that
recognize anti-Kv6.2 antibodies.
[0176] The molecules can also be conjugated directly to signal
generating compounds, e.g., by conjugation with an enzyme or
fluorophore. Enzymes of interest as labels will primarily be
hydrolases, particularly phosphatases, esterases and glycosidases,
or oxidotases, particularly peroxidases. Fluorescent compounds
include fluorescein and its derivatives, rhodamine and its
derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds
include luciferin, and 2,3-dihydrophthalazined- iones, e.g.,
luminol. For a review of various labeling or signal producing
systems that may be used, see U.S. Pat. No. 4,391,904.
[0177] Means of detecting labels are well known to those of skill
in the art. Thus, for example, where the label is a radioactive
label, means for detection include a scintillation counter or
photographic film as in autoradiography. Where the label is a
fluorescent label, it may be detected by exciting the fluorochrome
with the appropriate wavelength of light and detecting the
resulting fluorescence. The fluorescence may be detected visually,
by means of photographic film, by the use of electronic detectors
such as charge coupled devices (CCDs) or photomultipliers and the
like. Similarly, enzymatic labels may be detected by providing the
appropriate substrates for the enzyme and detecting the resulting
reaction product. Finally simple colorimetric labels may be
detected simply by observing the color associated with the label.
Thus, in various dipstick assays, conjugated gold often appears
pink, while various conjugated beads appear the color of the
bead.
[0178] Some assay formats do not require the use of labeled
components. For instance, agglutination assays can be used to
detect the presence of the target antibodies. In this case,
antigen-coated particles are agglutinated by samples comprising the
target antibodies. In this format, none of the components need be
labeled and the presence of the target antibody is detected by
simple visual inspection.
VI. Assays for Modulators of Kv6.2
[0179] A. Assays
[0180] Kv6.2 monomers and Kv6.2 alleles, orthologs, and polymorphic
variants are subunits of voltaleg-gated potassium channels. The
activity of a potassium channel comprising Kv6.2 can be assessed
using a variety of in vitro and in vivo assays, e.g., measuring
current, measuring membrane potential, measuring ion flux, e.g.,
potassium or rubidium, measuring potassium concentration, measuring
second messengers and transcription levels, using
potassium-dependent yeast growth assays, and using e.g.,
voltage-sensitive dyes, radioactive tracers, and patch-clamp
electrophysiology.
[0181] Furthermore, such assays can be used to test for inhibitors
and activators of channels comprising Kv6.2. Such modulators of a
potassium channel are useful for treating various disorders
involving potassium channels. Treatment of dysfunctions include,
e.g., endocrine disorders, CNS disorders such as migraines, hearing
and vision problems, psychotic disorders, seizures, and use as
neuroprotective agents (e.g., to prevent stroke). Such modulators
are also useful for investigation of the channel diversity provided
by Kv6.2 and the regulation/modulation of potassium channel
activity provided by Kv6.2.
[0182] Modulators of the potassium channels are tested using
biologically active Kv6.2, either recombinant or naturally
occurring. Kv6.2 can be isolated, co-expressed in a cell, or
co-expressed in a membrane derived from a cell. In such assays,
Kv6.2 is expressed alone to form a homomeric potassium channel or
is preferably co-expressed with a second alpha subunit (e.g.,
another Kv superfamily member such as Kv2.1 or Kv2.2 or a Kv6
family member) so as to form a heteromeric potassium channel. Kv6.2
can also be expressed with additional beta subunits. Modulation is
tested using one of the in vitro or in vivo assays described above.
Samples or assays that are treated with a potential potassium
channel inhibitor or activator are compared to control samples
without the test compound, to examine the extent of modulation.
Control samples (untreated with activators or inhibitors) are
assigned a relative potassium channel activity value of 100.
Inhibition of channels comprising Kv6.2 is achieved when the
potassium channel activity value relative to the control is about
90%, preferably 50%, more preferably 25%. Activation of channels
comprising Kv6.2 is achieved when the potassium channel activity
value relative to the control is 110%, more preferably 150%, more
preferable 200% higher. Compounds that increase the flux of ions
will cause a detectable increase in the ion current density by
increasing the probability of a channel comprising Kv6.2 being
open, by decreasing the probability of it being closed, by
increasing conductance through the channel, and/or by allowing the
passage of ions.
[0183] Changes in ion flux may be assessed by determining changes
in polarization (i.e., electrical potential) of the cell or
membrane expressing the potassium channel comprising Kv6.2. A
preferred means to determine changes in cellular polarization is by
measuring changes in current (thereby measuring changes in
polarization) with voltage-clamp and patch-clamp techniques, e.g.,
the "cell-attached" mode, the "inside-out" mode, and the "whole
cell" mode (see, e.g., Ackerman et al., New Engl. J. Med.
336:1575-1595 (1997)). Whole cell currents are conveniently
determined using the standard methodology (see, e.g., Hamil et al.,
PFlugers. Archiv. 391:85 (1981). Other known assays include:
radiolabeled rubidium flux assays and fluorescence assays using
voltage-sensitive dyes (see, e.g., Vestergarrd-Bogind et al., J.
Membrane Biol. 88:67-75 (1988); Daniel et al., J. Pharmacol. Meth.
25:185-193 (1991); Holevinsky et al., J. Membrane Biology 137:59-70
(1994)). Assays for compounds capable of inhibiting or increasing
potassium flux through the channel proteins comprising Kv6.2 can be
performed by application of the compounds to a bath solution in
contact with and comprising cells having a channel of the present
invention (see, e.g., Blatz et al., Nature 323:718-720 (1986);
Park, J. Physiol. 481:555-570 (1994)). Generally, the compounds to
be tested are present in the range from 1 pM to 100 mM.
[0184] The effects of the test compounds upon the function of the
channels can be measured by changes in the electrical currents or
ionic flux or by the consequences of changes in currents and flux.
Changes in electrical current or ionic flux are measured by either
increases or decreases in flux of ions such as potassium or
rubidium ions. The cations can be measured in a variety of standard
ways. They can be measured directly by concentration changes of the
ions or indirectly by membrane potential or by radio-labeling of
the ions. Consequences of the test compound on ion flux can be
quite varied. Accordingly, any suitable physiological change can be
used to assess the influence of a test compound on the channels of
this invention. The effects of a test compound can be measured by a
toxin binding assay. When the functional consequences are
determined using intact cells or animals, one can also measure a
variety of effects such as transmitter release (e.g., dopamine),
hormone release (e.g., insulin), transcriptional changes to both
known and uncharacterized genetic markers (e.g., northern blots),
cell volume changes (e.g., in red blood cells), immunoresponses
(e.g., T cell activation), changes in cell metabolism such as cell
growth or pH changes, and changes in intracellular second
messengers such as Ca.sup.2+, or cyclic nucleotides.
[0185] Preferably, the Kv6.2 that is a part of the potassium
channel used in the assay will have the sequence displayed in SEQ
ID NO:1, SEQ ID NO:17, or a conservatively modified variant
thereof. Alternatively, the Kv6.2 of the assay will be derived from
a eukaryote and include an amino acid subsequence having
substantial amino acid sequence identity to the subunit association
region or the S4-S6 region of Kv6.2. Generally, the amino acid
sequence identity will be at least 70%, preferably at least 75, 80,
85, 90%, most preferably at least 95%.
[0186] Kv6.2 orthologs will generally confer substantially similar
properties on a channel comprising such Kv6.2, as described above.
In a preferred embodiment, the cell placed in contact with a
compound that is suspected to be a Kv6.2 homolog is assayed for
increasing or decreasing ion flux in a eukaryotic cell, e.g., an
oocyte of Xenopus (e.g., Xenopus laevis) or a mammalian cell such
as a CHO or HeLa cell. Channels that are affected by compounds in
ways similar to Kv6.2 are considered homologs or orthologs of
Kv6.2.
[0187] B. Modulators
[0188] The compounds tested as modulators of Kv6.2 channels
comprising a Kv6.2 subunit can be any small chemical compound, or a
biological entity, such as a protein, sugar, nucleic acid or lipid.
Alternatively, modulators can be genetically altered versions of a
human Kv6.2 subunit. Typically, test compounds will be small
chemical molecules and peptides. Essentially any chemical compound
can be used as a potential modulator or ligand in the assays of the
invention, although most often compounds can be dissolved in
aqueous or organic (especially DMSO-based) solutions are used. The
assays are designed to screen large chemical libraries by
automating the assay steps and providing compounds from any
convenient source to assays, which are typically run in parallel
(e.g., in microtiter formats on microtiter plates in robotic
assays). It will be appreciated that there are many suppliers of
chemical compounds, including Sigma (St. Louis, Mo.), Aldrich (St.
Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka
Chemika-Biochemica Analytika (Buchs Switzerland) and the like.
[0189] In one preferred embodiment, high throughput screening
methods involve providing a combinatorial chemical or peptide
library containing a large number of potential therapeutic
compounds (potential modulator or ligand compounds). Such
"combinatorial chemical libraries" or "ligand libraries" are then
screened in one or more assays, as described herein, to identify
those library members (particular chemical species or subclasses)
that display a desired characteristic activity. The compounds thus
identified can serve as conventional "lead compounds" or can
themselves be used as potential or actual therapeutics.
[0190] A combinatorial chemical library is a collection of diverse
chemical compounds generated by either chemical synthesis or
biological synthesis, by combining a number of chemical "building
blocks" such as reagents. For example, a linear combinatorial
chemical library such as a polypeptide library is formed by
combining a set of chemical building blocks (amino acids) in every
possible way for a given compound length (i.e., the number of amino
acids in a polypeptide compound). Millions of chemical compounds
can be synthesized through such combinatorial mixing of chemical
building blocks.
[0191] Preparation and screening of combinatorial chemical
libraries is well known to those of skill in the art. Such
combinatorial chemical libraries include, but are not limited to,
peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Int.
J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., Nature
354:84-88 (1991)). Other chemistries for generating chemical
diversity libraries can also be used. Such chemistries include, but
are not limited to: peptoids (e.g., PCT Publication No. WO
91/19735), encoded peptides (e.g., PCT Publication No. WO
93/20242), random bio-oligomers (e.g., PCT Publication No. WO
92/00091), benzodiazepines (e.g., U.S. Pat. No. 5,288,514),
diversomers such as hydantoins, benzodiazepines and dipeptides
(Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)),
vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc.
114:6568 (1992)), nonpeptidal peptidomimetics with glucose
scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218
(1992)), analogous organic syntheses of small compound libraries
(Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates
(Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates
(Campbell et al., J. Org. Chem. 59:658 (1994)), nucleic acid
libraries (see Ausubel, Berger and Sambrook, all supra), peptide
nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083),
antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology,
14(3):309-314 (1996) and PCT/US96/10287), carbohydrate libraries
(see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S.
Pat. No. 5,593,853), small organic molecule libraries (see, e.g.,
benzodiazepines, Baum C&EN, Jan. 18, page 33 (1993);
isoprenoids, U.S. Pat. No. 5,569,588; thiazolidinones and
metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat.
Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No.
5,506,337; benzodiazepines, U.S. Pat No. 5,288,514, and the
like).
[0192] Devices for the preparation of combinatorial libraries are
commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem
Tech, Louisville Ky., Symphony, Rainin, Wobum, Mass., 433A Applied
Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford,
Mass.). In addition, numerous combinatorial libraries are
themselves commercially available (see, e.g., ComGenex, Princeton,
N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar,
Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek
Biosciences, Columbia, Md., etc.).
[0193] In one embodiment, the invention provides solid phase based
in vitro assays in a high throughput format, where the cell or
tissue expressing a Kv6.2 channel comprising a human Kv6.2 subunit
is attached to a solid phase substrate. In the high throughput
assays of the invention, it is possible to screen up to several
thousand different modulators or ligands in a single day. In
particular, each well of a microtiter plate can be used to run a
separate assay against a selected potential modulator, or, if
concentration or incubation time effects are to be observed, every
5-10 wells can test a single modulator. Thus, a single standard
microtiter plate can assay about 96 modulators. If 1536 well plates
are used, then a single plate can easily assay from about 100-
about 1500 different compounds. It is possible to assay several
different plates per day; assay screens for up to about
6,000-20,000 different compounds is possible using the integrated
systems of the invention.
VII. Computer Assisted Drug Design Using Kv6.2
[0194] Yet another assay for compounds that modulate the activities
of Kv6.2 involves computer assisted drug design, in which a
computer system is used to generate a three-dimensional structure
of Kv6.2 based on the structural information encoded by the amino
acid sequence. The input amino acid sequence interacts directly and
actively with a pre-established algorithm in a computer program to
yield secondary, tertiary, and quaternary structural models of the
protein. The models of the protein structure are then examined to
identify regions of the structure that have the ability to bind,
e.g., ligands or other potassium channel subunits. These regions
are then used to identify ligands that bind to the protein or
region where Kv6.2 interacts with other potassium channel
subunits.
[0195] The three-dimensional structural model of the protein is
generated by entering channel protein amino acid sequences of at
least 25, 50, 75 or 100 amino acid residues or corresponding
nucleic acid sequences encoding an Kv6.2 monomer into the computer
system. The amino acid sequence of each of the monomers is selected
from the group consisting of SEQ ID NO:1, SEQ ID NO:17, and a
conservatively modified versions thereof. The amino acid sequence
represents the primary sequence or subsequence of each of the
proteins, which encodes the structural information of the protein.
At least 25, 50, 75, or 100 residues of the amino acid sequence (or
a nucleotide sequence encoding at least about 25, 50, 75 or 100
amino acids) are entered into the computer system from computer
keyboards, computer readable substrates that include, but are not
limited to, electronic storage media (e.g., magnetic diskettes,
tapes, cartridges, and chips), optical media (e.g., CD ROM),
information distributed by internet sites, and by RAM. The
three-dimensional structural model of the channel protein is then
generated by the interaction of the amino acid sequence and the
computer system, using software known to those of skill in the art.
The resulting three-dimensional computer model can then be saved on
a computer readable substrate.
[0196] The amino acid sequence represents a primary structure that
encodes the information necessary to form the secondary, tertiary
and quaternary structure of the monomer and the heteromeric
potassium channel protein comprising four monomers. The software
looks at certain parameters encoded by the primary sequence to
generate the structural model. These parameters are referred to as
"energy terms," or anisotropic terms and primarily include
electrostatic potentials, hydrophobic potentials, solvent
accessible surfaces, and hydrogen bonding. Secondary energy terms
include van der Waals potentials. Biological molecules form the
structures that minimize the energy terms in a cumulative fashion.
The computer program is therefore using these terms encoded by the
primary structure or amino acid sequence to create the secondary
structural model.
[0197] The tertiary structure of the protein encoded by the
secondary structure is then formed on the basis of the energy terms
of the secondary structure. The user at this point can enter
additional variables such as whether the protein is membrane bound
or soluble, its location in the body, and its cellular location,
e.g., cytoplasmic, surface, or nuclear. These variables along with
the energy terms of the secondary structure are used to form the
model of the tertiary structure. In modeling the tertiary
structure, the computer program matches hydrophobic faces of
secondary structure with like, and hydrophilic faces of secondary
structure with like.
[0198] Once the structure has been generated, potential ligand
binding regions are identified by the computer system.
Three-dimensional structures for potential ligands are generated by
entering amino acid or nucleotide sequences or chemical formulas of
compounds, as described above. The three-dimensional structure of
the potential ligand is then compared to that of Kv6.2 protein to
identify ligands that bind to Kv6.2. Binding affinity between the
protein and ligands is determined using energy terms to determine
which ligands have an enhanced probability of binding to the
protein.
[0199] Computer systems are also used to screen for mutations,
polymorphic variants, alleles and interspecies homologs of Kv6.2
genes. Such mutations can be associated with disease states. Once
the variants are identified, diagnostic assays can be used to
identify patients having such mutated genes associated with disease
states. Identification of the mutated Kv6.2 genes involves
receiving input of a first nucleic acid, e.g., SEQ ID NO:2 or SEQ
ID NO:18, or an amino acid sequence encoding Kv6.2, selected from
the group consisting of SEQ ID NO:1 or SEQ ID NO:17, and a
conservatively modified versions thereof. The sequence is entered
into the computer system as described above. The first nucleic acid
or amino acid sequence is then compared to a second nucleic acid or
amino acid sequence that has substantial identity to the first
sequence. The second sequence is entered into the computer system
in the manner described above. Once the first and second sequences
are compared, nucleotide or amino acid differences between the
sequences are identified. Such sequences can represent allelic
differences in Kv6.2 genes, and mutations associated with disease
states.
[0200] The first and second sequences described above can be saved
on a computer readable substrate.
[0201] Kv6.2 monomers and the potassium channels containing these
Kv6.2 monomers can be used with high density oligonucleotide array
technology (e.g., GeneChip.TM.) to identify homologs and
polymorphic variants of Kv6.2 in this invention. In the case where
the homologs being identified are linked to a known disease, they
can be used with GeneChip.TM. as a diagnostic tool in detecting the
disease in a biological sample, see, e.g., Gunthand et al., AIDS
Res. Hum. Retroviruses 14: 869-876 (1998); Kozal et al., Nat. Med.
2:753-759 (1996); Matson et al., Anal. Biochem. 224:110-106 (1995);
Lockhart et al., Nat. Biotechnol. 14:1675-1680 (1996); Gingeras et
al., Genome Res. 8:435-448 (1998); Hacia et al., Nucleic Acids Res.
26:3865-3866 (1998).
VIII. Cellular Transfection and Gene Therapy
[0202] The present invention provides the nucleic acids of Kv6.2
for the transfection of cells in vitro and in vivo. These nucleic
acids can be inserted into any of a number of well-known vectors
for the transfection of target cells and organisms as described
below. The nucleic acids are transfected into cells, ex vivo or in
vivo, through the interaction of the vector and the target cell.
The nucleic acid for Kv6.2, under the control of a promoter, then
expresses a Kv6.2 monomer of the present invention, thereby
mitigating the effects of absent, partial inactivation, or abnormal
expression of the Kv6.2 gene.
[0203] Such gene therapy procedures have been used to correct
acquired and inherited genetic defects, cancer, and viral infection
in a number of contexts. The ability to express artificial genes in
humans facilitates the prevention and/or cure of many important
human diseases, including many diseases which are not amenable to
treatment by other therapies (for a review of gene therapy
procedures, see Anderson, Science 256:808-813 (1992); Nabel &
Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH
11:162-166 (1993); Mulligan, Science 926-932 (1993); Dillon,
TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van
Brunt, Biotechnology 6(10):1149-1154 (1998); Vigne, Restorative
Neurology and Neuroscience 8:35-36 (1995); Kremer &
Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada
et al., in Current Topics in Microbiology and Immunology (Doerfler
& Bohm eds., 1995); and Yu et al., Gene Therapy 1:13-26
(1994)).
[0204] Delivery of the gene or genetic material into the cell is
the first critical step in gene therapy treatment of disease. A
large number of delivery methods are well known to those of skill
in the art. Preferably, the nucleic acids are administered for in
vivo or ex vivo gene therapy uses. Non-viral vector delivery
systems include DNA plasmids, naked nucleic acid, and nucleic acid
complexed with a delivery vehicle such as a liposome. Viral vector
delivery systems include DNA and RNA viruses, which have either
episomal or integrated genomes after delivery to the cell.
[0205] Methods of non-viral delivery of nucleic acids include
lipofection, microinjection, biolistics, virosomes, liposomes,
immunoliposomes, polycation or lipid:nucleic acid conjugates, naked
DNA, artificial virions, and agent-enhanced uptake of DNA.
Lipofection is described in, e.g., U.S. Pat. No. 5,049,386, U.S.
Pat No. 4,946,787; and U.S. Pat. No. 4,897,355 and lipofection
reagents are sold commercially (e.g., Transfectam.TM. and
Lipofectin.TM.). Cationic and neutral lipids that are suitable for
efficient receptor-recognition lipofection of polynucleotides
include those of Felgner, WO 91/17424, WO 91/16024. Delivery can be
to cells (ex vivo administration) or target tissues (in vivo
administration).
[0206] The preparation of lipid:nucleic acid complexes, including
targeted liposomes such as immunolipid complexes, is well known to
one of skill in the art (see, e.g., Crystal, Science 270:404-410
(1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et
al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate
Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995);
Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos.
4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728,
4,774,085, 4,837,028, and 4,946,787).
[0207] The use of RNA or DNA viral based systems for the delivery
of nucleic acids take advantage of highly evolved processes for
targeting a virus to specific cells in the body and trafficking the
viral payload to the nucleus. Viral vectors can be administered
directly to patients (in vivo) or they can be used to treat cells
in vitro and the modified cells are administered to patients (ex
vivo). Conventional viral based systems for the delivery of nucleic
acids could include retroviral, lentivirus, adenoviral,
adeno-associated and herpes simplex virus vectors for gene
transfer. Viral vectors are currently the most efficient and
versatile method of gene transfer in target cells and tissues.
Integration in the host genome is possible with the retrovirus,
lentivirus, and adeno-associated virus gene transfer methods, often
resulting in long term expression of the inserted transgene.
Additionally, high transduction efficiencies have been observed in
many different cell types and target tissues.
[0208] The tropism of a retrovirus can be altered by incorporating
foreign envelope proteins, expanding the potential target
population of target cells. Lentiviral vectors are retroviral
vector that are able to transduce or infect non-dividing cells and
typically produce high viral titers. Selection of a retroviral gene
transfer system would therefore depend on the target tissue.
Retroviral vectors are comprised of cis-acting long terminal
repeats with packaging capacity for up to 6-10 kb of foreign
sequence. The minimum cis-acting LTRs are sufficient for
replication and packaging of the vectors, which are then used to
integrate the therapeutic gene into the target cell to provide
permanent transgene expression. Widely used retroviral vectors
include those based upon murine leukemia virus (MuLV), gibbon ape
leukemia virus (GaLV), simian immunodeficiency virus (SIV), human
immunodeficiency virus (HIV), and combinations thereof (see, e.g.,
Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J.
Virol. 66:1635-1640 (1992); Sommerfelt et al., Virol. 176:58-59
(1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et
al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).
[0209] In applications where transient expression of the nucleic
acid is preferred, adenoviral based systems are typically used.
Adenoviral based vectors are capable of very high transduction
efficiency in many cell types and do not require cell division.
With such vectors, high titer and levels of expression have been
obtained. This vector can be produced in large quantities in a
relatively simple system. Adeno-associated virus ("AAV") vectors
are also used to transduce cells with target nucleic acids, e.g.,
in the in vitro production of nucleic acids and peptides, and for
in vivo and ex vivo gene therapy procedures (see, e.g., West et
al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO
93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J.
Clin. Invest. 94:1351 (1994)). Construction of recombinant AAV
vectors are described in a number of publications, including U.S.
Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260
(1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984);
Hermonat & Muzyczka, Proc. Natl. Acad. Sci. U.S.A. 81:6466-6470
(1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
[0210] In particular, at least six viral vector approaches are
currently available for gene transfer in clinical trials, with
retroviral vectors by far the most frequently used system. All of
these viral vectors utilize approaches that involve complementation
of defective vectors by genes inserted into helper cell lines to
generate the transducing agent.
[0211] pLASN and MFG-S are examples are retroviral vectors that
have been used in clinical trials (Dunbar et al., Blood 85:3048-305
(1995); Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al.,
Proc. Natl. Acad. Sci. U.S.A. 94:22 12133-12138 (1997)).
PA317/pLASN was the first therapeutic vector used in a gene therapy
trial. (Blaese et al., Science 270:475-480 (1995)). Transduction
efficiencies of 50% or greater have been observed for MFG-S
packaged vectors (Ellem et al., Immunol Immunother. 44(1):10-20
(1997); Dranoffet al., Hum. Gene Ther. 1:111-2 (1997)).
[0212] Recombinant adeno-associated virus vectors (rAAV) are a
promising alternative gene delivery systems based on the defective
and nonpathogenic parvovirus adeno-associated type 2 virus. All
vectors are derived from a plasmid that retains only the AAV 145 bp
inverted terminal repeats flanking the transgene expression
cassette. Efficient gene transfer and stable transgene delivery due
to integration into the genomes of the transduced cell are key
features for this vector system (Wagner et al., Lancet 351:9117
1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)).
[0213] Replication-deficient recombinant adenoviral vectors (Ad)
are predominantly used transient expression gene therapy, because
they can be produced at high titer and they readily infect a number
of different cell types. Most adenovirus vectors are engineered
such that a transgene replaces the Ad E1a, E1b, and E3 genes;
subsequently the replication defector vector is propagated in human
293 cells that supply deleted gene function in trans. Ad vectors
can transduce multiple types of tissues in vivo, including
nondividing, differentiated cells such as those found in the liver,
kidney and muscle system tissues. Conventional Ad vectors have a
large carrying capacity. An example of the use of an Ad vector in a
clinical trial involved polynucleotide therapy for antitumor
immunization with intramuscular injection (Sterman et al., Hum.
Gene Ther. 7:1083-9 (1998)). Additional examples of the use of
adenovirus vectors for gene transfer in clinical trials include
Rosenecker et al., Infection 241:5-10 (1996); Sterman et al., Hum.
Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther.
2.205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997);
Topfet al., Gene Ther. 5:507-513 (1998); Sterman et al., Hum. Gene
Ther. 7:1083-1089 (1998).
[0214] Packaging cells are used to form virus particles that are
capable of infecting a host cell. Such cells include 293 cells,
which package adenovirus, and .psi.2 cells or PA317 cells, which
package retrovirus. Viral vectors used in gene therapy are usually
generated by producer cell line that packages a nucleic acid vector
into a viral particle. The vectors typically contain the minimal
viral sequences required for packaging and subsequent integration
into a host, other viral sequences being replaced by an expression
cassette for the protein to be expressed. The missing viral
functions are supplied in trans by the packaging cell line. For
example, AAV vectors used in gene therapy typically only possess
ITR sequences from the AAV genome which are required for packaging
and integration into the host genome. Viral DNA is packaged in a
cell line, which contains a helper plasmid encoding the other AAV
genes, namely rep and cap, but lacking ITR sequences. The cell line
is also infected with adenovirus as a helper. The helper virus
promotes replication of the AAV vector and expression of AAV genes
from the helper plasmid. The helper plasmid is not packaged in
significant amounts due to a lack of ITR sequences. Contamination
with adenovirus can be reduced by, e.g., heat treatment to which
adenovirus is more sensitive than AAV.
[0215] In many gene therapy applications, it is desirable that the
gene therapy vector be delivered with a high degree of specificity
to a particular tissue type. A viral vector is typically modified
to have specificity for a given cell type by expressing a ligand as
a fusion protein with a viral coat protein on the viruses outer
surface. The ligand is chosen to have affinity for a receptor known
to be present on the cell type of interest. For example, Han et
al., Proc. Natl. Acad. Sci. U.S.A. 92:9747-9751 (1995), reported
that Moloney murine leukemia virus can be modified to express human
heregulin fused to gp70, and the recombinant virus infects certain
human breast cancer cells expressing human epidermal growth factor
receptor. This principle can be extended to other pairs of virus
expressing a ligand fusion protein and target cell expressing a
receptor. For example, filamentous phage can be engineered to
display antibody fragments (e.g., FAB or Fv) having specific
binding affinity for virtually any chosen cellular receptor.
Although the above description applies primarily to viral vectors,
the same principles can be applied to nonviral vectors. Such
vectors can be engineered to contain specific uptake sequences
thought to favor uptake by specific target cells.
[0216] Gene therapy vectors can be delivered in vivo by
administration to an individual patient, typically by systemic
administration (e.g., intravenous, intraperitoneal, intramuscular,
subdermal, or intracranial infusion) or topical application, as
described below. Alternatively, vectors can be delivered to cells
ex vivo, such as cells explanted from an individual patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or universal
donor hematopoietic stem cells, followed by reimplantation of the
cells into a patient, usually after selection for cells which have
incorporated the vector.
[0217] Ex vivo cell transfection for diagnostics, research, or for
gene therapy (e.g., via re-infusion of the transfected cells into
the host organism) is well known to those of skill in the art. In a
preferred embodiment, cells are isolated from the subject organism,
transfected with a nucleic acid (gene or cDNA); and re-infused back
into the subject organism (e.g., patient). Various cell types
suitable for ex vivo transfection are well known to those of skill
in the art (see, e.g., Freshney et al., Culture of Animal Cells, A
Manual of Basic Technique (3rd ed. 1994)) and the references cited
therein for a discussion of how to isolate and culture cells from
patients).
[0218] In one embodiment, stem cells are used in ex vivo procedures
for cell transfection and gene therapy. The advantage to using stem
cells is that they can be differentiated into other cell types in
vitro, or can be introduced into a mammal (such as the donor of the
cells) where they will engraft in the bone marrow. Methods for
differentiating CD34+ cells in vitro into clinically important
immune cell types using cytokines such a GM-CSF, IFN-.gamma. and
TNF-.alpha. are known (see Inaba et al., J. Exp. Med. 176:1693-1702
(1992)).
[0219] Stem cells are isolated for transduction and differentiation
using known methods. For example, stem cells are isolated from bone
marrow cells by panning the bone marrow cells with antibodies which
bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB
cells), GR-1 (granulocytes), and Iad (differentiated antigen
presenting cells) (see Inaba et al., J. Exp. Med. 176:1693-1702
(1992)).
[0220] Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing therapeutic nucleic acids can be also administered
directly to the organism for transduction of cells in vivo.
Alternatively, naked DNA can be administered. Administration is by
any of the routes normally used for introducing a molecule into
ultimate contact with blood or tissue cells. Suitable methods of
administering such nucleic acids are available and well known to
those of skill in the art, and, although more than one route can be
used to administer a particular composition, a particular route can
often provide a more immediate and more effective reaction than
another route.
[0221] Administration is by any of the routes normally used for
introducing a molecule into ultimate contact with blood or tissue
cells. The nucleic acids are administered in any suitable manner,
preferably with pharmaceutically acceptable carriers. Suitable
methods of administering such nucleic acids are available and well
known to those of skill in the art, and, although more than one
route can be used to administer a particular composition, a
particular route can often provide a more immediate and more
effective reaction than another route.
IX. Pharmaceutical Compositions
[0222] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered (e.g., nucleic
acid, protein, modulatory compounds or transduced cell), as well as
by the particular method used to administer the composition.
Accordingly, there are a wide variety of suitable formulations of
pharmaceutical compositions of the present invention (see, e.g.,
Remington's Pharmaceutical Sciences, 17.sup.th ed., 1989).
[0223] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as an effective amount of the packaged
nucleic acid suspended in diluents, such as water, saline or PEG
400; (b) capsules, sachets or tablets, each containing a
predetermined amount of the active ingredient, as liquids, solids,
granules or gelatin; (c) suspensions in an appropriate liquid; and
(d) suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise the active
ingredient in a flavor, e.g., sucrose, as well as pastilles
comprising the active ingredient in an inert base, such as gelatin
and glycerin or sucrose and acacia emulsions, gels, and the like
containing, in addition to the active ingredient, carriers known in
the art.
[0224] The compound of choice, alone or in combination with other
suitable components, can be made into aerosol formulations (i.e.,
they can be "nebulized") to be administered via inhalation. Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0225] Suitable formulations for rectal administration include, for
example, suppositories, which consist of the packaged nucleic acid
with a suppository base. Suitable suppository bases include natural
or synthetic triglycerides or paraffin hydrocarbons. In addition,
it is also possible to use gelatin rectal capsules which consist of
a combination of the compound of choice with a base, including, for
example, liquid triglycerides, polyethylene glycols, and paraffin
hydrocarbons.
[0226] Formulations suitable for parenteral administration, such
as, for example, by intraarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions can be administered, for example,
by intravenous infusion, orally, topically, intraperitoneally,
intravesically or intrathecally. Parenteral administration and
intravenous administration are the preferred methods of
administration. The formulations of commends can be presented in
unit-dose or multi-dose sealed containers, such as ampules and
vials.
[0227] Injection solutions and suspensions can be prepared from
sterile powders, granules, and tablets of the kind previously
described. Cells transduced by nucleic acids for ex vivo therapy
can also be administered intravenously or parenterally as described
above.
[0228] The dose administered to a patient, in the context of the
present invention should be sufficient to effect a beneficial
therapeutic response in the patient over time. The dose will be
determined by the efficacy of the particular vector employed and
the condition of the patient, as well as the body weight or surface
area of the patient to be treated. The size of the dose also will
be determined by the existence, nature, and extent of any adverse
side-effects that accompany the administration of a particular
vector, or transduced cell type in a particular patient.
[0229] In determining the effective amount of the vector to be
administered in the treatment or prophylaxis of conditions owing to
diminished or aberrant expression of the Kv6.2 channels comprising
a human Kv6.2 alpha subunit, the physician evaluates circulating
plasma levels of the vector, vector toxicities, progression of the
disease, and the production of anti-vector antibodies. In general,
the dose equivalent of a naked nucleic acid from a vector is from
about 1 .mu.g to 100 .mu.g for a typical 70 kilogram patient, and
doses of vectors which include a retroviral particle are calculated
to yield an equivalent amount of therapeutic nucleic acid.
[0230] For administration, compounds and transduced cells of the
present invention can be administered at a rate determined by the
LD-50 of the inhibitor, vector, or transduced cell type, and the
side-effects of the inhibitor, vector or cell type at various
concentrations, as applied to the mass and overall health of the
patient. Administration can be accomplished via single or divided
doses.
[0231] Transduced cells are prepared for reinfusion according to
established methods (see, e.g., Abrahamsen et al., J. Clin.
Apheresis 6:48-53 (1991); Carter et al., J. Clin. Apheresis
4:113-117 (1998); Aebersold et al., J. Immunol. Meth. 112:1-7
(1998); Muul et al., J. Immunol. Methods 101 :171-181 (1987); and
Carter et al., Transfusion 27:362-365 (1987)).
X. Kits
[0232] Human Kv6.2 and its homologs are useful tools for examining
expression and regulation of potassium channels. Human
Kv6.2-specific reagents that specifically hybridize to Kv6.2
nucleic acid, such as Kv6.2 probes and primers, and Kv6.2-specific
reagents that specifically bind to the Kv6.2 protein, e.g., Kv6.2
antibodies are used to examine expression and regulation.
[0233] Nucleic acid assays for the presence of Kv6.2 DNA and RNA in
a sample include numerous techniques are known to those skilled in
the art, such as Southern analysis, northern analysis, dot blots,
RNase protection, S1 analysis, amplification techniques such as PCR
and LCR, and in situ hybridization. In in situ hybridization, for
example, the target nucleic acid is liberated from its cellular
surroundings in such as to be available for hybridization within
the cell while preserving the cellular morphology for subsequent
interpretation and analysis. The following articles provide an
overview of the art of in situ hybridization: Singer et al.,
Biotechniques 4:230-250 (1986); Haase et al., Methods in Virology,
vol. VII, pp. 189-226 (1984); and Nucleic Acid Hybridization: A
Practical Approach (Hames et al., eds. 1987). In addition, Kv6.2
protein can be detected with the various immunoassay techniques
described above. The test sample is typically compared to both a
positive control (e.g., a sample expressing recombinant Kv6.2
monomers) and a negative control.
[0234] The present invention also provides for kits for screening
modulators of the heteromeric potassium channels. Such kits can be
prepared from readily available materials and reagents. For
example, such kits can comprise any one or more of the following
materials: Kv6.2 monomers, reaction tubes, and instructions for
testing the activities of potassium channels containing Kv6.2. A
wide variety of kits and components can be prepared according to
the present invention, depending upon the intended user of the kit
and the particular needs of the user. For example, the kit can be
tailored for in vitro or in vivo assays for measuring the activity
of a potassium channel comprising a Kv6.2 monomer.
[0235] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0236] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to one of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
EXAMPLES
[0237] The following example is provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of noncritical parameters that could be
changed or modified to yield essentially similar results.
Example I
Cloning of Mouse Kv6.2
[0238] Using PCR and primers, according to standard conditions,
mouse Kv6.2 is amplified from whole brain cDNA. The following
primers are used for amplification: ATGCCCATGTCTTCCAGAGACAGG (SEQ
ID NO:3), and GATGTCTAGAGGGAGTTACATGTAGCG (SEQ ID NO:4).
[0239] The cDNA is prepared from total RNA isolated from whole
brain according to standard methods. Kv6.2 is amplified with the
primers described above using the following conditions: 15 seconds
at 96.degree. C., 15 seconds at 72-60.degree. C., and 3 minutes at
72.degree. C. for 40 cycles.
[0240] The PCR products are subcloned into plasmids and sequenced
according to standard techniques. The nucleotide and amino acid
sequences of mouse Kv6.2 are provided, respectively, in SEQ ID NO:2
and SEQ ID NO:1 (see also FIG. 1 for a comparison of human and
mouse Kv6.2 amino acid sequences).
Example II
Cloning of Human Kv6.2
[0241] An approximately 200 bp fragment of the human Kv6.2 gene was
cloned using RT-PCR from human whole brain mRNA with a sense primer
from the pore region of mouse Kv6.2 (TAGCATCCCGGCATCCTATTGGTG; SEQ
ID NO:11) and a degenerate antisense primer to the S6 region
(AGGAGTGAGAGAACGTRTGRAADAT; SEQ ID NO:12). Cycling conditions used
were 20 cycles of 95 degrees-15 seconds, 65-45 degrees-15 seconds
(1 degree dropped/cycle), 72 degrees 2 minutes, followed by 20
cycles of 95 degrees-15 seconds, 45 degrees-15 seconds, 72
degrees-2 minutes.
[0242] The 3' end of the gene was cloned using a single round of
standard 3' RACE PCR using the gene specific sense primer binding
to the P region (CATCCTATTGGTGGGCCATCATCT; SEQ ID NO:13). Cycling
conditions were: 24 cycles of 95 degrees-15 seconds, 72-60
degrees-15 seconds (0.5 degrees dropped per cycle), 72 degrees-2
minutes, followed by 21 cycles of 95 degrees-15 seconds, 60
degrees-15 seconds, 72 degrees-2 minutes. A single band of
approximately 500 bp was isolated and sequenced. It contained the P
region through the stop codon of human Kv6.2.
[0243] The 5' end was cloned with two rounds of 5' RACE PCR using
nested gene specific oligos. The 1.sup.st round reaction conditions
were identical to that used for the 3' RACE, except that a
different gene specific primer (GGGAGAAGGTGTGGAAGATAGACG; SEQ ID
NO:10) which binds to S6 in the antisense direction was used. One
tenth of a microliter of this reaction was used as a template for a
second reaction in which the a nested gene specific antisense
primer was used (GCCACCATCTGGCCTGGCACACTG; SEQ ID NO:14). The
cycling conditions for this reaction were 95 degrees-15 seconds, 60
degrees 15 seconds, 72 degrees 2 minutes (25 cycles). A single band
of approximately 1.7 Kb was isolated. It was found to contain the
5' end of the human Kv6.2 gene, including the initiator methionine
through the P region.
[0244] The entire human Kv6.2 gene was then amplified in a single
piece for an expression vector the sense primer
TCTTGAATTCCGCCATGCCCATGCCTTCCAG- AGACGG (SEQ ID NO:15) (which adds
an EcoRi restriction site and Kozak consensus to the initiator
methionine) and the antisense primer CTGGGCTCTAGAAACACCACCAGGT (SEQ
ID NO:16), which lies in the 3' UTR of human Kv6.2. Cycles were
identical to that used for the 3' RACE PCR. A single band of
approximately 1.7 Kb was isolated and found to contain the entire
open reading frame of human Kv6.2. the primer pair
ATGCCCATGCCTTCCAGAGACGG (SEQ ID NO:7) and
TTACATGTGCATGATAGGCAAGGCTG(SEQ ID NO:8) is sufficient to amplify
the open reading frame of Kv6.2 under these conditions. The
nucleotide and amino acid sequences of mouse Kv6.2 are provided,
respectively, in SEQ ID NO:18 and SEQ ID NO:17 (see also FIG. 1 for
a comparison of human and mouse Kv6.2 amino acids sequences).
Example III
Expression and Voltage-Gated Activity of Heteromeric Channels
Containing Kv6.2 Monomers
[0245] Human Kv6.2 monomer was co-expressed in Xenopus oocytes with
human Kv2.1 monomer according to standard methodology, to
demonstrate its ability to form heteromeric potassium channels with
voltage-gated activity (see FIG. 2). Mouse Kv6.2 and human Kv2.1
were also co-expressed. Changes in current magnitude are indirectly
measured using a reporter voltage-sensitive fluorescent dye (see,
e.g., Etts et al., Chemistry and Physiology of Lipids, 69:137
(1994)). Changes in current magnitude are also measured directly
using electrophysiology, and with ion flux. Kv6.2 expressed alone
was electrically silent (see FIG. 2).
Sequence CWU 1
1
18 1 506 PRT Mus sp. mouse alpha subunit of heteromeric voltage-
gated potassium channel Kv6.2 1 Met Pro Met Ser Ser Arg Asp Arg Asp
Leu His Pro Gly His His His 1 5 10 15 Phe Gly Ser Cys Ser Pro Leu
Ser Gln Leu Trp Pro Gly Pro Glu Pro 20 25 30 Lys Ser Val Lys Gly
Leu Tyr Tyr Ser Arg Ala Arg Lys Val Gly Asn 35 40 45 Gln Asp Ala
Ser Pro Glu Ala Asn Leu Lys Glu Ile Leu Val Asn Val 50 55 60 Gly
Gly Gln Arg Tyr Leu Leu Pro Trp Ser Thr Leu Asp Ala Phe Pro 65 70
75 80 Leu Ser Arg Leu Ser Arg Leu Arg Leu Cys Arg Ser His Glu Glu
Ile 85 90 95 Thr Gln Leu Cys Asp Asp Tyr Asp Glu Asp Ser Gln Glu
Phe Phe Phe 100 105 110 Asp Arg Asn Pro Ser Ala Phe Gly Val Ile Val
Ser Phe Leu Ala Ala 115 120 125 Gly Lys Leu Val Leu Leu Arg Glu Met
Cys Ala Leu Ser Phe Arg Glu 130 135 140 Glu Leu Ser Tyr Trp Gly Ile
Glu Glu Thr Asn Leu Glu Arg Cys Cys 145 150 155 160 Leu Arg Lys Leu
Leu Lys Lys Leu Glu Glu Ala Ala Glu Leu Arg Arg 165 170 175 Glu Glu
Ala Ala Gln Arg Gln Gln Gln Arg Gln Ala Cys His Ser Glu 180 185 190
Val Gln Ala Ser Arg Trp Ala Arg Ser Met Asn Gln Leu Arg Glu Met 195
200 205 Val Glu Asp Pro Gln Ser Gly Leu Pro Gly Lys Val Phe Ala Cys
Leu 210 215 220 Ser Val Leu Phe Val Ala Thr Thr Ala Val Ser Leu Cys
Val Ser Thr 225 230 235 240 Met Pro Asp Phe Arg Ala Glu Glu Gly Lys
Gly Glu Cys Thr Arg Lys 245 250 255 Cys Tyr Tyr Ile Phe Val Val Glu
Ser Ile Cys Val Ala Trp Phe Ser 260 265 270 Leu Glu Phe Cys Leu Arg
Phe Val Gln Ala Pro Asn Lys Cys Gln Phe 275 280 285 Phe Arg Gly Pro
Leu Asn Val Ile Asp Ile Leu Ala Ile Ser Pro Tyr 290 295 300 Tyr Val
Ser Leu Ala Val Ser Asp Glu Ser Pro Glu Ala Gly Glu Arg 305 310 315
320 Pro Ser Ser Ser Ser Tyr Leu Glu Lys Val Gly Leu Val Leu Arg Val
325 330 335 Leu Arg Ala Leu Arg Ile Leu Tyr Val Met Arg Leu Ala Arg
His Ser 340 345 350 Leu Gly Leu Gln Thr Leu Gly Leu Thr Val Arg Arg
Cys Ala Arg Glu 355 360 365 Phe Gly Leu Leu Met Leu Phe Leu Ala Val
Ala Val Thr Leu Phe Ser 370 375 380 Pro Leu Val Tyr Val Ala Glu Asn
Glu Ser Gly Arg Val Leu Glu Phe 385 390 395 400 Thr Ser Ile Pro Ala
Ser Tyr Trp Trp Ala Ile Ile Ser Met Thr Thr 405 410 415 Val Gly Tyr
Gly Asp Met Val Pro Arg Ser Val Pro Gly Gln Met Val 420 425 430 Ala
Leu Ser Ser Ile Leu Ser Gly Ile Leu Ile Met Ala Phe Pro Ala 435 440
445 Thr Ser Ile Phe His Thr Phe Ser His Ser Tyr Leu Glu Leu Lys Arg
450 455 460 Glu Gln Glu Gln Val Gln Ala Arg Leu Arg Arg Leu Gln Asn
Thr Asn 465 470 475 480 Ser Ala Ser Glu Arg Glu Leu Leu Ser Asp Val
Asp Asp Leu Val Pro 485 490 495 Glu Gly Leu Thr Ser Pro Gly Arg Tyr
Met 500 505 2 1518 DNA Mus sp. CDS (1)..(1518) mouse alpha subunit
of heteromeric voltage- gated potassium channel Kv6.2 2 atgcccatgt
cttccagaga cagggacttg catcctggac accatcactt tggctcctgc 60
agccccttga gccagctctg gccgggcccc gagcctaagt cagtcaaggg cctttactac
120 agcagggccc ggaaggtggg caaccaggac gcctctccgg aggccaactt
gaaggagatc 180 ctagtgaatg tgggtggcca gcggtacctg ctgccctgga
gcaccctgga tgccttcccg 240 ctgagccgcc tgagcaggct ccggctgtgc
cgcagccatg aggagatcac gcagctctgc 300 gatgactacg atgaggacag
ccaggagttc ttcttcgaca ggaaccccag cgccttcggg 360 gtgatcgtga
gcttcctggc cgcgggaaag ctggtgcttc tgcgagagat gtgcgccctg 420
tccttccggg aggagctgag ctactggggc atcgaggaaa ccaacctgga gcgctgctgc
480 ctgcgcaagc tgctgaagaa gctggaggag gcggccgagc tgcgccggga
ggaggctgcc 540 cagcgccagc agcagcgcca ggcctgccac tccgaggtgc
aggcttcacg atgggcccgc 600 agcatgaacc agctgcgtga aatggtggag
gacccacagt cggggctgcc cgggaaggtc 660 ttcgcctgcc tctccgtgct
cttcgtggca accacggctg tcagcctgtg tgtgagcacc 720 atgcccgact
tcagggctga ggagggcaag ggagaatgca ctagaaagtg ctattacatc 780
ttcgtggtgg aatccatctg tgtggcctgg ttctcgctgg agttttgcct gcgctttgtc
840 caggccccga acaaatgtca gttcttccgc gggcccctga atgtcatcga
cattctagcc 900 atctccccat actatgtgtc gctcgcagtg tctgacgaat
ccccggaggc aggcgagagg 960 ccgagcagca gctcctacct ggagaaagtg
gggttagtgc tgcgtgttct gcgggcacta 1020 cgcatcctct acgtaatgcg
cctggctcgc cactccctgg ggctgcagac gctgggcctc 1080 actgtgcgcc
gctgcgcccg agagtttggt ctcctgatgc tcttcctggc tgtggcggtt 1140
accctcttct caccgttggt ctatgtagct gagaatgagt ccggaagggt cctggagttc
1200 actagcatcc ccgcatccta ttggtgggcc atcatctcca tgacgaccgt
gggctatggg 1260 gacatggtcc ctcgcagcgt cccgggacag atggtggctc
tgagcagcat ccttagcggg 1320 atccttatca tggctttccc agccacatcc
atcttccaca cgttctctca ctcctacctg 1380 gagctgaagc gggagcagga
gcaggtccag gcccgcctcc ggcgtcttca gaacaccaat 1440 tcggccagcg
aacgggagct cctgagtgac gtagatgatc tggtccctga gggtctgacc 1500
tccccaggcc gctacatg 1518 3 24 DNA Artificial Sequence Description
of Artificial Sequencemouse amplification primer 3 atgcccatgt
cttccagaga cagg 24 4 27 DNA Artificial Sequence Description of
Artificial Sequencemouse amplification primer 4 gatgtctaga
gggagttaca tgtagcg 27 5 28 DNA Artificial Sequence Description of
Artificial Sequence amplification primer 5 ggcactacgc atcctctacg
taatgcgc 28 6 26 DNA Artificial Sequence Description of Artificial
Sequence amplification primer 6 gatgatggcc caccaatagg atgcgg 26 7
23 DNA Artificial Sequence Description of Artificial Sequencehuman
open reading frame amplification primer 7 atgcccatgc cttccagaga cgg
23 8 26 DNA Artificial Sequence Description of Artificial
Sequencehuman open reading frame amplification primer 8 ttacatgtgc
atgataggca aggctg 26 9 24 DNA Artificial Sequence Description of
Artificial Sequence amplification primer 9 gtccaggccc aagacaagtg
tcag 24 10 24 DNA Artificial Sequence Description of Artificial
Sequencehuman 5' RACE PCR nested gene specific S6 region antisense
primer 10 gggagaaggt gtggaagata gacg 24 11 24 DNA Artificial
Sequence Description of Artificial Sequencehuman RT-PCR pore (P)
region sense primer 11 tagcatcccg gcatcctatt ggtg 24 12 25 DNA
Artificial Sequence Description of Artificial Sequencehuman RT-PCR
degenerate antisense S6 region primer 12 aggagtgaga gaacgtrtgr
aadat 25 13 24 DNA Artificial Sequence Description of Artificial
Sequencehuman standard 3' RACE PCR gene specific pore (P) region
sense primer 13 catcctattg gtgggccatc atct 24 14 24 DNA Artificial
Sequence Description of Artificial Sequencehuman 5' RACE PCR nested
gene specific antisense primer 14 gccaccatct ggcctggcac actg 24 15
37 DNA Artificial Sequence Description of Artificial Sequencehuman
amplification sense primer 15 tcttgaattc cgccatgccc atgccttcca
gagacgg 37 16 25 DNA Artificial Sequence Description of Artificial
Sequencehuman amplification antisense primer 16 ctgggctcta
gaaacaccac caggt 25 17 519 PRT Homo sapiens human alpha subunit of
heteromeric voltage- gated potassium channel Kv6.2 17 Met Pro Met
Pro Ser Arg Asp Gly Gly Leu His Pro Arg His His His 1 5 10 15 Tyr
Gly Ser His Ser Pro Trp Ser Gln Leu Leu Ser Ser Pro Met Glu 20 25
30 Thr Pro Ser Ile Lys Gly Leu Tyr Tyr Arg Arg Val Arg Lys Val Gly
35 40 45 Ala Leu Asp Ala Ser Pro Val Asp Leu Lys Lys Glu Ile Leu
Ile Asn 50 55 60 Val Gly Gly Arg Arg Tyr Leu Leu Pro Trp Ser Thr
Leu Asp Arg Phe 65 70 75 80 Pro Leu Ser Arg Leu Ser Lys Leu Arg Leu
Cys Arg Ser Tyr Glu Glu 85 90 95 Ile Val Gln Leu Cys Asp Asp Tyr
Asp Glu Asp Ser Gln Glu Phe Phe 100 105 110 Phe Asp Arg Ser Pro Ser
Ala Phe Gly Val Ile Val Ser Phe Leu Ala 115 120 125 Ala Gly Lys Leu
Val Leu Leu Gln Glu Met Cys Ala Leu Ser Phe Gln 130 135 140 Glu Glu
Leu Ala Tyr Trp Gly Ile Glu Glu Ala His Leu Glu Arg Cys 145 150 155
160 Cys Leu Arg Lys Leu Leu Arg Lys Leu Glu Glu Leu Glu Glu Leu Ala
165 170 175 Lys Leu His Arg Glu Asp Val Leu Arg Gln Gln Arg Glu Thr
Arg Arg 180 185 190 Pro Ala Ser His Ser Ser Arg Trp Gly Leu Cys Met
Asn Arg Leu Arg 195 200 205 Glu Met Val Glu Asn Pro Gln Ser Gly Leu
Pro Gly Lys Val Phe Ala 210 215 220 Cys Leu Ser Ile Leu Phe Val Ala
Thr Thr Ala Val Ser Leu Cys Val 225 230 235 240 Ser Thr Met Pro Asp
Leu Arg Ala Glu Glu Asp Gln Gly Glu Cys Ser 245 250 255 Arg Lys Cys
Tyr Tyr Ile Phe Ile Val Glu Thr Ile Cys Val Ala Trp 260 265 270 Phe
Ser Leu Glu Phe Cys Leu Arg Phe Val Gln Ala Gln Asp Lys Cys 275 280
285 Gln Phe Phe Gln Gly Pro Leu Asn Ile Ile Asp Ile Leu Ala Ile Ser
290 295 300 Pro Tyr Tyr Val Ser Leu Ala Val Ser Glu Glu Pro Pro Glu
Asp Gly 305 310 315 320 Glu Arg Pro Ser Arg Ser Ser Tyr Leu Glu Lys
Val Gly Leu Val Leu 325 330 335 Arg Val Leu Arg Ala Leu Arg Ile Leu
Tyr Val Met Arg Leu Ala Arg 340 345 350 His Ser Leu Gly Leu Gln Thr
Leu Gly Leu Thr Val Arg Arg Cys Thr 355 360 365 Cys Glu Phe Gly Leu
Leu Leu Leu Phe Leu Ala Val Ala Ile Thr Leu 370 375 380 Phe Ser Pro
Leu Val Tyr Val Ala Glu Lys Glu Ser Gly Arg Val Leu 385 390 395 400
Glu Phe Thr Ser Ile Pro Ala Ser Tyr Trp Trp Ala Ile Ile Ser Met 405
410 415 Thr Thr Val Gly Tyr Gly Asp Met Val Pro Arg Ser Val Pro Gly
Gln 420 425 430 Met Val Ala Leu Ser Ser Ile Leu Ser Gly Ile Leu Ile
Met Ala Phe 435 440 445 Pro Ala Thr Ser Ile Phe His Thr Phe Ser His
Ser Tyr Leu Glu Leu 450 455 460 Lys Lys Glu Gln Glu Gln Leu Gln Ala
Arg Leu Arg His Leu Gln Asn 465 470 475 480 Thr Gly Pro Ala Ser Glu
Cys Glu Leu Leu Asp Pro His Val Ala Ser 485 490 495 Glu His Glu Leu
Met Asn Asp Val Asn Asp Leu Ile Leu Glu Gly Pro 500 505 510 Ala Leu
Pro Ile Met His Met 515 18 2022 DNA Homo sapiens CDS (149)..(1708)
human alpha subunit of heteromeric voltage- gated potassium channel
Kv6.2 18 cttccccttc atctccacca gaaacctgtc ccttccctgg gcaccaagag
atgggctccc 60 cttgcctggc agagaaacag ctggaaactg gctccctgag
acaagaagac tggtaaaccc 120 agcgcttcct acctggtggt cttcagcaat
gcccatgcct tccagagacg ggggcctgca 180 tcccagacac caccactatg
gttcccacag cccttggagt cagctcctgt ccagccccat 240 ggagacgccg
tccatcaagg gcctttacta ccggagggtg cggaaggtgg gtgccctgga 300
cgcctcccca gtggacctga agaaggagat cctgatcaac gtggggggca ggaggtatct
360 cctcccctgg agcacactgg accggttccc gctgagccgc ctgagcaaac
tcaggctctg 420 tcggagctac gaggagatcg tgcagctctg cgatgattac
gacgaggaca gccaggagtt 480 cttcttcgac aggagcccca gcgccttcgg
ggtgatcgtg agcttcctgg cggccgggaa 540 gctggtgctt ctgcaggaga
tgtgcgcgct gtccttccag gaggagctgg cctactgggg 600 catcgaggag
gcccacctgg agaggtgctg cctgcggaag ctgctgagga agctggagga 660
gctggaggag ctggccaagc tgcacaggga ggacgtactg aggcagcaga gggagacccg
720 ccgccccgcc tcgcactcct cgcgctgggg cctgtgcatg aaccggctgc
gcgagatggt 780 ggaaaacccg cagtccgggc tgcccgggaa ggtcttcgct
tgcctctcca tcctcttcgt 840 ggccaccaca gccgtcagcc tgtgtgtcag
caccatgccc gacctcaggg cagaggagga 900 ccagggcgaa tgctctcgga
agtgctacta tattttcatc gtggagacca tctgcgtggc 960 ctggttctcc
ctggagttct gcctgcggtt tgtccaggcc caagacaagt gtcagttctt 1020
ccaggggccc ctgaacatca tcgacatcct ggccatctcc ccatactacg tgtcgctggc
1080 ggtgtctgag gagcccccgg aggacggcga gaggccgagc aggagctcct
acctggagaa 1140 ggtggggctg gtcctgcgtg tgctgcgagc gctgcgcatc
ctctacgtga tgcgcctggc 1200 tcgccactcg ctggggctgc agacgctggg
gctcaccgtg cgccgttgca catgtgagtt 1260 cggcctgctc cttctcttcc
tggccgtggc catcaccctc ttctcccctt tggtctacgt 1320 ggccgagaag
gagtccgggc gggtgctgga gttcaccagc atccccgcct cctattggtg 1380
ggccatcatc tccatgacaa cggtgggcta cggggacatg gtgccccgca gtgtgccagg
1440 ccagatggtg gccctcagca gcatcctgag cgggatcctc atcatggcct
tcccggccac 1500 gtctatcttc cacaccttct cccactccta cctggagctc
aagaaggagc aggagcagct 1560 tcaggcccgc ctccgccacc tccaaaacac
cggtccagcc agtgaatgtg aactcctgga 1620 cccccatgtg gccagtgaac
atgagctcat gaacgatgtc aatgacctaa tcctggaggg 1680 cccagccttg
cctatcatgc acatgtaact cagcaccccc catgactaca tggtaacctc 1740
aacccatcac cctgcctgaa acacactcaa gggtaccccg catagaccac ctggtggtgt
1800 ttctagagcc cagggaagac tttcaaagct ggaggggcat aaggccacag
aggctgtgtg 1860 tctgtgatcc ttgtccctcg gggccccgat gtcccaggct
gactgtgtcc agcctgcttg 1920 ccttttcctc tctctgccca tctactgagc
atgtccaatc ttgctggagt agctcagtct 1980 cctttcattc tcttttcctt
cccagcagag gctttaacat cc 2022
* * * * *
References