U.S. patent application number 10/732271 was filed with the patent office on 2004-07-01 for human inositol monophosphatase h1.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Gocayne, Jeannine D., Meissner, Paul S..
Application Number | 20040126377 10/732271 |
Document ID | / |
Family ID | 34812186 |
Filed Date | 2004-07-01 |
United States Patent
Application |
20040126377 |
Kind Code |
A1 |
Meissner, Paul S. ; et
al. |
July 1, 2004 |
Human inositol monophosphatase H1
Abstract
Human inositol monophosphatase H1 polynucleotide and DNA (RNA)
encoding such polypeptides and a procedure for producing such
polypeptide by recombinant techniques and utilizing such
polypeptide for therapeutic purposes, for example, screening and
designing compounds capable of inhibiting hIMP-H1 and mapping
genetic diseases are disclosed. Further disclosed are antibodies
against hIMP-H1 polypeptides and methods for producing such
antibodies and utilizing such antibodies for therapeutic or
diagnostic purposes. Also disclosed is antagonists against such
polypeptide along with procedures for using such antagonists for
therapeutic purposes, for example, for treating psychotic and
depressive disorders. Diagnostic assays for identifying mutations
in nucleic acid sequence encoding a polypeptide of the present
invention and for detecting altered levels of the polypeptide of
the present invention are also disclosed.
Inventors: |
Meissner, Paul S.;
(Barnesville, MD) ; Gocayne, Jeannine D.;
(Potomac, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville
MD
20850
|
Family ID: |
34812186 |
Appl. No.: |
10/732271 |
Filed: |
December 11, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10732271 |
Dec 11, 2003 |
|
|
|
09440113 |
Nov 15, 1999 |
|
|
|
6709653 |
|
|
|
|
09440113 |
Nov 15, 1999 |
|
|
|
09314198 |
May 19, 1999 |
|
|
|
6403310 |
|
|
|
|
09314198 |
May 19, 1999 |
|
|
|
09002072 |
Feb 9, 1998 |
|
|
|
5955339 |
|
|
|
|
09002072 |
Feb 9, 1998 |
|
|
|
08461731 |
Jun 5, 1995 |
|
|
|
5716806 |
|
|
|
|
08461731 |
Jun 5, 1995 |
|
|
|
PCT/US94/10465 |
Sep 16, 1994 |
|
|
|
Current U.S.
Class: |
424/146.1 ;
435/196; 435/320.1; 435/325; 435/6.18; 435/69.1; 530/388.26;
536/23.2 |
Current CPC
Class: |
C12N 2799/026 20130101;
A61K 38/00 20130101; C12N 9/16 20130101; A61K 48/00 20130101 |
Class at
Publication: |
424/146.1 ;
435/006; 435/069.1; 435/196; 435/320.1; 435/325; 530/388.26;
536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; A61K 039/395; C12N 009/16; C07K 016/40 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
comprising amino acid 1 to amino acid 265 as set forth in SEQ ID
NO:2; (b) a polynucleotide capable of hybridizing to and which is
at least 70% identical to the polynucleotide of (a); and (c) a
polynucleotide fragment of the polynucleotide of (a) or (b).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 1 wherein the polynucleotide is
RNA.
4. The polynucleotide of claim 1 wherein the polynucleotide is
genomic DNA.
5. The polynucleotide of claim 2 which encodes the polypeptide
comprising amino acid 1 to 265 of SEQ ID NO:2.
6. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide which encodes a mature
polypeptide having the amino acid sequence expressed by the DNA
contained in ATCC Deposit No. 75753; (b) a polynucleotide which
encodes a mature polypeptide having the amino acid sequence
expressed by the DNA contained in ATCC Deposit No. 75753; (c) a
polynucleotide capable of hybridizing to and which is at least 70%
identical to the polynucleotide of (a); and (d) a polynucleotide
fragment of the polynucleotide of (a), (b) or (c).
7. The polynucleotide of claim 1 comprising the sequence as set
forth in SEQ ID No. 1 from nucleotide to nucleotide 798.
8. The polynucleotide of claim 1 comprising the sequence as set
forth in SEQ ID No. 3 from nucleotide to nucleotide 1313.
9. A vector containing the DNA of claim 2.
10. A host cell genetically engineered with the vector of claim
9.
11. A process for producing a polypeptide comprising: expressing
from the host cell of claim 10 the polypeptide encoded by said
DNA.
12. A process for producing cells capable of expressing a
polypeptide comprising genetically engineering cells with the
vector of claim 9.
13. A polypeptide comprising a member selected from the group
consisting of (i) a polypeptide having the deduced amino acid
sequence of SEQ ID NO:2 and fragments, analogs and derivatives
thereof, and (ii) a polypeptide encoded by the cDNA of ATCC Deposit
No. 75753 and fragments, analogs and derivatives of said
polypeptide.
14. The polypeptide of claim 13 wherein the polypeptide comprises
amino acid 1 to amino acid 265 of SEQ ID NO:2.
15. A compound which inhibits activation of the polypeptide of
claim 13.
16. A method for the treatment of a patient having need to inhibit
a hIMP-HI polypeptide comprising: administering to the patient a
therapeutically effective amount of the compound of claim 13.
17. The method of claim 13 wherein said compound is a polypeptide
and said therapeutically effective amount of the polypeptide is
administered by providing to the patient DNA encoding said
polypeptide and expressing said polypeptide in vivo.
18. A process for diagnosing a disease or a susceptibility to a
disease related to expression of the polypeptide of claim 13
comprising: determining a mutation in a nucleic acid sequence
encoding said polypeptide.
19. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 13 in a sample derived from a host.
20. A process for detecting compounds which inhibit the polypeptide
of claim 13 comprising: contacting a compound with a cell line
expressing hIMP-h1 in the presence of inositol monophosphate; and
measuring the hydrolysis of inositol monophosphate by hIMP-H1.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 09/440,113, filed Nov. 15, 1999, which is a divisional of U.S.
application Ser. No. 09/314,198, filed May 19, 1999, (now U.S. Pat.
No. 6,403,310, issued Jun. 11, 2002), which is a divisional of U.S.
application Ser. No. 09/002,072, filed Feb. 9, 1998 (now U.S. Pat.
No. 5,955,339, issued Sep. 21, 1999), which is a divisional of U.S.
application Ser. No. 08/461,731, filed Jun. 5, 1995 (now U.S. Pat.
No. 5,716,806, issued Feb. 10, 1998), which is a
continuation-in-part of International Application No.
PCT/US94/10465, filed Sep. 16, 1994. Each of the above cited
patents and patent applications is incorporated by reference
herein.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is human Inositol
Monophosphatase H1, sometimes hereinafter referred to as "hIMP-H1".
The invention also relates to inhibiting the action of such
polypeptides.
[0003] Cells respond to extracellular stimuli through complicated
networks of responses. Inositol lipid metabolism plays a key role
in intracellular signalling. Agonist-induced stimulation of cells
releases the signalling molecules diacylglycerol and inositol
polyphosphates via phospholipase C hydrolysis of phosphoinositides.
Diacylglycerol functions to stimulate protein kinase C (Nishizuka,
Y., Science, 233:305-312 (1986), and several inositol
polyphosphates, most notably inositol 1, 4, 5-triphosphate evoke
the release of intracellular and intercellular calcium (Berridge,
M. J. and Irvine, R. F., Nature, (London), 312, 315-321 (1984).
Action of inositol phosphatases and kinases gives rise to a
plethora of inositol phosphates (Majerus, P. W. et al., J. Biol.
Chem., 263:3051-3054 (1988) in the cytosol that may also serve as
signalling or regulatory molecules.
[0004] Inositol monophosphatase (IMP) plays an important role in
the phosphatidylinositol signalling pathway by catalyzing the
hydrolysis of inositol monophosphates. IMP's are believed to be the
molecular site of action for lithium therapy for manic-depressive
illness. Lithium inhibits inositol monophosphatase and prevents the
accumulation of free inositol from inositol-1-phosphate. for
manic-depressive illness. Lithium inhibits inositol monophosphatase
and prevents the accumulation of free inositol from
inositol-1-phosphate.
[0005] Lithium carbonate was shown to be an effective antimanic
compound by John Cade in 1949, and this compound was approved for
wide-spread use in 1969. However, treatment of manic-depressive
patients with lithium is associated with certain deleterious side
effects. These include tremor, weight gain, diarrhea, skin rash,
transient leukocytosis, hypothyroidism, and polyuria-polydipsia.
Additional clinical ailments associated with chronic lithium
therapy are structural lesions in the kidney (including tubular
atrophy, glomerular sclerosis and interstitial fibrosis). These
side effects are directly due to lithium toxicity.
[0006] The phosphoinositide (PI) cycle is a likely target for
lithium action, since it has been demonstrated that a profound
elevation of inositol-1-phosphate and a corresponding decrease in
free inositol in the brains of rats occurred when treated
systemically with lithium. This was attributed to inhibition of
inositol-1-phosphate phosphatase and led to the hypothesis that
lithium was able to damp down the activity of the PI cycle in
overstimulated cells, thus explaining its effectiveness in
controlling mania.
[0007] Provision of inositol for the PI cycle can come from
hydrolysis of inositol phosphates, by de novo synthesis from
glucose, or from the diet. The former processes are dependent on
the operation of inositol-1-phosphate phosphatase and are,
therefore, inhibited by lithium. Dietary inositol can bypass
lithium blockade in peripheral tissues but not in the CNS, since
inositol does not cross the blood brain barrier. Thus, the increase
in inositol-1-phosphate in brain is accompanied by an equivalent
decrease in free inositol.
[0008] Manganese supports catalysis by inositol monophosphatase. On
the other hand, divalent ions, i.e., calcium and manganese, are
competitive inhibitors (Hallcher, L. M. and Sherman, W. R., J.
Biol. Chem., 255:10896-901 (1980)). Lithium inhibits inositol
monophosphate phosphatase uncompetitively.
[0009] IMP liberates inositol from the substrates INS (1) P, INS
(3) P and INS (4) P. IMP is also capable of hydrolyzing various
non-inositol containing substrates including but not limited to
those disclosed by Sherman, J. Biol. Chem., 224:10896-10901 (1980),
Takimoto, J. Biol. Chem. (Tokyo), 98:363-370 (1985) and by Gee,
Bio. Chem. J., 249:883-889 (1988). The first human IMP cDNA was
isolated and is disclosed by McAllister et al., (WO 93/25692
(1993)).
[0010] The polypeptide of the present invention has been putatively
identified as a human inositol monophosphatase polypeptide. This
identification has been made as a result of amino acid sequence
homology.
[0011] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide, as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The polypeptide of the
present invention is of human origin.
[0012] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding a
polypeptide of the present invention including mRNAs, DNAs, cDNAs,
genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments thereof.
[0013] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention, under conditions promoting expression of said protein
and subsequent recovery of said protein.
[0014] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides for
therapeutic purposes, for example, for screening and designing
compounds capable of inhibiting this class of enzymes, and for the
treatment of psychiatric disorders.
[0015] In accordance with yet a further aspect of the present
invention, there is provided an antibody against such
polypeptides.
[0016] In accordance with yet another aspect of the present
invention, there are provided antagonists against such
polypeptides, which may be used to inhibit the action of such
polypeptides, for example, in the treatment of psychotic and
depressive disorders (bipolar and non-bipolar).
[0017] In accordance with yet a further aspect of the present
invention, there is also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to a nucleic acid sequence of the present invention.
[0018] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases or susceptibility to diseases related to mutations in the
nucleic acid sequences encoding a polypeptide of the present
invention.
[0019] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, for example,
synthesis of DNA and manufacture of DNA vectors.
[0020] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0022] FIGS. 1A, 1B and 1C collectively show the polynucleotide
sequence (SEQ ID NO:1) and its complement as well as the
corresponding deduced amino acid sequence (SEQ ID NO:2) for the
putative mature human inositol monophosphate H1 polypeptide,
wherein FIG. 1A illustrates the first portions of the
polynucleotide sequence of the cDNA encoding the of the putative
mature human inositol monophosphate H1 polypeptide, its complement
and its deduced amino acid sequence and FIGS. 1B-1C consecutively
continue with their respective parts to the end of the same
polynucleotide, its complement and amino acid sequences. The
standard one-letter abbreviations for amino acid residues are used
to illustrate the amino acid sequence in FIGS. 1A-C.
[0023] FIGS. 2A, 2B and 2C collectively show the polynucleotide
sequence (SEQ ID NO:1) for the putative human inositol
monophosphate H1 polypeptide, wherein FIG. 2A illustrates the first
portion of the polynucleotide sequence of the cDNA encoding the
mature putative human inositol monophosphate H1 polypeptide and
FIGS. 2B-2C consecutively continue with their respective parts to
the end of the same polynucleotide sequence.
[0024] FIGS. 3A and 3B collectively show the amino acid homology
between the hIMP polypeptide (top line of each comparative row; SEQ
ID NO:10); the hIMP-H1 polypeptide of the present invention (second
line of each comparative row; SEQ ID NO:2); and the consensus
sequence (common amino acids boxed and bottom line of each
comparative row; SEQ ID NO:11). Wherein FIG. 3A illustrates the
first portions of the hIMP polypeptide in the top line of each
comparative row and the first portions of the hIMP-H1 polypeptide
in the second line of each comparative row and FIG. 3B
consecutively continues with the ends of the same two amino acid
sequences. The standard one-letter abbreviations for amino acid
residues are used to illustrate the amino acid sequences in FIGS.
3A-B.
[0025] Sequencing inaccuracies are a common problem when attempting
to determine polynucleotide sequences. Accordingly, the sequence of
FIGS. 1A-1C is based on several sequencing runs and the sequencing
accuracy is considered to be at least 97%.
[0026] In accordance with an aspect of the present invention, there
is provided an isolated nucleic acid (polynucleotide) which encodes
for the mature polypeptide having the deduced amino acid sequence
of FIGS. 1A-1C (SEQ ID NO:2) or for the mature polypeptide encoded
by the cDNA of the clone deposited as ATCC Deposit No. 75753 on
Apr. 25, 1994. And, this ATCC number is directed to a biological
deposit with the American Tissue Culture Collection, 10801
University Blvd., Manassas, Va. 201 10-2209, USA. The strain
referred to is being maintained under the terms of the Budapest
Treaty and will be made available to a patent office signatory to
the Budapest Treaty.
[0027] A polynucleotide encoding a polypeptide of the present
invention may be obtained from human brain, lymphocytes and
placenta. The polynucleotide of this invention was discovered in a
cDNA library derived from human brain tissue. It is structurally
related to the inositol phosphatase family. It contains an open
reading frame encoding a protein of about 265 amino acid residues.
The protein exhibits the highest degree of homology to human
inositol monophosphatase with 55% identity and 65% similarity over
a 265 amino acid stretch. It is also important that the amino acid
sequence DPIDGT (SEQ ID NO:12) is conserved in the polypeptide of
the present invention, since this region has been shown to be
essential at the active site of IMP enzymes.
[0028] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIGS. 1A-1C (SEQ ID NO:1) or that of the deposited clone
or may be a different coding sequence which coding sequence, as a
result of the redundancy or degeneracy of the genetic code, encodes
the same mature polypeptide as the DNA of FIGS. 1A-1C (SEQ ID NO:1)
or the deposited cDNA.
[0029] The polynucleotide which encodes for the mature polypeptide
of FIGS. 1A-1C (SEQ ID NO:2) or for the mature polypeptide encoded
by the deposited cDNA may include, but is not limited to: only the
coding sequence for the mature polypeptide; the coding sequence for
the mature polypeptide and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the coding
sequence for the mature polypeptide (and optionally additional
coding sequence) and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptide.
[0030] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0031] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1A-1C (SEQ ID NO:2) or the polypeptide
encoded by the cDNA of the deposited clone. The variant of the
polynucleotide may be a naturally occurring allelic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0032] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1C (SEQ
ID NO:2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or the polypeptide encoded
by the cDNA of the deposited clone. Such nucleotide variants
include deletion variants, substitution variants and addition or
insertion variants.
[0033] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1 C (SEQ ID NO:1) or of the
coding sequence of the deposited clone. As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0034] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains. Thus, for
example, the polynucleotide of the present invention may encode for
a mature protein, or for a protein having a prosequence or for a
protein having both a prosequence and a presequence (leader
sequence).
[0035] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0036] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0037] Fragments of the full length gene of the present invention
may be used as a hybridization probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and may
contain, for example, 50 or more bases. The probe may also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0038] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A-1C (SEQ ID
NO:1) or the deposited cDNA(s).
[0039] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0040] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0041] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn.112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with any description of sequences herein. A license may be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0042] The present invention further relates to a polypeptide which
has the deduced amino acid sequence of FIGS. 1A-1C or which has the
amino acid sequence encoded by the deposited cDNA, as well as
fragments, analogs and derivatives of such polypeptide.
[0043] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A-1C (SEQ ID NO:2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0044] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0045] The fragment, derivative or analog of the polypeptide of
FIGS. 1A-1C (SEQ ID NO:2) or that encoded by the deposited cDNA may
be (i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence. Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0046] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0047] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0048] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least 95% similarity (still more preferably at
least 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0049] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0050] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0051] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0052] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
hIMP-H1 genes. The culture conditions, such as temperature, pH and
the like, are those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan.
[0053] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0054] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0055] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0056] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0057] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein.
[0058] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0059] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0060] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0061] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0062] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0063] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0064] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0065] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. Coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0066] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0067] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0068] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0069] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0070] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0071] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0072] The hIMP-H1 polypeptides can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography hydroxylapatite
chromatography and lectin chromatography. It is preferred to have
low concentrations (approximately 0.15-5 mM) of calcium ion present
during purification. (Price et al., J. Biol. Chem., 244:917
(1969)). Protein refolding steps can be used, as necessary, in
completing configuration of the mature protein. Finally, high
performance liquid chromatography (HPLC) can be employed for final
purification steps.
[0073] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0074] hIMP-H1 may be employed to design alternative therapeutic
compounds, other than lithium, for manic-depressive illnesses.
hIMP-H1 is therefore useful for screening and designing compounds
capable of inhibiting hIMP-H1.
[0075] hIIMP-H1 may also be employed to map genetic diseases. For
example, the exact genetic lesion(s) responsible for some forms of
hereditary manic-depressive illness are still unknown but are the
subject of intense investigation (York, et al., PNAS USA,
90:5833-5837, (1993)). One of the targets of this investigation is
the IMP gene. The hlIMP-H1 cDNA can be employed to isolate the
chromosomal locus of the complete gene. This region of the
chromosome can then be tested to determine if any mutations in
families affected by manic depression and possibly other
psychiatric disorders are localized in this region.
[0076] The present invention relates to an assay which identifies
compounds which block (antagonists) hIMP-H1 from functioning. In
order to provide a structural basis from which to design
alternative therapeutic compounds which inhibit hIMP-H1, the
purification, cloning and X-ray crystallization of hIMP-H1 is
undertaken. From the cloned enzyme structural data is generated,
especially X-ray crystallographic and structural data is obtained
and used to screen for and design antagonists to hIMP-H1. An
example of such a screen includes measuring the release of
[.sup.14C]inositol from DL-Ins(1)P containing L-[U-.sup.14C]Ins(1)P
as label, as described in (Gumber et al., Plant Physiol., 76:40-44
(1989)). One unit of enzyme activity represents 1 .mu.mol of
substrate hydrolysed/min, at 37.degree. C. Protein concentrations
may be determined by the method of Bradford (Bradford, M., Anal.
Biochem., 72:248-252 (1976)).
[0077] The above described assay may also be used to block the
other enzymes which are critical to the PI cycle, for example,
phosphoinositol kinases which are enzymes involved in the
phosphatidylinositol signaling pathway, namely they catalyze the
hydrolysis of the 1 position phosphate from inositol
1,3,4-triphosphate and inositol 1,4-biphosphate.
[0078] Potential antagonists include an antibody against the
hIMP-H1 polypeptide which binds thereto making the hIMP-H1
polypeptide inaccessible to substrate.
[0079] Potential antagonists also include proteins which are
mimetics of hIMP-H1 (a closely related protein which does not
retain hIMP-H1 function) which recognize and bind to the receptor
subtypes which hIMP-H1 normally binds. However, there is no second
messenger response. In this manner, the function of the hIMP-H1
enzyme is prevented and the beneficial therapeutic effects of
inhibiting hIMP-H1 are achieved. Examples of these proteins
include, but are not limited to, oligonucleotides and small-peptide
molecules.
[0080] Antisense technology may also be used to control gene
expression through triple-helix formation or antisense DNA or RNA,
both of which methods are based on binding of a polynucleotide to
DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes for the mature polypeptides
of the present invention, is used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the
gene involved in transcription (triple helix-see Lee et al., Nucl.
Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251:1360 (1991)), thereby preventing
transcription and the production of hIMP-H1. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the hIMP-H1 (antisense-Okano,
J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
The oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of hIMP-H1.
[0081] Another potential antagonist is a small molecule which binds
to and occupies the catalytic site of the hIMP-H1 enzyme thereby
making the catalytic site inaccessible to a substrate such that
normal biological activity is prevented. Examples of small
molecules include but are not limited to small peptides or
peptide-like molecules.
[0082] The antagonists may be employed to treat psychotic and
depressive disorders (bipolar and non-bipolar) other than mania.
The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0083] The compounds which inhibit the action of hIMP-H1 may be
employed in combination with a suitable pharmaceutical carrier.
Such compositions comprise a therapeutically effective amount of
the compound, and a pharmaceutically acceptable carrier or
excipient. Such a carrier includes but is not limited to saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The formulation should suit the mode of
administration.
[0084] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, the amount
administered is an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc.
[0085] The compounds identified which inhibit hIMP-H1 and which are
polypeptides may also be employed in accordance with the present
invention by expression of such polypeptides in vivo, which is
often referred to as "gene therapy."
[0086] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0087] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0088] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0089] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B 19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0090] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0091] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0092] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0093] This invention is also related to the use of the gene of the
present invention as a diagnostic. Detection of a mutated form of
the gene will allow a diagnosis of a disease or a susceptibility to
a disease which results from underexpression of hIMP-H1
[0094] Individuals carrying mutations in the gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, including but not limited to blood, urine, saliva,
tissue biopsy and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by using
PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example,
PCR primers complementary to the nucleic acid encoding hIMP-H1 can
be used to identify and analyze mutations. For example, deletions
and insertions can be detected by a change in size of the amplified
product in comparison to the normal genotype. Point mutations can
be identified by hybridizing amplified DNA to radiolabeled RNA or
alternatively, radiolabeled antisense DNA sequences. Perfectly
matched sequences can be distinguished from mismatched duplexes by
RNase A digestion or by differences in melting temperatures.
[0095] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0096] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0097] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., PNAS, USA,
85:4397-4401 (1985)).
[0098] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0099] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0100] The present invention also relates to a diagnostic assay for
detecting altered levels of the polypeptide of the present
invention in various tissues. Assays used to detect levels of the
polypeptide of the present invention in a sample derived from a
host are well-known to those of skill in the art and include
radioimmunoassays, competitive-binding assays, Western Blot
analysis and preferably an ELISA assay. An ELISA assay initially
comprises preparing an antibody specific to the hIMP-H1 antigen,
preferably a monoclonal antibody. In addition a reporter antibody
is prepared against the monoclonal antibody. To the reporter
antibody is attached a detectable reagent such as radioactivity,
fluorescence or in this example a horseradish peroxidase enzyme. A
sample is now removed from a host and incubated on a solid support,
e.g. a polystyrene dish, that binds the proteins in the sample. Any
free protein binding sites on the dish are then covered by
incubating with a non-specific protein such as bovine serum
albumin. Next, the monoclonal antibody is incubated in the dish
during which time the monoclonal antibodies attached to any of the
polypeptide of the present invention attached to the polystyrene
dish. All unbound monoclonal antibody is washed out with buffer.
The reporter antibody linked to horseradish peroxidase is now
placed in the dish resulting in binding of the reporter antibody to
any monoclonal antibody bound to the polypeptide of the present
invention. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of the polypeptide of the present invention present in a
given volume of patient sample when compared against a standard
curve.
[0101] A competition assay may be employed wherein antibodies
specific to the polypeptide of the present invention are attached
to a solid support and labeled hIMP-H1 and a sample derived from
the host are passed over the solid support and the amount of label
detected attached to the solid support can be correlated to a
quantity of the polypeptide of the present invention in the
sample.
[0102] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0103] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA,
thus complicating the amplification process. These primers are then
used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0104] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0105] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA having at least 50 or 60 bases. For a review of this
technique, see Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988).
[0106] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0107] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0108] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0109] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0110] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0111] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0112] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0113] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0114] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0115] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0116] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0117] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0118] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0119] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units to
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0120] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
[0121] Bacterial Expression and Purification of hIMP-H1
[0122] The DNA sequence encoding for hIMP-H1, ATCC # 75753, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' end sequences of the processed hIMP-H1 protein (minus the
signal peptide sequence) and the vector sequences 3' to the hIMP-H1
gene. Additional nucleotides corresponding to hIMP-H1 were added to
the 5' and 3' sequences respectively. The 5' oligonucleotide primer
has the sequence 5' ACTTGCTACGGATCCATGTGCACCACAGGGGCG 3' (SEQ ID
NO:4) contains a Bam H1 restriction enzyme site followed by 18
nucleotides of hIMP-H1 coding sequence starting from the presumed
terminal amino acid of the processed protein codon. The 3' sequence
5' ACTTGCTACAAGCTTTCACTTCTCATCATCCCG 3' (SEQ ID NO:5) contains a
Hind III site and is followed by 18 nucleotides of hIMP-H1
including the final stop codon. The restriction enzymes sites
correspond to the restriction enzyme sites on the bacterial
expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth,
Calif., 91311). pQE-9 encodes antibiotic resistance (Amp.sub.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 was then digested with Bam H1 and
Hind III. The amplified sequences were ligated into pQE-9 and were
inserted in frame with the sequence encoding for the histidine tag
and the RBS. The ligation mixture was then used to transform E.
coli strain available from Qiagen under the trademark M15/rep 4 by
the procedure described in Sambrook, J. et al., Molecular Cloning:
A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4
contains multiple copies of the plasmid pREP4, which expresses the
lacI repressor and also confers kanamycin resistance (Kan.sup.r).
Transformants are identified by their ability to grow on LB plates
and ampicillin/kanamycin resistant colonies were selected. Plasmid
DNA was isolated and confirmed by restriction analysis. Clones
containing the desired constructs were grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells were grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 3 to 4 hours. Cells were then harvested
by centrifugation. The cell pellet was solubilized in the
chaotropic agent 6 Molar Guanidine HCl . After clarification,
solubilized hIMP-H1 was purified from this solution by
chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E. et al., J. Chromatography 411:177-184 (1984). hIMP-H1
(95% pure) was eluted from the column in 6 molar guanidine HCl pH
5.0 and for the purpose of renaturation adjusted to 3 molar
guanidine HCl, 100 mM sodium phosphate, 10 mmolar glutathione
(reduced) and 2 mmolar glutathione (oxidized). After incubation in
this solution for 12 hours the protein was dialyzed to 10 mmolar
sodium phosphate.
EXAMPLE 2
[0123] Cloning and Expression of hIMP-H1 Using the Baculovirus
Expression System
[0124] The DNA sequence encoding the full length hIMP-H1 protein,
ATCC # 75753, was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0125] The 5' primer has the sequence 5' CCGGATCCGCCACC
AIGTGCACCACAGGGGCGGGG 3' (SEQ ID NO:6) contains a Bam H1
restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) and
is just behind the first 21 nucleotides of the hIMP-H1 gene (the
initiation codon for translation "ATG" is underlined).
[0126] The 3' primer has the sequence 5' CACAGGTACCCAGCTT
TGCCTCAGCCGCAG 3' (SEQ ID NO:7) contains the cleavage site for the
restriction endonuclease Asp718 and 20 nucleotides complementary to
the 3' non-translated sequence of the hIMP-H1 gene. The amplified
sequences were isolated from a 1% agarose gel using a commercially
available kit ("Geneclean," BIO 101 Inc., La Jolla, Calif.). The
fragment was then digested with the endonucleases Bam H1 and Asp718
and then purified again on a 1% agarose gel. This fragment is
designated F2.
[0127] The vector pRG1 (modification of pVL941 vector, discussed
below) is used for the expression of the hIMP-H1 protein using the
baculovirus expression system (for review see: Summers, M. D. and
Smith, G. E. 1987, A manual of methods for baculovirus vectors and
insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555). This expression vector contains the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by the recognition sites for
the restriction endonucleases Bam H1 and Asp718. The
polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of cotransfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers,
M. D., Virology, 170:31-39).
[0128] The plasmid was digested with the restriction enzymes Bam H1
and Asp718 then dephosphorylated using calf intestinal phosphatase
by procedures known in the art. The DNA was then isolated from a 1%
agarose gel using the commercially available kit ("Geneclean" BIO
101 Inc., La Jolla, Calif.). This vector DNA is designated V2.
[0129] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBachIMP-H1) with
the hIMP-H1 gene using the enzymes Bam H1 and Asp718. The sequence
of the cloned fragment was confirmed by DNA sequencing.
[0130] 5 .mu.g of the plasmid pBachIMP-H1 was cotransfected with
1.0 .mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci.
USA, 84:7413-7417 (1987)).
[0131] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBachIMP-H1 were mixed in a sterile well of a microtiter
plate containing 50 .mu.l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace' medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0132] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0133] Four days after the serial dilution of the viruses was added
to the cells, blue stained plaques were picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculoviruses was used
to infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0134] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-hIMP-H1 at a multiplicity of infection (MOI) of 2.
Six hours later the medium was removed and replaced with SF900 II
medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) were added. The cells were
further incubated for 16 hours before they were harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
[0135] Expression of Recombinant hIMP-H1 in COS Cells
[0136] The expression of plasmid, hIMP-H1-HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
hIMP-H1 precursor and a HA tag fused in frame to its 3' end was
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag corresponds to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H. Niman,
R. Heighten, A Cherenson, M. Connolly, and R. Lemer, 1984, Cell 37,
767). The infusion of HA tag to the target protein allows easy
detection of the recombinant protein with an antibody that
recognizes the HA epitope.
[0137] The plasmid construction strategy is described as follows:
The DNA sequence encoding hIMP-H1, ATCC # 75753, was constructed by
PCR on the original EST cloned using two primers: the 5' primer 5'
5' CCGGATCCGCCACCATGTGCACCACAGGGGCGGGG 3' (SEQ ID NO:8) and
contains a Bam H1 restriction enzyme site (in bold), and 18
nucleotides of hIMP-H1 starting from the initiation codon
(underlined); the 3' sequence
CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACTT CTCATCATCCCGCCC (SEQ ID
NO:9) which contains complementary sequences to an XbaI restriction
site, translation stop codon, HA tag and the last 18 nucleotides of
the hIMP-H1 coding sequence (not including the stop codon).
Therefore, the PCR product contains a hIMP-H1 coding sequence
followed by HA tag fused in frame, a translation termination stop
codon next to the HA tag, and a Bam HI and XbaI site. The PCR
amplified DNA fragment and the vector, pcDNAI/Amp, were digested
with Bam H1 and Xba I restriction enzymes and ligated. The ligation
mixture was transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037) the transformed culture was plated on
ampicillin media plates and resistant colonies were selected.
Plasmid DNA was isolated from transformants and examined by
restriction analysis for the presence of the correct fragment. For
expression of the recombinant hIMP-H1, COS cells were transfected
with the expression vector by DEAE-DEXTRAN method. (J. Sambrook, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989)). The expression of the hIIMP-H1 HA
protein was detected by radiolabelling and immunoprecipitation
method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8
hours with .sup.35S-cysteine two days post transfection. Culture
media were then collected and cells were lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and culture media were precipitated with a HA specific
monoclonal antibody. Proteins precipitated were analyzed on 15%
SDS-PAGE gels.
EXAMPLE 4
[0138] Expression Via Gene Therapy
[0139] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0140] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0141] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB 101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0142] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0143] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0144] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0145] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
12 1 798 DNA Homo sapiens 1 atgtgcacca caggggcggg gctggagatc
atcagaaaag cccttactga ggaaaaacgt 60 gtctcaacaa aaacatcagc
tgcagatctt gtgacagaaa cagatcacct tgtggaagat 120 ttaattattt
ctgagttgcg agagaggttt ccttcacaca ggttcattgc agaagaggcc 180
gcggcttctg gggccaagtg tgtgctcacc cacagcccga cgtggatcat cgaccccatc
240 gacggcacct gcaattttgt gcacagattc ccgactgtgg cggttagcat
tggatttgct 300 gttcgacaag agcttgaatt cggagtgatt taccactgca
cagaggagcg gctgtacacg 360 ggccggcggg gtcggggcgc cttctgcaat
ggccagcggc tccgggtctc cggggagaca 420 gatctctcaa aggccttggt
tctgacagaa attggcccca aacgtgaccc tgcgaccctg 480 aagctgttcc
tgagtaacat ggagcggctg ctgcatgcca aggcgcatgg ggtccgagtg 540
attggaagct ccacattggc actctgccac ctggcctcag gggccgcgga tgcctattac
600 cagtttggcc tgcactgctg ggatctggcg gctgccacag tcatcatcag
agaagcaggc 660 ggcatcgtga tagacacttc gggtggaccc ctcgacctca
tggtttgcag agtggttgcg 720 gccagcaccc gggagatggc gatgctcata
gctcaggcct tacagacgat taactatggg 780 cgggatgatg agaagtga 798 2 265
PRT Homo sapiens 2 Met Cys Thr Thr Gly Ala Gly Leu Glu Ile Ile Arg
Lys Ala Leu Thr 1 5 10 15 Glu Glu Lys Arg Val Ser Thr Lys Thr Ser
Ala Ala Asp Leu Val Thr 20 25 30 Glu Thr Asp His Leu Val Glu Asp
Leu Ile Ile Ser Glu Leu Arg Glu 35 40 45 Arg Phe Pro Ser His Arg
Phe Ile Ala Glu Glu Ala Ala Ala Ser Gly 50 55 60 Ala Lys Cys Val
Leu Thr His Ser Pro Thr Trp Ile Ile Asp Pro Ile 65 70 75 80 Asp Gly
Thr Cys Asn Phe Val His Arg Phe Pro Thr Val Ala Val Ser 85 90 95
Ile Gly Phe Ala Val Arg Gln Glu Leu Glu Phe Gly Val Ile Tyr His 100
105 110 Cys Thr Glu Glu Arg Leu Tyr Thr Gly Arg Arg Gly Arg Gly Ala
Phe 115 120 125 Cys Asn Gly Gln Arg Leu Arg Val Ser Gly Glu Thr Asp
Leu Ser Lys 130 135 140 Ala Leu Val Leu Thr Glu Ile Gly Pro Lys Arg
Asp Pro Ala Thr Leu 145 150 155 160 Lys Leu Phe Leu Ser Asn Met Glu
Arg Leu Leu His Ala Lys Ala His 165 170 175 Gly Val Arg Val Ile Gly
Ser Ser Thr Leu Ala Leu Cys His Leu Ala 180 185 190 Ser Gly Ala Ala
Asp Ala Tyr Tyr Gln Phe Gly Leu His Cys Trp Asp 195 200 205 Leu Ala
Ala Ala Thr Val Ile Ile Arg Glu Ala Gly Gly Ile Val Ile 210 215 220
Asp Thr Ser Gly Gly Pro Leu Asp Leu Met Val Cys Arg Val Val Ala 225
230 235 240 Ala Ser Thr Arg Glu Met Ala Met Leu Ile Ala Gln Ala Leu
Gln Thr 245 250 255 Ile Asn Tyr Gly Arg Asp Asp Glu Lys 260 265 3
1313 DNA Homo sapiens 3 ggatccagga gttggagccc gcctgcgcgc tgcgggacgg
ggcacggcgg aagggttggg 60 tccgcctcga gcggggaggg taatgtgcac
cacaggggcg gggctggaga tcatcagaaa 120 agcccttact gaggaaaaac
gtgtctcaac aaaaacatca gctgcagatc ttgtgacaga 180 aacagatcac
cttgtggaag atttaattat ttctgagttg cgagagaggt ttccttcaca 240
caggttcatt gcagaagagg ccgcggcttc tggggccaag tgtgtgctca cccacagccc
300 gacgtggatc atcgacccca tcgacggcac ctgcaatttt gtgcacagat
tcccgactgt 360 ggcggttagc attggatttg ctgttcgaca agagcttgaa
ttcggagtga tttaccactg 420 cacagaggag cggctgtaca cgggccggcg
gggtcggggc gccttctgca atggccagcg 480 gctccgggtc tccggggaga
cagatctctc aaaggccttg gttctgacag aaattggccc 540 caaacgtgac
cctgcgaccc tgaagctgtt cctgagtaac atggagcggc tgctgcatgc 600
caaggcgcat ggggtccgag tgattggaag ctccacattg gcactctgcc acctggcctc
660 aggggccgcg gatgcctatt accagtttgg cctgcactgc tgggatctgg
cggctgccac 720 agtcatcatc agagaagcag gcggcatcgt gatagacact
tcgggtggac ccctcgacct 780 catggtttgc agagtggttg cggccagcac
ccgggagatg gcgatgctca tagctcaggc 840 cttacagacg attaactatg
ggcgggatga tgagaagtga ctgcggctga ggcaaagctg 900 ctcccaaggc
ctccctgggc tgctgtgggc tcctggggag gtggccctcg tggcccacgc 960
tccatgccag tggctcacgc tctgctcctg gctaccccag agggagttgt cacgctacag
1020 tgagtggctg gccttttaaa tcgacgtctc tctcaccagg atttggtgtt
tagctgtttc 1080 tctctttaat ctcacgtagc cctttttcag gttagtacgt
gttcttctgt cagggcaaaa 1140 ctcaaatctc ctgtgaaata cgtattgata
atccaatctt gatttttccc cccagaatat 1200 aaatctcagg taatasaggc
tttagaactg ctgataaagg gatcgttctc aggcctcccc 1260 ccggagtact
tcagaatgca ataaatcaaa atatgggaaa aaaaaaactc gag 1313 4 33 DNA
Artificial Sequence Primer 4 acttgctacg gatccatgtg caccacaggg gcg
33 5 33 DNA Artificial Sequence Primer 5 acttgctaca agctttcact
tctcatcatc ccg 33 6 35 DNA Artificial Sequence Primer 6 ccggatccgc
caccatgtgc accacagggg cgggg 35 7 30 DNA Artificial Sequence Primer
7 cacaggtacc cagctttgcc tcagccgcag 30 8 35 DNA Artificial Sequence
Primer 8 ccggatccgc caccatgtgc accacagggg cgggg 35 9 57 DNA
Artificial Sequence Primer 9 cgctctagat caagcgtagt ctgggacgtc
gtatgggtac ttctcatcat cccgccc 57 10 277 PRT Homo sapiens 10 Met Ala
Asp Pro Trp Gln Glu Cys Met Asp Tyr Ala Val Thr Leu Ala 1 5 10 15
Arg Gln Ala Gly Glu Val Val Cys Glu Ala Ile Lys Asn Glu Met Asn 20
25 30 Val Met Leu Lys Ser Ser Pro Val Asp Leu Val Thr Ala Thr Asp
Gln 35 40 45 Lys Val Glu Lys Met Leu Ile Ser Ser Ile Lys Glu Lys
Tyr Pro Ser 50 55 60 His Ser Phe Ile Gly Glu Glu Ser Val Ala Ala
Gly Glu Lys Ser Ile 65 70 75 80 Leu Thr Asp Asn Pro Thr Trp Ile Ile
Asp Pro Ile Asp Gly Thr Thr 85 90 95 Asn Phe Val His Arg Phe Pro
Phe Val Ala Val Ser Ile Gly Phe Ala 100 105 110 Val Asn Lys Lys Ile
Glu Phe Gly Val Val Tyr Ser Cys Val Glu Gly 115 120 125 Lys Met Tyr
Thr Ala Arg Lys Gly Lys Gly Ala Phe Cys Asn Gly Gln 130 135 140 Lys
Leu Gln Val Ser Gln Gln Glu Asp Ile Thr Lys Ser Leu Leu Val 145 150
155 160 Thr Glu Leu Gly Ser Ser Arg Thr Pro Glu Thr Val Arg Met Val
Leu 165 170 175 Ser Asn Met Glu Lys Leu Phe Cys Ile Pro Val His Gly
Ile Arg Ser 180 185 190 Val Gly Thr Ala Ala Val Asn Met Cys Leu Val
Ala Thr Gly Gly Ala 195 200 205 Asp Ala Tyr Tyr Glu Met Gly Ile His
Cys Trp Asp Val Ala Gly Ala 210 215 220 Gly Ile Ile Val Thr Glu Ala
Gly Gly Val Leu Met Asp Val Thr Gly 225 230 235 240 Gly Pro Phe Asp
Leu Met Ser Arg Arg Val Ile Ala Ala Asn Asn Arg 245 250 255 Ile Leu
Ala Glu Arg Ile Ala Lys Glu Ile Gln Val Ile Pro Leu Gln 260 265 270
Arg Asp Asp Glu Asp 275 11 278 PRT Homo sapiens misc_feature
(1)..(20) Xaa = "MADPWQECMDYAVTLARQAG" or "------------MCTTGAGL" 11
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5
10 15 Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Ala Xaa Xaa Xaa Glu Xaa
Xaa 20 25 30 Val Xaa Xaa Lys Xaa Ser Xaa Xaa Asp Leu Val Thr Xaa
Thr Asp Xaa 35 40 45 Xaa Val Glu Xaa Xaa Xaa Ile Ser Xaa Xaa Xaa
Glu Xaa Xaa Pro Ser 50 55 60 His Xaa Phe Ile Xaa Glu Glu Xaa Xaa
Ala Xaa Gly Xaa Lys Xaa Xaa 65 70 75 80 Leu Thr Xaa Xaa Pro Thr Trp
Ile Ile Asp Pro Ile Asp Gly Thr Xaa 85 90 95 Asn Phe Val His Arg
Phe Pro Xaa Val Ala Val Ser Ile Gly Phe Ala 100 105 110 Val Xaa Xaa
Xaa Xaa Glu Phe Gly Val Xaa Tyr Xaa Cys Xaa Glu Xaa 115 120 125 Xaa
Xaa Tyr Thr Xaa Arg Xaa Gly Xaa Gly Ala Phe Cys Asn Gly Gln 130 135
140 Xaa Leu Xaa Val Ser Xaa Xaa Xaa Asp Xaa Xaa Lys Xaa Leu Xaa Xaa
145 150 155 160 Thr Glu Xaa Gly Xaa Xaa Arg Xaa Pro Xaa Thr Xaa Xaa
Xaa Xaa Leu 165 170 175 Ser Asn Met Glu Xaa Leu Xaa Xaa Xaa Xaa Xaa
His Gly Xaa Arg Xaa 180 185 190 Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Cys
Xaa Xaa Ala Xaa Gly Xaa Ala 195 200 205 Asp Ala Tyr Tyr Xaa Xaa Gly
Xaa His Cys Trp Asp Xaa Ala Xaa Ala 210 215 220 Xaa Xaa Ile Xaa Xaa
Glu Ala Gly Gly Xaa Xaa Xaa Asp Xaa Xaa Gly 225 230 235 240 Gly Pro
Xaa Asp Leu Met Xaa Xaa Arg Val Xaa Ala Ala Xaa Xaa Arg 245 250 255
Xaa Xaa Ala Xaa Xaa Ile Ala Xaa Xaa Xaa Gln Xaa Ile Xaa Xaa Xaa 260
265 270 Arg Asp Asp Glu Xaa Xaa 275 12 6 PRT Homo sapiens 12 Asp
Pro Ile Asp Gly Thr 1 5
* * * * *