U.S. patent application number 10/746442 was filed with the patent office on 2004-06-24 for methods of alleviating neuropathic pain.
This patent application is currently assigned to The Regents of the University of California, a California corporation. Invention is credited to O'Brien, John S..
Application Number | 20040121958 10/746442 |
Document ID | / |
Family ID | 56289790 |
Filed Date | 2004-06-24 |
United States Patent
Application |
20040121958 |
Kind Code |
A1 |
O'Brien, John S. |
June 24, 2004 |
Methods of alleviating neuropathic pain
Abstract
The invention provides a method of alleviating neuropathic pain
in a subject by administering a neuropathic pain alleviating amount
of prosaposin receptor agonist to the subject. The invention also
provides a method of inhibiting the onset of neuropathic pain in a
subject by administering neuropathic pain alleviating amount of
prosaposin receptor agonist to the subject. The present invention
also provides prosaposin receptor agonists and the use of these
agonists for stimulating neurite outgrowth, inhibiting neural cell
death, promoting myelination and inhibiting neural demyelination.
In addition, there is provided a method of inhibiting sensory or
motor neuropathy by contacting neuronal cells with a composition
comprising an effective inhibiting amount of prosaposin receptor
agonist.
Inventors: |
O'Brien, John S.; (San
Diego, CA) |
Correspondence
Address: |
FISH & RICHARDSON, PC
12390 EL CAMINO REAL
SAN DIEGO
CA
92130-2081
US
|
Assignee: |
The Regents of the University of
California, a California corporation
|
Family ID: |
56289790 |
Appl. No.: |
10/746442 |
Filed: |
December 24, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10746442 |
Dec 24, 2003 |
|
|
|
08928074 |
Sep 11, 1997 |
|
|
|
08928074 |
Sep 11, 1997 |
|
|
|
08611307 |
Mar 5, 1996 |
|
|
|
6271196 |
|
|
|
|
08928074 |
Sep 11, 1997 |
|
|
|
PCT/US97/04143 |
Mar 5, 1997 |
|
|
|
Current U.S.
Class: |
514/18.3 ;
424/450; 514/18.2; 530/324; 530/325; 530/326 |
Current CPC
Class: |
A61P 25/02 20180101;
C12N 5/0619 20130101; A61P 25/00 20180101; C07K 14/475 20130101;
A61P 25/04 20180101; A61P 25/28 20180101; A61K 38/00 20130101 |
Class at
Publication: |
514/012 ;
514/013; 514/014; 514/015; 424/450; 530/324; 530/325; 530/326 |
International
Class: |
A61K 038/17; A61K
038/10; C07K 007/08 |
Claims
We claim:
1. A prosaposin receptor agonist having from about 14 to 50 amino
acids and comprising the amino acid sequence
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4- X.sub.3X.sub.1X.sub.1, wherein:
X.sub.1 is any amino acid; X.sub.2 is any amino acid, but not L or
R; X.sub.3 is a charged amino acid; and X.sub.4, when present, is a
charged amino acid.
2. The prosaposin receptor agonist of claim 1, wherein
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.sub.3X.sub.1X.sub.1 has the
amino acid sequence shown in SEQ ID NO:2.
3. The prosaposin receptor agonist of claim 1, wherein the
prosaposin receptor agonist consists of the sequence shown in SEQ
ID NO:1 or SEQ ID NO:2.
4. A pharmaceutical composition comprising the prosaposin receptor
agonist of claim 1 in a pharmaceutically acceptable carrier.
5. The composition of claim 4 in a controlled release
formulation.
6. The composition of claim 4 in a liposomal form.
7. The composition of claim 4 in a lyophilized form.
8. The composition of claim 4 in a unit dosage form.
9. A method of alleviating neuropathic pain in a subject,
comprising administering a neuropathic pain alleviating amount of a
prosaposin receptor agonist to the subject.
10. The method of claim 9, wherein the prosaposin receptor agonist
has from about 14 to 50 amino acids and comprises the amino acid
sequence LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.sub.3X.sub.1X.sub.1,
wherein: X.sub.1 is any amino acid; X.sub.2 is any amino acid, but
not L or R; X.sub.3 is a charged amino acid; and X.sub.4, when
present, is a charged amino acid.
11. The method of claim 10, wherein
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.su- b.3X.sub.1X.sub.1 has the
amino acid sequence shown in SEQ ID NO:2.
12. The method of claim 10, wherein the prosaposin receptor agonist
is an amino acid sequence selected from the group consisting of SEQ
ID NO:1 and SEQ ID NO:2.
13. The method of claim 9, wherein prosaposin receptor agonist is
an amino acid sequence selected from the group consisting of SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO: 5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ
ID NO:16, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19.
14. The method of claim 9, wherein the neuropathic pain results
from a peripheral nerve disorder.
15. The method of claim 14, wherein the peripheral nerve disorder
is selected from the group consisting of neuroma; nerve
compression; nerve crush, nerve stretch and incomplete nerve
transsection; mononeuropathy and polyneuropathy.
16. The method of claim 9, wherein the neuropathic pain results
from a disorder selected from the group consisting of a disorder of
dorsal root ganglia, spinal cord, brainstem, thalamus and
cortex.
17. The method of claim 9, wherein the administering is selected
from the group consisting of intravenous, intramuscular,
intradermal, subcutaneous, intracranial, intracerebrospinal,
topical, oral, transdermal, transmucosal and transnasal.
18. A method of inhibiting the onset of neuropathic pain in a
subject, comprising administering a neuropathic pain alleviating
amount of a prosaposin receptor agonist to the subject.
19. The method of claim 18, wherein the prosaposin receptor agonist
has from about 14 to 50 amino acids and comprises the amino acid
sequence LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.sub.3X.sub.1X.sub.1,
wherein: X.sub.1 is any amino acid; X.sub.2 is any amino acid, but
not L or R; X.sub.3 is a charged amino acid; and X.sub.4, when
present, is a charged amino acid.
20. The method of claim 19, wherein
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.su- b.3X.sub.1X.sub.1 has the
amino acid sequence shown in SEQ ID NO:2.
21. The method of claim 18, wherein the prosaposin receptor agonist
consists of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID
NO:2.
22. A method of stimulating neurite outgrowth, inhibiting neural
cell death, promoting myelination or inhibiting demyelination,
comprising: contacting neuronal cells with a composition comprising
an effective amount of a prosaposin receptor agonist, wherein the
prosaposin receptor agonist has from about 14 and 50 amino acids
and comprises the sequence shown in SEQ ID NO:2.
23. The method of claim 22, wherein the composition comprises a
peptide having the sequence shown in SEQ ID NO:2.
24. The method of claim 22, wherein the contacting is in vitro.
25. The method of claim 22, wherein the contacting is in vivo.
26. A method of inhibiting sensory or motor neuropathy, comprising:
contacting neuronal cells with a composition comprising an
inhibiting effective amount of a prosaposin receptor agonist.
27. The method of claim 26, wherein the prosaposin receptor agonist
has from about 14 to 50 amino acids and comprises the amino acid
sequence LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.sub.3X.sub.1X.sub.1,
wherein: X.sub.1 is any amino acid; X.sub.2 is any amino acid, but
not L or R; X.sub.3 is a charged amino acid; and X.sub.4, when
present, is a charged amino acid.
28. The method of claim 27, wherein
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.su- b.3X.sub.1X.sub.1 has the
amino acid sequence shown in SEQ ID NO:2.
29. The method of claim 26, wherein the prosaposin receptor agonist
is selected from the group consisting of SEQ ID NO:1 and SEQ ID
NO:2.
30. The method of claim 26, wherein the contacting is in vitro.
31. The method of claim 26, wherein the contacting is in vivo.
Description
CLAIM OF PRIORITY
[0001] This application is a continuation-in-part of U.S. Ser. No.
08/611,307, filed on Mar. 5, 1996 and International application
PCT/US97/04143, filed Mar. 5, 1997.
FIELD OF THE INVENTION
[0002] This invention relates generally to the field of pain
therapy and more specifically to the use of prosaposin receptor
agonist for the treatment of neuropathic pain.
BACKGROUND OF THE INVENTION
[0003] Neuropathic pain results from injury to a nerve. In contrast
to the immediate pain (nociceptive pain) caused by tissue injury,
neuropathic pain can develop days or months after a traumatic
injury. Furthermore, while pain caused by tissue injury is usually
limited in duration to the period of tissue repair, neuropathic
pain frequently is long-lasting or chronic. Moreover, neuropathic
pain can occur spontaneously or as a result of stimulation that
normally is not painful.
[0004] The clinical causes of neuropathic pain are widespread and
include both trauma and disease. For example, traumatic nerve
compression or crush and traumatic injury to the brain or spinal
cord are common causes of neuropathic pain. Furthermore, most
traumatic nerve injuries also cause the formation of neuromas, in
which pain occurs as a result of aberrant nerve regeneration. In
addition, cancer-related neuropathic pain is caused when tumor
growth painfully compresses adjacent nerves, brain or spinal cord.
Neuropathic pain also is associated with diseases such as diabetes
or alcoholism.
[0005] Unfortunately, neuropathic pain frequently is resistant to
available drug therapies. In addition, current therapies have
serious side-effects including, for example, cognitive changes,
sedation, nausea and, in the case of narcotic drugs, addiction.
Many patients suffering from neuropathic pain are elderly or have
other medical conditions that particularly limit their tolerance of
the side-effects associated with available drug therapy. The
inadequacy of current therapy in relieving neuropathic pain without
producing intolerable side-effects frequently is manifest in the
depression and suicidal tendency of chronic pain sufferers.
[0006] Methods of alleviating neuropathic pain would improve the
quality of life for many people suffering from pain due to trauma
or disease. However, there currently are no effective drugs that
relieve neuropathic pain without undesirable side-effects such as
sedation and addiction. Thus, there is a need for methods of
alleviating neuropathic pain without producing undesirable
side-effects. The present invention satisfies this need and
provides related advantages as well.
SUMMARY OF THE INVENTION
[0007] The present invention provides a method of alleviating
neuropathic pain in a subject by administering a neuropathic pain
alleviating amount of a prosaposin receptor agonist to the subject.
For example, the invention provides a method of alleviating
neuropathic pain resulting from a disorder of peripheral nerve,
dorsal root ganglia, spinal cord, brainstem, thalamus or cortex in
a subject by administering a neuropathic pain alleviating amount of
a prosaposin receptor agonist having the amino acid sequence
Cys-Glu-Phe-Leu-Val-Lys-Glu-Val-Thr-Lys-Leu-Ile-Asp-Asn-Asn-
-Lys-Thr-Glu-Lys-Glu-Ile-Leu (SEQ ID NO:1) or
Thr-D-Ala-Leu-Ile-Asp-Asn-As- n-Ala-Thr-Glu-Glu-Ile-Leu-Tyr (SEQ ID
NO:2). In addition, the invention provides a method of inhibiting
the onset of neuropathic pain in a subject by administering a
neuropathic pain alleviating amount of a prosaposin receptor
agonist to the subject. The present invention also provides
prosaposin receptor agonists, prosaposin-derived peptides and the
use of these peptides for stimulating neurite outgrowth, inhibiting
neural cell death, promoting myelination and inhibiting neural
demyelination. In addition, there is provided a method of
inhibiting sensory or motor neuropathy by contacting neuronal cells
with a composition comprising a neuropathic pain alleviating amount
of a prosaposin receptor agonist.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1 shows the threshold of tactile allodynia before (time
0) and at various times after bolus injection of prosaposin-derived
22-mer peptide (SEQ ID NO: 1) in Chung model rats.
[0009] FIG. 2 shows the threshold of tactile allodynia before (time
0) and at various times after bolus injection of prosaposin-derived
14-mer peptide (SEQ ID NO:2) in Chung model rats.
[0010] FIG. 3 shows the sum flinches in response to 0.5% formalin
after intraperitoneal administration of prosaposin-derived 14-mer
peptide (SEQ ID NO:2) or saline in diabetic rats.
[0011] FIG. 4 shows the effects of prosaptide TX 14(A) on the
relief of neuropathy in a diabetic rat model. Prosaptide TX 14(A)
prevented hypoalgesia in streptozotocin (STZ)-diabetic rats
[0012] FIG. 5 shows the effects of diabetes and efficacy of a
peptide fragment of prosaposin in treating diabetic nerve
dysfunction. All three groups treated with prosaptide TX 14(A)
showed significant decreases in weight loss in a dose dependent
manner when compared to diabetic animals. Thermal response latency
was restored to control non-diabetic levels in animals treated with
200 and 1000 .mu.g prosaptide TX 14(A), while the 20 .mu.g
treatment group showed an intermediate response.
[0013] FIG. 6 shows the effects of diabetes and efficacy of a
peptide fragment of prosaposin in treating diabetic nerve
dysfunction. Diabetic animals treated with prosaptide TX 14(A) at
doses of 200 and 1000 .mu.g/kg body weight showed enhanced motor
nerve conduction velocities compared to the untreated diabetic
group and diabetic animals receiving 20 .mu.g/kg body weight. In
addition, all prosaptide TX 14(A)-treated rats showed a slower loss
of sensory nerve conduction velocity when compared to diabetic
unheated animals.
[0014] FIG. 7 shows that prosaptide TX 14(A) halts progressive
slowing of sensory conduction and reverses hyperalgesia in diabetic
rats. Prosaptide TX 14(A), given parenterally, reverses
hyperalgesia in the diabetic rat. The anti-hyperalgesic properties
of prosaptide are specific to diabetes rats rather than being a
general effect on the fomalin test per se.
DETAILED DESCRIPTION OF THE INVENTION
[0015] The present invention provides a method of alleviating
neuropathic pain in a subject by administering a neuropathic pain
alleviating amount of a prosaposin receptor agonist to the subject.
As disclosed herein, the method of the invention can alleviate
neuropathic pain in a subject within 30 minutes of administration.
Such a method is useful for alleviating neuropathic pain resulting
from a disorder of peripheral nerve, dorsal root ganglia, spinal
cord, brainstem, thalamus or cortex.
[0016] As used herein, the term "prosaposin receptor agonist"
refers to a molecule which binds to any site on a cell to which
prosaposin or a prosaposin-derived molecule can bind, and which
thereby acts to alter the cell's function in the manner that
prosaposin or a prosaposin-derived molecule acts. An agonist is any
molecule that improves the activity of a different molecule; e.g.,
a hormone, which acts as an agonist when it binds to its receptor,
thus triggering a biochemical response. A molecule that both binds
to receptors and has an intrinsic effect is an agonist. A receptor
agonist is a substance that mimics a specific hormone, is able to
attach to that hormone's receptor, and thereby produces the same
action that the hormone usually produces. Drugs are often designed
as receptor agonists to treat diseases and disorders caused when
the hormone is missing or depleted in a subject.
[0017] As used herein, the term "prosaposin receptor" refers to a
site on a cell to which prosaposin or a prosaposin-derived molecule
can bind, thereby acting to alter the cell's function. Prosaposin
receptors may be cell surface proteins, other cell proteins, or
glycosphingolipids. One putative prosaposin receptor protein is a
54-60 kilodalton (kDa) protein isolated from whole rat brain, rat
cerebellum and mouse neuroblastoma cells using the plasma membrane
P-100 fraction. The 54-60 kDa protein binds irreversibly to saposin
C, a prosaposin derivative. The isolation of the putative
prosaposin receptor is described in EXAMPLES XI and XII.
[0018] Prosaposin receptors may also be membrane lipids called
glycosphingolipids. Glycosphingolipids are sphingolipids that have
a carbohydrate head group and two hydrocarbon chains; one a fatty
acid and the other a sphingosine derivative. Glycosphingolipids are
important components of the myelin sheath, a structure which
protects and insulates nerve fibers. Prosaposin binds
glycosphingolipids such as gangliosides, cerebrosides and
sulfatides with high affinity and facilitates their transfer from
micelles to membranes (Sueda et al. J. Biol. Chem. (1993); Hiraiwa
et al., Proc. Natl. Acad. Sci. USA., 89: 11254-11258(1992)).
Gangliosides contain one or more sialic acid residues and are most
abundant in the plasma membrane of neurons where they constitute
approximately 6% of the total lipid mass. Although the function of
gangliosides is largely unknown, they have been implicated in the
stimulation of neuronal differentiation, neuritogenesis and nervous
system repair.
[0019] In one embodiment, prosaposin receptor agonists may be
prosaposin-derived peptides. As used herein, the term "active
fragment of prosaposin" is synonymous with "prosaposin-derived
peptide". A peptide useful in the invention is derived from
prosaposin, which is a 517 amino acid protein originally identified
as the precursor of four sphingolipid activator proteins (Kishimoto
et al., J. Lipid Res., 33:1255-1267 (1992)). Four adjacent tandem
domains inprosaposin are proteolytically processed in lysosomes to
generate saposins A, B, C, and D, which activate hydrolysis of
glycosphingolipids by lysosomal hydrolases (O'Brien and Kishimoto,
FASEB J., 5:301-308 (1991)).
[0020] The unprocessed form of prosaposin is found in high
concentrations in human and rat brain, where it is localized within
neuronal surface membranes. During embryonic development,
prosaposin mRNA is abundant in brain and dorsal root ganglia.
Furthermore, prosaposin binds with high affinity to gangliosides,
which stimulate neurite outgrowth, and promotes transfer of
gangliosides from micelles to membranes.
[0021] The neurotrophic activity of prosaposin is consistent with
its localization in neuronal cell populations (O'Brien et al.,
Proc. Natl. Acad. Sci., USA 91:9593-9596(1994); Sanoetal., Biochem.
Biophys. Res. Commun., 204:994-1000 (1994)). Prosaposin stimulates
motor neurite outgrowth in vitro and in vivo and increases choline
acetyltransferase activity, which is a marker of neuronal
differentiation. In addition, prosaposin prevents cell death in
neuroblastoma cells (O'Brien et al., supra, 1994; O'Brien et al.,
FASEB J. 9: 681-685 (1995)).
[0022] The neurotrophic activity of prosaposin is localized to
saposin C, a domain of 80 amino acids. A 22-mer peptide
corresponding to amino acids 8 to 29 of the saposin C domain (SEQ
ID NO: 1) stimulates neurite outgrowth and choline
acetyltransferase activity and prevents cell death in neuroblastoma
cells (O'Brien et al., supra, 1995).
[0023] Prosaposin or the prosaposin-derived 22-mer peptide (SEQ ID
NO: 1), for example, can modulate motor neuron function by
promoting neurite outgrowth. Prior to the present invention,
however, it was not known whether prosaposin or a peptide fragment
of prosaposin could affect sensory neuron function. Moreover, the
neurotrophic activity of prosaposin or a prosaposin-derived peptide
in stimulating motor neurite outgrowth is evident only after a
period of 24 to 48 hours (see, for example, O'Brien et al., supra
(1994)). Neurotrophic activity of prosaposin or a
prosaposin-derived peptide has not been demonstrated to occur in a
shorter period of time.
[0024] In contrast, the present invention provides a method of
alleviating neuropathic pain, which involves both sensory and motor
neuron components. Furthermore, the method of the invention is
effective in inhibiting or alleviating neuropathic pain in a matter
of minutes rather than the hours or days previously demonstrated to
be required for the neurotrophic activity of prosaposin or a
prosaposin-derived peptide.
[0025] The effectiveness of the method of the invention in
alleviating neuropathic pain was demonstrated using the
well-recognized Chung rat model of peripheral neuropathy. In the
Chung rat model, spinal nerve partial ligation of left spinal
nerves L-5 and L-6 produces a long-lasting hypersensitivity to
light pressure on the affected left foot. The hypersensitivity is
similar to the pain experienced by humans with the neuropathic
condition of causalgia as described in Kim and Chung, Pain
50:355-363 (1992).
[0026] Prior to administration of an active fragment of prosaposin,
Chung model rats had a threshold of 3.0 to 4.0 g before the
affected foot was withdrawn in response to pressure (Von Frey
hairs) (see FIG. 1). After administration of an active fragment of
prosaposin (prosaposin-derived 22-mer; SEQ ID NO:1), neuropathic
pain was alleviated, as evidenced by a greater tolerance to
pressure before the affected foot was withdrawn. The effect of the
active fragment of prosaposin occurred within 15 minutes and was
sustained for 3 hours following administration as shown in FIG. 1.
This rapid relief of neuropathic pain is in stark contrast to the
delayed neurotrophic effects previously reported for prosaposin and
peptides derived from prosaposin.
[0027] A prosaposin receptor agonist such as the prosaposin-derived
peptide SEQ ID NO:2 also alleviated pain in a rat model of painful
diabetic neuropathy. As described in EXAMPLE III, peptide SEQ ID
NO:2 reduced allodynia in rats with short-term insulin-deficient
diabetes induced by the selective .beta. cell toxin, streptozotocin
(STZ). Thus, a prosaposin receptor agonist of the invention can be
used to alleviate a variety of types of neuropathic pain including
mechanical pain, as exemplified by the Chung rat model, and
metabolic pain, as exemplified by the use of these peptides in
reducing pain in diabetic rats.
[0028] As used herein, the term "neuropathic pain" means pain
resulting from injury to a nerve. Neuropathic pain is distinguished
from nociceptive pain, which is the pain caused by acute tissue
injury involving small cutaneous nerves or small nerves in muscle
or connective tissue. Pain involving a nociceptive mechanism
usually is limited in duration to the period of tissue repair and
generally is alleviated by available analgesic agents or opioids as
described in Myers, Regional Anesthesia 20:173-184 (1995).
[0029] Neuropathic pain typically is long-lasting or chronic and
often develops days or months following an initial acute tissue
injury. Neuropathic pain can involve persistent, spontaneous pain
as well as allodynia, which is a painful response to a stimulus
that normally is not painful. Neuropathic pain also can be
characterized by hyperalgesia, in which there is an accentuated
response to a painful stimulus that usually is trivial, such as a
pin prick. Unlike nociceptive pain, neuropathic pain generally is
resistant to opioid therapy (Myers, supra (1995)).
[0030] The method of the invention is useful in alleviating
neuropathic pain resulting from a disorder of peripheral nerve,
dorsal root ganglia, spinal cord, brainstem, thalamus or cortex. As
used herein, the term "disorder" means any trauma, injury, disease
or condition resulting in neuropathic pain.
[0031] The method of the invention is useful in alleviating
neuropathic pain regardless of the etiology of the pain. For
example, a method of the invention can be used to alleviate
neuropathic pain resulting from a peripheral nerve disorder such as
neuroma; nerve compression; nerve crush, nerve stretch or
incomplete nerve transsection; mononeuropathy or polyneuropathy. A
method of the invention also can be used to alleviate neuropathic
pain resulting from a disorder such as dorsal root ganglion
compression; inflammation of the spinal cord; contusion, tumor or
hemisection of the spinal cord; tumors of the brainstem, thalamus
or cortex; or trauma to the brainstem, thalamus or cortex (see, for
example, TABLE 1).
[0032] The method of the invention can be useful, for example, to
alleviate neuropathic pain resulting from a neuroma, which can
develop readily after traumatic injury to nerve, especially when a
whole nerve is severely crushed or transsected. In a neuroma, the
neurite outgrowth that normally regenerates a peripheral nerve is
aberrant or misguided due, for example, to a physical obstruction
such as scar tissue. Thus, a regenerating nerve fiber is entangled
in an environment in which mechanical and physical factors
precipitate abnormal electrophysiologic activity and pain (Myers,
supra (1995)). An amputation neuroma, for example, can cause
phantom pain or can cause pain triggered by the use of a limb
prosthesis. As disclosed herein, such neuropathic pain can be
alleviated by administration of a prosaposin receptor agonist
according to a method of the invention.
[0033] Nerve compression also results in neuropathic pain that can
be treated using the method of the
1 TABLE 1 Nerve Neuroma (amputation, nerve transsection) Nerve
compression (entrapment neuropathies, tumors) Nerve crush, stretch
or incomplete transsection (trauma) Mononeuropathy Diabetes
mellitus Irradiation Ischemia Vasculitis Polyneuropathy Post-polio
syndrome Diabetes mellitus Alcohol Amyloid Toxic HIV Hypothyroidism
Uremia Vitamin deficiencies Chemotherapy (vincristine, cisplatinum,
paclitaxel) ddC (zalcitabine) Fabry's disease Dorsal root ganglion
Compression (disk, tumor, scar tissue) Root avulsion Inflammation
(postherpetic neuralgia) Spinal cord Contusion Tumor Hemisection
Brainstem, thalamus, cortex Infarction, tumors, trauma
[0034] invention. Nerve compression can be abrupt, as in the case
of traumatic nerve crush, or can be prolonged and moderate,
secondary to tumor growth or scar formation in the proximity of a
major nerve bundle. Compression neuropathy can occur as a result of
changes in blood flow to a nerve, causing severe ischemia and
consequent nerve injury (Myers, supra (1995)).
[0035] Administration of a prosaposin receptor agonist according to
the method of the invention also can alleviate neuropathic pain
resulting from a mononeuropathy or polyneuropathy. As used herein,
a neuropathy is a functional disturbance or pathological change in
the peripheral nervous system and is characterized clinically by
sensory or motor neuron abnormalities. The term mononeuropathy
indicates that a single peripheral nerve is affected, while the
term polyneuropathy indicates that several peripheral nerves are
affected. The etiology of a neuropathy can be known or unknown
(see, for example, Myers, supra (1995); Galer, Neurology 45(suppl
9):S17-S25 (1995); Stevens and Lowe, Pathology, Times Mirror
International Publishers Limited, London (1995)). Known etiologies
include complications of a disease or toxic state; for example,
diabetes is the most common metabolic disorder causing neuropathy.
The method of the invention alleviates the neuropathic pain of a
mononeuropathy resulting, for example, from diabetes, irradiation,
ischemia or vasculitis. The method of the invention also alleviates
the neuropathic pain of a polyneuropathy resulting, for example,
from post-polio syndrome, diabetes, alcohol, amyloid, toxins, HIV,
hypothyroidism, uremia, vitamin deficiencies, chemotherapy, ddC or
Fabry's disease (see TABLE 1). The method of the invention
particularly is useful in alleviating post-polio myalgia. The
method of the invention also can alleviate neuropathic pain of
unknown etiology.
[0036] As disclosed herein, a prosaposin receptor agonist, for
example, an active fragment of prosaposin, also can be useful in
alleviating neuropathic pain or in stimulating neurite outgrowth,
inhibiting neural cell death, promoting myelination or inhibiting
demyelination or in inhibiting sensory neuropathy. The term "active
fragment of prosaposin," as used herein, means a peptide that has
an amino acid sequence corresponding to an amino acid sequence of
prosaposin and that has activity in alleviating neuropathic pain or
in stimulating neurite outgrowth, inhibiting neural cell death,
promoting myelination or inhibiting demyelination or in inhibiting
sensory or motor neuropathy.
[0037] As used herein, the term "inhibiting neuropathic pain" or
"alleviating neuropathic pain" refers to any diminution in the
severity of neuropathic pain. In a human subject, a prosaposin
receptor agonist reduces the severity of neuropathic pain such that
the subject's suffering is diminished and quality of life is
improved. A prosaposin receptor agonist, for example, an active
fragment of prosaposin, also can alleviate neuropathic pain in
anyone of a number of well-established animal models of neuropathic
pain as described further below (also see Bennett, Muscle &
Nerve 16:1040-1048 (1993)). As used herein, the term "active
fragment of prosaposin" is synonymous with "prosaposin-derived
peptide".
[0038] In one embodiment, the prosaposin receptor agonist useful in
the invention is a prosaposin receptor agonist of 14 to 50 amino
acids which has the amino acid sequence
LIRX.sub.1NNX.sub.2TX.sub.3X.sub.4X.sub.3X.su- b.1X.sub.1, where
X.sub.1 is any amino acid; X.sub.2 is any amino acid, but not L or
R; X.sub.3 is a charged amino acid; and X.sub.4, when present, is a
charged amino acid.
[0039] The prosaposin receptor agonist preferably contains the
amino acid sequence Leu-Ile-Asp-Asn-Asn-Lys-Thr-Glu-Lys-Glu-Ile-Leu
(SEQ ID NO:3), which corresponds to amino acids 18 to 29 of saposin
C. More preferably, an active fragment of prosaposin has the amino
acid sequence
Cys-Glu-Phe-Leu-Val-Lys-Glu-Val-Thr-Lys-Leu-Ile-Asp-Asn-Asn-Lys-Thr-Glu-L-
ys-Glu-Ile-Leu (SEQ ID NO:1), which corresponds to amino acids 8 to
29 of saposin C, or the amino acid sequence
Thr-D-Ala-Leu-Ile-Asp-Asn-Asn-Ala-T- hr-Glu-Glu-Ile-Leu-Tyr (SEQ ID
NO:2), which corresponds to amino acids 16 to 29 of saposin C but
which has been modified by a D-alanine for lysine substitution at
position 2; an alanine for lysine substitution at position 8; a
deletion of lysine at position 11 and the addition of a C-terminal
tyrosine residue (see TABLE 2). Such modifications can be useful
for increasing peptide stability or uptake across the blood-brain
barrier as described below. As used herein, D-alanine can be
represented by D-Ala or X.
[0040] An active fragment of prosaposin can have about 12 amino
acids to about 80 amino acids, which is the full-length of saposin
C. Preferably, an active fragment of prosaposin has about 12 amino
acids to about 40 amino acids and, more preferably, about 14 amino
acids to about 22 amino acids.
2TABLE 2 PEPTIDE SEQUENCE SEQ ID NO: Prosaposin-derived 22-mer
CEFLVKEVTKLIDNNKTEKEIL 1 Prosaposin-derived 14-mer TXLIDNNATE-EILY
2 Prosaposin-derived 12-mer LIDNNKTEKEIL 3 where X = D-alanine
[0041] For use in alleviating neuropathic pain in a human subject,
an active fragment of human prosaposin, such as SEQ ID NO:1 or SEQ
ID NO:2, is preferred. However, an active fragment derived from
another mammalian prosaposin also is useful in alleviating
neuropathic pain according to the method of the invention. Thus,
for example, an active fragment of mouse prosaposin, rat
prosaposin, guinea pig prosaposin or bovine prosaposin such as SEQ
ID NOS: 4 through 7 also can be useful in alleviating neuropathic
pain in a subject.
[0042] The amino acid sequence of an active fragment of human
prosaposin (SEQ ID NO:1), which corresponds to amino acids 8 to 29
of saposin C, is well conserved among other species, as shown in
TABLE 3. In particular, adjacent asparagine (N) residues are
conserved among human, mouse, rat, guinea pig and bovine
prosaposins. In addition, a leucine (L) residue is conserved 3 to 4
residues toward the N-terminus of the two asparagine residues and
one or more charged residues (aspartic acid (D), lysine (K),
glutamic acid (E) or arginine (R)) are conserved 2 to 8 residues
toward the C-terminus of the two asparagine residues. Each of these
well-conserved residues is underlined in TABLE 3.
3TABLE 3 SPECIES SEQUENCE SEQ ID NO. Human CEFLVKEVTKLIDNNKTEKEIL 1
Mouse CQFVMNKFSELIVNNATE-ELLY 4 Rat CQLVNRKLSELIINNATE-ELL 5 Guinea
Pig CEYVVKKVMLLIDNNRTEEKII 6 Bovine CEFVVKEVAKLIDNNRTEEEIL 7
[0043] The well-conserved adjacent asparagine residues, leucine
residue and charged residues described above can be important for
the activity of an active fragment of prosaposin in alleviating
neuropathic pain or in stimulating neurite outgrowth, inhibiting
neural cell death, promoting myelination or inhibiting
demyelination or in inhibiting or motor neuropathy. For example,
the prosaposin-derived 22-mer (SEQ ID NO:1) or the
prosaposin-derived 14-mer (SEQ ID NO:2) is a prosaposin receptor
agonist, an active fragment of prosaposin, which reduces the
painful allodynia seen in the Chung rat model of peripheral
neuropathy, as disclosed in EXAMPLE I (see FIGS. 1 and 2). In
contrast, a mutant 22-mer (SEQ ID NO:8), which differs from SEQ ID
NO:1 in having an aspartic acid residue (D) in place of the first
conserved asparagine (see TABLE 4), lacks activity in alleviating
neuropathic pain as assayed using Chung rats (see EXAMPLE I).
4TABLE 4 PEPTIDE SEQUENCE SEQ ID NO: Prosaposin-derived 22-mer
CEFLVKEVTKLIDNNKTEKEIL 1 Mutant 22-mer CEFLVKEVTKLIDDNKTEKEIL 8
Prosaposin-derived 14-mer TXLIDNNATE-EILY 2 Mutant 14-mer M-1
TKLIDNDKTEKEIL 9 Mutant 14-mer M-2 TKSIDNNKTEKEIL 10 where X =
D-alanine
[0044] The activity of a peptide in alleviating neuropathic pain
also can correlate with neurotrophic activity. For example, the
prosaposin-derived 22-mer (SEQ ID NO:1) and the prosaposin-derived
14-mer (SEQ ID NO:2) alleviate neuropathic pain and have
neurotrophic activity. In addition, the mutant 22-mer (SEQ ID NO:8)
is inactive in alleviating neuropathic pain as described above and
lacks neurotrophic activity, further indicating that activity in
alleviating neuropathic pain can correlate with neurotrophic
activity. The mutant 14-mer peptide M-1 (SEQ ID NO:9), which has a
substitution of the second conserved asparagine residue, lacks
neurotrophic activity, indicating that peptide SEQ ID NO:9 also is
inactive in alleviating neuropathic pain. The mutant 14-mer peptide
M-2 (SEQ ID NO:10), which has a substitution of the conserved
leucine residue, lacks neurotrophic activity, indicating that
peptide SEQ ID NO:10 is inactive in alleviating neuropathic pain.
In contrast, the prosaposin-derived 12-mer peptide (SEQ ID NO:3),
which has the conserved adjacent asparagines, leucine and charged
residues described above, is active as a neurotrophic factor. Thus,
the prosaposin-derived 12-mer peptide (SEQ ID NO:3) also can
alleviate neuropathic pain according to the method of the
invention.
[0045] Prosaposin receptor agonists, including prosaposin-derived
peptides and neurotrophic analogs thereof, possess significant
therapeutic applications in promoting functional recovery after
toxic, traumatic, ischemic, degenerative or inherited lesions to
the peripheral or central nervous system. In addition, these
peptides can promote myelination or inhibit demyelination, thereby
counteracting the effects of demyelinating diseases. Furthermore,
such peptides stimulate the outgrowth of neurons and inhibit
programmed cell death in neuronal tissues. The active neurotrophic
and myelinotrophic peptides of the invention have between about 12
or 14 and about 50 amino acids and preferably include the
non-naturally occurring prosaposin sequence shown in SEQ ID NO:2.
For example, the active neurotrophic and myelinotrophic peptides of
the invention have between 14 and about 50 amino acids and include
the non-naturally occurring prosaposin sequence shown in SEQ ID
NO:2.
[0046] In another embodiment of the present invention, there is
provided a method of stimulating neurite outgrowth, inhibiting
neural cell death, promoting myelination or inhibiting
demyelination in differentiated or undifferentiated neuronal cells
by administering to the neuronal cells an effective amount of a
neurite outgrowth or myelin-facilitating peptide having between
about 12 and about 50 amino acids and preferably including the
peptide shown in SEQ ID NO:2. In the methods of the invention for
stimulating neurite outgrowth, inhibiting neural cell death,
promoting myelination or inhibiting demyelination, an effective
amount of a peptide having, for example, between 14 and about 50
amino acids and including the peptide shown in SEQ ID NO:2 can be
used.
[0047] As used herein, the term "stimulating neurite outgrowth"
refers to inducing or increasing the outgrowth of neural processes
from neural cells. Neurite outgrowth may occur in differentiated or
undifferentiated neural cells. For example, in differentiated
cells, neurite outgrowth may be from from dorsal root ganglion
explants, sympathetic ganglia explants, or nodose ganglion
explants. Neurite outgrowth responses may also occur in
neoroblastoma cells, such as NS20Y neuroblastoma cells or PC 12
pheocromocytoma cells. As used herein, the term "inhibiting neural
cell death" refers to the inhibition of the death of neural cells.
Necrosis and apoptosis are two basic processes by which cells may
die. In necrosis, cell death usually is a result of cell injury.
The cells generally swell and lyse. The cell contents ultimately
spill into the extracellular space. By contrast, apoptosis is a
mode of cell death in which single cells are deleted in the midst
of living tissues. Apoptosis accounts for most of the programmed
cell death in tissue remodeling and for the cell loss that
accompanies atrophy of adult tissues following withdrawal of
endocrine and other growth stimuli. As used herein, the term
"promoting myelination" refers to promoting the formation of a
myelin sheath, a sheath of white, fatty protein (myelin) that
covers and acts as an electrical insulator for nerve fibers.
Oligodendrocytes form myelin in the central nervous system. Schwann
cell form myelin in the peripheral nervous system. As used herein,
the term "inhibiting demyelination" refers to the inhibition of the
destruction of myelin sheaths that surrounds nerve fibers, which
results in the loss of function of those nerves. In several
diseases, the body attacks its own nervous system, destroying the
myelin sheath that protects the nerve cells. This demyelination
prevents the nerves from carrying signals properly, and afflicted
persons can experience problems with muscular coordination, vision
and other sensory problems, and paralysis. Several diseases that
result in demyelination of nerve fibers include multiple sclerosis,
acute disseminated leukoencephalitis, progressive multifocal
leukoencephalitis, metachromatic leukodystrophy and adrenal
leukodystrophy.
[0048] The ability of any such peptide to stimulate neurite
outgrowth, inhibit neural cell death, promote myelination or
inhibit demyelination readily can be determined by one skilled in
the art using the procedures described in EXAMPLES IV to VII.
Methods for assaying the abilities of these peptides to promote
myelination and to inhibit demyelination are set forth in EXAMPLES
VI and VII below.
[0049] The present invention also provides a method of inhibiting
sensory neuropathy by contacting neuronal cells with a composition
comprising an effective inhibiting amount of a prosaposin receptor
agonist, for example, an active fragment of prosaposin. The
invention provides, for example, a method of inhibiting sensory
neuropathy by contacting neuronal cells with a composition
comprising an effective inhibiting amount of a peptide having the
sequence shown as SEQ ID NO:1 or SEQ ID NO:2.
[0050] As described herein in EXAMPLE X, a prosaposin-derived
peptide can be useful in inhibiting sensory neuropathy. In a mouse
model in which sensory neuropathy is induced by taxol
administration, a loss of thermal sensation is normally seen.
However, in taxol-treated mice given 100 .mu.g/kg of peptide SEQ ID
NO: 1, the loss of thermal sensation was inhibited. These results
indicate that prosaposin-derived peptides can be a neurotrophic
factor for both sensory and motor neurons.
[0051] A peptide useful in the methods of the invention also can
be, for example, SEQ ID NOS:11 through 19 (see TABLE 5). For
example, sequence alignment of the prosaposin-derived 22-mer
peptide SEQ ID NO:1 with cytokines and growth factors indicates
sequence similarity to a number of human (h) cytokines including
hCNTF, hIL-6, hIL-2, hIL-3, hIL-.gamma., erythropoietin (hEPO),
human leukocyte inhibitory factor (hLIF), the hIL-1 .beta.chain and
oncostatin-M (hONC-M). SEQ ID NOS:11 through 19, like the active
fragment of prosaposin SEQ ID NO:1, contain two asparagine residues
that are adjacent or separated by one amino acid. In addition, the
cytokine-derived peptide sequences can contain a leucine (L) or
isoleucine (I) residue three to four residues toward the N-terminus
of the two asparagine residues and one or more charged residues
(aspartic acid (D), lysine (K), glutamic acid (E), or arginine (R))
two to eight residues toward the C-terminus of the two asparagine
residues, as is seen in the active fragment of prosaposin (22-mer;
SEQ ID NO:1). Each of these residues is underlined in TABLE 5.
[0052] Models of cytokine-receptor binding (Sprang and Bazan, Curr.
Opin. Struct. Biol., 3:816 (1993)) have highlighted the
evolutionary conservation of a four-helical bundle structure common
to many cytokines. Each of the cytokine or growth-factor sequences
related to the prosaposin-derived sequence SEQ ID NO:1 is located
between helices A and B (AB loop) or within helix C of the
cytokine.
5TABLE 5 CYTOKINE SEQUENCE LOCATION SEQ ID NO: Prosaposin
CEFLVKEVTKLIDNNKTEKEIL -- 1 hCNTF YVKHQGLNKNINLDSVDGVP AB loop 11
hIL-6 EALAENNLNLPKMAG AB loop 12 hIL-2 LQMILNGINNYKNPKLT AB loop 13
hIL-3 ILMENNLRRPNL AB loop 14 hIL1-.gamma. FYLRNNQLVAGTL AB loop 15
hEPO AEHCSLNENITVPDTKV AB loop 16 hLIF YTAQGEPFPNNVEKLCAP AB loop
17 hIL-1.beta. FNKIEINNKLEFESA Helix C 18 hONC-M RPNIGLRNNIYCMAQLL
Helix C 19
[0053] The structurally related cytokine and growth factor-derived
peptides SEQ ID NOS:11 through 19 also can be useful in methods of
alleviating neuropathic pain. Peptides SEQ ID NOS:11 through 19 can
be assayed for activity in alleviating neuropathic pain using, for
example, the Chung rat model described in EXAMPLE I; a model of
diabetic neuropathy as described in EXAMPLE III assays described by
Wall et al., Pain 7:103-113 (1979); Bennett and Xie, Pain 33:87-107
(1988); Lekan et al., Soc. Neurosci. Abstr. 18:287 (1992) or
Palacek et al., Soc. Neurosci. Abstr. 18:287 (1992); or other
assays for neuropathic pain.
[0054] The cytokine and growth factor-derived peptides SEQ ID
NOS:11 through 19 also can be useful in methods of stimulating
neurite outgrowth, inhibiting neural cell death, promoting
myelination or inhibiting demyelination or in methods of inhibiting
sensory or motor neuropathy. A peptide having between about 14 and
about 50 amino acids and including the active neurotrophic region
contained within one of sequences SEQ ID NOS:11 through 19 can be
assayed for the ability to stimulate neurite outgrowth as described
in EXAMPLE IV; or assayed for the ability to inhibit neural cell
death as described in EXAMPLE V; or for the ability to promote
myelination as described in EXAMPLE VI; or for the ability to
inhibit demyelination as described in EXAMPLE VII; or for the
ability to inhibit sensory neuropathy as described in EXAMPLE
X.
[0055] A prosaposin receptor agonist useful in alleviating
neuropathic pain can be identified by screening a large collection,
or library, of random peptides or peptides of interest using, for
example, one of a number of animal models of neuropathic pain. Such
prosaposin receptor agonists of interest can be, for example, the
cytokine and growth factor-derived peptides SEQ ID NOS:11 through
19, which have amino acid sequences related to an active fragment
of prosaposin (SEQ ID NO:1). Peptides of interest also can be, for
example, a population of peptides related in amino acid sequence to
SEQ ID NO:1 by having the conserved asparagine residues,
leucine/isoleucine residue and one or more charged residues at the
positions corresponding to the positions in which these residues
are found in SEQ ID NO:1 but also having one or more amino acids
that differ from the amino acids of SEQ ID NO:1.
[0056] Peptide libraries include, for example, tagged chemical
libraries comprising peptides and peptidomimetic molecules. Peptide
libraries also comprise those generated by phage display
technology. Phage display technology includes the expression of
peptide molecules on the surface of phage as well as other
methodologies by which a protein ligand is or can be associated
with the nucleic acid which encodes it. Methods for the production
of phage display libraries, including vectors and methods of
diversifying the population of peptides which are expressed, are
well known in the art (see, for example, Smith and Scott, Methods
Enzymol. 217:228-257 (1993); Scott and Smith, Science 249:386-390
(1990), and Huse, WO 91/07141 and WO 91/07149). These or other well
known methods can be used to produce a phage display library, from
which the displayed peptides can be cleaved and assayed for
activity in alleviating neuropathic pain or other neurotrophic or
myelinotrophic activity as described herein. If desired, a
population of peptides can be assayed for activity, and an active
population can be subdivided and the assay repeated in order to
isolate an active peptide from the population. Other methods for
producing peptides useful in the invention include, for example,
rational design and mutagenesis based on the amino acid sequences
of active fragments of prosaposin such as SEQ ID NO:1 and SEQ ID
NO:2, for example.
[0057] As disclosed herein, a prosaposin receptor agonist useful in
alleviating neuropathic pain can be identified by its activity in
alleviating neuropathic pain in any of a number of well-established
animal models of neuropathic pain (Bennett, supra (1993)). For
example, a prosaposin receptor agonist can be identified using an
experimental model of peripheral neuropathy produced by segmental
spinal nerve ligation in the rat. The Chung rat model duplicates
the symptoms of human patients with causalgia, or burning pain due
to injury of a peripheral nerve (Kim and Chung, supra (1992)). The
surgical procedure of Kim and Chung produces a long-lasting
hyperalgesia to noxious heat and mechanical allodynia of the
affected foot. As described in EXAMPLE I, rats with spinal nerve
ligation according to the procedure developed by Chung and Kim are
useful for identifying a prosaposin receptor agonist for use in
alleviating neuropathic pain.
[0058] A prosaposin receptor agonist useful in alleviating
neuropathic pain also can be identified by its activity in
alleviating neuropathic pain in a rat model of painful diabetic
neuropathy. Hyperalgesia to thermal, mechanical and chemical
noxious stimuli also has been reported in diabetic rats with
short-term insulin-deficient diabetes induced by selective p cell
toxins such as streptozotocin (Calcutt et al., Pain
68:293-299(1996)). Such a rat model is representative of the pain
evidenced in diabetic humans, who may exhibit a variety of aberrant
sensations including spontaneous pain, pain evoked by light touch
and hyperalgesia. Rats treated with streptozotocin or another
selective p cell toxin can be treated with a fragment or peptide of
interest; subsequently, the response to a noxious stimulus such as
0.5% formalin is measured. A reduced response can be used to
identify a prosaposin receptor agonist useful in alleviating
neuropathic pain.
[0059] A prosaposin receptor agonist useful in alleviating
neuropathic pain also can be identified using the neuroma model of
Wall et al. This well-recognized model of neuropathic pain
reproduces the human symptoms seen following amputation or nerve
transection in an intact limb (Wall et al., supra (1979)). As
discussed above, a neuroma forms readily after nerve transection
due to the frustrated growth of neurite sprouts.
[0060] A model of chronic constriction injury also can be used to
identify a prosaposin receptor agonist useful in alleviating
neuropathic pain. The chronic constriction injury model of Bennett
and Xie, supra (1988) is a rat model of peripheral neuropathy that
produces pain disorders like those seen in man. In the Bennett
model, nerve injury is created by loosely tying constrictive
ligatures around the rat sciatic nerve, causing degeneration of
nerve distal to the constriction. Allodynia and hyperalgesia are
produced by the constriction injury in addition to spontaneous
pain.
[0061] Primate models of neuropathic pain also are useful for
identifying a prosaposin receptor agonist (see, for example, Lekan
et al., supra (1992); Palacek et al., supra (1992)).
[0062] As used herein, the term "peptide," as used in reference to
an active fragment of prosaposin, a prosaposin-derived peptide or a
peptide useful in the methods of the invention, means a compound
containing naturally occurring amino acids, non-naturally occurring
amino acids or chemically modified amino acids, provided that the
compound retains activity in alleviating neuropathic pain or other
neurotrophic or myelinotrophic activity as described herein. A
prosaposin receptor agonist also can be a peptide mimetic, which is
a non-amino acid chemical structure that mimics the structure of a
prosaposin-derived peptide and retains activity. Such a mimetic
generally is characterized as exhibiting similar physical
characteristics such as size, charge or hydrophobicity in the same
spatial arrangement found in the prosaposin-derived peptide
counterpart. A specific example of a peptide mimetic is a compound
in which the amide bond between one or more of the amino acids is
replaced, for example, by a carbon-carbon bond or other bond well
known in the art (see, for example, Sawyer, Peptide Based Drug
Design, ACS, Washington (1995)).
[0063] As used herein, the term "amino acid" refers to one of the
twenty naturally occurring amino acids, including, unless stated
otherwise, L-amino acids and D-amino acids. The term amino acid
also refers to compounds such as chemically modified amino acids
including amino acid analogs, naturally occurring amino acids that
are not usually incorporated into proteins such as norleucine, and
chemically synthesized compounds having properties known in the art
to be characteristic of an amino acid, provided that the compound
can be substituted within a peptide such that it retains its
biological activity. For example, glutamine can be an amino acid
analog of asparagine, provided that it can be substituted within an
active fragment of prosaposin that retains its activity in
alleviating neuropathic pain or other neurotrophic or
myelinotrophic activity as described herein. Other examples of
amino acids and amino acids analogs are listed in Gross and
Meienhofer, The Peptides: Analysis, Synthesis, Biology, Academic
Press, Inc., New York (1983). An amino acid also can be an amino
acid mimetic, which is a structure that exhibits substantially the
same spatial arrangement of functional groups as an amino acid but
does not necessarily have both the .alpha.-amino and
.alpha.-carboxyl groups characteristic of an amino acid.
[0064] A prosaposin receptor agonist can be isolated or synthesized
using methods well known in the art. Such methods include
recombinant DNA methods and chemical synthesis methods for
production of a peptide. Recombinant methods of producing a peptide
through expression of a nucleic acid sequence encoding the peptide
in a suitable host cell are well known in the art and are
described, for example, in Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd Ed., Vols. 1 to 3, Cold Spring Harbor
Laboratory Press, New York (1989).
[0065] A prosaposin receptor agonist useful in the invention also
can be produced by chemical synthesis, for example, by the solid
phase peptide synthesis method of Merrifield et al., J. Am. Chem.
Soc. 85:2149 (1964). Standard solution methods well known in the
art also can be used to synthesize a peptide useful in the
invention (see, for example, Bodanszky, Principles of Peptide
Synthesis, Springer-Verlag, Berlin (1984) and Bodanszky, Peptide
Chemistry, Springer-Verlag, Berlin (1993)). A newly synthesized
peptide can be purified, for example, by high performance liquid
chromatography (HPLC), and can be characterized using, for example,
mass spectrometry or amino acid sequence analysis.
[0066] It is understood that limited modifications can be made to
an active fragment of prosaposin without destroying its biological
function. Thus, a modification of an active fragment of prosaposin
that does not destroy its ability to alleviate neuropathic pain is
within the definition of a prosaposin receptor agonist. A
modification can include, for example, an addition, deletion, or
substitution of amino acid residues; a substitution of a compound
that mimics amino acid structure or function; and addition of
chemical moieties such as amino or acetyl groups. The activity of a
modified peptide in alleviating neuropathic pain can be assayed
using an animal model of neuropathic pain, such as those described
above or the assay exemplified in EXAMPLE I.
[0067] A particularly useful modification of a prosaposin receptor
agonist is one that confers, for example, increased stability. For
example, incorporation of one or more D-amino acids or substitution
or deletion of lysine can increase the stability of an active
fragment of prosaposin by protecting against peptide degradation.
For example, as disclosed herein, the prosaposin-derived 14-mer SEQ
ID NO:2 has an amino acid sequence derived from amino acids 16 to
29 of saposin C but which has been modified by substitution or
deletion of each of the three naturally occurring lysines and the
addition of a C-terminal tyrosine residue. In particular, the
prosaposin-derived 14-mer SEQ ID NO:2 has a D-alanine for lysine
substitution at position 2; an alanine for lysine substitution at
position 8 and a deletion of lysine at position 11. The D-alanine
substitution at position 2 confers increased stability by
protecting the peptide from endoprotease degradation, as is well
known in the art (see, for example, page 247 of Partridge, Peptide
Drug Delivery to the Brain, Raven Press, New York (1991)). The
substitution or deletion of a lysine residue confers increased
resistance to trypsin-like proteases, as is well known in the art
(Partridge, supra (1991)). These substitutions increase stability
and, thus, bioavailability of peptide SEQ ID NO:2, but do not
affect activity in alleviating neuropathic pain.
[0068] A useful modification also can be one that promotes peptide
passage across the blood-brain barrier, such as a modification that
increases lipophilicity or decreases hydrogen bonding. For example,
a tyrosine residue added to the C-terminus of the
prosaposin-derived peptide (SEQ ID NO:2) increases hydrophobicity
and permeability to the blood-brain barrier (see, for example,
Banks et al., Peptides 13:1289-1294 (1992) and Pardridge, supra
(1991)). A chimeric peptide-pharmaceutical that has increased
biological stability or increased permeability to the blood-brain
barrier, for example, also can be useful in the method of the
invention.
[0069] One skilled in the art can readily assay the ability of a
prosaposin receptor agonist to cross the blood-brain barrier in
vivo, for example, as disclosed in EXAMPLE II. In addition, an
active fragment of prosaposin can be tested for its ability to
cross the blood-brain barrier using an in vitro model of the
blood-brain barrier based on a brain microvessel endothelial cell
culture system, for example as described in Bowman et al., Ann.
Neurol. 14:396-402 (1983) or Takahura et al., Adv. Pharmacol.
22:137-165 (1992).
[0070] As used herein, the term "a neuropathic pain alleviating
amount" or "effective amount" means the amount of a prosaposin
receptor agonist useful for causing a diminution in neuropathic
pain, whether by alleviating neuropathic pain or by inhibiting the
onset of neuropathic pain. An effective amount to be administered
systemically on a daily basis depends on the body weight of the
subject. Preferably, an effective amount to be administered
systemically on a daily basis is about 0.1 .mu.g/kg to about 1000
.mu.g/kg. More preferably, an effective amount to be administered
systemically on a daily basis is about 10 .mu.g/kg to about 100
.mu.g/kg.
[0071] An effective amount of a peptide for alleviating or
inhibiting the onset of pain can be determined empirically using
methods well known to those in the art, including, for example, the
assay described in EXAMPLE I or those disclosed above, including
assays in primates (Lekan et al., supra (1992), and Palacek et al.,
supra (1992)).
[0072] A typical minimum amount of the peptides of the invention
for neurotrophic or myelinotrophic activity in cell growth medium
is at least about 5 ng/ml. This amount or more of apeptide of the
invention can be used for in vitro use. Typically, concentrations
in the range of 0.1 .mu.g/ml to about 10 .mu.g/ml of a peptide of
the invention can be used. An effective amount for treatment of a
particular tissue can be determined as set forth in EXAMPLES IV and
VI.
[0073] Neural cells can be treated in vitro or ex vivo by directly
administering a peptide of the invention to the cells. This can be
done, for example, by culturing the cells in growth medium suitable
for a particular cell type, followed by addition of peptide to the
medium. When the neural cells to be treated are in vivo, typically
in a vertebrate, preferably a mammal, a peptide of the invention
can be administered by one of several techniques as described
below.
[0074] As used herein, the term "subject" means a vertebrate,
preferably a mammal and, in particular, a human.
[0075] The present invention provides methods of alleviating pain,
stimulating neurite outgrowth, inhibiting neural cell death,
promoting myelination and inhibiting demyelination and methods of
inhibiting sensory or motor neuropathy by administering an
effective amount of an active fragment of prosaposin intravenously,
intramuscularly, intradermally, subcutaneously, intracranially,
intracerebrospinally, topically, orally, transdermally,
transmucosally, or intranasally. A pharmaceutically acceptable
carrier of well known type can be administered with a prosaposin
receptor agonist. Such carriers include, for example, phosphate
buffered saline (PBS).
[0076] Preferably, an effective amount of a prosaposin receptor
agonist is injected directly into the bloodstream of the subject.
For example, intravenous injection of a prosaposin receptor agonist
can be used to administer the active fragment to the peripheral or
central nervous system, since an iodinated prosaposin-derived
18-mer
Tyr-Lys-Glu-Val-Thr-Lys-Leu-Ile-Asp-Asn-Asn-Lys-Thr-Glu-Lys-Glu-Ile-Leu
(SEQ ID NO:20), consisting of amino acids 12 to 29 of
prosaposin-derived 22-mer SEQ ID NO:1 with a substitution of
tyrosine for valine at amino acid 12 (MW=2000) crossed the
blood-brain barrier and entered the central nervous system as
described in EXAMPLE II. The uptake by the brain was approximately
0.03%, which is in the mid-range of values for peptides of that
approximate size that will cross the blood-brain barrier (Banks et
al., supra (1992)).
[0077] Oral administration often can be desirable, provided the
prosaposin receptor agonist is modified so as to be stable to
gastrointestinal degradation and readily absorbable. The
substitution, for example, of one or more D-amino acids can confer
increased stability to a prosaposin receptor agonist useful in the
invention.
[0078] Direct intracranial injection or injection into the
cerebrospinal fluid also can be used to introduce an effective
amount of a prosaposin receptor agonist into the central nervous
system of a subject. In addition, a prosaposin receptor agonist can
be administered to peripheral neural tissue by direct injection or
local topical application or by systemic administration. Various
conventional modes of administration also are contemplated,
including intravenous, intramuscular, intradermal, subcutaneous,
intracranial, epidural, topical, oral, transdermal, transmucosal,
and intranasal administration.
[0079] A prosaposin receptor agonist also can be administered in a
sustained release form. The sustained release of a prosaposin
receptor agonist has the advantage of alleviating neuropathic pain
over an extended period of time without the need for repeated
administrations of the active fragment.
[0080] Sustained release can be achieved, for example, with a
sustained release material such as a wafer, an immunobead, a
micropump or other material that provides for controlled slow
release of the prosaposin receptor agonist. Such controlled release
materials are well known in the art and available from commercial
sources (Alza Corp., Palo Alto Calif.; Depotech, La Jolla Calif.;
see, also, Pardoll, Ann. Rev. Immunol. 13:399-415 (1995)). In
addition, a bioerodible or biodegradable material that can be
formulated with a prosaposin receptor agonist, such as polylactic
acid, polygalactic acid, regenerated collagen, multilamellar
liposomes or other conventional depot formulations, can be
implanted to slowly release the active fragment of prosaposin. The
use of infusion pumps, matrix entrapment systems, and transdermal
delivery devices also are contemplated in the present
invention.
[0081] A prosaposin receptor agonist also can be advantageously
enclosed in micelles or liposomes. Liposome encapsulation
technology is well known. Liposomes can be targeted to a specific
tissue, such as neural tissue, through the use of receptors,
ligands or antibodies capable of binding the targeted tissue. The
preparation of these formulations is well known in the art (see,
for example, Pardridge, supra (1991), and Radin and Metz, Meth.
Enzymol. 98:613-618 (1983)).
[0082] A peptide composition of the invention can be packaged and
administered in unit dosage form, such as an injectable composition
or local preparation in a dosage amount equivalent to the daily
dosage administered to a patient, and if desired can be prepared in
a controlled release formulation. Unit dosage form can be, for
example, a septum sealed vial containing a daily dose of the active
composition of the invention in PBS or in lyophilized form. For
treatment of neural diseases, an appropriate daily systemic dosages
of a peptide of the invention is based on the body weight of the
vertebrate and is in the range of from about 10 to about 100
.mu.g/kg, although dosages from about 0.1 to about 1,000 .mu.g/kg
are also contemplated. Thus, for the typical 70 kg human, a
systemic dosage can be between about 7 and about 70,000 .mu.g daily
and preferably between about 700 and about 7,000 .mu.g daily. A
daily dosage of locally administered material will be about an
order of magnitude less than the systemic dosage. Oral
administration is also contemplated.
[0083] The invention also provides a method of alleviating
neuropathic pain in a subject by transplanting into the subject a
cell genetically modified to express and secrete a prosaposin
receptor agonist. Transplantation can provide a continuous source
of a prosaposin receptor agonist and, thus, sustained alleviation
of neuropathic pain. For a subject suffering from prolonged or
chronic neuropathic pain, such a method has the advantage of
obviating or reducing the need for repeated administration of an
active fragment of prosaposin.
[0084] Using methods well known in the art, a cell readily can be
transfected with an expression vector containing a nucleic acid
encoding an active fragment of prosaposin (Chang, Somatic Gene
Therapy, CRC Press, Boca Raton (1995)). Following transplantation
into the brain, for example, the transfected cell expresses and
secretes an active fragment of prosaposin and, thus, alleviates
neuropathic pain. Such a method can be useful to alleviate
neuropathic pain as described for the transplantation of cells that
secrete substances with analgesic properties (see, for example,
Czech and Sagen, Prog. Neurobiol. 46:507-529 (1995)).
[0085] The cell can be any cell that can survive when transplanted
and that can be modified to express and secrete an active fragment
of prosaposin. In practice, the cell should be immunologically
compatible with the subject. For example, a particularly useful
cell is a cell isolated from the subject to be treated, since such
a cell is immunologically compatible with the subject.
[0086] A cell derived from a source other than the subject to be
treated also can be useful if protected from immune rejection
using, for example, microencapsulation or immunosuppression. Useful
microencapsulation membrane materials include
alginate-poly-L-lysine alginate and agarose (see, for example,
Goosen, Fundamentals of Animal Cell Encapsulation and
Immobilization, CRC Press, Boca Raton (1993); Tai and Sun, FASEB J.
7:1061 (1993); Liu et al., Hum. Gene Ther. 4:291 (1993); and
Taniguchi et al., Transplant. Proc. 24: 2977 (1992)). For example,
pain reduction has been achieved using polymer encapsulated cells
transplanted into the rat spinal subarachnoid space (Wang et al.,
Soc. Neurosci. Abstr. 17:235 (1991)).
[0087] For treatment of a human subject, the cell can be a human
cell, although a non-human mammalian cell also can be useful. In
particular, a human fibroblast, muscle cell, glial cell, neuronal
precursor cell or neuron can be transfected with an expression
vector to express and secrete an active fragment of prosaposin such
as SEQ ID NO:1. A primary fibroblast can be obtained, for example,
from a skin biopsy of the subject to be treated and maintained
under standard tissue culture conditions. A primary muscle cell
also can be useful for transplantation. Considerations for neural
transplantation are described, for example, in Chang, supra
(1995).
[0088] A cell derived from the central nervous system can be
particularly useful for transplantation to the central nervous
system since the survival of such a cell is enhanced within its
natural environment. A neuronal precursor cell is particularly
useful in the method of the invention since a neuronal precursor
cell can be grown in culture, transfected with an expression vector
and introduced into an individual, where it is integrated. The
isolation of neuronal precursor cells, which are capable of
proliferating and differentiating into neurons and glial cells, is
described in Renfranz et al., Cell 66:713-729 (1991).
[0089] Methods of transfecting cells ex vivo are well known in the
art (Kriegler, Gene Transfer and Expression: A Laboratory Manual,
W. H. Freeman & Co., New York (1990)). For the transfection of
a cell that continues to divide such as a fibroblast, muscle cell,
glial cell or neuronal precursor cell, a retroviral vector is
preferred. For the transfection of an expression vector into a
postmitotic cell such as a neuron, a replication-defective herpes
simplex virus type 1 (HSV-1) vector is useful (During et al., Soc.
Neurosci. Abstr. 17:140 (1991); Sable et al., Soc. Neurosci. Abstr.
17:570 (1991)).
[0090] A nucleic acid encoding an active fragment of prosaposin can
be expressed under the control of one of a variety of promoters
well known in the art, including a constitutive promoter or
inducible promoter. See, for example, Chang, supra (1995). A
particularly useful constitutive promoter for high level expression
is the Moloney murine leukemia virus long-terminal repeat
(MLV-LTR), the cytomegalovirus immediate-early (CMV-IE) or the
simian virus 40 early region (SV40).
[0091] A nucleic acid sequence encoding an active fragment of
prosaposin is disclosed herein. For example, a nucleic acid
sequence encoding SEQ ID NO:1 is
5'-TGTGAATTCCTGGTGAAGGAGGTGACCAAGCTGATTGACAACAACAAGACTGAGAA
AGAAATACTC-3' (SEQ ID NO:21) (Dewji et al., Proc. Natl. Acad. Sci.
USA 84:8652-8656 (1987)).
[0092] In order to direct secretion of peptide SEQ ID NO:1, for
example, a nucleic acid encoding a signal sequence, such as the
signal sequence of .beta.-lactamase, can be operably linked to SEQ
ID NO:21 as described in Simon et al., J. Cell Biol. 104:1165
(1987).
[0093] The invention further provides a method of inhibiting the
onset of neuropathic pain in a subject by administering an
effective amount of a prosaposin receptor agonist to the subject.
The method of preventing neuropathic pain is useful when applied
prior to a painful event, for example, prior to chemotherapy or
surgery that is known to result in neuropathic pain.
[0094] The following examples are intended to illustrate but not
limit the present invention.
EXAMPLE I
Alleviation of Neuropathic Pain in Chung Model Rats
[0095] This EXAMPLE describes the effects of bolus intrathecal
injection of an active fragment of prosaposin in the Chung
experimental model of peripheral neuropathic pain.
[0096] Each of the three peptides were obtained in pure form by
chemical synthesis, dissolved in sterile PBS and buffered to a
neutral pH.
[0097] The surgical procedure previously described by Kim and
Chung, supra (1992) was performed on male Sprague-Dawley rats
weighing 120 to 150 grams to induce an allodynic state. Briefly,
the rats were anesthetized with halothane; subsequently, the left
L-5 and L-6 spinal nerves were isolated adjacent to the vertebral
column and ligated with 6.0 silk suture distal to the dorsal root
ganglion. After a ten to fourteen day post operative recovery
period, a spinal catheter was introduced. Five days following the
second surgery, intrathecal drug administration was accomplished
using a gear driven micro-injection syringe connected to a spinal
catheter inserted through the foramen magnum. Prior to testing, the
rats were placed in clear plastic wire meshed cages and allowed to
acclimate.
[0098] To assess the 50% mechanical threshold for paw withdrawal, a
von Frey hair was applied to the hind foot avoiding the foot pad.
Each of the von Frey hairs, which are calibrated to bend at
increasing log forces, were pressed perpendicularly to the foot
with sufficient force to cause slight bending for a duration of
approximately six to eight seconds. A positive response was noted
if the foot was sharply withdrawn. Six data points were collected
for each point with the maximum and minimum stimulus noted for each
time point. The resulting pattern of the responses was tabulated,
and the 50% response threshold was computed. The graph gives the
response to the indicated dosage of peptide given as a single
intrathecal bolus injection. The X-axis indicates the time after
the injection at which point the hypersensitivity to pressure on
the foot pad was measured.
[0099] All surgically lesioned rats showed tactile allodynia prior
to injection with an active fragment of prosaposin. As shown at
time zero in FIG. 1, the measured threshold was less than 3.0 to
4.0 g in the absence of peptide. Intrathecal injection of 0.7 or
0.07 .mu.g of the prosaposin-derived 22-merpeptide (SEQ ID NO:1)
suppressed allodynia in a dose-dependent fashion. The reduction of
allodynia is manifest by the increase in the force threshold as the
rats withstand an increasing force before withdrawing the affected
foot. A significant effect was observed by 15 minutes after the
injection. The maximum effect was seen 120 minutes post-injection.
Rats injected with the high estdose of the prosaposin-derived
22-merpeptide (SEQ ID NO: 1) continued to demonstrate significantly
reduced allodynia at the latest time point assayed (180 minutes).
Rats that were injected with 0.007 .mu.g prosaposin-derived 22-mer
peptide (SEQ ID NO:1) showed no significant reduction in allodynia.
No significant side effects such as sedation were observed at any
concentration.
[0100] The ability of the prosaposin-derived 14-mer peptide (SEQ ID
NO:2; see TABLE 1) to relieve allodynia in Chung model rats also
was examined. As shown in FIG. 2, the active fragment of prosaposin
(SEQ ID NO:2) was effective in reducing allodynia. The peak effect
of the prosaposin-derived 14-mer peptide (SEQ ID NO:2) was observed
15 to 30 minutes following the injection and returned to the
pre-injection value by 60 minutes (FIG. 2). No side effects were
observed at either concentration of prosaposin-derived 14-mer
peptide (SEQ ID NO:2) tested.
[0101] A mutant 22-merpeptide (SEQ ID NO:8) that differs from the
prosaposin-derived 22-merpeptide (SEQ ID NO:1) by containing an
aspartic acid residue instead of an asparagine (see TABLE 4) also
was tested for activity in relieving allodynia in Chung model rats.
No change in the allodynic response of the Chung rats was observed
following injection of 17.5 .mu.g mutant 22-mer peptide (SEQ ID
NO:8).
[0102] Normal rats, which do not experience pain as a result of
surgical lesion introduced according to the Chung model, also were
injected with an active fragment of prosaposin (SEQ ID NO:1) and
tested for their response to a heat stimulus according to the
procedure developed by Bennett and Xie, supra (1988). Briefly, the
period of time before the rat withdraws the affected foot from a
source of heat is defined as the hot plate latency and is a measure
of tolerance to pain caused by a heat stimulus.
[0103] An intrathecal catheter was placed into normal male Sprague
Dawley rats. Five days after this surgery, rats were injected
intrathecally with an active fragment of prosaposin (SEQ ID NO:1).
Rats were examined on the hot plate (52.5.degree. C.); hot plate
response latencies were measured prior to injection and at various
time points up to 180 minutes after the injection. No significant
elevation of the hot plate response latency was observed. Thus, the
prosaposin-derived peptide SEQ ID NO:1 does not effect the
perception of pain in normal animals.
EXAMPLE II
In vivo Uptake of Prosaposin-derived Peptides By the Central
Nervous System
[0104] The results described in this EXAMPLE indicate that
prosaposin-derived peptides cross the blood-brain barrier.
[0105] An 18-mer peptide (SEQ ID NO:20) consisting of amino acids
12-29 of saposin C with a tyrosine substituted for valine at
position 12 was chemically synthesized on an Applied Biosystems
Model 430 peptide synthesizer. The peptide was then radioiodinated
by the lactoperoxidase method; 20.times.10.sup.6 cpm radiolabeled
peptide were injected into the auricles of rats. The animals were
sacrificed after one hour and 24 hours, and the hearts were
perfused with isotonic saline in order to remove the blood from the
brain.
[0106] In order to determine the percentage of peptide uptake, the
brain was then counted in a gamma counter. In addition, the brain
was homogenized and fractionated into a capillary rich fraction
(pellet) and a parenchymal brain fraction (supernatant) after
dextran centrifugation (Triguero et al., J. Neurochem.,
54:1882-1888(1990)). This method allows for the discrimination
between radiolabeled peptide within blood vessels and that within
the brain. After 24 hours, 0.017% of the injected peptide (SEQ ID
NO:20) was detected in whole brain; 75% of the label was in the
parenchymal fraction and 25% was in the capillary fraction. At 1
hour, 0.03% of the injected dose was present in whole brain.
[0107] The prosaposin-derived peptide SEQ ID NO:2 also was assayed
for ability to cross the blood-brain barrier as follows. A female
Sprague-Dawley rat was anesthesized with methoxyflurane, and
approximately 20 .mu.g peptide SEQ ID NO:2 (3.2.times.10.sup.8 cpm)
was injected into the tail vein. After 40 minutes, the rat was
sacrificed by ether anesthesia and perfused with about 250 ml PBS
through the heart. The total amount of peptide in brain, liver and
blood was calculated as a percentage of the injected material as
shown in TABLE 6. In order to determine the localization in brain,
the capillary depletion method of Triguero, J. Neurochem. 54:1882
(1990) was used to separate brain tissue into a parenchyma fraction
and a brain capillary fraction. The fractionation results showed
that 87% of the SEQ ID NO:2 peptide present in brain was localized
to brain parenchyma while 13% was found in brain capillary.
6TABLE 6 TOTAL CPM PERCENTAGE OF TISSUE WEIGHT IN TISSUE INITIAL
CPM Brain 1.3 gm 161,000 0.050 Liver 8.8 gm 5.2 .times. 10.sup.6
1.625 Blood about 22 .mu.l 1.01 .times. 10.sup.8 31.6
[0108] In a similar experiment in which rats were sacrificed after
three hours treatment with SEQ ID NO:2, 0.06% of the peptide was
evident in brain, of which 85% was in the parenchyma. These results
demonstrate that at least some of the prosaposin-derived peptide
SEQ ID NO:2 crossed the blood brain barrier and was concentrated in
the brain parenchyma rather than the vascular endothelium (blood
vessels). The percentage of peptide which crossed the blood brain
barrier is in the mid-range of peptides which cross the barrier as
set forth in Banks, supra (1992).
[0109] In order to determine the percentage of intact material in
the brain, liver and blood, radiolabeled material (SEQ ID NO:2)
isolated from the tissues was analyzed by high pressure liquid
chromatography. To normalize for degradation during processing of
tissue homogenates, peptide SEQ ID NO:2 was added to tissue
homogenates. The extent of degradation observed with the added
peptide material was used to normalize for degradation during
tissue processing. After normalization, the results were as
follows: SEQ ID NO:2 was about 60% intact in brain; about 80%
intact in liver and about 40% intact in blood. In a second
experiment, peptide SEQ ID NO:2 was about 68% intact in brain.
These results indicate that the peptide SEQ ID NO:2 crosses the
blood brain barrier and is largely intact in brain.
EXAMPLE III
Alleviation of Neuropathic Pain in Diabetic Rats
[0110] This EXAMPLE describes the effects of intraperitoneal
administration of a peptide having the sequence of SEQ ID NO:2 in a
rat model of diabetic neuropathy.
[0111] Rats were made diabetic by a single intraperitoneal
injection of streptozotocin (STZ) (50 mg/kgbody weight, freshly
dissolved in 0.9% sterile saline) to ablate pancreatic P cells and
induce insulin deficiency as described in Calcutt et al., Pain
68:293-299 (1996). Two days later, diabetes was confirmed in
streptozotocin-injected rats by measuring blood glucose levels.
Streptozotocin-injected animals with a blood glucose concentration
below 15 mmol/l were excluded from subsequent studies, according to
the commonly accepted definition of non-fasting hyperglycemia in
studies of diabetes in rats.
[0112] Both diabetic and control rats were studied at 8 weeks by
analyzing the behavioral response to the noxious chemical formalin
as an indicator of allodynia (Calcutt et al. supra (1996)).
Briefly, rats received a subcutaneous injection of freshly-prepared
formalin (50 .mu.l of0.5% solution in sterile saline) into the
dorsal surface of the right hind paw. This concentration of
formalin induces sub-maximal behavioral responses in control rats
and allows detection of hyperalgesia in diabetic rats during phases
Q and 2 (Calcutt et al., Eur. J. Pharmacol. 285:189-197 (1995).
Animals were transferred to an observation chamber constructed to
allow continuous visualization of the paws. The number of flinches
during one minute periods were counted at 5 minute intervals for
the next 60 minutes by an observer who was unaware of the treatment
group of each animal. Phase 1 was defined as the initial
measurement of flinching (1-2 and 5-6 minutes post injection); the
Q (quiescent) phase as the measurements made at 10-11, 15-16 and
20-21 minutes; and Phase 2 as all subsequent measurements post
injection, as previously defined for studies of diabetic rats (see,
for example, Malmberg et al., Neurosci. Lett. 161:45-48 (1993)).
Comparisons of activity during each phase were made by summing the
flinches at measurement points within the phase. Diabetic rats gave
an abnormal flinch response, as has been reported previously.
Peptide SEQ ID NO:2 was obtained in pure form by chemical
synthesis, dissolved in sterile PBS and buffered to a neutral pH.
Diabetic rats were divided in two groups of four animals each,
which were administered saline or peptide SEQ ID NO:2,
respectively. Two hours before treatment with 0.5% formalin, the
diabetic rats were treated with saline or 200 .mu.g/kg peptide SEQ
ID NO:2 using intraperitoneal administration. As shown in FIG. 3,
administration of SEQ ID NO:2 completely prevented the abnormal
flinch response in Phase 1 and ameliorated the response in Phase 2
by 70%. Thus, parenteral administration of peptide SEQ ID NO:2
alleviated the pain from formalin injection in a rat model of
painful diabetic neuropathy.
EXAMPLE IV
Stimulation of Neurite Outgrowth in Vitro
[0113] This EXAMPLE describes the use of a peptide having the
sequence of SEQ ID NO:2 in stimulating neurite outgrowth in
vitro.
[0114] NS20Y neuroblastoma cells are grown in Dulbecco's modified
Eagle medium (DMEM) containing 10% fetal calf serum (FCS). Cells
are removed with trypsin and plated in 30 mm petri dishes onto
glass coverslips. After 20 to 24 hours, the medium is replaced with
2 ml DMEM containing 0.5% fetal calf serum with 0, 0.5, 1, 2, 4 or
8 ng/ml of a peptide having sequence SEQ ID NO:2 or a scrambled
control peptide. Cells are cultured for an additional 24 hours,
washed with PBS and fixed with Bouin's solution (saturated aqueous
picric acid/formalin/acetic acid 15:5:1) for 30 minutes. After
fixative is removed with PBS, neurite outgrowth is scored under a
phase contrast microscope. Cells exhibiting one or more clearly
defined neurites equal to or longer than one cell diameter are
scored as positive for neurite outgrowth. At least 200 cells are
scored in different positions of each dish to determine the
percentage of neurite bearing cells with each peptide assayed in
duplicate.
[0115] The peptide shown in SEQ ID NO:2 significantly increases
neurite outgrowth in NS20Y cells as compared to a scrambled control
peptide having the same amino acids in a different order. Increased
neurite outgrowth is evident using as little as 0.5 ng/ml
peptide.
EXAMPLE V
Inhibition of Neural Cell Death in Vitro
[0116] This EXAMPLE describes the use of a peptide having the
sequence of SEQ ID NO:2 in inhibiting neural cell death in
vitro.
[0117] NS20Y cells are plated as described in EXAMPLE IV and grown
on glass coverslips in 0.5% fetal bovine serum for 2 days in the
presence or absence of 8 ng/ml of a peptide having the sequence
shown as SEQ ID NO:2 or a scrambled control peptide. Media is
removed and 0.2% trypan blue in PBS is added to each well. Dead
cells stain blue with the trypan blue dye and are scored as a
percentage of the total on an inverted microscope, counting 400
cells in four areas of each well. The average error of duplicates
is +5%. The peptide shown as SEQ ID NO:2 substantially reduces the
number of trypan blue-positive (dead) cells. This indicates that a
peptide having the sequence SEQ ID NO:2 can inhibit programmed cell
death.
EXAMPLE VI
Ex Vivo Myelination Assay
[0118] This EXAMPLE describes the use of a peptide having the
sequence of SEQ ID NO:2 in stimulating neurite outgrowth ex vivo
and in promoting myelination.
[0119] Newborn mouse cerebellar explants are prepared according to
Satomi, Zool. Sci. 9:127-137 (1992). Neurite outgrowth and
myelination are observed over 22 days in culture, during the period
when the newborn mouse cerebellum normally undergoes neuronal
differentiation and myelination begins. On the second day after
preparation of the explants, the peptide having the sequence of SEQ
ID NO:2 is added to three explants at a concentration of 10
.mu.g/ml and a scrambled control peptide is added to three explants
at a concentration of 10 .mu.g/ml. Neurite outgrowth and
myelination in three control and three treated explants is assessed
under a bright field microscope with a video camera. On the eighth
day, cultures containing the peptides are thinner and more spread
out than control cultures. On day 15, cultures treated with peptide
SEQ ID NO:2 contain many cells with long projections at the
periphery of the explant. Such projections are absent or less
prominent in control cultures. Cultures treated with peptide SEQ ID
NO:2 contain significantly more myelinated axons in the subcortical
white matter at 22 days compared to control explants. Thus, the
peptide of the invention induces myelination in differentiating
cerebellum ex vivo.
EXAMPLE VII
Inhibition of Demyelination
[0120] Reduction of Schwann cell death is correlated with
inhibition ofdemyelination. Schwann cells contain an extensive
myelin sheath. The addition of the peptide shown in SEQ ID NO:2 to
Schwann cells in culture reduces Schwann cell death in a
dose-dependent manner not seen with a control scrambled peptide.
Thus, a peptide of the invention having the sequence of SEQ ID NO:2
can inhibit demyelination.
EXAMPLE VIII
Treatment of Traumatic Ischemic CNS Lesions
[0121] Humans with traumatic lesions to the spinal cord receive an
intracerebrospinal injection or direct injection of about 100
.mu.g/ml of the peptide shown in SEQ ID NO:2 in a sterile saline
solution or in depot form to enable slow, continuous release of the
peptide at the lesion site. Improvement is assessed by gain of
motor nerve function such as increased limb movement. Treatments
are repeated until no further improvement occurs.
EXAMPLE IX
Treatment of Demyelination Disorders
[0122] Patients diagnosed with early stage MS are given a peptide
having the sequence shown in SEQ ID NO:2 by direct intravenous
injection into the cerebrospinal fluid using the same dose range as
in EXAMPLE VIII. Dosages are repeated daily or weekly and
improvement in muscle strength, musculoskeletal coordination and
myelination (as determined by magnetic resonance imaging (MRI)) is
observed.
EXAMPLE X
Treatment of Sensory Neuropathy
[0123] Mice were administered taxol in order to induce sensory
neuropathy. The taxol-treated mice were administered 100 .mu.g/kg,
200 .mu.g/kg or 1 mg/kg of the prosaposin-derived peptide SEQ ID
NO:2. The loss of thermal sensation was measured using a Hargreaves
sensory testing apparatus as an indicator of sensory neuropathy.
Each of the three doses of peptide SEQ ID NO:2 administered were
effective in inhibiting loss of thermal sensation in taxol-treated
mice. The prosaposin-derived 22-mer peptide SEQ ID NO:1 also was
similarly assayed and found to be effective in inhibiting less of
thermal sensation in the taxol-treated mice. These results show
that prosaposin-derived peptides such as SEQ ID NO:1 and SEQ ID
NO:2 can be used to effectively inhibit sensory neuropathy.
EXAMPLE XI
Incorporation of .sup.32P into NS20Y Proteins After Treatment with
Prosaposin or its Active Fragments
[0124] NS20Y cells were incubated in phosphate-free Hanks' balanced
salt solution containing 2.5 .mu.g/ml actinomycin D and 80-100
.mu.Ci/ml carrier-free [.sup.32P]-orthophosphate (New England
Nuclear) and effector proteins (0.5-1.0 .mu.g/ml) and incubated for
10-15 minutes at room temperature. Cells were solubilized in
SDS-PAGE sample buffer, analyzed by SDS-PAGE and
autoradiographed.
[0125] Prosaposin and saposin C were found to stimulate
phosphorylation of proteins of 148, 100, 80, 68, 50, 38 and 34 kDa
to a greater extent than controls or cells treated with similar
concentrations of saposins A, B or D. This 148 kDa protein maybe
phospholipase C-.gamma., a protein known to be involved in
phospholipid metabolism and which is phosphorylated on tyrosine
residues in response to a number of growth factors. Densitometric
analysis indicated a 3-5 fold stimulation of phosphorylation after
10 minutes. Treatment of gels with alkali revealed that the
prominent phosphorylated proteins were alkali-resistant, indicating
that they contain phosphotyrosine and/or phosphothreonine (located
next to proline) residues. These results indicate that prosaposin
and its active fragments bind to a cell surface receptor and
activate a kinase cascade, similar to other neurotrophins and
growth factors. Since prosaposin-ganglioside GM.sub.1 or saposin
C-ganglioside GM.sub.3 complexes inhibit neuritogenesis, while
prosaposin or saposin C alone promote this process, this indicates
that gangliosides may abolish neurotogenic activity by masking a
receptor binding site on the neurotrophin. In addition, since
prosaposin and its active fragments induce tyrosine phosphorylation
of cytoplasmic proteins in responsive cells, most likely by
activation of a tyrosine kinase similar to cytokines and growth
factors, this provides further evidence that a cell surface
receptor is involved.
[0126] A 20 kDa protein has been identified as the putative
receptor for prosaposin as described in the following EXAMPLE:
EXAMPLE XII
Isolation of a Putative Prosaposin Receptor
[0127] A putative prosaposin receptor protein was isolated from
whole rat brain, rat cerebellum and mouse neuroblastoma cells using
the plasma membrane P-100 fraction. Briefly, cells or tissues were
solubilized and centrifuged at 14,000 rpm to remove debris. The
supernatant was centrifuged at 40,000 rpm for 1 hour at 4.degree.
C. The pellet, enriched in plasma membrane, was solubilized in RIPA
buffer (10 mM MOPS, pH 7.5, 0.3 M sucrose, 5 mM EDTA, 1% Trasylol,
10 .mu.M leupeptin and 10 .mu.M antipain). This P-100 fraction was
applied to an affinity column containing the bound, active 22-mer
fragment of saposin C. The column was washed with 0.05 M NaCl to
elute loosely-bound proteins followed by 0.25 M NaCl which eluted
the putative 54-60 kDa prosaposin receptor. In addition, it was
determined that the 54-60 kDa protein could be eluted using a
100-fold excess of unbound peptide thus demonstrating specific
elution. The 54-60 kDa protein was approximately 90% pure as judged
by SDS-PAGE. The protein was purified to homogeneity using HPLC and
eluted at 50% acetonitrile in an acetonitrile/water gradient on a
Vydac C4 column. After treatment with the cross-linking reagent
disuccinimidyl suberate (DSS; Pierce, Rockford, Ill.), the 54-60
kDa protein bound irreversibly to .sup.125I labeled saposin C as
evidenced by the 72 kDa molecular weight of the complex (60 kDa+12
kDa).
EXAMPLE XIII
Alleviation of Neuropathic Pain in Selzer Model Rats
[0128] Prosaptide TX 14(A) (SEQ ID NO:2) was tested for relief of
hyperalgesia in the Selzer rat model. After induction of
hyperalgesia by ligation of the sciatic nerve in one hind limb, the
animals were injected with Prosaptide TX 14(A). Relief was measured
using the hot plate withdrawal technique comparing ligated vs.
unligated hind foot withdrawal. Within 3 hours of injection of
Prosaptide TX 14(A), intravenous at a dose of 200 mg/kg, nearly
complete relief of hyperalgesia was observed. The relief lasted for
up to 48 hours post injection.
EXAMPLE XIV
The Effects of Prosaptide TX 14(A) on the Relief of Neuropathy in a
Diabetic Rat Model
[0129] While conventional medical treatment of diabetes mellitus
markedly prolongs life-span, serious medical complications affect a
large proportion of the more than 10 million people believed to
have diabetes in the USA. Peripheral neuropathy is the most common
complication, affecting one third of newly diagnosed cases. The
frequency of neuropathy increases with duration of disease to
affect over half of all diabetics. Nerve dysfunction usually
progresses to become a distal symmetrical polyneuropathy with
morphologic evidence of paranodal widening, segmental demyelination
and remyelination, axonal atrophy and ultimate fiber loss. This
pathology is accompanies by loss of sensory function that, when
coupled with impaired healing processes and vascular disease, can
lead to gangrene and limb amputation.
[0130] Hyperglycemia may be induced in animals by a variety of
means and diabetic rodents have been widely studied to gain
insights into mechanisms underlying diabetic complications. Acute,
insulin-deficient, experimental diabetes may be introduced by
selective chemical ablation of the beta cells of the pancreas using
streptozatocm (STZ) to produce analogous to severe type 1
(insulin-dependent) diabetes.
[0131] STZ-diabetic rats exhibit electrophysiologic disorders that
are similar to those found in newly-diagnosed diabetic patients.
Symptoms include, reduced nerve conduction, relacitios, and
resistance to ischemic conduction block. Other functional disorders
present in the peripheral nerves of STZ-diabetic rats include
exaggerated pain responses to a painful stimulus with concurrent
thermal hypoalgesia (slowing of response times to painful thermal
stimuli, reduced levels of neuropeptide neurotransmitters, impaired
regeneration after injury and reduced nerve blood).
[0132] Since prosaposin and the prosaptides have been shown to
cause peripheral and central nerve regeneration and prevent
demyelination and induce remyelination, this preliminary EXAMPLE
was conducted using prosaptide TX 14(A) (SEQ ID NO:2) using
STZ-diabetic rats.
[0133] Control and STZ-diabetic rats were treated using 1000 .mu.g
prosaptide TX 14(A) per kg body weights i.p., three times per week
for 8 weeks. Treatment did not prevent hyperglycemia or loss of
body weight in diabetic rats (control=280 gm; control plus
prosaptide TX 14(A)=280 gm; diabetic=195 gm; and diabetic plus
prosaptide TX 14(A)=204 gm). However, prosaptide TX 14(A) prevented
hypoalgesia in the STZ-diabetic rats (FIG. 4).
[0134] This is an important finding as loss of thermal sensation
and thermal pain sensation is an early indicator of neuropathy in
diabetic patients.
EXAMPLE XV
Prosaposin in Peripheral Nerve: Effects of Diabetes and Efficacy of
a Peptide Fragment of Prosaposin in Treating Diabetic Nerve
Dysfunction
[0135] A more comprehensive EXAMPLE was then undertaken to include
more parameters and to establish a dose response ofprosaptide TX
14(A) (SEQ ID NO:2). In this EXAMPLE, control and STZ-diabetic rats
were treated with prosaptide TX 14(A) at doses of 20 .mu.g/kg, 200
.mu.g/kg, and 1000 .mu.g/kg body weight, i.p., three times per week
for 8 weeks. The rats were weighed at the beginning, midpoint and
the end of the experiment and motor nerve conduction (MNCV) and
sensor nerve conduction velocity (SNCV) measurements were taken at
the three time points. In this EXAMPLE, all three groups treated
with prosaptide TX 14(A) showed significant decreases in weight
loss in a dose dependent manner when compared to diabetic animals
(FIG. 5). Thermal response latency was restored to control
non-diabetic levels in animals treated with 200 and 1000 .mu.g
prosaptide TX 14(A), while the 20 .mu.g treatment group showed an
intermediate response (FIG. 5). Diabetic animals treated with
prosaptide TX 14(A) at doses of 200 and 1000 .mu.g/kg body weight
showed enhanced motor nerve conduction velocities compared to the
untreated diabetic group and diabetic animals receiving 20 .mu.g/kg
body weight (FIG. 6). In addition, all prosaptide TX 14(A)-treated
rats showed a slower loss of sensory nerve conduction velocity when
compared to diabetic unheated animals (FIG. 6).
[0136] In detail, the results of this EXAMPLE were as follows:
Saposin C and its precursor prosaposin exhibit neurogenic
properties and protect neurons from ischemic injury.
Immunostaining, using a monoclonal antibody that recognizes both
prosaposin and saposin C, was demonstrated in Schwann cells of
peripheral nerve. Further, after 8 weeks of untreated diabetes,
prosaposin mRNA levels increased 2-fold in the peripheral nerves of
rats, suggesting either dysfunctional processing or a local
response to developing neuropathy. Therefore, the effect of a 14
amino acid neuroactive peptide fragment of saposin C (prosaptide;
SEQ ID NO:2) on peripheral nerve function in control and diabetic
rats was investigated. MNCV (63.7.+-.1.0 m/s; mean term) and SNCV
(63.4.+-.1.3) were significantly (p<0.05 or less by ANOVA and
Student-Newman-Keuls test) reduced after 8 weeks of streptozotocin
diabetes (52.8.+-.1.1 and 49.8.+-.1.8 respectively). These deficits
were attenuated by thrice weekly treatment (1 mg/kg i.p. for 8
weeks) with prosaptide (58.1.+-.1.2 and 54.9.+-.1.3 respectively).
Thermal hypoalgesia in diabetic rats (control=85.+-.3.4 sec:
diabetic=11.0.+-.0.8) was also prevented by prosaptide treatment
(8.8+0.6) while there was no effect on hyperglycemia, accumulation
of polyol pathway metabolites, nerve myo-inositol depletion or
reduced nerve laser Doppler flux. There was no detectable effect of
prosaptide on any measured parameter in control rats. In a
subsequent time course study, thermal hypoalgesia and the decline
in nerve conduction velocities during 8 weeks of diabetes were
attenuated by prosaptide in a dose-dependent manner using thrice
weekly treatment with either 20, 200 or 1000 .mu.g i.p. These data
demonstrate the novel presence in Schwann cells of a neuroactive
protein (prosaposin) whose mRNA is increased during diabetes.
Moreover, a peptide fragment of this protein (prosaptide; SEQ ID
NO:2) is capable of preventing slowed nerve conductance and thermal
hypoalgesia in diabetic rats without modulating exaggerated polyol
pathway flux or reduced nerve vascular perfusion.
[0137] This EXAMPLE demonstrates that prosaptide TX 14(A) (SEQ ID
NO:2) can prevent the symptoms of diabetic neuropathy and slow or
prevent motor and sensory nerve degeneration as measured by nerve
conduction velocities. In addition, the optimal dose ofprosaptide
can now be established as greater than 20 .mu.g/kg and less than
100 .mu.g/kg body weight.
EXAMPLE XVI
Prosaptide Halts Progressive Slowing of Sensory Conduction and
Reverses Hyperalgesia in Diabetic Rats
[0138] The results of this EXAMPLE demonstrate that the prevention
of formalin-induced pain (allodynia) in diabetic rats treated with
prosaptide at 200 mg/kg. The formalin testing was done after 4
weeks, of three time weekly injections, and testing was done after
the last dose (last bar, FIG. 7). In a second study after 8 weeks
of diabetes, prosaptide TX 14(A) (SEQ ID NO:2) was administered 30
min before testing (200 mg/kg i.p.) and reversed the hyperalgesia
to a significant (p>0.05) extent (third bar, FIG. 7). These
results demonstrated that prosaptide TX 14(A), given parenterally,
reverses hyperalgesia in the diabetic rat, when given as a single
dose after 2 months of neuropathy and latter animal testing was
performed 24-48 hours after the last dose, and reversal was again
highly significant (p>0.05).
[0139] In detail, the results of this EXAMPLE show that prosaptide
(SEQ ID NO:2), a 14 amino acid neuroactive peptide fragment of
saposin C, attenuates the decline in nerve conduction velocities
(NCV) of diabetic rats in a dose-dependent manner when given from
the onset of diabetes. This EXAMPLE was designed to determine
whether prosaptide could also reverse conduction deficits and
hyperalgesia in the formalin test pain model once these disorders
are established in diabetic rats. SNCV was measured before onset of
diabetes and 4-8 weeks later in groups of control, untreated
diabetic and prosaptide-treated (200 .mu.g/kg i.p. thrice weekly
for the last 4 weeks) diabetic rats. Flinch responses to injection
of formalin (50 .mu.l 0.5% or 5.0% solution) were followed for 60
min in control, 8 week untreated diabetic, 8 week diabetic treated
with prosaptide (200 .mu.g/kg i.p.) 30 min pre-test and 8 week
diabetic treated with prosaptide (200 .mu.g/kg i.p.) thrice weekly
for the last 4 weeks (the last treatment being 48-72 hr pre-test).
Untreated diabetic rats showed a progressive decline in SNCV so
that values were significantly (P>0.05 by ANOVA with Dunnett's
test) lower than controls after 4 weeks and decreased further
between weeks 4 and 8. Treatment with prosaptide beginning after 4
weeks of diabetes prevents any further decline in SNCV between
weeks 4 and 8 of diabetes. These animals also showed a significant
(P>0.05 vs. untreated diabetic rats by ANOVA) reduction in
hyperalgesia during the formalin test compared to untreated
diabetics. A single bolus treatment with prosaptide given 30 min
before testing in otherwise untreated 8 week diabetic rats was also
effective in abolishing hyperalgesia during the formalin test
whereas prosaptide in single bolus doses ofup to 1 mg/kg i.p. 30
min pre-test was without effect on responses to formalin in control
rats.
[0140] This EXAMPLE shows that the progression of an established
SNCV disorder in diabetic rats can be halted by prosaptide. The
anti-hyperalgesic properties of prosaptide are specific to diabetes
rats rather than being a general effect on the formalin test per
se, and prosaptide is effective either as a single dose 30 min
pre-test or by chronic treatment with the final dose being at least
48 hr pre-test.
[0141] Although the invention has been described with reference to
the EXAMPLES above, it should be understood that various
modifications can be made without departing from the spirit of the
invention. Accordingly, the invention is limited only by the
following claims.
Sequence CWU 1
1
25 1 22 PRT Artificial Sequence Description of Artificial Sequence
Artificial peptide sequence 1 Cys Glu Phe Leu Val Lys Glu Val Thr
Lys Leu Ile Asp Asn Asn Lys 1 5 10 15 Thr Glu Lys Glu Ile Leu 20 2
14 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence 2 Thr Ala Leu Ile Asp Asn Asn Ala Thr
Glu Glu Ile Leu Tyr 1 5 10 3 12 PRT Artificial Sequence Artificial
Peptide Sequence (Amino acids 18-29 of saposin C) 3 Leu Ile Asp Asn
Asn Lys Thr Glu Lys Glu Ile Leu 1 5 10 4 22 PRT Artificial Sequence
Description of Artificial Sequence Artificial Peptide Sequence
(Mouse) 4 Cys Gln Phe Val Met Asn Lys Phe Ser Glu Leu Ile Val Asn
Asn Ala 1 5 10 15 Thr Glu Glu Leu Leu Tyr 20 5 21 PRT Artificial
Sequence Description of Artificial Sequence Artificial Peptide
Sequence (Rat) 5 Cys Gln Leu Val Asn Arg Lys Leu Ser Glu Leu Ile
Ile Asn Asn Ala 1 5 10 15 Thr Glu Glu Leu Leu 20 6 22 PRT
Artificial Sequence Description of Artificial Sequence Artificial
Peptide Sequence (Guinea Pig) 6 Cys Glu Tyr Val Val Lys Lys Val Met
Leu Leu Ile Asp Asn Asn Arg 1 5 10 15 Thr Glu Glu Lys Ile Ile 20 7
22 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence (Bovine) 7 Cys Glu Phe Val Val Lys Glu
Val Ala Lys Leu Ile Asp Asn Asn Arg 1 5 10 15 Thr Glu Glu Glu Ile
Leu 20 8 22 PRT Artificial Sequence Description of Artificial
Sequence Artificial Peptide Sequence 8 Cys Glu Phe Leu Val Lys Glu
Val Thr Lys Leu Ile Asp Asp Asn Lys 1 5 10 15 Thr Glu Lys Glu Ile
Leu 20 9 14 PRT Artificial Sequence Description of Artificial
Sequence Artificial Peptide Sequence 9 Thr Lys Leu Ile Asp Asn Asp
Lys Thr Glu Lys Glu Ile Leu 1 5 10 10 14 PRT Artificial Sequence
Description of Artificial Sequence Artificial Peptide Sequence 10
Thr Lys Ser Ile Asp Asn Asn Lys Thr Glu Lys Glu Ile Leu 1 5 10 11
20 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence (hCNTF) 11 Tyr Val Lys His Gln Gly Leu
Asn Lys Asn Ile Asn Leu Asp Ser Val 1 5 10 15 Asp Gly Val Pro 20 12
15 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence (hIL-6) 12 Glu Ala Leu Ala Glu Asn Asn
Leu Asn Leu Pro Lys Met Ala Gly 1 5 10 15 13 17 PRT Artificial
Sequence Description of Artificial Sequence Artificial Peptide
Sequence (hIL-2) 13 Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys
Asn Pro Lys Leu 1 5 10 15 Thr 14 12 PRT Artificial Sequence
Description of Artificial Sequence Artificial Peptide Sequence
(hIL-3) 14 Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu 1 5 10
15 13 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence (hIL1-gamma) 15 Phe Tyr Leu Arg Asn Asn
Gln Leu Val Ala Gly Thr Leu 1 5 10 16 17 PRT Artificial Sequence
Description of Artificial Sequence Artificial Peptide Sequence
(hEPO) 16 Ala Glu His Cys Ser Leu Asn Glu Asn Ile Thr Val Pro Asp
Thr Lys 1 5 10 15 Val 17 18 PRT Artificial Sequence Description of
Artificial Sequence Artificial Peptide Sequence 17 Tyr Thr Ala Gln
Gly Glu Pro Phe Pro Asn Asn Val Glu Lys Leu Cys 1 5 10 15 Ala Pro
18 15 PRT Artificial Sequence Description of Artificial Sequence
Artificial Peptide Sequence (hIL-1beta) 18 Phe Asn Lys Ile Glu Ile
Asn Asn Lys Leu Glu Phe Glu Ser Ala 1 5 10 15 19 17 PRT Artificial
Sequence Description of Artificial Sequence Artificial Peptide
Sequence (hONC-M) 19 Arg Pro Asn Ile Gly Leu Arg Asn Asn Ile Tyr
Cys Met Ala Gln Leu 1 5 10 15 Leu 20 18 PRT Artificial Sequence
Description of Artificial Sequence Artificial Peptide Sequence 20
Tyr Lys Glu Val Thr Lys Leu Ile Asp Asn Asn Lys Thr Glu Lys Glu 1 5
10 15 Ile Leu 21 66 DNA Artificial Sequence Description of
Artificial Sequence Artificial Nucleic Acid Sequence 21 tgt gaa ttc
ctg gtg aag gag gtg acc aag ctg att gac aac aac aag 48 Cys Glu Phe
Leu Val Lys Glu Val Thr Lys Leu Ile Asp Asn Asn Lys 1 5 10 15 act
gag aaa gaa ata ctc 66 Thr Glu Lys Glu Ile Leu 20 22 2749 DNA Homo
sapiens CDS (1)..(1572) 22 atg tac gcc ctc ttc ctc ctg gcc agc ctc
ctg ggc gcg gct cta gcc 48 Met Tyr Ala Leu Phe Leu Leu Ala Ser Leu
Leu Gly Ala Ala Leu Ala 1 5 10 15 ggc ccg gtc ctt gga ctg aaa gaa
tgc acc agg ggc tcg gca gtg tgg 96 Gly Pro Val Leu Gly Leu Lys Glu
Cys Thr Arg Gly Ser Ala Val Trp 20 25 30 tgc cag aat gtg aag acg
gcg tcc gac tgc ggg gca gtg aag cac tgc 144 Cys Gln Asn Val Lys Thr
Ala Ser Asp Cys Gly Ala Val Lys His Cys 35 40 45 ctg cag acc gtt
tgg aac aag cca aca gtg aaa tcc ctt ccc tgc gac 192 Leu Gln Thr Val
Trp Asn Lys Pro Thr Val Lys Ser Leu Pro Cys Asp 50 55 60 ata tgc
aaa gac gtt gtc acc gca gct ggt gat atg ctg aag gac aat 240 Ile Cys
Lys Asp Val Val Thr Ala Ala Gly Asp Met Leu Lys Asp Asn 65 70 75 80
gcc act gag gag gag atc ctt gtt tac ttg gag aag acc tgt gac tgg 288
Ala Thr Glu Glu Glu Ile Leu Val Tyr Leu Glu Lys Thr Cys Asp Trp 85
90 95 ctt ccg aaa ccg aac atg tct gct tca tgc aag gag ata gtg gac
tcc 336 Leu Pro Lys Pro Asn Met Ser Ala Ser Cys Lys Glu Ile Val Asp
Ser 100 105 110 tac ctc cct gtc atc ctg gac atc att aaa gga gaa atg
agc cgt cct 384 Tyr Leu Pro Val Ile Leu Asp Ile Ile Lys Gly Glu Met
Ser Arg Pro 115 120 125 ggg gag gtg tgc tct gct ctc aac ctc tgc gag
tct ctc cag aag cac 432 Gly Glu Val Cys Ser Ala Leu Asn Leu Cys Glu
Ser Leu Gln Lys His 130 135 140 cta gca gag ctg aat cac cag aag cag
ctg gag tcc aat aag atc cca 480 Leu Ala Glu Leu Asn His Gln Lys Gln
Leu Glu Ser Asn Lys Ile Pro 145 150 155 160 gag ctg gac atg act gag
gtg gtg gcc ccc ttc atg gcc aac atc cct 528 Glu Leu Asp Met Thr Glu
Val Val Ala Pro Phe Met Ala Asn Ile Pro 165 170 175 ctc ctc ctc tac
cct cag gac ggc ccc cgc agc aag ccc cag cca aag 576 Leu Leu Leu Tyr
Pro Gln Asp Gly Pro Arg Ser Lys Pro Gln Pro Lys 180 185 190 gat aat
ggg gac gtt tgc cag gac tgc att cag atg gtg act gac atc 624 Asp Asn
Gly Asp Val Cys Gln Asp Cys Ile Gln Met Val Thr Asp Ile 195 200 205
cag act gct gta cgg acc aac tcc acc ttt gtc cag gcc ttg gtg gaa 672
Gln Thr Ala Val Arg Thr Asn Ser Thr Phe Val Gln Ala Leu Val Glu 210
215 220 cat gtc aag gag gag tgt gac cgc ctg ggc cct ggc atg gcc gac
ata 720 His Val Lys Glu Glu Cys Asp Arg Leu Gly Pro Gly Met Ala Asp
Ile 225 230 235 240 tgc aag aac tat atc agc cag tat tct gaa att gct
atc cag atg atg 768 Cys Lys Asn Tyr Ile Ser Gln Tyr Ser Glu Ile Ala
Ile Gln Met Met 245 250 255 atg cac atg caa ccc aag gag atc tgt gcg
ctg gtt ggg ttc tgt gat 816 Met His Met Gln Pro Lys Glu Ile Cys Ala
Leu Val Gly Phe Cys Asp 260 265 270 gag gtg aaa gag atg ccc atg cag
act ctg gtc ccc gcc aaa gtg gcc 864 Glu Val Lys Glu Met Pro Met Gln
Thr Leu Val Pro Ala Lys Val Ala 275 280 285 tcc aag aat gtc atc cct
gcc ctg gaa ctg gtg gag ccc att aag aag 912 Ser Lys Asn Val Ile Pro
Ala Leu Glu Leu Val Glu Pro Ile Lys Lys 290 295 300 cac gag gtc cca
gca aag tct gat gtt tac tgt gag gtg tgt gaa ttc 960 His Glu Val Pro
Ala Lys Ser Asp Val Tyr Cys Glu Val Cys Glu Phe 305 310 315 320 ctg
gtg aag gag gtg acc aag ctg att gac aac aac aag act gag aaa 1008
Leu Val Lys Glu Val Thr Lys Leu Ile Asp Asn Asn Lys Thr Glu Lys 325
330 335 gaa ata ctc gac gct ttt gac aaa atg tgc tcg aag ctg ccg aag
tcc 1056 Glu Ile Leu Asp Ala Phe Asp Lys Met Cys Ser Lys Leu Pro
Lys Ser 340 345 350 ctg tcg gaa gag tgc cag gag gtg gtg gac acg tac
ggc agc tcc atc 1104 Leu Ser Glu Glu Cys Gln Glu Val Val Asp Thr
Tyr Gly Ser Ser Ile 355 360 365 ctg tcc atc ctg ctg gag gag gtc agc
cct gag ctg gtg tgc agc atg 1152 Leu Ser Ile Leu Leu Glu Glu Val
Ser Pro Glu Leu Val Cys Ser Met 370 375 380 ctg cac ctc tgc tct ggc
acg cgg ctg cct gca ctg acc gtt cac gtg 1200 Leu His Leu Cys Ser
Gly Thr Arg Leu Pro Ala Leu Thr Val His Val 385 390 395 400 act cag
cca aag gac ggt ggc ttc tgc gaa gtg tgc aag aag ctg gtg 1248 Thr
Gln Pro Lys Asp Gly Gly Phe Cys Glu Val Cys Lys Lys Leu Val 405 410
415 ggt tat ttg gat cgc aac ctg gag aaa aac agc acc aag cag gag atc
1296 Gly Tyr Leu Asp Arg Asn Leu Glu Lys Asn Ser Thr Lys Gln Glu
Ile 420 425 430 ctg gct gct ctt gag aaa ggc tgc agc ttc ctg cca gac
cct tac cag 1344 Leu Ala Ala Leu Glu Lys Gly Cys Ser Phe Leu Pro
Asp Pro Tyr Gln 435 440 445 aag cag tgt gat cag ttt gtg gca gag tac
gag ccc gtg ctg atc gag 1392 Lys Gln Cys Asp Gln Phe Val Ala Glu
Tyr Glu Pro Val Leu Ile Glu 450 455 460 atc ctg gtg gag gtg atg gat
cct tcc ttc gtg tgc ttg aaa att gga 1440 Ile Leu Val Glu Val Met
Asp Pro Ser Phe Val Cys Leu Lys Ile Gly 465 470 475 480 gcc tgc ccc
tcg gcc cat aag ccc ttg ttg gga act gag aag tgt ata 1488 Ala Cys
Pro Ser Ala His Lys Pro Leu Leu Gly Thr Glu Lys Cys Ile 485 490 495
tgg ggc cca agc tac tgg tgc cag aac aca gag aca gca gcc cag tgc
1536 Trp Gly Pro Ser Tyr Trp Cys Gln Asn Thr Glu Thr Ala Ala Gln
Cys 500 505 510 aat gct gtc gag cat tgc aaa cgc cat gtg tgg aac
taggaggagg 1582 Asn Ala Val Glu His Cys Lys Arg His Val Trp Asn 515
520 aatattccat cttggcagaa accacagcat tggttttttt ctacttgtgt
gtctggggga 1642 atgaacgcac agatctgttt gactttgtta taaaaatagg
gctcccccac ctcccccatt 1702 tctgtgtcct ttattgtagc attgctgtct
gcaagggagc ccctagcccc tggcagacat 1762 agctgcttca gtgccccttt
tctctctgct agatggatgt tgatgcactg gaggtctttt 1822 agcctgccct
tgcatggcgc ctgctggagg aggagagagc tctgctggca tgagccacag 1882
tttcttgact ggaggccatc aaccctcttg gttgaggcct tgttctggcc ctgacatgtg
1942 cttgggcact ggtgggcctg ggcttctgag gtggcctcct gccctgatca
gggaccctcc 2002 ccgctttcct gggcctctca gttgaacaaa gcagcaaaac
aaaggcagtt ttatatgaaa 2062 gattagaagc ctggaataat caggcttttt
aaatgatgta attcccactg taatagcata 2122 gggattttgg aagcagctgc
tggtggcttg ggacatcagt ggggccaagg gttctctgtc 2182 cctggttcaa
ctgtgatttg gctttcccgt gtctttcctg gtgatgcctt gtttggggtt 2242
ctgtgggttt gggtgggaag agggcaatct gcctgaatgt aacctgctag ctctccgaag
2302 gccctgcggg cctggcttgt gtgagcgtgt ggacagtggt ggccgcgctg
tgcctgctcg 2362 tgttgcctac atgtccctgg ctgttgaggc gctgcttcag
cctgcacccc tcccttgtct 2422 catagatgct ccttttgacc ttttcaaata
aatatggatg gcgagctcct aggcctctgg 2482 cttcctggta gagggcggca
tgccgaaggg tctgctcggt gtggattgga tgctggggtg 2542 tgggggttgg
aagctgtctg tggcccactt gggcacactt gggcacccac gcttctgtcc 2602
acttctggtt gccaggagac agcaagcaaa gccagcagga catgaagttg ctattaaatg
2662 gacttcgtga tttttgtttt gcactaaagt ttctgtgatt taacaataaa
attctgttag 2722 ccagaaaaaa aaaaaaaaaa aaaaaaa 2749 23 524 PRT Homo
sapiens 23 Met Tyr Ala Leu Phe Leu Leu Ala Ser Leu Leu Gly Ala Ala
Leu Ala 1 5 10 15 Gly Pro Val Leu Gly Leu Lys Glu Cys Thr Arg Gly
Ser Ala Val Trp 20 25 30 Cys Gln Asn Val Lys Thr Ala Ser Asp Cys
Gly Ala Val Lys His Cys 35 40 45 Leu Gln Thr Val Trp Asn Lys Pro
Thr Val Lys Ser Leu Pro Cys Asp 50 55 60 Ile Cys Lys Asp Val Val
Thr Ala Ala Gly Asp Met Leu Lys Asp Asn 65 70 75 80 Ala Thr Glu Glu
Glu Ile Leu Val Tyr Leu Glu Lys Thr Cys Asp Trp 85 90 95 Leu Pro
Lys Pro Asn Met Ser Ala Ser Cys Lys Glu Ile Val Asp Ser 100 105 110
Tyr Leu Pro Val Ile Leu Asp Ile Ile Lys Gly Glu Met Ser Arg Pro 115
120 125 Gly Glu Val Cys Ser Ala Leu Asn Leu Cys Glu Ser Leu Gln Lys
His 130 135 140 Leu Ala Glu Leu Asn His Gln Lys Gln Leu Glu Ser Asn
Lys Ile Pro 145 150 155 160 Glu Leu Asp Met Thr Glu Val Val Ala Pro
Phe Met Ala Asn Ile Pro 165 170 175 Leu Leu Leu Tyr Pro Gln Asp Gly
Pro Arg Ser Lys Pro Gln Pro Lys 180 185 190 Asp Asn Gly Asp Val Cys
Gln Asp Cys Ile Gln Met Val Thr Asp Ile 195 200 205 Gln Thr Ala Val
Arg Thr Asn Ser Thr Phe Val Gln Ala Leu Val Glu 210 215 220 His Val
Lys Glu Glu Cys Asp Arg Leu Gly Pro Gly Met Ala Asp Ile 225 230 235
240 Cys Lys Asn Tyr Ile Ser Gln Tyr Ser Glu Ile Ala Ile Gln Met Met
245 250 255 Met His Met Gln Pro Lys Glu Ile Cys Ala Leu Val Gly Phe
Cys Asp 260 265 270 Glu Val Lys Glu Met Pro Met Gln Thr Leu Val Pro
Ala Lys Val Ala 275 280 285 Ser Lys Asn Val Ile Pro Ala Leu Glu Leu
Val Glu Pro Ile Lys Lys 290 295 300 His Glu Val Pro Ala Lys Ser Asp
Val Tyr Cys Glu Val Cys Glu Phe 305 310 315 320 Leu Val Lys Glu Val
Thr Lys Leu Ile Asp Asn Asn Lys Thr Glu Lys 325 330 335 Glu Ile Leu
Asp Ala Phe Asp Lys Met Cys Ser Lys Leu Pro Lys Ser 340 345 350 Leu
Ser Glu Glu Cys Gln Glu Val Val Asp Thr Tyr Gly Ser Ser Ile 355 360
365 Leu Ser Ile Leu Leu Glu Glu Val Ser Pro Glu Leu Val Cys Ser Met
370 375 380 Leu His Leu Cys Ser Gly Thr Arg Leu Pro Ala Leu Thr Val
His Val 385 390 395 400 Thr Gln Pro Lys Asp Gly Gly Phe Cys Glu Val
Cys Lys Lys Leu Val 405 410 415 Gly Tyr Leu Asp Arg Asn Leu Glu Lys
Asn Ser Thr Lys Gln Glu Ile 420 425 430 Leu Ala Ala Leu Glu Lys Gly
Cys Ser Phe Leu Pro Asp Pro Tyr Gln 435 440 445 Lys Gln Cys Asp Gln
Phe Val Ala Glu Tyr Glu Pro Val Leu Ile Glu 450 455 460 Ile Leu Val
Glu Val Met Asp Pro Ser Phe Val Cys Leu Lys Ile Gly 465 470 475 480
Ala Cys Pro Ser Ala His Lys Pro Leu Leu Gly Thr Glu Lys Cys Ile 485
490 495 Trp Gly Pro Ser Tyr Trp Cys Gln Asn Thr Glu Thr Ala Ala Gln
Cys 500 505 510 Asn Ala Val Glu His Cys Lys Arg His Val Trp Asn 515
520 24 80 PRT Artificial Sequence Description of Artificial
Sequence Artificial Peptide Sequence 24 Ser Asp Val Tyr Cys Glu Val
Cys Glu Phe Leu Val Lys Glu Val Thr 1 5 10 15 Lys Leu Ile Asp Asn
Asn Lys Thr Glu Lys Glu Ile Leu Asp Ala Phe 20 25 30 Asp Lys Met
Cys Ser Lys Leu Pro Lys Ser Leu Ser Glu Glu Cys Gln 35 40 45 Glu
Val Val Asp Thr Tyr Gly Ser Ser Ile Leu Ser Ile Leu Leu Glu 50 55
60 Glu Val Ser Pro Glu Leu Val Cys Ser Met Leu His Leu Cys Ser Gly
65 70 75 80 25 12 PRT Artificial Sequence Description of Artificial
Sequence Artificial Peptide Sequence 25 Leu Ile Xaa Asn Asn Xaa Thr
Xaa Xaa Xaa Xaa Xaa 1 5 10
* * * * *