U.S. patent application number 10/600816 was filed with the patent office on 2004-06-24 for identification and modulation of a g-protein coupled receptor (gpcr), rai-3, associated with chronic obstructive pulmonary disease (copd) and nf-kappab and e-selectin regulation.
Invention is credited to Barber, Lauren E., Bennett, Kelley L., Cacace, Angela, Garulacan, Leah Ann, McKinnon, Murray, Opiteck, Gregory, Ramanathan, Chandra S., Tsuchihashi, Zenta, Whitney, Gena S..
Application Number | 20040121362 10/600816 |
Document ID | / |
Family ID | 30003172 |
Filed Date | 2004-06-24 |
United States Patent
Application |
20040121362 |
Kind Code |
A1 |
Whitney, Gena S. ; et
al. |
June 24, 2004 |
Identification and modulation of a G-protein coupled receptor
(GPCR), RAI-3, associated with chronic obstructive pulmonary
disease (COPD) and NF-kappaB and E-selectin regulation
Abstract
The present invention describes a G-protein coupled receptor
(GPCR) family member newly identified as being modified, e.g.,
phosphorylated, and associated with tyrosine phosphorylated
activation complexes, following exposure of cells to smoke from
tobacco burning substances, namely, cigarette smoke. This GPCR
protein is RAI-3, which was first found to be phosphorylated in
cells treated with cigarette smoke and to be associated with other
proteins activated in cigarette smoke treated cells by virtue of
the present invention. Because cigarette smoke is considered to be
a major causative factor of chronic obstructive pulmonary disease
(COPD) and disorders and conditions related thereto, the RAI-3
protein is newly provided as a cellular drug target for screening,
discovering, and identifying modulators for the treatment and/or
prevention of COPD and its related disorders and conditions, such
as emphysema and chronic bronchitis. In accordance with the present
invention RAI-3 modulators, e.g., agonists and antagonists, can be
used as therapeutics in the treatment of COPD and numerous other
diseases and disorders that are associated with regulation of
NF-.kappa.B and/or its associated or interacting signaling
molecules. This invention further provides SNPs of RAI-3, e.g., for
determining COPD association in individuals.
Inventors: |
Whitney, Gena S.;
(Lawrenceville, NJ) ; Opiteck, Gregory;
(Lawrenceville, NJ) ; Garulacan, Leah Ann;
(Langhorne, PA) ; Ramanathan, Chandra S.;
(Wallingford, CT) ; McKinnon, Murray; (Washington
Crossing, PA) ; Bennett, Kelley L.; (Skillman,
NJ) ; Barber, Lauren E.; (Higganum, CT) ;
Cacace, Angela; (Clinton, CT) ; Tsuchihashi,
Zenta; (Skillman, NJ) |
Correspondence
Address: |
STEPHEN B. DAVIS
BRISTOL-MYERS SQUIBB COMPANY
PATENT DEPARTMENT
P O BOX 4000
PRINCETON
NJ
08543-4000
US
|
Family ID: |
30003172 |
Appl. No.: |
10/600816 |
Filed: |
June 20, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60390850 |
Jun 20, 2002 |
|
|
|
60407006 |
Aug 29, 2002 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/320.1; 435/325; 435/69.1; 530/350; 536/23.5 |
Current CPC
Class: |
G01N 2800/122 20130101;
C07K 14/705 20130101; G01N 33/5011 20130101; G01N 33/5041 20130101;
G01N 33/5017 20130101; G01N 2333/726 20130101; C12Q 1/6886
20130101; G01N 33/5091 20130101; G01N 33/566 20130101; G01N 2500/00
20130101; C12Q 2600/136 20130101; G01N 33/5044 20130101; G01N
33/5008 20130101; G01N 33/6884 20130101; G01N 33/5023 20130101;
G01N 33/574 20130101; G01N 33/74 20130101; C12Q 2600/158
20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/320.1; 435/325; 530/350; 536/023.5 |
International
Class: |
C12Q 001/68; C07H
021/04; C07K 014/705 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence selected from the group consisting of:
(a) a polynucleotide fragment of SEQ ID NO:2 or a polynucleotide
fragment of the cDNA sequence included in ATCC Deposit No: ______,
which is hybridizable to SEQ ID NO:2; (b) a polynucleotide encoding
a polypeptide fragment of SEQ ID NO:3 or a polypeptide fragment
encoded by the cDNA sequence included in ATCC Deposit No: ______,
which is hybridizable to SEQ ID NO:2; (c) a polynucleotide encoding
a polypeptide domain of SEQ ID NO:3 or a polypeptide domain encoded
by the cDNA sequence included in ATCC Deposit No: ______, which is
hybridizable to SEQ ID NO:2; (d) a polynucleotide encoding a
polypeptide epitope of SEQ ID NO:3 or a polypeptide epitope encoded
by the cDNA sequence included in ATCC Deposit No: ______, which is
hybridizable to SEQ ID NO:2; (e) a polynucleotide encoding a
polypeptide of SEQ ID NO:3 or the cDNA sequence included in ATCC
Deposit No: ______, which is hybridizable to SEQ ID NO:2, having
biological activity; (f) a polynucleotide which is a variant of SEQ
ID NO:2; (g) a polynucleotide which is an allelic variant of SEQ ID
NO:2; (h) an isolated polynucleotide comprising nucleotides 251 to
1324 of SEQ ID NO:2, wherein said nucleotides encode a polypeptide
corresponding to amino acids 2 to 357 of SEQ ID NO:3 minus the
start methionine; (i) an isolated polynucleotide comprising
nucleotides 254 to 1324 of SEQ ID NO:2, wherein said nucleotides
encode a polypeptide corresponding to amino acids 2 to 357 of SEQ
ID NO:3 including the start codon; (j) an isolated polynucleotide
comprising nucleotides 521 to 565 of SEQ ID NO:2, wherein said
nucleotides encode a polypeptide corresponding to amino acids 90 to
104 of SEQ ID NO:3; (k) an isolated polynucleotide comprising
nucleotides 1055 to 1105 of SEQ ID NO:2, wherein said nucleotides
encode a polypeptide corresponding to amino acids 269 to 284 of SEQ
ID NO:3; (l) an isolated polynucleotide comprising nucleotides 1271
to 1312 of SEQ ID NO:2, wherein said nucleotides encode a
polypeptide corresponding to amino acids 340 to 353 of SEQ ID NO:3;
(m) an isolated polynucleotide comprising nucleotides 716 to 787 of
SEQ ID NO:2, wherein said nucleotides encode a polypeptide
corresponding to amino acids 155 to 178 of SEQ ID NO:3; (n) an
isolated polynucleotide comprising nucleotides 947 to 997 of SEQ ID
NO:2, wherein said nucleotides encode a polypeptide corresponding
to amino acids 232 to 248 of SEQ ID NO:3; (o) an isolated
polynucleotide comprising nucleotides 1106 to 1165 of SEQ ID NO:2,
wherein said nucleotides encode a polypeptide corresponding to
amino acids 285 to 304 of SEQ ID NO:3; (p) a polynucleotide which
represents the complimentary sequence (antisense) of SEQ ID NO:2;
and (q) a polynucleotide capable of hybridizing under stringent
conditions to any one of the polynucleotides specified in (a)-(p),
wherein said polynucleotide does not hybridize under stringent
conditions to a nucleic acid molecule having a nucleotide sequence
of only A residues or of only T residues.
2. The isolated nucleic acid molecule of claim 1, wherein the
polynucleotide fragment consists of a nucleotide sequence encoding
a human G-protein coupled receptor.
3. A recombinant vector comprising the isolated nucleic acid
molecule of claim 1.
4. A recombinant host cell comprising the vector sequences of claim
3.
5. An isolated polypeptide comprising an amino acid sequence
selected from the group consisting of: (a) a polypeptide fragment
of SEQ ID NO:3 or the encoded sequence included in ATCC Deposit No:
______; (b) a polypeptide fragment of SEQ ID NO:3 or the encoded
sequence included in ATCC Deposit No: ______, having coupling
activity; (c) a polypeptide domain of SEQ ID NO:3 or the encoded
sequence included in ATCC Deposit No: ______; (d) a polypeptide
epitope of SEQ ID NO:3 or the encoded sequence included in ATCC
Deposit No: ______; (e) a full length protein of SEQ ID NO:3 or the
encoded sequence included in ATCC Deposit No: ______; (f) a
polypeptide comprising amino acids 2 to 357 of SEQ ID NO:3, wherein
said amino acids 2 to 357 comprising a polypeptide of SEQ ID NO:3
minus the start methionine; (g) a polypeptide comprising amino
acids 1 to 357 of SEQ ID NO:3; (h) a polypeptide comprising amino
acids 90 to 104 of SEQ ID NO:3; (i) a polypeptide comprising amino
acids 269 to 284 of SEQ ID NO:3; (j) a polypeptide comprising amino
acids 340 to 353 of SEQ ID NO:3; (k) a polypeptide comprising amino
acids 155 to 178 of SEQ ID NO:3; (l) a polypeptide comprising amino
acids 232 to 248 of SEQ ID NO:3; and (m) a polypeptide comprising
amino acids 285 to 304 of SEQ ID NO:3.
6. The isolated polypeptide of claim 5, wherein the full length
protein comprises sequential amino acid deletions from either the
C-terminus or the N-terminus.
7. An isolated antibody that binds specifically to the isolated
polypeptide of claim 5.
8. A recombinant host cell that expresses the isolated polypeptide
of claim 5.
9. A method of making an isolated polypeptide comprising: (a)
culturing the recombinant host cell of claim 8 under conditions
such that said polypeptide is expressed; and (b) recovering said
polypeptide.
10. The polypeptide produced by claim 9.
11. A method for preventing, treating, or ameliorating a medical
condition, comprising the step of administering to a mammalian
subject a therapeutically effective amount of the polypeptide of
claim 5, or a modulator thereof.
12. A method of diagnosing a pathological condition or a
susceptibility to a pathological condition in a subject comprising:
(a) determining the presence or absence of a mutation in the
polynucleotide of claim 1; and (b) diagnosing a pathological
condition or a susceptibility to a pathological condition based on
the presence or absence of said mutation.
13. A method of diagnosing a pathological condition or a
susceptibility to a pathological condition in a subject comprising:
(a) determining the presence or amount of expression of the
polypeptide of claim 5 in a biological sample; and (b) diagnosing a
pathological condition or a susceptibility to a pathological
condition based on the presence or amount of expression of the
polypeptide.
14. An antisense compound 8 to 30 nucleotides in length that
specifically hybridizes to a nucleic acid molecule encoding the
human RAI-3 polypeptide having the sequence set forth in SEQ ID
NO:3, wherein said antisense compound inhibits the expression of
the human RAI-3 polypeptide.
15. The antisense compound according to claim 14 wherein said
antisense compound is selected from the group consisting of: SEQ ID
NO:52, 53, 54, 55, 56, 57, 58, 59, 60, and 61.
16. A method of inhibiting the expression of the human RAI-3
polypeptide having the sequence set forth in SEQ ID NO:3 in human
cells or tissues comprising contacting said cells or tissues in
vitro with an antisense compound of claim 15 so that expression of
the RAI-3 polypeptide is inhibited.
17. A method for preventing, treating, or ameliorating a medical
condition, comprising the step of administering to a mammalian
subject a therapeutically effective amount of the antisense
compound according to claim 15.
18. The antisense compound according to claim 14, wherein said
antisense compound is double stranded.
19. The antisense compound according to claim 18, wherein said
antisense compound is a DNA/RNA hybrid.
20. The antisense compound according to claim 19 wherein said
antisense compound is selected from the group consisting of: SEQ ID
NO:94, and 95.
21. An isolated polynucleotide comprising one or more polymorphic
alleles selected from the group consisting of: SEQ ID NO:18, 22,
23, 24, 25, 26, 27, 28, 29, 65, 66, 67, 68, 69, and 70.
22. The isolated polynucleotide comprising one or more polymorphic
alleles of claim 21 comprising a reference allele at one or more
polymorphic loci.
23. The isolated polynucleotide comprising one or more polymorphic
alleles of claim 21 comprising an alternate allele at one or more
polymorphic loci.
24. An isolated polypeptide comprising one or more polymorphic
alleles selected from the group consisting of: SEQ ID NO:19, 8, 9,
13, 15, 17, 20, and 21.
25. The isolated polypeptide comprising one or more polymorphic
alleles of claim 24 comprising a reference allele at one or more
polymorphic loci.
26. The isolated polypeptide comprising one or more polymorphic
alleles of claim 24 comprising an alternate allele at one or more
polymorphic loci.
27. The method of diagnosing a pathological condition of claim 13
wherein the condition is a member of the group consisting of: a
disorder related to aberrant G-protein coupled signaling; a
disorder related to aberrant cell cycle regulation; pulmonary
disorders, inflammatory lung disorders, COPD, the underlying
symptoms of COPD, COPD-related disorders and/or conditions,
autoimmune disorders, disorders related to hyperimmune activity,
inflammatory conditions, disorders related to aberrant acute phase
responses, hypercongenital conditions, birth defects, necrotic
lesions, wounds, organ transplant rejection, conditions related to
organ transplant rejection, renal diseases, ischemia-reperfusion
injury, heart disorders, disorders related to aberrant signal
transduction, proliferation disorders, cancers, such as lung
cancer, stomach cancer, testicular cancer, breast cancer, etc.,
metastases, HIV infection, or HIV propagation in cells infected
with other viruses, asthma, cystic fibrosis and pulmonary fibrosis,
ulcerative colitis, cerebral infarct, myocardial infarct, diabetic
nephropathy, allergic rhinitis, Crohn's disease, atherosclerosis,
rheumatoid arthritis, inflammatory/auto-immune disorders outside of
the lung in addition to COPD, glioblastoma, pulmonary small cell
undifferentiated carcinoma, carcinoma of the breast, colon, lung,
ovary, pancreas, prostate, non-Hodgkin's lymphoma, disorders
associated with aberrant cell adhesion, disorders associated with
aberrant I-CAM function and/or regulation, disorders associated
with aberrant E-selectin function and/or regulation, disorders
associated with aberrant NF-.kappa.B function and/or
regulation.
28. The method for preventing, treating, or ameliorating a medical
condition of claim 11, wherein the medical condition is selected
from the group consisting of: a disorder related to aberrant
G-protein coupled signaling; a disorder related to aberrant cell
cycle regulation; pulmonary disorders, inflammatory lung disorders,
COPD, the underlying symptoms of COPD, COPD-related disorders
and/or conditions, autoimmune disorders, disorders related to
hyperimmune activity, inflammatory conditions, disorders related to
aberrant acute phase responses, hypercongenital conditions, birth
defects, necrotic lesions, wounds, organ transplant rejection,
conditions related to organ transplant rejection, renal diseases,
ischemia-reperfusion injury, heart disorders, disorders related to
aberrant signal transduction, proliferation disorders, cancers,
such as lung cancer, stomach cancer, testicular cancer, breast
cancer, etc., metastases, HIV infection, or HIV propagation in
cells infected with other viruses, asthma, cystic fibrosis and
pulmonary fibrosis, ulcerative colitis, cerebral infarct,
myocardial infarct, diabetic nephropathy, allergic rhinitis,
Crohn's disease, atherosclerosis, rheumatoid arthritis,
inflammatory/auto-immune disorders outside of the lung in addition
to COPD, glioblastoma, pulmonary small cell undifferentiated
carcinoma, carcinoma of the breast, colon, lung, ovary, pancreas,
prostate, non-Hodgkin's lymphoma, disorders associated with
aberrant cell adhesion, disorders associated with aberrant I-CAM
function and/or regulation, disorders associated with aberrant
E-selectin function and/or regulation, disorders associated with
aberrant NF-.kappa.B function and/or regulation.
29. A method of screening for candidate compounds capable of
modulating the activity of a G-protein coupled receptor
polypeptide, comprising: (a) contacting a test compound with a cell
or tissue comprising an expression vector capable of expressing a
polypeptide comprising an amino acid sequence as set forth in SEQ
ID NO:3, under conditions in which said polypeptide is expressed;
and (b) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide.
30. The method according to claim 29 wherein said cells comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements.
31. The method according to claim 31 wherein said cells further
comprise a vector comprising the coding sequence of G alpha 15
under conditions wherein G alpha 15 is expressed.
32. The method according to claim 31 wherein said cells express the
G-protein coupled receptor polypeptide at low levels relative to an
internal control polypeptide.
33. The method according to claim 26 wherein said cells express the
G-protein coupled receptor polypeptide at high levels relative to
an internal control polypeptide.
34. A method of predicting the likelihood that an individual will
be diagnosed as being at risk of developing COPD, a COPD-like
disorder, or one or more of the underlying symptoms of COPD, upon
exposure to cigarette smoke, wherein said method comprises the
steps of: a.) determining the level of RAI-3 expression relative to
a control; and b.) associating said level with the likelihood of
being at risk of developing COPD, a COPD-like disorder, or one or
more of the underlying symptoms of COPD, upon exposure to cigarette
smoke.
Description
[0001] This application claims benefit to provisional application
U.S. Serial No. 60/390,850 filed Jun. 20, 2002; and to provisional
application U.S. Serial No. 60/407,006, filed Aug. 29, 2002, under
35 U.S.C. 119(e). The entire teachings of the referenced
applications are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the identification of drug
targets, and modulators thereof, for the treatment of chronic
obstructive pulmonary disease (COPD) and COPD related disorders and
conditions, such as emphysema and chronic bronchitis, as well as
for the treatment of other diseases and disorders related to the
regulation and/or mediation of the NF-.kappa.B pathway and
components thereof. In particular, this invention relates to the
new discovery that the RAI-3 protein, a member of the G-protein
coupled receptor (GPCR) superfamily, is associated with the
development of COPD and COPD related disorders and conditions. The
invention further relates to modulators of the RAI-3 protein and
their use in methods of treating not only COPD, but also a variety
of other diseases and conditions that are affected or mediated by
NF-.kappa.B regulation.
BACKGROUND OF THE INVENTION
[0003] Many medically significant biological processes that are
mediated by proteins participating in signal transduction pathways
involving G-proteins and/or second messengers, e.g., cAMP, have
been established (Lefkowitz, 1991, Nature, 351:353-354). These
proteins are often referred to as proteins participating in
pathways with G-proteins or PPG proteins. Some examples of these
proteins include the G protein-coupled receptors (GPCR), such as
those for adrenergic agents and dopamine (B. K. Kobilka et al.,
1987, Proc. Natl. Acad. Sci. USA, 84:46-50; B. K. Kobilka et al.,
1987, Science, 238:650-656; and J. R. Bunzow et al., 1988, Nature,
336:783-787), G-proteins themselves, effector proteins, e.g.,
phospholipase C, adenylate cyclase and phosphodiesterase and
actuator proteins, e.g., protein kinase A and protein kinase C (M.
I. Simon et al., 1991, Science, 252:802-8).
[0004] For example, in one form of signal transduction, the effect
of hormone binding results in activation of the enzyme adenylate
cyclase inside the cell. Enzyme activation by hormones is dependent
on the presence of the nucleotide GTP, where GTP also influences
hormone binding. A G-protein binds the hormone receptors to
adenylate cyclase. The G-protein has further been shown to exchange
GTP for bound GDP when activated by hormone receptors. The
GTP-carrying form of the G-protein then binds to an activated
adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the
G-protein itself, returns the G-protein to its basal, inactive
form. Thus, the G-protein serves a dual role--as an intermediate
that relays the signal from receptor to effector, and as a "clock"
that controls the duration of the signal.
[0005] The membrane protein gene superfamily of G-protein coupled
receptors (GPCRs) has been characterized as having seven putative
transmembrane domains. The domains are believed to represent
transmembrane .alpha.-helices connected by extracellular or
cytoplasmic loops. GPCRs include a wide range of biologically
active receptors, such as hormone, viral, growth factor, and
neuronal receptors.
[0006] GPCRs are further characterized as having seven conserved
hydrophobic stretches of about 20 to 30 amino acids, connecting at
least eight divergent hydrophilic loops. The G-protein coupled
receptor family includes, for example, the following types of
receptors: dopamine, calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, histamine,
thrombin, kinin, follicle stimulating hormone, opsins, endothelial
differentiation gene-1 receptor, rhodopsins, odorant and
cytomegalovirus receptors, etc.
[0007] Most GPCRs have single conserved cysteine residues in each
of the first two extracellular loops which form disulfide bonds
that are believed to stabilize functional protein structure. The 7
transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5,
TM6, and TM7. TM3 has been implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or farnesylation) of
cysteine residues can influence signal transduction of some GPCRs.
Most GPCRs contain potential phosphorylation sites within the third
cytoplasmic loop and/or the carboxyl terminus. For several GPCRs,
such as the .beta.-adrenoreceptor, phosphorylation by protein
kinase A and/or specific receptor kinases mediates receptor
desensitization.
[0008] For some receptors, the ligand binding sites of GPCRs are
believed to comprise a hydrophilic socket formed by the
transmembrane domains of several GPCRs. This socket is surrounded
by hydrophobic residues of the GPCRs. The hydrophilic side of each
GPCR transmembrane helix is postulated to face inward and form the
polar ligand-binding site. TM3 has been implicated in several GPCRs
as having a ligand-binding site, which includes the TM3 aspartate
residue. In addition, serines within TM5, a TM6 asparagine and
phenylalanines or tyrosines within TM6 or TM7 are also implicated
in ligand binding.
[0009] GPCRs can be intracellularly coupled by heterotrimeric
G-proteins to various intracellular enzymes, signal transduction
pathways and molecules, ion channels and transporters (see, e.g.,
Johnson et al., 1989, Endocrin. Rev., 10:317-331). Different
G-protein .beta.-subunits preferentially stimulate particular
effectors to modulate various biological functions in a cell.
Phosphorylation of cytoplasmic residues of GPCRs have been
identified as an important mechanism for the regulation of
G-protein coupling of some GPCRs. GPCRs are found in numerous sites
within a mammalian host.
[0010] GPCRs are one of the largest receptor superfamilies known.
These receptors are biologically important and malfunction of these
receptors results in diseases such as Alzheimer's, Parkinson,
diabetes, dwarfism, color blindness, retinitis pigmentosa, asthma
and others. GPCRs are also involved in depression, schizophrenia,
sleeplessness, hypertension, anxiety, stress, renal failure and in
several other cardiovascular, metabolic, neural, oncological and
immune disorders (F. Horn and G. Vriend, 1998, J. Mol. Med.,
76:464-468). They have also been shown to play a role in HIV
infection (Y. Feng et al., 1996, Science, 272: 872-877).
[0011] As mentioned above, the structure of GPCRs comprises seven
transmembrane helices that are connected by loops. The N-terminus
is always extracellular and C-terminus is intracellular. GPCRs are
involved in signal transduction. The signal is typically received
at the extracellular N-terminus side. The signal can be an
endogenous ligand, a chemical moiety, another type of extracellular
signal, and even light. This signal is then transduced through the
membrane to the cytosolic side where a heterotrimeric G-protein is
activated which in turn elicits a response (F. Horn et al., 1998,
Recept. and Chann., 5: 305-314).
[0012] Modulators, e.g., ligands, agonists and antagonists, for
GPCRs are utilized for preventative and therapeutic purposes to
treat various diseases, disorders and/or conditions. The present
invention has achieved the identification of a particular GPCR,
newly linked by this invention to chronic obstructive pulmonary
disease (COPD) and COPD-related disorders and conditions. This
COPD-related GPCR, as described herein and newly associated with
COPD, provides a new target for drug discovery and treatments
effective against COPD and disorders and conditions related
thereto. In addition, modulators of this COPD-related GPCR have
been newly found in accordance with the present invention and as
described herein to affect transcriptional mediators and signaling
molecules, thereby providing new agents for treating not only COPD,
but also other diseases and conditions affected by regulation of
these transcriptional mediators, components of pathways related
thereto and/or cell signaling components.
[0013] Chronic obstructive pulmonary disease (COPD), which
encompasses both chronic bronchitis and emphysema, is one of the
most common respiratory conditions of adults in the developed
world. COPD poses an enormous burden to society both in terms of
direct cost to healthcare services and indirect costs to society,
primarily through loss of productivity. In the Western world, COPD
is the fourth most common cause of death and it claims the lives of
over 119,000 Americans annually. Approximately eighty to ninety
percent of COPD patients have smoked and/or do smoke
cigarettes.
[0014] The definition of COPD that is recognized by both the
American Thoracic Society and the European Respiratory Society is a
disorder characterized by reduced maximal expiratory flow and slow
forced emptying of the lungs--features that do not change markedly
over several months. This limitation in airflow is only minimally
reversible with bronchodilators. The respiratory disease emphysema
is defined pathologically as a condition in which there is
permanent destructive enlargement of the air spaces distal to the
terminal bronchioles without obvious fibrosis. Chronic bronchitis
is defined clinically by the presence of chronic bronchial
secretions, enough to cause expectoration, occurring on most days
for a minimum of three months of the year for two consecutive
years. The pathological basis of chronic bronchitis is mucus
hypersecretion secondary to hypertrophy of the glandular elements
of the bronchial mucosa. Patients with COPD have features of both
conditions, although one of the conditions may be more prominent
than the other.
[0015] Chronic bronchitis only really became recognized as a
distinct disease, rather than as a set of symptoms, in the late
1950's. The great `British Smogs` of the 1950's precipitated the
deaths of many patients from respiratory failure. There is little
doubt that at the present time, the most important risk factor in
the development of COPD is smoking of tobacco burning products, in
particular, cigarette smoking. Because approximately 80 to 90% of
COPD cases are caused by smoking, a smoker is ten times more likely
than a nonsmoker to die of COPD. According to the World Health
Organization, 75% of deaths from COPD that occur in developed
countries are directly related to smoking tobacco.
[0016] The effects of smoke from tobacco burning products, such as
cigarette smoke, on the lungs are manifold. Cigarette smoke has
been found to attract inflammatory cells into the lungs and
stimulates the release of the proteolytic enzyme elastase from
these cells. Elastase, in turn, breaks down elastin, a normal
structural component of lung tissue. Normally, however, the lung is
protected from the destructive effect of elastase by an inhibitor,
alpha-1 antitrypsin (AAT). One effect of cigarette smoke is to
attract more cells and stimulate the release of more elastase. The
development of COPD, and in particular emphysema, is thought to be
due, in part, to the imbalance between the destructive elastase and
the protective AAT.
[0017] Not all people who smoke develop COPD; and not all patients
with COPD are smokers, or have smoked in the past (although 85%- to
90% of COPD patients have smoked or are smoking). There seems to be
a varying susceptibility to lung damage due to cigarette smoke
within the general population. Only a proportion of smokers (maybe
only 10-15%) or former smokers show a rate of decline of lung
function over the years that is fast enough to result in the severe
impairment that is typical of patients who present with
breathlessness due to COPD. Unfortunately, these types of former
smokers do not improve after they stop smoking. By the time these
subjects are symptomatic with breathlessness, they will have
already had severe impairment of lung function. Cessation of
smoking at this stage may extend their life expectancy, but may not
improve their symptoms.
[0018] Another well established risk factor for COPD is a
deficiency of the protective protease inhibitor, alpha-1
antitrypsin (AAT), which is produced in the liver. The risk factor
relates to an inherited autosomal recessive (designated PiZZ)
disorder which is fairly rare in the general gene pool. The
incidence of homozygous births is about 1 in 3000 live births. As
such, AAT deficiency accounts for probably less than 5% of all
cases of COPD. The onset of AAT deficiency emphysema generally
occurs between the ages of 20 to 40 years and is characterized by
shortness of breath and decreased exercise capacity. Blood
screening is used if the trait is suspected and can determine if a
person is a carrier, or is AAT-deficient. If children are diagnosed
as being AAT-deficient through blood screening, they may undergo a
liver transplant.
[0019] Low levels of AAT allow the uninhibited action of elastase
on the lung parenchyma, thereby giving rise to destruction of the
alveoli and the eventual development of emphysema rather than
chronic bronchitis. The pattern of emphysema in AAT deficiency
differs slightly from that of smoking-induced pure emphysema in
that AAT deficiency produces panlobular emphysema affecting
predominantly the lower lung fields, while smoking-induced
emphysema is usually centrilobular affecting the upper lung fields
initially.
[0020] The quality of life for a person suffering from COPD
diminishes as the disease progresses. People with COPD may
eventually require supplemental oxygen and may have to rely on
mechanical respiratory assistance. A recent American Lung
Association survey revealed that about half of all COPD patients
(i.e., 51%) indicate that their condition limits their ability to
work. It also limits them in normal physical exertion (70%),
household chores (56%), social activities (53%), sleeping (50%),
and family activities (46%).
[0021] None of the existing medications for COPD have been shown to
modify the long-term decline in lung function that is the hallmark
of this disease. Therefore, pharmacotherapy for COPD is used to
decrease symptoms and/or complications. Bronchodilator medications
are central to the symptomatic management of COPD. Additional
treatment includes antibodies, oxygen therapy, and systemic
glucocorticosteroids. The efficacy of inhaled glucocorticosteroids
is currently under study. Chronic treatment with steroids is
avoided because of an unfavorable benefit-to-risk ratio. Lung
transplantation is being performed in increasing numbers and may be
an option for people who suffer from severe emphysema. In addition,
lung volume reduction surgery has shown promise and is being
performed with increasing frequency. However, a recent study found
that emphysema patients who have severe lung obstruction with
either limited ability to exchange gas when breathing, or damage
that is evenly distributed throughout their lungs, are at high risk
of death from the foregoing procedures. Treatments for AAT
deficiency emphysema, including AAT replacement therapy and gene
therapy, are currently being evaluated.
[0022] Because of the magnitude of the health and health care
problems that correlate with COPD and COPD related conditions and
disorders, both at the level of the patient and the patient's care
by the medical community, it is clear that new drug target
molecules, as well as alternative drugs and treatments, are sorely
needed to combat and counteract this disease. As discussed above,
the present therapies are sometimes only palliative, and do not
satisfactorily treat, reduce, ameliorate, or eliminate all of the
debilitating effects of COPD.
[0023] In addition, as described herein, it is newly recognized
that the prevalent use of tobacco burning materials and substances,
such as cigarettes and cigars, generates smoke-related cellular
products, e.g., proteins and peptides, which are major causative
factors for COPD. Therefore, identifying the proteins, signal
transduction pathways and components thereof that are activated
and/or modified when cells are exposed to smoke from tobacco
burning products can be key to identifying new drug targets for the
treatment of COPD. The present invention newly provides previously
unrecognized sources and targets for new anti-COPD drugs and
compounds useful in profoundly needed treatments and therapies for
COPD and COPD related diseases, which can benefit vast numbers of
COPD patients and sufferers.
[0024] In their diverse cellular roles, GPCRs can also be involved
in cell suicide, or programmed cell death, during the lifetime of a
multicellular organism. Programmed cell death or apoptosis occurs
during a number of events in the organism's life cycle, such as for
example, in the development of an embryo, during the course of an
immunological response, or in the demise of cancerous cells after
drug treatment, among others. The final outcome of cell survival
versus apoptosis is dependent on the balance of two counteracting
events, namely, the onset and speed of caspase cascade activation
(essentially a protease chain reaction), and the delivery of
anti-apoptotic factors which block the caspase activity (B. B.
Aggarwal, 2000, Biochem. Pharmacol., 60:1033-1039; N. A. Thornberry
and Y. Lazebnik, 1998, Science, 281:1312-1316).
[0025] The production of anti-apoptotic proteins is controlled by
the transcriptional factor complex NF-.kappa.B. For example,
exposure of cells to the protein tumor necrosis factor (TNF) can
signal both cell death and survival, an event playing a major role
in the regulation of immunological and inflammatory responses (S.
Ghosh et al., 1998, Annu. Rev. Immunol., 16:225-260; N. Silverman
and T. Maniatis, 2001, Genes and Dev., 15:2321-2342; and V. Baud
and M. Karin, 2001, Trends Cell Biol., 11:372-377). The
anti-apoptotic activity of NF-.kappa.B is also crucial to
oncogenesis and to chemo- and radio-resistance in cancer (A. S.
Baldwin, 2001, J. Clin. Invest., 107:241-246).
[0026] Nuclear Factor-.kappa.B (NF-.kappa.B), is composed of
dimeric complexes of p50 (NF-.kappa.B1) or p52 (NF-.kappa.B2) that
are usually associated with members of the Rel family (p65, c-Rel,
Rel B) which have potent transactivation domains. Different
combinations of NF-.kappa.B/Rel proteins bind to distinct .kappa.B
sites to regulate the transcription of different genes. Early work
involving NF-.kappa.B suggested that its expression was limited to
specific cell types, particularly in stimulating the transcription
of genes encoding kappa immunoglobulins in B lymphocytes. However,
it has been discovered that NF-.kappa.B is, in fact, present and
inducible in many, if not all, cell types and that it acts as an
intracellular messenger capable of playing a broad role in gene
regulation as a mediator of inducible signal transduction.
Specifically, it has been demonstrated that NF-.kappa.B plays a
central role in the regulation of intercellular signals in many
cell types. For example, NF-.kappa.B has been shown to positively
regulate the human beta-interferon (beta-IFN) gene in many, if not
all, cell types. Moreover, NF-.kappa.B has also been shown to serve
the important function of acting as an intracellular transducer of
external influences.
[0027] The transcription factor NF-.kappa.B is sequestered in an
inactive form in the cytoplasm as a complex with its inhibitor,
I.kappa.B; the most prominent member of the class of I.kappa.B
inhibitors is I.kappa.B.alpha.. A number of factors are known to
serve the role of stimulators of NF-.kappa.B activity, such as, for
example, tumor necrosis factor (TNF). After TNF exposure, the
inhibitor is phosphorylated and proteolytically removed, thus
releasing NF-.kappa.B into the nucleus and allowing its
transcriptional activity. Numerous genes are up-regulated by this
transcription factor, among them I.kappa.B.alpha.. The newly
synthesized I.kappa.B.alpha. protein inhibits NF-.kappa.B,
effectively shutting down further transcriptional activation of its
downstream effectors.
[0028] However, as mentioned above, the I.kappa.B.alpha. protein
may only inhibit NF-.kappa.B in the absence of I.kappa.B.alpha.
stimuli, such as TNF stimulation, for example. Other agents that
are known to stimulate NF-.kappa.B release, and thus NF-.kappa.B
activity, are bacterial lipopolysaccharide, extracellular
polypeptides, chemical agents, such as phorbol esters, which
stimulate intracellular phosphokinases, inflammatory cytokines,
IL-1, oxidative and fluid mechanical stresses, and Ionizing
Radiation (S. Basu et al., 1998, Biochem. Biophys. Res. Commun.,
247(1):79-83). Therefore, as a general rule, the stronger the
insulting stimulus, the stronger the resulting NF-.kappa.B
activation, and the higher the level of I.kappa.B.alpha.
transcription. As a consequence, measuring the level of
I.kappa.B.alpha. RNA can be used as a marker for anti-apoptotic
events, and indirectly, for the onset and strength of pro-apoptotic
events.
SUMMARY OF THE INVENTION
[0029] The present invention relates to the identification of
proteins and their component peptides that are activated when cells
are exposed to smoke from tobacco burning products, particularly,
cigarette smoke. Since cigarette smoke is the major causative
factor for COPD, this invention has provided an innovative means of
newly identifying proteins, signal transduction pathways and
components thereof that are activated and/or modified when cells
are exposed to cigarette smoke (or smoke resulting from the burning
of other tobacco-containing substances). According to the present
invention, the identification of such proteins, pathways and
pathway components is a critical advancement to discovering and
identifying new drug targets for the treatment of COPD and COPD
related diseases, disorders and conditions, as newly described
herein. Further, the identification of such proteins and the
proteins with which they interact or regulate allows for the
detection and discovery of modulators, e.g., agonists and/or
antagonists, of protein targets that can have therapeutic efficacy
in the treatment of a variety of diseases and disorders that are
associated with downstream signaling and messenger events that are
affected by target protein modulation.
[0030] In accordance with this invention, proteomics methods were
utilized to isolate cigarette smoke-inducible tyrosine
phosphorylated proteins (activation complexes) from airway
epithelial cells. By means of this technique, the RAI-3 protein, a
member of the G-protein coupled receptor superfamily, has been
newly identified as being tyrosine phosphorylated, and/or as being
associated/complexed with tyrosine phosphorylated proteins, only in
those cells that had been exposed to cigarette smoke. As described
herein, cellular peptides were identified and characterized using
proteomics methodologies to allow the first determination that
RAI-3 protein activation and/or modification results from smoke
exposure to cells. According to this invention and the findings
related thereto, RAI-3 can serve as a drug target for COPD and COPD
related diseases and conditions. In addition, RAI-3 can be utilized
as described herein to identify and/or screen for modulators, e.g.,
agonists or antagonists, for use in methods and compositions for
the prevention and treatment of COPD. It is to be understood that
throughout this disclosure, the present invention relates to
methods and compositions suitable for the prevention, treatment and
therapeutic intervention of COPD as well as COPD related diseases,
disorders and conditions. The RAI-3 protein is also provided as a
target for drug development in the field of oncology to treat a
variety of cancers, tumors and malignancies.
[0031] It is an aspect of this invention to provide novel peptides
and polypeptides which are modified in, e.g., by phosphorylation,
and isolated from, cells exposed to smoke resulting from the
burning of tobacco containing substances, namely cigarettes. More
specifically, the GPCR protein RAI-3 has been newly identified as
being associated with cellular responses to exposure to cigarette
smoke. Thus, the RAI-3 protein and its peptides can serve as drug
targets for the prevention and treatment of COPD.
[0032] It is another aspect of the present invention to provide
modulators of the RAI-3 protein and RAI-3 peptide targets which can
affect the function or activity of RAI-3 in a cell in which RAI-3
function or activity is to be modulated or affected. In addition,
modulators of RAI-3 can affect downstream systems and molecules
that are regulated by, or which interact with, RAI-3 in the cell.
Modulators of RAI-3 include compounds, antibodies, antisense
reagents, siRNA reagents, materials, agents, drugs, and the like,
that antagonize, inhibit, reduce, block, suppress, diminish,
decrease, or eliminate RAI-3 function and/or activity. Such
compounds, antibodies, antisense reagents, siRNA reagents,
materials, agents, drugs and the like can be collectively termed
"antagonists". Alternatively, modulators of RAI-3 include
compounds, antibodies, antisense reagents, siRNA reagents,
materials, agents, drugs, and the like, that agonize, enhance,
increase, augment, or amplify RAI-3 function in a cell. Such
compounds, antibodies, antisense reagents, siRNA reagents,
materials, agents, drugs and the like can be collectively termed
"agonists".
[0033] Antagonists and agonists of the present invention include,
for example, small molecules, large molecules, and antibodies
directed against the RAI-3 protein or peptides thereof. Antagonists
and agonists of the invention also include nucleotide sequences,
such as antisense, siRNA reagents, and ribozyme molecules, and gene
or regulatory sequence replacement constructs, that can be used to
inhibit or enhance expression of the RAI-3 nucleic acid molecule,
or oligomeric portions thereof, such as peptide encoding nucleic
acid fragments.
[0034] Yet another aspect of this invention provides methods and
compositions, including pharmaceutical compositions, for the
treatment and/or prevention of COPD, or COPD related disorders and
conditions. The compositions can comprise modulators of the RAI-3
protein, or peptides thereof. The modulators can be antagonists or
agonists. Pharmaceutical compositions preferably comprising a
pharmaceutically and/or physiologically acceptable diluent,
excipient, or carrier (vehicle) are provided. The modulators can be
employed alone, or in combination with other standard treatment
regimens for lung-related diseases and/or conditions, e.g.,
emphysema. Such methods and compositions are capable of modulating
the level of RAI-3 gene expression and/or the level of activity of
the RAI-3 gene product or polypeptide. The methods include, for
example, modulating the expression of the RAI-3 gene and/or the
activity of the RAI-3 gene product, or modulating the expression of
a gene or gene product that is regulated or controlled by RAI-3,
effective for the treatment of COPD.
[0035] It is another aspect of the invention to provide screening
methods for the identification of compounds, materials, substances,
drugs, and agents that modulate the expression of the RAI-3 nucleic
acid and/or the activity of the RAI-3 polypeptide. Such methods
include, without limitation, assays that measure the effects of a
test compound or agent on RAI-3 mRNA and/or gene product levels;
assays that measure levels of RAI-3 activity or function; and
assays that measure the levels or activities of molecules and/or
systems that are regulated or mediated by RAI-3, or modulators of
RAI-3, such as NF-.kappa.B and/or I.kappa.B, or E-selectin, for
example.
[0036] It is another aspect of the present invention to provide the
RAI-3 GPCR protein as a component of a cell signaling pathway in
which it is involved in apoptotic events. Accordingly, downstream
cellular events can be regulated via the activity of the RAI-3
protein using RAI-3 modulators, e.g., antagonists or agonists, such
as antisense polynucleotides, polypeptides or low molecular weight
chemicals to achieve a therapeutic effect in cancer, (e.g., lung
cancer, breast cancer, stomach cancer, testicular cancer),
autoimmune diseases, immunological disorders, renal diseases,
ischemia-reperfusion injury, asthma, pulmonary fibrosis, cystic
fibrosis and heart failure.
[0037] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, and fragments thereof, for
treating, diagnosing, and/or ameliorating proliferative disorders,
cancers, ischemia-reperfusion injury, heart failure,
immunocompromised conditions, HIV infection, and renal diseases.
According to the invention, RAI-3 polynucleotides and polypeptides,
and fragments thereof, are useful for increasing NF-.kappa.B
activity, increasing apoptotic events, and/or decreasing
I.kappa.B.alpha. expression or activity levels.
[0038] It is another aspect of the present invention to provide
antagonists directed against RAI-3 for treating, diagnosing, and/or
ameliorating disorders, diseases and/or conditions including
autoimmune disorders, disorders related to hyperimmune activity,
inflammatory conditions, disorders related to aberrant acute phase
responses, hypercongenital conditions, birth defects, necrotic
lesions, wounds, organ transplant rejection, conditions related to
organ transplant rejection, disorders related to aberrant signal
transduction, proliferation disorders, cancers, e.g., lung cancer,
breast cancer, stomach cancer, testicular cancer, etc., HIV
infection, and HIV propagation in cells infected with other
viruses. According to the present invention, antagonists directed
against RAI-3 are useful for decreasing NF-.kappa.B activity,
decreasing apoptotic events, and/or increasing I.kappa.b.alpha.
expression or activity levels.
[0039] In a further aspect of the present invention, agonists
directed against RAI-3 are provided for treating, diagnosing,
and/or ameliorating autoimmune disorders, disorders related to
hyperimmune activity, hypercongenital conditions, birth defects,
necrotic lesions, wounds, disorders related to aberrant signal
transduction, immunocompromised conditions, HIV infection,
proliferation disorders, and/or numerous types of cancers.
According to the invention, agonists directed against RAI-3 are
useful for increasing NF-.kappa.B activity, increasing apoptotic
events, and/or decreasing I.kappa.B.alpha. expression or activity
levels.
[0040] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, fragments thereof, and modulators
thereof, for treating, diagnosing, and/or ameliorating ulcerative
colitis, cerebral infarct, myocardial infarct, diabetic
nephropathy, allergic rhinitis, Crohn's disease, atherosclerosis
and rheumatoid arthritis.
[0041] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, fragments thereof, and modulators
thereof, for treating, diagnosing, and/or ameliorating
inflammatory/auto-immune disorders outside of the lung in addition
to COPD.
[0042] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, fragments thereof, and modulators
thereof, for treating, diagnosing, and/or ameliorating
glioblastoma, pulmonary small cell undifferentiated carcinoma,
carcinoma of the breast, colon, lung, ovary, pancreas, and
prostate, and non-Hodgkin's lymphoma.
[0043] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, fragments thereof, and modulators
thereof, for treating, diagnosing, and/or ameliorating pulmonary
diseases and disorders which include the following, not limiting
examples: ARDS, emphysema, cystic fibrosis, interstitial lung
disease, chronic obstructive pulmonary disease, bronchitis,
lymphangioleiomyomatosis, pneumonitis, eosinophilic pneumonias,
granulomatosis, pulmonary infarction, pulmonary fibrosis,
pneumoconiosis, alveolar hemorrhage, neoplasms, lung abscesses,
empyema, and increased susceptibility to lung infections (e.g.,
immumocompromised, HIV, etc.), for example.
[0044] It is another aspect of this invention to provide RAI-3
polynucleotides and polypeptides, fragments thereof, and modulators
thereof, for treating, diagnosing, and/or ameliorating pulmonary
infections: pnemonia, bacterial pnemonia, viral pnemonia (for
example, as caused by Influenza virus, Respiratory syncytial virus,
Parainfluenza virus, Adenovirus, Coxsackievirus, Cytomegalovirus,
Herpes simplex virus, Hantavirus, etc.), mycobacteria pnemonia (for
example, as caused by Mycobacterium tuberculosis, etc.) mycoplasma
pnemonia, fungal pnemonia (for example, as caused by Pneumocystis
carinii, Histoplasma capsulatum, Coccidioides immitis, Blastomyces
dermatitidis, Candida sp., Cryptococcus neoformans, Aspergillus
sp., Zygomycetes, etc.), Legionnaires' Disease, Chlamydia pnemonia,
aspiration pnemonia, Nocordia sp. Infections, parasitic pnemonia
(for example, as caused by Strongyloides, Toxoplasma gondii, etc.)
necrotizing pnemonia, in addition to any other pulmonary disease
and/or disorder (e.g., non-pneumonia) implicated by the causative
agents listed above or elsewhere herein.
[0045] In another of its aspects, the present invention encompasses
vectors or vector constructs, including expression vectors and
cloning vectors, that contain the RAI-3 nucleic acid sequence, or
peptide encoding portions of the RAI-3 nucleic acid sequence, or
RAI-3 variants, for the expression of the RAI-3 nucleic acid
molecule(s) in host organisms. The present invention also relates
to host cells molecularly/genetically engineered to contain and/or
express RAI-3 nucleic acid molecules. Such host cells which express
RAI-3 polypeptides or peptides can be employed in screening assays
as described herein, for example, to identify RAI-3 modulating
compounds, and/or to assess the effect(s) of a variety of cell
treatments and compounds on RAI-3 function or biological activity,
which can include structural, biochemical, physiological, or
biochemical functions in a cell. Further, host organisms that have
been transformed with these nucleic acid molecules are also
encompassed in the present invention, e.g., transgenic animals,
particularly transgenic non-human animals, and particularly
transgenic non-human mammals.
[0046] In another aspect of the present invention, methods are
provided for regulating second messenger pathways and molecules
therein by modulating RAI-3 function and/or activity. More
particularly, the present invention affords the ability to
regulate, modulate, or affect the activity of the NF-.kappa.B
pathway and components thereof, e.g., I.kappa.B, by modulating,
particularly by antagonizing, the function and/or activity of
RAI-3. RAI-3 modulation can result in treatments for COPD, as well
as for other diseases and disorders that are mediated by
NF-.kappa.B and/or other molecules related thereto. Accordingly,
the present invention further provides methods of treating diseases
that are caused by, or are associated with, the NF-.kappa.B pathway
and/or its components, preferably in which antagonist modulators of
RAI-3 are employed to suppress, inhibit, or reduce the activity of
the NF-.kappa.b pathway and/or its component molecules.
[0047] It is yet another aspect of the present invention to provide
antisense nucleic acid molecules, and/or siRNA nucleic acid
molecules, that specifically antagonize RAI-3 nucleic acid, e.g.,
by binding to mRNA of RAI-3, or RAI-3 peptides. Antisense molecules
refer to nucleotide sequences, e.g., oligomers, and compositions
containing nucleic acid sequences that are complementary to a
specific DNA or RNA sequence, such as RAI-3 DNA or RNA sequences.
In the case of siRNA, the specific DNA or RNA is preferably double
stranded. Whether an antisense or siRNA molecule, the nucleic acid
may be either a DNA, RNA, or DNA/RNA hybrid. The term "antisense
strand" is used in reference to a nucleic acid strand that is
complementary to the "sense" strand. Antisense (i.e.,
complementary) nucleic acid molecules include peptide nucleic acids
("PNAs"), as discussed below, and may be produced by any method,
including synthesis or transcription. Once introduced into a cell,
the complementary nucleotides combine with natural sequences
produced by the cell to form duplexes, which block either
transcription or translation of the RAI-3 mRNA or protein,
respectively. The designation "negative" is sometimes used in
reference to the antisense strand, and "positive" is sometimes used
in reference to the sense strand.
[0048] PNAs are antisense molecules or anti-gene agents which
comprise an oligonucleotide ("oligo") linked via an amide bond,
similar to the peptide backbone of amino acid residues. PNAs
typically comprise oligos of at least 5 nucleotides linked via
amide bonds. PNAs may or may not terminate in positively charged
amino acid residues to enhance binding affinities to DNA. Such
amino acids include, for example, lysine and arginine, among
others. These small molecules stop transcript elongation by binding
to their complementary strand of nucleic acid (P. E. Nielsen et
al., 1993, Anticancer Drug Des., 8:53-63). PNA may be pegylated to
extend their life spans in the cell where they preferentially bind
to complementary single stranded DNA and RNA.
[0049] An additional aspect of this invention pertains to the use
of RAI-3 sequences and antibodies directed against the produced
protein and peptides for diagnostic assessment of COPD,
COPD-related disease states, or susceptibility to COPD and related
disorders.
[0050] Another aspect of the present invention relates to a method
of diagnosing, ameliorating, treating, reducing, eliminating, or
preventing a disease, disorder, and/or condition affected by
modulation of the G-protein coupled receptor protein RAI-3 in cells
that express RAI-3, which involves providing a modulator, e.g., an
agonist or antagonist, of RAI-3 in an amount effective to affect
the function or activity of RAI-3, and/or to effect the function or
activity of cellular molecules that are associated or correlated
with modulated RAI-3 activity or function. In accordance with the
present invention, the modulation of RAI-3 activity and/or function
can occur in cells stimulated by a variety of stimuli, including
cytokines, factors and chemokines, such as TNF-alpha, EGF, LPS,
eotaxin, RANTES, smoke from tobacco burning materials such as
cigarettes, and the like. In addition, the modulation of RAI-3
activity and/or function can occur as a result of cell exposure,
interaction, or association with other molecules, such as, for
example, cell adhesion molecules like I-CAM and E-selectin.
Preferably, the cell stimulation, exposure, or interaction is
associated with NF-.kappa.B activation. Examples of diseases,
disorders, and/or conditions that can be diagnosed, ameliorated,
treated, reduced, eliminated, or prevented by the methods of this
invention, in which RAI-3 is modulated, include without limitation,
COPD, the underlying symptoms of COPD, COPD-related disorders
and/or conditions, autoimmune disorders, disorders related to
hyperimmune activity, inflammatory conditions, disorders related to
aberrant acute phase responses, hypercongenital conditions, birth
defects, necrotic lesions, wounds, organ transplant rejection,
conditions related to organ transplant rejection, renal diseases,
ischemia-reperfusion injury, heart disorders, disorders related to
aberrant signal transduction, proliferation disorders, numerous
types of cancers, such as lung cancer, stomach cancer, breast
cancer, testicular cancer, etc., metastases, HIV infection, or HIV
propagation in cells infected with other viruses, asthma, cystic
fibrosis and pulmonary fibrosis.
[0051] Yet another aspect of the present invention provides a
method for predicting the likelihood that an individual will be
diagnosed as being at risk of developing COPD, a COPD-like
disorder, or one or more of the underlying symptoms of COPD, upon
exposure to cigarette smoke. The method comprises the steps of (a)
obtaining a nucleic acid sample(s) from am individual to be
assessed; and (b) determining the nucleotide present at one or more
polymorphic position(s) of a gene of SEQ ID NO:2, wherein the one
or more polymorphic position(s) is preferably selected from one or
more of nucleotide positions 112, 364, 511, 523, 605, 797, 1111, or
1173 of SEQ ID NO:2 (see Tables 1 and 3 herein), and further
wherein the presence of the alternative nucleotide at the one or
more polymorphic position(s) as provided in Tables 1 and 3
indicates that the individual has a higher likelihood of being
diagnosed as being at risk of developing COPD or a COPD-like
disorder, or one or more of the underlying symptoms of COPD,
compared to an individual having a reference allele at said
polymorphic position(s).
[0052] In another of its aspects, the present invention relates to
a method for predicting the likelihood that an individual will be
diagnosed as being at risk of developing COPD, a COPD-like
disorder, or one or more of the underlying symptoms of COPD upon
exposure to cigarette smoke. The method comprises the steps of (a)
obtaining a nucleic acid sample(s) from am individual to be
assessed; and (b) determining the nucleotide present at one or more
polymorphic position(s) of a gene of SEQ ID NO:2, wherein the one
or more polymorphic position(s) is preferably selected from one or
more of nucleotide positions 112, 364, 511, 523, 605, 797, 1111, or
1173 of SEQ ID NO:2 (see Tables 1 and 3 herein), and further
wherein the presence of the alternative nucleotide at the one or
more polymorphic position(s) as provided in Tables 1 and 3
indicates that the individual has a higher likelihood of being
diagnosed as at risk of developing COPD, a COPD-like disorder, or
one or more of the underlying symptoms of COPD, as compared to an
individual having an alternate allele at the polymorphic
position(s).
[0053] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide.
[0054] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells.
[0055] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements.
[0056] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements, wherein said cells
further comprise a vector comprising the coding sequence of G alpha
15 under conditions wherein G alpha 15 is expressed.
[0057] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of CRE response elements.
[0058] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are HEK cells.
[0059] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are HEK cells wherein said cells
comprise a vector comprising the coding sequence of the beta
lactamase gene under the control of CRE response elements.
[0060] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements, wherein said cells
further comprise a vector comprising the coding sequence of G alpha
15 under conditions wherein G alpha 15 is expressed, and futher
wherein said cells express the polypeptide at either low, moderate,
or high levels.
[0061] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements, wherein said cells
further comprise a vector comprising the coding sequence of G alpha
15 under conditions wherein G alpha 15 is expressed, wherein said
candidate compound is a small molecule, a peptide, or an antisense
molecule.
[0062] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements, wherein said cells
further comprise a vector comprising the coding sequence of G alpha
15 under conditions wherein G alpha 15 is expressed, wherein said
candidate compound is a small molecule, a peptide, or an antisense
molecule, wherein said candidate compound is an agonist or
antagonist.
[0063] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are HEK cells wherein said cells
comprise a vector comprising the coding sequence of the beta
lactamase gene under the control of CRE response elements, wherein
said candidate compound is a small molecule, a peptide, or an
antisense molecule.
[0064] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are HEK cells wherein said cells
comprise a vector comprising the coding sequence of the beta
lactamase gene under the control of CRE response elements, wherein
said candidate compound is a small molecule, a peptide, or an
antisense molecule, wherein said candidate compound is an agonist
or antagonist.
[0065] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are CHO cells that comprise a
vector comprising the coding sequence of the beta lactamase gene
under the control of NFAT response elements, wherein said cells
further comprise a vector comprising the coding sequence of G alpha
15 under conditions wherein G alpha 15 is expressed, wherein said
cells express beta lactamase at low, moderate, or high levels.
[0066] The invention further relates to a method of screening for
candidate compounds capable of modulating the activity of a
G-protein coupled receptor polypeptide, comprising: (i) contacting
a test compound with a cell or tissue comprising an expression
vector capable of expressing a polypeptide comprising an amino acid
sequence as set forth in SEQ ID NO:3, or encoded by ATCC deposit
RAI-3, under conditions in which said polypeptide is expressed; and
(ii) selecting as candidate modulating compounds those test
compounds that modulate activity of the G-protein coupled receptor
polypeptide, wherein said cells are HEK cells wherein said cells
comprise a vector comprising the coding sequence of the beta
lactamase gene under the control of CRE response elements, wherein
said cells express beta lactamase at low, moderate, or high
levels.
[0067] The statement, "wherein said cells express beta lactamase at
low, moderate, or high levels" is a reference to cells that either
express beta lactamase at low, moderate, or high levels relative to
the expression levels of a reference mRNA, gene, or protein; or a
reference to the actual percentage of cells that express beta
lactamase. In the latter example, high levels of expression would
be achieved if the majority of cells were expressing beta
lactamase, while low levels of expression would be achieved if only
a subset of cells were expressing beta lactamase. Such cells may
also express other proteins, such as the proteins of the present
invention at low, moderate, or high levels as well.
[0068] Further aspects, features, and advantages of the present
invention will be better appreciated upon a reading of the detailed
description of the invention when considered in connection with the
accompanying figures or drawings.
DESCRIPTION OF THE FIGURES
[0069] At least one Figure comprising this patent specification is
executed in color. Copies of the patent with color Figure(s) will
be provided by the U.S. Patent and Trademark Office upon request
and payment of the necessary fee.
[0070] FIGS. 1A and 1B illustrate the results of Western Blot
analysis of H292 lung airway epithelial cells (ATCC) using
anti-phosphotyrosine (anti-Ptyr) antibodies. FIG. 1A illustrates
the results of serum-starved H292 cells exposed to cigarette smoke
bubbled medium (i.e., CS-240, the equivalent of 240 cigarettes per
500 ml of cell medium) for the periods of time shown (10 sec., 5
min., 10 min., 15 min., 30 min., 60 min., and 120 min.) and to EGF
(10 nM) for 5 minutes. Whole cell lysates were obtained as
described in the Examples herein, subjected to SDS-PAGE,
transferred to PVDF membrane, and blotted with anti-Ptyr antibody
conjugated to horse radish peroxidase (HRP). Molecular weight
markers are shown in the left-most lane. FIG. 1B shows the results
of immunoprecipitation of proteins from cigarette smoke-treated
cell lysates, as described for FIG. 1A, using anti-EGFR antibody
prior to SDS-PAGE and Western blotting analysis using anti-Ptyr
antibody. For this experiment, 1.5 ml of cell lysate (.about.1/2 of
a confluent T75 flask) was pre-cleared twice with 50 .mu.l of
Protein A slurry with rotation at 4.degree. C. Pre-cleared lysate
was transferred to a new Eppendorf tube and 50 .mu.l of Protein A
and 2 .mu.l of EGFR antisera (HER1/TWIB2 rabbit antisera to human
EGFR) were added. After mixing for 1 hour at 4.degree. C., the
precleared lysate, Protein A and EGFR antisera were washed three
times with Lysis buffer, one time with 1.times.PBS and aspirated
"dry". Samples were subjected to SDS-PAGE and then transferred to
nitrocellulose by standard western blotting techniques. The
membranes were then blotted with the antiphosphotyrosine antibody
HRP-Conjugated-4G10 #16-105 (Upstate Biotechnology, Inc. Lake
Placid, N.Y.). (Example 1(C)).
[0071] FIGS. 2A and 2B depict SDS-PAGE and Western Blot analysis of
H292 cell lysates prepared from cells that had either been treated
with cigarette smoke (CS-160) or not treated (Control, Serum Free
Medium, SFM). FIG. 2A shows whole cell lysates from cigarette
smoke-treated and control cells with no immunoprecipitation using
anti-phosphotyrosine (anti-Ptyr) antibodies. FIG. 2B shows whole
cell lysates from smoke treated and control cells following
immunoprecipitation using anti-phosphotyrosine antibodies. Numerous
phosphorylated proteins are observed in the smoke-treated cells
after anti-Ptyr immunoprecipitation. Specifically, H292 lung airway
epithelial cells were grown in complete RPMI media to confluence
(approximately 3.times.10.sup.9 cells in 24-500 cm.sup.2 plates)
and then serum-starved for 24 hours. The cells were then treated
with CS-160 cigarette smoke-bubbled media (serum-free) for various
times. CS-160 is equivalent to 160 cigarettes per 500 ml. After
treatment, the cells were washed with ice-cold PBS and lysed in
Lysis Buffer. The lysates were centrifuged and the supernatants
recovered. Protein concentration was determined by a BCA assay. 10
.mu.g of protein were run in each lane and blotted for
anti-phosphotyrosine. (Example 1(D)). For immunoprecipitation of
tyrosine phosphorylated proteins, cell lysates were first
precleared and then incubated overnight at 4.degree. C. with a 100
.mu.g each of the five antibodies as described in Example 1(D). The
bound proteins were incubated with a pre-washed cocktail of agarose
beads conjugated to streptavidin, anti-mouse IgG and Protein G for
two hours at 4.degree. C. Precipitated immune complexes were then
washed with lysis buffer including inhibitors, suspended in sample
buffer, subjected to SDS-PAGE and then transferred to
nitrocellulose by standard western blotting techniques. The
membranes were then blotted with the antiphosphotyrosine antibody
HRP-Conjugated-4G10 #16-105 (Upstate Biotechnology, Inc. Lake
Placid, N.Y.).
[0072] FIGS. 3 and 4 show the results of two LC/LC/MS/MS analyses.
Identification of the immunoprecipitated proteins was performed on
the digested samples as described in Example 1(E) herein below. A
peptide having the amino acid sequence AHAWPSPYKDYEVK (SEQ ID NO:1)
was identified and was determined to correspond to the RAI-3
protein (RefSeq NP.sub.--003970.1, amino acid sequence; RefSeq
NM.sub.--003979, nucleic acid sequence).
[0073] FIG. 5 shows the results of treating cells (HEK 293,
BEAS-2B, and H292) with all-trans retinoic acid (ATRA), (1 .mu.M),
for 24 hours as described in Examples 1N and 1O herein.
Transcription of RAI-3 mRNA is induced relative to control cells
that were not treated with ATRA. Data are expressed as a fold
increase over a reference tissue or cell type. Duplicate data
values are shown above the bars.
[0074] FIGS. 6 and 7 show the results gene chip experiments as
described in Example 1(R) herein. The Affymetrix human U95v2 A, B,
and C chips were probed with biotinylated in vitro transcription
product prepared from sample mRNA obtained from the various tissues
shown, per the manufacturer's instructions (see: Protocol for
Affymetrix Gene Chip Expression). Hybridization, wash, and
Phycoerythrin streptavidin staining were performed using the
Affymetrix hybridization oven and fluidics workstation per the
manufacturer's protocols (Chapter 6 of Affymetrix GeneChip
Expression Analysis Manual, revision 2). Stained chips were scanned
on the Affymetrix GeneChip scanner, and data were analyzed using
the Affymetrix GeneChip software to determine the specifically
hybridizing signal for each gene. The results represent the average
of standard deviation (SD) of 3 replicates. The results in FIG. 6
show that RAI-3 relative message level is highest in the lung,
followed by the aorta, trachea and thyroid. Expression levels in
the other tissues tested is low.
[0075] In FIG. 7, A549, H292, BEAS-2B cell lines were seeded to
confluency, starved for 24 hours, and then treated with 10 nM EGF
for 30 minutes, 6 hours and 18 hours. RNA was harvested with the
Rneasy Midi Kit (Qiagen, Hilden, Germany). The results show that
RAI-3 mRNA expression is highest in H292 cells and does not show a
clear induction in response to any treatment. RAI-3 expression is
low in A549, BEAS-2B and Caco (colon, ATCC, Manassas, Va.) cells
lines.
[0076] FIGS. 8A and 8B shows a characterization of RAI-3 stable
cell lines and immunoprecipitation and Western Blotting as
described in Example U herein. Controls included untransfected
HEK293 cells (FIG. 8A) and a purified FLAG fusion protein (FIG.
8B).
[0077] FIGS. 9A and 9B show a characterization of RAI-3 stable cell
lines by FACS analysis as described in Example IK herein.
[0078] FIGS. 10A and 10B present the full-length nucleotide
sequence (2456 nucleotides) of human RAI-3 cDNA (RefSeq
NM.sub.--003979), (SEQ ID NO:2).
[0079] FIGS. 11A-11C show the human RAI-3 polynucleotide and amino
acid sequences. FIG. 11A shows the human RAI-3 amino acid sequence
(357 amino acids), (SEQ ID NO:3), encoded by the RAI-3 nucleic acid
sequence (SEQ ID NO:2) of FIGS. 10A and 10B. FIGS. 11B and 11C show
the RAI-3 nucleic acid sequence (2456 nucleotides), (SEQ ID NO:2),
and the encoded amino acid sequence of the RAI-3 polypeptide (SEQ
ID NO:3). The RAI-3 peptide of SEQ ID NO:1 is underlined in FIG.
11C.
[0080] FIG. 12 presents a multiple sequence alignment of the human
RAI-3 GPCR (RAI-3_HUMAN) amino acid sequence with four related GPCR
amino acid sequences, namely, human GPCR5D (GPCR5D_HUMAN), (SEQ ID
NO:4); murine GPCR5D (GPCR5D_MOUSE), (SEQ ID NO:5); human GPCR5B
(GPCR5B_HUMAN), (SEQ ID NO:6); and human GPCR5C (GPCR5C_HUMAN),
(SEQ ID NO:7). The GCG pileup program was used to generate the
alignment. The blackened areas represent identical amino acid
residues in more than half of the listed sequences and the gray
highlighted areas represent similar amino acid residues.
[0081] FIG. 13 presents a multiple sequence alignment of the human
RAI-3 GPCR amino acid sequence with other related GPCR sequences as
described for FIG. 12. Non-synonymous SNPs are presented in
double-underlined, italicized letters. The human RAI-3 amino acid
sequence comprising the non-synonymous SNP (Ser/Gly) at amino acid
position 118 (base A/G) is set forth in SEQ ID NO:8; and the human
RAI-3 amino acid sequence comprising the non-synonymous SNP
(Gln/Arg) at amino acid position 307 (base A/G) is set forth in SEQ
ID NO:9.
[0082] FIGS. 14A and 14B show the results of experiments in which
antisense nucleic acid to RAI-3 was used to evaluate the outcome of
I.kappa.B mRNA expression in A549 cells and E-selectin surface
expression in human microvascular endothelial cells (HMVECs). Based
on these experiments, it was found that antisense to RAI-3
increased the level of I.kappa.B mRNA in A549 cells that had been
released from quiescence four hours prior to transfection with the
RAI-3 ultramer antisense (FIG. 14A and Example 2). At sixteen to
twenty-four hours post transfection, the mRNA was harvested and
TaqMan analysis was preformed for the expression of I.kappa.B and
GAPDH. All samples were normalized to GAPDH and I.kappa.B values
were reported as fold change relative to I.kappa.B in samples that
were transfected with an ultramer control. Next, the RAI-3 ultramer
was applied to primary HMVEC cells for 16-24 hours, followed by
TNF-a treatment for 6 hours. Thereafter, E-selectin protein
expression on the cell surface was evaluated. Knock down of RAI-3
mRNA decreased TNF-.alpha. induced E-selectin surface expression in
HMVECs. (FIG. 14B and Example 3).
[0083] FIG. 15 shows the relative expression of RAI-3 in normal
tissues, including various regions of the lung, as determined by
quantitative PCR (Example 10). The high level of expression of
RAI-3 in lung bronchus (tertiary) and lung parenchyma is
particularly evident. For reference, primary lung airway tissue
constitutes the trachea, while secondary lung tissue constitutes
lobar tissue, both of which are major dissectible airways. Any
airways which are distal to the primary and secondary airways, and
which are greater than about 2 mm in diameter, are referred to as
"tertiary". Quaternary refers to the smallest macroscopically
dissectible bronchi of less than 2 mm in diameter. Such bronchi
contain little or no macroscopically visible cartilage in their
walls. More distal tissue comprises the parenchyma, which refers
not only to alveoli, but also to very small bronchi and
bronchioles, such as terminal and respiratory bronchioles.
[0084] FIG. 16 shows the results of quantitative PCR analysis in
breast tumors. (Example 10). Control breast tissue RNAs and breast
tumor RNAs were evaluated. It was demonstrated that breast tumors
(2 out of 5) have elevated steady-state RAI-3 RNA levels.
[0085] FIG. 17 shows the results of quantitative PCR analysis in
stomach tumors. (Example 10). Control stomach tissue RNAs and
stomach tumor RNAs were evaluated. It was demonstrated that stomach
tumors (2 or 3 matched tissue samples and one additional
non-matched sample for a total of 3 out 4) have elevated
steady-state RAI-3 RNA levels.
[0086] FIG. 18 shows the results of quantitative PCR analysis in
testicular tumors. (Example 10). Control testis tissue RNAs and
testicular tumor RNAs were evaluated. It was demonstrated that
testicular tumors (4 out of 5 samples) have elevated steady-state
RAI-3 RNA levels.
[0087] FIGS. 19A and 19B show multiple amino acid sequence
alignments of the SNP containing regions of human RAI-3 GPCR with
RAI-3 sequences of other species and with other related GPCR
sequences. The amino acids at the position of the SNPs are
presented in larger, bold-faced type and are double underlined in
all of the sequences. The human GPCR5D (GPCR5D_HUMAN) amino acid
sequence is set forth in SEQ ID NO:4; the murine GPCR5D
(GPCR5D_MOUSE) amino acid sequence is set forth in SEQ ID NO:5; the
human RAI-3 amino acid sequence (RAI-3_HUMAN) is set forth in SEQ
ID NO:3 (no SNPs); the human GPCR5D (GPCR5D_HUMAN) amino acid
sequence as shown in FIG. 19A is set forth in SEQ ID NO:88; the
mouse GPCR5D (GPCR5D_MOUSE) amino acid sequence as shown in FIG.
19A is set forth in SEQ ID NO:89; the mouse RAI-3 amino acid
sequence (RAI-3_MOUSE) as shown in FIG. 19A is set forth in SEQ ID
NO:10; the rat RAI-3 amino acid sequence (RAI-3_RAT) as shown in
FIG. 19A is set forth in SEQ ID NO:11; the cow RAI-3 amino acid
sequence (RAI-3_COW) as shown in FIG. 19A is set forth in SEQ ID
NO:12; and the variant human RAI-3 amino acid sequence containing
glycine at position 118 as a result of the Ser118Gly SNP, as shown
in FIG. 19A, is set forth in SEQ ID NO:13. In FIG. 19B, the human
GPCR5D (GPCR5D_HUMAN) amino acid sequence as shown in FIG. 19B is
set forth in SEQ ID NO:90; the partial human RAI-3 amino acid
sequence shown is set forth in SEQ ID NO:14 (no SNP); the variant
human RAI-3 amino acid sequence containing arginine at position 307
as a result of the Glu307Arg SNP is set forth in SEQ ID NO:15; and
the partial mouse RAI-3 sequence shown in FIG. 19B is set forth in
SEQ ID NO:16.
[0088] FIG. 20 illustrates a comparison of the amino acid sequences
of human RAI-3 and its murine RAI-3 orthologue. The alternative
amino acids resulting from the missense SNPs in the RAI-3 nucleic
acid sequence are shown in bold, double-underlining. Both the
Ser118Gly and Thr182Ala SNPs occur at amino acid positions that are
not conserved between the human and murine sequences. The Gln307Arg
involves a conserved amino acid residue. The variant human RAI-3
amino acid sequence containing glycine at position 118 as a result
of the Ser118Gly SNP is set forth in SEQ ID NO:13; the variant
human RAI-3 amino acid sequence containing alanine at position 182
as a result of the Thr182Ala SNP is set forth in SEQ ID NO:17; and
the variant human RAI-3 amino acid sequence containing arginine at
position 307 as a result of the Gln307Arg SNP is set forth in SEQ
ID NO:15.
[0089] FIG. 21 depicts an untransfected CHO NFAT-G alpha 15 cell
line FACS profile. "NFAT" is an acronym for "Nuclear Factor
Activator of Transcription". CHO/NFAT-CRE cells, in the absence of
the pcDNA3.1 Hygro.TM./RAI-3 mammalian expression vector
transfection, were used as controls, as described herein. The cells
were analyzed via FACS (Fluorescence Activated Cell Sorter)
analysis according to their wavelength emission at 518 nM (Channel
R3--Green Cells), and 447 nM (Channel R2--Blue Cells). As shown,
the vast majority of cells emitted at 518 nM, with minimal emission
observed at 447 nM. This is expected, since the NFAT response
elements remain dormant in the absence of an activated G-protein
dependent signal transduction pathway (e.g., a pathway mediated by
Gq/11 or promiscuous G coupled receptors). As a result, the cell
permeant, CCF2/AM.TM. (Aurora Biosciences; G. Zlokarnik et al.,
1998, Science, 279:84-88) substrate remains intact and emits light
at 518 nM.
[0090] FIG. 22 demonstrates that overexpression of RAI-3
constitutively couples through the promiscuous G protein- (G alpha
15) coupled NFAT response element. CHO/NFAT G alpha 15 cell lines
were transfected with the pcDNA3.1 Hygro.TM./RAI-3 mammalian
expression vector, as described herein. The cells were analyzed via
FACS according to their wavelength emission at 518 nM (Channel
R3--Green Cells), and 447 nM (Channel R2--Blue Cells). As shown,
overexpression of RAI-3 resulted in functional coupling, and
subsequent activation, of beta lactamase gene expression, as
evidenced by the significant number of cells with fluorescent
emission at 447 nM relative to the non-transfected CHO/NFAT G alpha
15 cells used as control (see FIG. 23A).
[0091] FIGS. 23A and 23B illustrate the expression of RAI-3 in
transfected cells. For the experiments leading to these results,
CHO/NFAT G alpha 15 cell lines were transfected with the pcDNA3.1
Hygro.TM./RAI-3-FLAG mammalian expression vector and were subjected
to immunocytochemistry using a FITC-conjugated anti-Flag monoclonal
antibody, as described herein. Untransfected control cells are
shown in FIG. 23A. The image in FIG. 23B shows the fluorescent
emission of the RAI-3-transfected cells at 530 nm, following
illumination with a mercury light source. The cellular localization
is clearly evident and is consistent with the expression of
RAI-3.
[0092] FIGS. 24A-24D shows that representative transfected CHO/NFAT
G alpha 15 cell lines with intermediate and high beta lactamase
expression levels are useful in screens to identify RAI-3 agonists
and/or antagonists. Several CHO/NFAT G alpha 15 cell lines
transfected with the pcDNA3.1 Hygro.TM./RAI-3 mammalian expression
vector and having either intermediate or high beta lactamase
expression levels of constitutive activation were isolated via
FACS, as described herein. FIG. 24A shows untransfected CHO/NFAT G
alpha 15 cells prior to stimulation with 10 nM phorbol myristyl
acetate (PMA) and 1 .mu.M Thapsigargin/(-P/T). FIG. 24B shows
CHO/NFAT-CRE cells after stimulation with 10 nM PMA and 1 .mu.M
Thapsigargin/(+P/T). FIG. 24C shows CHO/NFAT G alpha 15 cells
transfected with a representative orphan GPCR (oGPCR) and having an
intermediate level of beta lactamase expression. FIG. 24D shows
CHO/NFAT G alpha 15 cells transfected with a representative orphan
GPCR (oGPCR) and having a high level of beta lactamase
expression.
[0093] FIGS. 25A-25C presents the RAI-3 nucleic acid sequence and
encoded amino-acid sequence including polymorphic loci, e.g.,
single nucleotide polymorphisms (SNPs), at the designated positions
in the sequence. The positions in the RAI-3 nucleic acid sequence
comprising polymorphic loci are represented by an "n" (SEQ ID
NO:18), wherein n includes the nucleotides as shown in Table 1; the
amino acid changes related to the SNPs in the encoded RAI-3 amino
acid sequence are designated with an "X" (SEQ ID NO:19), wherein X
includes the amino acids as shown in Table 1. The underlined
sequence (amino acids 340-353) in FIG. 25B represents the RAI-3
peptide of SEQ ID NO:1. Accordingly, the present invention is
directed to a polynucleotide or a polypeptide comprising any
combination of one or more of the polymorphisms according to those
presented in FIGS. 25A-25C. The following Table 1 depicts the RAI-3
nucleic acid and amino acid sequences and various SNPs contained
therein:
[0094] FIGS. 26A and 26B illustrate the results of Western Blot
analysis of an A549 cell line (Human Lung Carcinoma CCL-185,
American Type Culture Collection, Manassas, Va.) transiently
transfected with a FLAG RAI-3 construct (described herein). Media
on the cells was changed to serum-free and 48 hours
port-transfection the cells were treated with cigarette
smoke-bubbled media (i.e., CS-160, the equivalent of 160 cigarettes
per 500 ml of cell medium) for the periods of time shown (1 hr., 2
hr., and 3 hr.) and with EGF (10 nM) for 5 minutes. Lysates were
immuno-precipitated with 2 .mu.g of anti-FLAG M2 antibody (Catalog
# F-3165, Sigma, Saint Louis, Mo.) and 40 .mu.l of Protein A. The
Protein A/lysate/antibody mixture was washed, aspirated "dry", and
60 .mu.l of 2.times.SDS-PAGE sample buffer was added. After heating
at 95.degree. C. for 10 minutes, the samples were loaded onto two
4-20% gradient gels, resolved by SDS-PAGE and transferred to
nitrocellulose by standard Western Blotting techniques. The
membranes were blotted/probed with either an anti-FLAG-HRP antibody
(Sigma, Saint Louis, Mo., Catalog # A8592) as shown in FIG. 26A, or
an anti-phosphotyrosine-HRP antibody (HRP-conjugated-4G10 antibody,
#16-105, Upstate Biotechnology, Inc., Lake Placid, N.Y.) as shown
in FIG. 26B. Lane 1 shows untreated A549/Flag-RAI-3, Lane 2 shows
A549 cells transfected with Flag-RAI-3 plus EGF (10 nM) for 60
minutes, Lanes 3-5 show A549 cells transfected with Flag-RAI-3
treated with cigarette smoke-bubbled medium. Lane 6 shows
untransfected A549 cells treated with cigarette smoke-bubbled
medium and Lane 7 shows a control FLAG-fusion protein with a
molecular weight of {fraction (52/48)} kDa.
[0095] FIGS. 27A and 27B illustrate the results of a Western Blot
analysis of a CHO/NFAT G alpha 15 cell line stably transfected with
the pcDNA3.1/Flag-RAI-3 mammalian expression vector (Flag-RAI-3
CHO), as previously described and the results of a Western Blot
analysis of the parental CHO cell line as a control. FIG. 27A
illustrates the results of an anti-RAI-3 immunblot of lysates from
1/2 of a confluent T75 flask of either the stable Flag-RAI-3 CHO or
parental cell line immuno-precipitated with 2 .mu.g of anti-FLAG M2
antibody 5 (Catalog # F-316, Sigma, Saint Louis, Mo.) and 40 .mu.l
of Protein A. The Protein A/lysate/antibody mixture was washed,
aspirated "dry", and 60 .mu.l of 2.times.SDS-PAGE sample buffer was
added. After heating at 95.degree. C. for 10 minutes, the samples
were loaded onto 4-20% gradient gels, resolved by SDS-PAGE and
transferred to nitrocellulose by standard Western Blotting
techniques. The membranes were blotted/probed with either an
anti-FLAG-HRP antibody (Catalog # A8592, Sigma, Saint Louis, Mo.)
at a 1:1000 dilution, a rabbit pre-immune antisera or rabbit RAI-3
anti-sera (GW7, Post Boost #4, production bleed) both at a 1:500
dilution. All samples were immunoprecipitated with an anti-Flag
antibody. Lanes 1 and 2 show an anti-Flag blot of the Parental CHO
and Flag-RAI-3 CHO, respectively. Lanes 3 and 4 show a rabbit
pre-immune sera blot of the parental CHO cell line and Flag-RAI-3
CHO, respectively. Lanes 5 and 6 show a rabbit RAI-3 antisera blot
of the parental CHO and Flag-RAI-3 CHO, respectively. FIG. 27B
illustrates the results of an anti-Flag immunblot of lysates from
{fraction (1/2)} of a confluent T75 flask of either the stable
Flag-RAI-3 CHO cell line or parental cell line immuno-precipitated
with either 5 ul of rabbit RAI-3 antisera (GW7, Post Boost #4,
production bleed antisera) and 40 .mu.l of Protein A or 2 .mu.g of
anti-FLAG M2 antibody Catalog # F-3165 (Sigma, Saint Louis, Mo.)
and 40 .mu.l of Protein A. The Protein A/lysate/antibody mixture
was washed, aspirated "dry", and 301 .mu.l of 2.times.SDS-PAGE
sample buffer was added. After heating at 95.degree. C. for 10
minutes, the samples were loaded onto a 4-20% gradient gel, and
resolved by SDS-PAGE and transferred to nitrocellulose by standard
Western Blotting techniques. The membranes were blotted/probed with
an anti-FLAG-HRP antibody (Sigma, Saint Louis, Mo., Catalog #
A8592) at a 1:1000 dilution. All samples are immuno-blotted with an
anti-FLAG-HRP antibody. Lanes 1 and 2 show the anti-Flag blot of
the parental CHO and Flag-RAI-3 CHO cell lines immunoprecipitated 2
.mu.g of anti-FLAG M2 antibody, respectively. Lanes 3 and 4 show
the anti-Flag blot of the parental CHO and Flag-RAI-3 CHO cell
lines immuno-precipitated with 5 ul of rabbit RAI-3 antisera (GW7,
Post Boost #4, production bleed antisera).
[0096] FIGS. 28A and 28B illustrate the results of a Western Blot
analysis of the H292 cell line immunoprecipitated with either
anti-EGFR, rabbit pre-immune sera or rabbit anti-RAI-3 and
immunoblotted with an anti-phosphotyrosine antibody. FIG. 28A
illustrates the results of Western Blot analysis of H292 lung
airway epithelial cells (American Type Culture Collection (ATCC),
Manassas, Va.) that were serum-starved for 24 hours and then
treated with cigarette smoke-bubbled media (i.e., CS-160, the
equivalent of 160 cigarettes per 500 ml of cell medium and CS-240)
3 hours. Lysates from 1/2 of a confluent T75 flask were
immuno-precipitated with either a 4 ul of rabbit anti-EGFR (HER1
TW2, in-house) or 5 ul of rabbit RAI-3 and 40 .mu.l of Protein A.
The Protein A/lysate/antibody mixture was washed, aspirated "dry",
and 30 .mu.l of 2.times.SDS-PAGE sample buffer was added. After
heating at 95.degree. C. for 10 minutes, the samples were loaded
onto a 4-20% gradient gel, resolved by SDS-PAGE and transferred to
nitrocellulose by standard Western Blotting techniques. The
membranes were blotted/probed with an anti-phosphotyrosine-HRP
antibody (HRP-conjugated-4G10 antibody, #16-105, Upstate
Biotechnology, Inc., Lake Placid, N.Y.). Lanes 1 and 4 show
untreated H292s, Lanes 2 and 5 and show H292s treated 3 hours with
cigarette smoke-bubbled medium, CS-160. Lanes 3 and 6 and show
H292s treated 3 hours with cigarette smoke-bubbled medium, CS-240.
Lanes 1-3 are immunoprecipitated with rabbit anti-EGFR and Lanes
4-6 are immunoprecipitated with rabbit anti-RAI-3. The membrane was
blotted with an anti-phosphotyrosine-HRP antibody. FIG. 28B
illustrate the results of Western Blot analysis of H292 lung airway
epithelial cells (American Type Culture Collection (ATCC),
Manassas, Va.) that were serum-starved for 24 hours and then
treated with cigarette smoke-bubbled media. (i.e., CS-80, the
equivalent of 80 cigarettes per 500 ml of cell medium, CS-160 and
CS-240) for 3 hours. Lysates from {fraction (1/2)} of a confluent
T75 flask were immuno-precipitated with either 4 ul of rabbit
anti-EGFR (HER1 TW2, in-house), 5 ul of rabbit pre-immune sera, or
5 ul of rabbit RAI-3 and 40 .mu.l of Protein A. The Protein
A/lysate/antibody mixture was washed, aspirated "dry", and 30 .mu.l
of 2.times.SDS-PAGE sample buffer was added. After heating at
95.degree. C. for 10 minutes, the samples were loaded onto a 4-20%
gradient gel, resolved by SDS-PAGE and transferred to
nitrocellulose by standard Western Blotting techniques. The
membranes were blotted/probed with an anti-phosphotyrosine-HRP
antibody (HRP-conjugated-4G10 antibody, #16-105, Upstate
Biotechnology, Inc., Lake Placid, N.Y.). Lanes 1, 4 and 7 show
H292s treated 3 hours with cigarette smoke-bubbled medium, CS-80.
Lanes 2, 5 and 8 show H292s treated 3 hours with cigarette
smoke-bubbled medium, CS-160. Lanes 3, 6 and 9 show H292s treated 3
hours with cigarette smoke-bubbled medium, CS-240. Lanes 1-3 were
immunoprecipitated with rabbit anti-EGFR. Lanes 4-6 were
immunoprecipitated with rabbit pre-immune sera. Lanes 7-9 were
immunoprecipitated with rabbit anti-RAI-3. The membrane was blotted
with an anti-phosphotyrosine-HRP antibody.
[0097] FIG. 29 illustrates the results of a FACs analysis comparing
the stably expressing Flag-RAI-3 CHO cell line, clone B8, to the
parental CHO cell line. The top panel shows a FACs analysis
histogram comparing the stably expressing Flag-RAI-3 CHO cell line,
clone B8, to the parental CHO cell line using an HRP-conjugated
anti-FLAG. The middle panel shows a FACs analysis histogram
comparing the stably expressing Flag-RAI-3 CHO cell line, clone B8,
to the parental CHO cell line using the pre-immune antisera from
the GW7 rabbit. The lower panel shows a FACs analysis histogram
comparing the stably expressing Flag-RAI-3 CHO cell line, clone B8,
to the parental CHO cell line using a post boost #4 bleed of the
rabbit antisera, GW7. Cells from the confluent 100 mM cell culture
plates (or equivalent), i.e., .about.2.times.10.sup.6 cells, were
washed once with 1.times.PBS and then lifted from the plates with
2-3 ml of Cell Stripper (Cellgro/Mediatech, Herndon, Va.). 15 ml of
1.times.PBS was added to wash cells and then the cells were
centrifuged at 1.5 K for 8 minutes at 4.degree. C. to pellet. Cells
were resuspended in 0.2 ml of binding buffer which is composed from
DMEM (Gibco/BRL/Invitrogen Corporation, Carlsbad, Calif.) with a
final concentration of 1% BSA (30% solution, Sigma-Aldrich Co.
Saint Louis, Mo.) and 0.02% azide. Anti-FLAG FITC (Sigma, Saint
Louis, Mo.; Catalog #F4049) was added at a dilution of 1:400 or
rabbit anti sera was added at a dilution of 1:250. The cells and
antibody mixture were incubated for one hour on ice. The cells
incubated with the rabbit antisera were centrifuged at 1.5 K for 8
minutes at 4.degree. C. to pellet and washed twice with 10 ml of
binding buffer and resuspended in a final volume of 0.2 ml of
binding buffer containing the 2.degree. antibody a Fluorescein
(FITC)-conjugated AffiniPure F(ab').sub.2 Goat Anti-Rabbit IgG.at a
dilution of 1:200 (Jackson Immunoreseach Laboratories, Inc, West
Grove, Pa.). The cells and antibody mixture were incubated for 30
minutes on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet and washed twice with 10 ml of binding
buffer and resuspended in a final volume of 0.5 ml of binding
buffer for FACS analysis. The cells were analyzed on a Becton
Dickenson FACSort using Cell Quest software (Becton-Dickenson,
Franklin Lakes, N.J.). Cells were live gated and red/green color
was compensated.
[0098] FIG. 30 illustrates the results of a FACs analysis comparing
expression of the endogenous RAI-3 protein on the surface of the
A549 and H292 cell lines. The top panels show results of a FACs
analysis histogram without any antibody present. The second from
top panels show the results of a FACs analysis histogram using the
20 antibody alone. The second from bottom panels show the results
of a FACs analysis histogram using the pre-immune antisera from the
GW7 rabbit. The bottom panels show the results of a FACs analysis
histogram using the post boost #4 bleed of the rabbit antisera,
GW7. Cells from the confluent 100 mM cell culture plates (or
equivalent), i.e., .about.2.times.10.sup.6 cells, were washed once
with 1.times.PBS and then lifted from the plates with 2-3 ml of
Cell Stripper (Cellgro/Mediatech, Herndon, Va.). 15 ml of
1.times.PBS was added to wash cells and then the cells were
centrifuged at 1.5 K for 8 minutes at 4.degree. C. to pellet. Cells
were resuspended in 0.2 ml of binding buffer which was composed
from DMEM (Gibco/BRL/Invitrogen Corporation, Carlsbad, Calif.) with
a final concentration of 1% BSA (30% solution, Sigma-Aldrich Co.
Saint Louis, Mo.) and 0.02% azide. Rabbit anti sera was added at a
dilution of 1:250. The cells and antibody mixture was incubated for
one hour on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet and washed twice with 10 ml of binding
buffer and resuspended in a final volume of 0.2 ml of binding
buffer containing the 2.degree. antibody a Fluorescein
(FITC)-conjugated AffiniPure F(ab').sub.2 Goat Anti-Rabbit IgG.at a
dilution of 1:200 (Jackson Immunoreseach Laboratories, Inc, West
Grove, Pa.). The cells and antibody mixture was incubated for 30
minutes on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet and washed twice with 10 ml of binding
buffer and resuspended in a final volume of 0.5 ml of binding
buffer for FACS analysis. The cells were analyzed on a Becton
Dickenson FACSort using Cell Quest software (Becton-Dickenson,
Franklin Lakes, N.J.). Cells were live gated and red/green color
was compensated.
[0099] FIG. 31 illustrates the results of a FACs analysis of the
H292 cell line transfected with the RAI-3 siRNA reagent 1864+1865
and controls. The most right column show the FACs analysis
histogram of control H292 cells that were not transfected with
Lipofectamine or siRNA. The top analysis figure show the mean
signal when no antibody was added to the cells, the middle analysis
figure shows the mean signal when the pre-immune antisera from the
GW7 rabbit was added, and the bottom analysis figure shows the mean
signal when the post boost #4 bleed of the rabbit RAI-3 antisera,
GW7 was added. The middle column shows the FACs analysis histograms
of control H292 cells that were transfected, in triplicate, with
Lipofectamine 2000 alone without any siRNA. The most right column
shows the histograms of H292 cells that were transfected, in
triplicate, with the RAI-3 siRNA reagent 1864+1865. FACs analysis
of H292 cells that were transfected, in triplicate, with control
siRNA reagents (described in herein), showed an average mean
greater than the controls. The day before transfection,
.about.2.5.times.10.sup.4H292 cells/well were seeded into 24
well-plates in RPMI media containing 10% fetal bovine serum, 20 mM
Glutamine, 1% Penicillin-Streptomycin (Gibco/Invitrogen
Corporation, Carlsbad, Calif.). On the day of the transfection, the
cells were .about.90% confluent and the media was replaced with
RPMI media containing 10% fetal bovine serum and 20 mM Glutamine
and no antibiotics. For each well, 4 ul of a 20 uM stock of the
siRNA was diluted into 50 ul Opti-MEM (Gibco/Invitrogen
Corporation, Carlsbad, Calif.). In a separate tube, 2 ul of
Lipofectamine 2000 (Invitrogen Corp., Carlsbad, Calif.) was diluted
into 50 ul of Opti-MEM. The diluted siRNA and the diluted
Lipofectamine 2000 solutions were mixed and left at room
temperature for 20 minutes. The mixture was then added to the cells
containing media without antibiotics and incubated at 37.degree.
C., 5% CO.sub.2, for 24 hours. The transfections were done in
triplicates. Cells (siRNA transfected as described above) from each
well of the 24 well-culture plates (i.e., .about.0.5.times.10.sup.5
cells) were washed once with 1.times.PBS and then lifted from the
plates with 0.5 ml of Cell Stripper (Cellgro/Mediatech, Herndon,
Va.). 3 ml of 1.times.PBS was added to wash cells and then the
cells were centrifuged at 1.5 K for 8 minutes at 4.degree. C. to
pellet.
[0100] Cells were resuspended in 0.2 ml of binding buffer which is
composed from DMEM (Gibco/BRL/Invitrogen Corporation, Carlsbad,
Calif.) with a final concentration of 1% BSA (Sigma-Aldrich Co.
Saint Louis, Mo.) and 0.02% azide. Rabbit anti sera was added at a
dilution of 1:250. The cells and antibody mixture was incubated for
one hour on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet, washed twice with 10 ml of binding
buffer and resuspended in a final volume of 0.2 ml of binding
buffer containing the 2.degree. antibody a Fluorescein
(FITC)-conjugated AffiniPure F(ab').sub.2 Goat Anti-Rabbit IgG.at a
dilution of 1:200 (Jackson Immunoreseach Laboratories, Inc, West
Grove, Pa.). The cells and antibody mixture was incubated for 30
minutes on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet washed twice with 10 ml of binding buffer
and resuspended in a final volume of 0.5 ml of binding buffer for
FACS analysis. The cells were analyzed on a Becton Dickenson
FACSort using Cell Quest software (Becton-Dickenson, Franklin
Lakes, N.J.). Cells were live gated and red/green color was
compensated.
[0101] FIG. 32 illustrates the results of an ELISA assay detecting
muc5AC protein levels in the supernatants of H292 cells transfected
with the RAI-3 siRNA reagent 1864+1865 and exposed to cigarette
smoke bubbled media, CS-10. Shown on the left are H292 cells that
were untransfected, in triplicate, and exposed to cigarette smoke
bubbled media, CS-10, for 72 hours. Shown in the middle, are H292
cells that were transfected with Lipofectamine 2000 alone without
any siRNA, in triplicate, and exposed to cigarette smoke bubbled
media, CS-10, for 72 hours. Shown on the left are H292 cells that
were transfected with the RAI-3 siRNA reagent 1864+1865, in
triplicate, and exposed to cigarette smoke bubbled media, CS-10,
for 72 hours. Untransfected controls (in triplicate) receiving
CS-10 media showed a 7.73 fold increase in the levels of muc5AC
protein in the supernatant when compared to the supernatant of
cells with only serum-free RPMI media (CS-10: average signal
0.5927, StDev 0.1326, serum-free media: average signal 0.0766,
StDev 0.0339).
[0102] FIG. 33 shows the results of immunohistochemical (IHC)
staining in human lung tissue using rabbit ant-RAI-3 antisera.
Anti-RAI-3 antisera was generated using a synthesized peptide
corresponding to amino acids 269-284 of SEQ ID NO:3 as described
herein. Panel A shows RAI-3 staining in respiratory epithelium in
normal lung isolated from a 78-year-old female at 40.times.
magnification. Panel B shows RAI-3 staining in respiratory
epithelium in normal lung isolated from a 47-year-old female at
40.times. magnification. Panel C shows RAI-3 staining in
respiratory epithelium in emphysema lung isolated from a
57-year-old female at 40.times. magnification. The level of
staining of RAI-3 in emphysema tissues is more pronounced as
compared to the level of staining observed in normal lung tissue.
The results are consistent with the putative role of RAI-3 in the
pathobiology of cigarette smoke-related pulmonary disease.
[0103] FIG. 34 shows the results of immunohistochemical (IHC)
staining in human lung tissue using rabbit ant-RAI-3 antisera.
Anti-RAI-3 antisera was generated using a synthesized peptide
corresponding to amino acids 269-284 of SEQ ID NO:3 as described
herein. Panel A shows RAI-3 staining in respiratory epithelium in
bronchitus lung isolated from a 56-year-old male at 40.times.
magnification. Panel B shows RAI-3 staining in respiratory
epithelium in bronchitus lung isolated from a 63-year-old male at
40.times. magnification. Panel C shows RAI-3 staining in seromucous
glands in bronchitus lung isolated from a 63-year-old male at
40.times. magnification. Panel D shows RAI-3 staining in mucosal
inflammation in bronchitus lung isolated from a 63-year-old male at
40.times. magnification. The level of staining of RAI-3 in
bronchitis, seromucous gland, and mucosal inflammation tissues is
more pronounced as compared to the level of staining observed in
normal lung tissue (compare Panels A and B in FIG. 33). The results
are consistent with the putative role of RAI-3 in the pathobiology
of cigarette smoke-related pulmonary disease.
[0104] FIG. 35 shows the .beta.-lactamase concentration response
curve obtained from the UHTSS system for Compound 1 that was
identified by screening the RAI-3 polypeptide for modulators (Panel
A). Panel B shows the P-lactamase concentration response curve
obtained from the UHTSS system for Compound 1 against another
G-protein coupled receptor, HGPRBMY7. The constitutive level of
activity of the RAI-3 expressing cell lines was matched to the
level of constitutive activity for HGPRBMY7 for all data points.
The data demonstrates that Compound 1 is a selective modulator of
RAI-3.
1TABLE 1 Position Corre- in RAI-3 sponding Amino Acid/ Nucleic Acid
Nucleotides Position Corresponding Sequence in FIGS. in RAI- Amino
Acid in (cDNA) 25A-C (wt 3 Amino Acid in FIGS. nt/variant Sequence
in (wt aa/variant ID 25A-C nt*) aa**) RAI-3-s1 112 g/a RAI-3-s2 364
c/t 37 (Ala37Ala) Ala/Ala RAI-3-s3 511 c/t RAI-3-s4 523 c/t
RAI-3-s5 797 a/g 182 Thr/Ala (Thr182Ala) RAI-3-s6 605 a/g 118
Ser/Gly (dbSNP (Ser118Gly) rs850932.sup..Yen.) RAI-3-s8 1111 t/c
286 Pro/Pro (Pro286Pro) RAI-3-s9 1173 a/g 307 Gln/Arg (Gln307Arg)
*wild-type nucleotide/variant nucleotide **wild-type amino
acid/variant amino acid .sup..Yen.The Ser118Gly missense SNP was
identified as rs850932 in the NCBI SNP database (NCBI dbSNP).
DETAILED DESCRIPTION OF THE INVENTION
[0105] The present invention describes the identification of
proteins and their component peptides that are activated and/or
modified when cells are exposed to smoke resulting from the burning
of tobacco containing products and substances, namely cigarette
smoke. Since cigarette smoke is the major causative factor for
COPD, identifying the proteins and signal transduction pathways
that are activated and/or modified when cells are exposed to
cigarette smoke is newly provided as a critical aspect of
identifying new drug targets for the treatment of COPD as described
herein. In accordance with this invention, proteomics methods were
designed and used to isolate cigarette smoke-inducible tyrosine
phosphorylated proteins (activation complexes) from airway
epithelial cells exposed to smoke. (Examples 1D-1F).
[0106] This strategy was employed based on the following
nonlimiting hypothesis according to this invention: Exposure to
smoke induces oxidative stress, inhibits phosphatases, activates
Src and transactivates EGFR, and potentially other receptor
tyrosine kinases. This activation contributes to the transcription
of mucin and cytokine genes which, in turn, contribute to the cause
and symptoms of COPD. Compounds that are able to inhibit this
activation, e.g., by affecting cellular proteins and/or peptides
that are induced, activated and/or modified following cigarette
smoke exposure, are thus reasoned to be useful as drugs for
treating COPD.
[0107] In accordance with the present invention, the RAI-3 protein,
a member of the G-protein coupled receptor superfamily, was newly
identified among the various proteins found to be tyrosine
phosphorylated (or associated/complexed with tyrosine
phosphorylated proteins) only in cells that had been exposed to
cigarette smoke. As described herein, phosphorylated RAI-3 protein
has been newly found to be associated with the exposure of cells to
cigarette smoke. Because of its first identification as a protein
whose expression and modification are linked to smoke exposure of
cells, and thus to COPD as described herein, RAI-3 emerges by
virtue of the present invention as a new target for use in
identifying RAI-3 modulators, e.g., drugs, compounds, or biological
agents, and the like, for the treatment and prevention of COPD and
COPD related diseases, disorders and conditions. Because RAI-3 was
found to be expressed primarily in lung tissue (FIG. 6), it is an
especially appealing target for the identification and screening of
drugs for the treatment and prevention of COPD.
[0108] Briefly, to achieve the identification of proteins having a
strong link to the exposure of cells to cigarette smoke, and thus a
link to COPD, airway epithelial cells (lung cells) were treated
both with and without cigarette smoke-bubbled media. (Examples 1A
and 1B). Whole cell lysates were harvested and the proteins therein
purified using anti-phosphotyrosine antibodies. The purified
phosphorylated proteins were then proteolyzed together and the
polypeptide fragments so created were identified by packed
capillary HPLC coupled to tandem mass spectrometry. (Examples 1D
and 3E). Data were searched, and peptides identified, using the
SEQUEST algorithm as further described herein. Approximately 350
proteins were identified as being tyrosine phosphorylated (or
associated with tyrosine phosphorylated proteins) only in those
cells that had been exposed to cigarette smoke (treated cells).
Included among the 350 identified proteins were a variety of
signaling molecules, components of the epidermal growth factor
receptor (EGFR) pathway, and RAI-3. The proteins found to be
present in the treated versus the untreated samples were compared
to identify those proteins that were activated by the cigarette
smoke treatment, either exclusively or preferentially. Using this
technique, certain peptides corresponding to the amino acid
sequence of the RAI-3 (Retinoic Acid Induced 3) protein were
isolated and the peptides were used in the determination of RAI-3
as a target protein for COPD treatment and prevention.
[0109] The gene encoding RAI-3, (formerly known as RAIG1), was
reported in connection with studies performed to identify retinoic
acid-regulated genes from a human oral squamous carcinoma cell
line. (Y. Cheng and R. Lotan, 1998, "Molecular cloning and
characterization of a novel retinoic acid-inducible gene that
encodes a putative G protein-coupled receptor", J. Biol. Chem.,
273:35008-15). In their studies, Cheng and Lotan used differential
display to identify retinoic acid-regulated genes from a human oral
squamous carcinoma cell line to better understand the mechanisms
through which retinoids suppress carcinogenesis. A cDNA
corresponding to a retinoic acid-induced gene was named RAIG1.
Subsequently, RAIG1 was renamed "RAI-3", as it is now known.
Synonyms for RAI-3 include RAI-3; Retinoic Acid Induced 3; RAIG1;
raig1 and GPRC5A.
[0110] According to Cheng and Lotan, RAI-3 expression was induced
in cells subjected to all-trans-retinoic acid (ATRA) rapidly and in
a dose-dependent manner. The levels of RAI-3 mRNA in different
cancer cells varied greatly, with no correlation between the
expression levels and the type of cancer cells. RAI-3 was also
nonspecifically expressed in several normal human tissues, with the
highest expression levels found in fetal and adult lung. Northern
blot analysis detected two RAI-3 transcripts of 2.4 and 6.8 kb,
which were surmised to result from the alternative use of different
polyadenylation sites. (Cheng and Lotan, 1998, Ibid.).
[0111] The approved UCLA/HGNC/HUGO Human Gene Nomenclature database
symbol is RAI-3 (retinoic acid induced 3), which corresponds to
RefSeq NM.sub.--003979 (NCBI Database), which is 2456 bases in
length (RAI-3 sequences: FIGS. 10A and 10B and FIGS. 11B and 11C),
(SEQ ID NO:2).
[0112] The human RAI-3 polynucleotide sequence encodes a deduced
protein of 357 amino acids in length (SEQ ID NO:3), with a
calculated molecular mass of 40,256 Da. RAI-3 contains 7 predicted
transmembrane domains, which is a signature motif of the G
protein-coupled receptor superfamily, and a potential N-linked
glycosylation site. Using a combination of radiation hybrid mapping
and YAC contig mapping, the RAI-3 gene was localized to
12p13-p12.3, between markers D12S358 and D12S847. (Cheng and Lotan,
1998, Ibid.).
[0113] RAI-3 is a member of the GPCR Class C Family of Metabotropic
glutamate/pheromone GPCRs and defined a new group in Class C, Group
5. Group 5 GPCR family members are most homologous to Class C
GPCRs, although topographically they are more similar to the Class
A GPCRs which have short extracellular amino terminal domains,
rather than to the very long extracellular amino terminal domains
of the Class C GPCRs. Since the time that RAI-3 was cloned, three
new members of the group, GPRC5B, GPRC5C and GPRC5D have all been
cloned by bioinformatics methods (H. Brauner-Osborne et al., 2000,
Genomics, 65:121-128; M. J. Robbins et al., 2000, Genomics,
67:8-18; H. Brauner-Osborne et al., 2001, Biochim Biophys Acta,
1518:237-248).
[0114] The GCG pileup program was used to generate a multiple
sequence alignment of RAI-3 with other Class C, Group 5 family
members (FIG. 9). The percentage identities and similarities
between RAI-3 and other Class C, Group 5 family members were
generated using the general method of S. B. Needleman and C. D.
Wunsch. (1970, "A general method applicable to the search for
similarities in the amino acid sequence of two proteins", J. Mol.
Biol., 48(3):443-53) and are shown in Table 2. Specifically, the
GAP global alignment program in GCG was used to calculate the
percent identity and similarity values presented in Table 2. The
following GAP program parameters were used to obtain the values:
gap creation penalty: 6; and gap extension penalty: 2.
2TABLE 2 Sequence Similarity/Identity of Human RAI-3 with Other
GPCR Class C, Group 5 Family Members Identity (%) Similarity (%)
Human RAI-3 vs Human GPCR5B 37.791 46.512 Human RAI-3 vs Human
GPCR5C 40.510 49.858 Human RAI-3 vs Human GPCR5D 45.455 53.079
Human RAI-3 vs Mouse GPCR5D 46.959 55.405
[0115] As can be seen from Table 2, human RAI-3 is most similar to
GPCR5D (45% sequence identity with human GPCR5D and 47% sequence
identity with murine GPCR5D) and to GPRC5C (41% sequence
identity).
[0116] In accordance with an embodiment of the present invention,
proteomics methods (i.e., a combination of biochemistry and
analytical chemistry techniques) were used to test a premise
according to the present invention that certain proteins would
become phosphorylated directly or indirectly (e.g., by associating
with already-phosphorylated proteins, or with proteins that became
phosphorylated) as a result of exposure of epithelial airway cells
with solubilized cigarette smoke (Examples 1A-1F). This premise was
based upon observations that the oxidative stressing of these cells
by solubilized cigarette smoke and by other agents (e.g., J.
Immunol., 2000, 164(3):1546-1552) contributed to an increase in the
transcription of mucin and cytokine genes, and that the concomitant
translations of these transcripts contributed to the cause(s) and
underlying symptoms of COPD. Thus, cellular proteins induced,
activated and/or modified by exposure to cigarette smoke, or smoke
from other tobacco burning materials, would make good candidate
targets for the diagnosis, screening, prognosis and treatment of
the cause(s) and symptoms of COPD. Thus, using proteomics methods
and a series of replicate experiments and evaluation, a set of
proteins was identified, one of which was the RAI-3 protein. The
discovery of RAI-3 following cigarette smoke exposure of airways
cells supported the premise that certain proteins were indeed
tyrosine phosphorylated directly, or indirectly by associating with
other proteins that were already phosphorylated, or that became
phosphorylated, following treatment of epithelial airway cells with
solubilized cigarette smoke.
[0117] As a protein that by itself is a candidate for activating
genes that cause the symptoms and/or the effects of COPD, or for
playing a more indirect role in such gene activation, RAI-3, and
peptides thereof, are thus provided as pivotal targets for treating
and/or preventing COPD according to this invention. In addition,
modification and/or activation of RAI-3 following cellular exposure
to cigarette smoke can serve directly to cause or maintain the
effects of COPD, and/or its symptoms.
[0118] The RAI-3 protein is also regulated by all-trans-retinoic
acid (ATRA), as RAI-3 mRNA levels were found to increase in
response to ATRA (Example 1(M) and FIG. 5). Because RAI-3 is a
member of the GPCR protein family, its induction by ATRA indicates
that the effects of retinoids, e.g., ATRA, and GPCR signal
transduction pathways are linked or associated. Thus, RAI-3 could
further play a role in mediating the effects of ATRA on
embryogenesis, differentiation and tumorigenesis. (L. J. Gudas,
1994, Curr. Opin. Cell Biol., 6:825-831; G. M. Morriss-Kay and N.
Sokolova, 1996, FASEB J., 10:961-968; M. B. Sporn et al., 1994, The
Retinoids: Biology, Chemistry and Medicine, 2nd Ed., Raven Press,
New York, N.Y.). Experiments in which rats displaying
characteristics of human and experimental emphysema were treated
with ATRA resulted in a reversal of the adverse changes to the
lungs (G. D. Massaro et al., 2000, Am J Physiol Lung Cell Mol
Physiol., 278(5):L955-L960). Because RAI-3 mRNA levels are
increased in response to ATRA in animal models of emphysema, RAI-3
is a candidate protein for involvement in regenerating lung tissue
and elasticity in the treatment of COPD and emphysema, particularly
in response to ATRA treatment of lung related diseases.
[0119] Further, RAI-3 may also be involved in processes that
reverse malignant transformation, in view of RAI-3 mRNA levels
being increased in response to ATRA. Retinoids, such as ATRA, have
been shown to be able to reverse malignant transformation in
several chemoprevention trials. More specifically, retinoids have
been shown to suppress oral premalignant leukopakia lesions and
decrease the incidence of second primary tumors in head and neck
cancer patients (P. G. Sacks et al., 1989, Head Neck,
11(3):219-25). Thus, modulators of RAI-3, such as agonist
compounds, can be considered to be efficacious in enhancing the
reversal of lung deterioration and disease, as well as in enhancing
the reversal of malignant transformation. Accordingly, uses of
RAI-3 modulators, e.g., agonists and/or antagonists, encompass
treatments for COPD and COPD related disorders, as well as for
cancers, e.g., lung cancer, breast cancer, stomach cancer,
testicular cancer, etc., as well as malignancies, so as to result
in reduction, amelioration, reversal, or elimination of a disease,
disorder or condition associated with RAI-3 activity and/or
function.
[0120] In one embodiment of the present invention the RAI-3 nucleic
acid and/or amino acid sequences, or a fragment thereof, e.g.,
oligomers or peptides, can be used to diagnose or screen for COPD,
or COPD related diseases or disorders, for example, by assaying for
over- or under-expression of the RAI-3 protein or RAI-3 peptides,
as is further described herein. Expression of RAI-3 in individuals
having COPD or a COPD related disorder, or in those individuals
suspected of having COPD or a COPD related disorder, can be
assessed by identifying mutations in the RAI-3 protein or in mRNA
levels. As discussed further herein, an RAI-3 polypeptide or
peptide is useful for screening compounds that affect the activity
or function of the RAI-3 protein as a target for compounds that are
suitable for use in treatments and therapies for COPD or COPD
related conditions, diseases and disorders.
[0121] Additional evidence that RAI-3 is involved in the cellular
response to cigarrette smoke demonstrates that RAI-3 is tyrosine
phosphorylated in response to cigarette smoke, but not in response
to EGF (see FIG. 26A). The results also demonstrate that endogenous
RAI-3 protein in H292 cell lines is tyrosine phosphorylated or
associated with tyrosine phosphorylated proteins in the H292 cell
line in response to cigarette smoke (see FIG. 26B). The blot in
FIG. 26B is a result of an immunoprecipitation using anti-flag
antibodies and blotting the gel with an anti-phosphotyrosine
secondary antibody.
[0122] Specifically, a transient transfection of a A549 cell line
with a Flag-RAI-3 construct (described herein) shows that an
anti-flag immunoprecipitate containing the recombinant Flag-RAI-3
protein is tyrosine phosphorylated in response a 1 to 3 hour
exposure to cigarette smoke-bubbled media, CS-160 (FIG. 26A and
FIG. 26B). The blot in FIG. 26A is a result of an
immunoprecipitation using anti-flag antibodies and blotting the gel
with an anti-flag secondary antibody. CS-160 for 3 hours is
equivalent to the dose that was used in the initial Proteomics
experiments that led to the identification of RAI-3 as being a
component of a cigarette smoke-induced tyrosine phosphorylated
complex. These results also show that EGF does not appear to cause
tyrosine phosphorylation of the recombinant FLAG-RAI-3 protein in
this experiment.
[0123] The latter results were confirmed to be specific to RAI-3 by
generating anti-RAI-3 antibodies and repeating the blots with the
anti-RAI-3 antibody (see FIGS. 27A and 27B).
[0124] Rabbit anti-RAI-3 polyclonal antibody was generated by
immunizing mice with an RAI-3 protein antigen (MS2-RAI-3 fusion
protein as described herein). The rabbit RAI-3 antisera was able to
recognize a protein of the predicted molecular weight of 41 kDa in
a lysate of a stable Flag-RAI-3 CHO cell line (previously
described) when immunoprecipitated with an anti-Flag antibody (FIG.
27A). The rabbit RAI-3 antisera was able to immunoprecipitate a
protein the predicted molecular weight from a lysate of a stable a
stable Flag-RAI-3 CHO cell line and detected with an anti-Flag-HRP
antibody (FIG. 27B). In addition to detecting a protein of the the
predicted molecular weight, the detection with an anti-Flag
antibody of the rabbit RAI-3 antisera immunoprecipitate of the
Flag-RAI-3 CHO cell line, showed a smear of high molecular weight
bands. This is consistent with the observations that HEK293
extracts over-expressing a c-myc-GPRC5B receptor (RAI-3, aka
GPRC5A, family member) when probed with rabbit anti-GPRC5B showed,
in addition to the expected MW of 68 kDa, higher molecular weight
bands that potentially represent GPRC5B dimers (at approximatelty
130 kDa) or higher molecular weight protein aggregates (Brain Res
Mol Brain Res. 2002 Oct. 15;106(1-2):136-44. Localisation of the
GPRC5B receptor in the rat brain and spinal cord. Robbins M J,
Charles K J, Harrison D C, Pangalos M N.).
[0125] Further confirmation that RAI-3 is a component of a
cigarette smoke-induced tyrosine phosphorylated complex, several
additional experiments demonstrated that rabbit RAI-3 antisera can
immunoprecipitate tyrosine phosphorylated proteins in response to
exposure cigarette smoke-bubbled media (see FIGS. 28A and 28B).
H292 lung airway epithelial cells were serum-starved for 24 hours
and then exposed to various dilutions cigarette smoke-bubbled media
(FIG. 28A and FIG. 28B) for three hours. The cells were lysed and
immunoprecipitated with either anti-EGFR antibody, rabbit
pre-immune antisera or rabbit RAI-3 antisera. There was a clear
dose response of increasing tyrosine phosphorylation with
increasing concentrations of cigarette smoke-bubbled media.
Comparing the bands in the anti-EGFR antibody immunoprecipitate to
the bands in the rabbit RAI-3 antisera immunopreciptate,
demonstrated that the banding pattern was clearly different between
the two antibodies. Although there appear to be some bands of the
same MW, it is clear that the banding pattern is different. The
.about.180 kDa MW band in the anti-EGFR antibody immunoprecipitate
is EGFR as determined by blotting with an anti-EGFR antibody (data
not shown). The band at .about.40 kDa in the rabbit RAI-3 antisera
immunopreciptate is believed to be RAI-3, although blotting with
the rabbit RAI-3 antisera did not give clear results in this
experiment (data not shown).
[0126] Additional characterization of the anti-RAI-3 antisera
demonstrated that it can recognize recombinant Flag-RAI-3 expressed
in a stable CHO cell line (see FIG. 29).
[0127] Specifically, polyclonal rabbit antisera, GW7, was raised
against an almost full length RAI-3 fusion protein antigen
expressed in bacteria (as discussed herein). A post boost #4 bleed
of the rabbit antisera, GW7, could recognize Flag-RAI-3 expressed
in the stable CHO cell line, clone B8, by FACs analysis (see FIG.
29). The parental CHO line and the stable CHO cell line, clone B8,
expressing the Flag-RAI-3 recombinant protein were compared using
an HRP-conjugated anti-FLAG antibody and a post boost #4 bleed of
the rabbit antisera, GW7. Using the HRP-conjugated anti-FLAG
antibody and gating 100%, the mean signal of the parental cell line
was 4.82 and the mean signal of the stable Flag-RAI-3 CHO cell
line, clone B8, was 34.97. The anti-FLAG signal detecting the
Flag-RAI-3 protein on the surface of the stable CHO cell line was
7-fold over background. Using the pre-immune antisera from the GW7
rabbit, and gating 100%, the mean signal of the parental cell line
was 8.23 and the mean signal of the stable Flag-RAI-3 CHO cell
line, B8, was 9.19. Clearly, there was no signal over background in
the rabbit GW7 pre-immune antisera against the Flag-RAI-3 CHO cell
line, clone B8. Using a post boost #4 bleed of the rabbit antisera,
GW7, and gating 100%, the mean signal of the parental cell line was
68.40 and the mean signal of the stable Flag-RAI-3 CHO cell line,
clone B8, was 193.51. Although there appears to be a higher
background signal against the parental CHO cell line with the post
boost #4 bleed of the rabbit antisera, GW7, the signal detecting
the Flag-RAI-3 protein on the surface of the stable Flag-RAI-3 CHO
cell line, clone B8, was 2.8-fold over background. Clearly, the
post boost #4 bleed of the rabbit antisera, GW7, can detect the
Flag-RAI-3 recombinant protein expressed at the surface in the
Flag-RAI-3 CHO cell line, clone B8.
[0128] Additional results also demonstrate that the RAI-3 rabbit
antisera can recognize endogenous RAI-3 on the surface of the
airway epithelial cell lines A549 and H292.
[0129] Specifically, the post boost #4 bleed of the rabbit
antisera, GW7, could recognize endogenous RAI-3 on the surface of
the airway epithelial cell lines, A549 and H292 by FACs analysis
(see FIG. 30). FACs analysis of the A549 and H292 cell lines with
no antibody present gave mean signals of 5.40 and 9.32,
respectively. FACs analysis of the A549 and H292 cell lines using
the 2.degree. antibody alone gave mean signals of 6.01 and 10.47,
respectively. FACs analysis of the A549 and H292 cell lines using
the rabbit GW7 pre-immune antisera gave mean signals of 7.58 and
14.70, respectively. There was no signal over background in the
rabbit GW7 pre-immune antisera detected on the airway epithelial
cell lines, A549 and H292. FACs analysis of the A549 and H292 cell
lines using the the post boost #4 bleed of the rabbit antisera,
GW7, gave mean signals of 50.24 and 115.72, respectively. Clearly,
there was no signal over background in the rabbit GW7 pre-immune
antisera detected on the airway epithelial cell lines, A549 and
H292. The post boost #4 bleed of the rabbit antisera, GW7, gave a
6.6-fold increase in signal as compared to the rabbit GW7
pre-immune antisera on the A549 cell line. The post boost #4 bleed
of the rabbit antisera, GW7, gave a 7.8-fold increase in signal as
compared to the rabbit GW7 pre-immune antisera on the H292 cell
line. Comparing the signals of the post boost #4 bleed of the
rabbit antisera, GW7, on the A549 and H292 cell line shows that the
H292 cell line has a 2.3 fold larger signal. This correlates well
with Affychip data that shows that the H292 cell line expresses
about twice as much RAI-3 mRNA as compared to the A549 cell line
(data not shown).
[0130] In an effort to further assess the role of RAI-3, double
stranded RNAi reagents were created to specifically inhibit
transcription of the RAI-3 protein. Several experiments were
performed to demonstrate that subjecting H292 cells with siRNA
reagents 1864 and 1865 reduced levels of endogenopus RAI-3 protein
(see FIG. 31). When the airway epithelial cell line, H292, was
transfected with the RAI-3 siRNA reagent 1864+1865, there were
reduced levels of endogenous RAI-3 protein expressed at the surface
of the cell as detected by FACs analysis using the post boost #4
bleed of the rabbit RAI-3 antisera, GW7. Transfections of the H292
cell line were done in triplicate. FACs analysis of control H292
cells that were not transfected had a mean signal of 13.74 when no
antibody was added, a mean signal of 64.74 when the pre-immune
antisera from the GW7 rabbit was added, and mean signal of 357.43
when the post boost #4 bleed of the rabbit RAI-3 antisera, GW7 was
added. FACs analysis of control H292 cells that were transfected,
in triplicate, with Lipofectamine 2000 alone without any siRNA, had
a average mean signal of 401.41 (StDev of 30.97). FACs analysis of
H292 cells that were transfected, in triplicate, with the RAI-3
siRNA reagent 1864+1865, had a average mean signal of 278.22 (StDev
of 47.83).
[0131] Consistent with the association of RAI-3 to the incidence of
pulmonary disease, and in particular COPD, additional experiments
were performed that demonstrate that H292 cells treated with
cigarette-smoke bubble media are transfected with RAI-3 siRNA
1864+1865, the levels of muc5AC protein in the cell supernatant is
significantly reduced when compared to untransfected or control
transfected cells. (see FIG. 32).
[0132] Specifically, when the airway epithelial cell line, H292,
was transfected with the RAI-3 siRNA reagent 1864+1865, there were
reduced levels of muc5AC protein in the supernatent as detected by
ELISA. H292 cells that were untransfected, in triplicate, and
exposed to cigarette smoke bubbled media, CS-10, for 72 hours
showed an average ELISA signal of 0.87 (StDev of 0.044). H292 cells
that were transfected with Lipofectamine 2000 alone without any
siRNA, in triplicate, and exposed to cigarette smoke bubbled media,
CS-10, for 72 hours showed an average ELISA signal of 0.91 (StDev
of 0.082). H292 cells that were transfected with with the RAI-3
siRNA reagent 1864+1865, in triplicate, and exposed to cigarette
smoke bubbled media, CS-10, for 72 hours showed an average ELISA
signal of 0.206 (StDev of 0.063).
[0133] Immunohistochemical assays were also performed to further
assess the expression pattern of RAI-3 and to identify any
differential expression patterns in normal compared to diseased
lung tissue. Polyclonal anti-RAI-3 antisera was generated from
rabbits immunized against one of two peptides specific to RAI-3
(SEQ ID NO:91 and 92). Consistent with the putative role of RAI-3
in the pathobiology of cigarette smoke-related pulmonary disease,
increases in staining were identified in samples of pulmonary
emphysema and chronic bronchitis when compared to normal
(disease-free) lungs as evident in the representative samples shown
in FIGS. 33 and 34.
[0134] In addition, increased staining over normal tissue was
observed in ulcerative colitis, cerebral infarct, myocardial
infarct, diabetic nephropathy, allergic rhinitis, Crohn's disease,
atherosclerosis and rheumatoid arthritis. These findings suggest a
role for RAI-3 in inflammatory/auto-immune disorders outside of the
lung in addition to COPD. The most noteworthy staining of
malignancies was observed in malignant melanoma in which tumor
cells stained moderately to strongly, and, in one sample, many
moderately to strongly positive tumor-associated lymphocytes were
identified. In addition, at least faintly positive staining was
identified in glioblastoma, pulmonary small cell undifferentiated
carcinoma, carcinoma of the breast, colon, lung, ovary, pancreas,
and prostate, and in non-Hodgkin's lymphoma. Increased staining was
also observed in benign prostatic hyperplasia.
RAI-3 Nucleic Acid and Variants
[0135] The RAI-3 nucleic acid molecule (SEQ ID NO:2) encodes the
RAI-3 protein or polypeptide (SEQ ID NO:3) that is newly described
by this invention as being involved in the development and/or
persistence of COPD and COPD related diseases, disorders and
conditions. Although RAI-3 has been shown to display sequence
homology to members of the G-protein receptor family, this protein
has not previously been shown to be associated with, or linked to,
cellular exposure to cigarette smoke, with COPD, or with COPD
related diseases, disorders and conditions. An RAI-3 nucleic acid
molecule or an RAI-3 nucleic acid or polynucleotide can also refer
to fragments and/or degenerate variants of nucleic acid sequences,
including naturally occurring variants or mutant alleles thereof.
Such fragments include, for example, nucleic acid sequences that
encode portions of the RAI-3 protein that correspond to functional
domains of the protein. In particular, an RAI-3 fragment, or
peptide, as determined by the proteomics methods of the present
invention is further embraced by the present invention. More
specifically an RAI-3 fragment of the present invention comprises a
nucleic acid sequence of at least 42 nucleotides in length encoding
an amino acid sequence having at least 14 amino acids in length,
for example, the polynucleotide provided in SEQ ID NO:1.
[0136] In preferred embodiments, the present invention encompasses
a polynucleotide lacking including the initiating start codon, in
addition to, the resulting encoded polypeptide of RAI-3.
Specifically, the present invention encompasses the polynucleotide
corresponding to nucleotides 251 thru 1324 of SEQ ID NO:2, and the
polypeptide corresponding to amino acids 1 thru 357 of SEQ ID NO:3.
Also encompassed are recombinant vectors comprising said encoding
sequence, and host cells comprising said vector.
[0137] In preferred embodiments, the present invention encompasses
a polynucleotide lacking the initiating start codon, in addition
to, the resulting encoded polypeptide of RAI-3. Specifically, the
present invention encompasses the polynucleotide corresponding to
nucleotides 254 thru 1324 of SEQ ID NO:2, and the polypeptide
corresponding to amino acids 2 thru 357 of SEQ ID NO:3. Also
encompassed are recombinant vectors comprising said encoding
sequence, and host cells comprising said vector.
[0138] Although RAI-3 displays sequence and structural homology to
members of the GPCR family of proteins (Table 2), as known in the
art, it is also known in the art that proteins displaying such
homologies can have significant differences in function, activity
and molecular interactions within the cell, as well as differences
in tissue expression. As such, it is acknowledged in the art that
nucleic acid molecules and the proteins encoded by those molecules
sharing these homologies can still represent diverse, distinct and
unique nucleic acids and proteins, respectively.
[0139] An RAI-3 nucleic acid molecule as described herein can
comprise the following sequences: (a) the DNA sequence of RAI-3 as
shown in FIGS. 10A and 10B and 11B and 11C, and SEQ ID NO:2; (b)
any nucleic acid sequence that encodes the amino acid sequence of
RAI-3 of SEQ ID NO:3 and FIGS. 11A-11C; (c) any nucleic acid
sequence that hybridizes to the complement of nucleic acid sequence
that encodes the amino acid sequence of SEQ ID NO:3, or FIGS.
11A-11C under highly stringent conditions, e.g., hybridization to
filter-bound DNA in 0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate
(SDS), 1 mM EDTA at 65.degree. C., and washing in
0.1.times.SSC/0.1% SDS at 68.degree. C. (see, e.g., F. M. Ausubel
et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I,
Green Publishing Associates, Inc., and John Wiley & sons, Inc.,
New York, at p. 2.10.3); or (d) any nucleic acid sequence that
hybridizes to the complement of the nucleic acid sequences that
encode the amino acid sequence of SEQ ID NO:3 or FIGS. 11A-11C
under less stringent conditions, such as moderately stringent
conditions, e.g., washing in 0.2.times.SSC/0.1% SDS at 42.degree.
C. (F. M. Ausubel et al., 1989, supra), and which encodes a gene
product functionally equivalent to an RAI-3 gene product encoded by
the nucleic acid sequence depicted in FIGS. 10A and 10B and 11B and
11C (SEQ ID NO:2). "Functionally equivalent" as used herein refers
to any protein capable of exhibiting a substantially similar in
vivo or in vitro activity as the RAI-3 gene product encoded by the
RAI-3 nucleic acid molecule described herein, e.g., modulation of
second messenger molecules involved in COPD or related diseases and
conditions, or direct causative effects associated with COPD or
related diseases and conditions.
[0140] As used herein, the term "RAI-3 nucleic acid molecule" or
"RAI-3 nucleic acid" can also refer to fragments and/or degenerate
variants of the nucleic acid sequences of (a) through (d) above,
including naturally occurring variants or mutant alleles thereof.
Such fragments include, for example, nucleic acid sequences that
encode portions of the RAI-3 protein that correspond to functional
domains of the protein. In addition, RAI-3 nucleic acid molecules
can include isolated nucleic acids, preferably DNA molecules, that
hybridize under highly stringent or moderately stringent
hybridization conditions to at least about 6, preferably at least
about 12, more preferably at least about 18, and most preferably
about 42 consecutive nucleotides of the nucleic acid sequences of
(a) through (d), as described above.
[0141] The terms "stringent conditions" or "stringency" refer to
the conditions for hybridization as defined by nucleic acid
composition, salt, and temperature. These conditions are well known
in the art and may be altered to identify and/or detect identical
or related polynucleotide sequences in a sample. A variety of
equivalent conditions comprising either low, moderate, or high
stringency depend on factors such as the length and nature of the
sequence (DNA, RNA, base composition), reaction milieu (in solution
or immobilized on a solid substrate), nature of the target nucleic
acid (DNA, RNA, base composition), concentration of salts and the
presence or absence of other reaction components (for example,
formamide, dextran sulfate and/or polyethylene glycol) and reaction
temperature (within a range of from about 5.degree. C. below the
melting temperature of the probe to about 20.degree. C.-25.degree.
C. below the melting temperature). One or more factors may be
varied to generate conditions, either low or high stringency that
are different from, but equivalent to, the aforementioned
conditions.
[0142] As will be understood by those of skill in the art, the
stringency of hybridization can be altered in order to identify or
detect identical or related polynucleotide sequences. As will be
further appreciated by the skilled practitioner, the melting
temperature, T.sub.m, can be approximated by the formulas that are
well known in the art, depending on a number of parameters, such as
the length of the hybrid or probe in number of nucleotides, or
hybridization buffer ingredients and conditions (see, for example,
T. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; J.
Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989; Current
Protocols in Molecular Biology, Eds. F. M. Ausubel et al., Vol. 1,
"Preparation and Analysis of DNA", John Wiley and Sons, Inc.,
1994-1995, Suppls. 26, 29, 35 and 42; pp. 2.10.7-2.10.16; G. M.
Wahl and S. L. Berger, 1987, Methods Enzymol. 152:399-407; and A.
R. Kimmel, 1987; Methods of Enzymol. 152:507-511).
[0143] As a general guide, T.sub.m decreases approximately
1.degree. C.-1.5.degree. C. with every 1% decrease in sequence
homology in an aqueous solution containing 100 mM NaCl. Also, in
general, the stability of a hybrid is a function of ionic strength
and temperature. Typically, the hybridization reaction is initially
performed under conditions of low stringency, followed by washes of
varying, but higher stringency. Reference to hybridization
stringency, for example, high, moderate, or low stringency,
typically relates to such washing conditions. It is to be
understood that the low, moderate and high stringency hybridization
or washing conditions can be varied using a variety of ingredients,
buffers and temperatures well known to and practiced by the skilled
artisan.
[0144] RAI-3 nucleic acid molecules can also include nucleic acids,
preferably DNA molecules, that hybridize to, and are therefore
complements of, the nucleic acid sequences of (a) through (d), as
set forth above. Such hybridization conditions may be highly
stringent or moderately stringent, as described above. In those
instances in which the nucleic acid molecules are
deoxyoligonucleotides ("oligos"), highly stringent conditions may
include, e.g., washing in 6.times.SSC/0.05% sodium pyrophosphate at
37.degree. C. (for 14-base oligos), 48.degree. C. (for 17-base
oligos), 55.degree. C. (for 20-base oligos), and 60.degree. C. (for
23-base oligos).
[0145] As will be discussed further below, the nucleic acid
molecules of the invention can encode or act as RAI-3 antisense
molecules useful, for example, in RAI-3 gene regulation or as
antisense primers in amplification reactions of RAI-3 nucleic acid
sequences. Further, such sequences can be used as part of ribozyme
and/or triple helix sequences, also useful for RAI-3 gene
regulation. Still further, such molecules can be used as components
of diagnostic methods whereby, for example, the presence of a
particular RAI-3 allele or alternatively-spliced RAI-3 transcript
responsible for causing or predisposing one to COPD, or to a
disorder or condition related to COPD can be detected.
[0146] Moreover, due to the degeneracy of the genetic code, other
DNA sequences that encode substantially the amino acid sequence of
RAI-3 can be used in the practice of the present invention, e.g.,
for the cloning and expression of RAI-3 polypeptides. Such DNA
sequences include those that are capable of hybridizing to RAI-3
nucleic acid under stringent (high or moderate) conditions, or that
would be capable of hybridizing under stringent conditions but for
the degeneracy of the genetic code. Typically, RAI-3 nucleic acids
should exhibit at least about 80% overall sequence homology at the
nucleotide level, more preferably at least about 85-90% overall
homology and most preferably at least about 95% overall homology to
the nucleic acid sequence of FIGS. 10A/10B and SEQ ID NO:2 (e.g.,
as determined by the CLUSTAL W algorithm using default parameters
(J. D. Thompson et al., 1994, Nucleic Acids Research,
2(22):4673-4680).
[0147] Alternatively, the RAI-3 polypeptide should exhibit at least
about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%,
99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%
overall homology to the RAI-3 amino acid sequence as depicted in
FIGS. 11A-C and in SEQ ID NO:3 (e.g., as determined by the CLUSTAL
W algorithm using default parameters (J. D. Thompson et al., 1994,
Nucleic Acids Research, 2(22):4673-4680).
[0148] Those having skill in the art will know how to determine
percent identity between/among sequences using, for example,
algorithms such as those used in the GAP computer program (S. B.
Needleman and C. D. Wunsch, 1970, "A general method applicable to
the search for similarities in the amino acid sequence of two
proteins", J. Mol. Biol., 48(3):443-53) or based on the CLUSTALW
computer program, mentioned above, or FASTDB, (Brutlag et al.,
1990, Comp. App. Biosci., 6:237-245). Although the FASTDB algorithm
typically does not consider internal non-matching deletions or
additions in sequences, i.e., gaps, in its calculation, this can be
corrected manually to avoid an overestimation of the % identity.
GAP and CLUSTALW, however, do take sequence gaps into account in
their identity calculations.
[0149] Also available to those having skill in this art are the
BLAST and BLAST 2.0 algorithms (Altschul et al., 1977, Nuc. Acids
Res., 25:3389-3402 and Altschul et al., 1990, J. Mol. Biol.,
215:403-410). The BLASTN program for nucleic acid sequences uses as
defaults a wordlength (W) of 11, an expectation (E) of 10, M=5,
N=4, and a comparison of both strands. For amino acid sequences,
the BLASTP program uses as defaults a wordlength (W) of 3, and an
expectation (E) of 10. The BLOSUM62 scoring matrix (Henikoff &
Henikoff, 1989, Proc. Natl. Acad. Sci., USA, 89:10915) uses
alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a
comparison of both strands.
[0150] Altered RAI-3 nucleic acid sequences that can be used in
accordance with the invention include deletions, additions or
substitutions of different nucleotide residues resulting in a
modified nucleic acid molecule, i.e., mutated or truncated, that
encodes the same or a functionally equivalent RAI-3 gene product.
The gene product itself may contain deletions, additions or
substitutions of amino acid residues within the RAI-3 protein
sequence, which result in a silent change, thus producing a
functionally equivalent RAI-3 polypeptide. Such amino acid
substitutions may be made on the basis of similarity in polarity,
charge, solubility, hydrophobicity, hydrophilicity, and/or the
amphipatic nature of the residues involved. For example,
negatively-charged amino acids include aspartic acid and glutamic
acid; positively-charged amino acids include lysine, arginine and
histidine; amino acids with uncharged polar head groups having
similar hydrophilicity values include the following: leucine,
isoleucine, valine, glycine, alanine, asparagine, glutamine,
serine, threonine, phenylalanine, tyrosine. A functionally
equivalent RAI-3 polypeptide can include a polypeptide which
displays the same type of biological activity (e.g., COPD related
expression and/or modification) as the native RAI-3 protein, but
not necessarily to the same extent.
[0151] The RAI-3 nucleic acid molecule or RAI-3 polynucleotide
sequences can be engineered in order to alter the RAI-3 coding
sequence for a variety of reasons, including but not limited to,
alterations that modify processing and expression of the gene
product. For example, mutations may be introduced using techniques
which are well known in the art, e.g., site-directed mutagenesis,
to insert new restriction sites, to alter glycosylation patterns,
phosphorylation, etc. For example, in certain expression systems
such as yeast, host cells may over-glycosylate the gene product.
When using such expression systems, it may be preferable to alter
the RAI-3 coding sequence to eliminate any N-linked glycosylation
sites.
[0152] In another embodiment, an RAI-3 nucleic acid sequence, e.g.,
a modified RAI-3 nucleic acid, can be ligated to a heterologous
protein-encoding sequence to encode a fusion protein. Preferably,
the RAI-3 nucleic acid that encodes a polypeptide with an activity
of an RAI-3 protein, or a fragment thereof, is linked,
uninterrupted by stop codons and in frame, to a nucleotide sequence
that encodes a heterologous protein or peptide. The fusion protein
can be engineered to contain a cleavage site, located between the
RAI-3 sequence and the heterologous protein sequence, so that the
RAI-3 protein can be cleaved away from the heterologous moiety.
Nucleic acid sequences encoding fusion proteins can include full
length RAI-3 coding sequence, sequences encoding truncated RAI-3,
sequences encoding mutated RAI-3, or sequences encoding peptide
fragments of RAI-3. The RAI-3 nucleic acid molecules can also be
used as hybridization probes for obtaining RAI-3 cDNAs or genomic
RAI-3 DNA. In addition, RAI-3 nucleic acids can be used as primers
in PCR amplification methods to isolate RAI-3 cDNAs and genomic
DNA, e.g., from other species.
[0153] The RAI-3 gene sequence can also used to isolate mutant or
variant RAI-3 gene alleles. Such mutant or variant alleles can be
isolated from individuals either known or proposed to have a
genotype related to COPD, COPD susceptibility, or COPD related
disorders, conditions, or dysfunctions. Mutant or variant alleles
and mutant or variant allele gene products can then be used in the
screening, therapeutic and diagnostic systems described herein. In
addition, such RAI-3 gene sequences can be used to detect RAI-3
gene regulatory (e.g., promoter) defects which can affect COPD or
COPD related disorders.
[0154] Single nucleotide polymorphisms (SNPs) within the coding
region of the human RAI-3 sequence are encompassed and described
herein. Both non-synonymous and synonymous SNPs are included.
Several SNPs are provided as follows:
[0155] Non-Synonymous SNPs in Human RAI-3:
[0156] 1) AA118: Ser/Gly (base A/G, wherein "A" represents the
wild-type or reference RAI-3 nucleotide and "G" represents the
variant or polymorphic nucleotide in the RAI-3 sequence) and
[0157] 2) AA307: Gln/Arg (base A/G).
[0158] Synonymous SNPs in Human RAI-3:
[0159] 1) AA37: Ala/Ala (base C/T) and
[0160] 2) AA286: Pro/Pro (base T/C).
[0161] The Ser118Gly SNP is located in the second cytoplasmic
domain of the RAI-3 polypeptide sequence; Thr182Ala is located in
the fifth transmembrane (TM5) domain of RAI-3; and Gln307Arg is
located in the cytoplasmic tail.
[0162] FIG. 13 shows a multiple sequence alignment containing the
human RAI-3 amino acid sequence identifying the non-synonymous SNPs
in the RAI-3 coding region. Accordingly, an RAI-3 variant
comprising a non-synonymous SNP at amino acid position 118 in the
RAI-3 amino acid sequence is set forth in SEQ ID NO:8. All other
sequences are as described for FIG. 12. An RAI-3 variant comprising
a non-synonymous SNP at amino acid position 307 in the RAI-3 amino
acid sequence is set forth in SEQ ID NO:9. Further, an RAI-3
variant comprising a synonymous SNP at amino acid position 37 in
the RAI-3 amino acid sequence is set forth in SEQ ID NO:20; and an
RAI-3 variant comprising a synonymous SNP at amino acid position
286 in the RAI-3 amino acid sequence is set forth in SEQ ID
NO:21.
[0163] The S/G amino acid variation at position 118 of the human
RAI-3 amino acid sequence, resulting from the a/g SNP at position
605 of the RAI-3 nucleic acid sequence, is present in the
intracellular loop between the third and fourth transmembrane
domains (TMs 3 and 4). This intracellular loop is functionally
associated with G-protein coupling. The amino acid corresponding to
this position is conserved in RAI-3 sequences from non-human
species and also in human and mouse GPCR5D, a closely related
sequence. (See FIG. 19A). In human RAI-3, the position 118 amino
acid residue is a Serine (S), a hydrophilic residue. In the other
sequences listed in the alignment shown in FIG. 19A, the amino acid
at this position is an Asparagine (N), a basic residue. The
non-synonymous SNP at position 118 in the human RAI-3 amino acid
sequence corresponds to Glycine (G), which is neither as
hydrophilic as Serine, nor as basic as Asparagine. Since this
residue is present in the intracellular loop, any change in the
hydrophilicity could have an effect on G-protein coupling.
[0164] This Q/R amino acid variation at position 307 of the human
RAI-3 amino acid sequence, resulting from the a/g SNP at position
1173 of the RAI-3 nucleic acid sequence, is present in the
C-terminus cytoplasmic tail of the protein. The C-terminus of GPCRs
is typically associated with functions such as signal transduction
and receptor trafficking. This residue is conserved in both human
and mouse RAI-3 sequences (See FIG. 19B). The SNP in human RAI-3 is
non-synonymous and it changes the residue at amino acid position
307 in the sequence from Glutamine (Q) to Arginine (R). This
polymorphic variation might have functional effects on the signal
transduction pathway or on the trafficking of the RAI-3 receptor
protein.
[0165] SNPs that were identified in the RAI-3 coding sequence
(e.g., RAI-3-s2, RAI-3-s6, RAI-3-s8 and RAI-3-s9) are set forth in
Table 3. The columns of the Table provide (i) a flanking sequence
of contiguous nucleotides within the RAI-3 nucleic acid sequence of
SEQ ID NO:2 in which the wild-type RAI-3 nucleotide is in bold;
(ii) the SNP-containing RAI-3 sequence of contiguous nucleotides
within the RAI-3 nucleic acid sequence of SEQ ID NO:2 in which the
SNP nucleotide is in bold and underlined; (iii) a listing of the
base change of the wild-type base versus the SNP base; and a
description of the location of the SNP (in FIGS. 25A-25C and SEQ ID
NO:2). The corresponding SEQ ID NOS of the RAI-3 reference and
SNP-containing nucleic acid sequences are shown below each
sequence.
3TABLE 3 Location (FIGS. 25A-C); (SEQ ID SNP # RAI-3 Flanking
Sequence RAI-3 SNP-containing sequence Base change NO: 2) RAI-3-s2
5'-ctagaaacgg tggccacagc 5'-ctagaaacgg tggccacagc c/t BP 364
cggggttgtg acctcggtgg-3' tggggttgtg acctcggtgg-3' (SEQ ID NO: 22)
(SEQ ID NO: 23) RAI-3-s6 5'-tgcctgctgg ctcatgctgt 5'-tgcctgctgg
ctcatgctgt a/g BP 605 cagtctgacc aagctcgtcc cggtctgacc aagctcgtcc
gggg-3' gggg-3' (SEQ ID NO: 25) (SEQ ID NO: 24) RAI-3-s8
5'-tcctgttgag gatgctttct 5'-tcctgttgag gatgctttct t/c BP 1111
gtaaacctca actcgtgaag gtaaacccca actcgtgaag aagagctatg-3'
aagagctatg-3' (SEQ ID NO: 26) (SEQ ID NO: 27) RAI-3-s9
5'-tctcaagagg aaatcactca 5'-tctcaagagg aaatcactcg a/g BP 1173
aggttttgaa gagacagggg-3' aggttttgaa gagacagggg-3' (SEQ ID NO: 28)
(SEQ ID NO: 29)
[0166] In a related embodiment, the present invention relates to
RAI-3 SNP discovery by DNA sequencing (e.g., Example 7). In this
preferred aspect of the invention, the 10 RAI-3 nucleic acid (gene)
sequence was examined in 48 individuals, in which the coding region
of the RAI-3 gene containing four exons was analyzed. The DNA
analyzed comprised 36 Caucasian DNA samples from the Coriell Cell
Repositories (Collingswood, N.J.), and as further described herein.
Six SNPs were identified, including one missense SNP, as presented
in Table 4.
4TABLE 4 Nucleotide AA SNP_ID Location Position Position Nature
Comments RAI-3-s1 EXON1 112 5' UTR RAI-3-s7 INTRON1 intron RAI-3-s2
EXON2 364 37 silent (Ala/Ala) RAI-3-s3 EXON2 511 86 silent
(Ile/Ile) RAI-3-s4 EXON2 523 90 silent (Asp/Asp) RAI-3-s5 EXON2 797
182 missense missense (Thr/Ala)
[0167] The RAI-3 SNPs as provided above, either alone or in
combination, are useful as diagnostic tools, e.g., nucleic acid
probes provided in a kit, for identifying individuals who are at
risk for, or who are susceptible to, developing COPD or COPD
related disorders, by way of nonlimiting example.
[0168] A cDNA of a mutant RAI-3 gene can be isolated, for example,
by using PCR, a technique that is well known to those of skill in
the art (see, e.g., U.S. Pat. No. 4,683,202). The first cDNA strand
may be synthesized by hybridizing an oligo-dT oligonucleotide to
mRNA isolated from tissue known or suspected to be expressed in an
individual putatively carrying the mutant RAI-3 allele, and by
extending the new strand with reverse transcriptase. The second
strand of the cDNA is then synthesized using an oligonucleotide
that hybridizes specifically to the 5' end of the normal gene.
Using these two primers, the product is then amplified via PCR,
cloned into a suitable vector, and subjected to DNA sequence
analysis through methods well known in the art. By comparing the
DNA sequence of the mutant RAI-3 allele to that of the normal RAI-3
allele, the mutation(s) responsible for the loss or alteration of
function of the mutant RAI-3 gene product can be ascertained.
[0169] Alternatively, a genomic library can be constructed using
DNA obtained from an individual suspected of or known to carry the
mutant RAI-3 allele, or a cDNA library can be constructed using RNA
from tissue known, or suspected, to express the mutant RAI-3
allele. The normal RAI-3 gene, or any suitable fragment thereof,
can then be labeled and used as a probe to identify the
corresponding mutant RAI-3 allele in such libraries. Clones
containing mutant RAI-3 gene sequences can then be purified and
subjected to sequence analysis according to methods well known in
the art.
[0170] In another aspect, an expression library can be constructed
utilizing cDNA synthesized from, for example, RNA isolated from a
tissue known or suspected to express a mutant RAI-3 allele in an
individual suspected of or known to carry such a mutant allele.
Gene products made by the putatively mutant tissue can be expressed
and screened using standard antibody screening techniques in
conjunction with antibodies raised against the normal RAI-3 gene
product. For screening techniques, see, for example, Harlow, E. and
Lane, eds., 1988, Antibodies: A Laboratory Manual, Cold Spring
Harbor Press, Cold Spring Harbor.
[0171] In cases in which an RAI-3 mutation results in an expressed
gene product with altered function (e.g., as a result of a missense
or a frameshift mutation), a polyclonal set of anti-RAI-3 gene
product antibodies are likely to cross-react with the mutant RAI-3
gene product. Library clones detected via their reaction with such
labeled antibodies can be purified and subjected to sequence
analysis according to methods well known to those of skill in the
art.
[0172] Alternatively, the coding sequence of RAI-3 can be
synthesized in whole or in part, using chemical methods well known
in the art, based on the nucleic acid and/or amino acid sequences
of the RAI-3 gene and protein, respectively. (See, for example,
Caruthers et al., 1980, Nuc. Acids Res. Symp. Ser., 7: 215-233;
Crea and Horn, 1980, Nuc. Acids Res., 9(10): 2331; Matteucci and
Caruthers, 1980, Tetrahedron Letters, 21: 719; and Chow and Kempe,
1981, Nuc. Acids Res., 9(12): 2807-2817). The invention encompasses
(a) DNA vectors that contain any of the foregoing RAI-3 nucleic
acids and/or their complements; (b) DNA expression vectors that
contain any of the foregoing RAI-3 coding sequences operatively
associated with a regulatory element that directs the expression of
the coding sequences; and (c) genetically engineered host cells
that contain any of the foregoing RAI-3 coding sequences
operatively associated with a regulatory element that directs the
expression of the coding sequences in the host cell. As used
herein, regulatory elements include, but are not limited to,
inducible and non-inducible promoters, enhancers, operators and
other elements that drive and regulate expression, as known to
those skilled in the art. Nonlimiting examples of such regulatory
elements include the cytomegalovirus hCMV immediate early gene, the
early or late promoters of SV40 adenovirus, the lac system, the trp
system, the TAC system, the TRC system, the major operator and
promoter regions of phage A, the control regions of fd coat
protein, the promoter for 3-phosphoglycerate kinase, the promoters
of acid phosphatase, and the promoters of the yeast .alpha.-mating
factors.
[0173] The invention further relates to nucleic acid analogs,
including but not limited to, peptide nucleic acid analogues,
equivalent to the nucleic acid molecules described herein.
"Equivalent" as used in this context refers to nucleic acid analogs
that have the same primary base sequence as the RAI-3 nucleic acid
molecules described above. Nucleic acid analogs and methods for the
synthesis of nucleic acid analogs are well known to those of skill
in the art. (See, e.g., Egholm, M. et al., 1993, Nature,
365:566-568; and Perry-O'Keefe, H. et al., 1996, Proc. Natl. Acad.
USA, 93:14670-14675).
Modulation of RAI-3: Methods, Compounds and Compositions Related
Thereto
[0174] In another embodiment, modulators of RAI-3 are particularly
embraced by the present invention. Modulators can include any
molecule, e.g., protein, peptide, oligopeptide, small organic
molecule, chemical compound, polysaccharide, polynucleotide, etc.,
having the capability to directly or indirectly alter or modify the
activity or function of the RAI-3 polypeptide. Candidate modulatory
agents or compounds or materials can also encompass numerous
chemical classes, though typically they are organic molecules,
preferably small organic compounds, for example, without
limitation, those having a molecular weight of more than 100 and
less than about 10,000 daltons, preferably, less than about 2000 to
5000 daltons. Candidate modulatory compounds can comprise
functional groups necessary for structural interaction with
proteins, particularly hydrogen bonding, and typically include at
least an amine, carbonyl, hydroxyl or carboxyl group, preferably at
least two of the functional chemical groups. The candidate
compounds often comprise cyclical carbon or heterocyclic structures
and/or aromatic or polyaromatic structures substituted with one or
more of the above functional groups. Candidate compounds are also
found among biomolecules including peptides, saccharides, fatty
acids, steroids, purines, pyrimidines, derivatives, structural
analogs or combinations thereof.
[0175] Modulatory agents or compounds can be obtained from a wide
variety of sources including libraries of synthetic or natural
compounds. For example, numerous means are available for random and
directed synthesis of a wide variety of organic compounds and
biomolecules, including expression of randomized oligonucleotides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. In addition, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means. Known pharmacological
agents can also be subjected to directed or random chemical
modifications, such as acylation, alkylation, esterification,
amidification to produce structural analogs.
[0176] Modulators of RAI-3 as embraced by this invention can be
antagonists, suppressors, inhibitors, or blockers of RAI-3, as such
modulators can be efficacious in affecting smoke-induced activation
and in reducing the symptoms underlying COPD. An antagonist is
typically a molecule which, when bound to, or associated with,
RAI-3 polypeptide, or a functional fragment thereof, decreases or
inhibits the amount or duration of the biological or immunological
activity of the RAI-3 polypeptide. Antagonists can include
proteins, nucleic acids, carbohydrates, antibodies, or any other
molecules that decrease or reduce the effect of an RAI-3
polypeptide. Antagonists typically, diminish, inhibit, block,
decrease, reduce, suppress, or abolish the function or activity of
an RAI-3 molecule. More specifically, modulators of RAI-3 can be
efficacious in treating, ameliorating, or preventing chronic
bronchitis, emphysema, the symptoms of chronic bronchitis, the
symptoms of emphysema, in addition to increasing maximal expiratory
flow of the lungs, increasing forced emptying of the lungs,
increasing airflow of the lungs when used in conjunction with a
bronchodilator, decreasing enlargement of the air spaces distal to
the terminal bronchioles, decreasing bronchial secretions,
decreasing mucus secretion in the lung, decreasing hypertrophy of
the glandular elements of the bronchial mucosa, decreasing the
level of elastase released into the lungs, increasing the level of
alpha-1 antitrypsin (AAT) in the lungs, increasing the
effectiveness of alpha-1 antitrypsin in the lungs in protecting the
lung from elastase-dependent damage, and/or decreasing the number
of inflammatory cells into the lungs. Indeed, since RAI-3 either
directly or indirectly can affect mucus production, modulators of
RAI-3 find utility in the treatment, amelioration, therapy, and/or
prevention of cystic fibrosis.
[0177] In addition, modulators such as agonists or enhancers of
RAI-3 function or activity are embraced by the present invention,
particularly, for an RAI-3 target that is part of a reparative,
reversing, and/or protective mechanism, which is induced following
the exposure of cells to smoke, such as cigarette smoke, for
example. Agonists typically are molecules which, when bound to, or
associated with, an RAI-3 polypeptide, or a functional fragment
thereof, increase, enhance, or prolong the duration of the effect
of the RAI-3 polypeptide. Agonists may include proteins, peptides,
nucleic acids, carbohydrates, or any other molecules that bind to
and modulate the effect of the RAI-3 polypeptide. Agonists
typically enhance, increase, or augment the function or activity of
an RAI-3 molecule. As such, an agonist compound may be efficacious
in enhancing the protective mechanism of RAI-3 in alleviating the
symptoms of COPD. Another embodiment of the present invention
encompasses screening methods and assays for the identification of
compounds that modulate the expression of RAI-3 nucleic acid and/or
the activity of the RAI-3 polypeptide or peptides of the invention,
e.g., assays that measure RAI-3 mRNA and/or RAI-3 gene product
levels, or assays that measure levels of RAI-3 activity, such as
the ability of the RAI-3 protein, or modulators thereof, to
regulate or modulate second messengers or other molecules, such as
E-selectin, or a component of the NF-.kappa.B pathway, such as
I.kappa.B.
[0178] In an embodiment of this invention, cellular and
non-cellular assays can be used to identify compounds that interact
with the RAI-3 gene and/or gene product, e.g., modulate the
activity of the gene and/or bind to the gene product. Such
cell-based assays are generally known, and in terms of the present
invention, utilize cells, cell lines, or engineered cells or cell
lines that express the RAI-3 gene product or RAI-3 peptide
products. Illustratively, such methods comprise contacting a cell
with a compound or agent that expresses an RAI-3 nucleic acid
sequence, e.g., the RAI-3 gene; measuring the level of gene
expression, gene product expression, or gene product activity, and
comparing this level to the level of RAI-3 gene expression, gene
product expression, or gene product activity produced by the cell
in the absence of the compound or agent, such that if the level
obtained in the presence of the compound differs from that obtained
in its absence, a compound that modulates the expression of the
RAI-3 gene and/or the synthesis, function, or activity of the gene
product has been identified. Such assays can comprise subjecting
the appropriate RAI-3-expressing cells to cigarette smoke in the
presence of a candidate compound or agent to determine if the
compound or agent prevents modification, e.g., phosphorylation, of
RAI-3 in the cells, or complexation of RAI-3 with other proteins,
following cigarette smoke treatment or cells, relative to control
cells. A compound or agent that prevents phosphorylation of RAI-3,
or its complexation with other cellular proteins, in the
smoke-treated cells, relative to control cells, is identified as
one which modulates the activity or function of RAI-3 in response
to smoke exposure.
[0179] Screening assays and methods also comprise administering a
compound or agent to a host organism, e.g., a transgenic animal
that expresses a RAI-3 transgene or a mutant RAI-3 transgene, and
measuring the level of RAI-3 gene (or nucleic acid) expression,
gene product expression, or gene product activity. The measured
expression level is compared to the level of RAI-3 gene expression,
gene product expression, or gene product activity in a host that is
not exposed to the compound or agent, such that if the level
obtained when the host is exposed to the compound or agent differs
from that obtained when the host is not exposed to the compound, a
compound or agent that modulates the expression of the RAI-3 gene
and/or the synthesis or activity of the RAI-3 gene products has
been identified. In addition, the host organism harboring the RAI-3
gene and expressing RAI-3 protein can be exposed to cigarette smoke
prior to performing the screening assays, e.g., employing lung
cells or tissue.
[0180] The compounds identified by these methods include
therapeutic compounds that can comprise pharmaceutical compositions
and formulations to reduce or eliminate the symptoms or effects of
COPD or COPD related disorders and conditions. Pharmaceutical
formulations suitable for the treatment of COPD or COPD related
disorders comprise at least one compound that inhibits or activates
RAI-3 activity, in combination with a pharmaceutically acceptable
carrier, diluent or excipient as further described herein.
[0181] In another embodiment, the present invention further
provides a method of identifying a compound that modulates the
biological activity of RAI-3, comprising (a) combining a candidate
modulator compound with RAI-3 having the polypeptide sequence as
set forth in SEQ ID NO:3, or with an RAI-3 peptide; and measuring
an effect of the candidate modulator compound on the activity of
RAI-3, or, if appropriate, on the activity of the RAI-3
peptide.
[0182] In view of the involvement of RAI-3 in the regulation of
second messengers and cellular molecules, such as I.kappa.B and
E-selectin, another embodiment of this invention further provides a
method of identifying a compound that modulates the biological
activity of an RAI-3 regulated or modified second messenger,
cellular molecule, or a pathway or system that is associated with
the RAI-3 regulated or modified second messenger. For example, the
method comprises combining a candidate modulator compound with a
host cell expressing RAI-3 (e.g., the RAI-3 amino acid sequence as
set forth in SEQ ID NO:3, or fragments or portions thereof); and
(b) measuring an effect of the candidate modulator compound on the
activity of the expressed RAI-3, and/or on the RAI-3 regulated or
modified second messenger or cellular molecule, e.g.,
I.kappa.B.
[0183] The invention further relates to a method of identifying a
compound that modulates the biological activity of RAI-3. Such a
compound can be used to affect RAI-3 function or activity in the
cells of COPD sufferers, or those with COPD related diseases and
conditions. The method comprises combining a candidate modulator
compound with a host cell containing a vector in which RAI-3, or a
peptide thereof, preferably a functional RAI-3 peptide, is
expressed by the cell, and measuring an effect of the candidate
modulator compound on the activity of the expressed RAI-3 or
peptide thereof.
[0184] In another embodiment, the present invention embraces a
method of screening for a compound that is capable of modulating
the biological activity of RAI-3, comprising (a) providing a host
cell in which RAI-3, or a peptide thereof, is expressed such as
described herein; (b) determining the biological activity of RAI-3
in the absence of a modulator compound; (c) contacting the cell
with the modulator compound; and (d) determining the biological
activity of RAI-3 in the presence of the modulator compound. In
this method, a difference between the activity of RAI-3 in the
presence of the modulator compound and in the absence of the
modulator compound indicates a modulating effect of the compound.
Accordingly, the invention further relates to a compound that
modulates the biological activity of human RAI-3, wherein the
compound has been identified by the methods described herein.
[0185] Polypeptide or polynucleotides and/or agonist or antagonists
of the present invention may also be used to increase the efficacy
of a pharmaceutical composition, either directly or indirectly.
Such a use may be administered in simultaneous conjunction with
said pharmaceutical, or separately through either the same or
different route of administration (e.g., intravenous for the
polynucleotide or polypeptide of the present invention, and orally
for the pharmaceutical, among others described herein.).
RAI-3 Modulation, NF-.kappa.B and Components Related Thereto
[0186] The regulation or modulation of the Nuclear Factor .kappa.B
(NF-.kappa.B) pathway and/or components thereof, and/or cell
signaling or transcriptional molecules by RAI-3 is also embraced by
the present invention. As a transcriptional activator, NF-.kappa.B
plays a central role in regulating the transcription of a number of
genes, including those which encode proteins involved in
inflammatory and immune responses. Representative examples of genes
controlled by NF-.kappa.B include the cytokines tumor necrosis
factor (TNF-.alpha.), IL-1.beta., IL-6, and IL-8; the adhesion
molecules E-selectin and vascular cell adhesion molecule (VCAM)-1;
and the enzyme nitric oxide (NO)-synthase (for reviews, see
Siebenlist et al. Annu. Rev. Cell Biol. 10: 405-455, 1994; Bauerle
and Baltimore, Cell, 87:13-20, 1997). Also, NF-.kappa.B has been
shown to be induced by several stimuli, in addition to mediators of
immune function, such as UV irradiation, growth factors, and viral
infection.
[0187] The NF-.kappa.B transcription factor normally resides in the
cytoplasm in unstimulated cells as an inactive complex with a
member of the inhibitor .kappa.B (I.kappa.B) inhibitory protein
family. The I.kappa.B class of proteins includes I.kappa.B-.alpha.,
I.kappa.B-.beta., and I.kappa.B-.epsilon.--all of which contain
ankyrin repeats for complexing with NF-.kappa.B (for review, see
Whiteside et al., EMBO J. 16:1413-1426,1997). In the case of
I.kappa.B-.alpha., the most carefully studied member of this class,
stimulation of cells with agents which activate
NF-.kappa.B-dependent gene transcription results in the
phosphorylation of I.kappa.B-.alpha. at serine-32 and serine-36
(Brown et al. Science, 267:1485-1488, 1995).
[0188] I.kappa.B is a cytoplasmic protein that controls NF-.kappa.B
activity by retaining NF-.kappa.B in the cytoplasm. I.kappa.B is
phosphorylated by the I.kappa.B kinase (IKK), which has two
isoforms, IKK-1 (or I.kappa.B kinase .alpha., IKK.alpha.) and IKK-2
(or I.kappa.B kinase .beta., IKK.beta.). Upon phosphorylation of
I.kappa.B by IKK, NF-.kappa.B is rapidly released into the cell and
translocates to the nucleus where it binds to the promoters of many
genes and up-regulates the transcription of pro-inflammatory genes.
Inhibitors of IKK can block the phosphorylation of I.kappa.B and
further downstream effects, specifically those associated with
NF-.kappa.B transcription factors. Inhibition of NF-.kappa.B and/or
its activation pathway provides a means for treating a wide range
of diseases including autoimmune diseases, Alzheimer's disease,
atherosclerosis, oncogenesis, and so forth. See, e.g., Baldwin,
1996, "The NF-.kappa.B and I.kappa.B Proteins: New Discoveries and
Insights," Annual Rev. Immunol., Vol. 14:649-81; see also Christman
et al., 2000, "Impact of Basic Research on Tomorrow's Medicine, The
Role of Nuclear Factor-KB in Pulmonary Diseases," Chest, Vol.
117:1482-87.
[0189] Phosphorylation of I.kappa.B-.alpha. is critical for its
subsequent ubiquitination and proteolysis, upon which NF-.kappa.B
is released from complexing with I.kappa.B. NF-.kappa.B can then
translocate into the nucleus and ultimately activate gene
transcription (Finco et al., 1994, Proc. Natl. Acad. Sci. USA,
91:11884-11888; Baldi et al., 1996, J. Biol. Chem., 271:376-379;
and Roff et al., 1996, J. Biol. Chem., 271:7844-7850). Substituting
both serine-32 and serine-36 of I.kappa.B with alanine prevents
signal-induced NF-.kappa.B activation and also results in an
I.kappa.B (e.g. I.kappa.B-a), which is not phosphorylated,
ubiquitinated, or proteolytically digested (Roff et al., Ibid.).
Analogous serines have been identified in both I.kappa.B-.beta. and
I.kappa.B-.epsilon., and phosphorylation at these residues appears
to regulate the proteolytic degradation of these proteins by a
mechanism similar to that of I.kappa.B-.alpha. (Weil et al., 1997,
J. Biol. Chem., 272:9942-9949; and Whiteside et al., 1997, EMBO J.,
16:1413-1426).
[0190] More particularly, upon phosphorylation, ubiquitination and
degradation of I.kappa.B, NF-.kappa.B is released from the
I.kappa.B/NF-.kappa.B complex and allowed to translocate from the
cytoplasm to the nucleus and activate a number of genes,
particularly those involved in inflammatory and immune responses.
Since NF-.kappa.B is of significant importance in inflammation and
immune responses, inhibition of I.kappa.B, for example, by
inhibiting the signal-inducible phosphorylation of I.kappa.B, can
be an important target in the treatment of inflammatory and immune
system-related diseases and disorders. In accordance with this
invention, modulation of I.kappa.B and/or NF-.kappa.B activation,
particularly by RAI-3 or RAI-3 modulation, either directly or
indirectly, can also be important in the treatment and/or the
pathobiology of COPD, cancers, such as lung cancer, breast cancer,
stomach cancer, testicular cancer, etc., malignancies and
asthma.
[0191] In a particular embodiment related to the modulation of
NF-.kappa.B via RAI-3 or RAI-3 modulation, and/or the modulation of
other components of the cellular pathway that includes NF-.kappa.B
via RAI-3 or RAI-3 modulation, the present invention embraces the
treatment, therapy, amelioration and/or prevention of pulmonary
fibrosis. Because the expression of many pro-inflammatory cytokines
and chemokines, including TNF-alpha (a), are NF-.kappa.B dependent,
it is expected that inhibitors of NF-.kappa.B function or activity
would be efficacious in pulmonary fibrosis. TNF-.alpha., among
other pro-inflammatory factors, is believed to play an important
role in driving the pathology of pulmonary fibrosis (e.g., N.
Sueoka et al., 1998, Cytokine, 10:124-131). NF-.kappa.B has been
shown to be activated in the lungs of affected animals in animal
models of pulmonary fibrosis (see, e.g., G. Gurujeyalakshmi et al.,
2000, J. Pharmacol. Lung Cell Mol. Physiol., 293:82-90; and A. K.
Hubbard et al., 2002, Am. J. Physiol. Lung Cell Mol. Physiol.,
282:L968-75). Moreover, oxidative stress responses are thought to
play a role in pulmonary fibrosis and cellular glutathione (GSH)
levels are important in regulating oxidative stress. Consistent
with the role of NF-.kappa.B in disease, the expression of
gamma-glutamylcysteine synthetase (gamma-GCS), which controls the
key regulatory step in GSH synthesis and is up-regulated in animal
models of pulmonary fibrosis, is also NF-.kappa.B dependent. (R. M.
Day et al., 2002, Am. J. Physiol. Lung Cell Mol. Physiol.,
282:L1349-57).
[0192] In accordance with another particular, yet nonlimiting,
embodiment of the present invention, RAI-3 modulation, i.e., the
activity of RAI-3 antisense as described herein (FIGS. 14A and 14B
and Example 2), produced an increase in the level of I.kappa.B mRNA
in cells. The up-regulation of I.kappa.B.alpha. due to the
down-regulation of RAI-3 thus places this GPCR protein into a
signaling pathway potentially involved in cellular apoptotic
events. This affords the opportunity to regulate downstream events
via the activity of the RAI-3 protein with modulators, such as
antisense polynucleotides, polypeptides, or low molecular
chemicals, for example, with the potential of achieving a
therapeutic effect in cancer and/or autoimmune diseases, among
others. In addition to cancer and immunological disorders, NF-kB
has significant roles in other diseases (See, A. S. Baldwin, 2001,
J. Clin. Invest., 107:3-6). Also, NF-kB is a key factor in the
pathophysiology of ischemia-reperfusion injury and heart failure
(G. Valen et al., 2001, J. Am. Coll. Cardiol., 38:307-14).
Furthermore, NF-kB has been found to be activated in experimental
renal disease (C. Guijarro and J. Egido, 2001, Kidney Int.,
59:415-425).
[0193] In other preferred embodiments of this invention in keeping
with the above, RAI-3 polynucleotides and polypeptides, including
fragments thereof, are useful for treating, diagnosing, and/or
ameliorating proliferative disorders, cancers, (e.g., lung cancer,
breast cancer, stomach cancer, testicular cancer, etc.),
ischemia-reperfusion injury, heart failure, immunocompromised
conditions, HIV infection, and renal diseases. Moreover, RAI-3
polynucleotides and polypeptides, including fragments thereof, are
useful for increasing NF-.kappa.B activity, increasing apoptotic
events, and/or decreasing I.kappa.B.kappa. expression or activity
levels. Indeed, because many anti-apoptotic factors are NF-.kappa.B
dependent, a modulator of RAI-3 which inhibits, suppresses,
reduces, blocks, or antagonizes NF-.kappa.B activation can have
applicability in lung cancer, for example, in view of the
expression of RAI-3 in lung tissue as described and demonstrated
herein. Accordingly the present invention encompasses a method of
treating lung cancer involving the use of an RAI-3 modulator, e.g.,
as determined by the methods described herein, which inhibits
NF-.kappa.B activation.
[0194] In still other preferred embodiments, antagonists directed
against RAI-3 are useful for treating, diagnosing, and/or
ameliorating the following disorders, diseases and/or conditions:
autoimmune disorders, disorders related to hyperimmune activity,
inflammatory conditions, disorders related to aberrant acute phase
responses, hypercongenital conditions, birth defects, necrotic
lesions, wounds, organ transplant rejection, conditions related to
organ transplant rejection, disorders related to aberrant signal
transduction, proliferation disorders, cancers, (e.g., lung cancer,
breast cancer, stomach cancer, testicular cancer, etc.), HIV
infection, and HIV propagation in cells infected with other
viruses. Moreover, antagonists directed against RAI-3 are useful
for decreasing NF-.kappa.B activity, decreasing apoptotic events,
and/or increasing I.kappa.B.alpha. expression or activity
levels.
[0195] In additional preferred embodiments of the present
invention, agonists directed against RAI-3 are useful for treating,
diagnosing, and/or ameliorating autoimmune disorders, disorders
related to hyperimmune activity, hypercongenital conditions, birth
defects, necrotic lesions, wounds, disorders related to aberrant
signal transduction, immunocompromised conditions, HIV infection,
proliferation disorders, and/or cancers, such as lung cancer,
breast cancer, stomach cancer, testicular cancer, ovarian cancer,
cervical cancer, etc. In addition, agonists directed against RAI-3
are useful for increasing NF-.kappa.B activity, increasing
apoptotic events, and/or decreasing I.kappa.B.alpha. expression or
activity levels.
The RAI-3 Protein and Peptides, and Expression Thereof
[0196] The RAI-3 nucleic acid can be used to generate recombinant
DNA molecules that direct the expression of the RAI-3 protein
(polypeptide) or peptides thereof in appropriate host cells,
including the full-length RAI-3 protein, functionally active or
equivalent RAI-3 proteins and polypeptides, e.g., mutated,
truncated or deleted forms of RAI-3, peptide fragments of RAI-3, or
RAI-3 fusion proteins. A functionally equivalent RAI-3 polypeptide
can include a polypeptide which displays the same type of
biological activity (e.g., regulation or modulation of second
messenger activity and/or function) as the native RAI-3 protein,
but not necessarily to the same extent. Such recombinantly
expressed RAI-3 molecules are useful in the various screening
assays for determining modulators of RAI-3, particularly for
treatments and therapies of COPD and COPD related disorders as
described herein.
[0197] The amino acid sequence of the RAI-3 polypeptide is depicted
in FIG. 11 and SEQ ID NO:3. Both the RAI-3 polypeptide and RAI-3
peptide sequences are useful as targets, and/or as immunogens to
generate antibodies for the methods and compositions according to
the present invention. The proteins and polypeptides of the
invention include peptide fragments of RAI-3, peptides
corresponding to one or more domains of the protein, mutated,
truncated or deleted forms of the proteins and polypeptides, as
well as RAI-3 fusion proteins; all of the aforementioned RAI-3
derivatives can be obtained by techniques well known in the art,
given the RAI-3 nucleic acid and amino acid sequences as described
herein. The RAI-3 protein and its peptides can also contain
deletions, additions or substitutions of amino acid residues within
the RAI-3 protein sequence, which can result in a silent change,
thus producing a functionally equivalent RAI-3 polypeptide. Such
amino acid substitutions can be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipatic nature of the residues involved. For example,
negatively-charged amino acids include aspartic acid and glutamic
acid; positively-charged amino acids include lysine, arginine and
histidine; amino acids with uncharged polar head groups having
similar hydrophilicity values include the following: leucine,
isoleucine, valine, glycine, alanine, asparagine, glutamine,
serine, threonine, phenylalanine, tyrosine.
[0198] The RAI-3 polypeptide should exhibit at least about 80%
overall sequence identity at the amino acid level, more preferably
at least about 85-90% overall identity and most preferably at least
about 95% overall identity to the amino acid sequence of FIGS.
11A-11C and SEQ ID NOS:1 and/or 3 (e.g., as determined by the
CLUSTAL W algorithm using default parameters (J. D. Thompson et
al., 1994, Nucleic Acids Research, 2(22):4673-4680).
[0199] Alternatively, the RAI-3 polypeptide should exhibit at least
about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%,
99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%
overall identity to the RAI-3 amino acid sequence as depicted in
FIGS. 11A-C and in SEQ ID NO:3 (e.g., as determined by the CLUSTAL
W algorithm using default parameters (J. D. Thompson et al., 1994,
Nucleic Acids Research, 2(22):4673-4680).
[0200] Mutated or altered forms of the RAI-3 protein and peptides
can be obtained using random mutagenesis techniques, site-directed
mutagenesis techniques, or by chemical methods, e.g., protein
synthesis techniques, as practiced in the art. Mutant RAI-3 protein
or peptides can be engineered so that regions important for
function are maintained, while variable residues are altered, e.g.,
by deletion or insertion of an amino acid residue(s) or by the
substitution of one or more different amino acid residues. For
example, conservative alterations at the variable positions of a
polypeptide can be engineered to produce a mutant RAI-3 polypeptide
that retains the function of RAI-3. Non-conservative alterations of
variable regions can be engineered to alter RAI-3 function, if
desired. Alternatively, in those cases where modification of
function (either to increase or decrease function) is desired,
deletion or non-conservative alterations of conserved regions of
the RAI-3 polypeptide can be engineered.
[0201] In another aspect, fusion proteins containing RAI-3 amino
acid sequences can also be obtained by techniques known in the art,
including genetic engineering and chemical protein synthesis
techniques. According to this aspect, RAI-3 fusion proteins are
encoded by an isolated nucleic acid molecule comprising an RAI-3
nucleic acid that encodes a polypeptide with an activity of an
RAI-3 protein, or a fragment thereof, linked in frame and
uninterrupted by stop codons, to a nucleotide sequence that encodes
a heterologous protein or peptide.
[0202] Fusion proteins include those that contain the full length
RAI-3 amino acid sequence, an RAI-3 peptide sequence, e.g.,
encoding one or more functional domains, a mutant RAI-3 amino acid
sequence, or a truncated RAI-3 amino acid sequence linked to an
unrelated protein or polypeptide sequence. Such fusion proteins
include, but are not limited to, Ig Fc fusions which stabilize the
RAI-3 fusion protein and can prolong the half-life of the protein
in vivo, or fusions to an enzyme, fluorescent protein or
luminescent (chemiluminescent) protein that provides a marker
function.
[0203] RAI-3 protein, peptides, and derivatives thereof, can be
produced using genetic engineering techniques. Thus, in order to
express a biologically active RAI-3 polypeptide by recombinant
technology, a nucleic acid molecule coding for the polypeptide, or
a functional equivalent thereof, is inserted into an appropriate
expression vector, i.e., a vector which contains the necessary
elements for the transcription and translation of the inserted
coding sequence. More specifically, the RAI-3 nucleic acid is
operatively associated with a regulatory nucleotide sequence
containing transcriptional and/or translational regulatory
information that controls expression of the RAI-3 nucleic acid in
the host cell. The RAI-3 gene products so produced, as well as host
cells, or cell lines transfected or transformed with recombinant
RAI-3 expression vectors, can be used for a variety of purposes.
These include, but are not limited to, generating antibodies (i.e.,
monoclonal or polyclonal) that bind to the RAI-3 protein or
peptides, including those that competitively inhibit binding and
thus "neutralize" RAI-3 activity, and the screening and selection
of RAI-3 analogs, ligands, or interacting molecules.
[0204] In preferred embodiments, for example, RAI-3 transfected
CHO/NFAT-CRE cell lines of the present invention, as described in
Example 1(L), are useful for the identification of agonists and
antagonists of the RAI-3 polypeptide. Representative uses of these
cell lines include employing the cell lines in a method of
identifying RAI-3 agonists and antagonists. Preferably, the cell
lines are useful in a method for identifying a compound that
modulates the biological activity of the RAI-3 polypeptide,
comprising the steps of: (a) combining a candidate modulator
compound with a host cell expressing the RAI-3 polypeptide having
the sequence as set forth in SEQ ID NO:3; and (b) measuring an
effect of the candidate modulator compound on the activity of the
expressed RAI-3 polypeptide. Representative vectors expressing the
RAI-3 polypeptide are referenced herein (e.g., pcDNA3.1 hygro.TM.)
or otherwise known in the art and as described in Example 1(L).
[0205] RAI-3 expressing cell lines are also useful in a method of
screening for a compound that is capable of modulating the
biological activity of RAI-3 polypeptide, comprising the steps of:
(a) determining the biological activity of the RAI-3 polypeptide in
the absence of a modulator compound; (b) contacting a host cell
expression the RAI-3 polypeptide with the modulator compound; and
(c) determining the biological activity of the RAI-3 polypeptide in
the presence of the modulator compound; wherein a difference
between the activity of the RAI-3 polypeptide in the presence of
the modulator compound and in the absence of the modulator compound
indicates a modulating effect of the compound. Additional uses for
such RAI-3 cell lines are described herein or otherwise known in
the art.
[0206] Methods that are well known to those skilled in the art are
used to construct expression vectors containing the RAI-3 protein
or peptide coding sequences and appropriate transcriptional and
translational control elements and/or signals. These methods
include in vitro recombinant DNA techniques, synthetic techniques
and in vivo recombination/genetic recombination. See, for example,
the techniques described in Maniatis et al., 1989, Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.
and Ausubel et al., 1989, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, N.Y. See also,
Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Press, N.Y.
[0207] A variety of host-expression vector systems can be used to
express the RAI-3 coding sequences. Such host-expression systems
represent vehicles by which the coding sequences of interest can be
produced and subsequently purified, but also represent cells which
can, when transformed or transfected with the appropriate
nucleotide coding sequences, exhibit the corresponding RAI-3 gene
product(s) in situ and/or function in vivo. These hosts include,
but are not limited to, microorganisms such as bacteria (e.g., E.
coli, B. subtilis) transformed with recombinant bacteriophage DNA,
plasmid DNA, or cosmid DNA expression vectors containing the RAI-3
coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed
with recombinant yeast expression vectors containing RAI-3 coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing RAI-3 coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus (CaMV); tobacco
mosaic virus (TMV)) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing RAI-3 coding
sequences; or mammalian cell systems, including human cells, (e.g.,
COS, CHO, BHK, 293, NIH/3T3) harboring recombinant expression
constructs containing promoters derived from the genome of
mammalian cells as described below.
[0208] The expression elements of these systems can vary in their
strength and specificities. Depending on the host/vector system
utilized, any of a number of suitable transcriptional and
translational elements, including constitutive and inducible
promoters, can be used in the expression vector. For example, when
cloning in bacterial systems, inducible promoters such as pL of
bacteriophage .lambda., plac, ptrp, ptac (ptrp-lac hybrid promoter)
and the like can be used; when cloning in insect cell systems,
promoters such as the baculovirus polyhedrin promoter can be used;
when cloning in plant cell systems, promoters derived from the
genome of plant cells (e.g., heat shock promoters; the promoter for
the small subunit of RUBISCO; the promoter for the chlorophyll a/b
binding protein) or from plant viruses (e.g., the 35S RNA promoter
of CaMV; the coat protein promoter of TMV) can be used; when
cloning in mammalian cell systems, promoters derived from the
genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter) can be used; when generating cell lines that
contain multiple copies of RAI-3 DNA, SV40-, BPV- and EBV-based
vectors can be used with an appropriate selectable marker.
[0209] In bacterial systems, a number of expression vectors can be
advantageously selected depending upon the use intended for the
expressed RAI-3 polypeptide or peptide. For example, when large
quantities of the RAI-3 polypeptide or peptide are to be produced,
e.g., for the generation of antibodies or for the production of the
RAI-3 gene product, vectors which direct the expression of high
levels of fusion protein products that are readily purified may be
desirable. Such vectors include, but are not limited to, the E.
coli expression vector pUR278 (Ruther et al., 1983, EMBO J.,
2:1791), in which the RAI-3 coding sequence can be ligated into the
vector in-frame with the lacZ coding region so that a hybrid
RAI-3/lacZ protein is produced; pIN vectors (Inouye & Inouye,
1985, Nucleic Acids Res., 13: 3101-3109; Van Heeke & Schuster,
1989, J. Biol. Chem., 264: 5503-5509); and the like. pGEX vectors
can also be used to express foreign polypeptides as fusion proteins
with glutathione S-transferase (GST). In general, such fusion
proteins are soluble and can easily be purified from lysed cells by
affinity chromatography, e.g., adsorption to glutathione-agarose
beads followed by elution in the presence of free glutathione. The
pGEX vectors are designed to include thrombin or factor Xa protease
cleavage sites so that the cloned polypeptide of interest can be
released from the GST moiety. See also Booth et al., 1988, Immunol.
Lett., 19: 65-70; and Gardella et al., 1990, J. Biol. Chem., 265:
15854-15859; Pritchett et al., 1989, Biotechniques, 7: 580.
[0210] In yeast, a number of vectors containing constitutive or
inducible promoters are suitable for use. For a review, see Current
Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al.,
Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et
al., 1987, Expression and Secretion Vectors for Yeast, In: Methods
in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y.,
Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. 11, IRL
Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene
Expression in Yeast, Methods in Enzymology, Eds. Berger &
Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular
Biology of the Yeast Saccharomyces, 1982, Cold Spring Harbor Press,
Vols. I and II.
[0211] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) can be used as a vector to express
foreign genes. The virus grows in Spodoptera frugiperda cells.
RAI-3 encoding sequences can be cloned into non-essential regions
(for example, the polyhedrin gene) of the virus and placed under
the control of an AcNPV promoter (for example, the polyhedrin
promoter). Successful insertion of the RAI-3 coding sequence
results in inactivation of the polyhedrin gene and production of
non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These
recombinant viruses can then be used to infect Spodoptera
frugiperda cells in which the inserted gene is expressed (see e.g.,
Smith et al., 1983, J. Virol., 46: 584; Smith, U.S. Pat. No.
4,215,051).
[0212] In mammalian host cells, a number of virus-based expression
systems can be employed. In cases where an adenovirus is used as an
expression vector, the RAI-3 coding sequence can be ligated to an
adenovirus transcription/translation control complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene
can then be inserted into the adenovirus genome by in vitro or in
vivo recombination. Insertion into a non-essential region of the
viral genome (e.g., region E1 or E3) results in a recombinant virus
that is viable and capable of expressing RAI-3 in infected hosts
(see, e.g., Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA,
81: 3655-3659). Alternatively, the vaccinia 7.5K promoter can be
used (see, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. USA,
79: 7415-7419; Mackett et al., 1984, J. Virol., 49: 857-864;
Panicali et al., 1982, Proc. Natl. Acad. Sci. USA, 79:
4927-4931).
[0213] Specific initiation signals may also be required for
efficient translation of inserted RAI-3 coding sequences. These
signals include the ATG initiation codon and adjacent sequences. In
cases where the entire RAI-3 gene, including its own initiation
codon and adjacent sequences, is inserted into the appropriate
expression vector, no additional translational control signals may
be needed. However, in cases where only a portion of the RAI-3
coding sequence is inserted, exogenous translational control
signals, including the ATG initiation codon, are preferably
provided. Furthermore, the initiation codon is preferably in phase
with the reading frame of the RAI-3 coding sequence to ensure
translation of the entire insert. These exogenous translational
control signals and initiation codons can be of a variety of
origins, both natural and synthetic. The efficiency of expression
can be enhanced by the inclusion of appropriate transcription
enhancer elements, transcription terminators, etc. (see, e.g.,
Bittner et al., 1987, Methods in Enzymol., 153:516-544).
[0214] In addition, a host cell strain can be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products can frequently be important for the function of
the protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins. Appropriate cells lines or host systems can be chosen
to ensure the correct modification and processing of the foreign
protein expressed. To this end, eukaryotic host cells which possess
the cellular machinery for proper processing of the primary
transcript, glycosylation, and phosphorylation of the gene product
can be used. Such mammalian host cells include, but are not limited
to, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, and in
particular, breast cancer cell lines such as, for example, BT483,
Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell lines
such as, for example, CRL7030 and Hs578Bst, and the like.
[0215] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the RAI-3 polypeptide or peptide are
engineered. Thus, rather than using expression vectors which
contain viral origins of replication, host cells can be transformed
with RAI-3 encoding nucleic acid molecules, e.g., DNA, controlled
by appropriate expression control elements (e.g., promoter,
enhancer, sequences, transcription terminators, polyadenylation
sites, etc.), and at least one selectable marker. Following the
introduction of the foreign DNA, engineered cells are allowed to
grow for about 1-2 days in an enriched medium, and then are placed
in selective medium. The selectable marker in the recombinant
plasmid confers resistance to the selection medium and allows cells
to stably integrate the plasmid into their chromosomes and grow to
form foci which, in turn, can be cloned and expanded into cell
lines. This method can advantageously be used to engineer cell
lines which express cellular RAI-3 polypeptides or peptides. Such
engineered cell lines are particularly useful in screening for
RAI-3 analogs or ligands, or for determining compounds, molecules,
and the like, which modulate RAI-3 expression or function.
[0216] In instances in which the mammalian cell is a human cell,
human artificial chromosome (HAC) systems are among the expression
systems by which RAI-3 nucleic acid sequences can be expressed
(see, e.g., Harrington et al., 1997, Nature Genetics, 15: 345-355).
RAI-3 gene products can also be expressed in transgenic animals,
such as mice, rats, rabbits, guinea pigs, pigs, micro-pigs, sheep,
goats, and non-human primates, e.g., baboons, monkeys, and
chimpanzees. The term "transgenic" as used herein refers to animals
expressing RAI-3 nucleic acid sequences from a different species
(e.g., mice expressing human RAI-3 nucleic acid sequences), as well
as animals that have been genetically engineered to over-express
endogenous (i.e., same species) RAI-3 nucleic acid sequences, or
animals that have been genetically engineered to no longer express
endogenous RAI-3 nucleic acid sequences (i.e., "knock-out"
animals), and their progeny.
[0217] Transgenic animals can be produced using techniques well
known in the art, including, but not limited to, pronuclear
microinjection (P. C. Hoppe and T. E. Wagner, 1989, U.S. Pat. No.
4,873,191); retrovirus mediated gene transfer into germ lines (Van
der Putten et al., 1985, Proc. Natl. Acad. Sci. USA, 82:
6148-6152); gene targeting in embryonic stem cells (Thompson et
al., 1989, Cell, 56: 313-321); electroporation of embryos (Lo,
1983, Mol Cell. Biol., 3: 1803-1814); and sperm-mediated gene
transfer (Lavitrano et al., 1989, Cell, 57: 717-723); etc. For a
review of such techniques, see Gordon, 1989, Transgenic Animals,
Intl. Rev. Cytol., 115: 171-229. In addition, any technique known
in the art can be used to produce transgenic animal clones
containing an RAI-3 transgene, for example, nuclear transfer into
enucleated oocytes of nuclei from cultured embryonic, fetal or
adult cells at quiescence (Campbell et al., 1996, Nature, 380:
64-66; and Wilmut et al., 1997, Nature, 385: 810-813).
[0218] Host cells which contain the RAI-3 coding sequence and which
preferably express a biologically active gene product can be
identified by at least four general approaches: (a) DNA-DNA or
DNA-RNA hybridization; (b) the presence or absence of "marker" gene
functions; (c) assessing the level of transcription as measured by
the expression of RAI-3 mRNA transcripts in the host cell; and (d)
detection of the gene product as measured by immunoassay or by its
biological activity.
[0219] In the first approach, the presence of the RAI-3 coding
sequence inserted into the expression vector can be detected by
DNA-DNA or DNA-RNA hybridization using probes comprising nucleotide
sequences that are homologous to the RAI-3 coding sequence,
respectively, or portions or derivatives thereof.
[0220] In the second approach, the recombinant expression
vector/host system can be identified and selected based upon the
presence or absence of certain "marker" gene functions. For
example, if the RAI-3 coding sequence is inserted within a marker
gene sequence of the vector, recombinants containing the RAI-3
coding sequence can be identified by the absence of the marker gene
function. Alternatively, a marker gene can be placed in tandem with
the RAI-3 sequence under the control of the same or a different
promoter used to control the expression of the RAI-3 coding
sequence. Expression of the marker in response to induction or
selection indicates expression of the RAI-3 coding sequence.
[0221] Selectable markers include, for example, resistance to
antibiotics, resistance to methotrexate, transformation phenotype,
and occlusion body formation in baculovirus. In addition, thymidine
kinase activity (M. Wigler et al., 1977, Cell, 11: 223)
hypoxanthine-guanine phosphoribosyltransferase (Szybalska &
Szybalski, 1962, Proc. Natl. Acad. Sci. USA, 48: 2026), and adenine
phosphoribosyltransferase (Lowy et al., 1980, Cell, 22: 817) genes
can be employed in tk.sup.-, hgprt.sup.- or aprt.sup.- cells,
respectively. Also, anti-metabolite resistance can be used as the
basis of selection for dhfr, which confers resistance to
methotrexate (M. Wigler et al., 1980, Proc. Natl. Acad. Sci. USA,
77: 3567; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA, 78:
1527); gpt, which confers resistance to mycophenolic acid (Mulligan
& Berg, 1981, Proc. Natl. Acad. Sci. USA, 78: 2072); neo, which
confers resistance to the aminoglycoside G-418 (Colberre-Garapin,
et al., 1981, J. Mol. Biol., 150: 1); and hygro, which confers
resistance to hygromycin (Santerre et al., 1984, Gene, 30: 147).
Additional selectable genes have been described, namely trpB, which
allows cells to utilize indole in place of tryptophan; hisD, which
allows cells to utilize histinol in place of histidine (Hartman
& Mulligan, 1988, Proc. Natl. Acad. Sci. USA, 85: 8047); and
ODC (ornithine decarboxylase) which confers resistance to the
ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine,
DFMO (McConlogue, 1987, in Current Communications in Molecular
Biology, Cold Spring Harbor Laboratory ed.).
[0222] In the third approach, transcriptional activity for the
RAI-3 coding region can be assessed by hybridization assays. For
example, RNA can be isolated and analyzed by Northern blot using a
probe homologous to the RAI-3 coding sequence or particular
portions thereof. Alternatively, total nucleic acids of the host
cell can be extracted and assayed for hybridization to such
probes.
[0223] In the fourth approach, the expression of the RAI-3 protein
or peptide product can be assessed immunologically, for example by
Western blots, immunoassays such as radio-immunoprecipitation,
enzyme-linked immunoassays and the like. The ultimate test of the
success of the expression system, however, involves the detection
of biologically active RAI-3 gene product. A number of assays can
be used to detect RAI-3 activity, including but not limited to,
binding assays and biological assays for RAI-3 activity.
[0224] Once a cell clone that produces high levels of a
biologically active RAI-3 polypeptide is identified, the cloned
cells can be expanded and used to produce large amounts of the
polypeptide which can be purified using techniques well known in
the art, including but not limited to, immunoaffinity purification
using antibodies, immunoprecipitation, or chromatographic methods
including high performance liquid chromatography (HPLC).
[0225] In instances in which the RAI-3 coding sequence is
engineered to encode a cleavable fusion protein, purification can
be readily accomplished using affinity purification techniques. For
example, a collagenase cleavage recognition consensus sequence can
be engineered between the carboxy terminus of RAI-3 and protein A.
The resulting fusion protein can be purified using an IgG column
that binds to the protein A moiety. Unfused RAI-3 can be released
from the column by treatment with collagenase. Another example
embraces the use of pGEX vectors that express foreign polypeptides
as fusion proteins with glutathione S-transferase (GST). The fusion
protein can be engineered with either thrombin or factor Xa
cleavage sites between the cloned gene and the GST moiety. The
fusion protein can be easily purified from cell extracts by
adsorption to glutathione agarose beads, followed by elution in the
presence of glutathione. In fact, any cleavage site or enzyme
cleavage substrate can be engineered between the RAI-3 gene product
sequence and a second peptide or protein that has a binding partner
which can be used for purification, e.g., any antigen for which an
immunoaffinity column can be prepared.
[0226] In addition, RAI-3 fusion proteins can be readily purified
by utilizing an antibody specific for the fusion protein being
expressed. For example, a system described by Janknecht et al.
allows for the purification of non-denatured fusion proteins
expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl.
Acad. Sci. USA, 88: 8972-8976). In this system, the gene of
interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag consisting of six histidine residues.
Extracts from cells infected with recombinant vaccinia virus are
loaded onto Ni.sup.2+ nitriloacetic acid-agarose columns and
histidine-tagged proteins are selectively eluted with
imidazole-containing buffers.
[0227] Alternatively, RAI-3 protein and peptides can be produced
using chemical methods to synthesize the RAI-3 amino acid sequences
in whole or in part. For example, peptides can be synthesized by
solid phase techniques, cleaved from the resin, and purified by
preparative high performance liquid chromatography (see, e.g.,
Creighton, 1983, Proteins: Structures And Molecular Principles,
W.H. Freeman and Co., N.Y., pp. 50-60). The composition of the
synthetic peptides can be confirmed by amino acid analysis or
sequencing (e.g., the Edman degradation procedure; see Creighton,
1983, Proteins: Structures and Molecular Principles, W.H. Freeman
and Co., N.Y., pp. 34-49).
[0228] The RAI-3 protein, polypeptides and peptide fragments,
mutated, truncated or deleted forms of RAI-3 and/or RAI-3 fusion
products can be prepared for various uses, including but not
limited to, the generation of antibodies (See, Example 10), as
reagents in diagnostic assays, the identification of other cellular
gene products associated with RAI-3 in the development or
continuance of COPD or COPD related disorders, and as reagents in
assays for screening for compounds for use in the treatment of COPD
and COPD related diseases and disorders.
[0229] In a particular related embodiment, RAI-3 peptides,
preferably the RAI-3 peptide of SEQ ID NO:1, can be used to
identify individuals who are at risk for developing COPD or the
underlying symptoms thereof. Such identification can be achieved by
a variety of diagnostic or screening methods and assays as are
known in the art. For example, antibodies specific for the RAI-3
peptide of SEQ ID NO:1 can be used in such assays, in addition to
primers directed against the polynucleotide sequence that codes for
the RAI-3 peptide. Primers are preferably obtained from the nucleic
acid sequence encoding the RAI-3 polypeptide of SEQ ID NO:3; e.g.,
nucleotides 1271-1312 of SEQ ID NO:2, which encode the RAI-3
peptide of SEQ ID NO:1, namely,
gcccacgcttggccgagcccttacaaagactatgaagtaaa- g (SEQ ID NO:30).
Illustrative primers include, for example, the first 17 nucleotides
of the RAI-3-encoding polynucleotide sequence of SEQ ID NO:2, i.e.,
gcccacgcttggccgag (sense primer), (SEQ ID NO:31); in addition to
the antisense of the 3'-most sequence of the RAI-3-encoding
polynucleotide, i.e., ctttacttcatagtctttg (antisense primer), (SEQ
ID NO:32). In addition, degenerative sequences that encode the
RAI-3 polypeptide are encompassed in this embodiment, for example,
the degenerative nucleotide that codes for the RAI-3 peptide of SEQ
ID NO:1, i.e., nucleotides 1271-1312 of SEQ ID NO:2): namely,
gcncaygcntggccntcnccntayaargaytaygargtnaar, (SEQ ID NO:33),
(wherein "n" equals A, G, C, or T; wherein "y" equals C or T, and
wherein "r" equals A or G). Illustrative primers for this
degenerative sequence include, for example, gcncaygcntggccntc
(degenerative sense primer), (SEQ ID NO:34) and
yttnacytcrtartcyttrtang (degenerative antisense primer), (SEQ ID
NO:35), wherein n, y and r are as described above.
Functional Coupling of Human GPCR, RAI-3
[0230] In another of its embodiments, the present invention relates
to functional coupling of the human RAI-3 GPCR. It has been
reported that certain GPCRs exhibit a cDNA concentration-dependent
constitutive activity through cAMP response element (CRE)
luciferase reporters. (G. Chen et al., 1999, J. Pharmacol. Toxicol.
Methods, 42:199-206). In accordance with the present invention,
functional coupling of RAI-3 to known GPCR second messenger
pathways was demonstrated as described in Example 1(L) herein.
Briefly, to this end, RAI-3 cDNA was PCR amplified and subcloned
into the pcDNA3.1 Hygro.TM. mammalian expression vector, which was
transfected into a CHO cell line wherein the RAI-3 polypeptide was
expressed at high constitutive levels as described herein.
[0231] To demonstrate functional coupling of the RAI-3 polypeptide
as shown by example herein, i.e., Example 1(L), the ability of
RAI-3 to couple to a G protein was examined by employing the
promiscuous G protein, G alpha 15. Specific domains of alpha
subunits of G proteins have been shown to control coupling to GPCRs
(e.g., J. Blahos et al., 2001, J. Biol. Chem., 275(5), 3262-3269).
It has been shown that the extreme C-terminal 20 amino acids of
either G alpha 15 or 16 confer the unique ability of these G
proteins to couple to many GPCRs, including those that naturally do
not stimulate phospholipase C (PLC), (J. Blahos et al., 2001,
Ibid.). Indeed, both G alpha 15 and 16 have been shown to couple a
wide variety of GPCRs to PLC activation of calcium mediated
signaling pathways (including the NFAT-signaling pathway), (See,
e.g., S. Offermanns and M. I. Simon, 1995, J. Biol. Chem.,
270(25):15175-15180). In brief, as described in Example 1(L)
hereinbelow, to demonstrate that RAI-3 was functioning as a GPCR,
the CHO/NFAT G alpha 15 cell line that contained only the
integrated NFAT response element linked to the Beta-Lactamase
reporter was transfected with a pcDNA3.1 Hygro.TM./RAI-3 construct.
Analysis of the fluorescence emission from this stable pool showed
that RAI-3 constitutively coupled to the NFAT-mediated second
messenger pathways via G alpha 15 (FIGS. 20 and 21). The results
are consistent with RAI-3 functioning as a GPCR in a manner
analogous to that of the known G alpha 15 coupled receptors.
Therefore, constitutive expression of RAI-3 in the CHO/NFAT G alpha
15 cell line leads to NFAT activation through accumulation of
intracellular Ca.sup.2+.
[0232] Accordingly, in preferred embodiments according to this
invention, RAI-3 polynucleotides and polypeptides, including
agonists, antagonists, and fragments thereof, are useful for
modulating intracellular Ca.sup.2+ levels, modulating
Ca.sup.2+-sensitive signaling pathways, and modulating NFAT
element-associated signaling pathways via G alpha 15.
[0233] In additional preferred embodiments, the RAI-3 transfected
CHO/NFAT G alpha 15 cell lines of the present invention are useful
for the identification of agonists and antagonists of the RAI-3
polypeptide. Illustrative uses of such cell lines include methods
of identifying RAI-3 agonists and antagonists. Preferably, an
embodiment of the invention embraces a method of identifying a
compound that modulates the biological activity of the RAI-3
polypeptide, comprising (a) combining a candidate modulator
compound with a host cell expressing the RAI-3 polypeptide having
the sequence as set forth in SEQ ID NO:3, or a fragment or portion
thereof; and (b) measuring an effect of the candidate modulator
compound on the activity of the expressed RAI-3 polypeptide.
Representative vectors expressing the RAI-3 polypeptide are
described herein, e.g., pcDNA3.1 Hygro.TM., or are otherwise known
in the art.
[0234] The cell lines of the present invention are also useful in a
method of screening for compounds that are capable of modulating
the biological activity of the RAI-3 polypeptide, or a peptide
thereof, comprising the steps of: (a) determining the biological
activity of the RAI-3 polypeptide in the absence of a modulator
compound; (b) contacting a host cell expressing the RAI-3
polypeptide with the modulator compound; and (c) determining the
biological activity of the RAI-3 polypeptide in the presence of the
modulator compound; wherein a difference between the activity of
the RAI-3 polypeptide in the presence of the modulator compound and
in the absence of the modulator compound indicates a modulating
effect of the compound. Additional uses for such cell lines are
described herein or otherwise known in the art.
Anti-RAI-3 Antibodies
[0235] The present invention also includes antibodies directed to
the RAI-3 polypeptide and peptides, as well as methods for the
production of such antibodies, including antibodies that
specifically recognize one or more RAI-3 epitopes or epitopes of
conserved RAI-3 variants, or peptide fragments of RAI-3. Antibodies
can be generated against the RAI-3 polypeptide comprising, or
alternatively, consisting of, an epitope of the polypeptide having
an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:3. Antibodies
refer to intact molecules as well as fragments thereof, such as
Fab, F(ab').sub.2, Fv, which are capable of binding to an epitopic
or antigenic determinant. An antigenic determinant refers to that
portion of a molecule that makes contact with a particular antibody
(i.e., an epitope). The term "epitope" as used herein, refers to
portions of a polypeptide having antigenic or immunogenic activity
in an animal, preferably a mammal, and most preferably a human. An
"immunogenic epitope" as used herein, refers to a portion of a
protein that elicits an antibody response in an animal, as
determined by any method known in the art, for example, by the
methods for generating antibodies described herein. (See, for
example, Geysen et al., 1983, Proc. Natl. Acad. Sci. USA,
81:3998-4002). The term "antigenic epitope" as used herein refers
to a portion of a protein to which an antibody can
immunospecifically bind to its antigen as determined by any method
well known in the art, for example, by the immunoassays described
herein. Immunospecific binding excludes non-specific binding, but
does not necessarily exclude cross-reactivity with other antigens.
Antigenic epitopes need not necessarily be immunogenic. Either the
full-length protein or an antigenic peptide fragment can be used.
Antibodies are preferably prepared from these regions or from
discrete fragments in regions of the RAI-3 nucleic acid and protein
sequences comprising an epitope.
[0236] Anti-RAI-3 antibodies can also be prepared from any region
of the RAI-3 polypeptide or peptides thereof as described herein.
Antibodies can be developed against the entire receptor or portions
of the receptor, for example, the intracellular carboxy terminal
domain, the amino terminal extracellular domain, the entire
transmembrane domain, specific transmembrane segments, any of the
intracellular or extracellular loops, or any portions of these
regions. Antibodies can also be developed against specific
functional sites, such as the site of ligand binding, or sites that
are glycosylated, phosphorylated, myristylated, or amidated, for
example. Also, when inactivation of the protein is desired, a
preferred fragment generates the production of an antibody that
diminishes or completely prevents ligand binding.
[0237] In the present invention, antigenic epitopes preferably
contain a sequence of at least 4, at least 5, at least 6, at least
7, more preferably at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least
20, at least 25, at least 30, at least 40, at least 50, and, most
preferably, between about 15 to about 45 amino acids. Preferred
polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, or 100 amino acid residues in length. Additional
non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed herein, as well as portions thereof, as well as
any combination of two, three, four, five or more of these
antigenic epitopes. Antigenic epitopes are useful, for example, to
raise antibodies, including monoclonal antibodies, that
specifically bind the epitope. In addition, antigenic epitopes can
be used as the target molecules in immunoassays. (See, for
instance, Wilson et al., 1984, Cell, 37:767-778; and Sutcliffe et
al., 1983, Science, 219:660-666). Such fragments as described
herein are not to be construed, however, as encompassing any
fragments which may be disclosed prior to the invention.
[0238] When the RAI-3 protein or a peptide portion of RAI-3 is used
to immunize a host animal, numerous regions of the protein may
induce the production of antibodies which bind specifically to a
given region or three-dimensional structure on the protein; these
regions or structures are referred to as antigenic determinants. An
antigenic determinant may compete with the intact antigen (i.e.,
the immunogen used to elicit the immune response) for binding to an
antibody. Specific binding or specifically binding refer to the
interaction between a protein or peptide, i.e., the RAI-3 protein
or an RAI-3 peptide, and a binding molecule, such as an agonist, an
antagonist, or an antibody. The interaction is dependent upon the
presence of a particular structure (i.e., an antigenic determinant
or epitope) of the protein that is recognized by the binding
molecule.
[0239] Similarly, immunogenic epitopes can be used, for example, to
induce antibodies according to methods well known in the art. (See,
for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow
et al., 1985, Proc. Natl. Acad. Sci. USA, 82:910-914; and Bittle et
al., 1985, J. Gen. Virol., 66:2347-2354). Preferred immunogenic
epitopes include the immunogenic epitopes disclosed herein, as well
as any combination of two, three, four, five or more of these
immunogenic epitopes.
[0240] The RAI-3 polypeptide comprising one or more immunogenic
epitopes which elicit an antibody response can be introduced
together with a carrier protein, such as albumin, to an animal
system (such as rabbit or mouse). Alternatively, if the polypeptide
is of sufficient length (e.g., at least about 25 amino acids), the
polypeptide can be presented without a carrier. However,
immunogenic epitopes comprising as few as 5 to 10 amino acids have
been shown to be sufficient to raise antibodies capable of binding
to, at the very least, linear epitopes in a denatured polypeptide
(e.g., in Western blotting).
[0241] An epitope-bearing RAI-3 polypeptide or peptide can be used
to induce antibodies according to methods well known in the art
including, but not limited to, in vivo immunization, in vitro
immunization, and phage display methods. See, e.g., Sutcliffe et
al., supra; Wilson et al., supra; and Bittle et al., supra). If in
vivo immunization is used, animals can be immunized with free
peptide; however, the anti-peptide antibody titer may be boosted by
coupling the peptide to a macromolecular carrier, such as keyhole
limpet hemacyanin (KLH), or tetanus toxoid (TT). For instance,
peptides containing cysteine residues can be coupled to a carrier
using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester
(MBS), while other peptides may be coupled to carriers using a more
general linking agent, such as glutaraldehyde.
[0242] Epitope bearing RAI-3 polypeptide or peptides can also be
synthesized as multiple antigen peptides (MAPs), first described by
J. P. Tam et al., 1995, Biomed. Pept., Proteins, Nucleic Acids,
199, 1(3):123-32; and Calvo, et al., 1993, J. Immunol.,
150(4):1403-12), which are hereby incorporated by reference in
their entirety herein. MAPs contain multiple copies of a specific
peptide attached to a non-immunogenic lysine core. MAP peptides
usually contain four or eight copies of the peptide, which are
often referred to as MAP4 or MAP8 peptides. By way of non-limiting
example, MAPs can be synthesized onto a lysine core matrix attached
to a polyethylene glycol-polystyrene (PEG-PS) support. The peptide
of interest is synthesized onto the lysine residues using
9-fluorenylmethoxycarbonyl (Fmoc) chemistry. For example, Applied
Biosystems (Foster City, Calif.) offers commercially available MAP
resins, such as, for example, the Fmoc Resin 4 Branch and the Fmoc
Resin 8 Branch which can be used to synthesize MAPs. Cleavage of
MAPs from the resin is performed with standard trifloroacetic acid
(TFA)-based cocktails known in the art. Purification of MAPs,
except for desalting, is not generally necessary. MAP peptides can
be used in immunizing vaccines which elicit antibodies that
recognize both the MAP and the native protein from which the
peptide was derived.
[0243] Epitope-bearing RAI-3 polypeptide and peptides thereof can
also be incorporated into a coat protein of a virus, which can then
be used as an immunogen or a vaccine with which to immunize
animals, including humans, in order stimulate the production of
anti-epitope antibodies. For example, the V3 loop of the gp120
glycoprotein of the human immunodeficiency virus type 1 (HIV-1) has
been engineered to be expressed on the surface of rhinovirus.
Immunization with rhinovirus displaying the V3 loop peptide yielded
apparently effective mimics of the HIV-1 immunogens (as measured by
their ability to be neutralized by anti-HIV-1 antibodies as well as
by their ability to elicit the production of antibodies capable of
neutralizing HIV-1 in cell culture). This techniques of using
engineered viral particles as immunogens is described in more
detail in Smith et al., 1997, Behring Inst Mitt Feb, (98):229-39;
Smith et al., 1998, J. Virol., 72:651-659; and Zhang et al., 1999,
Biol. Chem., 380:365-74), which are hereby incorporated by
reference herein in their entireties.
[0244] Epitope bearing RAI-3 polypeptide and peptides thereof can
be modified, for example, by the addition of amino acids at the
amino- and/or carboxy-terminus of the peptide. Such modifications
are performed, for example, to alter the conformation of the
epitope bearing polypeptide such that the epitope will have a
conformation more closely related to the structure of the epitope
in the native protein. An example of a modified epitope-bearing
polypeptide of the invention is a polypeptide in which one or more
cysteine residues have been added to the polypeptide to allow for
the formation of a disulfide bond between two cysteines, thus
resulting in a stable loop structure of the epitope-bearing
polypeptide under non-reducing conditions. Disulfide bonds can form
between a cysteine residue added to the polypeptide and a cysteine
residue of the naturally-occurring epitope, or between two
cysteines which have both been added to the naturally-occurring
epitope-bearing polypeptide. In addition, it is possible to modify
one or more amino acid residues of the naturally-occurring
epitope-bearing polypeptide by substitution with cysteines to
promote the formation of disulfide bonded loop structures. Cyclic
thioether molecules of synthetic peptides can be routinely
generated using techniques known in the art, e.g., as described in
PCT publication WO 97/46251, incorporated in its entirety by
reference herein. Other modifications of epitope-bearing
polypeptides contemplated by this invention include
biotinylation.
[0245] For the production of antibodies in vivo, host animals, such
as rabbits, rats, mice, sheep, or goats, are immunized with either
free or carrier-coupled peptides or MAP peptides, for example, by
intraperitoneal and/or intradermal injection. Injection material is
typically an emulsion containing about 100 .mu.g of peptide or
carrier protein and Freund's adjuvant, or any other adjuvant known
for stimulating an immune response. Several booster injections may
be needed, for instance, at intervals of about two weeks, to
provide a useful titer of anti-peptide antibody which can be
detected, for example, by ELISA assay using free peptide adsorbed
to a solid surface. The titer of anti-peptide antibodies in serum
from an immunized animal can be increased by selection of
anti-peptide antibodies, e.g., by adsorption of the peptide onto a
solid support and elution of the selected antibodies according to
methods well known in the art.
[0246] As one having skill in the art will appreciate, and as
discussed above, the RAI-3 polypeptide and peptides as described
herein, which comprise an immunogenic or antigenic epitope, can be
fused to other polypeptide sequences. For example, the polypeptides
of the present invention can be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgD, or IgM), or portions thereof,
e.g., CH1, CH2, CH3, or any combination thereof, and portions
thereof, or with albumin (including, but not limited to,
recombinant human albumin, or fragments or variants thereof (see,
e.g., U.S. Pat. No. 5,876,969; EP Patent No. 0 413 622; and U.S.
Pat. No. 5,766,883, incorporated by reference in their entirety
herein), thereby resulting in chimeric polypeptides. Such fusion
proteins may facilitate purification and may increase half-life in
vivo. This has been shown for chimeric proteins containing the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins. See, e.g., Traunecker et al., 1988, Nature,
331:84-86).
[0247] Enhanced delivery of an antigen across the epithelial
barrier to the immune system has been demonstrated for antigens
(e.g., insulin) conjugated to an FcRn binding partner, such as IgG
or Fc fragments (see, e.g., PCT publications WO 96/22024 and WO
99/04813). IgG fusion proteins that have a disulfide-linked dimeric
structure due to the IgG portion disulfide bonds have also been
found to be more efficient in binding and neutralizing other
molecules than are monomeric polypeptides, or fragments thereof,
alone. See, e.g., Fountoulakis et al., 1995, J. Biochem.,
270:3958-3964).
[0248] Nucleic acids encoding epitopes can also be recombined with
a gene of interest as an epitope tag (e.g., a hemagglutinin ("HA")
tag or Flag tag) to aid in detection and purification of the
expressed polypeptide. For example, a system for the ready
purification of non-denatured fusion proteins expressed in human
cell lines has been described by Janknecht et al., (1991, Proc.
Natl. Acad. Sci. USA, 88:8972-897). In this system, the gene of
interest is subcloned into a vaccinia recombination plasmid such
that the open reading frame of the gene is translationally fused to
an amino-terminal tag having six histidine residues. The tag serves
as a matrix binding domain for the fusion protein. Extracts from
cells infected with the recombinant vaccinia virus are loaded onto
an Ni.sup.2+ nitriloacetic acid-agarose column and histidine-tagged
proteins are selectively eluted with imidazole-containing
buffers.
[0249] Additional fusion proteins of the invention can be generated
by employing the techniques of gene-shuffling, motif-shuffling,
exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA shuffling"). DNA shuffling can be employed to modulate the
activities of polypeptides of the invention, such methods can be
used to generate polypeptides with altered activity, as well as
agonists and antagonists of the polypeptides. See, generally, U.S.
Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and
5,837,458, and Patten et al., 1997, Curr. Opinion Biotechnol.,
8:724-33; Harayama, 1998, Trends Biotechnol., 16(2):76-82; Hansson,
et al., 1999, J. Mol. Biol., 287:265-76; and Lorenzo and Blasco,
1998, Biotechniques, 24(2):308-313, the contents of each of which
are hereby incorporated by reference in its entirety).
[0250] In one aspect, the alteration of a polynucleotide encoding
the RAI-3 polypeptide or a fragment thereof can be achieved by DNA
shuffling. DNA shuffling involves the assembly of two or more DNA
segments by homologous or site-specific recombination to generate
variation in the polynucleotide sequence. Alternatively, the RAI-3
polynucleotide, or its encoded polypeptide or peptides, can be
altered by being subjected to random mutagenesis by error-prone
PCR, random nucleotide insertion, or other methods, prior to
recombination. In addition, one or more components, motifs,
sections, parts, domains, fragments, etc., of a polynucleotide
encoding the RAI-3 polypeptide can be recombined with one or more
components, motifs, sections, parts, domains, fragments, etc. of
one or more heterologous molecules.
[0251] A bispecific or bifunctional antibody is an artificial
hybrid antibody having two different heavy/light chain pairs and
two different binding sites. Bispecific antibodies can be produced
by a variety of methods, including fusion of hybridomas or linking
of Fab' fragments. (See, e.g., Songsivilai & Lachmann, 1990,
Clin. Exp. Immunol., 79:315-321; Kostelny et al., 1992, J.
Immunol., 148:1547 1553). In addition, bispecific antibodies can be
formed as "diabodies" (See, Holliger et al., 1993, Proc. Natl.
Acad. Sci. USA, 90:6444-6448), or "Janusins" (See, Traunecker et
al., 1991, EMBO J., 10:3655-3659 and Traunecker et al., 1992, Int.
J. Cancer Suppl. 7:51-52-127).
[0252] Antibodies of the invention include the various types
mentioned herein above, as well as anti-idiotypic (anti-Id)
antibodies (including, e.g., anti-Id antibodies to antibodies of
the invention), intracellularly made antibodies (i.e.,
intrabodies), and epitope-binding fragments of any of the above.
The immunoglobulin molecules of the invention can be of any type
(e.g., IgG, IgE, IgM, IgD, IgA and IgY), class or subclass (e.g.,
IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) of immunoglobulin molecule.
A preferred immunoglobulin is of the IgG1 isotype. Other preferred
antibody isotypes include the IgG2 and the IgG4 isotypes.
[0253] As is appreciated by the skilled practitioner,
immunoglobulins can have both a heavy and a light chain. An array
of IgG, IgE, IgM, IgD, IgA, and IgY heavy chains can be paired with
a light chain of the kappa or lambda types. Most preferably,
antibodies of the present invention are human antigen-binding
antibodies and antibody fragments and include, but are not limited
to, Fab, Fab' F(ab') 2, Fd, single-chain Fvs (scFv), single-chain
antibodies, disulfide-linked Fvs (sdFv) and fragments comprising
either a V.sub.L or V.sub.H domain. Antigen-binding antibody
fragments, including single-chain antibodies, can comprise the
variable region(s) alone or in combination with the entirety or a
portion of the following: hinge region, and CH1, CH2, and CH3
domains. Also included in connection with the invention are
antigen-binding fragments also comprising any combination of
variable region(s) with a hinge region, and CH1, CH2, and CH3
domains. The antibodies of the invention can be from any animal
origin including birds and mammals. Preferably, the antibodies are
of human, murine (e.g., mouse and rat), donkey, sheep, rabbit,
goat, guinea pig, camel, horse, or chicken origin. As used herein,
"human" antibodies include antibodies having the amino acid
sequence of a human immunoglobulin and include antibodies isolated
from human immunoglobulin libraries or from animals transgenic for
one or more human immunoglobulin and that do not express endogenous
immunoglobulins, as described herein and, for example, in U.S. Pat.
No. 5,939,598.
[0254] The antibodies of the present invention can be monospecific,
bispecific, trispecific, or of greater multispecificity.
Multispecific antibodies can be specific for different epitopes of
the RAI-3 polypeptide, or can be specific for both an RAI-3
polypeptide and a heterologous epitope, such as a heterologous
polypeptide or solid support material. (See, e.g., PCT publications
WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt et al.,
1991, J. Immunol., 147:60-69; U.S. Pat. Nos. 4,474,893; 4,714,681;
4,925,648; 5,573,920; 5,601,819; and Kostelny et al., 1992, J.
Immunol., 148:1547-1553).
[0255] Antibodies of the present invention can be described or
specified in terms of the epitope(s) or portion(s) of the RAI-3
polypeptide which are recognized or specifically bound. The
epitope(s) or polypeptide portion(s) can be specified, e.g., by
N-terminal and C-terminal positions, by size in contiguous amino
acid residues, or as presented in the sequences defined herein.
Further included in accordance with the present invention are
antibodies which bind to polypeptides encoded by polynucleotides
which hybridize to the RAI-3 polynucleotide (SEQ ID NO:2) under
stringent, or moderately stringent, hybridization conditions as
described herein.
[0256] The antibodies of the invention (including molecules
comprising, or alternatively consisting of, antibody fragments or
variants thereof) can bind immunospecifically and/or preferentially
to an RAI-3 polypeptide, an RAI-3 polypeptide fragment, or a
variant RAI-3 protein. By way of non-limiting example, an antibody
can be considered to bind to a first antigen preferentially if it
binds to the first antigen with a dissociation constant (Kd) that
is less than the antibody's Kd for the second antigen. In another
non-limiting embodiment, an antibody can be considered to bind to a
first antigen preferentially if it binds to the first antigen with
an affinity that is at least one order of magnitude less than the
antibody's Ka for the second antigen. In another non-limiting
example, an antibody can be considered to bind to a first antigen
preferentially if it binds to the first antigen with an affinity
that is at least two orders of magnitude less than the antibody's
Kd for the second antigen.
[0257] In another nonlimiting example, an antibody can be
considered to bind to a first antigen preferentially if it binds to
the first antigen with an off rate (koff) that is less than the
antibody's koff for the second antigen. In a further nonlimiting
example, an antibody can be considered to bind to a first antigen
preferentially if it binds to the first antigen with an affinity
that is at least one order of magnitude less than the antibody's
koff for the second antigen. In yet a further nonlimiting example,
an antibody can be considered to bind to a first antigen
preferentially if it binds to the first antigen with an affinity
that is at least two orders of magnitude less than the antibody's
koff for the second antigen.
[0258] Anti-RAI-3-antibodies of this invention can also be
described or specified in terms of their binding affinity to the
RAI-3 polypeptide or peptide thereof. Preferred binding affinities
include those with a dissociation constant or Kd of less than
5.times.10.sup.-2 M, 1.times.10.sup.-2 M, 5.times.10.sup.-3 M,
1.times.10.sup.-3 M, 5.times.10.sup.-4 M, or 1.times.10.sup.-4 M.
More preferred binding affinities include those with a dissociation
constant or Kd less than 5.times.10.sup.-5 M, 1.times.10.sup.-5 M,
5.times.10.sup.-6 M, 1.times.10.sup.-6 M, 5.times.10.sup.-7 M,
1.times.10.sup.-7 M, 5.times.10.sup.-8 M, or 1.times.10.sup.-8 M.
Even more preferred antibody binding affinities include those with
a dissociation constant or Kd of less than 5.times.10.sup.-9 M,
1.times.10.sup.-9 M, 5.times.10.sup.-10 M, 1.times.10.sup.-10 M,
5.times.10.sup.-11 M, 1.times.10.sup.-11 M, 5.times.10.sup.-12 M,
1.times.10.sup.-12 M, 5.times.10.sup.-13 M, 1.times.10.sup.-13 M,
5.times.10.sup.-14 M, 1.times.10.sup.-14M, 5.times.10.sup.-15 M, or
1.times.10.sup.-15 M.
[0259] More specifically, antibodies of the invention bind to the
RAI-3 polypeptide, RAI-3 fragments, or variants thereof, with an
off rate (koff) of less than or equal to about 5.times.10.sup.-2
sec.sup.1, 1.times.10.sup.-2 sec.sup.-1, 5.times.10.sup.-3
sec.sup.-1, or 1.times.10.sup.-3 sec.sup.-1. More preferably,
antibodies of the invention bind to the RAI-3 polypeptide, RAI-3
fragments, or variants thereof, with an off rate (koff) of less
than or equal to about 5.times.10.sup.-4 sec.sup.-1,
1.times.10.sup.-4 sec.sup.-1, 5.times.10.sup.-5 sec.sup.1,
1.times.10.sup.-5 sec.sup.-1, 5.times.10.sup.-6 sec.sup.-1,
1.times.10.sup.-6 sec.sup.-1, 5.times.10.sup.-7 sec.sup.-1, or
1.times.10.sup.-7 sec.sup.-1. In other aspects, antibodies of the
invention bind to the RAI-3 polypeptide, RAI-3 fragments, or
variants thereof with an on rate (kon) of greater than or equal to
1.times.10.sup.3 M.sup.-1 sec.sup.-1, 5.times.10.sup.3 M.sup.-1
sec.sup.1, 1.times.10.sup.4 M.sup.-1 sec.sup.-1, or
5.times.10.sup.4 M.sup.-1 sec.sup.-1. More preferably, antibodies
of the invention bind to the RAI-3 polypeptide, or RAI-3 fragments,
or variants thereof with an on rate greater than or equal to
1.times.10.sup.5 M.sup.-1 sec.sup.-, 5.times.10.sup.5 M.sup.-1
sec.sup.-1, 1.times.10.sup.6 M.sup.-1 sec.sup.-1, 5.times.10.sup.-6
M.sup.-1 sec.sup.-1, or 1.times.10.sup.-7 M.sup.-1 sec.sup.-1.
[0260] The present invention also provides antibodies that
competitively inhibit the binding of an antibody to an RAI-3
epitope as determined by any method known in the art for
determining competitive binding, for example, the immunoassays as
described herein. In preferred embodiments, the antibody
competitively inhibits binding to an epitope by at least 95%, at
least 90%, at least 85%, at least 80%, at least 75%, at least 70%,
at least 60%, or at least 50%.
[0261] As mentioned above, antibodies of the present invention can
act as agonists or antagonists of the RAI-3 polypeptide. For
example, the invention includes antibodies which disrupt RAI-3
receptor/ligand interactions, or disrupt interactions of cellular
molecules affected by RAI-3 following cell stimulation, either
partially or fully. The invention includes both receptor-specific
antibodies and ligand-specific antibodies. The invention also
includes receptor-specific antibodies which do not prevent ligand
binding, but do prevent receptor activation. Receptor activation
(i.e., signaling) can be determined by techniques described herein
or as otherwise known in the art. For example, receptor activation
can be determined by detecting the phosphorylation (e.g., on
tyrosine or serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by Western blot analysis. In specific
embodiments, antibodies are provided that inhibit ligand activity
or receptor activity by at least 95%, at least 90%, at least 85%,
at least 80%, at least 75%, at least 70%, at least 60%, or at least
50% of the activity in the absence of the antibody.
[0262] In an embodiment of the present invention, antibodies that
immunospecifically bind to the RAI-3 protein, or to a fragment or
variant thereof, comprise a polypeptide having the amino acid
sequence of any one of the Ig heavy chains expressed by an
anti-RAI-3 protein antibody-expressing cell line of the invention,
and/or any one of the Ig light chains expressed by an anti-RAI-3
protein antibody-expressing cell line of the invention. In another
embodiment of the present invention, antibodies that
immunospecifically bind to the RAI-3 protein, or to a fragment or
variant thereof, comprise a polypeptide having the amino acid
sequence of any one of the V.sub.H domains of a heavy chain
expressed by an anti-RAI-3 protein antibody-expressing cell line,
and/or any one of the V.sub.L domains of a light chain expressed by
an anti-RAI-3 protein antibody-expressing cell line. In preferred
embodiments, antibodies of the present invention comprise the amino
acid sequence of a V.sub.H domain and V.sub.L domain expressed by a
single anti-RAI-3 protein antibody-expressing cell line. In
alternative embodiments, antibodies of the present invention
comprise the amino acid sequence of a V.sub.H domain and a V.sub.L
domain expressed by two different anti-RAI-3 protein
antibody-expressing cell lines. Molecules comprising, or
alternatively consisting of, antibody fragments or variants of the
V.sub.H and/or V.sub.L domains expressed by an anti-RAI-3 protein
antibody-expressing cell line that immunospecifically bind to an
RAI-3 protein are also encompassed by the invention, as are nucleic
acid molecules encoding these V.sub.H and V.sub.L domains,
molecules, fragments and/or variants.
[0263] The present invention also provides antibodies that
immunospecificially bind to the RAI-3 polypeptide, or fragment or
variant of the RAI-3 protein, wherein the antibodies comprise, or
alternatively consist of, a polypeptide having an amino acid
sequence of any one, two, three, or more of the V.sub.H CDRs
contained in an Ig heavy chain expressed by one or more anti-RAI-3
protein antibody expressing cell lines. In particular, the
invention provides antibodies that immunospecifically bind to the
RAI-3 protein, comprising, or alternatively consisting of, a
polypeptide having the amino acid sequence of a V.sub.H CDR1
contained in an Ig heavy chain expressed by one or more anti-RAI-3
protein antibody expressing cell lines. In another embodiment,
antibodies that immunospecifically bind to the RAI-3 protein,
comprise, or alternatively consist of, a polypeptide having the
amino acid sequence of a V.sub.H CDR2 contained in a heavy chain
expressed by one or more anti-RAI-3 protein antibody expressing
cell lines. In a preferred embodiment, antibodies that
immunospecifically bind to the RAI-3 protein, comprise, or
alternatively consist of, a polypeptide having the amino acid
sequence of a V.sub.H CDR3 contained in an Ig heavy chain expressed
by one or more anti-RAI-3 protein antibody expressing cell lines of
the invention. Molecules comprising, or alternatively consisting
of, these antibodies, or antibody fragments or variants thereof,
that immunospecifically bind to the RAI-3 protein or to an RAI-3
protein fragment or variant thereof are also encompassed by the
invention, as are nucleic acid molecules encoding these anti-RAI-3
antibodies, molecules, fragments and/or variants.
[0264] The present invention also provides antibodies that
immunospecificially bind to the RAI-3 polypeptide, or a fragment or
variant of the RAI-3 protein, wherein the antibodies comprise, or
alternatively consist of, a polypeptide having an amino acid
sequence of any one, two, three, or more of the V.sub.L CDRs
contained in an Ig heavy chain expressed by one or more anti-RAI-3
protein antibody expressing cell lines of the invention. In
particular, the invention provides antibodies that
immunospecifically bind to the RAI-3 protein, comprising, or
alternatively consisting of, a polypeptide having the amino acid
sequence of a V.sub.L CDR1 contained in an Ig heavy chain expressed
by one or more anti-RAI-3 protein antibody-expressing cell lines of
the invention. In another embodiment, antibodies that
immunospecifically bind to the RAI-3 protein, comprise, or
alternatively consist of, a polypeptide having the amino acid
sequence of a V.sub.L CDR2 contained in an Ig heavy chain expressed
by one or more anti-RAI-3 protein antibody-expressing cell lines of
the invention. In a preferred embodiment, antibodies that
immunospecifically bind to the RAI-3 protein, comprise, or
alternatively consist of, a polypeptide having the amino acid
sequence of a V.sub.L CDR3 contained in an Ig heavy chain expressed
by one or more anti-RAI-3 protein antibody-expressing cell lines of
the invention. Molecules comprising, or alternatively consisting
of, these antibodies, or antibody fragments or variants thereof,
that immunospecifically bind to the RAI-3 protein or to an RAI-3
protein fragment or variant thereof are also encompassed by the
invention, as are nucleic acid molecules encoding these anti-RAI-3
antibodies, molecules, fragments and/or variants.
[0265] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants) that immunospecifically bind to the RAI-3
protein or to an RAI-3 polypeptide fragment or variant, wherein the
antibodies comprise, or alternatively consist of, one, two, three,
or more V.sub.H CDRs, and one, two, three or more V.sub.L CDRs, as
contained in an Ig heavy chain or light chain expressed by one or
more anti-RAI-3 protein antibody-expressing cell lines of the
invention. In particular, the invention provides antibodies that
immunospecifically bind to the RAI-3 protein or to an RAI-3
polypeptide fragment or variant, wherein the antibodies comprise,
or alternatively consist of, a V.sub.H CDR1 and a V.sub.L CDR1, a
V.sub.H CDR1 and a V.sub.L CDR2, a V.sub.H CDR1 and a V.sub.L CDR3,
a V.sub.H CDR2 and a V.sub.L CDR1, V.sub.H CDR2 and V.sub.L CDR2, a
V.sub.H CDR2 and a V.sub.L CDR3, a V.sub.H CDR3 and a V.sub.H CDR1,
a V.sub.H CDR3 and a V.sub.L CDR2, a V.sub.H CDR3 and a V.sub.L
CDR3, or any combination thereof, of the V.sub.H CDRs and V.sub.L
CDRs contained in an Ig heavy chain or Ig light chain expressed by
one or more anti-RAI-3 protein antibody-expressing cell lines of
the invention. In a preferred embodiment, one or more of these
combinations are from a single anti-RAI-3 protein
antibody-expressing cell line. Molecules comprising, or
alternatively consisting of, fragments or variants of these
antibodies that immunospecifically bind to the RAI-3 protein are
also encompassed by the invention, as are nucleic acid molecules
encoding these anti-RAI-3 antibodies, molecules, fragments or
variants.
[0266] Also provided are nucleic acid molecules, generally
isolated, encoding an antibody of the invention (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof). In a specific aspect, a nucleic
acid molecule of the invention encodes an antibody (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof), comprising, or alternatively
consisting of, a V.sub.H domain having an amino acid sequence of
any one of the V.sub.H domains of an immunoglobulin heavy chain
expressed by an anti-RAI-3 protein antibody-expressing cell line of
the invention and a V.sub.L domain having an amino acid sequence of
an immunoglobulin light chain expressed by an anti-RAI-3 protein
antibody-expressing cell line of the invention. In another aspect,
a nucleic acid molecule of the invention encodes an antibody
(including molecules comprising, or alternatively consisting of,
antibody fragments or variants thereof), comprising, or
alternatively consisting of, a V.sub.H domain having an amino acid
sequence of any one of the V.sub.H domains of an immunoglobulin
heavy chain expressed by an anti-RAI-3 protein antibody-expressing
cell line of the invention, or a V.sub.L domain having an amino
acid sequence of a light chain expressed by an anti-RAI-3 protein
antibody-expressing cell line of the invention. The present
invention also provides antibodies that comprise, or alternatively
consist of, variants (including derivatives) of the antibody
molecules (e.g., the V.sub.H domains and/or V.sub.L domains)
described herein, which antibodies immunospecifically bind to the
RAI-3 protein or to a fragment or a variant thereof.
[0267] Standard techniques known to those of skill in the art can
be used to introduce mutations in the nucleotide sequence encoding
a molecule of the invention, including, for example, site-directed
mutagenesis and PCR-mediated mutagenesis which result in amino acid
substitutions. Preferably the molecules are immunoglobulin
molecules. Also, preferably, the variants (including derivatives)
encode less than 50 amino acid substitutions, less than 40 amino
acid substitutions, less than 30 amino acid substitutions, less
than 25 amino acid substitutions, less than 20 amino acid
substitutions, less than 15 amino acid substitutions, less than 10
amino acid substitutions, less than 5 amino acid substitutions,
less than 4 amino acid substitutions, less than 3 amino acid
substitutions, or less than 2 amino acid substitutions, relative to
the reference V.sub.H domain, V.sub.H CDR1, V.sub.H CDR2, V.sub.H
CDR3, V.sub.L domain, V.sub.L CDR1, V.sub.L CDR2, or V.sub.L CDR3
domain.
[0268] A "conservative amino acid substitution" is one in which the
amino acid residue is replaced with an amino acid residue having a
side chain with a similar charge. Families of amino acid residues
having side chains with similar charges have been defined in the
art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine).
[0269] Alternatively, mutations can be introduced randomly along
all or part of the coding sequence, such as by saturation
mutagenesis. The resultant mutants can be screened for biological
activity to identify mutants that retain activity. For example, it
is possible to introduce mutations only in framework regions or
only in CDR regions of an antibody molecule. Introduced mutations
can be silent or neutral missense mutations, i.e., have no, or
little, effect on an antibody's ability to bind antigen. These
types of mutations can be useful to optimize codon usage, or to
improve hybridoma antibody production. Alternatively, non-neutral
missense mutations can alter an antibody's ability to bind antigen.
The location of most silent and neutral missense mutations is
likely to be in the framework regions, while the location of most
non-neutral missense mutations is likely to be in the CDRs,
although this is not an absolute requirement. One of skill in the
art is able to design and test mutant molecules with desired
properties, such as no alteration in antigen binding activity or
alteration in binding activity (e.g., improvements in antigen
binding activity or change in antibody specificity). Following
mutagenesis, the encoded protein may routinely be expressed and the
functional and/or biological activity of the encoded protein can be
determined using techniques described herein or by routinely
modifying techniques known and practiced in the art.
[0270] In a specific aspect, an antibody of the invention
(including a molecule comprising, or alternatively consisting of,
an antibody fragment or variant thereof), that immunospecifically
binds to the RAI-3 protein or to fragments or variants thereof,
comprises, or alternatively consists of, an amino acid sequence
encoded by a nucleotide sequence that hybridizes to a nucleotide
sequence that is complementary to that encoding one of the V.sub.H
or V.sub.L domains expressed by one or more anti-RAI-3 protein
antibody-expressing cell lines of the invention, preferably under
stringent conditions, e.g., hybridization to filter-bound DNA in
6.times. sodium chloride/sodium citrate (SSC) at about 45.degree.
C. followed by one or more washes in 0.2.times.SSC/0.1% SDS at
about 50-65.degree. C., preferably under highly stringent
conditions, e.g., hybridization to filter-bound nucleic acid in
6.times.SSC at about 45.degree. C. followed by one or more washes
in 0.1.times.SSC/0.2% SDS at about 68.degree. C., or under other
stringent hybridization conditions which are known to those of
skill in the art (see, for example, Ausubel, F. M. et al., eds.,
1989, Current Protocols in Molecular Biology, Vol. I, Green
Publishing Associates, Inc. and John Wiley & Sons, Inc., New
York at pages 6.3.1-6.3.6 and 2.10.3). Nucleic acid molecules
encoding these antibodies are also encompassed by the
invention.
[0271] It is well known within the art that polypeptides, or
fragments or variants thereof, with similar amino acid sequences
often have similar structures and many of the same biological
activities. Thus, in one aspect, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that immunospecifically binds to the RAI-3
polypeptide, or to RAI-3 peptide fragments or variants, comprises,
or alternatively consists of, a V.sub.H domain having an amino acid
sequence that is at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 99% identical to the amino acid sequence of a V.sub.H
domain of a heavy chain expressed by an anti-RAI-3 protein
antibody-expressing cell line of the invention.
[0272] In another aspect, an antibody (including a molecule
comprising, or alternatively consisting of, an antibody fragment or
variant thereof), that immunospecifically binds to the RAI-3
protein or to RAI-3 fragments or variants, comprises, or
alternatively consists of, a V.sub.L domain having an amino acid
sequence that is at least 35%, at least 40%, at least 45%, at least
50%, at least 55%, at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
or at least 99% identical to the amino acid sequence of a V.sub.L
domain of a light chain expressed by an anti-RAI-3 protein
antibody-expressing cell line of the invention.
[0273] The present invention also provides antibodies (including
molecules comprising, or alternatively consisting of, antibody
fragments or variants thereof), that down-regulate the cell-surface
expression of an RAI-3 protein, as determined by any method known
in the art such as, for example, FACS analysis or
immunofluorescence assays. By way of a non-limiting hypothesis,
such down-regulation may be the result of antibody induced
internalization of the RAI-3 protein. Such antibodies can comprise,
or alternatively consist of, a portion (e.g., V.sub.H CDR1, V.sub.H
CDR2, V.sub.H CDR3, V.sub.L CDR1, V.sub.L CDR2, or V.sub.L CDR3) of
a V.sub.H or V.sub.L domain having an amino acid sequence of an
antibody of the invention, or a fragment or variant thereof.
[0274] In another aspect, an antibody that down-regulates the
cell-surface expression of the RAI-3 protein comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a V.sub.H domain of an antibody of the invention, or a
fragment or variant thereof and a V.sub.L domain of an antibody of
the invention, or a fragment or variant thereof. In another aspect,
an antibody that down-regulates the cell-surface expression of the
RAI-3 protein comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a V.sub.H domain and
a V.sub.L domain from a single antibody (or scFv or Fab fragment)
of the invention, or fragments or variants thereof. In another
aspect, an antibody that down-regulates the cell-surface expression
of the RAI-3 protein comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a V.sub.H domain of
an antibody of the invention, or a fragment or variant thereof. In
another aspect, an antibody that down-regulates the cell-surface
expression of the RAI-3 protein comprises, or alternatively
consists of, a polypeptide having the amino acid sequence of a
V.sub.L domain of an antibody of the invention, or a fragment or
variant thereof.
[0275] In a preferred aspect, an antibody that down-regulates the
cell-surface expression of the RAI-3 protein comprises, or
alternatively consists of, a polypeptide having the amino acid
sequence of a V.sub.H CDR3 of an antibody of the invention, or a
fragment or variant thereof. In another preferred aspect, an
antibody that down-regulates the cell-surface expression of the
RAI-3 protein comprises, or alternatively consists of, a
polypeptide having the amino acid sequence of a V.sub.L CDR3 of an
antibody of the invention, or a fragment or variant thereof.
Nucleic acid molecules encoding these antibodies are also
encompassed by the invention.
[0276] In another preferred aspect, an antibody that enhances the
activity of the RAI-3 protein, or a fragment or variant thereof,
comprises, or alternatively consists of, a polypeptide having the
amino acid sequence of a V.sub.L CDR3 of an antibody of the
invention, or a fragment or variant thereof. Nucleic acid molecules
encoding these antibodies are also encompassed by the
invention.
[0277] In addition, as nonlimiting examples, anti-RAI-3 antibodies
as described herein can be used to purify, detect, and target the
RAI-3 polypeptide, including both in vitro and in vivo diagnostic,
detection, screening, and/or therapeutic methods. For example, the
antibodies can be used in immunoassays for qualitatively and
quantitatively measuring levels of the RAI-3 protein in biological
samples. (See, e.g., Harlow et al., Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, 2nd Ed. 1988, which is
incorporated by reference herein in its entirety). By way of
another nonlimiting example, anti-RAI-3 antibodies can be
administered to individuals as a form of passive immunization.
Alternatively, antibodies of the present invention can be used for
epitope mapping to identify the epitope(s) that are bound by one or
more antibodies. Epitopes identified in this way can, in turn, for
example, be used as vaccine candidates, i.e., to immunize an
individual to elicit antibodies against the naturally-occurring
forms of the RAI-3 protein.
[0278] As discussed in more detail below, anti-RAI-3 antibodies can
be used either alone or in combination with other compositions. The
antibodies can further be recombinantly fused to a heterologous
polypeptide at the N-or C-terminus, or chemically conjugated
(including covalent and non-covalent conjugations) to polypeptides
or other compositions. For example, antibodies of the present
invention can be recombinantly fused or conjugated to molecules
that are useful as labels in detection assays and to effector
molecules such as heterologous polypeptides, drugs, radionuclides,
or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO
89/12624; U.S. Pat. No. 5,314,995 and EP 396, 387.
[0279] The antibodies of the invention further include derivatives
that are modified, i.e., by the covalent attachment of any type of
molecule to the antibody. For example, without limitation,
anti-RAI-3 antibody derivatives include antibodies that have been
modified, e.g., by glycosylation, acetylation, pegylation,
phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a
cellular ligand or other protein, etc. Any of numerous chemical
modifications can be carried out by known techniques, including,
but not limited to, specific chemical cleavage, acetylation,
formylation, metabolic synthesis of tunicamycin, etc. In addition,
the derivative can contain one or more non-classical amino
acids.
[0280] Anti-RAI-3 antibodies of the present invention can be
generated by any suitable method known in the art. Polyclonal
antibodies directed against an antigen or immunogen of interest can
be produced by various procedures well known in the art. For
example, the RAI-3 protein or an RAI-3 peptide can be administered
to various host animals as elucidated above to induce the
production of sera containing polyclonal antibodies specific for
the antigen. Various adjuvants may be used to increase the
immunological response, depending on the host species; adjuvants
include, but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and corynebacterium parvum. Such
adjuvants are also well known in the art.
[0281] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art, including the use of hybridoma,
recombinant and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques as known and practiced in the art and as
taught, for example, in Harlow et al., Antibodies: A Laboratory
Manual, (Cold Spring Harbor Laboratory Press, 2nd Ed. 1988;
Hammerling, et al., In: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., pages 563-681, 1981, the contents of
which are incorporated herein by reference in their entireties. The
term "monoclonal antibody" as used herein is not limited to
antibodies produced through hybridoma technology. The term
"monoclonal antibody" refers to an antibody that is derived from a
single clone, including any eukaryotic, prokaryotic, or phage
clone, and not the method by which it is produced.
[0282] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art.
In a nonlimiting example, mice can be immunized with the RAI-3
polypeptide or a peptide thereof, or with a cell expressing the
RAI-3 polypeptide or peptide. Once an immune response is detected,
e.g., antibodies specific for the antigen are detected in the sera
of immunized mice, the spleen is harvested and splenocytes are
isolated. The splenocytes are then fused by well known techniques
to any suitable myeloma cells, for example cells from cell line
SP2/0 or P3.times.63-AG8.653 available from the ATCC. Hybridomas
are selected and cloned by limiting dilution techniques. The
hybridoma clones are then assayed by methods known in the art to
determine and select those cells that secrete antibodies capable of
binding to the RAI-3 protein, or to a portion of the RAI-3 protein.
Ascites fluid, which generally contains high levels of antibodies,
can be generated by immunizing mice with positive hybridoma
clones.
[0283] Another well known method for producing both polyclonal and
monoclonal human B cell lines is transformation using Epstein Barr
Virus (EBV). Protocols for generating EBV-transformed B cell lines
are commonly known in the art, such as, for example, the protocol
outlined in Chapter 7.22 of Current Protocols in Immunology,
Coligan et al., Eds., 1994, John Wiley & Sons, NY, which is
hereby incorporated by reference herein in its entirety. The source
of B cells for transformation is commonly human peripheral blood,
but B cells for transformation can also be obtained from other
sources including, but not limited to, lymph node, tonsil, spleen,
tumor tissue, and infected tissues. Tissues are generally prepared
as single cell suspensions prior to EBV transformation. In
addition, T cells that may be present in the B cell samples can be
either physically removed or inactivated (e.g., by treatment with
cyclosporin A). The removal of T cells is often advantageous,
because T cells from individuals who are seropositive for anti-EBV
antibodies can suppress B cell immortalization by EBV. In general,
a sample containing human B cells is innoculated with EBV and
cultured for 3-4 weeks. A typical source of EBV is the culture
supernatant of the B95-8 cell line (ATCC; VR-1492). Physical signs
of EBV transformation can generally be seen toward the end of the
3-4 week culture period.
[0284] By phase-contrast microscopy, transformed cells appear
large, clear and "hairy"; they tend to aggregate in tight clusters
of cells. Initially, EBV lines are generally polyclonal. However,
over prolonged periods of cell culture, EBV lines can become
monoclonal as a result of the selective outgrowth of particular B
cell clones. Alternatively, polyclonal EBV transformed lines can be
subcloned (e.g., by limiting dilution) or fused with a suitable
fusion partner and plated at limiting dilution to obtain monoclonal
B cell lines. Suitable fusion partners for EBV transformed cell
lines include mouse myeloma cell lines (e.g., SP2/0, X63-Ag8.653),
heteromyeloma cell lines (human.times.mouse; e.g., SPAM-8,
SBC-H.sub.2O, and CB-F7), and human cell lines (e.g., GM 1500,
SKO-007, RPMI 8226, and KR-4). Thus, the present invention also
includes a method of generating polyclonal or monoclonal human
antibodies against polypeptides of the invention or fragments
thereof, comprising EBV-transformation of human B cells.
[0285] Antibody fragments that recognize specific epitopes can be
generated by known techniques. For example, Fab and F(ab').sub.2
fragments of the invention can be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F (ab') 2 fragments).
F(ab').sub.2 fragments contain the variable region, the light chain
constant region and the CH1 domain of the heavy chain.
[0286] Antibodies encompassed by the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds to
the antigen of interest, i.e., the RAI-3 protein or fragment
thereof, can be selected or identified with antigen, e.g., using
labeled antigen or antigen bound or captured onto a solid surface
or bead. Phage used in these methods are typically filamentous
phage including fd and M13 binding domains expressed from phage
with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
Brinkman et al., 1995, J. Immunol. Methods, 182:41-50; Ames et al.,
1995, J. Immunol. Methods, 184:177-186; Kettleborough et al., 1994,
Eur. J. Immunol., 24:952-958; Persic et al., 1997, Gene, 187:9-18;
Burton et al., 1994, Advances in Immunology, 57:191-280; PCT
application No. PCT/GB91/01134; PCT publications WO 90/02809; WO
91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO
95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484;
5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108, each of
which is incorporated herein by reference in its entirety.
[0287] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below.
[0288] Examples of techniques that can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., 1991, Methods in
Enzymology, 203:46-88; Shu et al., 1993, Proc. Natl. Acad. Sci.
USA, 90:7995-7999; and Skerra et al., 1988, Science, 240:1038-1040.
For some uses, including the in vivo use of antibodies in humans
and in in vitro detection assays, it may be preferable to use
chimeric, humanized, or human antibodies. A chimeric antibody is a
molecule in which different portions of the antibody are derived
from different animal species, such as antibodies having a variable
region derived from a murine monoclonal antibody and a human
immunoglobulin constant region. Methods for producing chimeric
antibodies are known in the art. (See, e.g., Morrison, 1985,
Science, 229:1202; Oi et al., 1986, BioTechniques, 4:214; Gillies
et al., 1989, J. Immunol. Methods, 125:191-202; and U.S. Pat. Nos.
5,807,715; 4,816,567; and 4,816,397, which are incorporated herein
by reference in their entirety).
[0289] Humanized antibodies are antibody molecules from non-human
species antibody that bind to the desired antigen and have one or
more complementarity determining regions (CDRs) from the nonhuman
species and framework regions from a human immunoglobulin molecule.
Often, framework residues in the human framework regions are
substituted with the corresponding residues from the CDR donor
antibody to alter, and preferably to improve, antigen binding.
These framework substitutions are identified by methods well known
in the art, e.g., by modeling of the interactions of the CDR and
framework residues to identify framework residues important for
antigen binding, and by sequence comparison to identify unusual
framework residues at particular positions. (See, e.g., Queen et
al., U.S. Pat. No. 5,585,089; and Riechmann et al., 1988, Nature,
332:323, which are incorporated herein by reference in their
entireties). Antibodies can be humanized using a variety of
techniques known in the art, including, for example, CDR-grafting
(EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539;
5,530,101; and 5,585,089); veneering or resurfacing (EP 592,106; EP
519,596; Padlan, 1991, Molecular Immunology, 28(4/5):489-498;
Studnicka et al., 1994, Protein Engineering, 7(6):805-814; Roguska
et al., 1994, Proc. Natl. Acad. Sci. USA, 91:969-973; and chain
shuffling (U.S. Pat. No. 5,565,332).
[0290] Completely human antibodies can be made by a variety of
methods known in the art, including the phage display methods
described above, using antibody libraries derived from human
immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and
4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO
98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741;
each of which is incorporated herein by reference in its entirety.
Completely human antibodies are particularly desirable for
therapeutic treatment of human patients, so as to avoid or
alleviate immune reaction to foreign protein.
[0291] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes can be introduced randomly, or by homologous
recombination, into mouse embryonic stem cells. Alternatively, the
human variable region, constant region, and diversity region may be
introduced into mouse embryonic stem cells, in addition to the
human heavy and light chain genes. The mouse heavy and light chain
immunoglobulin genes can be rendered nonfunctional separately or
simultaneously with the introduction of human immunoglobulin loci
by homologous recombination. In particular, homozygous deletion of
the J.sub.H region prevents endogenous antibody production. The
modified embryonic stem cells are expanded and microinjected into
blastocysts to produce chimeric mice. The chimeric mice are then
bred to produce homozygous offspring which express human
antibodies. The transgenic mice are immunized in the normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of
the invention.
[0292] Monoclonal antibodies directed against the antigen can be
obtained from the immunized transgenic mice using conventional
hybridoma technology. The human immunoglobulin transgenes harbored
by the transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce useful human IgG,
IgA, IgM and IgE antibodies. For an overview of the technology for
producing human antibodies, see Lonberg and Huszar, 1995, Intl.
Rev. Immunol., 13:65-93. For a detailed discussion of the
technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO
96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318;
5,885,793; 5,916,771; 5,939,598; 6,075,181; and 6,114,598, which
are incorporated by reference herein in their entirety. In
addition, companies such as Abgenix, Inc. (Fremont, Calif.) and
Genpharm (San Jose, Calif.) can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to the above described technologies.
[0293] In another aspect, completely human antibodies which
recognize a selected epitope can be generated using a technique
referred to as "guided selection". In this approach, a selected
non-human monoclonal antibody, e.g., a mouse antibody, is used to
guide the selection of a completely human antibody recognizing the
same epitope. (Jespers et al., 1988, BioTechnology,
12:899-903).
[0294] Further, antibodies specific for the RAI-3 protein can, in
turn, be utilized to generate anti-idiotypic antibodies that
"mimic" the RAI-3 protein using techniques well known to those
skilled in the art. (See, e.g., Greenspan and Bona, 1989, FASEB J.,
7(5):437-444 and Nissinoff, 1991, J. Immunol., 147(8):2429-2438).
For example, antibodies which bind to and competitively inhibit
polypeptide multimerization and/or binding of the RAI-3 polypeptide
to a ligand can be used to generate anti-idiotypic antibodies that
"mimic" the polypeptide multimerization and/or binding domain and,
as a consequence, bind to and neutralize the polypeptide and/or its
ligand, e.g., in therapeutic regimens. Such neutralizing
anti-idiotypes or Fab fragments of such anti-idiotypes can be used
to neutralize polypeptide ligand. For example, such anti-idiotypic
antibodies can be used to bind the RAI-3 polypeptide and/or to bind
its ligands/receptors, and thereby activate or block its biological
activity.
[0295] In another aspect, intrabodies are embraced. Intrabodies are
antibodies, often scFvs, that are expressed from a recombinant
nucleic acid molecule and are engineered to be retained
intracellularly (e.g., retained in the cytoplasm, endoplasmic
reticulum, or periplasm of the host cells). Intrabodies can be
used, for example, to ablate the function of a protein to which the
intrabody binds. The expression of intrabodies can also be
regulated through the use of inducible promoters in the nucleic
acid expression vector comprising nucleic acid encoding the
intrabody. Intrabodies of the invention can be produced using
methods known in the art, such as those disclosed and reviewed in
Chen et al., 1994, Hum. Gene Ther., 5:595-601; Marasco, W. A.,
1997, Gene Ther., 4:11-15; Rondon and Marasco, 1997, Annu. Rev.
Microbiol., 51:257-283; Proba et al., 1998, J. Mol. Biol.,
275:245-253; Cohen et al., 1998, Oncogene, 17:2445-2456; Ohage and
Steipe, 1999, J. Mol. Biol., 291:1119-1128; Ohage et al., 1999, J.
Mol. Biol., 291:1129-1134; Wirtz and Steipe, 1999, Protein Sci.,
8:2245-2250; Zhu et al., 1999, J. Immunol. Methods,
231:207-222.
[0296] XenoMouse Technology Antibodies in accordance with the
invention are preferably prepared by the utilization of a
transgenic mouse that has a substantial portion of the human
antibody producing genome inserted, but that is rendered deficient
in the production of endogenous murine antibodies (e.g., XenoMouse
strains available from Abgenix Inc., Fremont, Calif.). Such mice
are capable of producing human immunoglobulin molecules and
antibodies and are virtually deficient in the production of murine
immunoglobulin molecules and antibodies. Technologies utilized for
achieving the same are disclosed in the patents, applications, and
references disclosed herein.
[0297] The ability to clone and reconstruct megabase-sized human
loci in YACs and to introduce them into the mouse germline provides
a powerful approach to elucidating the functional components of
very large or crudely mapped loci, as well as generating useful
models of human disease. Furthermore, the utilization of such
technology for substitution of mouse loci with their human
equivalents can provide unique insights into the expression and
regulation of human gene products during development, their
communication with other systems, and their involvement in disease
induction and progression. An important practical application of
such a strategy is the "humanization" of the mouse humoral immune
system. Introduction of human immunoglobulin (Ig) loci into mice in
which the endogenous Ig genes have been inactivated offers the
opportunity to study the mechanisms underlying programmed
expression and assembly of antibodies, as well as their role in B
cell development. Furthermore, such a strategy can provide an ideal
source for the production of fully human monoclonal antibodies (Hu
MAbs) an important milestone toward fulfilling the promise of
antibody therapy in human disease.
[0298] Fully human antibodies are expected to minimize the
immunogenic and allergic responses intrinsic to mouse or
mouse-derivatized monoclonal antibodies and thus to increase the
efficacy and safety of the administered antibodies. The use of
fully human antibodies can be expected to provide a substantial
advantage in the treatment of chronic and recurring human diseases,
such as cancer, which require repeated antibody
administrations.
[0299] One approach toward the goal of producing fully human
antibodies was to engineer mouse strains deficient in mouse
antibody production to harbor large fragments of the human Ig loci
in anticipation that such mice would produce a large repertoire of
human antibodies in the absence of mouse antibodies. Large human Ig
fragments would preserve the large variable gene diversity as well
as the proper regulation of antibody production and expression. By
exploiting the mouse machinery for antibody diversification and
selection and the lack of immunological tolerance to human
proteins, the reproduced human antibody repertoire in these mouse
strains should yield high affinity antibodies against any antigen
of interest, including human antigens. Using the hybridoma
technology, antigen-specific human monoclonal antibodies with the
desired specificity could be readily produced and selected.
[0300] This general strategy was demonstrated in connection with
the generation of the first "XenoMouseT" strains as published in
1994. See Green et al., 1994, Nature Genetics, 7:13-21. The
XenoMouse strains were engineered with yeast artificial chromosomes
(YACS) containing 245 kb and 10 190 kb-sized germline configuration
fragments of the human heavy chain locus and kappa light chain
locus, respectively, which contained core variable and constant
region sequences. Id. The human Ig containing YACs proved to be
compatible with the mouse system for both rearrangement and
expression of antibodies and were capable of substituting for the
inactivated mouse Ig genes. This was demonstrated by their ability
to induce B-cell development, to produce an adult-like human
repertoire of fully human antibodies, and to generate
antigen-specific human monoclonal antibodies. These results also
suggested that introduction of larger portions of the human Ig loci
containing greater numbers of V genes, additional regulatory
elements, and human Ig constant regions might recapitulate
substantially the full repertoire that is characteristic of the
human humoral response to infection and immunization. The work of
Green et al. was recently extended to the introduction of greater
than approximately 80% of the human antibody repertoire through the
use of megabase-sized, germline configuration YAC fragments of the
human heavy chain loci and kappa light chain loci, respectively, to
produce XenoMouse mice. See Mendez et al., 1997, Nature Genetics,
15:146-156; Green and Jakobovits, 1998, J. Exp. Med., 188:483-495;
and Green, 1999, Journal of Immunological Methods, 231:11-23, the
disclosures of which are hereby incorporated herein by
reference.
[0301] Human anti-mouse antibody (HAMA) responses have led the
industry to prepare chimeric or otherwise humanized antibodies.
While chimeric antibodies typically are comprised of a human
constant region and a murine variable region, it is expected that
certain human anti-chimeric antibody (HACA) responses will be
observed, particularly in treatments involving chronic or
multi-dose utilizations of the antibody. Thus, it is desirable to
provide fully human antibodies against the RAI-3 protein or
peptides in order to vitiate concerns and/or effects of HAMA or
HACA responses.
[0302] Polypeptide antibodies of the invention can be chemically
synthesized or produced through the use of recombinant expression
systems. Accordingly, the invention further embraces
polynucleotides comprising a nucleotide sequence encoding an
antibody of the invention and fragments thereof. The invention also
encompasses polynucleotides that hybridize under stringent or lower
stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, an antibody
that specifically binds to the RAI-3 polypeptide having the amino
acid sequence of SEQ ID NO:3.
[0303] Polynucleotides can be obtained, and the nucleotide sequence
of the polynucleotides determined, by any method known in the art.
For example, if the nucleotide sequence of the antibody is known, a
polynucleotide encoding the antibody can be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al., 1994, BioTechniques, 17:242), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, the annealing and
ligating of those oligonucleotides, and then the amplification of
the ligated oligonucleotides by PCR.
[0304] Alternatively, a polynucleotide encoding an antibody can be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin can be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, (or a nucleic acid,
preferably poly A+ RNA, isolated from), any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence. Alternatively, cloning using an oligonucleotide probe
specific for the particular gene sequence to identify, e.g., a cDNA
clone from a cDNA library that encodes the antibody can be
employed. Amplified nucleic acids generated by PCR can then be
cloned into replicable cloning vectors using any method well known
in the art.
[0305] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody are determined, the nucleotide sequence of
the antibody can be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook et al., 1990, Molecular
Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.; and Ausubel et al., eds.,
1998, Current Protocols in Molecular Biology, John Wiley &
Sons, NY, which are both incorporated by reference herein in their
entireties), to generate antibodies having a different amino acid
sequence, for example, to create amino acid substitutions,
deletions, and/or insertions.
[0306] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains can be inspected to
identify the sequences of the CDRs by methods that are well known
in the art, e.g., by comparison to known amino acid sequences of
other heavy and light chain variable regions, to determine the
regions of sequence hypervariability. Using routine recombinant DNA
techniques, one or more of the CDRs can be inserted within
framework regions, e.g., into human framework regions, to humanize
a non-human antibody, as described supra. The framework regions can
be naturally occurring or consensus framework regions, and
preferably, are human framework regions (see, e.g., Chothia et al.,
1998, J. Mol. Biol., 278:457-479 for a listing of human framework
regions).
[0307] Preferably, the polynucleotide generated by the combination
of the framework regions and CDRs encodes an antibody that
specifically binds to the RAI-3 protein. Also preferably, as
discussed supra, one or more amino acid substitutions can be made
within the framework regions; such amino acid substitutions are
performed with the goal of improving binding of the antibody to its
antigen. In addition, such methods can be used to make amino acid
substitutions or deletions of one or more variable region cysteine
residues participating in an intrachain disulfide bond to generate
antibody molecules lacking one or more intrachain disulfide bonds.
Other alterations to the polynucleotide are encompassed by the
present invention and are within the skill of the art.
[0308] For some uses, such as for in vitro affinity maturation of
an anti-RAI-3 protein antibody of the invention, it is useful to
express the V.sub.H and V.sub.L domains of the Ig heavy and light
chains of one or more antibodies of the invention as single chain
antibodies, or Fab fragments, in a phage display library using
phage display methods as described supra. For example, the cDNAs
encoding the V.sub.H and V.sub.L domains of one or more antibodies
of the invention can be expressed in all possible combinations
using a phage display library, thereby allowing for the selection
of V.sub.H/V.sub.L combinations that bind to the RAI-3 protein or
peptides thereof with preferred binding characteristics such as
improved affinity or improved off rates. In addition, V.sub.H and
V.sub.L segments, particularly, the CDR regions of the V.sub.H and
V.sub.L domains of one or more antibodies of the invention, can be
mutated in vitro. Expression of V.sub.H and V.sub.L domains with
"mutant" CDRs in a phage display library allows for the selection
of V.sub.H/V.sub.L combinations that bind to the RAI-3 protein,
which is a receptor polypeptide, with preferred binding
characteristics such as improved affinity or improved off
rates.
[0309] In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding the V.sub.H and V.sub.L domains are amplified
from animal cDNA libraries (e.g., human or murine cDNA libraries of
lymphoid tissues) or from synthetic cDNA libraries. The DNA
encoding the V.sub.H and V.sub.L domains are joined together by an
scFv linker by PCR and cloned into a phagemid vector (e.g., p
CANTAB 6 or pComb 3 HSS). The vector is introduced into E. coli via
electroporation and the E. coli is infected with helper phage.
Phage used in these methods are typically filamentous phage,
including fd and M13, and the V.sub.H and V.sub.L domains are
usually recombinantly fused either to the phage gene III or gene
VIII. Phage expressing an antigen binding domain that binds to an
antigen of interest (i.e., the RAI-3 polypeptide or a fragment
thereof) can be selected or identified with antigen, e.g., using
labeled antigen or antigen bound or captured onto a solid surface
or bead.
[0310] Recombinant expression of an anti-RAI-3 protein antibody of
the invention, or a fragment, derivative, variant, or analog
thereof (e.g., a heavy or light chain of an antibody, or a single
chain antibody, of the invention) requires construction of an
expression vector containing a polynucleotide that encodes the
antibody. Once a polynucleotide encoding an anti-RAI-3 protein
antibody molecule, or a heavy or light chain of an antibody, or
portion thereof (preferably containing the heavy or light chain
variable domain), of the invention has been obtained, the vector
for the production of the antibody molecule can be produced by
recombinant DNA technology using techniques well known in the art.
Methods for preparing a protein by expressing a polynucleotide
encoding an antibody are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus embraces replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, or a heavy or light chain thereof, or a heavy or
light chain variable domain, operably linked to a promoter. Such
vectors can include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., PCT publication WO
86/05807; PCT publication WO 89/01036; and U.S. Pat. No. 5,122,464)
and the variable domain of the antibody can be cloned into such a
vector for expression of the entire heavy or light chain.
[0311] Methods of constructing expression vectors; types of
vectors; methods of transferring the expression vectors into host
cells and culturing the cells to produce antibodies; use of
selection markers and systems; and the like, involve conventional
techniques, and have been described above with respect to RAI-3
protein expression. Such methods and the like are equally
applicable for recombinant immunoglobulin protein expression and
the production of anti-RAI-3 antibodies.
[0312] As one of its aspects, the invention includes host cells
containing a polynucleotide encoding an anti-RAI-3 protein
antibody, or a heavy or light chain thereof, or a single chain
antibody of the invention, operably linked to a heterologous
promoter. In preferred aspects for the expression of double-chained
antibodies, vectors encoding both the heavy and light chains may be
co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as detailed below.
[0313] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, "The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning", Vol.
3. (Academic Press, New York, 1987). When a marker in the vector
system expressing an antibody is amplifiable, an increase in the
level of inhibitor present in the host cell culture increases the
number of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., 1983, Mol. Cell. Biol., 3:257).
[0314] Vectors which use glutamine synthase (GS) or DHFR as the
selectable markers can be amplified in the presence of the drugs
methionine sulphoximine or methotrexate, respectively. An advantage
of glutamine synthase based vectors is the availability of cell
lines (e.g., the murine myeloma cell line, NSO) which are glutamine
synthase negative. Glutamine synthase expression systems can also
function in glutamine synthase expressing cells (e.g. Chinese
Hamster Ovary (CHO) cells) by providing additional inhibitor to
prevent the functioning of the endogenous gene.
[0315] Vectors that express glutamine synthase as the selectable
marker include, but are not limited to, the pEE6 expression vector
described in Stephens and Cockett, 1989, Nucl. Acids. Res.,
17:7110. A glutamine synthase expression system and components
thereof are detailed in PCT publications: WO87/04462; WO86/05807;
WO89/01036; WO89/10404; and WO91/06657 which are incorporated by
reference herein in their entireties. In addition, glutamine
synthase expression vectors that can be used in accordance with the
present invention are commercially available from suppliers,
including, for example, Lonza Biologics, Inc. (Portsmouth, N.H.).
The expression and production of monoclonal antibodies using a GS
expression system in murine myeloma cells is described in
Bebbington et al., 1992, BioTechnology, 10:169 and in Biblia and
Robinson, 1995, Biotechnol. Prog., 11:1, which are incorporated by
reference herein in their entireties.
[0316] A host cell can be co-transfected with two expression
vectors of the invention, the first vector encoding an Ig heavy
chain derived polypeptide and the second vector encoding an Ig
light chain derived polypeptide. The two vectors can contain
identical selectable markers which enable equal expression of heavy
and light chain polypeptides. Alternatively, a single vector can be
used which encodes, and is capable of expressing, both the Ig heavy
and light chain polypeptides. In such situations, the light chain
should be placed before the heavy chain to avoid an excess of toxic
free heavy chain (Proudfoot, 1986, Nature, 322:52; Kohler, 1980,
Proc. Natl. Acad. Sci. USA, 77:2197). The coding sequences for the
heavy and light chains can comprise cDNA or genomic DNA.
[0317] Once an anti-RAI-3 antibody molecule of the invention has
been produced by an animal, chemically synthesized, or
recombinantly expressed, it can be purified by any method known in
the art for the purification of an immunoglobulin or polypeptide
molecule, for example, by chromatography (e.g., ion exchange,
affinity, particularly by affinity for the specific antigen,
Protein A, and sizing column chromatography), centrifugation,
differential solubility, or by any other standard technique for the
purification of proteins. In addition, the antibodies of the
present invention or fragments thereof can be fused to heterologous
polypeptide sequences described herein or otherwise known in the
art, to facilitate purification.
[0318] The present invention encompasses antibodies that are
recombinantly fused or chemically conjugated (including both
covalently and non-covalently conjugated) to a polypeptide (or
portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70,
80, 90 or 100 amino acids of the polypeptide) of the present
invention to generate fusion proteins. The fusion does not
necessarily need to be direct, but can occur through linker
sequences. The antibodies can be specific for RAI-3 antigens (or
portions thereof, preferably at least 10, 20, 30, 40, 50, 60, 70,
80, 90 or 100 amino acids of the polypeptide). For example,
antibodies can be used to target the RAI-3 polypeptide to
particular cell types, either in vitro or in vivo, by fusing or
conjugating RAI-3 to antibodies specific for particular cell
surface receptors.
[0319] RAI-3 or anti-RAI-3 antibodies of the present invention
(including fragments or variants thereof) can be fused to either
the N-terminal or C-terminal end of a heterologous protein (e.g.,
immunoglobulin Fc polypeptide or human serum albumin polypeptide).
Antibodies of the invention can also be fused to albumin
(including, but not limited to, recombinant human serum albumin
(see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999; EP Patent
0 413 622; and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998,
incorporated herein by reference in their entirety), resulting in
chimeric polypeptides. In a preferred aspect, polypeptides and/or
antibodies of the present invention (including fragments or
variants thereof) are fused with the mature form of human serum
albumin (i.e., amino acids 1-585 of human serum albumin as shown in
FIGS. 1 and 2 of EP Patent 0 322 094, which is herein incorporated
by reference in its entirety). In another preferred aspect,
polypeptides and/or antibodies of the present invention (including
fragments or variants thereof) are fused with polypeptide fragments
comprising, or alternatively consisting of, amino acid residues 1-z
of human serum albumin, where z is an integer from 369 to 419, as
described in U.S. Pat. No. 5,766,883 incorporated herein by
reference in its entirety.
[0320] Polynucleotides encoding RAI-3 fusion proteins and
antibodies thereto are also encompassed by the invention. Such
fusion proteins can, for example, facilitate purification and can
increase half-life in vivo. Antibodies fused or conjugated to the
polypeptides of the present invention can also be used in in vitro
immunoassays and purification methods using methods known in the
art. See, e.g., Harbor et al., supra, and PCT publication WO
93/21232; EP 439, 095; Naramura et al., 1994, Immunol. Lett.,
39:91-99; U.S. Pat. No. 5,474,981; Gillies et al., 1992, Proc.
Natl. Acad. Sci. USA, 89:1428-1432; Fell et al., 1991, J. Immunol.,
146:2446-2452, which are incorporated by reference herein in their
entireties. For guidance, chimeric proteins having the first two
domains of the human CD4 polypeptide and various domains of the
constant regions of the heavy or light chains of mammalian
immunoglobulins have been described. (EP 394,827; Traunecker et
al., 1988, Nature, 331:84-86). RAI-3 polypeptide or peptide fused
or conjugated to an antibody, or portion thereof, having
disulfide-linked dimeric structures (due to the IgG), for example,
can also be more efficient in binding and neutralizing other
molecules, than the monomeric secreted protein or protein fragment
alone. (Fountoulakis et al., 1995, J. Biochem., 270:3958-3964).
[0321] The present invention further includes compositions
comprising the RAI-3 polypeptide or peptides thereof fused or
conjugated to antibody domains other than the variable region
domain. For example, the polypeptides of the present invention can
be fused or conjugated to an antibody Fc region, or portion
thereof. The antibody portion fused to a polypeptide of the present
invention can comprise the constant region, hinge region, CH1
domain, CH2 domain, CH3 domain, or any combination of whole domains
or portions thereof. The polypeptides can also be fused or
conjugated to the above antibody portions to form multimers. For
example, Fc portions fused to the polypeptides of the present
invention can form dimers through disulfide bonding between the Fc
portions. Higher multimeric forms can be made by fusing the
polypeptides to portions of IgA and IgM. Methods for fusing or
conjugating polypeptides to antibody portions are known in the art.
(See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929; 5,359,046;
5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT
publications WO 96/04388; WO 91/06570; Ashkenazi et al., 1991,
Proc. Natl. Acad. Sci. USA, 88:10535-10539; Zheng et al., 1995, J.
Immunol., 154:5590-5600; and Vil et al., Proc. Natl. Acad. Sci.
USA, 89:11337-11341, which are hereby incorporated by reference
herein in their entireties).
[0322] In many cases, the Fc portion in a fusion protein is
beneficial in therapy, diagnosis, and/or screening methods, and
thus can result in, for example, improved pharmacokinetic
properties. (EP A 232, 262). In drug discovery, for example, human
proteins, such as hIL-5, have been fused with Fc portions for the
purpose of high-throughput screening assays to identify antagonists
of hIL-5. (See, Bennett et al., 1995, J. Molecular Recognition,
8:52-58; and Johanson et al., 1995, J. Biol. Chem., 270:9459-9471).
Alternatively, deleting the Fc portion after the fusion protein has
been expressed, detected, and purified, may be desired. For
example, the Fc portion may hinder therapy and diagnosis if the
fusion protein is used as an antigen for immunizations.
[0323] Moreover, according to this invention, anti-RAI-3 antibodies
or fragments thereof can be fused to marker sequences, such as a
peptide, to facilitate their purification. In preferred
embodiments, the marker amino acid sequence is a hexa-histidine
peptide, such as the tag provided in a pQE vector (QIAGEN, Inc.,
Chatsworth, Calif.), among others, many of which are commercially
available. As described in Gentz et al., 1989, Proc. Natl. Acad.
Sci. USA, 86:821-824, for instance, hexa histidine provides for
convenient purification of the fusion protein. Other peptide tags
useful for purification include, but are not limited to, the "HA"
tag and the Flag tag, as previously described herein.
[0324] The present invention further encompasses antibodies or
fragments thereof conjugated to a diagnostic or therapeutic agent.
The antibodies can be used diagnostically, for example, to monitor
the development or progression of a tumor as part of a clinical
testing procedure, or to determine the efficacy of a given
treatment regimen. Detection can be facilitated by coupling the
antibody to a detectable substance. Nonlimiting examples of
detectable substances include various enzymes, prosthetic groups,
fluorescent materials, luminescent materials, bioluminescent
materials, radioactive materials, positron emitting metals using
various positron emission tomographies, and nonradioactive
paramagnetic metal ions. The detectable substance can be coupled or
conjugated either directly to the antibody (or fragment thereof) or
indirectly, through an intermediate (such as, for example, a linker
as known in the art) using techniques known in the art. (See, for
example, U.S. Pat. No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the
present invention).
[0325] Nonlimiting examples of suitable detectable enzymes include
horseradish peroxidase, alkaline phosphatase, beta-galactosidase,
or acetylcholinesterase; Nonlimiting examples of suitable
prosthetic group complexes include streptavidin/biotin and
avidin/biotin; nonlimiting examples of suitable fluorescent
materials include umbelliferone, fluorescein, fluorescein
isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl chloride or phycoerythrin; a nonlimiting example of a
luminescent material includes luminol; nonlimiting examples of
bioluminescent materials include luciferase, luciferin, and
aequorin; and nonlimiting examples of suitable radioactive material
include iodine (.sup.125I, .sup.131I), carbon (.sup.14C), sulfur
(3sus), tritium (.sup.3H), indium (.sup.111In and other radioactive
isotopes of inidium), technetium (.sup.99Tc, .sup.99mTc), thallium
(20Ti), gallium (.sup.68Ga, .sup.67Ga), palladium (.sup.103Pd),
molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.19F),
.sup.153Sm, .sup.177Lu, radioactive Gd, radioactive Pm, radioactive
La, radioactive Yb, .sup.166Ho, .sup.90Y, radioactive Sc,
radioactive Re, radioactive Re, .sup.142Pr, .sup.105Rh, and
.sup.97Ru.
[0326] In specific aspects, the RAI-3 protein or a peptide portion
thereof is attached to macrocyclic chelators useful for conjugating
radiometal ions, including, but not limited to, .sup.111In,
.sup.177Lu, .sup.90Y, .sup.166Ho, and .sup.153Sm, to polypeptides.
In a preferred aspect, the radiometal ion associated with the
macrocyclic chelators attached to the RAI-3 protein or peptide is
.sup.111In. In another preferred aspect, the radiometal ion
associated with the macrocyclic chelator attached to the RAI-3
protein or peptide is .sup.90Y. In specific aspects, the
macrocyclic chelator is 1, 4, 7,
10-tetraazacyclododecane-N,N',N",N'"-tet- raacetic acid (DOTA). In
other specific aspects, the DOTA is attached to the RAI-3 protein
or peptide via a linker molecule.
[0327] Examples of linker molecules useful for conjugating DOTA to
a polypeptide are commonly known in the art. (See, for example,
DeNardo et al., 1998, Clin. Cancer Res., 4(10):2483-90; Peterson et
al., 1999, Bioconjug. Chem., 10(4):553-557; and Zimmerman et al,
1999, Nucl. Med. Biol., 26(8):943-950, which are hereby
incorporated by reference in their entirety. In addition, U.S. Pat.
Nos. 5,652,361 and 5,756,065, which disclose chelating agents that
can be conjugated to antibodies and methods for making and using
them, are hereby incorporated by reference in their entireties.
Although U.S. Pat. Nos. 5,652,361 and 5,756,065 focus on
conjugating chelating agents to antibodies, one skilled in the art
can readily adapt the methods disclosed therein in order to
conjugate chelating agents to other polypeptides. Antibodies can
also be attached to solid supports, which are particularly useful
for immunoassays or purification of the target antigen. Such solid
supports include, but are not limited to, glass, cellulose,
polyacrylamide, nylon, polystyrene, polyvinyl chloride or
polypropylene.
[0328] Techniques for conjugating therapeutic moieties to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", In:
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56, Alan R. Liss, Inc., 1985; Hellstrom et al., "Antibodies
For Drug Delivery", In: Controlled Drug Delivery (2nd Ed.),
Robinson et al. (eds.), pp. 623-53, Marcel Deldcer, Inc., 1987;
Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", In: Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506, 1985; "Analysis,
Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Therapy", In: Monoclonal Antibodies
For Cancer Detection And Therapy, Baldwin et al. (eds.), pp.
303-316, Academic Press, 1985; and Thorpe et al., 1982, "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-158. Alternatively, an antibody can be
conjugated to a second antibody to form an antibody
heteroconjugate, e.g., as described in U.S. Pat. No. 4,676,980 to
Segal, which is incorporated herein by reference in its entirety.
An antibody, i.e., an antibody specific for RAI-3, with or without
a therapeutic moiety conjugated to it, and administered alone or in
combination with cytotoxic factor(s) and/or cytokine(s), can be
used as a therapeutic.
[0329] The antibodies of the invention can be utilized for
immunophenotyping of cell lines and biological samples. The
translation product of the RAI-3-encoding nucleic acid can be
useful as cell specific marker(s), or more specifically, as
cellular marker(s) that are differentially expressed at various
stages of differentiation and/or maturation of particular cell
types (e.g., in particular tissues). Monoclonal antibodies directed
against a specific epitope, or combination of epitopes, allow for
the screening of cellular populations expressing the marker.
Various techniques utilizing monoclonal antibodies can be employed
to screen for cellular populations expressing the marker(s),
including magnetic separation using antibody-coated magnetic beads,
"panning" with antibody(ies) attached to a solid matrix (i.e.,
tissue culture plate), and flow cytometry (See, e.g., U.S. Pat. No.
5,985,660; and Morrison et al., 1999, Cell, 96:737-749). The above
techniques allow for the screening of particular populations of
cells, such as might be found with cancers or malignancies (i.e.,
minimal residual disease (MRD), for example, in lung cancer
patients) and "non-self" cells in transplantations to prevent
graft-versus-host disease (GVHD).
[0330] Anti-RAI-3 antibodies according to this invention can be
assayed for immunospecific binding by any method known in the art.
The immunoassays which can be used include, but are not limited to,
competitive and non-competitive assay systems using techniques such
as BIAcore analysis, FACS (Fluorescence Activated Cell Sorter)
analysis, immunofluorescence, immunocytochemistry, Western blots,
radioimmunoassays, ELISA (enzyme linked immunosorbent assays),
"sandwich" immunoassays, immunoprecipitation assays, precipitin
reactions, gel diffusion precipitin reactions, immunodiffusion
assays, agglutination assays, complement fixation assays,
immunoradiometric assays, fluorescent immunoassays, protein A
immunoassays, to name but a few. Such assays are routine and well
known and practiced in the art (see, e.g., Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York, which is incorporated by reference
herein in its entirety). Nonlimiting, exemplary immunoassays are
described briefly below.
[0331] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (i.e., 1%
NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M
NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented
with protein phosphatase and/or protease inhibitors (e.g., EDTA,
PMSF, aprotinin, sodium vanadate); adding the antibody of interest
to the cell lysate; incubating for a period of time (e.g., 1 to 4
hours) at 4.degree. C.; adding protein A and/or protein G sepharose
beads to the cell lysate; incubating for about 60 minutes or more
at 4.degree. C.; washing the beads in lysis buffer; and
resuspending the beads in SDS/sample buffer. The ability of the
antibody of interest to immunoprecipitate a particular antigen can
be assessed by, for example, Western blot analysis. One of skill in
the art would be knowledgeable as to the parameters that can be
modified to increase the binding of the antibody to an antigen and
decrease the background (e.g., pre-clearing the cell lysate with
sepharose beads). For further discussion regarding
immunoprecipitation protocols, see, e.g., Ausubel et al, eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley &
Sons, Inc., New York, at 10.16.1.
[0332] Western blot analysis generally comprises preparing protein
samples; electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS PAGE depending on the molecular weight of the
antigen); transferring the protein sample from the polyacrylamide
gel to a solid support membrane such as nitrocellulose, PVDF or
nylon; blocking the membrane in blocking solution (e.g., PBS with
3% BSA or nonfat milk); washing the membrane in washing buffer
(e.g., PBS-Tween 20); blocking the membrane with primary antibody
(the antibody of interest) diluted in blocking buffer; washing the
membrane in washing buffer; blocking the membrane with a secondary
antibody (which recognizes the primary antibody, e.g., an
anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive
molecule (e.g., .sup.32P or .sup.125I) diluted in blocking buffer;
washing the membrane in wash buffer; and detecting the presence of
the antigen. One of skill in the art would be knowledgeable as to
the parameters that can be modified to increase the signal detected
and to reduce the background noise. For further discussion
regarding Western blot protocols, see, e.g., Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York, at 10.8.1.
[0333] ELISAs comprise preparing antigen; coating the wells of a 96
well microtiter plate with antigen; adding to the wells the
antibody of interest conjugated to a detectable compound such as an
enzymatic substrate (e.g., horseradish peroxidase or alkaline
phosphatase); incubating for a period of time; and detecting the
presence of the antigen. In ELISAs, the antibody of interest does
not have to be conjugated to a detectable compound; instead, a
second antibody (which recognizes the antibody of interest)
conjugated to a detectable compound can be added to the wells.
Further, instead of coating the wells with antigen, the antibody
can be first coated onto the well. In this case, a second antibody
conjugated to a detectable compound can be added to the
antibody-coated wells following the addition of the antigen of
interest. One of skill in the art would be knowledgeable as to the
parameters that can be modified to increase the signal detected, as
well as other variations of ELISAs known in the art. For further
discussion regarding ELISAs, see, e.g., Ausubel et al, eds, 1994,
Current Protocols in Molecular Biology, Vol. 1, John Wiley &
Sons, Inc., New York, at 11.2.1.
[0334] The binding affinity of an antibody to an antigen and the
off-rate of an antibody-antigen interaction can be determined by
competitive binding assays. One example of a competitive binding
assay is a radioimmunoassay (RIA) involving the incubation of
labeled antigen (e.g., .sup.3H or .sup.125I), or a fragment or
variant thereof, with the antibody of interest in the presence of
increasing amounts of labeled antigen, and the detection of the
antibody bound to the labeled antigen. The affinity of the antibody
of interest for the RAI-3 protein and the binding off rates can be
determined from the data by Scatchard plot analysis. Competition
with a second antibody can also be determined using RIAs. In this
case, the RAI-3 protein is incubated with antibody of interest
conjugated to a labeled compound (e.g., a compound labeled with
.sup.3H or .sup.125I in the presence of increasing amounts of an
unlabeled second antibody. This kind of competitive assay between
two antibodies, can also be used to determine if two antibodies
bind to the same or to different epitopes of the same molecule.
[0335] In a preferred aspect, BIAcore kinetic analysis is used to
determine the binding on and off rates of antibodies (including
antibody fragments or variants thereof) to the RAI-3 protein, or
fragments of the RAI-3 protein. Kinetic analysis comprises
analyzing the binding and dissociation of antibodies from chips
with immobilized RAI-3 protein on the chip surface.
Methods of Diagnosis of COPD and COPD Related Disorders and
Diseases
[0336] The present invention also relates to methods and
compositions for the diagnosis of COPD or COPD related disorders,
diseases and conditions. Such methods comprise, for example,
measuring expression of the RAI-3 gene, or peptide-encoding
fragments thereof, in a patient sample, or detecting a mutation in
the gene in the genome of an individual suspected of exhibiting
COPD or COPD related dysfunction. RAI-3 nucleic acid molecules can
also be used as diagnostic hybridization probes, or as primers, for
diagnostic PCR analysis to identify RAI-3 gene mutations, allelic
variations, or regulatory defects, such as defects in the
expression of the gene, which can serve as indicators of
susceptibility to COPD, or a lack thereof. Such diagnostic PCR
analyses can be used to diagnose individuals with COPD associated
mutation, allelic variation, or regulatory defects in the RAI-3
gene.
Diagnosis and Prognosis of COPD and COPD Related Disorders
[0337] Methods of the invention for the diagnosis, screening and/or
prognosis of COPD and COPD related diseases, disorders and
conditions can utilize reagents such as the RAI-3 nucleic acid
molecule and sequences or antibodies directed against the RAI-3
protein or polypeptide, including peptide fragments thereof.
Specifically, such reagents can be used, for example, for: (1) the
detection of the presence of RAI-3 gene mutations, or the detection
of either over- or under-expression of RAI-3 gene mRNA relative to
the COPD state, or the qualitative or quantitative detection of
alternatively-spliced forms of RAI-3 transcripts which may
correlate with COPD or COPD related disorders or susceptibility to
such disorders; and (2) the detection of either an over- or an
under-abundance of the RAI-3 gene product relative to the COPD
state or the presence of a modified (e.g., less than full length)
RAI-3 gene product which correlates with COPD dysfunctional state
or a progression toward such a state. In addition, such RAI-3
reagents can be used in methods for the screening, diagnosis and/or
prognosis of non-COPD related diseases, disorders, and/or
conditions, as described further herein, that are associated, for
example, with NF-.kappa.B activation, with the activity or function
of component molecules of the NF-.kappa.B pathway, or with other
cell signaling molecules.
[0338] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic test kits comprising at least
one specific RAI-3 nucleic acid or anti-RAI-3 antibody reagent
described herein, which can be conveniently used, e.g., in clinical
or laboratory settings, to screen and diagnose patients exhibiting
COPD or COPD related conditions or symptoms related thereto, and to
screen and identify those individuals exhibiting a predisposition
or susceptibility to COPD or COPD related conditions.
[0339] For the detection of RAI-3 mutations, any nucleated cell can
be used as a starting source for genomic nucleic acid; however,
lung cells, e.g., epithelial airway cells, are preferred. For the
detection of RAI-3 transcripts or RAI-3 gene products, any cell
type or tissue in which the RAI-3 gene is expressed can be
employed.
Detection of RAI-3 Nucleic Acid Molecules
[0340] Mutations or polymorphisms within the RAI-3 gene can be
detected by utilizing a number of techniques. Nucleic acid from any
nucleated cell can be used as the starting point for such assay
techniques, and can be isolated according to standard nucleic acid
preparation procedures which are well known to those of skill in
the art.
[0341] Genomic DNA can be used in hybridization or amplification
assays of biological samples to detect abnormalities involving the
RAI-3 gene structure, including point mutations, insertions,
deletions and chromosomal rearrangements. Such assays can include,
but are not limited to, direct sequencing (C. Wong et al., 1987,
Nature, 330:384-386), single stranded conformational polymorphism
analyses (SSCP; M. Orita et al., 1989, Proc. Natl. Acad. Sci. USA,
86:2766-2770), heteroduplex analysis (T. J. Keen et al., 1991,
Genomics, 11:199-205; D. J. Perry and R. W. Carrell, 1992),
denaturing gradient gel electrophoresis (DGGE; R. M. Myers et al.,
1985, Nucl. Acids Res., 13:3131-3145), chemical mismatch cleavage
(R. G. Cotton et al., 1988, Proc. Natl. Acad. Sci. USA,
85:4397-4401) and oligonucleotide hybridization (R. B. Wallace et
al., 1981, Nucl. Acids Res., 9:879-894; R. J. Lipshutz et al.,
1995, Biotechniques, 19:442-447).
[0342] Diagnostic methods for the detection of RAI-3 gene-specific
nucleic acid molecules, in patient samples or other appropriate
cell sources, can involve the amplification of specific gene
sequences, e.g., by PCR, followed by the analysis of the amplified
molecules using techniques well known to those of skill in the art,
such as, for example, those listed above. Utilizing analysis
techniques such as these, the amplified sequences can be compared
to those that would be expected if the nucleic acid being amplified
contained only normal copies of the RAI-3 gene, in order to
determine whether a RAI-3 gene mutation exists, for example, a
mutation that correlates or associates with COPD, or susceptibility
to, COPD or related disorders and conditions.
[0343] Further, well-known genotyping techniques can be performed
to type polymorphisms that are in close proximity to mutations in
the RAI-3 gene itself. These polymorphisms can be used to identify
individuals in families likely to carry mutations. If a
polymorphism exhibits linkage disequilibrium with mutations in the
RAI-3 gene, it can also be used to identify individuals in the
general population who are likely to carry mutations. Polymorphisms
that can be used in this way include restriction fragment length
polymorphisms (RFLPs), which involve sequence variations in
restriction enzyme target sequences, single nucleotide
polymorphisms (SNPs), (e.g., Examples 5-8), and simple sequence
repeat polymorphisms (SSLPs). For example, U.S. Pat. No. 5,075,217
to Weber describes a DNA marker based on length polymorphisms in
blocks of (dC-dA)n-(dG-dT)n short tandem repeats. The average
separation of (dC-dA).sub.n-(dG-dT).sub.n blocks is estimated to be
30,000-60,000 bp. Markers which are so closely spaced exhibit a
high frequency co-inheritance, and are extremely useful in the
identification of genetic mutations, such as, for example,
mutations within the RAI-3 gene, and the diagnosis of diseases and
disorders related to RAI-3 mutations.
[0344] Also, U.S. Pat. No. 5,364,759 to Caskey et al. describes a
DNA profiling assay for detecting short tri- and tetra-nucleotide
repeat sequences. The process includes extracting the DNA of
interest, e.g., the RAI-3 gene, amplifying the extracted DNA, and
labeling the repeat sequences to form a genotypic map of an
individual's DNA. An RAI-3 probe can also be used to directly
identify restriction fragment polymorphisms (RFLPs) in an
individual's DNA (gene). Further, an RAI-3 probe, or primers
derived from the RAI-3 sequence, can be used to isolate genomic
clones such as YACs, BACs, PACs, cosmids, phage or plasmids. The
DNA contained in these clones can be screened for single nucleotide
polymorphisms (SNPs) or simple sequence length polymorphisms
(SSLPs) using standard hybridization or sequencing procedures.
[0345] Alternative diagnostic methods for the detection of RAI-3
gene-specific mutations or polymorphisms can include hybridization
techniques which involve, for example, contacting and incubating
nucleic acids including recombinant DNA molecules, cloned genes, or
degenerate variants thereof, obtained from a sample, e.g., derived
from a patient sample or other appropriate cellular source, with
one or more labeled nucleic acid reagents, including RAI-3 nucleic
acid molecules, such as recombinant DNA molecules, cloned genes or
degenerate variants thereof, under conditions favorable for the
specific annealing of these reagents to their complementary
sequences within the RAI-3 gene. Preferably, the lengths of these
nucleic acid reagents are at least 15 to 30 nucleotides. After
incubation, all non-annealed nucleic acids are removed from the
nucleic acid:RAI-3 molecule hybrid. The presence of nucleic acids
which have hybridized, if any such molecules exist, is then
detected. Using such a detection scheme, the nucleic acid from the
cell type or tissue of interest can be immobilized, for example, to
a solid support such as a membrane, or a plastic surface such as
that on a microtiter plate or polystyrene beads. In this case,
after incubation, non-annealed, labeled RAI-3 nucleic acid
molecules are easily removed. Detection of the remaining annealed
and labeled RAI-3 nucleic acid reagents is accomplished using
standard techniques well-known to those in the art. The sequences
to which the RAI-3 nucleic acid molecules have annealed can be
compared to the annealing pattern expected from a normal RAI-3 gene
sequence in order to determine whether an RAI-3 gene mutation or
polymorphism is present.
[0346] Quantitative and qualitative aspects of RAI-3 gene
expression can also be assayed. For example, RNA from a cell type
or tissue known or suspected to express the RAI-3 gene can be
isolated and tested utilizing hybridization or PCR techniques as
described and known in the art. The isolated cells can be derived
from cell culture or from a patient. The analysis of cells taken
from culture may be a necessary step in the assessment of cells to
be used as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the expression of
the RAI-3 gene. Such analyses can reveal both quantitative and
qualitative aspects of the expression pattern of the RAI-3 gene,
including activation or inactivation of RAI-3 gene expression and
presence of alternatively spliced RAI-3 transcripts.
[0347] In one aspect of such a detection scheme, a cDNA molecule is
synthesized from an RNA molecule of interest (e.g., RAI-3, by
reverse transcription of the RNA molecule into cDNA). All or part
of the resulting cDNA is then used as the template for a nucleic
acid amplification reaction, such as a PCR amplification reaction,
or the like. The nucleic acid reagents used as synthesis initiation
reagents (e.g., primers) in the reverse transcription and nucleic
acid amplification steps of this method are chosen from the RAI-3
nucleic acid sequence. The preferred lengths of such nucleic acid
reagents are at least 9-30 nucleotides.
[0348] For detection of the amplified product, the nucleic acid
amplification can be performed using radioactively or
non-radioactively labeled nucleotides. Alternatively, enough
amplified product can be made so that the product can be visualized
by standard ethidium bromide staining or by utilizing any other
suitable nucleic acid staining protocol, or, for example,
quantitative PCR. Such RT-PCR techniques can be utilized to detect
differences in RAI-3 transcript size which may be due to normal or
abnormal alternative splicing. In addition, such techniques can be
utilized to detect quantitative differences between levels of full
length and/or alternatively-spliced RAI-3 transcripts detected in
normal individuals relative to those in individuals exhibiting COPD
or COPD related conditions or disorders, or exhibiting a
predisposition to COPD or COPD related disorders.
[0349] If detection of specific alternately-spliced species is
desired, appropriate primers and/or hybridization probes can be
used, such that, in the absence of such sequences, no amplification
would occur. Alternatively, primer pairs can be chosen utilizing
the RAI-3 nucleic acid sequence of SEQ ID NO:2 to choose primers
which will yield fragments of differing size depending on whether a
particular exon is present or absent from the RAI-3 transcript
being utilized.
[0350] As an alternative to amplification techniques, standard
Northern analyses can be performed if a sufficient quantity of the
appropriate cells can be obtained. Utilizing such techniques,
quantitative as well as size-related differences between RAI-3
transcripts can also be detected. In addition, it is possible to
perform RAI-3 gene expression assays in situ, i.e., directly upon
tissue sections (fixed and/or frozen) of patient tissue obtained
from biopsies or resections, such that no nucleic acid purification
is necessary. RAI-3 nucleic acid molecules can be used as probes
and/or primers for such in situ procedures (see, for example, G. J.
Nuovo, 1992, PCR In Situ Hybridization: Protocols And Applications,
Raven Press, NY).
Detection of RAI-3 Gene Product/RAI-3 Protein or Polypeptide
[0351] Antibodies directed against wild type or mutant RAI-3 gene
products, or conserved variants or peptide fragments thereof, as
described above, can also be used for the diagnosis and prognosis
of COPD or COPD related disorders. Such diagnostic methods can be
used to detect abnormalities in the level of RAI-3 gene expression
or abnormalities in the structure and/or temporal, tissue,
cellular, or subcellular location of RAI-3 gene products.
Antibodies, or fragments of antibodies, can be used to screen
potentially therapeutic compounds in vitro to determine their
effects on RAI-3 gene expression and RAI-3 peptide production. The
compounds which have beneficial effects on COPD and COPD related
disorders can be identified and a therapeutically effective dose
determined.
[0352] In vitro immunoassays can be used, for example, to assess
the efficacy of cell-based gene therapy for the treatment of COPD
and COPD related disorders. For example, antibodies directed
against RAI-3 peptides may be used in vitro to determine the level
of RAI-3 gene expression found in cells that have been genetically
engineered to produce RAI-3 peptides or protein. Such analysis
allows for a determination of the number of transformed cells
necessary to achieve therapeutic efficacy in vivo, as well as
optimization of the gene replacement protocol.
[0353] The tissue or cell type to be analyzed generally includes
those which are known, or suspected, to express the RAI-3 gene,
preferably lung cells or lung tissue cells. Protein isolation
methods employed can be those as described in Harlow, E. and Lane,
D., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., for example. The
isolated cells can be derived from cell culture or from a patient.
The analysis of cells taken from culture may be a necessary step in
the assessment of cells to be used as part of a cell-based gene
therapy technique or, alternatively, to test the effect of
compounds on the expression of the RAI-3 gene.
[0354] Preferred diagnostic methods for the detection of the RAI-3
gene products or conserved variants or peptide fragments thereof,
may involve, for example, immunoassays wherein the RAI-3 gene
product or conserved variants, including gene products which are
the result of alternatively-spliced transcripts, or peptide
fragments, are detected by their interaction with an
anti-RAI-3-specific antibody. For example, antibodies, or fragments
of antibodies, such as described above, can be used to detect both
quantitatively or qualitatively the presence of the RAI-3 gene
product or conserved variants or peptide fragments thereof. The
antibodies (or fragments thereof) can also be employed
histologically, for example, in immunofluorescence or
immunoelectron microscopy, for in situ detection of the RAI-3
protein or conserved variants or peptide fragments thereof. In situ
detection is carried out by removing a histological specimen from a
patient, and applying thereto a labeled RAI-3 antibody according to
this invention. The antibody (or antibody fragment) is preferably
applied by overlaying the labeled antibody (or fragment) onto a
biological sample. Through the use of such a procedure, it is
possible to determine not only the presence of the RAI-3 gene
product, or conserved variants or peptide fragments, but also its
distribution in the examined tissue. The skilled practitioner will
readily perceive that any of a wide variety of histological methods
(such as staining procedures) can be modified in order to achieve
such in situ detection.
[0355] Immunoassays for detecting RAI-3 or conserved variants or
peptide fragments thereof typically comprise incubating a sample,
such as a biological fluid, a tissue extract, freshly harvested
cells, or lysates of cells which have been incubated in cell
culture, in the presence of a detectably labeled antibody capable
of binding RAI-3 protein or conserved variants or peptide fragments
thereof, and detecting the bound antibody-RAI-3 complex by any of a
number of techniques well-known in the art.
[0356] The biological sample can be brought into contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, nylon membrane, PVDF membrane, or other solid
support that is capable of immobilizing cells, cell particles or
soluble proteins. The support can then be washed with suitable
buffers followed by treatment with the detectably labeled
anti-RAI-3 specific antibody. The solid phase support is washed
with the buffer a second time to remove unbound antibody. The
amount of bound label on the solid support is then detected by
conventional means.
[0357] A "solid phase support or carrier" refers to any support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble. The
support material can have virtually any possible structural
configuration so long as the coupled molecule is capable of binding
to an antigen or antibody. Thus, the support configuration can be
spherical, as in a bead, or cylindrical, as in the inside surface
of a test tube, or the external surface of a rod. Alternatively,
the surface can be flat such as a sheet, test strip, etc. Preferred
supports include polystyrene beads. Those skilled in the art will
know many other suitable carriers for binding antibody or antigen,
or will be able to ascertain the same by use of routine
experimentation.
[0358] The binding activity of an anti-RAI-3 antibody can be
determined according to well known methods. Those skilled in the
art will be able to determine operative and optimal assay
conditions for each determination by employing routine
experimentation. One of the ways in which an RAI-3-specific
antibody can be detectably labeled is by linking the antibody to an
enzyme in an enzyme linked immunoassay (ELISA) (A. Voller "The
Enzyme Linked Immunosorbent Assay (ELISA)", 1978, Diagnostic
Horizons 2:1-7, Microbiological Associates Quarterly Publication,
Walkersville, Md.); A. Voller et al., 1978, J. Clin. Pathol.,
31:507-520; J. E. Butler, 1981, Meth. Enzymol., 73:482-523; E.
Maggio (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton,
Fla.; E. Ishikawa et al., (eds.), 1981, Enzyme Immunoassay, Kgaku
Shoin, Tokyo). The enzyme which is bound to the antibody reacts
with an appropriate substrate, preferably a chromogenic substrate,
in such a manner as to produce a chemical moiety that can be
detected, for example, by spectrophotometric, fluorometric or
visual means. Examples of enzymes that can be used to detectably
label an antibody include, but are not limited to, malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase,
yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase,
triose phosphate isomerase, horseradish peroxidase, alkaline
phosphatase, asparaginase, glucose oxidase, beta-galactosidase,
ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase,
glucoamylase and acetylcholinesterase. The detection can be
accomplished by colorimetric methods which employ a chromogenic
substrate for the enzyme. Detection can also be accomplished by
visual comparison of the extent of enzymatic reaction of a
substrate compared with similarly prepared standards.
[0359] Detection can also be achieved using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect RAI-3
protein or peptides through the use of a radioimmunoassay (RIA)
(see, for example, B. Weintraub, Principles of Radioimmunoassays,
Seventh Training Course on Radioligand Assay Techniques, The
Endocrine Society, March, 1986. The radioactive isotope can be
detected by using a gamma counter or a scintillation counter or by
autoradiography.
[0360] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wavelength, its presence can then be detected
due to fluorescence (emission of light of a different wavelength).
Among the most commonly used fluorescent labeling compounds are
fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin,
allophycocyanin, o-phthaldehyde and fluorescamine. The antibody can
also be detectably labeled using fluorescence emitting metals such
as .sup.152Eu, or others of the lanthanide series. These metals can
be attached to the antibody using such metal chelating groups as
diethylenetriaminepentacetic acid (DTPA) or
ethylenediaminetetraacetic acid (EDTA).
[0361] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0362] Similarly, a bioluminescent compound can be used to label an
anti-RAI-3 antibody. Bioluminescence is a type of chemiluminescence
found in biological systems in which a catalytic protein increases
the efficiency of the chemiluminescent reaction. The presence of a
bioluminescent protein is determined by detecting the presence of
luminescence. Illustrative bioluminescent compounds for the
purposes of bioluminescent labeling include luciferin, luciferase
and aequorin.
Screening Assays for Determining Compounds that Modulate RAI-3 and
Compositions Related Thereto
[0363] Screening assays can be used to identify compounds that
modulate RAI-3 function or activity. Such compounds can include,
but are not limited to, peptides, small organic or inorganic
molecules or macromolecules such as nucleic acid molecules or
proteins, e.g., antibodies and antibody fragments, and can be
utilized, for example, in the control and/or treatment of COPD and
COPD related disorders, in the modulation of second messenger or
cellular molecules which are regulated or modulated by RAI-3, such
as I.kappa.B, and which may affect COPD and its related conditions
and disorders. These compounds may also be useful, e.g., in
elaborating the biological functions of the RAI-3 gene product,
i.e., the RAI-3 protein and its peptides, in modulating the RAI-3
biological functions and for preventing, treating, reducing, and/or
ameliorating symptoms and/or physiological characteristics and
effects of COPD or COPD related disorders.
[0364] The compositions of the invention include pharmaceutical
compositions comprising one or more of the RAI-3 modulator
compounds. Such pharmaceutical compositions can be formulated as
discussed hereinbelow. More specifically, these compounds can
include compounds that bind to RAI-3 and its peptide components,
compounds that bind to other proteins or molecules that interact
with an RAI-3 gene product and/or interfere with the interaction of
the RAI-3 gene product with other proteins or molecules, and
compounds that modulate the activity of the RAI-3 gene, i.e.,
modulate the level of RAI-3 gene expression and/or modulate the
level of the RAI-3 gene product or protein activity.
[0365] In a related aspect, assays can be utilized that identify
compounds that bind to RAI-3 gene regulatory sequences, e.g.,
promoter sequences (see e.g., K. A. Platt, 1994, J. Biol. Chem.,
269:28558-28562); such compounds may modulate the level of RAI-3
gene expression. In addition, functional assays can be used to
screen for compounds that modulate RAI-3 gene product activity. In
such assays, compounds are screened for agonistic or antagonistic
activity with respect to the biological activity or function of the
RAI-3 protein, polypeptide, or peptides, such as changes in the
intracellular levels or activity of a molecule with which RAI-3
interacts or which is regulated by RAI-3, changes in regulatory
factor release, or other activities or functions of the RAI-3
protein, polypeptide or peptides which are involved in causing or
maintaining COPD and COPD related disorders according to this
invention.
[0366] According to an embodiment of this invention, molecules that
are affected, regulated, modulated, or which otherwise interact
with RAI-3, particularly in cells affected by COPD, for example,
molecules of the NF-.kappa.B pathway and/or E-selectin molecules,
can be monitored or assayed in RAI-3-expressing host cells to
determine if modulators of RAI-3 (e.g., antagonists such as
antisense of RAI-3 as described further herein) affect the function
of component molecules in the pathway. In a particular aspect of
this embodiment, antisense to RAI-3 were used to evaluate the
outcome of I.kappa.B mRNA expression in A549 cells, as well as
E-selectin surface expression in human microvascular endothelial
cells (HMVECs). It was found that antisense to RAI-3 increased the
level of I.kappa.B mRNA in A549 cells and decreased TNF-.alpha.
induced E-selectin surface expression in HMVECs. (FIGS. 14A and 14B
and Examples 2 and 3).
[0367] With regard to the above findings, it has been shown that
the I.kappa.B promoter is driven by NF-.kappa.B and by an
NF-.kappa.B-independent arsenite/heat stress response (C. Y. Ito et
al., 1994, Nucleic Acids Res., 22:3787-3792; and H. R. Wong et al.,
1997, J. Clin. Invest., 99:2423-2428). In addition, the E-selectin
promoter has been shown to be activated by NF-.kappa.B; however,
elevated levels of cAMP can inhibit TNF-.alpha. stimulation of
E-selectin expression on endothelial cells (V Ollivier et al.,
1996, J. Biol. Chem., 271:20828-20835; and L. G. De Luca et al.,
1994, J. Biol. Chem., 269:19193-19196). Similarly, LPS stimulation
of TNF-.alpha. expression, a response that is also driven by
NF-.kappa.B has been shown to be inhibited by elevated cAMP in
RAW246.7 and THP-1 cells. (V Ollivier et al., 1996, J. Biol. Chem.,
271:20828-20835; and M Delgad et al., 1996, J. Biol. Chem.,
273:31427-31436). Stress induced by arsenite in PC12 cells has been
shown to stimulate ATF/CREB family members (cAMP-responsive
element-DNA binding proteins) to drive Gadd153 expression (T. W.
Fawcet et al., 1999, J. Biochem., 339:135-141). Taken together
these data suggest that antisense to RAI-3 could increase cAMP
pools that act to stimulate I.kappa.B expression, which, in turn,
can drive down NF-.kappa.B nuclear location. Under this scenario,
E-selectin expression would be decreased when RAI-3 is antagonized
(either by antisense or small molecules) as a consequence of a
decrease in NF-.kappa.B nuclear localization, as well as by
increasing the cAMP pools.
[0368] The ability of RAI-3 to regulate NF-.kappa.B functions in
RAI-3 expressing cells, endothelial cells and lung epithelial
cells, supports the view that antagonist and agonists to RAI-3
would have an impact on many diseases, including autoimmune
diseases, inflammation, asthma, COPD, rheumatoid arthritis (RA),
cancers, such as, but not limited to, lung cancer, stomach cancer,
breast cancer, testicular cancer, ovarian cancer, cervical cancer,
genitourinary tract cancer, bladder cancer, prostate cancer,
gastrointestinal cancer, colon cancer, esophageal cancer, head and
neck cancer, cancer of the brain, thyroid cancer, liver cancer,
pancreatic cancer, kidney cancer, etc., ischemia-reperfusion
injury, atherosclerosis, thrombosis, and other vascular diseases.
The results reported herein (Examples 2 and 3, FIGS. 14A and 14B)
support the view that antagonists to RAI-3 can down regulate
NF-.kappa.B-mediated functions, including reducing the expression
of genes that control endothelial cell adhesion events and cytokine
secretion (S. E. Meiler, 2002, J. Mol. Cell. Cardiol., 34:349-359;
S. Yoshimura et al., 2001, Gene Ther., 8:1635-1642; M. Morigi et
al., 1998, J. Clin. Investigation, 101:1905-1915; C. Sultana, 1998,
Blood, 92:3924-3935; and G. Voraberger et al., 1991, J. Immunol.,
147:2777-2786).
[0369] The impact of blocking the binding of leukocytes and
platelets to the endothelium is a reduction of inflammatory
responses on the vessel wall, as well as entry of leukocytes into
tissues involved in autoimmune diseases, sites of inflammation, and
in diseases such as COPD where foreign substances (i.e., smoke,
allergens, environmental pollutants, and pathogens) drive immune
cell recruitment and activation (D. J. Lefer, 2000, Ann. Rev.
Pharmacology and Toxicology, 40:283-294; M. P. Bevilacqua, 1994,
Ann. Rev. Med., 45:361-378; S. D. Rosen, 1993, Seminars Immunol.
5:237-247; A. J. Gearing and w. Newman, 1993, Immunol. Today,
14:506-512; and A. D. Blann and G. Y. Lip, 1997, Clin. Cardiol.,
20:822-824). Adhesion of metastatic cancer cells to endothelium is
also believed to contribute to the metastatic process; accordingly,
modulators such as antagonists to RAI-3 would be predicted to
reduce endothelium-cancer cell interactions. (B. R. Zetter, 1993,
Semin. Cancer Biol., 4:219-229; T. Krause, 1999, Clin. Exp.
Metastasis, 17:183-192).
[0370] The central role of NF-.kappa.B activation in bronchiolar
epithelium in coordinating airway inflammation has been
demonstrated in a number of mouse and cellular models where
chemokine, eotaxin, IL-8, MMP-9, and iNOS synthase expression are
enhanced leading to neutrophil and eosinophil infiltration and
tissue damage (M. E. Poynter, 2002, Am. J. Pathol., 160:1325-1334;
D-W. Jeong, 2002, J. Biol. Chem., 277:17871-17876; A. Hozumi et
al., 2001, Am. J. Physiol. Lung Cell Mol. Physiol.,
281:L1444-L1452; R. S. Smith et al., 2001, J. Immunol.,
167:366-374; R. W. Ganster et al., 2001, Proc. Natl. Acad. Sci.
USA, 98:8638-8643; and H. Takizawa, 1999, J. Immunol.,
162:4705-4711). In addition, NF-.kappa.B has been shown to regulate
aquaporin 5, a major water channel that is expressed in alveolar,
tracheal and upper bronchial epithelium, thereby contributing not
only to lung inflammation, but also to airway edema (J. E. Towne et
al., 2001, J. Biol. Chem., 276:18657-18664). Mucin production by
specialized epithelial cells has also been shown to be regulated by
NF-.kappa.B (Seuningen et al., 2001. Front. Biosci., 6:D1216-D1234;
and J.-D. Li et al., 1998, Proc. Natl. Acad. Sci. USA,
95:5718-5723). Thus, using antagonist or agonist modulators of
RAI-3 that target lung epithelial cells offers a novel utility as
therapeutics for many diseases of the lung.
[0371] According to another embodiment of this invention, screening
assays can be designed to identify compounds capable of binding to
the RAI-3 gene product or peptides thereof. Such compounds can be
useful, e.g., in modulating the activity of wild type and/or mutant
RAI-3, in elaborating the biological function of the RAI-3 gene
product, and in screens for identifying compounds that disrupt
normal RAI-3 gene product interactions. Alternatively, such
compounds may in themselves disrupt such interactions.
[0372] Screening assays to identify compounds that bind to RAI-3,
and/or its composite peptides can involve preparing a reaction
mixture of the RAI-3 protein or peptide and a test compound under
conditions and for a time sufficient to allow the two components to
interact with, i.e., bind to each other, and thus form a complex,
which can represent a transient complex that can be removed and/or
detected in the reaction mixture. For example, one type of assay
involves anchoring an RAI-3 polypeptide or peptide, or the test
substance, onto a solid phase and detecting the RAI-3 polypeptide
or peptide/test compound complexes anchored on the solid phase at
the end of the reaction. In one aspect of such a method, the RAI-3
polypeptide or peptide can be anchored onto a solid surface, and
the test compound, which is not anchored, can be labeled, either
directly or indirectly.
[0373] The detection of complexes anchored on the solid surface can
be accomplished in a number of ways. In cases in which the
previously non-immobilized component is pre-labeled, the detection
of label immobilized on the surface indicates that complexes were
formed. In cases in which the previously non-immobilized component
is not pre-labeled, an indirect label can be used to detect
complexes anchored on the surface; e.g., using a labeled antibody
specific for the previously non-immobilized component (the
antibody, in turn, can be directly labeled, or indirectly labeled
with a labeled anti-Ig antibody).
[0374] Alternatively, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted components,
and complexes detected, e.g., using an immobilized antibody
specific for the RAI-3 polypeptide or peptide, or the test
compound, to anchor any complexes formed in solution, and a labeled
antibody specific for the other component of the formed complex to
detect anchored complexes.
[0375] Compounds that modulate RAI-3 protein activity can also
include compounds that bind to proteins that interact with RAI-3.
These modulatory compounds can be identified by first identifying
those proteins, e.g., cellular proteins, that interact with the
RAI-3 protein product, e.g., by standard techniques known in the
art for detecting protein-protein interactions, such as
co-immunoprecipitation, cross-linking and co-purification through
gradients or chromatographic columns. Utilizing procedures such as
these allows for the isolation of proteins that interact with the
RAI-3 protein, polypeptide, or peptides.
[0376] Once isolated, such a protein can be identified and can, in
turn, be used, in conjunction with standard techniques, to identify
additional proteins with which that protein (and/or RAI-3)
interacts. For example, at least a portion of the amino acid
sequence of the protein that interacts with the RAI-3 gene product
can be ascertained using techniques well known to those of skill in
the art, such as via the Edman degradation technique (see, e.g.,
Creighton, 1983, Proteins: Structures and Molecular Principles,
W.H. Freeman & Co., N.Y., pp.34-49). The amino acid sequence
thus obtained can be used as a guide for the generation of
oligonucleotide mixtures that can, in turn, be used to screen for
gene sequences encoding the interacting proteins. Screening is
accomplished, for example, by standard hybridization or PCR
techniques. Techniques for the generation of oligonucleotide
mixtures and screening are well-known and practiced in the art
(see, e.g., F. M. Ausubel, supra, and PCR Protocols: A Guide to
Methods and Applications, 1990, M. Innis et al., eds. Academic
Press, Inc., New York).
[0377] In addition, methods can be employed that result in the
simultaneous identification of genes which encode proteins that
interact with the RAI-3 polypeptide. These methods include, for
example, probing expression libraries with labeled RAI-3 protein or
polypeptide, using RAI-3 protein or polypeptide in a manner similar
to the well known technique of antibody probing of .lambda.gt11
libraries. One method that detects protein interactions in vivo is
the two-hybrid system. A version of this system is described by
Chien et al., 1991, Proc. Natl. Acad. Sci. USA, 88:9578-9582 and is
commercially available from Clontech (Palo Alto, Calif.).
[0378] Compounds that disrupt the interaction of RAI-3 with other
molecules, or binding partners, as determined by techniques
exemplified above, can be useful in regulating the activity of the
RAI-3 protein, including mutant RAI-3 proteins. Such compounds can
include, but are not limited to, molecules such as peptides, and
the like, which bind to RAI-3 as described above. Illustrative
assay systems used to identify compounds that interfere with the
interaction between RAI-3 and its interacting molecule(s) involves
preparing a reaction mixture containing the RAI-3 protein or
peptide and the interacting molecule, under conditions and for a
time sufficient to allow the two to interact (and bind), thus
forming a complex. In order to test a compound for inhibitory
activity, the reaction mixture is prepared in the presence and
absence of the test compound. The test compound can be initially
included in the reaction mixture, or it can be added at a time
subsequent to the addition of RAI-3 and its interacting molecule.
Control reaction mixtures are incubated without the test compound
or with a placebo. Complexes formed between RAI-3 and the
interacting molecule(s) are then detected. The formation of a
complex in the control reaction, but not in the reaction mixture
containing the test compound, indicates that the compound
interferes with the interaction of RAI-3 and the interacting
molecule. Further, complex formation within reaction mixtures
containing the test compound and a normal RAI-3 protein or peptide
product can also be compared with complex formation within reaction
mixtures containing the test compound and a mutant RAI-3 protein or
peptide product. This comparison could be particularly useful in
those cases in which it is desirable to identify compounds that
disrupt interactions of mutant but not normal RAI-3 proteins.
[0379] Assaying for compounds that interfere with the interaction
of the RAI-3 protein or peptides and interacting (e.g., modulated
or regulated) molecules can be conducted in a heterogeneous or
homogeneous format. Heterogeneous assays involve anchoring either
RAI-3 or the binding molecule onto a solid phase and detecting
complexes anchored on the solid phase at the end of the reaction.
In homogeneous assays, the entire reaction is carried out in a
liquid phase. In either approach, the order of addition of the
reaction components can be varied to obtain different information
about the compounds being tested. For example, test compounds that
interfere with the interaction between RAI-3 and its interacting
molecules, e.g., by competition, can be identified by conducting
the reaction in the presence of the test substance; i.e., by adding
the test substance to the reaction mixture prior to, or
simultaneously with, RAI-3 and the interacting molecule.
Alternatively, test compounds that disrupt preformed complexes,
e.g., compounds with higher binding constants that displace one of
the components from the complex, can be tested by adding the test
compound to the reaction mixture after the complexes between RAI-3
and another molecule or molecules have been formed. The various
formats are described briefly below.
[0380] In a heterogeneous assay system, either RAI-3 or the
interacting molecule, is anchored onto a solid surface, while the
non-anchored molecule is labeled, either directly or indirectly. In
practice, microtiter plates are conveniently utilized. The anchored
species can be immobilized by non-covalent or covalent attachments.
Non-covalent attachment can be achieved simply by coating the solid
surface with a solution comprising RAI-3 or the interacting
molecule and drying the surface. Alternatively, an immobilized
antibody specific for the molecule to be anchored can be used to
anchor the species to the solid surface. The surfaces can be
prepared in advance and stored.
[0381] In order to conduct the assay, the partner of the
immobilized species is exposed to the coated surface with or
without the test compound. After the reaction is complete,
unreacted components are removed (e.g., by washing) and any
complexes formed remain immobilized on the solid surface. The
detection of complexes anchored on the solid surface is performed
in a number of ways. Where the non-immobilized species is
pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the non-immobilized
species is not pre-labeled, an indirect label can be used to detect
complexes anchored on the surface; e.g., using a labeled antibody
specific for the initially non-immobilized species (the antibody,
in turn, can be directly labeled or indirectly labeled with a
labeled anti-Ig antibody). Depending upon the order of adding the
reaction components, test compounds which inhibit complex
formation, or which disrupt preformed complexes, can be
detected.
[0382] Alternatively, the reaction can be conducted in a liquid
phase in the presence or absence of the test compound, the reaction
products separated from unreacted components, and complexes
detected; e.g., using an immobilized antibody specific for one of
the interacting components, to anchor any complexes formed in
solution, and a labeled antibody specific for the other partner to
detect anchored complexes. Again, depending upon the order of
addition of reaction components to the liquid phase, test compounds
that inhibit complex formation or that disrupt preformed complexes
can be identified.
[0383] In another aspect of such assays, a preformed complex of the
RAI-3 protein or peptide and an interacting molecule is prepared in
which either RAI-3 or its interacting partner molecule is labeled.
However, the signal generated by the label is quenched due to
complex formation between RAI-3 and the interacting molecule (see,
e.g., U.S. Pat. No. 4,109,496 to Rubenstein which utilizes this
approach for immunoassays). The addition of a test substance that
competes with and displaces one of the species from the preformed
complex will result in the generation of a signal above background.
In this way, test substances that disrupt RAI-3 protein/interacting
partner interactions can be identified.
[0384] Techniques as described above can be employed using RAI-3
peptide fragments that correspond to the binding domains of the
RAI-3 protein and/or the interacting partner, instead of one or
both of the full length proteins. Any number of methods routinely
practiced in the art can be used to identify and isolate the
binding sites. These methods include, but are not limited to,
mutagenesis of the gene encoding one of the proteins and screening
for disruption of binding in a co-immunoprecipitation assay.
Compensating mutations in the gene encoding the second species in
the complex can then be selected. Sequence analysis of the genes
encoding the respective proteins will reveal the mutations that
correspond to the region of the protein involved in interacting,
e.g., binding. Alternatively, one protein can be anchored to a
solid surface using methods as described above, and allowed to
interact with, e.g., bind, to its labeled interacting partner,
which has been treated with a proteolytic enzyme, such as trypsin.
After washing, a short, labeled peptide comprising the interacting,
e.g., binding, domain may remain associated with the solid
material; the associated domain can be isolated and identified by
amino acid sequencing. Also, once the gene coding for the
intracellular binding partner is obtained, short gene segments can
be engineered to express peptide fragments of the protein, which
can then be tested for binding activity and purified or
synthesized.
[0385] The human RAI-3 polypeptide and/or peptides, or immunogenic
fragments or oligopeptides thereof, can be used for screening for
therapeutic drugs or compounds for COPD or COPD related disorders
in a variety of drug screening techniques. The fragment employed in
such a screening assay can be free in solution, affixed to a solid
support, borne on a cell surface, or located intracellularly. The
reduction or elimination of activity in the formation of binding
complexes between RAI-3 protein and the agent being tested can be
measured. Thus, the present invention provides a method for
screening or assessing a plurality of compounds for their specific
binding affinity with the RAI-32 polypeptide, or a bindable peptide
fragment, involving obtaining or providing or testing a plurality
of compounds, combining the RAI-3 polypeptide, or a bindable
peptide fragment, with each of the plurality of compounds for a
time sufficient to allow binding under suitable conditions and
detecting binding of the RAI-3 polypeptide or peptide to each of
the plurality of test compounds, thereby identifying the compounds
that specifically bind to the RAI-3 polypeptide or peptide.
[0386] Methods of identifying compounds that modulate the activity
of the RAI-3 polypeptide and/or peptides comprise combining a
potential or candidate compound or drug modulator with RAI-3
polypeptide or peptide, for example, the RAI-3 amino acid sequence
as set forth in SEQ ID NO:3, or a peptide encoding sequence
thereof, and measuring an effect of the candidate compound or drug
modulator on the biological activity of the RAI-3 polypeptide or
peptide. Such measurable effects include, for example, physical
binding interaction; effects on native and cloned RAI-3-expressing
cell lines; and effects on components of the NF-.kappa.B pathway
which are regulated or modulated by RAI-3 either directly or
indirectly via RAI-3 modulators as described herein.
[0387] Another method of identifying compounds that modulate the
biological activity of the RAI-3 protein comprises combining a
potential or candidate compound or drug modulator, e.g., of an
NF-.kappa.B pathway component, such as I.kappa.B, with a host cell
that expresses the RAI-3 polypeptide and measuring an effect of the
candidate compound or drug modulator on the biological activity of
the RAI-3 polypeptide. The host cell can also be capable of being
induced to express the RAI-3 polypeptide, e.g., via inducible
expression. Physiological effects of a given candidate modulator on
the RAI-3 polypeptide can also be measured. Thus, cellular assays
for particular NF-.kappa.B pathway modulators can be either direct
measurement or quantification of the physical biological activity
of RAI-3, or they can involve measurement or quantification of a
physiological effect. Such methods preferably employ the RAI-3
polypeptide as described herein, or an overexpressed recombinant
RAI-3 polypeptide in suitable host cells containing an expression
vector as described herein, wherein the RAI-3 polypeptide is
expressed, overexpressed, or undergoes up-regulated expression.
[0388] Another aspect of the present invention embraces a method of
screening for a compound that is capable of modulating the
biological activity of the RAI-3 polypeptide, comprising providing
a host cell containing an expression vector harboring a nucleic
acid sequence encoding a RAI-3 polypeptide, or a functional peptide
or portion of the RAI-3 amino acid sequence (SEQ ID NO:3);
determining the biological activity of the expressed RAI-3
polypeptide in the absence of a modulator compound; contacting the
cell with the modulator compound; and determining the biological
activity of the expressed RAI-3 polypeptide in the presence of the
modulator compound. In such a method, a difference between the
activity of the RAI-3 polypeptide in the presence of the modulator
compound and in the absence of the modulator compound indicates a
modulating effect of the compound.
[0389] Essentially any chemical compound can be employed as a
potential modulator or ligand in the assays for determining or
identifying RAI-3 modulators or effector molecules. Compounds
tested as candidate modulators can be any small chemical compound,
or biological entity (e.g., protein, sugar, nucleic acid, lipid).
Test compounds are typically small chemical molecules and peptides.
Generally, the compounds used as potential modulators can be
dissolved in aqueous or organic (e.g., DMSO-based) solutions. The
assays are designed to screen large chemical libraries by
automating the assay steps and providing compounds from any
convenient source. Assays are routinely run in parallel, for
example, in microtiter formats on microtiter plates in robotic
assays, e.g., high throughput assays. There are many suppliers of
chemical compounds, including Sigma (St. Louis, Mo.), Aldrich (St.
Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka
Chemika-Biochemica Analytika (Buchs, Switzerland), for example.
Also, compounds may be synthesized by methods known in the art.
[0390] High throughput screening methodologies are especially
envisioned for the detection of modulators or effectors of the
RAI-3 polypeptide particularly for preventing, treating or
ameliorating COPD and COPD related disorders as discussed herein.
Such high throughput screening methods typically involve providing
a combinatorial chemical or peptide library containing a large
number of potential therapeutic compounds (e.g., ligand or
modulator compounds). Such combinatorial chemical libraries or
ligand libraries are then screened in one or more assays to
identify those library members (e.g., particular chemical species
or subclasses) that display a desired characteristic activity. The
compounds so identified can serve as conventional lead compounds,
or can themselves be used as potential or actual therapeutics.
[0391] As is appreciated by the skilled practitioner, a
combinatorial chemical library is a collection of diverse chemical
compounds generated either by chemical synthesis or biological
synthesis, by combining a number of chemical building blocks (i.e.,
reagents such as amino acids). As an example, a linear
combinatorial library, e.g., a polypeptide or peptide library, is
formed by combining a set of chemical building blocks in every
possible way for a given compound length (i.e., the number of amino
acids in a polypeptide or peptide compound). Millions of chemical
compounds can be synthesized through such combinatorial mixing of
chemical building blocks.
[0392] The preparation and screening of combinatorial chemical
libraries is well known to those having skill in the pertinent art.
Combinatorial libraries include, without limitation, peptide
libraries (e.g. U.S. Pat. No. 5,010,175; Furka, 1991, Int. J. Pept.
Prot. Res., 37:487-493; and Houghton et al., 1991, Nature,
354:84-88). Other chemistries for generating chemical diversity
libraries can also be used. Nonlimiting examples of chemical
diversity library chemistries include, peptoids (PCT publication
no. WO 91/019735), encoded peptides (PCT publication no. WO
93/20242), random bio-oligomers (PCT publication no. WO 92/00091),
benzodiazepines (U.S. Pat. No. 5,288,514), diversomers such as
hydantoins, benzodiazepines and dipeptides (Hobbs et al., 1993,
Proc. Natl. Acad. Sci. USA, 90:6909-6913), vinylogous polypeptides
(Hagihara et al., 1992, J. Amer. Chem. Soc., 114:6568), nonpeptidal
peptidomimetics with glucose scaffolding (Hirschmann et al., 1992,
J. Amer. Chem. Soc., 114:9217-9218), analogous organic synthesis of
small compound libraries (Chen et al., 1994, J. Amer. Chem. Soc.,
116:2661), oligocarbamates (Cho et al., 1993, Science, 261:1303),
and/or peptidyl phosphonates (Campbell et al., 1994, J. Org. Chem.,
59:658), nucleic acid libraries (see Ausubel, Berger and Sambrook,
all supra), peptide nucleic acid libraries (U.S. Pat. No.
5,539,083), antibody libraries (e.g., Vaughn et al., 1996, Nature
Biotechnology, 14(3):309-314) and PCT/US96/10287), carbohydrate
libraries (e.g., Liang et al., 1996, Science, 274-1520-1522) and
U.S. Pat. No. 5,593,853), small organic molecule libraries (e.g.,
benzodiazepines, Baum C&EN, Jan. 18, 1993, page 33; and U.S.
Pat. No. 5,288,514; isoprenoids, U.S. Pat. No. 5,569,588;
thiazolidinones and metathiazanones, U.S. Pat. No. 5,549,974;
pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino
compounds, U.S. Pat. No. 5,506,337; and the like).
[0393] Devices for the preparation of combinatorial libraries are
commercially available (e.g., 357 MPS, 390 MPS, Advanced Chem Tech,
Louisville Ky.; Symphony, Rainin, Woburn, Mass.; 433A Applied
Biosystems, Foster City, Calif.; 9050 Plus, Millipore, Bedford,
Mass.). In addition, a large number of combinatorial libraries are
commercially available (e.g., ComGenex, Princeton, N.J.; Asinex,
Moscow, Russia; Tripos, Inc., St. Louis, Mo.; ChemStar, Ltd.,
Moscow, Russia; 3D Pharmaceuticals, Exton, Pa.; Martek Biosciences,
Columbia, Md., and the like).
[0394] Solid phase-based in vitro assays in a high throughput
format are encompassed in which the cell or tissue expressing an
RAI-3 polypeptide or an RAI-3 peptide is attached to a solid phase
substrate. In such high throughput assays, it is possible to screen
up to several thousand different modulators or ligands in a single
day. In particular, each well of a microtiter plate can be used to
perform a separate assay against a selected potential modulator,
or, if concentration or incubation time effects are to be observed,
every 5-10 wells can test a single modulator. Thus, a single
standard microtiter plate can assay about 96 modulators. If 1536
well plates are used, then a single plate can easily assay from
about 100 to about 1500 different compounds. It is possible to
assay several different plates per day; thus, for example, assay
screens for up to about 6,000-20,000 different compounds are
possible using the described integrated systems.
[0395] Also encompassed are screening and small molecule (e.g.,
drug) detection assays which involve the detection or
identification of small molecules that can bind to the RAI-3
polypeptide or peptide. Particularly preferred are assays suitable
for high throughput screening methodologies. In such binding-based
detection, identification, or screening assays, a functional assay
is not typically required. All that is needed is a target protein,
preferably substantially purified, and a library or panel of
compounds (e.g., ligands, drugs, small molecules) or biological
entities to be screened or assayed for binding to the protein
target. Preferably, most small molecules that bind to the target
protein will modulate activity in some manner, due to preferential,
higher affinity binding to functional areas or sites on the
protein.
[0396] An example of such an assay is the fluorescence based
thermal shift assay (3-Dimensional Pharmaceuticals, Inc., 3DP,
Exton, Pa.) as described in U.S. Pat. Nos. 6,020,141 and 6,036,920
to Pantoliano et al.; see also, J. Zimmerman, 2000, Gen. Eng. News,
20(8)). The assay allows the detection of small molecules (e.g.,
drugs, ligands) that bind to expressed, and preferably purified,
polypeptides such as RAI-3, based on affinity of binding
determinations by analyzing thermal unfolding curves of
protein-drug or ligand complexes. The drugs or binding molecules
determined by this technique can be further assayed, if desired, by
methods, such as those described herein, to determine if the
molecules affect or modulate function or activity of the target
protein.
[0397] To purify RAI-3 polypeptide or peptides for use in measuring
or quantifying a biological binding or ligand binding activity, the
source may be a whole cell lysate that can be prepared by
successive freeze-thaw cycles (e.g., one to three) in the presence
of standard protease inhibitors. The RAI-3 polypeptide can be
partially or completely purified by standard protein purification
methods, e.g., affinity chromatography using specific antibody as
described, or by ligands specific for an epitope tag engineered
into a recombinant RAI-3 polypeptide molecule. Binding activity can
then be measured as described.
[0398] Compounds which are identified according to the methods
provided herein, and which modulate or regulate the biological
activity or physiology of the RAI-3 polypeptide are embraced as a
preferred embodiment of this invention. It is contemplated that
such modulatory compounds can be employed in treatment, prevention
and therapeutic methods for treating or preventing COPD or COPD
related disorders or conditions which are mediated by, associated
with, regulated or modulated by RAI-3, by administering to an
individual in need of such treatment a therapeutically effective
amount of the compound identified by the methods described herein.
In addition, the present invention provides methods for treating an
individual in need of such treatment for COPD or a COPD related
disease, disorder, or condition that is mediated by RAI-3,
comprising administering to the individual a therapeutically
effective amount of the RAI-3-modulating compound identified by a
method provided herein.
Methods and Compositions for the Treatment of COPD and COPD Related
Disorders, as well as NF-.kappa.B-Mediated Diseases and Disorders,
Associated With RAI-3 and/or Modulators Thereof
[0399] The present invention also relates to methods and
compositions for the treatment, amelioration, modulation and/or
prevention of COPD and COPD related disorders that are mediated or
regulated by RAI-3 expression or function, e.g., RAI-3
phosphorylation or activation, interaction with signal transduction
molecules or cellular regulatory factor molecules or release, or by
RAI-3 modulation, and the like. Further, RAI-3 effector functions
can be modulated via such methods and compositions. Moreover, as
described herein, the present invention relates to the treatment,
amelioration, modulation, and/or prevention of a variety of other
diseases or disorders involving the modulation of NF-.kappa.B
activity or function, or the activity or function of NF-.kappa.B
associated molecules, through RAI-3 or RAI-3 modulation.
[0400] That RAI-3 expression, function, and/or modulation have a
direct involvement with COPD, the underlying symptoms of COPD, and
COPD-related diseases, disorders, and/or conditions, is highly
consistent with the finding that RAI-3 is overexpressed in the lung
parenchyma (FIG. 15 and Example 10), since COPD is believed to
originate in this part of the lung tissue. The parenchyma
constitutes the terminal respiratory units, i.e., the most distal
portions, of the lung, which are composed of alveolar ducts with
the accompanying interconnected alveoli; the parenchyma also can
contain very small caliber bronchi and bronchioles (such as
terminal and respiratory bronchioles). It is well documented that
emphysema is defined as an abnormal permanent enlargement of the
air spaces distal to the terminal bronchioli, with concomitant
destruction of the alveolar walls. In view of its connection with
lung disease (and COPD), RAI-3 expression is consequently highest
in parenchymal regions of the lung, which are known to be damaged
in emphysema.
[0401] Moreover, it has been reported that increased airway
resistance in COPD may also be due to disease of the small
bronchioles just proximal to the alveolar regions. (W. M.
Thurlbeck, 1991, Pathology of Chronic Airflow Obstruction, Ist Ed.,
W. B. Saunders, Philadelphia, Pa. pp3-20). The main
histopathological changes in these small airways involve
inflammation, increased muscle mass and the abnormal appearance of
goblet cells that produce increased amounts of mucin in the airway
lumen, thereby resulting in airflow obstruction (M. G. Cosio et
al., 1978,. New Engl. J. Med., 298:1277-1281; D. Lamb, 1995,
Chronic Obstructive Pulmonary Disease, 2.sup.nd ed. Chapman and
Hall, London, pp. 9-34; and A. A. Glynn and L. Michaels, 1960,
Thorax, 15:142-153). Because mucus overproduction is a hallmark of
chronic bronchitis, it further correlates with the role of RAI-3 in
lung pathobiology and disease states that RAI-3 is expressed in
those regions of the lung where pathological changes contribute to
bronchitis, as well as to emphysema.
[0402] The methods in accordance with this aspect of the invention
include those that modulate RAI-3 gene and gene product activity.
In certain instances, the treatment will require an increase,
enhancement, upregulation or activation of RAI-3 activity, while in
other instances, the treatment will require a decrease, reduction,
down-regulation or suppression of RAI-3 activity. "Increase" and
"decrease" refer to the differential levels of RAI-3 activity
relative to RAI-3 activity in the cell type of interest in the
absence of modulatory treatment. Methods for the decrease or
increase of RAI-3 activity are described below. Methods which can
either increase or decrease RAI-3 activity depending on the
particular manner in which the method is practiced are further
described below.
Methods Associated With a Decrease of RAI-3 Activity
[0403] Treatment of COPD and/or COPD related conditions and
disorders can be achieved by methods which serve to decrease RAI-3
activity. Activity can be decreased directly, e.g., by decreasing
the RAI-3 gene product, i.e., protein, activity and/or by
decreasing the level of RAI-3 gene expression. For example,
compounds such as those identified through the methods and assays
described above that decrease RAI-3 protein activity can be used in
accordance with the invention to ameliorate, reduce or abolish
symptoms associated with COPD or COPD related conditions and
disorders. Alternatively, compounds such as those identified
through the methods and assays described above that decrease RAI-3
protein activity can be used in accordance with the invention to
ameliorate, reduce or abolish symptoms associated with NF.kappa.B,
I.kappa.B.alpha., and/or E-selectin related conditions and
disorders. As discussed above, such molecules can include, but are
not limited to, peptides, including soluble peptides, and small
organic or inorganic molecules, i.e., RAI-3 antagonists. Techniques
for the determination of effective doses and administration of such
compounds are described herein.
Antisense, siRNA, Ribozymes, and Triple Helix Formation
[0404] In addition, antisense and ribozyme molecules that inhibit
RAI-3 gene expression can also be used to reduce the level of RAI-3
gene expression, thus effectively reducing the level of RAI-3
protein present in a cell, thereby decreasing the level of RAI-3
protein activity, or modulation that occurs in the cell as a result
of smoke exposure. In addition, antisense molecules of RAI-3, and
the like, can be used to modulate or affect the function of
molecules which are regulated or mediated by, interact with, and/or
are recipients of downstream effects of, RAI-3 in a cell. Still
further, triple helix molecules can be utilized in reducing the
level of RAI-3 gene expression. Such molecules can be designed to
reduce or inhibit either wild type, or if appropriate, mutant RAI-3
target gene activity. Techniques for the production and use of such
molecules are well known to those having skill in the art.
[0405] As is understood by the skilled practitioner, antisense
approaches involve the design of oligonucleotides (either DNA or
RNA) that are complementary to mRNA of the RAI-3 gene sequence or a
portion thereof. The antisense oligonucleotides will bind to the
complementary RAI-3 gene mRNA transcripts and prevent translation.
Absolute complementarity, although preferred, is not required. A
sequence "complementary" to a portion of an RNA, as referred to
herein, means a sequence having sufficient complementarity to be
able to hybridize with the RNA, and form a stable duplex. In the
case of double-stranded antisense nucleic acids, a single strand of
the duplex DNA may thus be tested, or triplex formation may be
assayed. The ability to hybridize depends upon both the degree of
complementarity and the length of the antisense nucleic acid.
Generally, the longer the hybridizing nucleic acid, the more base
mismatches with an RNA it may contain and still form a stable
duplex (or triplex, as the case may be). One skilled in the art can
ascertain a tolerable degree of mismatch by using of standard
procedures and practice to determine the melting point of the
hybridized complex.
[0406] Antisense oligonucleotides may be single or double stranded.
Double stranded RNA's may be designed based upon the teachings of
Paddison et al., Proc. Nat. Acad. Sci., 99:1443-1448 (2002); and
International Publication Nos. WO 01/29058, and WO 99/32619; which
are hereby incorporated herein by reference. Antisense oligos,
particularly siRNA reagents, may be used therapeutically by
following the methods outlined Tiscornia et al (PNAS,
100(4):1844-1848 (2003); which is hereby incorporated by reference
in its entirety). Other methods are known in the art and
encompassed by the present invention.
[0407] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, typically work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have recently been shown to be
effective at inhibiting translation of mRNAs as well. (See,
generally, R. Wagner, 1994, Nature, 372:333-335). Thus,
oligonucleotides complementary to either the 5' or 3' untranslated
(UTR), non-coding regions of the RAI-3 nucleic acid could be used
in an antisense approach to inhibit translation of endogenous RAI-3
gene mRNA.
[0408] Oligonucleotides complementary to the 5' untranslated region
of the mRNA preferably include the complement of the AUG start
codon. Antisense oligonucleotides complementary to mRNA coding
regions are less efficient inhibitors of translation, but can be
used in accordance with the invention. Whether designed to
hybridize to the 5' UTR, 3' UTR or coding region of a target or
pathway gene mRNA, antisense nucleic acids are preferably at least
six nucleotides in length, and are preferably oligonucleotides
ranging from 6 to about 50 nucleotides in length. In specific
aspects, the oligonucleotide is at least 10 nucleotides, at least
17 nucleotides, at least 25 nucleotides, at least 26 nucleotides,
or at least 50 nucleotides.
[0409] Regardless of the choice of target sequence, it is preferred
that in vitro studies are first performed to quantify the ability
of the antisense oligonucleotide to inhibit gene expression. It is
preferred that these studies utilize controls that distinguish
between antisense gene inhibition and non-specific biological
effects of oligonucleotides. It is also preferred that these
studies compare levels of the target RNA or protein with that of an
internal control RNA or protein. In addition, results obtained
using the antisense oligonucleotide are preferably compared with
those obtained using a control oligonucleotide. It is also
preferred that the control oligonucleotide is of approximately the
same length as the antisense oligonucleotide and that the
nucleotide sequence of the control oligonucleotide differs from the
antisense sequence no more than is necessary to prevent specific
hybridization to the target sequence.
[0410] The oligonucleotides can be DNA, RNA, or chimeric mixtures,
derivatives, or modified versions thereof, single-stranded or
double-stranded. The oligonucleotide can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The
oligonucleotide may also include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents for facilitating transport across the cell membrane (see,
e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA.,
86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. USA,
84:648-652; PCT Application No. WO 88/09810) or the blood-brain
barrier (see, e.g., PCT Application No. WO 89/10134), or
hybridization-triggered cleavage agents (see, e.g., Krol et al.,
1988, Biotechniques, 6:958-976) or intercalating agents (see, e.g.,
Zon, 1988, Pharm. Res., 5:539-549). For example, the
oligonucleotide can be conjugated to another molecule, e.g., a
peptide, hybridization triggered cross-linking agent, transport
agent, hybridization-triggered cleavage agent, etc.
[0411] Such oligonucleotides can be synthesized by standard methods
known in the art, for example, by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As nonlimiting examples,
phosphorothioate oligonucleotides can be synthesized by the method
of Stein et al. (1988, Nucl. Acids Res., 16:3209) and
methylphosphonate oligonucleotides can be prepared by use of
controlled pore glass polymer supports (Sarin et al., 1988, Proc.
Natl. Acad. Sci. USA, 85:7448-7451), etc.
[0412] The antisense molecules are preferably delivered to cells
expressing the RAI-3 gene in vivo. A number of methods have been
developed for delivering antisense DNA or RNA to cells; e.g.,
antisense molecules can be injected directly into the tissue site,
or modified antisense molecules that are designed to target the
desired cells (e.g., antisense linked to peptides or antibodies
that specifically bind to receptors or antigens expressed on the
target cell surface) can be administered systemically. Because it
is often difficult to achieve intracellular concentrations of the
antisense molecules that are sufficient to suppress translation of
endogenous mRNAs, a particular approach utilizes a recombinant DNA
construct in which the antisense oligonucleotide is placed under
the control of a strong pol III or pol II promoter. The use of such
a construct to transfect target cells, ex vivo, in vivo, or in
vitro, will result in the transcription of sufficient amounts of
single stranded RNAs that will form complementary base pairs with
the endogenous RAI-3 gene transcripts and thereby prevent
translation of the RAI-3 gene mRNA. For example, a vector can be
introduced in vivo such that it is taken up by a cell and directs
the transcription of an antisense RNA.
[0413] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA (For a review, see, e.g., Rossi, J.,
1994, Current Biology, 4:469-471). The mechanism of ribozyme action
involves sequence-specific hybridization of the ribozyme molecule
to complementary target RNA, followed by a endonucleolytic
cleavage. The composition of ribozyme molecules must include one or
more sequences complementary to the target gene mRNA, and must
include the well known catalytic sequence responsible for mRNA
cleavage. For this sequence, see U.S. Pat. No. 5,093,246, which is
incorporated by reference herein in its entirety. As such, within
the scope of the invention are engineered hammerhead motif ribozyme
molecules that specifically and efficiently catalyze
endonucleolytic cleavage of RNA sequences encoding target gene
proteins. Ribozyme molecules designed to catalytically cleave RAI-3
gene mRNA transcripts can also be used to prevent translation of
RAI-3 gene mRNA and expression of target or pathway genes. (See,
e.g., PCT Application No. WO 90/11364; and Sarver et al., 1990,
Science, 247:1222-1225).
[0414] The ribozymes for use in the present invention also include
RNA endoribonucleases (hereinafter referred to as "Cech-type
ribozymes") such as that which occurs naturally in Tetrahymena
thermophila (known as the IVS, or L-19 IVS RNA) and which has been
extensively described by Thomas Cech and collaborators (Zaug, et
al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science,
231:470-475; Zaug, et al., 1986, Nature, 324:429-433; PCT Patent
Application No. WO 88/04300; and Been and Cech, 1986, Cell,
47:207-216). The Cech-type ribozymes have an eight base pair active
site which hybridizes to a target RNA sequence, after which
cleavage of the target RNA takes place. Encompassed by the present
invention are those Cech-type ribozymes which target eight
base-pair active site sequences that are present in the RAI-3
gene.
[0415] As in the antisense approach, ribozymes can be composed of
modified oligonucleotides (e.g. for improved stability, targeting,
etc.) and should be delivered to cells which express the RAI-3
gene, in vivo, in vitro, or ex vivo. A preferred method of delivery
involves using a DNA construct "encoding" the ribozyme under the
control of a strong constitutive pol III or pol II promoter, so
that transfected cells produce sufficient quantities of the
ribozyme to destroy endogenous RAI-3 gene messages and inhibit
RAI-3 mRNA translation. Because ribozymes, unlike antisense
molecules, are catalytic, a lower intracellular concentration is
required for efficiency.
[0416] Endogenous RAI-3 gene expression can also be reduced by
inactivating or "knocking out" the target and/or pathway gene or
its promoter using targeted homologous recombination (see, e.g.,
Smithies et al., 1985, Nature, 317:230-234; Thomas & Capecchi,
1987, Cell, 51:503-512; and Thompson et al., 1989 Cell, 5:313-321).
For example, a mutant, non-functional RAI-3 gene (or a completely
unrelated DNA sequence) flanked by DNA homologous to the endogenous
RAI-3 gene (either the coding regions or regulatory regions of the
RAI-3 gene) can be used, with or without a selectable marker and/or
a negative selectable marker, to transfect cells that express the
RAI-3 gene in vivo. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the RAI-3
gene. Such techniques can also be utilized to generate COPD or COPD
related disorders animal models. It should be noted that this
approach can be adapted for use in humans provided that the
recombinant DNA constructs are preferably directly administered or
targeted to the required site in vivo using appropriate viral
vectors, e.g., herpes virus vectors.
[0417] Alternatively, endogenous RAI-3 gene expression can be
reduced by targeting deoxyribonucleotide sequences complementary to
the regulatory region of the RAI-3 gene (i.e., the RAI-3 gene
promoter and/or enhancers) to form triple helical structures that
prevent transcription of the RAI-3 gene in target cells in the body
(see generally, Helene, C., 1991, Anticancer Drug Des.,
6(6):569-84; Helene, C., et al., 1992, Ann. N.Y. Acad. Sci.,
660:27-36; and Maher, L. J., 1992, Bioassays, 14(12):807-15).
Nucleic acid molecules for use in triple helix formation to inhibit
transcription should be single stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides
should be designed to promote triple helix formation via Hoogsteen
base pairing rules, which generally require that sizeable stretches
of either purines or pyrimidines are present on one strand of the
duplex. Nucleotide sequences can be pyrimidine-based, which will
result in TAT and CGC+ triplets across the three associated strands
of the resulting triple helix. The pyrimidine-rich molecules
provide base complementarity to a purine-rich region of a single
strand of the duplex in a parallel orientation to that strand. In
addition, nucleic acid molecules can be chosen that are
purine-rich, for example, containing a stretch of G residues. These
molecules form a triple helix with a DNA duplex that is rich in GC
pairs, in which the majority of the purine residues are located on
a single strand of the targeted duplex, resulting in GGC triplets
across the three strands of the triplex.
[0418] Alternatively, the potential sequences that can be targeted
for triple helix formation are increased by creating a "switchback"
nucleic acid molecule. Switchback molecules are synthesized in an
alternating 5'-3',3'-5' manner, such that they base pair with first
one strand of a duplex and then with the other, eliminating the
necessity for a sizeable stretch of either purines or pyrimidines
to be present on one strand of the duplex.
[0419] In instances in which the antisense, ribozyme, and/or triple
helix molecules described herein are utilized to inhibit mutant
RAI-3 gene expression, it is possible that the technique may so
efficiently reduce or inhibit the transcription (triple helix)
and/or translation (antisense, ribozyme) of mRNA produced by normal
target gene alleles that the concentration of normal target gene
product present may be lower than is necessary for a normal
phenotype. In such cases, to ensure that substantially normal
levels of RAI-3 gene activity are maintained, nucleic acid
molecules that encode and express RAI-3 polypeptides exhibiting
normal target gene activity can be introduced into cells via gene
therapy methods that do not contain sequences susceptible to
whatever antisense, ribozyme, or triple helix treatments are being
utilized. In instances in which the target gene encodes an
extracellular protein, it may be preferable to co-administer normal
target gene protein in order to maintain the requisite level of
target gene activity.
[0420] Antisense RNA and DNA, ribozyme, and triple helix molecules
of the invention can be prepared by any method known in the art,
e.g., methods for chemically synthesizing oligodeoxyribonucleotides
and oligoribonucleotides that are practiced in the art such as
solid phase phosphoramidite chemical synthesis. Alternatively, RNA
molecules can be generated by in vitro and in vivo transcription of
DNA sequences encoding the antisense RNA molecule. Such DNA
sequences can be incorporated into a wide variety of vectors which
incorporate suitable RNA polymerase promoters, such as the T7 or
SP6 polymerase promoters. Alternatively, antisense cDNA constructs
that synthesize antisense RNA constitutively or inducibly,
depending on the promoter used, can be introduced into cell lines
to form stable cell lines containing the construct.
[0421] In addition, well-known modifications to DNA molecules can
be introduced into the RAI-3 nucleic acid molecule as a means of
increasing intracellular stability and half-life. Illustrative
modifications include, but are not limited to, the addition of
flanking sequences of ribo- or deoxyribo-nucleotides to the 5'
and/or 3' ends of the molecule, or the use of phosphorothioate or
2' O-methyl rather than phosphodiesterase linkages within the
oligodeoxyribonucleotide backbone.
Methods for Increasing RAI-3 Activity
[0422] Successful treatment of COPD or COPD related conditions and
disorders can also be effected, where appropriate, by techniques
that result in an increase in the level of RAI-3 and/or RAI-3
activity. Activity can be increased by, for example, directly
increasing RAI-3 protein activity and/or by increasing the level of
RAI-3 gene expression. For example, modulatory compounds such as
those identified through the assays and methods described above
that increase RAI-3 activity can be used to treat COPD and/or COPD
related conditions and disorders. Such molecules can include, but
are not limited to peptides, including soluble peptides, and small
organic or inorganic molecules, and are typically considered to be
RAI-3 agonists. Such a modulatory compound can be administered to a
patient exhibiting COPD or COPD related disorders and/or symptoms
at a level sufficient to treat COPD or COPD related disorders and
symptoms. Alternatively, such a modulatory compound can be
administered to a patient exhibiting NF.kappa.B, I.kappa.B.alpha.,
and/or E-selectin related disorders and/or symptoms at a level
sufficient to treat the NF.kappa.B, I.kappa.B.alpha., and/or
E-selectin related disorders and/or symptoms. One of skill in the
art will readily know how to determine the concentration of an
effective non-toxic dose of the compound using procedures routinely
practiced in the art.
[0423] Alternatively, in instances in which the compound to be
administered is a peptide compound, DNA sequences encoding the
peptide compound, i.e., a DNA molecule, can be directly
administered to a patient exhibiting COPD or a COPD related
disorder or symptoms, at a concentration sufficient to produce a
level of peptide compound sufficient to ameliorate, reduce or
abolish the symptoms of the disorder. Any of the techniques
described herein which provide the intracellular administration of
compounds, such as, for example, liposome administration,
transfection, infection, or direct injection, can be utilized for
the administration of such DNA molecules. In the case of peptide
compounds which act extracellularly, the DNA molecules encoding
such peptides can be taken up and expressed by any cell type, so
long as a sufficient circulating concentration of peptide results
for the elicitation of a reduction or elimination or amelioration
of COPD or COPD related conditions or symptoms.
[0424] In cases in which COPD or a COPD related disorder or
condition can be localized to a particular portion or region of the
body, the DNA molecules encoding such modulatory peptides can be
administered as part of a delivery complex. Such a delivery complex
can comprise an appropriate nucleic acid molecule and a targeting
means. Such targeting means can comprise, for example, sterols,
lipids, viruses or target cell specific binding agents. Viral
vectors can include, but are not limited to adenovirus,
adeno-associated virus, and retrovirus vectors, in addition to
other materials that introduce DNA into cells, such as liposomes.
In instances in which COPD or a COPD related disorder or condition
involves an aberrant RAI-3 gene or protein, patients can be treated
by gene replacement therapy. One or more copies of a normal RAI-3
gene, or a portion of the gene that directs the production of a
normal RAI-3 protein with normal RAI-3 protein function, can be
inserted into cells by means of a delivery complex as described
above. Such gene replacement techniques can be accomplished either
in vivo or in vitro. Techniques which select for expression within
the cell type of interest are preferred. For in vivo applications,
such techniques can, for example, include appropriate local
administration of RAI-3 gene sequences.
[0425] Additional methods that can be used to increase the overall
level of RAI-3 activity, in appropriate conditions in which it is
advantageous to do so, include the introduction of appropriate
RAI-3 gene-expressing cells, preferably autologous cells, into a
patient at sites and in amounts sufficient to ameliorate, reduce,
or eliminate COPD or COPD related disorders, conditions, or
symptoms. Such cells can be either recombinant or non-recombinant.
Among the cell types that can be administered to increase the
overall level of RAI-3 gene expression in an individual are normal
cells, which express the RAI-3 gene. The cells can be administered
at the anatomical site of expression, or as part of a tissue graft
located at a different site in the body. Such cell-based gene
therapy techniques are well known to those skilled in the art (see,
e.g., Anderson, et al., U.S. Pat. No. 5,399,349; and Mulligan and
Wilson, U.S. Pat. No. 5,460,959).
[0426] RAI-3 gene sequences can also be introduced into autologous
cells in vitro. Cells expressing the RAI-3 gene sequence can then
be reintroduced, preferably by intravenous administration, into the
patient until the disorder is treated and symptoms of the disorder
are ameliorated, reduced, or eliminated.
Additional Modulatory Techniques
[0427] The present invention also includes modulatory techniques
which, depending on the specific application for which they are
utilized, can yield either an increase or a decrease in RAI-3
activity levels leading to the amelioration, reduction, or
elimination of COPD or COPD related disorders and conditions, such
as those described above.
[0428] For example, antibodies exhibiting modulatory capability can
be utilized according to the methods of this invention to treat
COPD or COPD related disorders. Depending on the specific antibody,
the modulatory effect can be an increase or decrease in RAI-3
activity, or in activity of a molecule regulated or modulated by
RAI-3, e.g., I.kappa.B. Specific antibodies can be generated using
standard techniques as described above against a full length wild
type or mutant RAI-3 polypeptide, or against peptides corresponding
to portions of the protein. The antibodies include, but are not
limited to, polyclonal, monoclonal, Fab fragments, single chain
antibodies, chimeric antibodies, etc.
[0429] Lipofectin or liposomes can be used to deliver the antibody
or an antibody fragment comprising the Fab region, which binds to
epitopic regions of the RAI-3 protein, to cells expressing RAI-3.
Where fragments of the antibody are used, the smallest inhibitory
fragment which binds to an RAI-3 binding domain is preferred. For
example, peptides having an amino acid sequence corresponding to
the domain of the variable region of an antibody that binds to the
RAI-3 protein can be used. Such peptides can be synthesized
chemically, or produced via recombinant DNA technology using
methods well known in the art (e.g., see Creighton, 1983, supra and
Sambrook et al., 1989, supra). Alternatively, single chain
antibodies, such as neutralizing antibodies, which bind to
intracellular epitopes can also be administered. Such single chain
antibodies can be administered, for example, by expressing
nucleotide sequences encoding single-chain antibodies within the
target cell population using, for example, techniques such as those
described in Marasco et al., 1993, Proc. Natl. Acad. Sci. USA,
90:7889-7893.
Pharmaceutical Preparations and Methods of Administration
[0430] The compounds, e.g., nucleic acid sequences, proteins,
polypeptides, peptides, and recombinant cells, described above can
be administered to a patient, or to an individual in need thereof,
in therapeutically effective doses to treat or ameliorate COPD or
COPD related conditions and disorders. Such compounds are
preferably modulators of RAI-3, such as antagonists or agonists,
more preferably, obtained by methods discussed herein. A
therapeutically effective dose refers to that amount of a compound
or cell population sufficient to result in amelioration, reduction,
elimination, or treatment of the disorder or symptoms.
Alternatively, a therapeutically effective amount is that amount of
a nucleic acid sequence sufficient to express a concentration of
the RAI-3 protein product which results in the amelioration of the
disorder or symptoms.
[0431] Toxicity and therapeutic efficacy of compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD.sub.50 (the
dose lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.5O/ED.sub.50. Compounds
which exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects can be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissue in order to minimize potential damage
to uninfected cells and, thereby, to reduce side effects. The data
obtained from the cell culture assays and animal studies can be
used in formulating a range of dosage for use in humans.
[0432] The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED.sub.50 with
little or no toxicity. The dosage can vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compound used in the methods of
the invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose can be formulated in
animal models to achieve a circulating blood or plasma
concentration range that includes the IC.sub.50 (i.e., the
concentration of the test compound which achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma can be measured, for example, by high
performance liquid chromatography.
[0433] Pharmaceutical compositions for use in accordance with the
present invention and methods can be formulated in a conventional
manner using one or more physiologically acceptable and/or
pharmaceutically acceptable carriers, diluents, or excipients.
Thus, therapeutic (and preventative) compounds and their
physiologically acceptable salts and solvents can be formulated for
administration by inhalation or insufflation (either through the
mouth or the nose) or oral, buccal, parenteral or rectal
administration.
[0434] For oral administration, the pharmaceutical compositions can
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pre-gelatinized maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulfate). Tablets can be coated
by methods well known in the art. Liquid preparations for oral
administration can take the form of, for example, solutions, syrups
or suspensions, or they can be presented as a dry product for
reconstitution with water or another suitable vehicle before use.
Such liquid formulations can be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations and
formulations can also contain buffer salts, flavoring, coloring and
sweetening agents as appropriate. Preparations for oral
administration can be suitably formulated to give controlled
release of the active compound. For buccal administration the
compositions can take the form of tablets or lozenges formulated in
conventional manner.
[0435] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol, the dosage unit can be
determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, for example, gelatin for use in an
inhaler or insufflator can be formulated containing a powder mix of
the compound and a suitable powder base such as lactose or
starch.
[0436] The compounds can be formulated for parenteral
administration (i.e., intravenous or intramuscular) by injection,
via, for example, bolus injection or continuous infusion.
Formulations for injection can be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions can take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and can contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents. Alternatively, the active ingredient can be in
powder form for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use. It is preferred that
RAI-3-expressing cells be introduced into patients via intravenous
administration.
[0437] The compounds can also be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing
conventional suppository bases such as cocoa butter or other
glycerides.
[0438] In addition to the formulations described previously, the
compounds can also be formulated as a depot preparation. Such long
acting formulations can be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds can be formulated with
suitable polymeric or hydrophobic materials (for example, as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0439] The compositions can, if desired, be presented in a pack or
dispenser device which can contain one or more unit dosage forms
containing the active ingredient. The pack can, for example,
comprise metal or plastic foil, such as a blister pack. The pack or
dispenser device can be accompanied by instructions for
administration.
[0440] Without intending to be in any way limiting, the following
further embodiments are encompassed by the present invention:
Embodiments 1 and 2
[0441] A method of diagnosing, ameliorating, treating, reducing,
eliminating, and/or preventing a disease, disorder, and/or
condition affected by modulation of the G-protein coupled receptor
protein RAI-3 in cells expressing RAI-3, which comprises providing
a modulator of RAI-3 in an amount effective to affect the function
or activity of RAI-3, and/or to affect the function or activity of
cellular molecules associated with modulated RAI-3 activity or
function. In such a method, the modulation of RAI-3 activity and/or
function can occur in cells stimulated by a variety of stimuli,
including cytokines, factors and chemokines, such as TNF-alpha,
EGF, LPS, eotaxin, RANTES, smoke from tobacco burning materials
such as cigarettes, and the like. In addition, the modulation of
RAI-3 activity and/or function can affect other cellular signaling
molecules or mediators, such as, for example, cell adhesion
molecules like I-CAM and E-selectin.
[0442] A method of diagnosing, ameliorating, treating, reducing,
eliminating, and/or preventing a disease, disorder, and/or
condition affected by modulation of the G-protein coupled receptor
protein RAI-3 in cells expressing RAI-3, which comprises providing
a modulator of RAI-3 in an amount effective to affect the function
or activity of RAI-3, and/or to affect the function or activity of
NF-.kappa.B activation associated with modulated RAI-3 activity or
function. In such a method, the modulation of RAI-3 activity and/or
function can occur in cells stimulated by a variety of stimuli,
including cytokines, factors and chemokines, such as TNF-alpha,
EGF, LPS, eotaxin, RANTES, smoke from tobacco burning materials
such as cigarettes, and the like. In addition, the modulation of
RAI-3 activity and/or function can affect other cellular signaling
molecules or mediators, such as, for example, cell adhesion
molecules like I-CAM and E-selectin.
[0443] The methods of embodiments 1 and 2, wherein the disease,
disorder, and/or condition that can be diagnosed, ameliorated,
treated, reduced, eliminated, or prevented includes COPD, the
underlying symptoms of COPD, COPD-related disorders and/or
conditions, autoimmune disorders, disorders related to hyperimmune
activity, inflammatory conditions, disorders related to aberrant
acute phase responses, hypercongenital conditions, birth defects,
necrotic lesions, wounds, organ transplant rejection, conditions
related to organ transplant rejection, renal diseases,
ischemia-reperfusion injury, heart disorders, disorders related to
aberrant signal transduction, proliferation disorders, cancers,
such as lung cancer, stomach cancer, testicular cancer, breast
cancer, etc., metastases, HIV infection, or HIV propagation in
cells infected with other viruses, asthma, cystic fibrosis and
pulmonary fibrosis, ulcerative colitis, cerebral infarct,
myocardial infarct, diabetic nephropathy, allergic rhinitis,
Crohn's disease, atherosclerosis, rheumatoid arthritis,
inflammatory/auto-immune disorders outside of the lung in addition
to COPD, glioblastoma, pulmonary small cell undifferentiated
carcinoma, carcinoma of the breast, colon, lung, ovary, pancreas,
and prostate, and non-Hodgkin's lymphoma.
[0444] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an antagonist.
[0445] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an antagonist
selected from drugs, chemical compounds, proteins, peptides,
antibodies, ligand compounds, small molecules, antisense
complementary nucleic acid molecules, siRNA molecules,
ribozymes.
[0446] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an RAI-3 antagonist
which decreases NF-.kappa.B activity, decreases apoptotic events,
and/or increases I.kappa.B.alpha. expression or activity
levels.
[0447] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an agonist.
[0448] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an agonist selected
from drugs, chemical compounds, proteins, peptides, antibodies,
ligand compounds, or small molecules.
[0449] The methods of embodiments 1 and 2, wherein the modulator of
RAI-3 function, activity and/or interaction is an RAI-3 agonist
which increases NF-.kappa.B activity, increases apoptotic events,
and/or decreases I.kappa.B.alpha. expression or activity
levels.
Embodiment 3
[0450] A method of identifying or screening for modulators of the
G-protein coupled receptor protein RAI-3 for ameliorating,
treating, reducing, eliminating, or preventing chronic obstructive
pulmonary disease (COPD), or diseases, disorders and/or conditions
related thereto, comprising testing a compound to determine if the
test compound modulates or affects (i) the activity and/or function
of RAI-3, (ii) the expression of RAI-3; and/or (iii) the
interaction of RAI-3 with an associated cell molecule in cells
exposed to smoke from tobacco burning products.
[0451] A method of identifying or screening for modulators of the
G-protein coupled receptor protein RAI-3 for ameliorating,
treating, reducing, eliminating, or preventing a disease, disorder
and/or condition selected from autoimmune disorders, disorders
related to hyperimmune activity, inflammatory conditions, disorders
related to aberrant acute phase responses, hypercongenital
conditions, birth defects, necrotic lesions, wounds, organ
transplant rejection, conditions related to organ transplant
rejection, renal diseases, ischemia-reperfusion injury, heart
disorders, disorders related to aberrant signal transduction,
proliferation disorders, cancers, such as lung cancer, breast
cancer, stomach cancer, testicular cancer, etc., metastases, HIV
infection, or HIV propagation in cells infected with other viruses,
asthma, cystic fibrosis, or pulmonary fibrosis, comprising testing
a compound to determine if the test compound modulates or affects
(i) the activity and/or function of RAI-3, (ii) the expression of
RAI-3, and/or (iii) the interaction of RAI-3 with an associated
cell molecule in cells in which NF-.kappa.B activation is
affected.
[0452] A method of identifying or screening for modulators of the
G-protein coupled receptor protein RAI-3, wherein modulators
comprise compounds and drugs functioning as agonists and
antagonists, comprising combining a candidate modulator compound
with a host cell expressing the RAI-3 polypeptide having the
sequence as set forth in SEQ ID NO:3; and measuring an effect of
the candidate modulator compound on the activity or function of the
expressed RAI-3 polypeptide. The method of this embodiment includes
the use of the NFAT system, the CRE response element; host cells,
e.g., CHO/NFAT-CRE cells and CHO/NFAT-G alpha 15 transfected with a
vector containing a nucleic acid sequence encoding all or a
functional part of the RAI-3 polypeptide, e.g., pcDNA3.1 Hygro.TM..
The method further includes RAI-3-transfected cell lines, e.g.,
RAI-3-transfected CHO/NFAT-G alpha 15 having low, intermediate, and
high levels of RAI-3 expression and/or low, intermediate and high
levels of coupling to the beta lactamase response as described
herein. (Example 1(L)).
[0453] A method of screening for or identifying compounds that can
modulate the biological activity or function of the RAI-3
polypeptide, comprising determining the biological activity of the
RAI-3 polypeptide in a cell expressing the RAI-3 polypeptide in the
absence of a modulator compound; contacting the host cell
expressing RAI-3 with the modulator compound; and determining the
biological activity or function of RAI-3 in the presence of the
modulator compound; wherein a difference between the activity of
the RAI-3 polypeptide in the presence of the modulator compound and
in the absence of the modulator compound is indicative of a
modulating effect of the compound on RAI-3 activity or function. As
in the above method, the NFAT system, the CRE response element;
host cells, e.g., CHO/NFAT-CRE cells and CHO/NFAT-G alpha 15
transfected with a vector containing a nucleic acid sequence
encoding all or a functional part of the RAI-3 polypeptide, e.g.,
pcDNA3.1 Hygro.TM. are envisioned for use as described herein. The
method further includes RAI-3-transfected cell lines, e.g.,
RAI-3-transfected CHO NFAT-G alpha 15 having low, intermediate, and
high levels of RAI-3 expression and/or low, intermediate and high
levels of coupling to the beta lactamase response as described
herein. (Example 1(L)).
[0454] A compound which is an RAI-3 modulator as identified by the
methods of embodiment 3, as well as compositions, including
pharmaceutical compositions, comprising the modulator compound.
Further Embodiments
[0455] An isolated RAI-3 variant which has a sequence variation
from that of SEQ ID NO:3. Such an RAI-3 variant has a sequence as
defined in SEQ ID NO:19. (for example, as shown in Table 1 and
FIGS. 25A-C).
[0456] An isolated nucleic acid variant of SEQ ID NO:2, wherein the
variant contains a single nucleotide polymorphism (SNP) according
to SEQ ID NO:18.
[0457] A polynucleotide sequence comprising at least 15 consecutive
nucleotides, wherein the at least 15 consecutive nucleotides
include a single nucleotide polymorphism (SNP) selected from Tables
1 and/or 10.
[0458] A polynucleotide sequence comprising at least about 15
consecutive nucleotides, wherein the at least about 15 consecutive
nucleotides include a single nucleotide polymorphism (SNP) selected
from Tables 1 and/or 10, and wherein the last nucleotide base of
said nucleotide ends with a polymorphic allele at the polymorphic
locus, wherein the term "about" is construed to equal either 1, 2,
3, 4, or 5 bases longer or shorter than the described nucleotide
length.
[0459] An isolated polynucleotide encoding an RAI-3 polypeptide,
said polynucleotide comprising the nucleic acid sequence set forth
in SEQ ID NO:18.
[0460] An isolated polynucleotide encoding an RAI-3 polypeptide
comprising the amino acid sequence set forth in SEQ ID NO:19.
[0461] Compositions, pharmaceutical compositions, vectors and host
cells comprising the variant RAI-3 amino acid and nucleic acid
sequences of these embodiments are encompassed by the
invention.
[0462] An RAI-3 peptide of SEQ ID NO:1.
[0463] Antibodies, or fragments thereof, directed against RAI-3
polypeptides, peptides, variants, and fragments thereof. The
antibodies can be directed against all or a portion of the RAI-3
peptides or polypeptides of one or more of SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ
ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:91, or SEQ ID
NO:92. The antibodies can be of any of the types described herein,
including, for example, monoclonal, polyclonal, chimeric, and the
like. Methods of utilizing the antibodies in screening assays, in
diagnostic assays, as modulators, in detection assays, in
purification techniques, and the like, are encompassed.
[0464] Compositions and pharmaceutical compositions comprising
RAI-3 variant polypeptides, peptides and/or antibodies are
encompassed by the invention. RAI-3 fusion polypeptides and
peptides are also encompassed.
Still Further Embodiments
[0465] An isolated nucleic acid molecule that is complementary to
all or a portion of the RAI-3 nucleic acid sequence of one or more
of SEQ ID NO:2, SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID
NO:33.
[0466] An isolated nucleic acid molecule selected from SEQ ID
NO:32, or SEQ ID NOS:52 through 61.
[0467] An isolated RAI-3 nucleic acid molecule selected from one or
more of SEQ ID NO:18, SEQ ID NO:23, SEQ ID NO:18, SEQ ID NO:25, SEQ
ID NO:27, SEQ ID NO:29, or SEQ ID NOS:65 through 70.
[0468] Compositions, pharmaceutical compositions, vectors and host
cells comprising the above isolated nucleic acid molecules are
encompassed. Probes and primer oligonucleotides as described in the
Tables and disclosure herein are also encompassed.
[0469] A method of treating chronic obstructive pulmonary disease
(COPD) and diseases, disorders and/or conditions related thereto,
comprising providing an antisense nucleic acid molecule of
G-protein coupled receptor protein RAI-3, or an oligomeric nucleic
acid portion thereof, preferably, in a pharmaceutically acceptable
formulation, in an amount effective to prevent expression of RAI-3
in cells exposed to smoke from tobacco burning products.
[0470] A method of treating a disease, disorder, and/or condition
associated with NF-.kappa.B activation, or associated with
activation of a molecule mediated by NF-.kappa.B activation,
comprising providing a modulator of G-protein coupled receptor
protein RAI-3, preferably, in a pharmaceutically acceptable
formulation, in an amount effective to modulate the expression of
RAI-3. In the method the modulator is an antagonist or an
agonist.
Additional Embodiments
[0471] A method of regulating second messenger pathways and
molecules therein, wherein the second messenger pathways and
molecules therein are associated with a pathobiological disease,
disorder, and/or condition, such as the following: COPD, the
underlying symptoms of COPD, COPD-related disorders and/or
conditions, autoimmune disorders, disorders related to hyperimmune
activity, inflammatory conditions, disorders related to aberrant
acute phase responses, hypercongenital conditions, birth defects,
necrotic lesions, wounds, organ transplant rejection, conditions
related to organ transplant rejection, renal diseases,
ischemia-reperfusion injury, heart disorders, disorders related to
aberrant signal transduction, proliferation disorders, cancers,
such as lung cancer, breast cancer, stomach cancer, testicular
cancer, etc., metastases, HIV infection, or HIV propagation in
cells infected with other viruses, asthma, cystic fibrosis and
pulmonary fibrosis, comprising: modulating the function and/or
activity of the G-protein coupled receptor RAI-3. The method
comprises regulating, modulating, or affecting the activity of the
NF-.kappa.B pathway and components thereof, e.g., I.kappa.B, by
modulating, either by antagonizing or agonizing, the function
and/or activity of RAI-3. RAI-3 modulation according to the method
provides treatments for COPD, as well as for other diseases,
disorders, and/or conditions that are mediated by NF-.kappa.B
and/or other molecules related thereto. The method provides
treatment, amelioration, or prevention of diseases that are caused
by, or are associated with, NF-.kappa.B, the NF-.kappa.B pathway
and/or its component molecules, wherein antagonist modulators of
RAI-3 are preferably employed to suppress, inhibit, or reduce the
activity of NF-.kappa.B, the NF-Kb pathway and/or its component
molecules, ulcerative colitis, cerebral infarct, myocardial
infarct, diabetic nephropathy, allergic rhinitis, Crohn's disease,
atherosclerosis, rheumatoid arthritis, inflammatory/auto-immune
disorders outside of the lung in addition to COPD, glioblastoma,
pulmonary small cell undifferentiated carcinoma, carcinoma of the
breast, colon, lung, ovary, pancreas, and prostate, and
non-Hodgkin's lymphoma.
[0472] A method of increasing I.kappa.B mRNA levels and/or
decreasing tumor necrosis factor-alpha (TNF-alpha)-induced
E-selectin expression in a cell, comprising: exposing the cell to a
modulator of the G-protein coupled receptor protein RAI-3, or a
functional portion thereof, wherein the modulator is preferably an
RAI-3 antagonist.
EXAMPLES
[0473] The Examples herein are meant to exemplify the various
aspects of carrying out the invention and are not intended to limit
the scope of the invention in any way. The Examples do not include
detailed descriptions for conventional methods employed, such as in
the construction of vectors, the insertion of cDNA into such
vectors, or the introduction of the resulting vectors into the
appropriate host. Such methods are well known to those skilled in
the art and are described in numerous publications, for example,
Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory
Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, USA,
(1989).
Example 1
Methods
[0474] A. Generation of Cigarette Smoke-Bubbled Medium
[0475] Cigarette-smoke bubbled medium was generated using a
cigarette smoking machine similar to that described by T. Muller,
(1995, "Expression of c-fos in quiescent Swiss 3T3 cells exposed to
aqueous cigarette smoke fractions", Cancer Res., 55:1927-1932). The
cigarettes used were the standard reference research cigarette 1R4F
(Tobacco and Health Research Institute, University of Kentucky,
Lexington, Ky.). For a concentration of CS-240 and CS-160, smoke
from 240 and 160 cigarettes (10 puffs per cigarette), respectively,
was bubbled through 500 ml of RPMI (Gibco/BRL/Invitrogen
Corporation, Carlsbad, Calif.) medium and sterile filtered for use
that same day.
[0476] B. Treatment of Cells With Cigarette Smoke-Bubbled
Medium
[0477] H292 lung airway epithelial cells (American Type Culture
Collection (ATCC), Manassas, Va.) were grown in RPMI medium
containing L-glutamine, 10% fetal bovine serum and 1%
Penicillin-Streptomycin (Gibco/BRL/Invitrogen Corporation,
Carlsbad, Calif.). When the cells reached confluency in the tissue
culture plate, they were serum-starved for 24 hours and then
treated with cigarette smoke-bubbled medium (serum-free) for
various times as described above. Cells were lysed in 3 mL of Lysis
Buffer containing 1% NP40, 50 mM Tris-HCl, 0.5% Na+ deoxycholate,
150 mM NaCl and 1 mM sodium orthovanadate in the presence of
phosphatase inhibitors and protease inhibitors in the form of 1 tab
(per 50 ml of Lysis Buffer) of Complete protease inhibitor cocktail
(Roche, Basel, Switzerland).
[0478] Following the cigarette smoke treatment of cells and cell
lysis, 15 .mu.l of cell lysate were mixed with sample buffer and
resolved by SDS-PAGE (4-20% gradient gel). Size-separated proteins
from the gel were transferred to nitrocellulose membrane by
standard Western Blotting techniques. The membrane were then probed
with antiphosphotyrosine antibody: HRP-conjugated-4G10 antibody,
#16-105, (Upstate Biotechnology, Inc., Lake Placid, N.Y.).
[0479] The optimum dose/concentration of cigarette smoke that
resulted in a strong phosphorylation response was determined; in
most experiments a concentration of CS-160 (equivalent to 240
cigarettes/500 ml of cell medium) was used. H292 cells were treated
with CS-240 media for varying times. Cells were lysed and whole
cell lysates were subjected to SDS PAGE to size-separate the
phosphorylated proteins as described. The proteins were then
analyzed by Western blot technique using an antiphosphotyrosine
antibody (FIG. 1A). The tyrosine phosphorylation signal began to
appear after about one hour of exposure and increased over the next
hour.
[0480] C. EGFR Immunoprecipitation
[0481] 1.5 ml of cell lysate (.about.1/2 of a confluent T75 flask)
was pre-cleared twice with 50 .mu.l of Protein A slurry, rotating
at 4.degree. C. Pre-cleared lysate was transferred to a new
Eppendorf tube and 501 .mu.l of Protein A and 2 .mu.l of EGFR
antisera (HER1/TWIB2, polyclonal rabbit antisera to human EGFR)
were added. The precleared lysate, Protein A and EGFR antisera were
mixed by rotating at 4.degree. C. for one hour, and then were
washed three times with Lysis Buffer, one time with 1.times.PBS (20
mM sodium phosphate, 150 mM NaCl, pH 7.4) followed by aspiration to
dryness. 50 .mu.l of sample buffer were added to the tubes and the
samples were placed at 95.degree. C. for 10 minutes before loading
onto a gel (20 .mu.l per lane).
[0482] Immunoprecipitation of EGFR showed that, upon exposure to
cigarette smoke-bubbled media, EGFR is tyrosine phosphorylated
(FIG. 1B). (K. Takeyama et al., 2001, Am. J. Physiol. Lung Cell
Mol. Physiol., 280(1):L165-172). Based on these experiments and
additional dosing experiments (FIGS. 2A and 2B), a dose of CS-160
for three hours was chosen for the proteomics experiments.
[0483] D. Proteomics Methods
[0484] H292 lung airway epithelial cells (ATCC) were grown in RPMI
medium containing L-glutamine, 10% fetal bovine serum and 1%
Penicillin-Streptomycin (Gibco/BRL). The cells were grown to a
density of 3.times.10.sup.9 cells in twenty-four 500 cm.sup.2
plates and were serum-starved for another 24 hours prior to
treatment with 1.times.PBS (for 3 hours), CS-160 cigarette smoke
(for 3 hours) and 10 nM epidermal growth factor, EGF
(Sigma-Aldrich, St. Louis, Mo.) for 2 hours. After treatment, the
cells were washed with ice-cold PBS and lysed in 20 mL of Lysis
Buffer containing 1% NP40, 50 mM Tris-HCl, 0.5% Na+ deoxycholate,
150 mM NaCl and 1 mM sodium orthovanadate in the presence of
protease and phosphatase inhibitors. The lysates were then
centrifuged at 100,000.times.g and the supernatants recovered.
Protein concentration of an aliquot of the supernatant was
determined by a BCA assay (P. K. Smith et al., 1985, Anal.
Biochem., 150:76-85).
[0485] For immunoprecipitation of tyrosine phosphorylated proteins,
cell lysates were first precleared with 500 .mu.l each of Protein G
agarose (Amersham Biosciences, Inc. Piscataway, N.J.),
streptavidin-agarose and anti-mouse IgG agarose (Cappel/ICN,
Aurora, Ohio) and were then incubated overnight at 4.degree. C.
with 100 .mu.g each of the following five antibodies: PY20
Mouse/Biotin, (250 .mu.g/mL), (Transduction Laboratories,
Lexington, Ky., Catalog No. P11120); PY69 Mouse, (1 mg/mL),
(Transduction Laboratories, Lexington, Ky., Catalog No. P39020);
RC20-Biotin (250 .mu.g/mL), (Transduction Laboratories, Lexington,
Ky., Catalog No. E11230-150); Polyclonal Rabbit, 250 .mu.g/mL),
(Transduction Laboratories, Lexington, Ky., Catalog No.
P11230-150); and 4G10 Mouse (1 mg/mL), (Upstate Biotechnology Inc.
Lake Placid, N.Y., Catalog No. 05-321).
[0486] The bound proteins were incubated with a pre-washed cocktail
of agarose beads conjugated to streptavidin, anti-mouse IgG and
Protein G for two hours at 4.degree. C. Precipitated immune
complexes were then washed three times with 1 mL lysis buffer
including inhibitors; washed another three times with TBS Wash
buffer (1.times.TBS/150 mM NaCl, 10 mM Tris-HCl, pH 7.5. plus
0.025% NP40/1 mM sodium orthovanadate) and eluted overnight with
500 .mu.l of 100 mM phenyl phosphate in TBS wash buffer. The eluted
proteins were concentrated using chloroform methanol precipitation
(D. Wessel and U. I. Flugge, 1984, Anal. Biochem., 138:141-143) and
dried in acetone. The dried pellets were resolubilized in 50 .mu.l
of 8M Urea, 400 mM ammonium bicarbonate, pH 8.5; reduced with 5
.mu.l of 45 mM DTT at 56.degree. C.; and alkylated with 5 .mu.l 100
mM iodoacetamide at room temperature for 15 minutes. After a 4-fold
dilution with water, each sample was digested overnight with 5
.mu.g of modified porcine trypsin at 37.degree. C. Contaminants
were removed via solid phase extraction using C18 spin columns
(Harvard Bioscience, Holliston, Mass.) according to the
manufacturer's specifications. Residual acetonitrile was removed by
lyophilization.
[0487] E. LC/LC/MS/MS (Biphasic Multidimensional Chromatography
Linked to Tandem Mass Spectrometry)
[0488] Identification of the immunoprecipitated phosphorylated
proteins was performed on the digested samples in a manner
described by M. P. Washburn et al. (2001, Nature Biotechnology,
19:242-247). For the work performed herein, samples were manually
loaded using an infusion pressure reservoir at 800 psi for
.about.30 minutes. The mobile phases used for reversed phase
elution were termed A and B, where A=water with 0.2% isopropanol,
0.1% acetic acid, and 0.001% trifluoroacetic acid; and B=95%
acetonitrile with 0.2% isopropanol, 0.1% acetic acid, and 0.001%
trifluoroacetic acid in water. Gradients were binary in A and B,
began with 0% B aqueous solvent, and moved to 50% B in 30 minutes.
The on-column flow rates were estimated to be 1 .mu.L per minute,
and were generated by applying .about.250 psi using a 249:1 split
ratio emanating from a high-pressure pump (1100, Agilent,
Wilmington, Del.). Mass spectrometry was performed on an ion trap
instrument (LCQDeca/ThermoFinnigan, San Jose, Calif.) using data
dependent scanning to choose the top three ions for fragmentation,
and a 60 second exclude time. The strong cation exchange material
used was Poros 20HS (Perkin Elmer/ABI, Weiterstadt, Germany) and
the number of potassium chloride steps used was seven: i.e., 0 mM,
10 mM, 50 mM, 100 mM, 250 mM, 500 mM, and 2 M. Data were searched
following acquisition using the SEQUEST algorithm (ThermoFinnigan,
San Jose, Calif.) against a database of non-redundant protein
sequences available from the National Center for Biotechnology
Information (National Library of Medicine).
[0489] As described above, a number of in vitro experiments were
carried out utilizing cultured epithelial (H292) cells, treated
with either serum free medium (SFM), (control) or with CS-160.
Cells were harvested following treatment and the phosphotyrosine
containing proteins were immunoprecipitated using a cocktail of
antibodies. The samples were then proteolyzed and analyzed by
LC/LC/MS/MS.
[0490] Approximately 350 proteins were identified as being tyrosine
phosphorylated (or associated with tyrosine phosphorylated
proteins) only from those cells that were exposed to cigarette
smoke. Included among the 350 proteins identified were many
signaling molecules and components of the EGFR pathway. Eighty four
of the proteins present were identified from multiple peptides. One
of the proteins identified was the lung-specific GPCR, RAI-3
(RefSeq NP.sub.--003970.1). The RAI-3 protein (RAI-3 peptide) was
identified in two independent cigarette smoke experiments (FIGS. 3
and 4) and was not identified or present in the controls.
[0491] F. Western Blotting for Proteomics Experiments
[0492] Samples from each treatment, with and without
immunoprecipitation, were boiled in Novex SDS-PAGE buffer and
loaded onto 4-12% Bis-Tris gradient gels using MES buffer
(Invitrogen Corporation, Carlsbad, Calif.). Separated proteins were
transferred to PVDF membrane, blocked with 1% BSA for 1.0 hour,
probed with 0.5 .mu.g/mL monoclonal anti-phosphotyrosine antibody
(Clone 4G10, Upstate Biotechnology Inc., Lake Placid, N.Y.) for 1.0
hour, followed by incubation with anti-mouse IgG coupled to HRP.
(Upstate Biotechnology Inc., Lake Placid, N.Y.). The signal was
detected using ECL Plus (Amersham Biosciences, Piscataway, N.J.)
and then imaged using Fluor-S Max (BioRad Laboratories, Hercules,
Calif.). Data were visualized with PDQuest software package (BioRad
Laboratories, Hercules, Calif.).
[0493] G. RAI-3 Subcloning and Transfection
[0494] As described below, RAI-3 was amplified from H292 cDNA with
appropriate restriction enzyme sites for cloning into mammalian
expression vectors. Two expression constructs were made, one with a
FLAG epitope tag at the amino terminus and one with a FLAG epitope
tag at the carboxy terminus (see below). These constructs were
transfected into A549, BEAS-2B, H292 and HEK 293 cell lines also as
described.
[0495] H. Expression Constructs
[0496] To generate the HA-FLAG-RAI-3/pcDNA3.1 construct, human
RAI-3 cDNA (Ref Seq NM.sub.--003979) was amplified by PCR from H292
cDNA using the following oligos:
5 RAI-3M254Forward: gcg cgg ccc aat tgc atg gct aca aca gtc cct gat
gg,; (SEQ ID NO: 36) and RAI-3X1544Reverse: gcg gcc ctc gag tta gct
gcc ctc ttt ctt tac. (SEQ ID NO: 37)
[0497] The initiating Methionine codon and stop codon are
underlined. HA, i.e., a modified hemaglutinin signal sequence is
described in X. M. Guan et al., 1992, J. Biol. Chem.,
267:21995-21998; also, see below.
[0498] The oligos contained restriction sites for cloning into the
expression vector, pcDNA3.1 (Invitrogen Corporation, Carlsbad,
Calif.) and fusion to the HA leader sequence (MKTIIALSYIFCLVFA),
(SEQ ID NO:38), and FLAG epitope tag (DYKDDDDARNS), (SEQ ID NO:39).
The resulting amino acid sequence upstream from the RAI-3
initiating Methionine is MKTIIALSYIFCLVFADYKDDDDARNS (SEQ ID
NO:40).
[0499] To generate the RAI-3-FLAG/pcDNA3.1Hygro construct, human
RAI-3 cDNA (Ref Seq NM.sub.--003979.2) was amplified by PCR from a
H292 cDNA using the following oligos:
6 RAI-3Bg254Forward: gcg gcc aga tct gcc acc atg gct aca aca gtc
cct gat; (SEQ ID NO: 41) and RAI-3FLAGReverse: gcg gcc ctc gag cta
ctt gtc gtc gtc gtc ctt gta gtc cat gct (SEQ ID NO: 42) gcc ctc ttt
ctt tac.
[0500] The initiating Methionine codon and stop codon are
underlined. The oligos contained restriction sites for cloning into
the expression vector, pcDNA3.1/Hygro (Invitrogen Corporation,
Carlsbad, Calif.) and fusion to a FLAG epitope tag. (A. Einhauer
and A. Jungbauer, 2001, "The FLAG peptide, a versatile fusion tag
for the purification of recombinant proteins", J. Biochem. Biophys.
Methods, 49(1-3):455-65). The resulting amino acid sequence after
the last amino acid residue of RAI-3 is MDYKDDDDK*, (*=Stop codon),
(SEQ ID NO:43). The DNA sequences of the constructs were confirmed
by DNA sequencing using conventional methods.
[0501] I. Cell Transfections
[0502] HEK 293, H292, and BEAS-2B cell lines (available from the
ATCC, Manassas, Va.) were plated in 100 mm cell culture dishes.
When the cells were approximately 50% confluent, they were
transfected with approximately 10 .mu.g of DNA (See construct
description above) using Lipofectamine and PLUS Reagents according
to the manufacture's protocol (Invitrogen Corporation, Carlsbad,
Calif.). After 24 hours the transfectants were passaged either 1:50
or 1:200 into 100 mM cell culture dishes containing the appropriate
selection medium. For the HA-FLAG-RAI-3/pcDNA3.1 transfectants, the
selection medium contained 600 .mu.g/ml Geneticin/G-418 Sulfate
(GibcoBRL/Invitrogen Corporation, Carlsbad, Calif.). For the cells
transfected with the HA-FLAG-RAI-3/pcDNA3.1Hygro construct, the
selection medium contained 500 .mu.g/ml of Hygromycin B (Invitrogen
Corporation, Carlsbad, Calif.). After approximately 10 days in
selection medium, cell colonies were picked and placed into wells
of a 24-well plate and were maintained in the same concentrations
of selective medium for expansion.
[0503] J. Characterization of RAI-3 Stable Cell Lines by
Immunoprecipitation and Western Blotting
[0504] Cell lines, e.g., human embryonic kidney cells (HEK 293),
stably transfected with RAI-3 were maintained in complete RPMI
medium containing L-glutamine, 10% fetal bovine serum and 1%
Penicillin-Streptomycin (Gibco/BRL/Invitrogen Corporation,
Carlsbad, Calif.) and 600 .mu.g/ml Geneticin/G-418 Sulfate
(GibcoBRL/Invitrogen Corporation, Carlsbad, Calif.). Each of 12
RAI-3 stably transfected cell line clones was plated in a 100 mM
cell culture dish. Once the cells grew to confluence, the medium
was aspirated to "dry" and 1.5 ml of ice-cold RIPA buffer (1%
NP-40/0.5% deoxycholate/150 mM NaCl/50 mM Tris HCl, pH 7.5, plus
protease inhibitors) were added. Cells were scraped off the dish
with a cell scraper and the lysate was transferred to a 1.5 ml tube
which was incubated on ice for 10 minutes. Cell debris was pelleted
via centrifugation at 14,000 rpm at 4.degree. C. for 10 minutes.
The supernatant was transferred to a new tube and frozen at
-80.degree. C. until use.
[0505] For immunoprecipitations, cell lysates were thawed and
pre-cleared three times (30 minutes with rotation at 4.degree. C.;
spin transfer to new tube) with 100 .mu.l of Protein A. Lysates
were immunoprecipitated with 2 .mu.g of anti-FLAG M2 antibody
Catalog # F-3165 (Sigma, Saint Louis, Mo.) overnight at 4.degree.
C. Thereafter, 40 .mu.l of Protein A was added to the
lysate/antibody mixture and rotated at 4.degree. C. for 1.5 hours.
The Protein A/lysate/antibody mixture was washed twice with RIPA
buffer and twice with 1.times.PBS. After the final wash, Protein
beads were aspirated "dry" and 30 .mu.l of 2.times.SDS-PAGE sample
buffer was added. After heating at 95.degree. C. for 10 minutes,
the samples were resolved by SDS-PAGE (4-20% gradient gel) and
transferred to nitrocellulose by standard Western Blotting
techniques. The membranes were blotted/probed with anti-FLAG-HRP
antibody (Sigma, Saint Louis, Mo., Catalog # A8592).
[0506] The results of the above work was as follows: from the RAI-3
transfections of cells, twelve G418-selected, stable,
FLAG-RAI-3/HEK 293 (Human Embryonic Kidney) clones were
characterized for FLAG-RAI-3 expression. Anti-FLAG
immunoprecipitation and Western blotting of clones 1-4 and 6-12
showed that the FLAG-RAI-3/HEK293 clones expressed a fusion protein
near the expected molecular weight of RAI-3 alone, i.e., 40.251 kD
(FIGS. 8A and 8B). The control lane (C) containing lysate from
untransfected HEK293 cells showed staining of protein bands with
the anti-FLAG antibody. Also included was a control of a purified
FLAG-fusion protein of {fraction (58/48)} kD. (FIG. 8B). Surface
expression of the FLAG-RAI-3 clones 1-12 was detected using an
anti-FLAG FITC-conjugated antibody. The clones had varying surface
expression; clones 12 and 11 showed the most intense staining.
(FIGS. 9A and 9B, and Example 1(K), below).
[0507] K. Characterization of RAI-3 Stable Cell Lines by FACS
Analysis
[0508] Cells from confluent 100 mM cell culture plates (i.e.,
.about.2.times.10.sup.6 cells) were washed once with 1.times.PBS
and then lifted from the plates with 2-3 ml of Cell Stripper
(Cellgro/Mediatech, Herndon, Va.). 15 ml of 1.times.PBS was added
to wash cells and then the cells were centrifuged at 1.5 K for 8
minutes at 4.degree. C. to pellet. Cells were resuspended in 0.2 ml
of binding buffer-DMEM (Gibco/BRL/Invitrogen Corporation, Carlsbad,
Calif.) with 1% BSA final. Anti-FLAG FITC (Sigma, Saint Louis, Mo.;
Catalog #F4049) was added at a dilution of 1:400. The cell and
antibody mixture was incubated on ice for one hour. Cells were
washed twice with 10 ml of binding buffer and resuspended in a
final volume of 0.5 ml of binding buffer for FACS analysis. The
cells were analyzed on a Becton Dickenson FACSort using Cell Quest
software. (Becton-Dickenson, Franklin Lakes, N.J.). Cells were live
gated and red/green color was compensated. The signal was compared
to an untransfected HEK293 control.
[0509] L. Functional Coupling of Human GPCR, RAI-3
[0510] The use of mammalian cell reporter assays to demonstrate
functional coupling of known GPCRs has been well documented in the
literature (A. G. Gilman, 1987, Annu. Rev. Biochem., 56, 615-649;
V. Boss et al., 1996, J. Biol. Chem., 271:10429-10432.; J. Alam and
J. L. Cook, 1990, Anal. Biochem., 188:245-254.; S. E. George et
al., 1997, J. Neurochem., 69:1278-1285; L. A. Selbie and S. J.
Hill, 1998, TIBS, 19:87-93; and S. Rees et al., 1999, "Reporter
gene systems for the study of G Protein Coupled Receptor signaling
in mammalian cells", In: Milligan G. (ed.): Signal Transduction: A
practical approach. Oxford, Oxford University Press, pp. 171-221).
Moreover, reporter assays have been successfully used for
identifying novel small molecule agonists or antagonists against
GPCRs as a class of drug targets (G. Zlokarnik et al., 1998,
Science, 279:84-88; S. E. George et al., 1997, Ibid.; V. Boss et
al., 1996, Ibid.; and S. Rees et al., 1999, Ibid.). In such
reporter assays, a promoter is regulated as a direct consequence of
activation of specific signal transduction cascades following
agonist binding to a GPCR (J. Alam and J. L. Cook, 1990, Ibid.; L.
A. Selbie and S. J. Hill, 1998, Ibid.; V. Boss et al., 1996, Ibid.;
S. E. George et al., 1997, Ibid.; and A. G. Gilman, 1987,
Ibid.).
[0511] A number of response element-based reporter systems have
been developed that enable the study of GPCR function. These
include cAMP response element (CRE)-based reporter genes for G
alpha i/o, G alpha s-coupled GPCRs, Nuclear Factor Activator of
Transcription (NFAT)-based reporters for G alpha q/111-, or the
promiscuous G protein G alpha 15/16-coupled receptors, and MAP
kinase reporter genes for use in Galpha i/o coupled receptors (J.
Blahos et al., 2001, J. Biol. Chem., 275(5):3262-3269; L. A. Selbie
and S. J. Hill, 1998, Ibid.; V. Boss et al., 1996, Ibid.; S. E.
George et al., 1997, Ibid.; S. Offermanns and M. I. Simon, 1995, J.
Biol. Chem., 270(25):15175-15180; A. G. Gilman, 1987, Ibid.; and S.
Rees et al., 1999, Ibid.). Transcriptional response elements that
regulate the expression of Beta-Lactamase within a CHO K1 cell line
(CHO/NFAT-CRE: Aurora Biosciences.TM.) (G. Zlokarnik et al., 1998,
Ibid.) have been implemented to characterize the function of the
orphan RAI-3 polypeptide of the present invention. The system
enables the demonstration of constitutive G-protein coupling to
endogenous cellular signaling components upon intracellular
overexpression of orphan receptors.
[0512] Receptor overexpression has been shown to represent a
physiologically relevant event. For example, it has been shown that
overexpression occurs in nature during metastatic carcinomas,
wherein defective expression of the monocyte chemotactic protein 1
receptor, CCR2, in macrophages is associated with the incidence of
human ovarian carcinoma (A. Sica et al., 2000, J. Immunology,
164:733-738 and R. Salcedo et al., 2000, Blood, 96(1):34-40). It
has been shown that overproduction of the Beta 2 Adrenergic
Receptor in transgenic mice leads to constitutive activation of the
receptor signaling pathway such that these mice exhibit increased
cardiac output (A. Kypson et al., 1999, Gene Therapy, 6:1298-304;
G. W. Dorn et al., 1999, Proc. Natl. Acad. Sci. USA, 96:6400-6405).
The above are only a few of the many examples demonstrating
constitutive activation of GPCRs in which many of these receptors
are likely to be in the active, i.e., R*, conformation (J. Wess,
1997, FASEB, J., 11 (5):346-54).
[0513] The materials and methods involved in the RAI-3 coupling
experiments are as follows:
DNA Constructs
[0514] GPCR RAI-3 cDNA was PCR amplified using PFU.TM.
(Stratagene). The primers used in the PCR reaction were specific to
the RAI-3 polynucleotide and were obtained from Gibco BRL,
namely,
7 1. RAI-3Bg254Forward: gcg gcc aga tct gcc acc atg gct aca aca gtc
cct gat; (SEQ ID NO: 41) and 2. RAI-3FLAGReverse: gcg gcc ctc gag
cta ctt gtc gtc gtc gtc ctt gta gtc (SEQ ID NO: 42) cat gct gcc ctc
ttt ctt tac.
[0515] The following 3' primer sequence can be used to add a
Flag-tag epitope to an RAI-3 nucleic acid sequence encoding an
RAI-3 polypeptide for immunocytochemistry:
5'-cgggatcctacttgtcgtcgtcgtccttgtagtcgctgccctctt- tctttacttc-3'
(SEQ ID NO:44), wherein the primer contains a BamHI site at the 5'
end, an optimal Kozak sequence, in addition to a sequence encoding
the FLAG tag epitope.
[0516] The product from the PCR reaction was isolated from a 0.8%
Agarose gel (Invitrogen, Carlsbad, Calif.) and purified using a Gel
Extraction Kit.TM. from Qiagen (Hilden, Germany). The purified
product was then digested overnight along with the pcDNA3.1
Hygro.TM. mammalian expression vector (Invitrogen) using the
HindIII and BamHI restriction enzymes (New England Biolabs (NEB),
Beverly, Mass.). These digested products were then purified using
the Gel Extraction Kit.TM. from Qiagen and subsequently ligated to
the pcDNA3.1 Hygro.TM. mammalian expression vector (Invitrogen)
using a DNA molar ratio of 4 parts insert to 1 part vector. All DNA
modification enzymes were purchased from NEB. The ligation was
incubated overnight at 16.degree. C.; thereafter, one microliter of
the mix was used to transform DH5 alpha cloning efficiency
competent E. coli.TM. cells (Gibco BRL, Carlsbad Calif.). The
plasmid DNA from the ampicillin resistant clones was isolated using
the Wizard DNA Miniprep System.TM., commercially available from
Promega (Madison, Wis.). Positive clones were confirmed and scaled
up for purification using the Qiagen Maxiprep.TM. plasmid DNA
purification kit.
Cell Line Generation
[0517] The pcDNA3.1 Hygro.TM. vector containing the orphan RAI-3
cDNA was used to transfect CHO/NFAT-CRE cells (Aurora Biosciences,
San Diego, Calif.) using Lipofectamine 2000.TM. according to the
manufacturer's specifications (Gibco BRL). After two days, the
cells were passaged 1:3 into selective medium (DMEM 11056, 600
.mu.g/ml Hygromycin, 200 .mu.g/ml Zeocin, 10% FBS), (Gibco
BRL-Invitrogen).
[0518] The CHO/NFAT-CRE cell lines, transiently or stably
transfected with the orphan RAI-3 GPCR, were analyzed using the
FACS Vantage SE.TM. (BD), fluorescence microscopy (Nikon), and the
LJL Analyst.TM. (Molecular Devices). In this system, changes in
real-time gene expression, as a consequence of constitutive
G-protein coupling of the orphan RAI-3 GPCR, is examined by
analyzing the fluorescence emission of the transformed cells at 447
nm and 518 nm. The changes in gene expression can be visualized
using Beta-Lactamase as a reporter, which, when induced by the
appropriate signaling cascade, hydrolyzes an intracellularly
loaded, membrane-permeant ester substrate, i.e.,
Cephalosporin-Coumarin-Fluoresce- in-2/Acetoxymethyl.TM.
(CCF2/AM.TM. Aurora Biosciences; G. Zlokarnik et al., 1998, Ibid.).
The CCF2/AM.TM. substrate is a 7-hydroxycoumarin cephalosporin with
a fluorescein attached through a stable thioether linkage. Induced
expression of the Beta-Lactamase enzyme is readily apparent, since
each enzyme molecule produced is capable of changing the
fluorescence of many CCF2/AM.TM. substrate molecules.
[0519] In sum, CCF2/AM.TM. is a membrane permeant,
intracellularly-trapped- , fluorescent substrate with a
cephalosporin core that links a 7-hydroxycoumarin to a fluorescein.
For the intact molecule, excitation of the coumarin at 409 nm
results in Fluorescence Resonance Energy Transfer (FRET) to the
fluorescein which emits green light at 518 nm. Production of active
Beta-Lactamase results in cleavage of the Beta-Lactam ring, leading
to disruption of FRET, and excitation of the coumarin only--thus
giving rise to blue fluorescent emission at 447 nm.
[0520] Fluorescent emissions were detected using a Nikon-TE300
microscope equipped with an excitation filter (D405/10X-25),
dichroic reflector (430DCLP) and a barrier filter for dual
DAPI/FITC (510 nM) to visually capture changes in Beta-Lactamase
expression. The FACS Vantage SE is equipped with a Coherent
Enterprise II Argon Laser and a Coherent 302C Krypton laser. In
flow cytometry, UV excitation at 351-364 nm from the Argon Laser or
violet excitation at 407 nm from the Krypton laser is used. The
optical filters on the FACS Vantage SE are HQ460/50m and HQ535/40m
bandpass separated by a 490 dichroic mirror.
[0521] Prior to analyzing the fluorescent emissions from the cell
lines as described above, the cells were loaded with the CCF2/AM
substrate. A 6.times.CCF2/AM loading buffer was prepared (1 mM
CCF2/AM (Aurora Biosciences) dissolved in 100% DMSO (Sigma)). 12
.mu.l of this stock solution was added to 60 .mu.l of 100 mg/ml
Pluronic F127 (Sigma) in DMSO containing 0.1% Acetic Acid (Sigma).
This solution was added while vortexing to 1 mL of Sort Buffer (PBS
minus calcium and magnesium, Gibco; 25 mM HEPES, Gibco, pH 7.4,
0.1% BSA). Cells were placed in serum-free medium and the
6.times.CCF2/AM was added to a final concentration of 1.times.. The
cells were then loaded at room temperature for one to two hours,
and then subjected to fluorescent emission analysis as described
herein. Additional details relative to the cell loading methods
and/or instrument settings are found in the following publications:
G. Zlokarnik et al., 1998, Ibid.; M. Whitney et al., 1998, Nature
Biotech, 16:1329-1333; and BD Biosciences, FACS Vantage SE Training
Manual. Part Number 11-11020-00 Rev. A. August, 1999.
Immunocytochemistry
[0522] The cell lines transfected and selected for expression of
Flag-epitope tagged orphan GPCRs were analyzed by
immunocytochemistry. The cells were plated at 1.times.10.sup.3 in
each well of a glass slide (VWR) and were rinsed with PBS followed
by acid fixation for 30 minutes at room temperature using a mixture
of 5% Glacial Acetic Acid/90% EtOH. The cells were then blocked in
2% BSA and 0.1% Triton in PBS, and incubated for 2 hours at room
temperature, or overnight at 4.degree. C. A monoclonal anti-Flag
FITC antibody was diluted at 1:50 in blocking solution and
incubated with the cells for 2 hours at room temperature. The cells
were then washed three times with 0.1% Triton in PBS for five
minutes. The slides were overlayed dropwise with mounting medium
(Biomedia-Gel Mount.TM.; Biomedia; Containing Anti-Quenching
Agent). Cells were examined at 10.times. magnification using a
Nikon TE300 microscope equipped with FITC filter (535 nm).
Demonstration of RAI-3 Expression in Cells
[0523] RAI-3 was tagged at the C-terminus using the Flag epitope
and was inserted into the pcDNA3.1 Hygro.TM. expression vector, as
described herein. Immunocytochemistry of CHO/NFAT G alpha 15 cell
lines transfected with the Flag-tagged RAI-3 construct with FITC
conjugated anti-Flag monoclonal antibody demonstrated that RAI-3
was indeed expressed in the cells. (FIG. 23B). Briefly, CHO/NFAT G
alpha 15 cell lines were transfected with the pcDNA3.1
Hygro.TM./RAI-3-Flag vector, fixed with 70% methanol, and
permeablized with 0.1% TritonX-100. The cells were then blocked
with 1% Serum and incubated with a FITC-conjugated anti-Flag
monoclonal antibody at 1:50 dilution in PBS-Triton. The cells were
then washed several times with PBS-Triton, overlayed with mounting
solution, and fluorescent images were captured. The control cell
line, i.e., a non-transfected CHO/NFAT G alpha 15 cell line,
exhibited no detectable background fluorescence. (FIG. 23A). The
results showed that RAI-3 was expressed in these cells.
Screening Paradigm
[0524] The Aurora Beta-Lactamase technology provides a clear path
for identifying agonists and antagonists of the RAI-3 polypeptide.
Cell lines that exhibit a range of constitutive coupling activity
can be identified by sorting RAI-3 transfected cell lines using the
FACS Vantage SE. (See, FIGS. 23A-D). For example, cell lines that
have been sorted as described herein were demonstrated to have an
intermediate level of orphan GPCR expression, which also correlates
with an intermediate coupling response, using the LJL analyst. Such
cell lines can provide the opportunity to screen, indirectly, for
both agonists and antagonists of RAI-3 by identifying either
antagonists (inhibitors) that block the beta lactamase response, or
agonists that increase the beta lactamase response. As described
hereinabove, modulating the expression level of beta lactamase
directly correlates with the level of cleaved CCR2 substrate. For
example, this screening paradigm has been shown to work for the
identification of modulators of a known GPCR, 5HT6, that couples
through Adenylate Cyclase, in addition to the identification of
modulators of the 5HT2c GPCR that couples through changes in
[Ca.sup.2+].sub.i.
[0525] The data presented in FIGS. 23A-D represent cell lines that
were engineered with the desired pattern of RAI-3 expression to
enable the identification of potent small molecule agonists and
antagonists. RAI-3 modulator screens can be carried out using a
variety of high throughput methods known in the art. Preferred is
the use of the fully automated Aurora UHTSS system. In FIG. 24A,
the uninduced orphan transfected CHO/NFAT G alpha 15 cell line
represents the relative background level of Beta Lactamase
expression. Following treatment with a cocktail of 1 .mu.M
Thapsigargin, and 100 nM PMA (FIG. 24B; T/P), the cells fully
activate the NFAT response element, thus demonstrating the dynamic
range of the assay. FIG. 24C represents an orphan transfected
CHO/NFAT G alpha 15 cell line that shows an intermediate level of
beta lactamase expression post T/P stimulation, while FIG. 24D
represents an orphan transfected CHO/NFAT G alpha 15 cell line that
shows a high level of beta lactamase expression post T/P
stimulation.
[0526] M. Cell Staining
[0527] Surface expression of the of the FLAG-RAI-3 was detected by
plating cells onto glass chamber slides (VWR Scientific,
Bridgeport, N.J.) at .about.75% confluency. Cells were washed four
times with 1.times.TBS. Cell surface expression was detected after
incubating the cells with an anti-FLAG M2 monoclonal antibody-FITC
conjugate (Sigma, St. Louis, Mo.) at 0.5 .mu.g/mL in TBS with 3%
nonfat dry milk, and then washing five times with 1.times.TBS.
Cells were visualized under the microscope using fluorescence
illumination.
[0528] N. Treatment of Cells With All-Trans Retinoic Acid
(ATRA)
[0529] 1.times.10.sup.6 cells of each of the HEK 293, H292 and
BEAS-2B cell lines were seeded into two (replicate) 100 mM cell
culture dishes containing 20 ml of RPMI complete medium which
contained L-glutamine, 10% fetal bovine serum and 1%
Penicillin-Streptomycin (Gibco/BRL). To one 100 mM dish, 0.2 .mu.l
of DMSO were added. To the other 100 mM dish, 0.2 .mu.l of 10 mM
ATRA (Sigma R-2625, St. Louis, Mo.) were added to a final
concentration of 1 nM. After 24 hours at 37.degree. C. and 5%
CO.sub.2, cells were lysed with Buffer RLT (Qiagen, Hilden,
Germany) and total RNA was harvested pursuant to the Rneasy Midi
Kit protocol (Qiagen, Hilden, Germany). RAI-3 messenger RNA levels
were measured by Real-time PCR as described below in Example 1
(N).
[0530] O. Real-Time PCR
[0531] After treatment of cells with ATRA for 24 hours as described
above, real-time PCR was performed using the following primers:
8 Primer set #1 RAI-3-105F: ccacacattttcagctgcaga (SEQ ID NO: 45)
and RAI-3-158R: gtgggatggagaattccttttg. (SEQ ID NO: 46) Primer set
#2 RAI-3-102F: attccacacattttcagctgca; (SEQ ID NO: 47) and
RAI-3-155R: ggatggagaattccttttggg. (SEQ ID NO: 48)
[0532] SYBR Green PCR amplification was performed on an ABI PRISM
7700 Sequence Detection System (PE Applied Biosystems, Foster City,
Calif.), and the reaction was carried out using SYBR Green PCR Core
reagents (PE Applied Biosystems). Real time PCR was carried out at
40 cycles with the following parameters: 95.degree. C. for 15
seconds and 60.degree. C. for 60 seconds, with a pre-incubation
period of 50.degree. C. for 2 minutes, followed by 95.degree. C.
for 10 minutes. All amplification was normalized to .beta.-actin
gene amplification in the linear portion of the amplification
curves. Data were then expressed as a fold increase over a
reference tissue or cell type. RAI-3 message (mRNA) levels were
found to increase in response to ATRA. In cells in which there was
a high basal level of RAI-3 expression, e.g., H292 cells, there was
also a modest, but measurable increase in RAI-3 mRNA levels.
[0533] P. Antibodies
[0534] For producing antibodies, the following RAI-3 peptides were
synthesized (W.M. Keck Biotechnology Resource Center, New Haven,
Conn.):
9 WHI5534: acetyl-CLTMNRTNVNVFSELSAPRRNEDFV-conh2, (25 residues),;
(SEQ ID NO: 49) WHI5535: acetyl-CMLPDFDRRWDDTTLSSA-conh2- , (18
residues),; (SEQ ID NO: 50) and WHI5536:
acetyl-CKPQLVKKSYGVNERAYSQEE-conh2, (21 residues),. (SEQ ID NO:
51)
[0535] Peptides were conjugated to maleimide-activated KLH (keyhole
limpet hemocyanin) carrier protein, (Pierce, Rockford, Ill.) via
cysteine residues using methods conventionally known in the art.
Conjugated peptides as immunogens are injected into rabbits to
generate polyclonal anti-RAI-3 antibodies comprising antisera using
conventional methods (e.g., as described by M. I. Becker et al.,
Antibodies: A Laboratory Manual, Ed. E. Harlow, Cold Spring Harbor
(CSH) Laboratory, CSH, New York, Chapter 5, pp. 56-100, 1998) and
into mice for the production of monoclonal antibodies by known
methods (e.g., Kohler and Milstein, 1975, Nature, 256:495). In
addition, phage display antibodies can be generated as known and
practiced in the art (e.g., Tissue Antigens (2000) 56:1-9 and JMB
(2000) 296:57-86).
[0536] Q. Antisense
[0537] Antisense oligonucleotides were determined and prepared by
Sequitur (Natick, Mass.) based upon the RAI-3 nucleic acid
sequence. Antisense oligos were tested in the A549 cell line (ATCC)
and in HMVECs as described herein in Examples 2 and 3.
[0538] R. Gene Chip "Affy" Methods
[0539] The Affymetrix human U95v2 A, B, and C chips were probed
with biotinylated in-vitro transcription product prepared from
sample RNA as described (see: Protocol for Affymetrix Gene Chip
Expression). Hybridization, wash, and Phycoerythrin streptavidin
staining were performed using the Affymetrix hybridization oven and
fluidics workstation per the manufacturer's protocols (Chapter 6 of
Affymetrix GeneChip Expression Analysis Manual, revision 2).
Stained chips were scanned on the Affymetrix GeneChip scanner, and
data were analyzed using the Affymetrix GeneChip software to
determine the specifically hybridizing signal for each gene.
Example 2
Method of Confirming the Functional Relevance of the RAI-3
Polynucleotide and Polypeptide to the I.kappa.B/NF-.kappa.B Pathway
Through the Application of Antisense Oligonucleotide
Methodology
[0540] Antisense molecules or nucleic acid sequences complementary
to the RAI-3 protein-encoding sequence, or any part thereof, were
used to decrease or to inhibit the expression of naturally
occurring RAI-3. Although the use of antisense or complementary
oligonucleotides comprising about 15 to 35 base-pairs is described,
essentially the same procedure is used with smaller or larger
nucleic acid sequence fragments.
[0541] An oligonucleotide based on the coding sequence of RAI-3
protein, as shown in FIGS. 10A and 10B, 11B-C and/or as depicted in
SEQ ID NO:2, for example, is used to inhibit expression of
naturally occurring RAI-3. The complementary oligonucleotide is
typically designed from the most unique 5' sequence and is used
either to inhibit transcription by preventing promoter binding to
the coding sequence, or to inhibit translation by preventing the
ribosome from binding to the RAI-3 protein-encoding transcript.
However, it is to be understood that other regions of the RAI-3
sequence may also be targeted.
[0542] Using an appropriate portion of a 5' sequence of SEQ ID
NO:2, an effective antisense oligonucleotide includes any of about
15 to 35 nucleotides spanning the region which translates into the
signal or 5' coding sequence, among other regions, encoding the
RAI-3 polypeptide as shown in FIGS. 11A-11C (SEQ ID NO:3).
Appropriate oligonucleotides were designed using OLIGO 4.06
software and the RAI-3 protein coding sequence (SEQ ID NO:2).
Preferred oligonucleotides are deoxyribonucleotide-, or chimeric
deoxyribonucleotide/ribonucleotide-based and are provided below.
The oligonucleotides were synthesized using chemistry essentially
as described in U.S. Pat. No. 5,849,902; which is hereby
incorporated herein by reference in its entirety. RAI-3 antisense
oligomers as used in the experiments described in this example are
presented in Table 5 below:
10TABLE 5 Oligo ID# Sequence 15689 uuccaguuccacggcacuucaugcuu (SEQ
ID NO: 52) 15692 guccaguccgaugaugaaggcgaagu (SEQ ID NO: 53) 15694
ultramer Contains equimolar concentrations of the following
sequences: 15689: uuccaguuccacggcacuucaugcuu; (SEQ ID NO: 52)
15692: guccaguccgaugaugaaggcgaagu; (SEQ ID NO: 53) 15696:
caguuguuauaaaggcggcccucgcu; (SEQ ID NO: 54) 15697:
uuguagccauucuggacccuagugcu; (SEQ ID NO: 55) and 15698:
ucuuccagcccgugaaggaaccacau (SEQ ID NO: 56) 15706 ultramer Contains
equimolar concentrations of the following sequences: control*
15701: accuugaccuuauccgcacaggagau; (SEQ ID NO: 57) 15702:
gagccuccccgggaauauuguugacu; (SEQ ID NO: 58) 15703:
gcugaucccaggucuuaccgauguuu; (SEQ ID NO: 59) 15704:
acaccaaggaagugcccgaccuucu; (SEQ ID NO: 60) and 15705:
gacugaaacuggcguccacccuacuu (SEQ ID NO: 61) *The initial fold change
was compared to the average of 3 ultramer controls. The fold change
compared to the RAI-3 ultramer control was 0.55.
[0543] In accordance with this invention, the RAI-3 polypeptide has
been shown to be involved in the regulation of mammalian
NF-.kappa.B and apoptosis pathways. Subjecting cells to an
effective amount of a pool of all five of the above-listed
antisense oligonucleotides resulted in a significant increase in
I.kappa.B.alpha. expression/activity, thus providing evidence that
RAI-3 at least regulates the activity and/or expression of
I.kappa.B.alpha., either directly or indirectly. Moreover, the
results suggest that RAI-3 is involved in the negative regulation
of NF-.kappa.B/I.kappa.B.alpha. activity and/or expression, either
directly or indirectly.
[0544] The I.kappa.B.alpha. assay used is described below and was
based upon the analysis of I.kappa.B.alpha. activity as a
downstream marker for proliferative signal transduction events.
Transfection of Post-Quiescent A549 Cells With Antisense
Oligonucleotides
[0545] The materials needed for this work include the following:
A549 cells maintained in DMEM cell culture medium with high glucose
(Gibco-BRL) supplemented with 10% Fetal Bovine Serum, 2 mM
L-Glutamine, and 1.times. penicillin/streptomycin; Opti-MEM
(Gibco-BRL); Lipofectamine 2000 (Invitrogen); Antisense oligomers
(Sequitur); Polystyrene tubes; and Tissue culture treated
plates.
[0546] Quiescent cells were prepared as follows:
[0547] On Day 0: 300,000 A549 cells were seeded in a T75 tissue
culture flask in 10 ml of A549 cell culture medium and incubated in
at 37.degree. C., 5% CO.sub.2 in a humidified incubator for 48
hours.
[0548] On Day 2: The T75 flasks were rocked to remove any loosely
adherent cells, and the A549 growth medium was removed and
replenished with 10 ml of fresh A549 medium. The cells were
cultured for six days without changing the medium to create a
quiescent cell population.
[0549] On Day 8: Quiescent cells were plated in multi-well format
and transfected with antisense oligonucleotides.
[0550] A549 cells were transfected according to the following
protocol:
[0551] The T75 flask containing quiescent population of A549 cells
was trypsinized.
[0552] The cells were counted and seeded into 24-well plates with
6.times.10.sup.4 quiescent A549 cells per well.
[0553] The cells were allowed to adhere to the tissue culture plate
(approximately 4 hours).
[0554] The cells were transfected with antisense and control
oligonucleotides according to the following protocol:
[0555] A 10.times. stock of lipofectamine 2000 (10 .mu.g/ml is
10.times.) was prepared, and diluted lipid was allowed to stand at
RT for 15 minutes. The stock solution of lipofectamine 2000 was 1
mg/ml. The 10.times. solution for transfection was 10 .mu.g/ml. To
prepare the 10.times. solution, 10 .mu.l of lipofectamine 2000
stock were diluted per 1 ml of Opti-MEM (serum free medium).
[0556] A 10.times. stock of each oligomer was prepared to be used
in the transfection. Stock solutions of oligomers were at 100 .mu.M
in 20 mM HEPES, pH 7.5. A 10.times. concentration of oligomer was
0.25 .mu.M. To prepare the 10.times. solutions, 2.5 .mu.l of
oligomer were diluted per 1 ml of Opti-MEM. Equal volumes of the
10.times. lipofectamine 2000 stock and the 10.times. oligomer
solutions were mixed well, and incubated for 15 minutes at room
temperature to allow complexation of the oligomer and lipid. The
resulting mixture was 5.times.. After the 15 minute complexation, 4
volumes of full growth medium was added to the oligomer/lipid
complexes (solution was 1.times.). The medium was aspirated from
the cells, and 0.5 ml of the 1.times. oligomer/lipid complexes were
added to each well. The cells were incubated for 16-24 hours at
37.degree. C. in a humidified CO.sub.2 incubator. Thereafter, cell
pellets were harvested for RNA isolation and TaqMan analysis of
downstream marker genes.
[0557] TaqMan Reactions were carried out as follows:
[0558] Quantitative RT-PCR analysis was performed on total RNA
preparations that had been treated with DNaseI or Poly A selected
RNA. The DnaseI treatment can be performed using methods known in
the art; preferably Qiagen's RNeasy kit is used to purify the RNA
samples, in which DNAse I treatment is performed on the column.
Briefly, a master mix of reagents was prepared according to the
following Table 6:
11TABLE 6 Dnase I Treatment Reagent Per r'xn (in .mu.L) 10x Buffer
2.5 Dnase I (1 unit/.mu.l @ 1 unit per .mu.g sample) 2 DEPC
H.sub.2O 0.5 RNA sample @ 0.1 .mu.g/ul (2-3 .mu.g total) 20 Total
25
[0559] Next, 5 .mu.l of master mix was aliquoted into the wells of
a 96-well PCR reaction plate (PE part # N801-0560). RNA samples
were adjusted to 0.1 .mu.g/.mu.l with DEPC treated H.sub.2O (if
necessary), and 20 .mu.l were added to the aliquoted master mix for
a final reaction volume of 251 .mu.l. The wells were capped using
strip well caps (PE part # N801-0935), placed in a plate centrifuge
(Beckman Instruments), and briefly centrifuged to collect all
volume in the bottom of the wells. Generally, a short spin up to
500 rpm in a Sorvall RT centrifuge was sufficient. The plates were
incubated at 37.degree. C. for 30 minutes. Thereafter, an equal
volume of 0.1 mM EDTA in 10 mM Tris was added to each well, and
heat inactivated at 70.degree. C. for 5 minutes. The plates were
stored at -80.degree. C. following inactivation.
[0560] The reverse transcriptase (RT) reaction was carried out as
follows:
[0561] A master mix of reagents was prepared according to the
following Table 7:
12TABLE 7 RT reaction RT No RT Reagent Per Rx'n (in .mu.l) Per Rx'n
(in .mu.l) 10x RT buffer 5 2.5 MgCl.sub.2 11 5.5 DNTP mixture 10 5
Random Hexamers 2.5 1.25 Rnase inhibitors 1.25 0.625 RT enzyme 1.25
-- Total RNA 500 ng (100 ng no RT) 19.0 max 10.125 max DEPC
H.sub.2O -- -- Total 50 .mu.L 25 .mu.L
[0562] Samples were adjusted to a concentration such that 500 ng of
RNA was added to each RT reaction (100 ng for the no RT). A maximum
of 19 .mu.l can be added to the RT reaction mixture (10.125 .mu.l
for the no RT.) Any remaining volume up to the maximum values was
filled with DEPC treated H.sub.2O, so that the total reaction
volume was 50 .mu.l (RT) or 25 .mu.l (no RT). 37.5 .mu.l of master
mix (22.5 .mu.l of no RT master mix) were aliquoted into the wells
of a 96-well PCR reaction plate (PE part # N801-0560), and the RNA
sample was added for a total reaction volume of 50 .mu.l (25 .mu.l,
no RT) in each well. Control samples were loaded into two or even
three different wells in order to have enough template for
generation of a standard curve.
[0563] The wells were capped using strip well caps (PE part #
N801-0935), placed in a plate centrifuge, and centrifuged briefly
to collect all volume in the bottom of the wells. Generally, a
short centrifugation (e.g., up to 500 rpm) in a Sorvall RT
centrifuge was sufficient. For the RT-PCR reaction, the following
thermal profile was used: 25.degree. C. for 10 min.; 48.degree. C.
for 30 min.; 95.degree. C. for 5 min.; 4.degree. C. hold (for 1
hour). The plate was stored at -20.degree. C. or lower upon
completion.
[0564] The TaqMan reaction (Template comes from RT plate) was
performed as follows: A master mix was prepared according to the
following Table 8:
13TABLE 8 TaqMan reaction (per well) Reagent Per Rx'n (in .mu.l)
TaqMan Master Mix 4.17 100 .mu.M Probe (SEQ ID NO: 64) .025 100
.mu.M Forward primer (SEQ ID NO: 62) .05 100 .mu.M Reverse primer
(SEQ ID NO: 63) .05 Template -- DEPC H.sub.2O 18.21 Total 22.5
[0565] The primers used for the RT-PCR reaction were as
follows:
I.kappa.B.alpha. Primer and Probes
[0566]
14 Forward Primer: gaggatgaggagagctatgacaca; (SEQ ID NO: 62)
Reverse Primer: ccctttgcactcataacgtcag; (SEQ ID NO: 63) and TaqMan
Probe: aaacacacagtcatcatagggcagctcgt. (SEQ ID NO: 64)
[0567] Using a Gilson P-10 repeat pipettor, 22.5 .mu.l of master
mix was aliquoted into each well of a 96-well optical plate. Then,
2.5 .mu.l of sample was added to individual wells using the P-10
pipettor. Generally, RT samples were run in triplicate with each
primer/probe set used, and the "no RT" samples were run once with
only one primer/probe set, often GAPDH (or other internal control).
A standard curve was constructed and loaded onto the plate. The
curve has five points plus one no template control (NTC, =DEPC
treated H.sub.2O). The curve was made with a high point of 50 ng of
sample (twice the amount of the RNA in unknowns), and successive
samples of 25, 10, 5, and 1 ng. The curve was made from a control
sample(s) (see above).
[0568] The wells were capped using optical strip well caps (PE part
# N801-0935), placed in a plate centrifuge, and centrifuged to
collect all volume in the bottom of the wells. Generally, a short
centrifugation (up to 500 rpm) in a Sorvall RT centrifuge was
sufficient. The plates were loaded onto a PE 5700 sequence
detector, taking precaution that the plate was aligned properly
with the notch in the upper right hand corner. The lid was
tightened down and run using the 5700 and 5700 quantification
program and the SYBR probe using the following thermal profile:
50.degree. C. for 2 min.; 95.degree. C. for 10 min.; and the
following profile for 40 cycles: 95.degree. C. for 15 sec.; and
60.degree. C. for 1 min., after which the reaction volume was
changed to 25 .mu.l.
[0569] Once the reaction was complete, a manual threshold of around
0.1 was set to minimize the background signal. Additional
information relative to operation of the GeneAmp 5700 machine may
be found in reference to the following manuals: "GeneAmp 5700
Sequence Detection System Operator Training CD"; and the "User's
Manual for 5700 Sequence Detection System"; available from
Perkin-Elmer and hereby incorporated by reference herein in their
entirety.
Example 3
Method of Confirming the Functional Relevance of the RAI-3
Polynucleotide and Polypeptide to the NF.kappa.B Pathway Through
the Application of Antisense OLIGONUCLEOTIDE METHODOLOGY
[0570] Antisense molecules or nucleic acid sequences complementary
to the RAI-3 protein-encoding sequence, or any part thereof, were
used to decrease or to inhibit the expression of naturally
occurring RAI-3. Although the use of antisense or complementary
oligonucleotides comprising about 15 to 35 base-pairs is described,
essentially the same procedure is used with smaller or larger
nucleic acid sequence fragments.
[0571] An oligonucleotide based on the nucleic acid coding sequence
of the RAI-3 protein, as shown in FIGS. 10A and 10B, 11B-11C,
and/or as depicted in SEQ ID NO:2, for example, is used to inhibit
expression of naturally occurring RAI-3. The complementary
oligonucleotide is typically designed from the most unique 5'
sequence and is used either to inhibit transcription by preventing
promoter binding to the coding sequence, or to inhibit translation
by preventing the ribosome from binding to the RAI-3
protein-encoding transcript. However, it is to be understood that
other regions of the RAI-3 sequence may also be targeted.
[0572] Using an appropriate portion of a 5' sequence of SEQ ID
NO:2, an effective antisense oligonucleotide includes any of about
15 to 35 nucleotides spanning the region which translates into the
signal or 5' RAI-3 coding sequence, among other regions, of the
RAI-3 polypeptide as shown in FIGS. 11A-11C, (SEQ ID NO:3).
Appropriate oligonucleotides were designed using OLIGO 4.06
software and the RAI-3 protein coding sequence (SEQ ID NO:2).
Preferred oligonucleotides are deoxyribonucleotide-, or chimeric
deoxyribonucleotide/ribonucleotide-based and are provided below.
The oligonucleotides were synthesized using chemistry essentially
as described in U.S. Pat. No. 5,849,902; which is hereby
incorporated herein by reference in its entirety. Antisense
oligomers as used in the experiments described in this example are
presented in Table 9 below:
15TABLE 9 Oligo ID# Sequence 15689 uuccaguuccacggcacuucaugcuu (SEQ
ID NO: 52) 15692 guccaguccgaugaugaaggcgaagu (SEQ ID NO: 53) 15694
ultramer Contains equimolar concentrations of the following
sequences: 15689: uuccaguuccacggcacuucaugcuu; (SEQ ID NO: 52)
15692: guccaguccgaugaugaaggcgaagu; (SEQ ID NO: 53) 15696:
caguuguuauaaaggcggcccucgcu; (SEQ ID NO: 54) 15697:
uuguagccauucuggacccuagugcu; (SEQ ID NO: 55) and 15698:
ucuuccagcccgugaaggaaccacau (SEQ ID NO: 56) 15706 ultramer Contains
equimolar concentrations of the following sequences: control 15701:
accuugaccuuauccgcacaggagau; (SEQ ID NO: 57) 15702:
gagccuccccgggaauauuguugacu; (SEQ ID NO: 58) 15703:
gcugaucccaggucuuaccgauguuu; (SEQ ID NO: 59) 15704:
acaccaaggaagugcccgaccuucu; (SEQ ID NO: 60) and 15705:
gacugaaacuggcguccacccuacuu (SEQ ID NO: 61) *: The initial fold
change was compared to the average of 3 ultramer controls. The fold
change compared to the RAI-3 ultramer control was 0.55.
[0573] According to the present invention, the RAI-3 polypeptide
has been shown to be involved in the regulation of mammalian
NF-.kappa.B and apoptosis pathways. Subjecting cells to an
effective amount of a pool of all five of the above-listed
antisense oligonucleotides resulted in a significant decrease in
E-selectin expression/activity in human microvascular endothelial
cells (HMVECs), thus providing evidence that RAI-3 at least
regulates the activity and/or expression of E-selectin, either
directly, or indirectly. Moreover, the results suggest that RAI-3
is involved in the positive regulation of
NF-.kappa.B/I.kappa.B.alpha. activity and/or expression, either
directly or indirectly. The NF-kB/E-selectin assay used is
described below and was based upon the analysis of E-selectin
activity as a downstream marker for inflammatory/proliferative
signal transduction events.
[0574] On Day 0, cell culture plates are coated with collagen. For
one cell culture plate, collagen (0.4 mg/ml) is stored at 4.degree.
C. until needed. To prepare the collagen solution for adding to the
plates, 112.5 .mu.l of glacial acetic acid is added to 13.5 ml of
H.sub.2O, and then 84.35 .mu.l of collagen is added to 13.5 ml of
acetic acid. 250 .mu.l of the collagen solution is added to each
well of the plate and the plate is incubated for 2 hours at room
temperature (final concentration of Type IV collagen (Sigma) is 2.5
.mu.g/ml). Collagen is removed and wells of the plate (Costar) are
rinsed with 500 .mu.l of 2.times.PBS. 200 .mu.l of cell culture
medium (EBM-2 supplemented with EGM-2 MV, Clonetics, San Diego,
Calif.) is added to the wells and the plate is kept at 37.degree.
C. until read for use. HMVEC cells are then plated at
3.times.10.sup.4 cells/well in 48 well plates.
[0575] On Day 1, HMVEC cells are transfected using 1 g/ml of
Lipofectamine 2000 lipid and 25 nM of antisense oligonucleotide
according to the following protocol: The materials needed include:
HMVEC cells maintained in EBM-2 (Clonetics) supplemented with EGM-2
MV (Clonetics); Opti-MEM (Gibco-BRL); Lipofectamine 2000
(Invitrogen); Antisense oligomers (Sequitur), see above;
Polystyrene tubes; and tissue culture treated plates. A 10.times.
stock of Lipofectamine 2000 (10 .mu.g/ml is 10.times.) is prepared
and the diluted lipid is allowed to stand at room temperature for
15 minutes. (Stock solution of Lipofectamine 2000 is 1 mg/ml; a
10.times. solution for transfection is 10 .mu.g/ml). To prepare
10.times. solution, 10 .mu.l of Lipofectamine 2000 stock is diluted
per 1 ml of Opti-MEM (serum free medium). A 10.times. stock of each
oligomer to be used in the transfection is then prepared. Stock
solutions of oligomers are at 100 .mu.M in 20 mM HEPES, pH 7.5. A
10.times. concentration of oligomer is 0.25 .mu.M. To prepare the
10.times. solutions, 2.5 .mu.l of oligomer is diluted per 1 ml of
Opti-MEM. Equal volumes of the 10.times. Lipofectamine 2000 stock
and the 10.times. oligomer solutions are mixed well and incubated
for 15 minutes at RT to allow complexation of the oligomer and
lipid. The resulting mixture is 5.times.. After the 15 minute
complexation, 4 volumes of full growth medium is added to the
oligomer/lipid complexes (the solution is now 1.times.). The medium
is then aspirated from the cells, and 0.5 ml of the 1.times.
oligomer/lipid complexes is added to each well. The cells are
incubated for 16-24 hours at 37.degree. C. in a humidified CO.sub.2
incubator. Oligomer update is evaluated by fluorescent microscopy.
In addition, the cell viability is evaluated by performing staining
analysis (CellTiter 96 Aqueous One, Promega, Madison, Wis.).
[0576] On Day 2, the TNF stimulation is carried out. TNF is stored
at -70.degree. C. in 10 .mu.l aliquots at concentration of 50
.mu.g/ml. Two fold dilutions of TNF are made by first adding 10
.mu.l to 1 ml of EBM-2/EGM-2 MV medium to yield 500 ng/ml of the
TNF aliquots. Then 300 .mu.l are added to 15 ml of EBM-2/EGM-2 MV
medium to yield a 10 ng/ml TNF solution. 250 .mu.l of this final
solution is added to each well containing HMVECs, and the cells are
stimulated for 6 hours at 37.degree. C. After stimulation, 100
.mu.l of the cell supernatant is removed from each well and stored
at -70.degree. C. The remaining medium is then removed from each
well. The cells are then titered, as follows: 200 .mu.l of fresh
medium is added to each well. 50 .mu.l CTR (cell titer reagent) is
added to each well. Two blank wells are included as controls with
medium alone and CTR. The cells are incubated at 37.degree. C. for
about 90 minutes. Next, 100 .mu.l of supernatant is removed from
each well and placed in a 96 well plate. The absorbance is then
read at 490 nm on spectrophotometer.
[0577] During the 90 minute incubation, a glutaraldehyde solution
is prepared, as follows: 140 .mu.l of glutaraldehyde is added to 14
ml of 1.times.PBS (0.5% glutaraldehyde). Blocking buffer is also
prepared. For one plate, 50 ml is prepared, as follows: 46.5 ml
1.times.PBS is mixed with 1.5 ml of goat serum (Sigma-Aldrich),
(stored at -20.degree. C.) and 2 ml 0.5 M EDTA. After the cell
titer is complete, the remaining medium is removed and 250 .mu.l of
glutaraldehyde solution is added to each well. A 10 minute
incubation at 4.degree. C. is performed. The plates are then
flicked, and 500 .mu.l of blocking buffer is added to each well.
The plates are then Incubated at 4.degree. C. overnight.
[0578] On Day 3, an E-selectin solution is prepared as follows:
22.5 .mu.l of 100 .mu.g/ml stock is added to 9 ml of blocking
buffer. 150 .mu.l of the resulting solution is added to each well,
and incubated for 1 hour at 37.degree. C. The wells are washed 4
times with cold PBS; the plates are flicked between washes; and
then aspirated to remove remaining PBS. Horse radish peroxidase
(HRP) solution is prepared by adding 2.25 .mu.l of HRP (0.87 mg/ml,
stored at 4.degree. C.) to 9 ml of blocking buffer. 150 .mu.l of
the HRP solution is added to each well, and incubated for 1 hour at
37.degree. C. The wells are washed 4 times with cold PBS; the
plates are flicked between washes and then aspirated at the end to
remove remaining PBS. 150 .mu.l peroxidase color reagent is added
to each well for development. The plates are allowed to develop for
about 5 minutes and stopped with 150 .mu.l of 1N H.sub.2SO.sub.4.
100 .mu.l/well of solution is then transferred from each well to a
96 well plate, and the OD read at 450 nm. The positives are then
noted. Antisense to RAI-3 was shown to result in inhibition of
E-selectin expression in HMVEC cells in the above assay. (FIG.
14B).
Example 4
Method of Determining Alterations in a Gene Corresponding to an
RAI-3 Polynucleotide
[0579] RNA isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease) is
isolated. cDNA is then generated from these RNA samples using
protocols known in the art. (See, e.g., J. Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989). The cDNA is used as a
template for PCR, employing primers surrounding the regions of
interest in SEQ ID NO:2, or SEQ ID NO:18. Suggested PCR conditions
consist of 35 cycles at 95.degree. C. for 30 seconds; 60-120
seconds at 52.degree. C.-58.degree. C.; and 60-120 seconds at
70.degree. C., using buffer solutions described, for example, in
Sidransky et al., 1991, Science, 252:706.
[0580] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies, Madison, Wis.). The
intron-exon borders of selected exons is also determined and
genomic PCR products analyzed to confirm the results. PCR products
harboring suspected mutations are then cloned and sequenced to
validate the results of the direct sequencing. PCR products are
cloned into T-tailed vectors as described in Holton et al., 1991,
Nucleic Acids Research, 19:1156 and are sequenced with T7
polymerase (United States Biochemical). Affected individuals are
identified by mutations not present in unaffected individuals.
[0581] Genomic rearrangements also serve as a method of determining
alterations in a gene corresponding to a polynucleotide. Genomic
clones are nick-translated with digoxigenindeoxy-uridine
5'-triphosphate (Boehringer Manheim), and FISH is performed as
described in Johnson et al., 191, Methods Cell Biol., 35:73-99.
Hybridization with the labeled probe is carried out using a vast
excess of human cot-I DNA for specific hybridization to the
corresponding genomic locus. Chromosomes are counter stained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson et al., 1991, Genet. Anal. Tech.
Appl., 8:75). Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, N.C.) Chromosome
alterations of the genomic region hybridized by the probe are
identified as insertions, deletions, and translocations. These
alterations are used as diagnostic markers for an associated
disease.
Example 5
Alternative Methods of Detecting Polymorphisms in an RAI-3
Polynucleotide
Preparation of Samples
[0582] Polymorphisms are detected in a target nucleic acid from an
individual being analyzed. To assay genomic DNA, virtually any
biological sample (other than pure red blood cells) is suitable.
For example, convenient tissue samples include whole blood, semen,
saliva, tears, urine, fecal material, sweat, buccal, skin and hair.
To assay cDNA or mRNA, the tissue sample must be obtained from an
organ in which the target nucleic acid is expressed. For example,
if the target nucleic acid is a cytochrome P450, the liver is a
suitable source.
[0583] Many of the methods described below require amplification of
DNA from target samples. This can be accomplished by methods known
in the art, particularly, for example, PCR. See generally, PCR
Technology: Principles and Applications for DNA Amplification,
(ed.) H. A. Erlich, Freeman Press, NY, N.Y., 1992; PCR Protocols: A
Guide to Methods and Applications (eds.) Innis, et al., Academic
Press, San Diego, Calif., 1990); Mattila et al., 1991, Nucleic
Acids Res., 19: 4967; Eckert et al., 1991, PCR Methods and
Applications 1; PCR (eds.) McPherson et al., IRL Press, Oxford; and
U.S. Pat. No. 4,683,202. Other suitable amplification methods
include the ligase chain reaction (LCR) (See, e.g., Wu and Wallace,
1989, Genomics, 4:560; Landegren et al., 1988, Science, 241:1077);
transcription amplification (Kwoh et al., 1989, Proc. Natl. Acad.
Sci. USA, 86:1173); self-sustained sequence replication (Guatelli
et al., 1990, Proc. Nat. Acad. Sci. USA, 87:1874); and nucleic acid
based sequence amplification (NASBA). The latter two amplification
methods involve isothermal reactions based on isothermal
transcription, which produce both single stranded RNA (ssRNA) and
double stranded DNA (dsDNA) as the amplification products in a
ratio of about 30 or 100 to 1, respectively. Additional methods of
amplification are known in the art or are described elsewhere
herein.
Detection of Polymorphisms in Target DNA
[0584] There are two distinct types of analyses of target DNA for
detecting polymorphisms. The first type of analysis, sometimes
referred to as de novo characterization, is carried out to identify
polymorphic sites not previously characterized (i.e., to identify
new polymorphisms). This analysis compares target sequences in
different individuals with identify points of variation, i.e.,
polymorphic sites. By analyzing groups of individuals representing
the greatest ethnic diversity among humans, and the greatest breed
and species variety in plants and animals, patterns characteristic
of the most common alleles/haplotypes of the locus can be
identified, and the frequencies of such alleles/haplotypes in the
population can be determined. Additional allelic frequencies can be
determined for subpopulations characterized by criteria such as
geography, race, or gender. The de novo identification of
polymorphisms of the invention is described further herein.
[0585] The second type of analysis determines which form(s) of a
characterized (known) polymorphism are present in individuals
undergoing testing. Additional methods of analysis are known in the
art or are described elsewhere herein.
Allele-Specific Probes
[0586] The design and use of allele-specific probes for analyzing
polymorphisms is described, for example, by Saiki et al., 1986,
Nature, 324:163-166; Dattagupta, EP 235,726; and Saiki, WO
89/11548. Allele-specific probes can be designed that hybridize to
a segment of target DNA from one individual but do not hybridize to
the corresponding segment from another individual due to the
presence of different polymorphic forms in the respective segments
from the two individuals. Hybridization conditions should be
sufficiently stringent that there is a significant difference in
hybridization intensity between alleles, and preferably an
essentially binary response, in which a probe hybridizes to only
one of the alleles. Some probes are designed to hybridize to a
segment of target DNA such that the polymorphic site aligns with a
central position (e.g., in a 15-mer at the 7 position; in a 16-mer,
at either the 8 or 9 position) of the probe. This type of probe
design achieves good discrimination in hybridization between
different allelic forms. Allele-specific probes are often used in
pairs, with one member of the pair showing a perfect match to a
reference form of a target sequence and the other member showing a
perfect match to a variant form. Several pairs of probes can then
be immobilized on the same support for simultaneous analysis of
multiple polymorphisms within the same target sequence.
Tiling Arrays
[0587] Polymorphisms can also be identified by hybridization to
nucleic acid arrays, some examples of which are described in WO
95/11995. The same arrays, or different arrays, can be used for the
analysis of characterized polymorphisms. WO 95/11995 also describes
sub-arrays that are optimized for the detection of a variant form
of a pre-characterized polymorphism. Such a sub-array contains
probes designed to be complementary to a second reference sequence,
which is an allelic variant of the first reference sequence. The
second group of probes is designed by the same principles as
described, except that the probes exhibit complementarity to the
second reference sequence. The inclusion of a second group (or
further groups) can be particularly useful for analyzing short
subsequences of the primary reference sequence in which multiple
mutations are expected to occur within a short distance
commensurate with the length of the probes (e.g., two or more
mutations within 9 to 20 or more bases).
Allele-Specific Primers
[0588] An allele-specific primer hybridizes to a site on target DNA
overlapping a polymorphism and only primes the amplification of an
allelic form to which the primer exhibits perfect complementarity.
See, e.g., Gibbs, 1989, Nucleic Acid Res., 17:2427-2448. An
allele-specific primer is used in conjunction with a second primer
which hybridizes at a distal site. Amplification proceeds from the
two primers, resulting in a detectable product which indicates that
the particular allelic form is present. A control is usually
performed with a second pair of primers, one of which shows a
single base mismatch at the polymorphic site, and the other of
which exhibits perfect complementarity to a distal site. The
single-base mismatch prevents amplification and no detectable
product is formed. The method works best when the mismatch is
included in the 3'-most position of the oligonucleotide aligned
with the polymorphism because this position is most destabilizing
elongation from the primer (see, e.g., WO 93/22456).
Direct-Sequencing
[0589] The direct analysis of the sequence of RAI-3 polymorphisms
according to this invention can be accomplished using either the
dideoxy chain termination method, or the Maxam--Gilbert method
(see, e.g., J. Sambrook et al., Molecular Cloning, A Laboratory
Manual (2nd Ed., CSHP, New York 1989); and Zyskind et al., 1988,
Recombinant DNA Laboratory Manual, (Acad. Press).
Denaturing Gradient Gel Electrophoresis
[0590] Amplification products generated using the polymerase chain
reaction can be analyzed by the use of denaturing gradient gel
electrophoresis. Different alleles can be identified based on the
different sequence-dependent melting properties and the
electrophoretic migration of DNA in solution. (e.g., Chapter 7, PCR
Technology. Principles and Applications for DNA Amplification,
(ed.) Erlich, W H. Freeman and Co, New York, 1992).
Single-Strand Conformation Polymorphism Analysis
[0591] Alleles of target sequences can be differentiated using
single-strand conformation polymorphism analysis, which identifies
base differences by alteration in electrophoretic migration of
single stranded PCR products, as described in Orita et al., 1989,
Proc. Nat. Acad. Sci. USA, 86:2766-2770. Amplified PCR products can
be generated as described above, and heated or otherwise denatured,
to form single stranded amplification products. Single-stranded
nucleic acids may refold or form secondary structures which are
partially dependent on the base sequence. The different
electrophoretic mobilities of single-stranded amplification
products can be related to base-sequence differences between
alleles of target sequences.
Single Base Extension
[0592] An alternative method for identifying and analyzing
polymorphisms is based on single-base extension (SBE) of a
fluorescently-labeled primer coupled with fluorescence resonance
energy transfer (FRET) between the label of the added base and the
label of the primer. Typically, the method, such as that described
by Chen et al., 1997, Proc. Natl. Acad. Sci. USA, 94:10756-61, uses
a locus-specific oligonucleotide primer labeled on the 5' terminus
with 5-carboxyfluorescein (F AM). This labeled primer is designed
so that the 3' end is immediately adjacent to the polymorphic site
of interest. The labeled primer is hybridized to the locus, and
single base extension of the labeled primer is performed with
fluorescently-labeled dideoxyribonucleotides (ddNTPs) in
dye-terminator sequencing fashion. An increase in fluorescence of
the added ddNTP in response to excitation at the wavelength of the
labeled primer is used to infer the identity of the added
nucleotide.
Example 6
Method of Genotyping Each RAI-3 SNP
Genomic DNA Preparation
[0593] Genomic DNA samples for genotyping are prepared using the
Purigene.TM. DNA extraction kit from Gentra Systems (Gentra
Systems, Inc., Minneapolis, Minn.). After preparation, DNA samples
are diluted to a 2 ng/.mu.l working concentration with TE buffer
(10 mM Tris-Cl, pH 8.0, 0.1 mM EDTA, pH 8.0) and stored in 1 ml 96
deep-well plates (VWR) at -20.degree. C. until use. Samples for
genomic DNA preparation may be obtained from the Coriell Institute
(Collingswood, N.J.), patients participating in a Bristol-Myers
Squibb (BMS) clinical study, from other sources known in the art,
or as otherwise described herein.
Genotyping
[0594] SNP genotyping reactions are performed using the
SNPStream.TM. system (Orchid Biosience, Princeton, N.J.) based on
genetic bit analysis (T. Nikiforov et al., 1994, Nucl. Acids Res.,
22:4167-4175). The regions including polymorphic sites are
amplified by PCR using a pair of primers (OPERON Technologies), one
of which can be phosphorothioated. 6 .mu.l of a PCR cocktail
containing 1.0 ng/.mu.l of genomic DNA, 200 .mu.M dNTPs, 0.5 .mu.M
forward PCR primer, 0.5 .mu.M reverse PCR primer
(phosphorothioated), 0.05 U/I Platinum Taq DNA polymerase
(LifeTechnologies), and 1.5 mM MgCl.sub.2. The PCR primer pairs
used for genotyping analysis can be designed using methods known in
the art in conjunction with the teachings described herein.
[0595] PCR reactions are set up in 384-well plates (MJ Research)
using a MiniTrak liquid handling station (Packard Bioscience). PCR
thermocycling can be performed under the following conditions in a
MJ Research Tetrad machine: step 1, 95 degrees for 2 min; step 2,
94 degrees for 30 min; step 3, 55 degrees for 2 min; step 4, 72
degrees for 30 sec; step 5, go back to step 2 for an additional 39
cycles; step 6, 72 degrees for 1 min; and step 7, 12 degrees
indefinitely. After thermocycling, the amplified samples are placed
in the SNPStream.TM. (Orchid Bioscience) machine, and the automated
genetic bit analysis (GBA) reaction (T. Nikiforov et al., Ibid.) is
performed. The first step of this reaction involves degradation of
one of the strands of the PCR products by T7 gene 6 exonuclease to
yield single-stranded products. The strand containing
phosphorothioated primer is resistant to T7 gene 6 nuclease, and is
not degraded by this enzyme. After digestion, the single-stranded
PCR products are subjected to an annealing step in which the single
stranded PCR products are annealed to the GBA primer on a solid
phase, and then subjected to the GBA reaction (single base
extension) using dideoxy-NTPs labeled with biotin or fluorescein.
The GBA primers are designed using methods known in the art, in
conjunction with the teachings of the present invention.
[0596] The present invention encompasses the substitution of
certain polynucleotides within the GBA primers with a
polynucleotide that can be substituted with a C3 linker (C3 spacer
phosphoramidite) during synthesis of the primer. Such linkers can
be obtained from Research Genetics; Sigma-Genosys; or Operon, for
example. Incorporation of the dideoxynucleotides into a GBA primer
is detected by use of a two color ELISA assay using
anti-fluorescein alkaline phosphatase conjugate and anti-biotin
horseradish peroxidase antibodies. Automated genotype calls are
made by GenoPak software (Orchid Bioscience). Manual correction of
automated calls can be performed upon inspection of the resulting
allelogram of each SNP.
Example 7
Method of Genotyping RAI-3 SNPs
[0597] The genotypes of the RAI-3 SNPs described hereinabove (e.g.,
Tables 1 and 4) can be obtained by genomic PCR amplification
followed by DNA sequencing. The PCR and sequencing primers are as
described herein. (see, e.g., Table 9) The first step involves PCR
amplification of the genomic DNA region containing the SNPs. The
PCR reaction mixture contains the following components:
16 10x PCR II Buffer* 2.5 .mu.l 25 mM MgCl.sub.2 2.5 .mu.l 10 mM
4dNTP Mix 0.4 .mu.l 5 U/.mu.l Taq Gold 0.4 .mu.l 20 .mu.M primer
mix** 0.4 .mu.l 5 ng/.mu.l Genomic DNA 3 .mu.l PCR dH.sub.2O 16
.mu.l Total Volume 25 .mu.l *Purchased from PE Applied Biosystems
(Foster City, CA) **Contains PCR forward primer and PCR reverse
primer. The names and sequences of these primers are described in
Table 10 below.
[0598] PCR was performed in the Tetrad PCR machine (MJ Research)
under the following conditions:
17 Step 1 94.degree. C., 10' Step 2 94.degree. C., 30" Step 3
60.degree. C., 30" Step 4 72.degree. C., 30" (steps 2-4 repeated 40
times) Step 5 72.degree. C., 7' Step 6 12.degree. C.
[0599] After the PCR reaction, 0.25 .mu.l of 10 units/.mu.l
exonuclease I and 4.8 .mu.l of deionized water was added and the
samples were incubated at 37.degree. C. for 45 minutes, and at
95.degree. C. for 15 minutes in succession.
[0600] After exonuclease I treatment, the samples were subjected to
DNA sequencing reactions and capillary electrophoresis on a PRISM
3700 electrophoresis apparatus (PE Applied Biosystems, Foster City,
Calif.) following the standard protocol as provided by the
manufacturer. M13 forward (M13F) and M13 reverse (M13R) primers
were used as DNA sequencing primers; the sequences of these M13
forward and reverse sequence primers are presented in Example 8
below. DNA sequencing results were analyzed by PolyPhred and Consed
softwares. (D. A. Nickerson et al., 1997, "Polyphred: automating
the detection and genotyping of single nucleotide substitutions
using fluorescence-based resequencing", Nucl. Acids Research,
25:2745-2751; see Polyphred website at the following address:
HyperText Transfer Protocol. (i.e., http)
droog.mbt.washington.edu/Polyph- red.HyperText Markup Language,
i.e., html). The positions of these SNPs can be identified using
the flanking sequence information provided in Table 10. The SNP
genotype in each person can be identified by visually inspecting
the DNA sequence trace of the corresponding SNP.
[0601] RAI-3 SNPs according to this invention, e.g., for use in the
diagnosis of COPD and related disorders, are presented in Table 10.
In Table 10, "Ref SEQ ID" refers to the identification (ID) of the
GenBank reference genomic sequence that covers the SNP-containing
region; "Ref SEQ Position" refers to the position of the SNP in the
reference GenBank genomic sequence; "Ref NT" indicates the
nucleotide at the SNP position in the GenBank genomic sequence;
"Alt NT" indicates nucleotide at the SNP position in the variant
form of the RAI-3 sequence; and "Ref AA" indicates amino acid
residue at the SNP position based on the GenBank genomic sequence;
"Alt. AA" refers to the amino acid residue at the SNP position
based on the variant RAI-3 genomic sequence; "Mutation type" refers
to the nature of the variation; "cDNA Ref. Seq. No." refers to the
identification (ID) of the reference GenBank cDNA sequence covering
the SNP-containing region; and "Protein Ref. Seq. No." refers to
the identification (ID) of the reference GenBank amino acid
sequence covering the SNP containing region.
[0602] The reference/SNP and flanking sequences in Table 10 are
derived from a BAC genomic sequence according to the Ref. SEQ ID as
shown in the table. As is appreciated by the skilled practitioner,
these sequences are thus complementary in orientation to the RAI-3
coding sequence.
18TABLE 10 Ref. RAI-3 SNP ID; Reference/SNP and Flanking SEQ Ref.
Alt. Ref. Alt. Mutation cDNA Ref. Protein Ref. EXON # Sequences
Ref. SEQ ID Position NT NT AA AA Type Seq No. Seq No. RAI-3-s1;
5'ctgagcagttgttataaagg[n]ggccctc AC007688.15 115864 C T Non CDS
NM_003979.2 NM_003970 EXON 1 gccggagggaggg3' (SEQ ID NO: 65) [n] =
c/t RAI-3-s7; 5'gccccagcgctctgggctcc[n]ggcgcc AC007688.15 115715 T
C Non CDS NM_003979.2 NM_003970 INTRON 1 tcacttaccctagt3' (SEQ ID
NO: 66) [n] = t/c RAI-3-s2; 5'gccaccgaggtcacaacccc[n]gctgtg
AC007688.15 99034 G A Synonymous NM_003979.2 NM_003970 EXON 2
gccaccgtttctag3' (SEQ ID NO: 67) [n] = g/a RAI-3-s3;
5'gtgctcccgtccagtccgat[n]atgaagg AC007688.15 98887 G A Synonymous
NM_003979.2 NM_003970 EXON 2 cgaaggtgaggcc3' (SEQ ID NO: 68) [n] =
g/a RAI-3-s4; 5'cgtgtgggccctgtgctccc[n]tccagtc AC007688.15 98875 G
A Synonymous NM_003979.2 NM_003970 EXON 2 cgatgatgaaggc3' (SEQ ID
NO: 69) [n] = g/a RAI-3-s5; 5'catcaagaagaggacgtagg[n]gagca
AC007688.15 98601 T C T A Non- NM_003979.2 NM_003970 EXON 2
ggaggacaaagtctt3' synonymous (SEQ ID NO: 70) [n] = t/c
[0603] The sequences of the primers as described for RAI-3 SNP
genotyping in this example are shown in the following Table 11.
19TABLE 11 PCR PCR Left Right (Forward) (Reverse) Primer Primer
Name PCR Left Primer Sequence (5'.fwdarw.3') Name PCR Right Primer
Sequence (5'.fwdarw.3') RAI-3 tgtaaaacgacggccagtgtcagacggtttttggg
RAI-3 caggaaacagctatgacccgctctccccagacgat Ex1_F tcat (SEQ ID NO:
71) Ex1_R tta (SEQ ID NO: 77) RAI-3
tgtaaaacgacggccagtgtcagacggtttttggg RAI-3
caggaaacagctatgacccgctctccccaga- cgat Ex1_F tcat (SEQ ID NO: 72)
Ex1_R tta (SEQ ID NO: 78) RAI-3 tgtaaaacgacggccagtaataccttctccccact
RAI-3 caggaaacagctatgaccagatggaaaagaggat Ex2-1_F ccaa (SEQ ID NO:
73) Ex2-1_R cccaa (SEQ ID NO: 79) RAI-3
tgtaaaacgacggccagtaataccttctccccact RAI-3
caggaaacagctatgaccagatggaaaagag- gat Ex2-1_F ccaa (SEQ ID NO: 74)
Ex2-1_R cccaa (SEQ ID NO: 80) RAI-3
tgtaaaacgacggccagtaataccttctccccact RAI-3
caggaaacagctatgaccagatggaaaagaggat Ex2-1_F ccaa (SEQ ID NO: 75)
Ex2-1_R cccaa (SEQ ID NO: 81) RAI-3
tgtaaaacgacggccagtcctttccctgttggtgat RAI-3
caggaaacagctatgaccgccaaaactcgg- gact Ex2-3_F tct (SEQ ID NO: 76)
Ex2-3_R aacat (SEQ ID NO: 82)
[0604] The SNPs described in Table 4 hereinabove were further
investigated to determine which DNA samples from individuals of a
Caucasian population (CORIELLE CA, Coriell Cell Repositories,
Collingswood, N.J.) contained the variations. The results are
presented in Table 12 below.
20TABLE 12 SNP RAI-3- RAI-3- RAI-3- RAI-3- RAI-3- RAI-3- RAI-3-
Sample ID SNP ID s1 s7 s2 s3 s4 s6 s5 NA17201 CORIELL CA homo*
NA17202 CORIELL CA NA17203 CORIELL CA het** het het NA17204 CORIELL
CA het NA17205 CORIELL CA homo NA17206 CORIELL CA het NA17207
CORIELL CA homo NA17208 CORIELL CA het NA17209 CORIELL CA het
NA17210 CORIELL CA het het NA17211 CORIELL CA het NA17212 CORIELL
CA het NA17213 CORIELL CA NA17214 CORIELL CA het NA17215 CORIELL CA
NA17216 CORIELL CA NA17217 CORIELL CA het NA17218 CORIELL CA het
NA17219 CORIELL CA homo NA17220 CORIELL CA het NA17221 CORIELL CA
NA17222 CORIELL CA het NA17223 CORIELL CA NA17224 CORIELL CA
NA17225 CORIELL CA homo NA17226 CORIELL CA NA17227 CORIELL CA het
NA17228 CORIELL CA NA17229 CORIELL CA het NA17230 CORIELL CA homo
NA17231 CORIELL CA het NA17232 CORIELL CA het NA17233 CORIELL CA
het NA17234 CORIELL CA het het het NA17235 CORIELL CA het NA17236
CORIELL CA *"homo": homozygous; **"het": heterozygous
[0605] In Table 12, the RAI-3-s6 SNP (118Gly allele) was not
observed in the Caucasian samples. This is not surprising since
this validated allele was found only in African Americans
(TSC-Sanger Centre project, NCBI dbSNP website: hypertext transfer
protocol, (i.e., http), world wide web (i.e., www), National Center
for Biotechnology Information (ncbi).National Library of Medicine
(nlm).National Institutes of Health (nih).Government (gov)/single
nucleotide polymorphism (snp)/.
[0606] The RAI-3-s5 SNP (182Ala allele) has a relatively low
frequency in Coriell Caucasian samples ({fraction (2/72)}=2.8%).
Recently, a genetic linkage of several chromosomal regions with
COPD phenotypes was discovered in the Caucasian population. (E. K.
Silverman et al., 2002, Am. J. Hum. Genet., 70(5):1229-1239). The
RAI-3 gene is located in the chromosomal region that overlaps one
of the linkage regions, namely, Chr12p13-p12.3. Since the RAI-3-s5
SNP is found in Caucasian samples and results in an amino acid
substitution in the RAI-3 polypeptide, it is reasonably provided as
a candidate for an underlying cause of COPD susceptibility in these
patients and/or in a population, such as a Caucasian population.
Thus, this SNP can exemplify a valuable genetic marker, for both
diagnostic and prognostic utilization in COPD.
Example 8
Alternative Method of Genotyping RAI-3 SNPs
[0607] In addition to the method of genotyping described herein
above, the skilled artisan can determine the genotype of the RAI-3
polymorphisms of the present invention using the below described
alternative method. This method is referred to as the "GBS method"
herein and can be performed as described in conjunction with the
teachings as described elsewhere herein.
[0608] Briefly, the direct analysis of the sequence of RAI-3
polymorphisms of the present invention is accomplished by DNA
sequencing of PCR products corresponding to the same PCR amplicons
that are designed to be in close proximity to the polymorphisms of
the present invention using the Primer3 program. The M13_SEQUENCE1
"tgtaaaacgacggccagt", (SEQ ID NO:83), is prepended to each forward
PCR primer. The M13_SEQUENCE2 "caggaaacagctatgacc", (SEQ ID NO:
84), is prepended to each reverse PCR primer.
[0609] PCR amplification can be performed on genomic DNA samples
amplified from (20 ng) in reactions (50 .mu.l) containing 10 mM
Tris-Cl pH 8.3, 50 mM KCl, 2.5 mM MgCl.sub.2, 150 .mu.M dNTPs, 3
.mu.M PCR primers, and 3.75 U TaqGold DNA polymerase (PE
Biosystems). PCR can be performed in MJ Research Tetrad machines
under a set of cycling conditions comprising 94.degree. C., 10
minutes, 30 cycles of 94.degree. C., 30 seconds, 60.degree. C., 30
seconds, and 72.degree. C., 30 seconds, followed by 72.degree. C.,
7 minutes. PCR products are purified using QIAquick PCR
purification kit (Qiagen) and are sequenced by the dye-terminator
method using PRISM 3700 automated DNA sequencer (Applied
Biosystems, Foster City, Calif.) following the manufacturer's
instruction outlined in the Owner's Manual, which is hereby
incorporated herein by reference in its entirety. PCR products are
sequenced by the dye-terminator method using the M13_SEQUENCE1 (SEQ
ID NO:83) and M13_SEQUENCE2 (SEQ ID NO:84) primers as described
above. The genotype can be determined by analysis of the sequencing
results at the polymorphic position.
Example 9
Additional Methods of Genotyping RAI-3 SNPs
[0610] The skilled practitioner appreciates that there are a number
of methods suitable for genotyping a SNP of the present invention,
aside from the preferred methods described herein. The present
invention encompasses the following non-limiting types of genotype
assays: PCR-free genotyping methods; Single-step homogeneous
methods; Homogeneous detection with fluorescence polarization;
Pyrosequencing; "Tag" based DNA chip system; Bead-based methods;
fluorescent dye chemistry; Mass spectrometry based genotyping
assays; TaqMan genotype assays; Invader genotype assays; and
microfluidic genotype assays, among others. Also encompassed by the
present invention are the following, non-limiting genotyping
methods: U. Landegren et al., 1998, Genome Res. 8:769-776; P. Kwok,
2000, Pharmacogenomics, 1:95-100; I. Gut, 2001, Hum Mutat.,
17:475-492; D. Whitcombe et al., 1998, Curr. Opin. Biotechnol.,
9:602-608; S. Tillib and A. Mirzabekov, 2001, Curr. Opin.
Biotechnol., 12:53-58; E. Winzeler et al., 1998, Science,
281:1194-1197; V. Lyamichev et al., 1999, Nat. Biotechnol.,
17:292-296; J. Hall et al., 2000, Proc. Natl. Acad. Sci. USA,
97:8272-8277; C. Mein et al., 2000, Genome Res., 10:333-343; Y.
Ohnishi et al., 2001, J. Hum. Genet., 46: 471-477; M. Nilsson et
al., 1994, Science, 265:2085-2088; J. Baner et al., 1998, Nucleic
Acids Res., 26: 5073-5078; J. Baner et al., 2001, Curr. Opin.
Biotechnol., 12:11-15; A. Hatch et al., 1999, Genet. Anal.,
15:35-40; P. Lizardi et al., 1998, Nat. Genet., 19(3):225-232; X.
Zhong et al., 2001, Proc. Natl. Acad. Sci. USA, 98:3940-3945; F.
Faruqi et al., 2001, BMC Genomics 2, 4; K. Livak, 1999, Genet.
Anal., 14:143-149; S. Marras et al., 1999, Genet. Anal.,
14:151-156; K. Ranade et al., 2001, Genome Res., 11:1262-1268; M.
Myakishev et al., 2001, Genome Res., 11:163-169; L. Beaudet et al.,
2001, Genome Res., 11:600-608; X. Chen et al., 1999, Genome Res.,
9:492-498; N. Gibson et al., 1997, Clin. Chem., 43:1336-1341; S.
Latif et al., 2001, Genome Res., 11: 436-440; T. Hsu et al., 2001,
Clin. Chem., 47:1373-1377; A. Alderborn et al., 2000, Genome Res.,
10:1249-1258; M. Ronaghi et al., 1998, Science, 281:363, 365; M.
Ronaghi, 2001, Genome Res., 11:3-11; A. Pease et al., 1994, Proc.
Natl. Acad. Sci. USA, 91:5022-5026; E. Southern et al., 1993,
Genomics, 13:1008-1017; D. Wang et al., 1998, Science,
280:1077-1082; P. Brown and D. Botstein, 1999, Nat. Genet.,
21:33-37; M. Cargill et al., 1999, Nat. Genet., 22:231-238; S. Dong
et al., 2001, Genome Res., 11:1418-1424; M. Halushka et al., 1999,
Nat. Genet., 22:239-247; J. Hacia, 1999, Nat. Genet., 21:42-47; R.
Lipshutz et al., 1999, Nat. Genet., 21:20-24; R. Sapolsky et al.,
1999, Genet. Anal., 14:187-192; Z. Tsuchihashi and P. Brown, 1994,
J. Virol., 68:5863; D. Herschlag, 1995, J. Biol. Chem.,
270:20871-20874; S. Head et al., 1997, Nucleic Acids Res.,
25:5065-5071; T. Nikiforov et al., 1994, Nucleic Acids Res.,
22:4167-4175; A. Syvanen et al., 1992, Genomics, 12:590-595; J.
Shumaker et al., 1996, Hum Mutat, 7:346-354; K. Lindroos et al.,
2001, Nucleic Acids Res., 29:E69-9; K. Lindblad-Toh et al., 2000,
Nat. Genet., 24:381-386; T. Pastinen et al., 2000, Genome Res.,
10:1031-1042; J. Fan et al., 2000, Genome Res, 10:853-860; J.
Hirschhorn et al., 2000, Proc. Natl. Acad. Sci. USA,
97:12164-12169; A. Bouchie, 2001, Nature Biotechnol., 19:704; M.
Hensel et al., 1995, Science, 269:400-403; D. Shoemaker et al.,
1996, Nature Genet., 14:450-456; N. Gerry et al., 1999, J. Mol.
Biol., 292:251-262; D. Ladner et al., 2001, Lab. Invest.,
81:1079-1086; M. Iannone et al., 2000, Cytometry, 39:131-140; R.
Fulton et al., 1997, J. Clin. Chem., 43:1749-1756; B. Armstrong et
al., 2000, Cytometry, 40:102-108H. Cai et al., 2000, Genomics,
69:395; J. Chen et al., 2000, Genome Res., 10:549-557; F. Ye et
al., 2001, Hum Mutat., 17:305-316; K. Michael et al., 1998, Anal.
Chem., 70:1242-1248; F. Steemers et al., 2000, Nature Biotechnol.,
18:91-94; W. Chan and S. Nie, 1998, Science, 281:2016-2018; M. Han
et al., 2001, Nature Biotechnol., 19:631-635; T. Griffin and L.
Smith, 2000, Trends Biotechnol., 18:77-84; P. Jackson et al., 2000,
Mol. Med. Today, 6:271-276; L. Haff and I. Smimov, 1997, Genome
Res., 7:378-388; P. Ross et al., 1998, Nat. Biotechnol.,
16:1347-1351; M. Bray et al., 2001, Hum. Mutat., 17:296-304; S.
Sauer et al., 2000, Nucleic Acids Res., 28:E13; S. Sauer et al.,
2000, Nucleic Acids Res., 28:E100; X. Sun et al., 2000, Nucleic
Acids Res., 28:E68; K. Tang et al., 1999, Proc. Natl. Acad. Sci.
USA, 91:10016-10020; J. Li et al., 1999, Electrophoresis,
20:1258-1265; D. Little et al., 1997, Nat. Med., 3:1413-1416; D.
Little et al., 1997, Anal. Chem., 69:4540-4546; T. Griffin et al.
1997, Nat. Biotechnol., 15:1368-1372; P. Ross et al., 1997, Anal.
Chem., 69:4197-4202; P. Jiang-Baucom et al., 1997, Anal. Chem.,
69:4894-4898; T. Griffin et al., 1999, Proc. Natl. Acad. Sci. USA,
96:6301-6306; M. Kokoris et al., 2000, Mol. Diagnos., 5:329-340; C.
Jurinke et al., 2001, Methods Mol. Biol., 200:170:103-16; and/or N.
Taranenko et al., 1996, Genet. Anal., 13:87-94.
Example 10
Site-Directed/Site-Specific Mutagenesis
[0611] In vitro site-directed/site-specific mutagenesis is an
invaluable technique for studying protein structure-function
relationships and gene expression, for example, as well as for
vector modification. Site-directed mutagenesis can also be used for
creating any of one or more of the RAI-3 mutants of the present
invention, particularly conservative and/or non-conservative amino
acid substitution RAI-3 mutants. Accordingly, site directed or site
specific mutagenesis can be used to create and RAI-3 nucleic acid
molecule encoding an RAI-3 allelic variant, e.g., an RAI-3 SNP as
described herein above. Approaches utilizing single stranded DNA
(ssDNA) as the template have been reported (e.g., T. A. Kunkel et
al., 1985, Proc. Natl. Acad. Sci. USA, 82:488-492; M. A. Vandeyar
et al., 1988, Gene, 65(1):129-133; M. Sugimoto et al., 1989, Anal.
Biochem., 179(2):309-311; and J. W. Taylor et al., 1985, Nuc.
Acids. Res., 13(24):8765-8785).
[0612] The use of PCR in site-directed mutagenesis accomplishes
strand separation by using a denaturing step to separate the
complementary strands and to allow efficient polymerization of the
PCR primers. Accordingly, PCR site-directed mutagenesis methods
permit site specific mutations to be incorporated in virtually any
double stranded plasmid, thus eliminating the need for
re-subcloning into M13-based bacteriophage vectors or
single-stranded rescue. (M. P. Weiner et al., 1995, Molecular
Biology: Current Innovations and Future Trends, Eds. A. M. Griffin
and H. G. Griffin, Horizon Scientific Press, Norfolk, UK; and C.
Papworth et al., 1996, Strategies, 9(3):3-4). A protocol for
performing site-directed mutagenesis, particularly employing the
QuikChange.TM. site-directed mutagenesis kit (Stratagene, La Jolla,
Calif.; U.S. Pat. Nos. 5,789,166 and 5,923,419) is provided for
making point mutations, to exchange, replace, or substitute amino
acids, and to delete or insert single or multiple amino acids in
the RAI-3 amino acid sequence.
Primer Design
[0613] For primer design using this protocol, the mutagenic
oligonucleotide primers are designed individually according to the
desired mutation. The following considerations are preferably made
for designing mutagenic primers: 1) Both of the mutagenic primers
preferably contain the desired mutation and anneal to the same
sequence on opposite strands of the plasmid; 2) Primers should be
between 25 and 45 bases in length, and the melting temperature
(T.sub.m) of the primers should be greater than, or equal to,
78.degree. C. The following formula is commonly used for estimating
the T.sub.m of primers: T=81.5+0.41 (% GC)-675/N--% mismatch. For
calculating T.sub.m, N is the primer length in bases; and values
for % GC and % mismatch are whole numbers. For calculating T.sub.m
for primers intended to introduce insertions or deletions, a
modified version of the above formula is employed: T=81.5+0.41 (%
GC)-675/N, where N does not include the bases which are being
inserted or deleted; 3) The desired mutation (deletion or
insertion) should be in the middle of the primer with approximately
10-15 bases of correct sequence on both sides; 4) The primers
optimally should have a minimum GC content of 40%, and should
terminate in one or more C or G bases; 5) Primers need not be
5'-phosphorylated, but are preferably purified either by fast
polynucleotide liquid chromatography (FPLC) or by polyacrylamide
gel electrophoresis (PAGE). Failure to purify the primers results
in a significant decrease in mutation efficiency; and 6) It is
important that primer concentration is in excess. It is suggested
to vary the amount of template while keeping the concentration of
the primers constantly in excess (QuikChange.TM. Site-Directed
Mutagenesis Kit, Stratagene, La Jolla, Calif.).
Protocol for Setting Up the Reactions
[0614] Using the above-described primer design, two complementary
oligonucleotides containing the desired mutation, flanked by
unmodified nucleic acid sequence, are synthesized. The resulting
oligonucleotide primers are purified. A control reaction is
prepared using 5 .mu.l 10.times. reaction buffer (100 mM KCl; 100
mM (NH.sub.4).sub.2SO.sub.4; 200 mM Tris-HCl, pH 8.8; 20 mM
MgSO.sub.4; 1% Triton.RTM. X-100; 1 mg/ml nuclease-free bovine
serum albumin, BSA); 2 .mu.l (10 ng) of pWhitescript.TM., 4.5-kb
control plasmid (5 ng/.mu.l); 1.25 .mu.l (125 ng) of
oligonucleotide control primer #1 (34-mer, 100 ng/.mu.l); 1.25
.mu.l (125 ng) of oligonucleotide control primer #2 (34-mer, 100
ng/.mu.l); 1 .mu.l of dNTP mix; double distilled H.sub.2O; to a
final volume of 50 .mu.l. Thereafter, 1 .mu.l of DNA polymerase
(PfuTurbo.RTM. DNA Polymerase, Stratagene), (2.5 U/.mu.l) is added.
PfuTurbo.RTM. DNA Polymerase is stated to have 6-fold higher
fidelity in DNA synthesis than does Taq polymerase. To maximize
temperature cycling performance, use of thin-walled test tubes is
preferred to ensure optimum contact with the heating blocks of the
temperature cycler.
[0615] The sample reaction is prepared by combining 5 .mu.l of
10.times. reaction buffer; 5-50 ng of dsDNA template; 125 ng of
oligonucleotide primer #1; 5-50 ng of dsDNA template; 125 ng of
oligonucleotide primer #2; 1 .mu.l of dNTP mix; and ddH.sub.2O to a
final volume of 50 .mu.l. Thereafter, 1 .mu.l of DNA polymerase
(PfuTurbo DNA Polymerase, Stratagene), (2.5 U/.mu.l), is added. If
the thermal cycler does not have a hot-top assembly, each reaction
should preferably be overlaid with approximately 30 .mu.l of
mineral oil.
Cycling the Reactions
[0616] Each reaction is cycled using the following cycling
parameters:
21 Segment Cycles Temperature Time 1 1 95.degree. C. 30 seconds 2
12-18 95.degree. C. 30 seconds 55.degree. C. 1 minute 68.degree. C.
2 minutes/kb of plasmid length
[0617] For the control reaction, a 12-minute extension time is used
and the reaction is run for 12 cycles. Segment 2 of the above
cycling parameters is adjusted in accordance with the type of
mutation desired. For example, for point mutations, 12 cycles are
used; for single amino acid changes, 16 cycles are used; and for
multiple amino acid deletions or insertions, 18 cycles are used.
Following the temperature cycling, the reaction is placed on ice
for 2 minutes to cool the reaction to <37.degree. C.
Digesting the Products and Transforming Competent Cells
[0618] One .mu.l of the DpnI restriction enzyme (10 U/.mu.l) is
added directly (below mineral oil overlay) to each amplification
reaction using a small, pointed pipette tip. The reaction mixture
is gently and thoroughly mixed by pipetting the solution up and
down several times. The reaction mixture is then centrifuged for 1
minute in a microcentrifuge. Immediately thereafter, each reaction
is incubated at 37.degree. C. for 1 hour to digest the parental
(i.e., the non-mutated) supercoiled dsDNA. Competent cells (i.e.,
XL1-Blue supercompetent cells, Stratagene) are thawed gently on
ice. For each control and sample reaction to be transformed, 50
.mu.l of the supercompetent cells are aliquotted to a pre-chilled
test tube (Falcon 2059 polypropylene). Next, 1 .mu.l of the
DpnI-digested DNA is transferred from the control and the sample
reactions to separate aliquots of the supercompetent cells. The
transformation reactions are gently swirled to mix and then are
incubated for 30 minutes on ice. Thereafter, the transformation
reactions are heat-pulsed for 45 seconds at 42.degree. C. for 2
minutes. Next, 0.5 ml of NZY+ broth, preheated to 42.degree. C., is
added to the transformation reactions which are then incubated at
37.degree. C. for 1 hour with shaking at 225-250 rpm. An aliquot of
each transformation reaction is plated on agar plates containing
the appropriate antibiotic for the vector. For the mutagenesis and
transformation controls, cells are spread on LB-ampicillin agar
plates containing 80 .mu.g/ml of X-gal and 20 mM IPTG.
Transformation plates are incubated for >16 hours at 37.degree.
C.
Example 11
TaqMan.TM. Quantitative PCR Analysis of RAI-3
[0619] Analysis of RAI-3 by TaqMan.TM. quantitative PCR on a large
panel of normal tissue RNAs revealed that transcripts for this GPCR
was found in tissues from all the major organ systems, with the
highest amount found in the respiratory system and the lowest
amount found in the nervous system. (FIG. 15). Within the lung,
there is a gradient of expression from the parenchyma to the
primary bronchus (all pulmonary related tissue RNAs obtained from
non-smoking individuals). The level of expression found in the
parenchyma of the lung is over 600,000 times higher then that
observed in most the brain sub-regions. The expression in the lung
parenchyma is, on average, about 6 times higher than that observed
in the next highest organ system, the gastrointestinal tract. (FIG.
15). It is to be noted that some of gastrointestinal samples were
obtained from smokers.
[0620] Quantitative PCR analysis in a variety of control and tumor
RNAs demonstrated that RAI-3 has elevated steady-state RNA levels
in breast tumors (2 out of 5), (FIG. 16); in stomach tumors (2 or 3
matched tissue samples and one additional non-matched sample for a
total of 3 out 4), (FIG. 17); and in testicular tumors (4 out 5
samples), (FIG. 18). These data suggest additional indications for
which agonists and antagonists of RAI-3 can have utility in the
treatment of a variety of human cancers. RAI-3 transcript levels
can also be useful in the determination of tumor progression and
diagnosis.
[0621] The sequences for the RAI-3 primer/probe set used in the
above experiments in this Example include the following:
22 Forward Primer: gcttcttcctctttgggatcct; (SEQ ID NO: 85) Reverse
Primer: cttggtcagactgacagcatgag; (SEQ ID NO: 86) and Probe:
ttccatctgcttctcctgcctgctg. (SEQ ID NO: 87)
Example 12
Additional Methods Used in Assessing Functional of RAI-3 and its
Association to COPD (Specific to FIGS. 26 to 28)
[0622] A. A549 Transient Transfection
[0623] The A549 cell line (American Type Culture Collection,
Manassas, Va.) was plated in 100 mm petri dishes and transfected at
about 75% confluency. Per plate each transfection was done with a
mixture of 750 ul Opti-MEM media (Gibco-Invitrogen Corp, Grand
Island N.Y.), 4 ug DNA and 20 ul Plus Reagent (Invitrogen Corp.
Carlsbad, Calif.) combined with a mixture of 5 ml of Opti-MEM media
and 30 ul Lipofectamine, as according to the manufacturer's
specifications. The transfection mixture was left on the cells for
5 hours at 37.degree. C. 5% CO.sub.2. At 5 hours, the transfection
media was replaced with RPMI media containing 10% fetal bovine
serum, 20 mM Glutamine, 1% Penicillin-Streptomycin
(Gibco/Invitrogen Corporation, Carlsbad, Calif.).
[0624] B. Treatment of Cells With Cigarette Smoke-Bubbled
Medium
[0625] At 24 hours post-transfection, the media on the cells was
changed to serum-free RPMI media containg only 20 mM Glutamine and
1% Penicillin-Streptomycin (Gibco/Invitrogen Corporation, Carlsbad,
Calif.). At 48 hours, the cells were exposed to cigarette
smoke-bubbled medium (see methods below, i.e., CS-160, the
equivalent of 160 cigarettes per 500 ml of cell medium) for the
periods of time shown (1 hr., 2 hr., and 3 hr.) and to EGF (10 nM)
for 5 minutes.
[0626] C. Generation of Cell Lysates
[0627] Cells on each 100 mm plate were lysed in 3 mL of Lysis
Buffer containing 1% NP40, 50 mM Tris-HCl, 0.5% Na+ deoxycholate,
150 mM NaCl and 1 mM sodium orthovanadate in the presence of
phosphatase inhibitors and protease inhibitors in the form of 1 tab
(per 50 ml of Lysis Buffer) of Complete protease inhibitor cocktail
(Roche, Basel, Switzerland) and transferred to 2 Eppendorf tubes.
Lysates wre placed on ice for 10 min. and then spun in a microfuge
at 4.degree. C. at 14,000 rpm for 10 min. The lysate was
transferred to a new tube and stored at -80 until
immunoprecipitation.
[0628] D. Immunoprecipitation and Immunoblotting
[0629] Lysates were immunoprecipitated overnight at 4.degree. C.,
rotating, with either 2 .mu.g of anti-FLAG M2 antibody Catalog #
F-3165 (Sigma, Saint Louis, Mo.) or 5 ul of rabbit antisera.
Thereafter, 40 .mu.l of Protein A was added to the lysate/antibody
mixture and rotated at 4.degree. C. for 1.5 hours. The Protein
A/lysate/antibody mixture was washed twice with RIPA buffer and
twice with 1.times.PBS. After the final wash the beads were
aspirated "dry" and 60 .mu.l of 2.times.SDS-PAGE sample buffer was
added. After heating at 95.degree. C. for 10 minutes, the samples
were split (30 ul/gel) and resolved by SDS-PAGE (4-20% gradient
gel) and transferred to nitrocellulose by standard Western Blotting
techniques. The membranes were blotted/probed with either an
anti-FLAG-HRP (Sigma, Saint Louis, Mo., Catalog # A8592), or an
anti-phosphotyrosine-HRP antibody (HRP-conjugated-4G10 antibody,
#16-105, Upstate Biotechnology, Inc., Lake Placid, N.Y.).
[0630] E. Generation of Cigarette Smoke-Bubbled Medium
[0631] Cigarette-smoke bubbled medium was generated using a
cigarette smoking machine similar to that described by T. Muller,
(1995, "Expression of c-fos in quiescent Swiss 3T3 cells exposed to
aqueous cigarette smoke fractions", Cancer Res., 55:1927-1932). The
cigarettes used were the standard reference research cigarette 1R4F
(Tobacco and Health Research Institute, University of Kentucky,
Lexington, Ky.). For a concentration of CS-160, smoke from 160
cigarettes (10 puffs per cigarette), respectively, was bubbled
through 500 ml of RPMI (Gibco/BRL/Invitrogen Corporation, Carlsbad,
Calif.) medium and sterile filtered for use that same day.
[0632] F. EGFR Immunoprecipitation
[0633] 1.5 ml of cell lysate (.about.1/2 of a confluent T75 flask)
was pre-cleared twice with 50 .mu.l of Protein A slurry, rotating
at 4.degree. C. Pre-cleared lysate was transferred to a new
Eppendorf tube and 50 .mu.l of Protein A and 2 .mu.l of EGFR
antisera (HER1/TWIB2, polyclonal rabbit antisera to human EGFR)
were added. The precleared lysate, Protein A and EGFR antisera were
mixed by rotating at 4.degree. C. for one hour, and then were
washed three times with Lysis Buffer, one time with 1.times.PBS (20
mM sodium phosphate, 150 mM NaCl, pH 7.4) followed by aspiration to
dryness. 30 .mu.l of sample buffer were added to the tubes and the
samples were placed at 95.degree. C. for 10 minutes before loading
onto a gel (30 .mu.l per lane).
[0634] G. Generation of RAI-3 Antigen for Injection into
Rabbits
[0635] An RAI-3 BglII/PstI restriction fragment (from the
intitiating Methionine at amino acid position 1 to the Glutamine at
amino acid position 328 of SEQ ID NO:3, deleting the last 30 amino
acids) was cloned into the pEX34 expression system (Strebel, K.,
Beck, E., Strohamier, K., and Schaller, H. Characterization of
foot-and-mouth disease virus gene products with antisera against
bacterially synthesized fusion proteins. J. Virol., 57:983-991,
1986). PEX34 is a heat inducible lambda repressor-controlled
expression system that uses a hydrophobic MS2 polymerase fragment
as an N-terminal 10 kDa tag. The construct was then transfected
into E. coli and the MS2-RAI-3 fusion protein was purified as
described previously (J. Virol., 57:983-991, 1986).
[0636] H. Generation of RAI-3 Polyclonal Antisera in Rabbits
[0637] A rabbit antiserum specific for human RAI-3 was raised
against the MS2 polymerase --RAI-3 fusion protein (as described
above). Two rabbits were injected with 10 mg of MS2 polymerase
--RAI-3 fusion protein for the initial immunization and 5 mg per
boost for the 7 subsequent booster injections. Freund's Complete
Adjuvant (FCA) was used for the initial immunization only and
Freund's Incomplete Adjuvant (FIA) for all subsequent boosts. The
sera was used directly as isolated from the rabbits and was not
affinity purified to isolate antibodies.
[0638] I. Characterization of GW7, Rabbit RAI-3 Polyclonal Antisera
by Immunoblotting
[0639] GW7, Post Boost #4, production bleed antisera was used to
Western blot a stable RAI-3-expressing CHO K1 cell line
(Cho/NFAT-CRE: Aurora Biosciences.TM.) (G. Zlokarnik et al., 1998,
Ibid.) The cells were immunoprecipitated with anti-flag antibody
and blotted with either Post Boost #4, production bleed antisera at
a 1:500 dilution or 2 .mu.g of anti-FLAG M2 antibody (Catalog #
F-3165, Sigma, Saint Louis, Mo.)
[0640] J. Characterization of Rabbit RAI-3 Polyclonal Antisera,
Immunoprecipitation
[0641] Lysates from 1/2 of a confluent T75 flask of either the
stable Flag-RAI-3 CHO cell line or parental cell line were
immuno-precipitated with 5 ul of rabbit RAI-3 antisera (GW7, Post
Boost #4, production bleed antisera) and or 5 ul of rabbit
pre-immune sera as an control and 40 .mu.l of Protein A. The
Protein A/lysate/antibody mixture was washed, aspirated "dry", and
301 .mu.l of 2.times.SDS-PAGE sample buffer was added. After
heating at 95.degree. C. for 10 minutes, the samples were loaded
onto a 4-20% gradient gel, and resolved by SDS-PAGE and transferred
to nitrocellulose by standard Western Blotting techniques. The
membranes were blotted/probed a 1:1000 dilution of an anti-FLAG-HRP
antibody (Catalog # A8592, Sigma, Saint Louis, Mo.).
Example 13
Additional Methods Used in Assessing Functional of RAI-3 and its
Association to COPD (Specific to FIGS. 29 to 32)
[0642] A. Characterization of Rabbit RAI-3 Antisera by
Fluorescence-Activated Cell Sorting (FACS) Analysis of
CHO/FlagRAI-3 Stable Cell Line and H292 and A549 Cell Lines
[0643] The cells were suspended in binding buffer of DMEM
(Gibco/Invitrogen Corporation, Carlsbad, Calif.) with 1% w/v bovine
serum albumin and 0.1% sodium azide The mixture was incubated on
ice for 1 hour followed by two washings with binding buffer. The
cells were centrifuged at 500.times.G for 5 minutes between each
wash. Ab were added on ice for 30 minutes. After further washing,
the cells were analyzed on a Becton Dickenson FACSort using Cell
Quest software. Cells were live gated and red/green color was
compensated. Siglec)) Cells from confluent 100 mM cell culture
plates (i.e., .about.2.times.106.cells) were washed once with
1.times.PBS and then lifted from the plates with 2-3 ml of Cell
Stripper (Cellgro/Mediatech, Herndon, Va.). 15 ml of 1.times.PBS
was added to wash cells and then the cells were centrifuged at 1.5
K for 8 minutes at 4.degree. C. to pellet. Cells were resuspended
in 0.2 ml of binding buffer-DMEM (Gibco/BRL/Invitrogen Corporation,
Carlsbad, Calif.) with 1% BSA final and 0.02% azide. Anti-FLAG FITC
(Sigma, Saint Louis, Mo.; Catalog #F4049) was added at a dilution
of 1:400 or rabbit anti sera was added at a dilution of 1:250. The
cells incubated with the rabbit antisera were centrifuged at 1.5 K
for 8 minutes at 4.degree. C. to pellet washed twice with 10 ml of
binding buffer and resuspended in a final volume of 0.2 ml of
binding buffer containing the 20 antibody a Fluorescein
(FITC)-conjugated AffiniPure F(ab').sub.2 Goat Anti-Rabbit IgG.at a
dilution of 1:200 (Jackson Immunoreseach Laboratories, Inc, West
Grove, Pa.). The cell and antibody mixture was incubated on ice for
one hour. Cells were washed twice with 10 ml of binding buffer and
resuspended in a final volume of 0.5 ml of binding buffer for FACS
analysis. The cells were analyzed on a Becton Dickenson FACSort
using Cell Quest software. (Becton-Dickenson, Franklin Lakes,
N.J.). Cells were live gated and red/green color was
compensated.
[0644] B. Fluorescence-Activated Cell Sorting (FACS) Analysis of
siRNAi Transfected H292 Cell Line
[0645] Cells (siRNA transfected as decribed above) from each well
of the 12 well-culture plates (i.e., .about.0.5.times.10.sup.6
cells) were washed once with 1.times.PBS and then lifted from the
plates with 0.5 ml of Cell Stripper (Cellgro/Mediatech, Herndon,
VA). 3 ml of 1.times.PBS was added to wash cells and then the cells
were centrifuged at 1.5 K for 8 minutes at 4.degree. C. to pellet.
Cells were resuspended in 0.2 ml of binding buffer-DMEM
(Gibco/BRL/Invitrogen Corporation, Carlsbad, Calif.) with 1% BSA
final. Anti-FLAG FITC (Sigma, Saint Louis, Mo.; Catalog #F4049) was
added at a dilution of 1:400. The cell and antibody mixture was
incubated on ice for one hour. Cells were washed twice with 10 ml
of binding buffer and resuspended in a final volume of 0.5 ml of
binding buffer for FACS analysis. The cells were analyzed on a
Becton Dickenson FACSort using Cell Quest software.
(Becton-Dickenson, Franklin Lakes, N.J.). Cells were live gated and
red/green color was compensated.
[0646] C. siRNA Oligo Sequences
[0647] For the RAI-3 siRNA oligos 1864+1865, the RAI-3 DNA target
sequence is AAGGTGCAGGACTCCAACAGG (SEQ ID NO:93) and the annealed
double stranded siRNA sequences are r(GGUGCAGGACUCCAACAGG)d(TT)
(SEQ ID NO:94) and r(CCUGUUGGAGUCCUGCACC)d(TT) (SEQ ID NO:95). The
target sequence for the Control siRNA oligos are
AATTCTCCGAACGTGTCACGTTT (SEQ ID NO:96) Sense Oligo is
UUCUCCGAACGUGUCACGUUUTT (SEQ ID NO:97) and the Antisense Oligo is
AAACGUGACACGUUCGGAGTT (SEQ ID NO:98). All siRNA oligos were
purchased from Xeragon/Qiagen (Valencia, Calif.).
[0648] D. CHO/FlagRAI-3 Stable Cell Line RNAi Transfection
[0649] The day before transfection, 5.times.10.sup.4 cells/well
were seeded in 12 well-plates in RPMI media containing 10% fetal
bovine serum, 20 mM Glutamine, 1% Penicillin-Streptomycin
(Gibco/Invitrogen Corporation, Carlsbad, Calif.). On the day of the
transfection, the cells were .about.90% confluent. The media on the
cells was replaced with 1 ml of RPMI media containing 10% fetal
bovine serum and 20 mM Glutamine (minus antibiotics). For each
well, 4 ul of a 20 uM stock of the siRNA was mixed with 100 ul
Opti-MEM (Gibco/Invitrogen Corporation, Carlsbad, Calif.). In a
separate tube, 4 ul of Lipofectamine 2000 (Invitrogen Corp.,
Carlsbad, Calif.) was diluted into 100 ul of Opti-MEM. The diluted
siRNA and the diluted Lipofectamine 2000 solutions were mixed and
left at room temperature for 20 minutes. The mixture was then added
to the cells and incubated at 37o, 5% CO.sub.2 for 48 hours. The
transfections were done in triplicates.
[0650] E. H292 siRNAi Transfection
[0651] The day before transfection, .about.2.5.times.10.sup.4H292
cells/well were seeded into 24 well-plates in RPMI media containing
10% fetal bovine serum, 20 mM Glutamine, 1% Penicillin-Streptomycin
(Gibco/Invitrogen Corporation, Carlsbad, Calif.). On the day of the
transfection, the cells were .about.90% confluent and the media was
replaced with RPMI media containing 10% fetal bovine serum and 20
mM Glutamine and no antibiotics. For each well, 4 ul of a 20 uM
stock of the siRNA was diluted into 50 ul Opti-MEM
(Gibco/Invitrogen Corporation, Carlsbad, Calif.). In a separate
tube, 2 ul of Lipofectamine 2000 (Invitrogen Corp., Carlsbad,
Calif.) was diluted into 50 ul of Opti-MEM. The diluted siRNA and
the diluted Lipofectamine 2000 solutions were mixed and left at
room temperature for 20 minutes. The mixture was then added to the
cells containing media without antibiotics and incubated at
37.degree. C., 5% CO.sub.2, for 24 hours. The transfections were
done in triplicates.
[0652] F. Treatment of H292/RAI-3 RNAi Transfectants With Cigarette
Smoke-Bubbled Media
[0653] At 24 hours post siRNA transfection, the media was changed
to serum-free RPMI media containing 20 mM Glutamine and 1%
Penicillin-Streptomycin and incubated at 37.degree. C., 5%
CO.sub.2, for 24 hours. At 48 hours post transfection, the
serum-free RPMI media was removed from the cells and replaced with
1.0 ml of cigarette smoke-bubbled medium (i.e., CS-10, the
equivalent of 10 cigarettes per 500 ml of cell culture medium) for
72 hours (96 hours post-transfection) or control. At 72 hours (96
hours post-transfection), 100 ul.times.3 of supernatent from each
well in the 24-well plate was transferred to 96-well plate for
ELISA analysis. Untransfected controls (in triplicate) receiving
CS-10 media showed a 7.73 fold increase in the levels of muc5AC
protein in the supernatant when compared to the supernatant of
cells with only serum-free RPMI media (CS-10: average 0.5927, StDev
0.1326, serum-free media: 0.0766, StDev 0.0339).
[0654] G. Fluorescence-Activated Cell Sorting (FACS) Analysis of
siRNAi Transfected H292 Cell Line
[0655] Cells (siRNA transfected as described above) from each well
of the 24 well-culture plates (i.e., .about.0.5.times.10.sup.5
cells) were washed once with 1.times.PBS and then lifted from the
plates with 0.5 ml of Cell Stripper (Cellgro/Mediatech, Herndon,
Va.). 3 ml of 1.times.PBS was added to wash cells and then the
cells were centrifuged at 1.5 K for 8 minutes at 4.degree. C. to
pellet. Cells were resuspended in 0.2 ml of binding buffer which is
composed from DMEM (Gibco/BRL/Invitrogen Corporation, Carlsbad,
Calif.) with a final concentration of 1% BSA (Sigma-Aldrich Co.
Saint Louis, Mo.) and 0.02% azide. Rabbit anti sera was added at a
dilution of 1:250. The cells and antibody mixture was incubated for
one hour on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet, washed twice with 10 ml of binding
buffer and resuspended in a final volume of 0.2 ml of binding
buffer containing the 2.degree. antibody a Fluorescein
(FITC)-conjugated AffiniPure F(ab').sub.2 Goat Anti-Rabbit IgG.at a
dilution of 1:200 (Jackson Immunoreseach Laboratories, Inc, West
Grove, Pa.). The cells and antibody mixture was incubated for 30
minutes on ice. The cells were centrifuged at 1.5 K for 8 minutes
at 4.degree. C. to pellet washed twice with 10 ml of binding buffer
and resuspended in a final volume of 0.5 ml of binding buffer for
FACS analysis. The cells were analyzed on a Becton Dickenson
FACSort using Cell Quest software (Becton-Dickenson, Franklin
Lakes, N.J.). Cells were live gated and red/green color was
compensated.
[0656] H. muc5AC Enzyme-Linked Immunosorbent Assays (ELISA)
[0657] A muc5AC coating antibody, Gastric Mucin Ab-1 45M 1
(NeoMarkers, Fremont, Calif.) was diluted 1:1000 to 1 ug/ml final
in 50 mM NaHCO3 pH 9 and coated onto a standard 96-well ELISA plate
overnight at room temperature with rotating. The next day the plate
was washed three times with 1.times.PBS/0.05% Tween 20 (PBS-T) and
blocked with 200 ul of blocking buffer, 1.times.PBS/1% BSA final
(30% solution, Sigma-Aldrich Co. Saint Louis, Mo.). Wells were
blocked overnight at room temperature with rotating. Wells were
washed three times with PBS-T and then 100 ul of the supernatant
was added to each well. The supernatant was left on the plate
overnight at room temperature with rotating. The next day the wells
were washed three times with PBS-T. Muc5AC protein in the
supernatent was detected with Peroxidase-Labeled Lectin from
Glycine Max (Sigma-Aldrich, St. Louis, Mo.) diluted to 1 .mu.g/ml
in 1.times.PBS/1% BSA final. Reactions were developed using 100
.mu.l/well of 50:50 TMB Microwell Peroxidase Substrate System 2-C
(Kirkegaard & Perry Laboratory, Gaithersburg, Md.). Color
reactions were stopped with 100 .mu.l/well 1 N. H.sub.2SO.sub.4 and
the absorbency at 450 nm-650 nm was measured. Untransfected
controls (in triplicate) receiving CS-10 media showed a 7.73 fold
increase in the levels of muc5AC protein in the supernatant when
compared to the supernatant of cells with only serum-free RPMI
media (CS-10: average 0.5927, StDev 0.1326, serum-free media:
0.0766, StDev 0.0339).
Example 14
Method of Assessing the Expression of RAI-3 in Human Tissues by
Immunohistochemical Staining Using Anti-RAI-3 Rabbit Polyclonal
Antibodies
[0658] Immunohistochemistry expression of RAI-3, describes positive
staining in pulmonary emphysema and chronic bronchitis samples when
compared to normal (disease-free) lung samples (see FIGS. 33 and
34). The latter is consistent with the putative role of RAI-3 in
the pathobiology of cigarette smoke-related pulmonary disease.
[0659] Immunohistochemical assay techniques are commonly known in
the art and are described briefly herein. Briefly,
immunocytochemical (ICC) experiments were performed on a DAKO
autostainer following the procedures and reagents developed by
DAKO. Specifically, the slides were blocked with avidin, rinsed,
blocked with biotin, rinsed, protein blocked with DAKO universal
protein block, machine blown dry, primary antibody, incubated, and
the slides rinsed. Biotinylated secondary antibody was applied
using the manufacturer's instructions (1 drop/10 ml, or
approximately 0.75 .mu.g/mL), incubated, rinsed slides, and applied
Vectastain ABC-AP reagent for 30 minutes. Vector Red was used as
substrate and prepared according to the manufacturer's instructions
just prior to use. Slides containing paraffin sections (LifeSpan
BioSciences, Inc.; Seattle, Wash.) were deparaffinized through
xylene and alcohol, rehydrated, and then subjected to the steam
method of target retrieval (#S1700; DAKO Corp.; Carpenteria,
Calif.).
[0660] The following RAI-3 peptides were synthesized and used as
antigens to create anti-RAI-3 antisera: peptide corresponding to
amino acids 90 to 104 of SEQ ID NO:3 (DGSTGPTRFFLFGIL SEQ ID
NO:91); or a peptide corresponding to amino acids 269 to 284 of SEQ
ID NO:3 (TKQRNPMDYPVEDAFC SEQ ID NO:92). The staining patterns and
conclusions described below and elsewhere herein were essentially
the same when using polyclonal antibodies (LifeSpan Biosciences,
Seattle, Wash.) directed against either a peptide (data not
shown).
[0661] The results of the immunohistochemical staining pattern in
human tissues of specific anti-RAI-3 rabbit polyclonal antibodies
was assessed by a pathologist at LifeSpan Biosciences, Seattle
Wash. Consistent with the putative role of RAI-3 in the
pathobiology of cigarette smoke-related pulmonary disease,
increases in staining were identified in samples of pulmonary
emphysema and chronic bronchitis when compared to normal
(disease-free) lungs as shown in FIGS. 33 and 34. No significant
changes in staining were identified in bronchial asthma compared to
normal lung (data not shown). With the emphysematous tissue, the
predominant staining was observed with pneumocytes and respiratory
epithelial cells while the chronic bronchitis samples showed
increased staining of respiratory epithelium, inflammatory cells,
occasional endothelial cells and pneumocytes.
[0662] Interestingly, increased staining over normal tissue was
observed in ulcerative colitis, cerebral infarct, myocardial
infarct, diabetic nephropathy, allergic rhinitis, Crohn's disease,
atherosclerosis and rheumatoid arthritis. This may suggest a role
for RAI-3 in inflammatory/auto-immune disorders outside of the lung
in addition to COPD. The most noteworthy staining of malignancies
was observed in malignant melanoma in which tumor cells stained
moderately to strongly, and, in one sample, many moderately to
strongly positive tumor-associated lymphocytes were identified. In
addition, at least faintly positive staining was identified in
glioblastoma, pulmonary small cell undifferentiated carcinoma,
carcinoma of the breast, colon, lung, ovary, pancreas, and
prostate, and in non-Hodgkin's lymphoma. Increased staining was
also observed in benign prostatic hyperplasia.
Example 15
Method of Testing the Ability of RAI-3 Modulators to Affect Lung
Physiology In Vivo
[0663] A number of methods may be employed to assess whether the
RAI-3 modulators of the present invention (e.g., antisense
compounds, siRNA compounds, anti-RAI-3 antibodies, small molecule
compounds, etc.) are capable of affecting the physiology of lung
cells, and in particular provide therapeutic efficacy in treating,
ameliorating, and/or treating lung disorders, particularly
inflammatory lung disordwers such as COPD. RAI-3 modulators can be
characterized in vivo by measuring the effect of a compound
(administered systemically or by inhalation) on neutrophilia,
cytokine (e.g., TNF.alpha.), chemokine (e.g., KC or IL-8), and
mucin production in either acutely or chronically-cigarette
smoke-challenged mice (1). Similar endpoints can be measured in
mice challenged by repeated intranasal administration of cigarette
smoke-conditioned media (2). Alternatively, the effect of RAI-3
modulators can be investigated in mice that have received repeated
intratracheal instillation of Escherichia coli LPS, with effects on
many pulmonary endpoints being measured. These include effects on
peribronchial and perivascular lymphocytic aggregates (CD4(+),
CD8(+), and CD19(+)), parenchymal accumulation of macrophages and
CD8(+) T cells, cytokine expression, as well as effects on airway
and alveolar alterations such as mucus cell metaplasia, airway wall
thickening, and irreversible alveolar enlargement (3).
[0664] The skilled artisan would appreciate that such methods are
exemplary and that the methods may be modified to be specific to
RAI-3, as applicable. The following publications are herein
incorporated herein by reference in their entirety.
[0665] 1. Churg A, Zay K, Shay S, Xie C, Shapiro S D, Hendricks R,
Wright J L. Acute cigarette smoke-induced connective tissue
breakdown requires both neutrophils and macrophage metalloelastase
in mice. Am J Respir Cell Mol Biol. 2002, 27:368-74.
[0666] 2. Miller L M, Foster W M, Dambach D M, Doebler D, McKinnon
M, Killar L, Longphre M. A murine model of cigarette smoke-induced
pulmonary inflammation using intranasally administered
smoke-conditioned medium. Exp. Lung Res. 2002, 28:435-55.
[0667] 3. Vernooy J H, Dentener M A, van Suylen R J, Buurman W A,
Wouters E F. Long-term intratracheal lipopolysaccharide exposure in
mice results in chronic lung inflammation and persistent pathology.
Am J Respir Cell Mol Biol. 2002, 26:152-9.
Example 16
Method of Creating N- and C-Terminal Deletion Mutants Corresponding
to the RAI-3 Polypeptide of the Present Invention
[0668] As described elsewhere herein, the present invention
encompasses the creation of N- and C-terminal deletion mutants, in
addition to any combination of N- and C-terminal deletions thereof,
corresponding to the RAI-3 polypeptide of the present invention. A
number of methods are available to one skilled in the art for
creating such mutants. Such methods may include a combination of
PCR amplification and gene cloning methodology. Although one of
skill in the art of molecular biology, through the use of the
teachings provided or referenced herein, and/or otherwise known in
the art as standard methods, could readily create each deletion
mutant of the present invention, exemplary methods are described
below.
[0669] Briefly, using the isolated cDNA clone encoding the
full-length RAI-3 polypeptide sequence (as described in herein, for
example), appropriate primers of about 15-25 nucleotides derived
from the desired 5' and 3' positions of SEQ ID NO:2 may be designed
to PCR amplify, and subsequently clone, the intended N- and/or
C-terminal deletion mutant. Such primers could comprise, for
example, an initiation and stop codon for the 5' and 3' primer,
respectively. Such primers may also comprise restriction sites to
facilitate cloning of the deletion mutant post amplification.
Moreover, the primers may comprise additional sequences, such as,
for example, flag-tag sequences, kozac sequences, or other
sequences discussed and/or referenced herein.
[0670] Representative PCR amplification conditions are provided
below, although the skilled artisan would appreciate that other
conditions may be required for efficient amplification. A 100 ul
PCR reaction mixture may be prepared using long of the template DNA
(cDNA clone of RAI-3), 200 uM 4dNTPs, 1 uM primers, 0.25 U Taq DNA
polymerase (PE), and standard Taq DNA polymerase buffer. Typical
PCR cycling condition are as follows:
23 20-25 cycles: 45 sec, 93 degrees 2 min, 50 degrees 2 min, 72
degrees 1 cycle: 10 min, 72 degrees
[0671] After the final extension step of PCR, 5 U Klenow Fragment
may be added and incubated for 15 min at 30 degrees.
[0672] Upon digestion of the fragment with the NotI and SalI
restriction enzymes, the fragment could be cloned into an
appropriate expression and/or cloning vector which has been
similarly digested (e.g., pSport1, among others). The skilled
artisan would appreciate that other plasmids could be equally
substituted, and may be desirable in certain circumstances. The
digested fragment and vector are then ligated using a DNA ligase,
and then used to transform competent E. coli cells using methods
provided herein and/or otherwise known in the art.
[0673] The 5' primer sequence for amplifying any additional
N-terminal deletion mutants may be determined by reference to the
following formula: (S+(X*3)) to ((S+(X*3))+25), wherein `S` is
equal to the nucleotide position of the initiating start codon of
the RAI-3 gene (SEQ ID NO:2), and `X` is equal to the most
N-terminal amino acid of the intended N-terminal deletion mutant.
The first term will provide the start 5' nucleotide position of the
5' primer, while the second term will provide the end 3' nucleotide
position of the 5' primer corresponding to sense strand of SEQ ID
NO:2. Once the corresponding nucleotide positions of the primer are
determined, the final nucleotide sequence may be created by the
addition of applicable restriction site sequences to the 5' end of
the sequence, for example. As referenced herein, the addition of
other sequences to the 5' primer may be desired in certain
circumstances (e.g., kozac sequences, etc.).
[0674] The 3' primer sequence for amplifying any additional
N-terminal deletion mutants may be determined by reference to the
following formula: (S+(X*3)) to ((S+(X*3))-25), wherein `S` is
equal to the nucleotide position of the initiating start codon of
the RAI-3 gene (SEQ ID NO:2), and `X` is equal to the most
C-terminal amino acid of the intended N-terminal deletion mutant.
The first term will provide the start 5' nucleotide position of the
3' primer, while the second term will provide the end 3' nucleotide
position of the 3' primer corresponding to the anti-sense strand of
SEQ ID NO:2. Once the corresponding nucleotide positions of the
primer are determined, the final nucleotide sequence may be created
by the addition of applicable restriction site sequences to the 5'
end of the sequence, for example. As referenced herein, the
addition of other sequences to the 3' primer may be desired in
certain circumstances (e.g., stop codon sequences, etc.). The
skilled artisan would appreciate that modifications of the above
nucleotide positions may be necessary for optimizing PCR
amplification.
[0675] The same general formulas provided above may be used in
identifying the 5' and 3' primer sequences for amplifying any
C-terminal deletion mutant of the present invention. Moreover, the
same general formulas provided above may be used in identifying the
5' and 3' primer sequences for amplifying any combination of
N-terminal and C-terminal deletion mutant of the present invention.
The skilled artisan would appreciate that modifications of the
above nucleotide positions may be necessary for optimizing PCR
amplification.
[0676] In preferred embodiments, the following N-terminal RAI-3
deletion polypeptides are encompassed by the present invention:
M1-S357, A2-S357, T3-S357, T4-S357, V5-S357, P6-S357, D7-S357,
G8-S357, C9-S357, R10-S357, N11-S357, G12-S357, L13-S357, K14-S357,
S15-S357, K16-S357, Y17-S357, Y18-S357, R19-S357, L20-S357,
C21-S357, D22-S357, K23-S357, A24-S357, E25-S357, A26-S357,
W27-S357, G28-S357, 129-S357, V30-S357, L31-S357, E32-S357,
T33-S357, V34-S357, A35-S357, T36-S357, A37-S357, G38-S357,
V39-S357, V40-S357, T41-S357, S42-S357, V43-S357, A44-S357,
F45-S357, M46-S357, L47-S357, T48-S357, L49-S357, P50-S357,
151-S357, L52-S357, V53-S357, C54-S357, K55-S357, V56-S357,
Q57-S357, D58-S357, S59-S357, N60-S357, R61-S357, R62-S357,
K63-S357, M64-S357, L65-S357, P66-S357, T67-S357, Q68-S357,
F69-S357, L70-S357, F71-S357, L72-S357, L73-S357, G74-S357,
V75-S357, L76-S357, G77-S357, 178-S357, F79-S357, G80-S357,
L81-S357, T82-S357, F83-S357, A84-S357, F85-S357, 186-S357,
187-S357, G88-S357, L89-S357, D90-S357, G91-S357, S92-S357,
T93-S357, G94-S357, P95-S357, T96-S357, R97-S357, F98-S357,
F99-S357, L100-S357, F101-S357, G102-S357, 1103-S357, L104-S357,
F105-S357, S106-S357, 1107-S357, C108-S357, F109-S357, S110-S357,
C111-S357, L112-S357, L113-S357, A114-S357, H115-S357, A116-S357,
V117-S357, S118-S357, L119-S357, T120-S357, K121-S357, L122-S357,
V123-S357, R124-S357, G125-S357, R126-S357, K127-S357, P128-S357,
L129-S357, S130-S357, L131-S357, L132-S357, V133-S357, 1134-S357,
L135-S357, G136-S357, L137-S357, A138-S357, V139-S357, G140-S357,
F141-S357, S142-S357, L143-S357, V144-S357, Q145-S357, D146-S357,
V147-S357, 1148-S357, A149-S357, 1150-S357, E151-S357, Y152-S357,
1153-S357, V154-S357, L155-S357, T156-S357, M157-S357, N158-S357,
R159-S357, T160-S357, N161-S357, V162-S357, N163-S357, V164-S357,
F165-S357, S166-S357, E167-S357, L168-S357, S169-S357, A170-S357,
P171-S357, R172-S357, R173-S357, N174-S357, E175-S357, D176-S357,
F177-S357, V178-S357, L179-S357, L180-S357, L181-S357, T182-S357,
Y183-S357, V184-S357, L185-S357, F186-S357, L187-S357, M188-S357,
A189-S357, L190-S357, T191-S357, F192-S357, L193-S357, M194-S357,
S195-S357, S196-S357, F197-S357, T198-S357, F199-S357, C200-S357,
G201-S357, S202-S357, F203-S357, T204-S357, G205-S357, W206-S357,
K207-S357, R208-S357, H209-S357, G210-S357, A211-S357, H212-S357,
1213-S357, Y214-S357, L215-S357, T216-S357, M217-S357, L218-S357,
L219-S357, S220-S357, 1221-S357, A222-S357, 1223-S357, W224-S357,
V225-S357, A226-S357, W227-S357, 1228-S357, T229-S357, L230-S357,
L231-S357, M232-S357, L233-S357, P234-S357, D235-S357, F236-S357,
D237-S357, R238-S357, R239-S357, W240-S357, D241-S357, D242-S357,
T243-S357, 1244-S357, L245-S357, S246-S357, S247-S357, A248-S357,
L249-S357, A250-S357, A251-S357, N252-S357, G253-S357, W254-S357,
V255-S357, F256-S357, L257-S357, L258-S357, A259-S357, Y260-S357,
V261-S357, S262-S357, P263-S357, E264-S357, F265-S357, W266-S357,
L267-S357, L268-S357, T269-S357, K270-S357, Q271-S357, R272-S357,
N273-S357, P274-S357, M275-S357, D276-S357, Y277-S357, P278-S357,
V279-S357, E280-S357, D281-S357, A282-S357, F283-S357, C284-S357,
K285-S357, P286-S357, Q287-S357, L288-S357, V289-S357, K290-S357,
K291-S357, S292-S357, Y293-S357, G294-S357, V295-S357, E296-S357,
N297-S357, R298-S357, A299-S357, Y300-S357, S301-S357, Q302-S357,
E303-S357, E304-S357, 1305-S357, T306-S357, Q307-S357, G308-S357,
F309-S357, E310-S357, E311-S357, T312-S357, G313-S357, D314-S357,
T315-S357, L316-S357, Y317-S357, A318-S357, P319-S357, Y320-S357,
S321-S357, T322-S357, H323-S357, F324-S357, Q325-S357, L326-S357,
Q327-S357, N328-S357, Q329-S357, P330-S357, P331-S357, Q332-S357,
K333-S357, E334-S357, F335-S357, S336-S357, 1337-S357, P338-S357,
R339-S357, A340-S357, H341-S357, A342-S357, W343-S357, P344-S357,
S345-S357, P346-S357, Y347-S357, K348-S357, D349-S357, Y350-S357,
and/or E351-S357 of SEQ ID NO:3. Polynucleotide sequences encoding
these polypeptides are also provided. The present invention also
encompasses the use of these N-terminal RAI-3 deletion polypeptides
as immunogenic and/or antigenic epitopes as described elsewhere
herein.
[0677] In preferred embodiments, the following C-terminal RAI-3
deletion polypeptides are encompassed by the present invention:
M1-S357, M1-G356, M1-E355, M1-K354, M1-K353, M1-V352, M1-E351,
M1-Y350, M1-D349, M1-K348, M1-Y347, M1-P346, M1-S345, M1-P344,
M1-W343, M1-A342, M1-H341, M1-A340, M1-R339, M1-P338, M1-I337,
M1-S336, M1-F335, M1-E334, M1-K333, M1-Q332, M1-P331, M1-P330,
M1-Q329, M1-N328, M1-Q327, M1-L326, M1-Q325, M1-F324, M1-H323,
M1-T322, M1-S321, M1-Y320, M1-P319, M1-A318, M1-Y317, M1-L316,
M1-T315, M1-D314, M1-G313, M1-T312, M1-E311, M1-E310, M1-F309,
M1-G308, M1-Q307, M1-T306, M1-I305, M1-E304, M I-E303, M I-Q302,
M1-S301, M1-Y300, M1-A299, M1-R298, M1-N297, M1-E296, M1-V295,
M1-G294, M1-Y293, M1-S292, M1-K291, M1-K290, M1-V289, M1-L288,
M1-Q287, M1-P286, M1-K285, M1-C284, M1-F283, M1-A282, M1-D281,
M1-E280, M1-V279, M1-P278, M1-Y277, M1-D276, M1-M275, M1-P274,
M1-N273, M1-R272, M1-Q271, M1-K270, M1-T269, M1-L268, M1-L267,
M1-W266, M1-F265, M1-E264, M1-P263, M1-S262, M1-V261, M1-Y260,
M1-A259, M1-L258, M1-L257, M1-F256, M1-V255, M1-W254, M1-G253,
M1-N252, M1-A251, M1-A250, M1-L249, M1-A248, M1-S247, M1-S246,
M1-L245, M1-I244, M1-T243, M1-D242, M1-D241, M1-W240, M1-R239,
M1-R238, M1-D237, M1-F236, M1-D235, M1-P234, M1-L233, M1-M232,
M1-L231, M1-L230, M1-T229, M1-I228, M1-W227, M1-A226, M1-V225,
M1-W224, M1-I223, M1-A222, M1-I221, M1-S220, M1-L219, M1-L218,
M1-M217, M1-T216, M1-L215, M1-Y214, M1-I213, M1-H212, M1-A211,
M1-G210, M1-H209, M1-R208, M1-K207, M1-W206, M1-G205, M1-T204,
M1-F203, M1-S202, M1-G201, M1-C200, M1-F199, M1-T198, M1-F197,
M1-S196, M1-S195, M1-M194, M1-L193, M1-F192, M1-T191, M1-L190,
M1-A189, M1-M188, M1-L187, M1-F186, M1-L185, M1-V184, M1-Y183,
M1-T182, M1-L181, M1-L180, M1-L179, M1-V178, M1-F177, M1-D176,
M1-E175, M1-N174, M1-R173, M1-R172, M1-P171, M1-A170, M1-S169,
M1-L168, M1-E167, M1-S166, M1-F165, M1-V164, M1-N163, M1-V162,
M1-N161, M1-T160, M1-R159, M1-N158, M1-M157, M1-T156, M1-L155,
M1-V154, M1-I153, M1-Y152, M1-E151, M1-I150, M1-A149, M1-I148,
M1-V147, M1-D146, M1-Q145, M1-V144, M1-L143, M1-S142, M1-F141,
M1-G140, M1-V139, M1-A138, M1-L137, M1-G136, M1-L135, M1-I134,
M1-V133, M1-L132, M1-L131, M1-S130, M1-L129, M1-P128, M1-K127,
M1-R126, M1-G125, M1-R124, M1-V123, M1-L122, M1-K121, M1-T120,
M1-L119, M1-S118, M1-V117, M1-A116, M1-H115, M1-A114, M1-L113,
M1-L112, M1-C111, M1-S110, M1-F109, M1-C108, M1-I107, M1-S106,
M1-F105, M1-L104, M1-I103, M1-G102, M1-F110, M1-L100, M1-F99,
M1-F98, M1-R97, M1-T96, M1-P95, M1-G94, M1-T93, M1-S92, M1-G91,
M1-D90, M1-L89, M1-G88, M1-I87, M1-I86, M1-F85, M1-A84, M1-F83,
M1-T82, M1-L81, M1-G80, M1-F79, M1-I78, M1-G77, M1-L76, M1-V75,
M1-G74, M1-L73, M1-L72, M1-F71, M1-L70, M1-F69, M1-Q68, M1-T67,
M1-P66, M1-L65, M1-M64, M1-K63, M1-R62, M1-R61, M1-N60, M1-S59,
M1-D58, M1-Q57, M1-V56, M1-K55, M1-C54, M1-V53, M1-L52, M1-I51,
M1-P50, M1-L49, M1-T48, M1-L47, M1-M46, M1-F45, M1-A44, M1-V43,
M1-S42, M1-T41, M1-V40, M1-V39, M1-G38, M1-A37, M1-T36, M1-A35,
M1-V34, M1-T33, M1-E32, M1-L31, M1-V30, M1-I29, M1-G28, M1-W27,
M1-A26, M1-E25, M1-A24, M1-K23, M1-D22, M1-C21, M1-L20, M1-R19,
M1-Y18, M1-Y17, M1-K16, M1-S15, M1-K14, M1-L13, M1-G12, M1-N11,
M1-R10, M1-C9, M1-G8, and/or M1-D7 of SEQ ID NO:3. Polynucleotide
sequences encoding these polypeptides are also provided. The
present invention also encompasses the use of these C-terminal
RAI-3 deletion polypeptides as immunogenic and/or antigenic
epitopes as described elsewhere herein.
Example 17
Method of Screening, In Vitro, Compounds that Bind to the RAI-3
Polypeptide
[0678] In vitro systems can be designed to identify compounds
capable of binding the RAI-3 polypeptide of the invention.
Compounds identified can be useful, for example, in modulating the
activity of wild type and/or mutant RAI-3 polypeptide, preferably
mutant RAI-3 polypeptide, can be useful in elaborating the
biological function of the RAI-3 polypeptide, can be utilized in
screens for identifying compounds that disrupt normal RAI-3
polypeptide interactions, or can in themselves disrupt such
interactions.
[0679] The principle of the assays used to identify compounds that
bind to the RAI-3 polypeptide involves preparing a reaction mixture
of the RAI-3 polypeptide and the test compound under conditions and
for a time sufficient to allow the two components to interact and
bind, thus forming a complex which can be removed and/or detected
in the reaction mixture. These assays can be conducted in a variety
of ways. For example, one method to conduct such an assay would
involve anchoring RAI-3 polypeptide or the test substance onto a
solid phase and detecting RAI-3 polypeptide/test compound complexes
anchored on the solid phase at the end of the reaction. In one
embodiment of such a method, the RAI-3 polypeptide can be anchored
onto a solid surface, and the test compound, which is not anchored,
can be labeled, either directly or indirectly.
[0680] In practice, microtitre plates can conveniently be utilized
as the solid phase. The anchored component can be immobilized by
non-covalent or covalent attachments. Non-covalent attachment can
be accomplished by simply coating the solid surface with a solution
of the protein and drying. Alternatively, an immobilized antibody,
preferably a monoclonal antibody, specific for the protein to be
immobilized can be used to anchor the protein to the solid surface.
The surfaces can be prepared in advance and stored.
[0681] In order to conduct the assay, the nonimmobilized component
is added to the coated surface containing the anchored component.
After the reaction is complete, unreacted components are removed
(e.g., by washing) under conditions such that any complexes formed
will remain immobilized on the solid surface. The detection of
complexes anchored on the solid surface can be accomplished in a
number of ways. Where the previously immobilized component is
pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the previously
nonimmobilized component is not pre-labeled, an indirect label can
be used to detect complexes anchored on the surface; e.g., using a
labeled antibody specific for the immobilized component (the
antibody, in turn, can be directly labeled or indirectly labeled
with a labeled anti-Ig antibody).
[0682] Alternatively, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted components,
and complexes detected; e.g., using an immobilized antibody
specific for RAI-3 polypeptide or the test compound to anchor any
complexes formed in solution, and a labeled antibody specific for
the other component of the possible complex to detect anchored
complexes.
[0683] Another example of a screening assay to identify compounds
that bind to RAI-3, relates to the application of a cell
membrane-based scintillation proximity assay ("SPA"). Such an assay
would require the idenification of a ligand for RAI-3 polypeptide.
Once identified, unlabeled ligand is added to assay-ready plates
that would serve as a positive control. The SPA beads and membranes
are added next, and then .sup.125I-labeled ligand is added. After
an equilibration period of 2-4 hours at room temperature, the
plates can be counted in a scintillation counting machine, and the
percent inhibition or stimulation calculated. Such an SPA assay may
be based upon a manual, automated, or semi-automated platform, and
encompass 96, 384, 1536-well plates or more. Any number of SPA
beads may be used as applicable to each assay. Examples of SPA
beads include, for example, Leadseeker WGA PS (Amersham cat # RPNQ
0260), and SPA Beads (PVT-PEI-WGA-TypeA; Amersham cat # RPNQ0003).
The utilized membranes may also be derived from a number of cell
line and tissue sources depending upon the expression profile of
the respective polypeptide and the adaptability of such a cell line
or tissue source to the development of a SPA-based assay. Examples
of membrane preparations include, for example, cell lines
transformed to express the receptor to be assayed in CHO cells or
HEK cells, for example. SPA-based assays are well known in the art
and are encompassed by the present invention. One such assay is
described in U.S. Pat. No. 4,568,649, which is incorporated herein
by reference. The skilled artisan would acknowledge that certain
modifications of known SPA assays may be required to adapt such
assays to each respective polypeptide.
[0684] One such screening procedure involves the use of
melanophores which are transfected to express the RAI-3 polypeptide
of the present invention. Such a screening technique is described
in PCT WO 92/01810, published Feb. 6, 1992. Such an assay may be
employed to screen for a compound which inhibits activation of the
receptor polypeptide of the present invention by contacting the
melanophore cells which encode the receptor with both the receptor
ligand, such as LPA, and a compound to be screened. Inhibition of
the signal generated by the ligand indicates that a compound is a
potential antagonist for the receptor, i.e., inhibits activation of
the receptor.
[0685] The technique may also be employed for screening of
compounds which activate the receptor by contacting such cells with
compounds to be screened and determining whether such compound
generates a signal, i.e., activates the receptor. Other screening
techniques include the use of cells which express the RAI-3
polypeptide (for example, transfected CHO cells) in a system which
measures extracellular pH changes caused by receptor activation. In
this technique, compounds may be contacted with cells expressing
the receptor polypeptide of the present invention. A second
messenger response, e.g., signal transduction or pH changes, is
then measured to determine whether the potential compound activates
or inhibits the receptor.
[0686] Another screening technique involves expressing the RAI-3
polypeptide in which the receptor is linked to phospholipase C or
D. Representative examples of such cells include, but are not
limited to, endothelial cells, smooth muscle cells, and embryonic
kidney cells. The screening may be accomplished as hereinabove
described by detecting activation of the receptor or inhibition of
activation of the receptor from the phospholipase second
signal.
[0687] Another method involves screening for compounds which are
antagonists or agonists by determining inhibition of binding of
labeled ligand, such as LPA, to cells which have the receptor on
the surface thereof, or cell membranes containing the receptor.
Such a method involves transfecting a cell (such as eukaryotic
cell) with DNA encoding the RAI-3 polypeptide such that the cell
expresses the receptor on its surface. The cell is then contacted
with a potential antagonist or agonist in the presence of a labeled
form of a ligand, such as LPA. The ligand can be labeled, e.g., by
radioactivity. The amount of labeled ligand bound to the receptors
is measured, e.g., by measuring radioactivity associated with
transfected cells or membrane from these cells. If the compound
binds to the receptor, the binding of labeled ligand to the
receptor is inhibited as determined by a reduction of labeled
ligand which binds to the receptors. This method is called binding
assay.
[0688] Another screening procedure involves the use of mammalian
cells (CHO, HEK 293, Xenopus Oocytes, RBL-2H3, etc) which are
transfected to express the receptor of interest. The cells are
loaded with an indicator dye that produces a fluorescent signal
when bound to calcium, and the cells are contacted with a test
substance and a receptor agonist, such as LPA. Any change in
fluorescent signal is measured over a defined period of time using,
for example, a fluorescence spectrophotometer or a fluorescence
imaging plate reader. A change in the fluorescence signal pattern
generated by the ligand indicates that a compound is a potential
antagonist or agonist for the receptor.
[0689] Another screening procedure involves use of mammalian cells
(CHO, HEK293, Xenopus Oocytes, RBL-2H3, etc.) which are transfected
to express the receptor of interest, and which are also transfected
with a reporter gene construct that is coupled to activation of the
receptor (for example, luciferase or beta-galactosidase behind an
appropriate promoter). The cells are contacted with a test
substance and the receptor agonist (ligand), such as LPA, and the
signal produced by the reporter gene is measured after a defined
period of time. The signal can be measured using a luminometer,
spectrophotometer, fluorimeter, or other such instrument
appropriate for the specific reporter construct used. Change of the
signal generated by the ligand indicates that a compound is a
potential antagonist or agonist for the receptor.
[0690] Another screening technique for antagonists or agonits
involves introducing RNA encoding the RAI-3 polypeptide into
Xenopus oocytes (or CHO, HEK 293, RBL-2H3, etc.) to transiently or
stably express the receptor. The receptor oocytes are then
contacted with the receptor ligand, such as LPA, and a compound to
be screened. Inhibition or activation of the receptor is then
determined by detection of a signal, such as, cAMP, calcium,
proton, or other ions.
[0691] Another method involves screening for RAI-3 polypeptide
inhibitors by determining inhibition or stimulation of RAI-3
polypeptide-mediated cAMP and/or adenylate cyclase accumulation or
dimunition. Such a method involves transiently or stably
transfecting a eukaryotic cell with RAI-3 polypeptide receptor to
express the receptor on the cell surface.
[0692] The cell is then exposed to potential antagonists or
agonists in the presence of RAI-3 polypeptide ligand, such as LPA.
The changes in levels of cAMP is then measured over a defined
period of time, for example, by radio-immuno or protein binding
assays (for example using Flashplates or a scintillation proximity
assay). Changes in cAMP levels can also be determined by directly
measuring the activity of the enzyme, adenylyl cyclase, in broken
cell preparations. If the potential antagonist or agonist binds the
receptor, and thus inhibits RAI-3 polypeptide-ligand binding, the
levels of RAI-3 polypeptide-mediated cAMP, or adenylate cyclase
activity, will be reduced or increased.
[0693] One preferred screening method involves co-transfecting
HEK-293 cells with a mammalian expression plasmid encoding a
G-protein coupled receptor (GPCR), such as RAI-3, along with a
mixture comprised of mammalian expression plasmids cDNAs encoding
GU15 (Wilkie T. M. et al Proc Natl Acad Sci USA 1991 88:
10049-10053), GU16 (Amatruda T. T. et al Proc Natl Acad Sci USA
1991 8: 5587-5591, and three chimeric G-proteins refered to as
Gqi5, Gqs5, and Gqo5 (Conklin B R et al Nature 1993 363: 274-276,
Conklin B. R. et al Mol Pharmacol 1996 50: 885-890). Following a 24
h incubation the trasfected HEK-293 cells are plated into
poly-D-lysine coated 96 well black/clear plates (Becton Dickinson,
Bedford, Mass.).
[0694] The cells are assayed on FLIPR (Fluorescent Imaging Plate
Reader, Molecular Devices, Sunnyvale, Calif.) for a calcium
mobilization response following addition of test ligands. Upon
identification of a ligand which stimulates calcium mobilization in
HEK-293 cells expressing a given GPCR and the G-protein mixtures,
subsequent experiments are performed to determine which, if any,
G-protein is required for the functional response. HEK-293 cells
are then transfected with the test GPCR, or co-transfected with the
test GPCR and G015, GD16, Gqi5, Gqs5, or Gqo5. If the GPCR requires
the presence of one of the G-proteins for functional expression in
HEK-293 cells, all subsequent experiments are performed with
HEK-293 cell cotransfected with the GPCR and the G-protein which
gives the best response. Alternatively, the receptor can be
expressed in a different cell line, for example RBL-2H3, without
additional Gproteins.
[0695] Another screening method for agonists and antagonists relies
on the endogenous pheromone response pathway in the yeast,
Saccharomyces cerevisiae. Heterothallic strains of yeast can exist
in two mitotically stable haploid mating types, MATa and MATa. Each
cell type secretes a small peptide hormone that binds to a
G-protein coupled receptor on opposite mating type cells which
triggers a MAP kinase cascade leading to G1 arrest as a prelude to
cell fusion.
[0696] Genetic alteration of certain genes in the pheromone
response pathway can alter the normal response to pheromone, and
heterologous expression and coupling of human G-protein coupled
receptors and humanized G-protein subunits in yeast cells devoid of
endogenous pheromone receptors can be linked to downstream
signaling pathways and reporter genes (e.g., U.S. Pat. Nos.
5,063,154; 5,482,835; 5,691,188). Such genetic alterations include,
but are not limited to, (i) deletion of the STE2 or STE3 gene
encoding the endogenous G-protein coupled pheromone receptors; (ii)
deletion of the FAR1 gene encoding a protein that normally
associates with cyclindependent kinases leading to cell cycle
arrest; and (iii) construction of reporter genes fused to the FUS 1
gene promoter (where FUS 1 encodes a membrane-anchored glycoprotein
required for cell fusion). Downstream reporter genes can permit
either a positive growth selection (e.g., histidine prototrophy
using the FUS1-HIS3 reporter), or a colorimetric, fluorimetric or
spectrophotometric readout, depending on the specific reporter
construct used (e.g., b-galactosidase induction using a FUS1-LacZ
reporter).
[0697] The yeast cells can be further engineered to express and
secrete small peptides from random peptide libraries, some of which
can permit autocrine activation of heterologously expressed human
(or mammalian) G-protein coupled receptors (Broach, J. R. and
Thorner, J., Nature 384: 14-16, 1996; Manfredi et al., Mol. Cell.
Biol. 16: 4700-4709,1996). This provides a rapid direct growth
selection (e.g, using the FUS 1-HIS3 reporter) for surrogate
peptide agonists that activate characterized or orphan receptors.
Alternatively, yeast cells that functionally express human (or
mammalian) G-protein coupled receptors linked to a reporter gene
readout (e.g., FUS1-LacZ) can be used as a platform for
high-throughput screening of known ligands, fractions of biological
extracts and libraries of chemical compounds for either natural or
surrogate ligands.
[0698] Functional agonists of sufficient potency (whether natural
or surrogate) can be used as screening tools in yeast cell-based
assays for identifying G-protein coupled receptor antagonists. For
example, agonists will promote growth of a cell with FUS-HIS3
reporter or give positive readout for a cell with FUSI-LacZ.
However, a candidate compound which inhibits growth or negates the
positive readout induced by an agonist is an antagonist. For this
purpose, the yeast system offers advantages over mammalian
expression systems due to its ease of utility and null receptor
background (lack of endogenous G-protein coupled receptors) which
often interferes with the ability to identify agonists or
antagonists.
Example 18
Method of Screening to Identify Modulators of the RAI-3
Polypeptide
Introduction
[0699] G protein-coupled receptors (GPCRs) are a superfamily of
seven transmembrane-spanning proteins that are activated by a wide
range of extracellular ligands, including small molecules such as
biogenic amines, amino acids, ions, small and large peptides, and
bioactive lipids. GPCRs are expressed in virtually all tissues and
are involved in the regulation of a variety of cellular and
physiological responses, such as neurotransmission, chemotaxis,
inflammation, cell proliferation, cardiac and smooth muscle
contractility, and visual and chemosensory perception (Bockaert et
al., 2002; Pierce et al., 2002).
[0700] The sequencing of the human genome has led to predictions
that as many as 1,000 of the 35,000-60,000 human genes encode
G-protein coupled receptors (Lander et al., 2001; Venter et al.,
2001). About 400 of these are non-chemosensory receptors and can
therefore be considered as potential drug targets. More than half
of the so-called "druggable" GPCRs are known receptors, in the
sense that their activating ligands have been identified. The
remaining .about.155 receptors are "orphan receptors" (oGPCRs), for
which the natural activating ligands remain unknown. While there
has been recent success in identifying endogenous ligands for some
oGPCRs, most remain without a cognate ligand despite substantial
effort. This suggests that improvements to established
deorphanizing methods can be made. The most common approach for
de-orphanizing thus far is use "reverse pharmacology" to screen
populations of mammalian cells transiently transfected with the
oGPCR of interest. This reverse pharmacological strategy has
resulted in the discovery of more than 50 ligands for orphan GPCRs
(Szekeres, 2002). Candidate compounds for screening can be selected
based on similarity of the orphan to receptors of known
pharmacology. This approach is, however, ill-suited for those
orphan receptors with little or no homology to known GPCRs.
Alternatively, activating ligands can be identified using mixtures
of fractionated tissue extracts, often prepared from tissues known
to express the oGPCR in question (Civelli, 1998; Hinuma et al.,
1999). Finally, diverse collections of known and presumptive GPCR
signaling molecules can be assembled and screened in bulk for
modulators of orphan receptor function. Also, since the signal
transduction pathway(s) to which a given oGPCR naturally couples is
unknown, orphan GPCRs are frequently screened in the presence of
co-expressed promiscuous G protein alpha subunits,
G.alpha..sub.15/G.alpha..sub.16, or various chimeric G.alpha.
subunits in order to re-direct receptor signal output to predefined
endpoints (Milligan et al., 1996; Milligan and Rees, 1999;
Offermanns and Simon, 1995).
[0701] The inherent difficulty in identifying stable cell lines
exhibiting expression and coupling of oGPCRs to signal transduction
pathways in mammalian cell lines has forced most oGPCR screening to
rely on transient transfection systems. Transient expression of an
oGPCR has certain advantages, namely, that following transfection,
oGPCRs are generally expressed at reasonably high levels at the
cell surface. However, the logistical challenges involved in
scaling transient transfection protocols to support high throughput
screening (HTS) has necessitated smaller, more focused screening
strategies for orphan GPCR ligand discovery (Howard et al., 2001).
The screening decks of pharmaceutical companies, on the other hand,
are large collections of very diverse drug-like molecules derived
from medicinal chemistry, combinatorial synthesis, and natural
products, and can exceed one million compounds. Successful
integration of orphan receptors into the drug discovery pipeline
would be greatly aided by methods and processes to support full
deck high throughput or ultra-high throughput screening of these
targets. Such integration would allow oGPCRs to be exposed to the
entire chemical diversity contained within a large screening deck
and is a complementary approach to the current endogenous
ligand/focused screening paradigm.
[0702] Many GPCRs when overexpressed in heterologous systems (or
when a mutant GPCR is expressed at endogenous levels), exhibit
ligand independent, constitutive activity (de Ligt et al., 2000;
Leurs et al., 2000). Constitutive receptor activity is generally
understood as a spontaneous conversion of ligand-free receptors to
an activated form that is capable of activating heterotrimeric G
proteins and producing a measurable cellular response (Leurs et
al., 1998). For orphan receptors, the presence of constitutive
activity can provide a convenient indicator of receptor function
and may reveal information about the receptor's signaling mechanism
(Chalmers and Behan, 2002). Constitutive activity can also confer
certain advantages during drug screening. For example, screening of
cell lines expressing constitutively active receptors can result in
an increased sensitivity toward agonists (Chen et al., 2000). In
addition, since constitutively active receptors are sensitive to
both agonists and inverse agonists, positive and negative
modulators can be identified using the same cellular reagents or,
possibly, during the same screening campaign (Chen et al.,
2000).
[0703] Constitutive activity can be used, in conjunction with
Aurora Biosciences' .beta.-lactamase reporter system, to identify
and select stable cell lines expressing functional oGPCRs for
high-throughput screening. The bacterial .beta.-lactamase reporter
gene system has important features that make it ideally suited for
orphan GPCR screening on an industrial scale. These include rapid
assay development in conjunction with flow cytometry and
compatibility with automated ultra-high throughput (uHTS) screening
in highly miniaturized, cost-effective formats. Finally, screening
cells that possess moderate to high constitutive receptor activity
allows for identification of functional antagonists (inverse
agonists), an ability that is absent from most deorphanizing assays
in current use.
[0704] The orphan GPCR RAI-3 was first isolated as a retinoic-acid
inducible transcript from the squamous carcinoma cell line,
UMSCC-22B (Cheng and Lotan, 1998). Expression analysis revealed
that RAI-3 transcripts were abundant in fetal and adult lung
tissue, although expression is detected in other peripheral tissues
as well. Based on sequence homologies to other G protein coupled
receptors, RAI-3, and the closely related receptors GPCR5B, GPCR5C,
and GPCR5D (Brauner-Osbome et al., 2001; Brauner-Osborne and
Krogsgaard-Larsen, 2000; Robbins et al., 2000) define a Group 5
within the Family C family of GPCRs. In addition to the RAI-3
related receptors, Family C contains the metabotropic glutamate
receptors, the metabotropic GABA-B receptors, and the
calcium-sensing receptor. Most Family C receptors, which are
typified by the presence of extremely long extracellular
amino-terminal extensions. These amino-terminal regions have been
proposed to form so-called "Venus Flytrap" structures and define
the ligand binding domains and participate in heterodimerization of
Family C receptors. RAI-3 and the other Group 5 receptors, however,
possess relatively short amino-terminal extensions, making
speculation about the endogenous RAI-3 ligand(s) difficult
(Brauner-Osborne et al., 2001).
[0705] Both fully automated ultra-high throughput full-deck
screening and focused screening deorphanizing methods to the
identification of modulatory ligands for the orphan GPCR, RAI-3, is
described.
Materials and Methods
Compounds and Compound Screening Plates
[0706] The orphan receptor deorphanizing ligand library was
constructed from commercially available GPCR compound libraries.
The Neurotransmitter, Bioactive Lipid, and Orphan Ligand Libraries
were obtained from BIOMOL Research Laboratories (Plymouth Meeting,
Pa.), and the GPCR Peptide Ligand Library was purchased from
Phoenix Pharmaceuticals (Belmont, Calif.). All other compounds were
purchased from Sigma-Aldrich (St. Louis, Mo.). Prior to use, the
peptides in the GPCR Peptide Ligand Library were diluted to 10
.mu.M final concentration using the manufacturer's peptide storage
buffer. The concentration and storage buffer of the molecules in
the commercial libraries varied but was typically 10 mM in DMSO.
The commercially obtained 96 well compound plates were reformatted
into 384 well storage plates. For screening, GPCR compound
libraries containing in-house synthesized molecules, along with
several hundred known GPCR agonists present in the Bristol-Myers
Squibb compound screening deck, were added to the deorphanizing
ligand library (in-house compound concentration 1 mM in 100% DMSO).
All compound plates destined for primary screening were replica
plated and stored at -80.degree. C. until use. Ten-point 1:3 serial
dilutions of compounds for concentration-response testing were
prepared in 100% DMSO using a Matrix Technologies SerialMate
(Hudson, N.H.).
Cell Culture
[0707] All cell culture media and supplements were purchased from
Invitrogen Life Technologies (Grand Island, N.Y.). The parental
CHO-NFAT/G15-BLam cells were obtained from Aurora Biosciences (La
Jolla, Calif.) (described herein) and maintained in Dulbecco's
modified Eagle's medium supplemented with 10% heat-inactivated
fetal bovine serum (FBS), 1 mM sodium pyruvate, 1.times.MEM
nonessential amino acids, 200 .mu.g/ml Zeocin.TM. and 3 .mu.g/ml
blasticidin. Cell lines stably expressing orphan GPCRs cells were
maintained in the same media with the addition of 600 .mu.g/ml
Hygromycin B. Cells were routinely propagated by subculturing on a
biweekly schedule.
Transient Transfection
[0708] HEK293 cells were cultured in modified Eagle's medium
supplemented with 10% FBS and seeded at 8.times.10.sup.6 cells per
T-175 cm.sup.2 tissue culture flask one day prior to transfections.
Transfections were performed with 12 .mu.g of total DNA per flask
using the Lipofectamine Plus.TM. reagent (Invitrogen Life
Technologies, Grand Island, N.Y.) according to the manufacturer's
instructions. Cells were transfected with a 50:50 mixture of
pcDNA3-G.alpha.15 and pcDNA3.1-RAI-3 FLAG plasmids, pcDNA3.1 (mock
transfections) or pcDNA3.1-Topaz (evaluation of transfection
efficiency). Twenty-four hours after transfection, cells
co-transfected with RAI-3+G.alpha.15, and the mock transfected
cells, were harvested, counted and seeded into 384 well plates for
the calcium imaging assay (see below). Cells transfected with Topaz
were harvested and transfection efficiency was determined by FACS
using the FACS Vantage SE (Becton Dickinson, Franklin Lakes, N.J.).
All plasmids were prepared using standard methods (Sambrook and
Russell, 2001).
Beta-Lactamase Assay
[0709] The day before the assay, cell lines displaying RAI-3
expression were plated into 384-well assay plates at a density of
15,000 cells/well in Dulbecco's modified Eagle's medium containing
2.5% heat-inactivated FBS, 25 mM HEPES, 1 mM sodium pyruvate, and
1.times.MEM nonessential amino acids. Plates were incubated
overnight at 37.degree. C. in an atmosphere containing 5% CO.sub.2.
The day of the assay, cells were treated with a positive control
stimulus (1 .mu.M thapsigargin and 10 nM phorbol 12-myristate
13-acetate (PMA) in cell culture medium), a negative control
stimulus (cell culture medium), or test compound. The final
concentration of DMSO in the assay wells was 0.5%. For
concentration-response testing, the highest concentration of
compound in the assay was 50 .mu.M. All concentration-response
assays were performed in triplicate. Following a 4 hour incubation
at 37.degree. C. to allow for expression of the .beta.-lactamase
enzyme, {fraction (1/6)} volume of a cell loading solution
containing 12 .mu.M CCF2-AM (PanVera LLC, Madison, Wis.), 6 mg/ml
pluronic F127 (prepared as a 100 mg/ml stock in DMSO containing 10%
acetic acid), and 15 mM probenecid was added and the cells
incubated for 1-2 hours at room temperature. Beta-lactamase
activity was measured on an UL fluorescence plate reader fitted
with a 425 nm long-pass dichroic mirror, a 405.+-.10 nm excitation
filter, and 460.+-.20 nm and 530.+-.25 nm emission filters.
Compound responses, either stimulatory or inhibitory, were
determined by comparing the cell-associated fluorescence in the
test well to that of the negative control (medium only) wells.
Ultra-High Throughput Screening
[0710] Ultra-high throughput screening (uHTS) was performed using
an Aurora Ultra High Throughput Screening System (UHTSS.TM., Aurora
Instruments, LLC, La Jolla). Assay-ready 3456-well screening plates
were prepared by predispensing 7.5 nL of test compound (1 mM in
100% DMSO) per well with the Piezo Sample Dispensing Robot.TM.
(PSDR). Assay-ready screening plates were stored at 4.degree. C.
for no more than 30 days. On each screening day, cells were
harvested from .about.90% confluent T-175 tissue culture flasks
using non-enzymatic cell dissociation buffer. Cells were
resuspended in fresh culture medium (containing 2.5%
heat-inactivated FBS, 25 mM HEPES, 1 mM sodium pyruvate, and
1.times.MEM nonessential amino acids), and 0.75 .mu.L of the cell
suspension was dispensed into the assay plates. An additional 0.75
.mu.l of media or the thapsigargin/PMA cocktail was added to
compound wells and control wells, respectively. Following a 4 hr
incubation at 37.degree. C./5% CO.sub.2, 0.3 .mu.L of the cell
loading solution containing 12 uM CCF2/AM and probenecid was added.
All cell and reagent additions were performed by the 3456-well
Reagent Dispensing Robot.TM. (RDR). After a one hour incubation at
room temperature, the assay plates were read on the Topology
Compensating Plate Reader.TM. (TcPR) set for 400 nM excitation and
dual emission reads of 460 and 535 nM. A flow chart of the process
is presented in FIG. 3. The TcPR photomultiplier gain was set to
900 volts per channel. This procedure was followed for each of the
cell lines and repeated on each day that the screen was to be run.
Hits were defined as compounds displaying activities greater than 3
standard deviations above (for agonists) or below (for inverse
agonists) the sample mean. Compounds selected as hits were
subsequently hit-picked from the original source plate utilizing
the Hit Picking Robot.TM. (HPR) in a fully automated manner on the
UHTSS. Briefly, 6-point serial dilutions for each compound were
prepared in intermediate 384-well storage plates. The intermediate
CRC source plates were reformatted into 3456-well plates by the
PSDR, which also prepared 5 separate dilutions from each of the
original dilutions. The highest concentration of compound in the
UHTSS concentration-response assay was typically 12 .mu.M. The
final DMSO concentration ranged from 1.2%-0.33%. All
concentration-response assays were performed simultaneously against
the original RAI-3 clonal line and its constitutive activity
matched comparison line. Primary hits displaying selective activity
at the RAI-3 cell line were considered to be confirmed hits.
Calcium Imaging Assay
[0711] Transiently transfected HEK293 cells were detached with Cell
Dissociation Buffer, resuspended in phenol red-free Dulbecco's
modified Eagle's medium supplemented with 20 mM HEPES, pH 7.2, and
plated at 15,000 cells per well in poly-d-lysine coated 384 well
assay plates (Corning Life Sciences, Acton, Mass.). Following an
overnight incubation at 37.degree. C./5% CO.sub.2, cells were
loaded for 90 minutes with the cell-permeable calcium indicator,
Fluo-4 (TEF Labs, Austin, Tex.). The loading solution (3.times.)
contained 10 .mu.g/ml Fluo-4 and 0.5 mg/ml pluronic F127 in Hanks
Balanced Salt Solution supplemented with 20 mM HEPES. Stable RAI-3
cell lines in the CHO-NFAT/G15 background were processed
identically except that the cells were plated overnight in medium
containing 1% HI-FBS, and the loading solution contained 7.5 mM
probenecid (final concentration 2.5 mM). The assay was initiated by
the addition of 20 .mu.L of a 2.5.times. compound solution, diluted
in the HEPES-buffered Hanks solution. Control wells received
dilution buffer only (negative controls) or a challenge dose of
either carbachol or ATP at 100M final concentration, both of which
activate endogenous HEK293 GPCRs that are coupled to calcium
mobilization. Changes in intracellular calcium concentration in
response to compound addition were imaged using a Molecular Devices
FLIPR.TM.. The final compound concentrations in the FLIPR primary
screening assay was 160 .mu.M, 16 .mu.M, and 160 nM for the
commercial compounds, in-house library compounds, and commercial
peptides, respectively. All primary screening hits were analyzed by
retesting in duplicate at the same compound concentrations used for
primary screening. Confirmed positives (those active during retest)
were further analyzed by concentration-response testing, and the
highest compound concentration in this assay was 160 .mu.M. All
concentration-response assays were performed in triplicate.
Statistical Calculations
[0712] The following statistical measures were used to calculate
assay robustness (x.sub.1 and x.sub.3 are the means of the minimum
and maximum signals, and s.sub.1 and s.sub.3 are the respective
standard deviations): 1 Z ' = 1 - ( 3 s 3 + 3 s 1 x _ 3 - x _ 1 )
Signal Window = ( x _ 3 - 3 s 3 ) - ( x _ 1 + 3 s 1 ) ( s 1 2 + s 3
2 ) 2 Signal - to - Noise = ( x _ 3 - x _ 1 ) s 3 2 + s 1 2
Selection of Cell Lines for Ultra-High Throughput Screening
[0713] Candidate stable .beta.-lactamase reporter cell lines
expressing the orphan GPCR, RAI-3, were tested to determine their
suitability for HTS. Beta-lactamase activity is assessed by
monitoring changes in the fluorescence resonance energy transfer
(FRET) between the .beta.-lactam-linked coumarin and fluorescein
dye pairs of CCF2. In conditions of low .beta.-lactamase
expression, excitation of the coumarin results in efficient FRET,
strong emission at 530 nm and a low em.sub.460/em.sub.530 ratio.
Expression of .beta.-lactamase enzyme results in cleavage of the
.beta.-lactam moiety and disruption of FRET, leading to increased
coumarin emission at 460 nm, and a resulting increase in the
em.sub.460/em.sub.530 ratio (Zlokarnik et al., 1998). The
constitutive .beta.-lactamase activity of each cell line was
estimated by comparing the observed .beta.-lactamase activity of
the orphan cell lines to that of the CHO-G15/NFAT parental cell
line. The ability of each of the cell lines to produce a positive
response was determined by the activity obtained following exposure
of the cells to the PMA cocktail. Statistical measures were
calculated for each orphan in "agonist mode" (using the basal and
PMA-inducible activities of the orphan cell line as the minimum and
maximum) and in "inverse-agonist mode" (using the basal orphan
activity as the maximum signal, and the parental basal activity as
the minimum signal). Cell lines with an assay Z' of at least 0.5 in
either agonist or antagonist mode were selected for screening. Two
cell lines stably expressing RAI-3 were selected for parallel
screening on the Aurora Ultra High Throughput Screening System
(UHTSS.TM.). One RAI-3 cell line (RAI-3 Clone E8) possessed very
low constitutive activity, thereby permitting the identification of
agonists only. The other RAI-3 cell line (Clone B8) possessed
sufficient constitutive activity to permit the detection of both
agonists and inverse agonists. Both cell lines displayed acceptable
assay performance during validation and testing (Tables 1 and 2).
During assay validation, the Z' for RAI-3 Clone B8 was below 0.5.
However, since this clone, unlike the other RAI-3 cell lines
investigated, had moderately high constitutive activity, it also
was selected for screening. Two additional orphan receptor cell
lines were validated and screened at the same time. Both of these
other orphans receptors belong to GPCR Family A (rhodopsin-like).
One is a putative peptide receptor while the other has the greatest
similarity to receptors for biogenic amines. These cell lines were
chosen in part because their constitutive activities roughly
corresponded to the constitutive activities displayed by the RAI-3
cell lines. This allowed for selectivity comparisons to be made for
the primary screening hits. All four cell lines were derived from
the same parental cells, CHO NFAT/Ga.sub.15, and utilized the
.beta.-lactamase reporter. All the clones were previously confirmed
to express the appropriate orphan receptor at the mRNA and protein
levels (described elsewhere herein).
Compound Identification--UHTSS.TM.
[0714] Approximately 290,000 compounds were screened in triplicate
against the four cell lines, with almost 4 million data points and
3,000 concentration-response curves generated in 8 weeks. During
screening, the assay Z' for both cell lines was typically greater
than 0.5 (data not shown). A total of thirty-three hits were
identified for the two RAI-3 cell lines. Approximately half
({fraction (16/33)}) appeared to possess agonist activity in the
UHTSS beta-lactamase screen, and of these six compounds were active
at both the RAI-3 Clone B8 and RAI-3 Clone E8 cell lines. By
comparison, there were 27 and 12 hits for the orphan cell lines
with moderate and low constitutive activity, respectively. All of
the RAI-3 primary hits were tested in concentration-response
experiments for agonist activity using a 384-well .beta.-lactamase
assay and a 384-well calcium imaging assay. Both these follow-up
assays permitted the use of higher starting compound concentrations
than did the closed-loop UHTSS process. In addition, the calcium
imaging assay employed transiently transfected HEK293, permitting
confirmation in an independent assay. The follow-up testing
confirmed three of the original 33 UHTSS hits as potential
surrogate agonists for RAI-3 (Table 2). One of these three
compounds showed selective agonist activity for RAI-3 in the
384-well .beta.-lactamase assay and in the HEK293 transient calcium
assay. A second compound was a selective agonist in the HEK293
transient calcium assay but was a nonselective agonist in the
384-well .beta.-lactamase assay. The third compound, while a
selective agonist in the HEK293 transient calcium assay, was
inactive in the 384-well .beta.-lactamase assay.
24TABLE 2 Clone B8 Clone E8 384-Well Compound uHTSS uHTSS HEK FLIPR
Lactamase 1 Agonist Agonist Selective Selective agonist agonist 2
Agonist Agonist Selective Nonselective agonist agonist 3 Agonist
Agonist Selective Inactive agonist
[0715] Thirty substances of interest from the RAI-3 ultra-high
throughput screening campaign, were identified. These were followed
up using 384-well .beta.-lactamase and calcium imaging assays.
Three substances displayed some degree of selectivity in the
follow-up assays: Compound 1 was selectively active in the 384 well
lactamase assay and the HEK transient FLIPR assay; Compound 2 was
selectively active in the HEK transient FLIPR assay but was active
in all CHO lines tested; and Compound 3 was inactive in all CHO
cell assays but was selectively active in the HEK transient FLIPR
assay.
[0716] A response curve for Compound 1 measuring the level of
modulation of RAI-3 constitutive activity is provided in FIG. 35A.
A response curve for Compound 1 measuring the level of modulation
of the constitutive activity of another G-protein coupled receptor,
HGPRBMY7 is provided in FIG. 35B. The data demonstrates that the
screening method for RAI-3 is capable of identifying selective
modulators of RAI-3.
LITERATURE CITED
[0717] Bockaert, J., Claeysen, S., Becamel, C., Pinloche, S., and
Dumuis, A. (2002). G protein-coupled receptors: dominant players in
cell-cell communication. Int Rev Cytol 212, 63-132.
[0718] Brauner-Osborne, H., Jensen, A. A., Sheppard, P. O., Brodin,
B., Krogsgaard-Larsen, P., and O'Hara, P. (2001). Cloning and
characterization of a human orphan family C G-protein coupled
receptor GPRC5D. Biochim Biophys Acta 1518, 237-248.
[0719] Brauner-Osborne, H., and Krogsgaard-Larsen, P. (2000).
Sequence and expression pattern of a novel human orphan
G-protein-coupled receptor, GPRC5B, a family C receptor with a
short amino-terminal domain. Genomics 65, 121-128.
[0720] Chalmers, D. T., and Behan, D. P. (2002). The use of
constitutively active GPCRs in drug discovery and functional
genomics. Nat Rev Drug Discovery 1, 599-608.
[0721] Chen, G., Way, J., Armour, S., Watson, C., Queen, K.,
Jayawickreme, C. K., Chen, W. J., and Kenakin, T. (2000). Use of
constitutive G protein-coupled receptor activity for drug
discovery. Mol Pharmacol 57, 125-134.
[0722] Cheng, Y., and Lotan, R. (1998). Molecular cloning and
characterization of a novel retinoic acid-inducible gene that
encodes a putative G protein-coupled receptor. J Biol Chem 273,
35008-35015.
[0723] Civelli, O. (1998). Functional genomics, the search for
novel neurotransmitters and neuropeptides. FEBS Letters 430,
55-58.
[0724] de Ligt, R. A., Kourounakis, A. P., and AP, I. J. (2000).
Inverse agonism at G protein-coupled receptors:
(patho)physiological relevance and implications for drug discovery.
Br J Pharmacol 130, 1-12.
[0725] Hinuma, S., Onda, H., and Fujino, M. (1999). The quest for
novel bioactive peptides utilizing orphan
seven-transmembrane-domain receptors. J Mol Med 77, 495-504.
[0726] Howard, A. D., McAllister, G., Feighner, S. D., Liu, Q.,
Nargund, R. P., Van der Ploeg, L. H., and Patchett, A. A. (2001).
Orphan G-protein-coupled receptors and natural ligand discovery.
Trends Pharmacol Sci 22, 132-140.
[0727] Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody,
M. C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W.,
et al. (2001). Initial sequencing and analysis of the human genome.
Nature 409, 860-921.
[0728] Leurs, R., Rodriguez Pena, M. S., Bakker, R. A., Alewijnse,
A. E., and Timmerman, H. (2000). Constitutive activity of G protein
coupled receptors and drug action. Pharm Acta Helv 74, 327-331.
[0729] Leurs, R., Smit, M. J., Alewijnse, A. E., and Timmerman, H.
(1998). Agonist-independent regulation of constitutively active
G-protein-coupled receptors. Trends Biochem Sci 23, 418-422.
[0730] Milligan, G., Marshall, F., and Rees, S. (1996). G(16) as a
universal G protein adapter: implications for agonist screening
strategies. Trends Pharmacol Sci 17, 235-237.
[0731] Milligan, G., and Rees, S. (1999). Chimaeric G alpha
proteins: their potential use in drug discovery. Trends Pharmacol
Sci 20, 118-124.
[0732] Offermanns, S., and Simon, M. I. (1995). G alpha 15 and G
alpha 16 couple a wide variety of receptors to phospholipase C. J
Biol Chem 270, 15175-15180.
[0733] Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002).
Seven-transmembrane receptors. Nature Reviews Mol Cell Biol 3,
639-650.
[0734] Robbins, M. J., Michalovich, D., Hill, J., Calver, A. R.,
Medhurst, A. D., Gloger, I., Sims, M., Middlemiss, D. N., and
Pangalos, M. N. (2000). Molecular cloning and characterization of
two novel retinoic acid-inducible orphan G-protein-coupled
receptors (GPRC5B and GPRC5C). Genomics 67, 8-18.
[0735] Sambrook, J., and Russell, D. W. (2001). Molecular Cloning:
A Laboratory Manual, 3rd Edition (Cold Spring Harbor, Cold Spring
Harbor Laboratory Press).
[0736] Szekeres, P. G. (2002). Functional assays for identifying
ligands at orphan G protein-coupled receptors. Receptors and
Channels 8, 297-308.
[0737] Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural,
R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A.,
Holt, R. A., et al. (2001). The sequence of the human genome.
Science 291, 1304-1351.
[0738] Zlokarnik, G., Negulescu, P. A., Knapp, T. E., Mere, L.,
Burres, N., Feng, L., Whitney, M., Roemer, K., and Tsien, R. Y.
(1998). Quantitation of transcription and clonal selection of
single living cells with beta-lactamase as reporter. Science 279,
84-88.
[0739] The contents of all patents, patent (applications, published
PCT applications and articles, books, references, reference
manuals, abstracts, the Sequence Listing and internet websites
cited herein are hereby incorporated by reference in their entirety
to more fully describe the state of the art to which the invention
pertains.
[0740] As various changes can be made in the above-described
subject matter without departing from the scope and spirit of the
present invention, it is intended that all subject matter contained
in the above description, or defined in the appended claims, be
interpreted as descriptive and illustrative of the present
invention. Many modifications and variations of the present
invention are possible in light of the above teachings.
Sequence CWU 0
0
* * * * *