U.S. patent application number 10/101454 was filed with the patent office on 2004-06-10 for acylated insulin.
Invention is credited to Andersen, Asser Sloth, Halstrom, John, Havelund, Svend, Jonassen, Ib, Markussen, Jan.
Application Number | 20040110664 10/101454 |
Document ID | / |
Family ID | 34279918 |
Filed Date | 2004-06-10 |
United States Patent
Application |
20040110664 |
Kind Code |
A1 |
Havelund, Svend ; et
al. |
June 10, 2004 |
Acylated insulin
Abstract
The present invention relates to protracted human insulin
derivatives in which the A21 and the B3 amino acid residues are,
independently, any amino acid residue which can be coded for by the
genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted;
the B30 amino acid residue is (a) a non-codable, lipophilic amino
acid having from 10 to 24 carbon atoms, in which case an acyl group
of a carboxylic acid with up to 5 carbon atoms is bound to the
.epsilon.-amino group of Lys.sup.B29; or (b) the B30 amino acid
residue is deleted or is any amino acid residue which can be coded
for by the genetic code except Lys, Arg and Cys, in any of which
cases the .epsilon.-amino group of Lys.sup.B29 has a lipophilic
substituent; and any Zn.sup.2+ complexes thereof with the proviso
that when B30 is Thr or Ala and A21 and B3 are both Asn, and
Phe.sup.B1 is present, then the insulin derivative is always
present as a Zn.sup.2+ complex.
Inventors: |
Havelund, Svend; (Bagsvaerd,
DK) ; Halstrom, John; (Hundested, DK) ;
Jonassen, Ib; (Valby, DK) ; Andersen, Asser
Sloth; (Frederiksberg C, DK) ; Markussen, Jan;
(Herlev, DK) |
Correspondence
Address: |
Reza Green, Esq.
Novo Nordisk of North America, Inc.
405 Lexington Avenue, Suite 6400
New York
NY
10174-6401
US
|
Family ID: |
34279918 |
Appl. No.: |
10/101454 |
Filed: |
March 12, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10101454 |
Mar 12, 2002 |
|
|
|
09398365 |
Sep 17, 1999 |
|
|
|
09398365 |
Sep 17, 1999 |
|
|
|
08975365 |
Nov 20, 1997 |
|
|
|
6011007 |
|
|
|
|
08975365 |
Nov 20, 1997 |
|
|
|
08400256 |
Mar 8, 1995 |
|
|
|
5750497 |
|
|
|
|
08400256 |
Mar 8, 1995 |
|
|
|
08190829 |
Feb 2, 1994 |
|
|
|
Current U.S.
Class: |
514/6.2 ;
514/6.3; 514/6.4 |
Current CPC
Class: |
Y10S 514/866 20130101;
C07K 14/62 20130101; A61K 38/00 20130101 |
Class at
Publication: |
514/003 |
International
Class: |
A61K 038/28 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 17, 1993 |
DK |
1044/93 |
Claims
1 An insulin derivative having the following sequence: 2wherein (a)
Aaa at positions A21 and B3 are, independently, any amino acid
residue which can be coded for by the genetic code except Lys, Arg
and Cys; (b) Xaa at position B1 is Phe or is deleted; (c) Xaa at
position B30 is any amino acid residue which can be coded for by
the genetic code except Lys, Arg and Cys; and (d) the
.epsilon.-amino group of Lys.sup.B29 is substituted with a
lipophilic substituent having at least 10 carbon atoms; wherein the
insulin derivative is a Zn.sup.2+ complex and the Zn.sup.2+ complex
of the insulin derivative is more water soluble than the insulin
derivative without Zn.sup.2+.
2 The insulin derivative according to claim 1, wherein Xaa at
position A21 is Asn.
3 The insulin derivative according to claim 2, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
4 The insulin derivative according to claim 1, wherein Xaa at
position A21 is Ala, Asn, Gin, Gly or Ser.
5 The insulin derivative according to claim 4, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
6 The insulin derivative according to claim 1, wherein Xaa at
position B1 is deleted.
7 The insulin derivative according to claim 6, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
8 The insulin derivative according to claim 1, wherein Xaa at
position B1 is Phe.
9 The insulin derivative according to claim 8, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
10 The insulin derivative according to claim 1, wherein Xaa at
position B3 is Asn, Asp, Gln or Thr.
11 The insulin derivative according to claim 10, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
12 The insulin derivative according to claim 1, wherein Xaa at
position B30 is Ala or Thr.
13 The insulin derivative according to claim 12, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
14 The insulin derivative according to claim 1, wherein Xaa at
position A21 is Ala, Asn, Gin, Gly or Ser, Xaa at position B3 is
Asn, Asp, Gin or Thr, and Xaa at position B30 is Ala or Thr.
15 The insulin derivative according to claim 14, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
16 The insulin derivative according to claim 1, wherein Xaa at
position A21 is Asn, Xaa at position B3 is Asn, Xaa at position B1
is Phe and Xaa at position B30 is Thr.
17 The insulin derivative according to claim 16, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
18 The insulin derivative according to claim 1, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
19 The insulin derivative according to claim 1 which is in the form
of a hexamer.
20 The insulin derivative according to claim 19, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
21 The insulin derivative according to claim 19, wherein Xaa at
position A21 is Asn, Xaa at position B1 is Phe, Xaa at position B3
is Asn, and Xaa at position B30 is Thr.
22 The insulin derivative according to claim 19, wherein two zinc
ions bind to the hexamer.
23 The insulin derivative according to claim 22, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
24 The insulin derivative according to claim 19, wherein three zinc
ions bind to the hexamer.
25 The insulin derivative according to claim 24, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
26 The insulin derivative according to claim 19, wherein four zinc
ions bind to the hexamer.
27 The insulin derivative according to claim 26, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
28 A pharmaceutical composition which is an aqueous solution,
comprising (a) an insulin derivative according to claim 1, (b) an
isotonic agent, (c) a preservative and (d) a buffer.
29 The pharmaceutical composition according to claim 28, wherein
the pH of the aqueous solution is in the range of 6.5-8.5.
30 The pharmaceutical composition according to claim 28, wherein
the solubility of the insulin derivative exceeds 600 nmol/ml of the
aqueous solution.
31 The pharmaceutical composition according to claim 28, further
comprising an insulin or an insulin analogue which has a rapid
onset of action.
32 The pharmaceutical composition according to claim 28, wherein
Xaa at position A21 is Asn, Xaa at position B3 is Asn, Xaa at
position B1 is Phe and Xaa at position B30 is Thr.
33 The pharmaceutical composition according to claim 28, wherein
the lipophilic substituent has from 12 to 24 carbon atoms.
34 The pharmaceutical composition according to claim 28, wherein
the insulin derivative is in the form of a hexamer.
35 A method of treating diabetes in a patient in need of such a
treatment, comprising administering to the patient a
therapeutically effective amount of a pharmaceutical composition
according to claim 28.
36 An insulin derivative having the following sequence: 3wherein
(a) Xaa at positions A21 and B3 are, independently, any amino acid
residue which can be coded for by the genetic code except Lys, Arg
and Cys; (b) Xaa at position BI is Phe or is deleted; (c) Xaa at
position B30 is deleted; and (d) the .epsilon.-amiiino group of
Lys.sup.B29 is substituted with a lipophilic substituent having at
least 10 carbon atoms; wherein the insulin derivative is a
Zn.sup.2+ complex and the Zn.sup.2+ complex of the insulin
derivative is more water soluble than the insulin derivative
without Zn.sup.2+.
37 The insulin derivative according to claim 36, wherein Xaa at
position A21 is Ala, Asn, Gln, Gly or Ser.
38 The insulin derivative according to claim 37, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
39 The insulin derivative according to claim 36, wherein Xaa at
position B1 is deleted.
40 The insulin derivative according to claim 39, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
41 Thc insulin derivative according to claim 36, wherein Xaa at
position B1 is Phe.
42 The insulin derivative according to claim 41, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
43 The insulin derivative according to claim 36, wherein Xaa at
position B3 is Asn, Asp, Gln or Thr.
44 The insulin derivative according to claim 43, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
45 The insulin derivative according to claim 36 wherein Xaa at
position A21 is Ala, Asn, Gln, Gly or Ser, and Xaa at position B3
is Asn, Asp, Gin or Thr.
46 The insulin derivative according to claim 45, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
47 The insulin derivative according to claim 36, wherein Xaa at
position A21 is Asn, Xaa at position B1 is Phe, and Xaa at position
B3 is Asn.
48 The insulin derivative according to claim 47, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
49 The insulin derivative according to claim 36, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
50 The insulin derivative according to claim 36 which is in the
form of a hexamer.
51 The insulin derivative according to claim 50, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
52 The insulin derivative according to claim 50, wherein Xaa at
position A21 is Asn, Xaa at position B3 is Asn, and Xaa at position
B1 is Phe.
53 The insulin derivative according to claim 50, wherein two zinc
ions bind to the hexamer.
54 The insulin derivative according to claim 53, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
55 The insulin derivative according to claim 50, wherein three zinc
ions bind to the hexamer.
56 The insulin derivative according to claim 55, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
57 The insulin derivative according to claim 50, wherein four zinc
ions bind to the hexamer.
58 The insulin derivative according to claim 57, wherein the
lipophilic substituent has from 12 to 24 carbon atoms.
59 A pharmaceutical composition which is an aqueous solution,
comprising (a) an insulin derivative according to claim 36, (b) an
isotonic agent, (c) a preservative and (d) a buffer.
60 The pharmaceutical composition according to claim 59, wherein
the pH of the aqueous solution is in the range of 6.5-8.5.
61 The pharmaceutical composition according to claim 59, wherein
the solubility of the insulin derivative exceeds 600 nmol/ml of the
aqueous solution.
62 The pharmaceutical composition according to claim 59, further
comprising an insulin or an insulin analogue which has a rapid
onset of action.
63 The pharmaceutical composition according to claim 59, wherein
the insulin derivative is a Zn.sup.2+ complex.
64 The pharmaceutical composition according to claim 59, wherein
Xaa at position A21 is Asn, Xaa at position B3 is Asn, and Xaa at
position B1 is Phe.
65 The pharmaceutical composition according to claim 59, wherein
the lipophilic substituent has from 12 to 24 carbon atoms.
66 The pharmaceutical composition according to claim 59, wherein
the insulin derivative is in the form of a hexamer.
67 A method of treating diabetes in a patient in need of such a
treatment, comprising administering to the patient a
therapeutically effective amount of a pharmaceutical composition
according to claim 59.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of pending application
U.S. Ser. No. 09/398,365 filed Sep. 17, 1999, which is a divisional
of U.S. Ser. No. 08/975,365 filed Nov. 20, 1997, now U.S. Pat. No.
6,011,007 issued Jan. 4, 2000, which is a continuation-in-part of
application Ser. No. 08/400,256 filed Mar. 8, 1995, now U.S. Pat.
No. 5,750,947, which is a continuation-in-part of Ser. No.
08/190,829 filed Feb. 2, 1994, now abandoned, and serial no.
PCT/DK94/00347 filed 16 Sep. 1994, now abandoned, which claims
priority under 35 U.S.C. 119 of Danish application no. 1044/93
filed 17 Sep. 1993, the contents of which are fully incorporated
herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to novel human insulin
derivatives which are soluble and have a protracted profile of
action, to a method of providing such derivatives, to
pharmaceutical compositions containing them, and to the use of such
insulin derivatives in the treatment of diabetes.
BACKGROUND OF THE INVENTION
[0003] Many diabetic patients are treated with multiple daily
insulin injections in a regimen comprising one or two daily
injections of a protracted insulin to cover the basal requirement
supplemented by bolus injections of a rapid acting insulin to cover
the requirement related to meals.
[0004] Protracted insulin compositions are well known in the art.
Thus, one main type of protracted insulin compositions comprises
injectable aqueous suspensions of insulin crystals or amorphous
insulin. In these compositions, the insulin compounds utilized
typically are protamine insulin, zinc insulin or protamine zinc
insulin.
[0005] Certain drawbacks are associated with the use of insulin
suspensions. Thus, in order to secure an accurate dosing, the
insulin particles must be suspended homogeneously by gentle shaking
before a defined volume of the suspension is withdrawn from a vial
or expelled from a cartridge. Also, for the storage of insulin
suspensions, the temperature must expelled from a cartridge. Also,
for the storage of insulin suspensions, the temperature must be
kept within more narrow limits than for insulin solutions in order
to avoid lump formation or coagulation.
[0006] While it was earlier believed that protamines were
non-immunogenic, it has now turned out that protamines can be
immunogenic in man and that their use for medical purposes may lead
to formation of antibodies (Samuel et al., Studies on the
immunogenecity of protamines in humans and experimental animals by
means of a micro-complement fixation test, Clin. Exp. Immunol. 33,
pp. 252-260 (1978)).
[0007] Also, evidence has been found that the protamine-insulin
complex is itself immunogenic (Kurtz et al., Circulating IgG
antibody to protamine in patients treated with protamine-insulins.
Diabetologica 25, pp. 322-324 (1983)). Therefore, with some
patients the use of protracted insulin compositions containing
protamines must be avoided.
[0008] Another type of protracted insulin compositions are
solutions having a pH value below physiological pH from which the
insulin will precipitate because of the rise in the pH value when
the solution is injected. A drawback with these solutions is that
the particle size distribution of the precipitate formed in the
tissue on injection, and thus the timing of the medication, depends
on the blood flow at the injection site and other parameters in a
somewhat unpredictable manner. A further drawback is that the solid
particles of the insulin may act as a local irritant causing
inflammation of the tissue at the site of injection.
[0009] WO 91/12817 (Novo Nordisk A/S) discloses protracted, soluble
insulin compositions comprising insulin complexes of cobalt(III).
The protraction of these complexes is only intermediate and the
bioavailability is reduced.
[0010] Human insulin has three primary amino groups: the N-terminal
group of the A-chain and of the B-chain and the .epsilon.-amino
group of Lys.sup.B29. Several insulin derivatives which are
substituted in one or more of these groups are known in the prior
art. Thus, U.S. Pat. No. 3,528,960 (Eli Lilly) relates to
N-carboxyaroyl insulins in which one, two or three primary amino
groups of the insulin molecule has a carboxyaroyl group. No
specifically N.sup..epsilon.B29-substituted insulins are
disclosed.
[0011] According to GB Patent No. 1.492.997 (Nat. Res. Dev. Corp.),
it has been found that insulin with a carbamyl substitution at
N.sup..epsilon.B29 has an improved profile of hypoglycaemic
effect.
[0012] JP laid-open patent application No. 1-254699 (Kodama Co.,
Ltd.) discloses insulin wherein a fatty acid is bound to the amino
group of Phe.sup.B1 or to the .epsilon.-amino group of Lys.sup.B29
or to both of these. The stated purpose of the derivatisation is to
obtain a pharmacologically acceptable, stable insulin
preparation.
[0013] Insulins, which in the B30 position have an amino acid
having at least five carbon atoms which cannot necessarily be coded
for by a triplet of nucleotides, are described in JP laid-open
patent application No. 57-067548 (Shionogi). The insulin analogues
are claimed to be useful in the treatment of diabetes mellitus,
particularly in patients who are insulin resistant due to
generation of bovine or swine insulin antibodies.
[0014] By "insulin derivative" as used herein is meant a compound
having a molecular structure similar to that of human insulin
including the disulfide bridges between Cys.sup.A7 and Cys.sup.B7
and between Cys.sup.A20 and Cys.sup.B19 and an internal disulfide
bridge between Cys.sup.A6 and Cys.sup.A11, and which have insulin
activity.
[0015] However, there still is a need for protracted injectable
insulin compositions which are solutions and contain insulins which
stay in solution after injection and possess minimal inflammatory
and immunogenic properties.
[0016] One object of the present invention is to provide human
insulin derivatives, with a protracted profile of action, which are
soluble at physiological pH values.
[0017] Another object of the present invention is to provide a
pharmaceutical composition comprising the human insulin derivatives
according to the invention.
[0018] It is a further object of the invention to provide a method
of making the human insulin derivatives of the invention.
SUMMARY OF THE INVENTION
[0019] Surprisingly, it has turned out that certain human insulin
derivatives, wherein the .epsilon.-amino group of Lys.sup.B29 has a
lipophilic substituent, have a protracted profile of action and are
soluble at physiological pH values.
[0020] Accordingly, in its broadest aspect, the present invention
relates to an insulin derivative having the following sequence:
1
[0021] wherein
[0022] Xaa at positions A21 and B3 are, independently, any amino
acid residue which can be coded for by the genetic code except Lys,
Arg and Cys;
[0023] Xaa at position B1 is Phe or is deleted;
[0024] Xaa at position B30 is (a) a non-codable, lipophilic amino
acid having from 10 to 24 carbon atoms, in which case an acyl group
of a carboxylic acid with up to 5 carbon atoms is bound to the
.epsilon.-amino group of Lys.sup.B29, (b) any amino acid residue
which can be coded for by the genetic code except Lys, Arg and Cys,
in which case the .epsilon.-amino group of Lys.sup.B29 has a
lipophilic substituent or (c) deleted, in which case the
.epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent;
and any Zn.sup.2+ complexes thereof, provided that when Xaa at
position B30 is Thr or Ala, Xaa at positions A21 and B3 are both
Asn, and Xaa at position B1 is Phe, then the insulin derivative is
a Zn.sup.2+ complex.
[0025] In one preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
deleted or is any amino acid residue which can be coded for by the
genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid
residues are, independently, any amino acid residues which can be
coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1
may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a
lipophilic substituent which comprises at least 6 carbon atoms; and
2-4 Zn.sup.2+ ions may be bound to each insulin hexamer with the
proviso that when B30 is Thr or Ala and A21 and B3 are both Asn,
and Phe.sup.B1 is not deleted, then 2-4 Zn.sup.2+ ions are bound to
each hexamer of the insulin derivative.
[0026] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
deleted or is any amino acid residue which can be coded for by the
genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid
residues are, independently, any amino acid residues which can be
coded for by the genetic code except Lys, Arg and Cys, with the
proviso that if the B30 amino acid residue is Ala or Thr, then at
least one of the residues A21 and B3 is different from Asn;
Phe.sup.B1 may be deleted; and the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which comprises at least 6
carbon atoms.
[0027] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
deleted or is any amino acid residue which can be coded for by the
genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid
residues are, independently, any amino acid residues which can be
coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1
may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a
lipophilic substituent which comprises at least 6 carbon atoms; and
2-4 Zn.sup.2+ ions are bound to each insulin hexamer.
[0028] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
deleted.
[0029] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
Asp.
[0030] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
Glu.
[0031] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid residue is
Thr.
[0032] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is a
lipophilic amino acid having at least 10 carbon atoms.
[0033] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is a
lipophilic .alpha.-amino acid having from 10 to 24 carbon
atoms.
[0034] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is a straight
chain, saturated, aliphatic .alpha.-amino acid having from 10 to 24
carbon atoms.
[0035] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is D- or
L-N.sup..epsilon.-dodecanoyllysine.
[0036] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino decanoic acid.
[0037] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino undecanoic acid.
[0038] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino dodecanoic acid.
[0039] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino tridecanoic acid.
[0040] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino tetradecanoic acid.
[0041] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino pentadecanoic acid.
[0042] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is
.alpha.-amino hexadecanoic acid.
[0043] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B30 amino acid is an
.alpha.-amino acid.
[0044] In another preferred embodiment, the invention relates to a
human insulin derivative in which the A21 amino acid residue is
Ala.
[0045] In another preferred embodiment, the invention relates to a
human insulin derivative in which the A21 amino acid residue is
Gln.
[0046] In another preferred embodiment, the invention relates to a
human insulin derivative in which the A21 amino acid residue is
Gly.
[0047] In another preferred embodiment, the invention relates to a
human insulin derivative in which the A21 amino acid residue is
Ser.
[0048] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B3 amino acid residue is
Asp.
[0049] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B3 amino acid residue is
Gln.
[0050] In another preferred embodiment, the invention relates to a
human insulin derivative in which the B3 amino acid residue is
Thr.
[0051] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group
corresponding to a carboxylic acid having at least 6 carbon
atoms.
[0052] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group,
branched or unbranched, which corresponds to a carboxylic acid
having a chain of carbon atoms 8 to 24 atoms long.
[0053] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group
corresponding to a fatty acid having at least 6 carbon atoms.
[0054] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group
corresponding to a linear, saturated carboxylic acid having from 6
to 24 carbon atoms.
[0055] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group
corresponding to a linear, saturated carboxylic acid having from 8
to 12 carbon atoms.
[0056] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an acyl group
corresponding to a linear, saturated carboxylic acid having from 10
to 16 carbon atoms.
[0057] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an oligo
oxyethylene group comprising up to 10, preferably up to 5,
oxyethylene units.
[0058] In another preferred embodiment, the invention relates to a
human insulin derivative in which the .epsilon.-amino group of
Lys.sup.B29 has a lipophilic substituent which is an oligo
oxypropylene group comprising up to 10, preferably up to 5,
oxypropylene units.
[0059] In another preferred embodiment, the invention relates to a
human insulin derivative in which each insulin hexamer binds 2
Zn.sup.2+ ions.
[0060] In another preferred embodiment, the invention relates to a
human insulin derivative in which each insulin hexamer binds 3
Zn.sup.2+ ions.
[0061] In another preferred embodiment, the invention relates to a
human insulin derivative in which each insulin hexamer binds 4
Zn.sup.2+ ionS.
[0062] In another preferred embodiment, the invention relates to
the use of a human insulin derivative according to the invention
for the preparation of a medicament for treating diabetes.
[0063] In another preferred embodiment, the invention relates to a
pharmaceutical composition for the treatment of diabetes in a
patient in need of such a treatment comprising a therapeutically
effective amount of a human insulin derivative according to the
invention together with a pharmaceutically acceptable carrier.
[0064] In another preferred embodiment, the invention relates to a
pharmaceutical composition for the treatment of diabetes in a
patient in need of such a treatment comprising a therapeutically
effective amount of a human insulin derivative according to the
invention, in mixture with an insulin or an insulin analogue which
has a rapid onset of action, together with a pharmaceutically
acceptable carrier.
[0065] In another preferred embodiment, the invention relates to a
pharmaceutical composition comprising a human insulin derivative
according to the invention which is soluble at physiological pH
values.
[0066] In another preferred embodiment, the invention relates to a
pharmaceutical composition comprising a human insulin derivative
according to the invention which is soluble at pH values in the
interval from about 6.5 to about 8.5.
[0067] In another preferred embodiment, the invention relates to a
protracted pharmaceutical composition comprising a human insulin
derivative according to the invention.
[0068] In another preferred embodiment, the invention relates to a
pharmaceutical composition which is a solution containing from
about 120 nmol/ml to about 1200 nmol/ml, preferably about 600
nmol/ml of a human insulin derivative according to the
invention.
[0069] In another preferred embodiment, the invention relates to a
method of treating diabetes in a patient in need of such a
treatment comprising administering to the patient a therapeutically
effective amount of an insulin derivative according to this
invention together with a pharmaceutically acceptable carrier.
[0070] In another preferred embodiment, the invention relates to a
method of treating diabetes in a patient in need of such a
treatment comprising administering to the patient a therapeutically
effective amount of an insulin derivative according to this
invention, in mixture with an insulin or an insulin analogue which
has a rapid onset of action, together with a pharmaceutically
acceptable carrier.
[0071] Examples of preferred human insulin derivatives according to
the present invention in which no Zn.sup.2+ ions are bound are the
following:
[0072] N.sup..epsilon..sup..sup.B29-tridecanoyl des(B30) human
insulin,
[0073] N.sup..epsilon.B29-tetradecanoyl des(B30) human insulin,
[0074] N.sup..epsilon.B29-decanoyl des(B30) human insulin,
[0075] N.sup..epsilon.B29-dodecanoyl des(B30) human insulin,
[0076] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 des(B30) human
insulin,
[0077] N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 des(B30) human
insulin,
[0078] N.sup..epsilon.B29-decanoyl Gly.sup.A21 des(B30) human
insulin,
[0079] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 des(B30) human
insulin,
[0080] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin,
[0081] N.sup..epsilon.B29-tetradecaloyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin,
[0082] N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 des(B30)
human insulin,
[0083] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin,
[0084] N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 des(B30) human
insulin,
[0085] N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 des(B30) human
insulin,
[0086] N.sup..epsilon.B29-decanoyl Ala.sup.A21 des(B30) human
insulin,
[0087] N.sup..epsilon.B29-decanoyl Ala.sup.A21 des(B30) human
insulin,
[0088] N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin,
[0089] N.sup..epsilon.B29Ala.sup.A21 Gln.sup.B3 des(B30) human
insulin,
[0090] N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 des(B30)
human insulin,
[0091] N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin,
[0092] N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 des(B30) huiman
insulin,
[0093] N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 des(B30) human
insulin,
[0094] N.sup..epsilon.B29-decanoyl Gln.sup.B3 des(B30) human
insulin,
[0095] N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 des(B30) human
insulin,
[0096] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 human
insulin,
[0097] N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 human
insulin,
[0098] N.sup..epsilon.B29-decanoyl Gly.sup.A21 human insulin,
[0099] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 human insulin,
[0100] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 human
insulin,
[0101] N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
human insulin,
[0102] N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 human
insulin,
[0103] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3 human
insulin,
[0104] N.sup..epsilon.B29tridecanoyl Ala.sup.A21 human insulin,
[0105] N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 human
insulin,
[0106] N.sup..epsilon.B29-decanoyl Ala.sup.A21 human insulin,
[0107] N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 human insulin,
[0108] N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin,
[0109] N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
human insulin,
[0110] N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 human
insulin,
[0111] N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin,
[0112] N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 human insulin,
[0113] N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 human
insulin,
[0114] N.sup..epsilon.B29-decanoyl Gln.sup.B3 human insulin,
[0115] N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 human insulin,
[0116] N.sup..epsilon.B29-tridecanoyl Glu.sup.B30 human
insulin,
[0117] N.sup..epsilon.B29-tetradecanoyl Glu.sup.B30 human
insulin,
[0118] N.sup..epsilon.B29-decanoyl Glu.sup.B30 human insulin,
[0119] N.sup..epsilon.B29-dodecanoyl Glu.sup.B30 human insulin,
[0120] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Glu.sup.B30 human
insulin,
[0121] N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Glu.sup.B30
human insulin,
[0122] N.sup..epsilon.B29-decanoyl Gly.sup.A21 Glu.sup.B30 human
insulin,
[0123] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Glu.sup.B30 human
insulin,
[0124] N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0125] N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0126] N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0127] N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0128] N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Glu.sup.B30 human
insulin,
[0129] N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Glu.sup.B30
human insulin,
[0130] N.sup..epsilon.B29-decanoyl Ala.sup.A21 Glu.sup.B30 human
insulin,
[0131] N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Glu.sup.B30 human
insulin,
[0132] N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0133] N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0134] N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0135] N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin,
[0136] N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin,
[0137] N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 Glu.sup.B30
human insulin,
[0138] N.sup..epsilon.B29-decanoyl Gln.sup.B3 Glu.sup.B30 human
insulin and
[0139] N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin.
[0140] Examples of preferred human insulin derivatives according to
the present invention in which two Zn.sup.2+ ions are bound per
insulin hexamer are the following:
[0141] (N.sup..epsilon.B29tridecanoyl des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0142] (N.sup..epsilon.B29-tetradecanoyl des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0143] (N.sup..epsilon.B29-decanoyl des(B30) human insulin).sub.6,
2Zn.sup.+,
[0144] (N.sup..epsilon.B29-dodecanoyl des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0145] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0146] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0147] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0148] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0149] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0150] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0151] (N.sup..epsilon.B29 decanoyl Gly.sup.A21 Gln.sup.B3 des(B30)
human insulin).sub.6, 2Zn.sup.2+,
[0152] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0153] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0154] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0155] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0156] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0157] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0158] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0159] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 des(B30)
human insulin).sub.6, 2Zn.sup.2+,
[0160] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 2Zn.sup.2+,
[0161] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 2Zn.sup.21+,
[0162] (N.sup..epsilon.B29 tetradecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0163] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 2Zn.sup.2+,
[0164] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 2Z.sup.2+,
[0165] (N.sup..epsilon.B29-tridecanoyl human insulin).sub.6,
2Zn.sup.2+,
[0166] (N.sup..epsilon.B29-tetradecanoyl human insulin).sub.6,
2Zn.sup.2+,
[0167] (N.sup..epsilon.B29-decanoyl human insulin).sub.6,
2Zn.sup.2+,
[0168] (N.sup..epsilon.B29-dodecanoyl human insulin).sub.6,
2Zn.sup.2+,
[0169] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0170] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0171] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0172] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0173] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gnl.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0174] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
human insulin).sub.6, 2Zn.sup.2+,
[0175] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0176] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0177] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0178] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0179] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 2Zn.sup.2+,
[0180] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0181] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
human insulin).sub.6, 2Zn.sup.2+,
[0182] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0183] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0184] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0185] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0186] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.+,
[0187] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0188] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0189] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B30 human
insulin).sub.6, 2Z1.sup.2+,
[0190] (N.sup..epsilon.B29-decanoyl Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0191] (N.sup..epsilon.B29-dodecanoyl Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.+,
[0192] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Glu.sup.B3 human
insulin).sub.6, 2Zn.sup.2+,
[0193] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Glu.sup.B30
human insulin).sub.6, 2Zn.sup.2+,
[0194] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 2Z.sup.2+,
[0195] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0196] (N.sup..epsilon.B29 tridecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2,
[0197] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0198] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0199] (N.sup..epsilon.B.sup.29-dodecanoyl Gly.sup.A22 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0200] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 2Zn.sup.2+,
[0201] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 2Zn.sup.2+,
[0202] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0203] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0204] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0205] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0206] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0207] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0208] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+,
[0209] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,
[0210] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+ and
[0211] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 2Zn.sup.2+.
[0212] Examples of preferred human insulin derivatives according to
the present invention in which three Zn.sup.2+ ions are bound per
insulin hexamer are the following:
[0213] (N.sup..epsilon.B29-tridecanoyl des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0214] (N.sup..epsilon.B29-tetradecanoyl des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0215] (N.sup..epsilon.B29-decanoyl des(B30) human insulin).sub.6,
3Zn.sup.2+,
[0216] (N.sup..epsilon.B29-dodecanoyl des(B30) hum an
insulin).sub.6, 3Zn 2+,
[0217] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0218] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0219] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0220] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0221] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 3Zn.sup.2+,
[0222] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 3Zn.sup.2+,
[0223] (N.sup..epsilon.B29-decanoyl Gla.sup.A21 Gln.sup.B3 des(B30)
human insulin).sub.6, 3Zn.sup.2+,
[0224] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 3Zn.sup.2+,
[0225] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0226] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0227] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0228] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0229] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 3Zn.sup.2+,
[0230] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 des(B30)
human insulin).sub.6, 3Zn.sup.2+,
[0231] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 3Zn.sup.2+,
[0232] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0233] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0234] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0235] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0236] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 3Zn.sup.2+,
[0237] (N.sup..epsilon.B29-tetradecanoyl human insulin).sub.6,
3Zn.sup.2+,
[0238] (N.sup..epsilon.B29-decanoyl human insulin).sub.6,
3Zn.sup.2+,
[0239] (N.sup..epsilon.B29-decanoyl human insulin).sub.6,
3Zn.sup.+,
[0240] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0241] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 human
insulin).sub.6, 3Zn.sup.2+,
[0242] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 n human
insulin).sub.6, 3Zn.sup.+,
[0243] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 human
insulin).sub.6, 3Zn.sup.2+,
[0244] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0245] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
human insulin).sub.6, 3Zn.sup.2+,
[0246] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0247] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0248] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 3Zn.sup.2+,
[0249] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 human
insulin).sub.6, 3Zn.sup.2+,
[0250] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 human
insulin).sub.6, 3Zn.sup.2+,
[0251] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 human
insuliln).sub.6, 3Zn.sup.2+,
[0252] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0253] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
human insulin).sub.6, 3Zn.sup.2+,
[0254] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0255] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0256] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0257] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0258] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0259] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 human
insulin).sub.6, 3Zn.sup.2+,
[0260] (N.sup..epsilon.B29-tridecanoyl Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.+,
[0261] (N.sup..epsilon.B29-tetradecanoyl Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0262] (N.sup..epsilon.B29-decanoyl Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0263] (N.sup..epsilon.B29-dodecanoyl Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0264] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Glu.sup.B30
human insulin).sub.6, 3Zn.sup.2+,
[0265] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Glu.sup.B30
human insulin).sub.6, 3Zn.sup.2+,
[0266] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2,
[0267] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0268] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0269] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0270] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0271] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0272] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 3Zn.sup.2+,
[0273] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 3Zn.sup.2+,
[0274] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0275] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0276] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0277] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0278] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0279] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,
[0280] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+,
[0281] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 Glu.sup.B30
human insulin).sub.6, 3Zn.sup.2+,
[0282] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+ and
[0283] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 3Zn.sup.2+.
[0284] Examples of preferred human insulin derivatives according to
the present invention in which four Zn.sup.2+ ions are bound per
insulin hexamer are the following:
[0285] (N.sup..epsilon.B29-tridecanoyl des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0286] (N.sup..epsilon.B29-tetradecanoyl des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0287] (N.sup..epsilon.B29-decanoyl des(B30) human insulin).sub.6,
4Zn.sup.2+,
[0288] (N.sup..epsilon.B29-dodecanoyl des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0289] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0290] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0291] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 des(B30) hum an
insulin).sub.6, 4Zn.sup.2+,
[0292] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0293] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0294] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0295] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 des(B30)
human insulin).sub.6, 4Zn.sup.2+,
[0296] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0297] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0298] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0299] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0300] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0301] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0302] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0303] (N.sup..epsilon.B29-decanoyl Ala.sup.21 Gln.sup.B3 des(B30)
human insulin).sub.6, 4Zn.sup.2+,
[0304] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
des(B30) human insulin).sub.6, 4Zn.sup.2+,
[0305] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0306] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0307] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0308] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 des(B30) human
insulin).sub.6, 4Zn.sup.2+,
[0309] (N.sup..epsilon.B29-tridecanoyl human insulin).sub.6,
4Zn.sup.2+,
[0310] (N.sup..epsilon.B29-tetradecanoyl human insulin).sub.6,
4Zn.sup.2+,
[0311] (N.sup..epsilon.B29-dodecanoyl human insulin).sub.6,
4Zn.sup.2+,
[0312] (N.sup..epsilon.B29-dodecanoyl human insulin).sub.6,
4Zn.sup.2+,
[0313] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0314] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0315] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0316] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0317] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0318] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
human insulin).sub.6, 4Zn.sup.2+,
[0319] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0320] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0321] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0322] (N.sup..epsilon.B29-dedecanoyl Ala.sup.A21 human
Insulin).sub.6, 4Zn.sup.2+,
[0323] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0324] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 human
insulin).sub.6, 4Zn.sup.2+,
[0325] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
human insulin).sub.6, 4Zn.sup.2+,
[0326] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0327] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0328] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0329] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0330] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0331] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0332] (N.sup..epsilon.B29-tridecanoyl Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0333] (N.sup..epsilon.B29-tetradecanoyl Glu.sup.B3 human
insulin).sub.6, 4Zn.sup.2+,
[0334] (N.sup..epsilon.B29-decanoyl Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0335] (N.sup..epsilon.B29-dodecanoyl Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0336] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Glu.sup.B30
human insulin).sub.6, 4Zn.sup.2+,
[0337] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Glu.sup.B3
human insulin).sub.6, 4Zn.sup.2+,
[0338] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 4Zn .sup.2+,
[0339] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0340] (N.sup..epsilon.B29-tridecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0341] (N.sup..epsilon.B29-tetradecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0342] (N.sup..epsilon.B29-decanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0343] (N.sup..epsilon.B29-dodecanoyl Gly.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0344] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 4Zn.sup.2+,
[0345] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Glu.sup.B30
human insulin).sub.6, 4Zn.sup.2+,
[0346] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0347] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0348] (N.sup..epsilon.B29-tridecanoyl Ala.sup.A21 Gln.sup.B3
GluB.sup.30 human insulin).sub.6, 4Zn.sup.2+,
[0349] (N.sup..epsilon.B29-tetradecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0350] (N.sup..epsilon.B29-decanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,
[0351] (N.sup..epsilon.B29-dodecanoyl Ala.sup.A21 Gln.sup.B3
Glu.sup.B0 human insulin).sub.6, 4Zn.sup.2+,
[0352] (N.sup..epsilon.B29-tridecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+,
[0353] (N.sup..epsilon.B29-tetradecanoyl Gln.sup.B3 Glu.sup.B30
human insulin).sub.6, 4Zn.sup.2+,
[0354] (N.sup..epsilon.B29-decanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+ and
[0355] (N.sup..epsilon.B29-dodecanoyl Gln.sup.B3 Glu.sup.B30 human
insulin).sub.6, 4Zn.sup.2+.
BRIEF DESCRIPTION OF THE DRAWINGS
[0356] The present invention is further illustrated with reference
to the appended drawings wherein
[0357] FIG. 1 shows the construction of the plasmid pEA5.3.2;
[0358] FIG. 2 shows the construction of the plasmid pEA108; and
[0359] FIG. 3 shows the construction of the plasmid pEA113.
DETAILED DESCRIPTION OF THE INVENTION
[0360] Terminology
[0361] The three letter codes and one letter codes for the amino
acid residues used herein are those stated in J. Biol. Chem. 243,
p. 3558 (1968).
[0362] In the DNA sequences, A is adenine, C is cytosine, G is
guanine, and T is thymine.
[0363] The following acronyms are used:
[0364] DMSO for dimethyl sulphoxide, DMF for dimethylformamide, Boc
for tert-butoxycarbolyl, RP-HPLC for reversed phase high
performance liquid chromatography, X-OSu is an N-hydroxysuccinimid
ester, X is an acyl group, and TFA for trifluoroacetic acid.
[0365] Preparation of Lipophilic Insulin Derivatives
[0366] The insulin derivatives according to the present invention
can be prepared i.a. as described in the following:
[0367] 1. Insulin Derivatives Featuring in Position B30 an Amino
Acid Residue Which can be Coded for by the Genetic Code, e.g.
Threonine (Human Insulin) or Alanine (Porcine Insulin).
[0368] 1.1 Starting from Human Insulin.
[0369] Human insulin is treated with a Boc-reagent (e.g.
di-tert-butyl dicarbonate) to form (A1,B1)-diBoc human insulin,
i.e., human insulin in which the N-terminal end of both chains are
protected by a Boc-group. After an optional purification, e.g. by
HPLC, an acyl group is introduced in the .epsilon.-amino group of
Lys.sup.B29 by allowing the product to react with a
N-hydroxysuccinimide ester of the formula X-OSu wherein X is the
acyl group to be introduced. In the final step, TFA is used to
remove the Boc-groups and the product, N.sup..epsilon.B29-X human
insulin, is isolated.
[0370] 1.2 Starting from a Single Chain Insulin Precursor.
[0371] A single chain insulin precursor, extended in position B1
with an extension (Ext) which is connected to B1 via an arginine
residue and in which the bridge from B30 to A1 is an arginine
residue, i.e. a compound of the general formula
Ext-Arg-B(1-30)-Arg-A(1-21), can be used as starting material.
Acylation of this starting material with a N-hydroxysuccinimide
ester of the general formula X-OSu wherein X is an acyl group,
introduces the acyl group X in the .epsilon.-amino group of
Lys.sup.B29 and in the N-terminal amino group of the precursor. On
treating this acylated precursor of the formula
(N.sup..epsilon.B29-X),X-- Ext-Arg-B(1-30)-Arg-A(1-21) with trypsin
in a mixture of water and a suitable water-miscible organic
solvent, e.g. DMF, DMSO or a lower alcohol, an intermediate of the
formula (N.sup..epsilon.B29-X),Arg.sup.B3- 1 insulin is obtained.
Treating this intermediate with carboxypeptidase B yields the
desired product, (N.sup..epsilon.B29-X) insulin.
[0372] 2. Insulin Derivatives with No Amino Acid Residue in
Position B30, i.e. des(B30) Insulins.
[0373] 2.1 Starting from Human Insulin or Porcine Insulin.
[0374] On treatment with carboxypeptidase A in ammonium buffer,
human insulin and porcine insulin both yield des(B30) insulin.
After an optional purification, the des(B30) insulin is treated
with a Boc-reagent (e.g. di-tert-butyl dicarbonate) to form
(A1,B1)-diBoc des(B30) insulin, i.e., des(B30) insulin in which the
N-terminal end of both chains are protected by a Boc-group. After
an optional purification, e.g. by HPLC, an acyl group is introduced
in the 6-amino group of Lys.sup.B29 by allowing the product to
react with a N-hydroxysuccinimide ester of the formula X-OSu
wherein X is the acyl group to be introduced. In the final step,
TFA is used to remove the Boc-groups and the product,
(N.sup..epsilon.B29-X) des(B30) insulin, is isolated.
[0375] 2.2 Starting from a Single Chain Human Insulin
Precursor.
[0376] A single chain human insulin precursor, which is extended in
position B1 with an extension (Ext) which is connected to B1 via an
arginine residue and which has a bridge from B30 to A1 can be a
useful starting material. Preferably, the bridge is a peptide of
the formula Y.sup.n-Arg, where Y is a codable amino acid except
lysine and arginine, and n is zero or an integer between 1 and 35.
When n>1, the Y's may designate different amino acids. Preferred
examples of the bridge from B30 to A1 are: AlaAlaArg, SerArg,
SerAspAspAlaArg and Arg (European Patent No. 163529). Treatment of
such a precursor of the general formula
Ext-Arg-B(1-30)-Y.sub.n-Arg-A(1-21) with a lysyl endopeptidase,
e.g. Achromobacter lyticus protease, yields Ext-Arg-B(1-29)
Thr-Y.sub.n-Arg-A(1-21) des(B30) insulin. Acylation of this
intermediate with a N-hydroxysuccinimide ester of the general
formula X-OSu wherein X is an acyl group, introduces the acyl group
X in the .epsilon.-amino group of Lys.sup.B29, and in the
N-terminal amino group of the A-chain and the B-chain to give
(N.sup..epsilon.B29-X) X-Ext-Arg-B(1-29) X-Thr-Y.sub.n-Arg-A(1-21)
des(B30) insulin. This intermediate on treatment with trypsin in
mixture of water and a suitable organic solvent, e.g. DMF, DMSO or
a lower alcohol, gives the desired derivative,
(N.sup..epsilon.B29-X) des(B30) human insulin.
[0377] Data on N.sup..epsilon.B29 Modified Insulins.
[0378] Certain experimental data on N.sup..epsilon.B29 modified
insulins are given in Table 1.
[0379] The lipophilicity of an insulin derivative relative to human
insulin, k'.sub.ref, was measured on a LiChrosorb RP18 (5 .mu.m,
250.times.4 mm) HPLC column by isocratic elution at 40.degree. C.
using mixtures of A) 0.1 M sodium phosphate buffer, pH 7.3,
containing 10% acetonitrile, and B) 50% acetonitrile in water as
eluents. The elution was monitored by following the UV absorption
of the eluate at 214 nm. Void time, t.sub.0, was found by injecting
0.1 mM sodium nitrate. Retention time for human insulin,
t.sub.human, was adjusted to at least 2 to by varying the ratio
between the A and B solutions.
k'.sub.ref=(t.sub.derivative-t.sub.0)/(t.sub.human-t.sub.0).
[0380] The degree of prolongation of the blood glucose lowering
effect was studied in rabbits. Each insulin derivative was tested
by subcutaneous injection of 12 nmol thereof in each of six rabbits
in the single day retardation test. Blood sampling for glucose
analysis was performed before injection and at 1, 2, 4 and 6 hours
after injection. The glucose values found are expressed as percent
of initial values. The Index of Protraction, which was calculated
from the blood glucose values, is the scaled Index of Protraction
(prolongation), see p. 211 in Markussen et al., Protein Engineering
1 (1987) 205-213. The formula has been scaled to render a value of
100 with bovine ultralente insulin and a value of 0 with
Actrapid.RTM. insulin (Novo Nordisk A/S, 2880 Bagsvaerd,
Denmark).
[0381] The insulin derivatives listed in Table 1 were administered
in solutions containing 3 Zn.sup.2+ per insulin hexamer, except
those specifically indicated to be Zn-free.
[0382] For the very protracted analogues the rabbit model is
inadequate because the decrease in blood glucose from initial is
too small to estimate the index of protraction. The prolongation of
such analogues is better characterized by the disappearance rate in
pigs. T.sub.50% is the time when 50% of the A14 Tyr(.sup.125I)
analogue has disappeared from the site of injection as measured
with an external .gamma.-counter (Ribel, U et al., The Pig as a
Model for Subcutaneous Absorption in Man. In: M. serrano-Rios and
P. J. Lefebre (Eds): Diabetes 1985; Proceedings of the 12th
Congress of the International Diabetes Federation, Madrid, Spain,
1985 (Excerpta Medica, Amsterdam, (1986) 891-96).
[0383] In Table 2 are given the T.sub.50% values of a series of
very protracted insulin analogues. The analogues were administered
in solutions containing 3 Zn.sup.2+ per insulin hexamer.
1TABLE 1 Relative Blood glucose, % of initial Index of Insulin
Derivative*) Lipophilicity 1 h 2 h 4 h 6 h protraction
N.sup..epsilon..sup..sup.B29-benzoyl insulin 1.14
N.sup..epsilon..sup..sup.B29-phenylacetyl insulin (Zn-free) 1.28
55.4 58.9 88.8 90.1 10 N.sup..epsilon..sup..sup.B29-
-cyclohexylacetyl insulin 1.90 53.1 49.6 66.9 81.1 28
N.sup..epsilon..sup..sup.B29-cyclohexylpropionyl insulin 3.29 55.5
47.6 61.5 73.0 39 N.sup..epsilon..sup..sup.B29-cyclohexylvaleroyl
insulin 9.87 65.0 58.3 65.7 71.0 49 N.sup..epsilon..sup..sup.B29-o-
ctanoyl insulin 3.97 57.1 54.8 69.0 78.9 33
N.sup..epsilon..sup..su- p.B29-decanoyl, des-(B30) insulin 11.0
74.3 65.0 60.9 64.1 65 N.sup..epsilon..sup..sup.B29-decanoyl
insulin 12.3 73.3 59.4 64.9 68.0 60
N.sup..epsilon..sup..sup.B29-undecanoyl, des-(B30) insulin 19.7
88.1 80.0 72.1 72.1 80 N.sup..epsilon..sup..sup.B29-lauroyl,
des-(B30) insulin 37.0 91.4 90.0 84.2 83.9 78
N.sup..epsilon..sup..sup.B29-myristoyl insulin 113 98.5 92.0 83.9
84.5 97 N.sup..epsilon..sup..sup.B29-choloyl insulin 7.64 58.2 53.2
69.0 88.5 20 N.sup..epsilon..sup..sup.B29-7-deoxycholoyl insulin
(Zn-free) 24.4 76.5 65.2 77.4 87.4 35 N.sup..epsilon..sup..sup.B29-
-lithocholoyl insulin (Zn-free) 51.6 98.3 92.3 100.5 93.4 115
N.sup..epsilon..sup..sup.B29-4-benzoyl-phenylalanyl insulin 2.51
53.9 58.7 74.4 89.0 14
N.sup..epsilon..sup..sup.B29-3,5-diiodotyrosyl insulin 1.07 53.9
48.3 60.8 82.1 27 N.sup..epsilon..sup..sup.B29-L- -thyroxyl insulin
8.00 *)3 Zn.sup.2+/insulin hexamer except where otherwise
indicated.
[0384]
2TABLE 2 Subcutaneous Relative disappearance Derivative of Human
Insulin hydrophobicity in pigs 600 .mu.M, 3 Zn.sup.2+/hexamer,
phenol k'.sub.rel T.sub.50%, hours 0.3%, glycerol 1.6%, pH 7.5
N.sup..epsilon.B29-decano- yl des (B30) insulin 11.0 5.6
N.sup..epsilon.B29-undecanoyl des (B30) insulin 19.7 6.9
N.sup..epsilon.B29-lauroyl des (B30) insulin 37 10.1
N.sup..epsilon.B29-tridecanoyl des (B30) insulin 65 12.9
N.sup..epsilon.B29-myristoyl des (B30) insulin 113 13.8
N.sup..epsilon.B29-palmitoyl des (B30) insulin 346 12.4
N.sup..epsilon.B29-2-succinyl-amido myristic acid 10.5 13.6 insulin
N.sup..epsilon.B29-myristoyl insulin 113 11.9
N.sup..epsilon.B29-2-succinyl-amido palmitic acid 420 20.1 insulin
N.sup..epsilon.B29-myristoyl-.alpha.-glutamyl des (B30) 23.7 8.8
insulin N.sup..epsilon.B29-myristoyl-.alpha.-glutamyl-glycyl 20.0
11.9 des(B30) insulin N.sup..epsilon.B29-lithocholoyl--
.alpha.-glutamyl 12.5 14.3 des (B30) insulin Human NPH 10
[0385] Solubility
[0386] The solubility of all the N.sup..epsilon.B29 modified
insulins mentioned in Table 1, which contain 3 Zn.sup.2+ ions per
insulin hexamer, exceeds 600 nmol/ml in a neutral (pH 7.5),
aqueous, pharmaceutical formulation which further comprises 0.3%
phenol as preservative, and 1.6% glycerol to achieve isotonicity.
600 mmol/ml is the concentration of human insulin found in the 100
IU/ml compositions usually employed in the clinic.
[0387] The .epsilon.-B29 amino group can be a component of an amide
bond, a sulphonamide bond, a carbamide, a thiocarbamide, or a
carbamate. The lipophilic substituent carried by the .epsilon.-B29
amino group can also be an alkyl group.
[0388] Pharmaceutical compositions containing a human insulin
derivative according to the present invention may be administered
parenterally to patients in need of such a treatment. Parenteral
administration may be performed by subcutaneous, intramuscular or
intravenous injection by means of a syringe, optionally a pen-like
syringe. Alternatively, parenteral administration can be performed
by means of an infusion pump. A further option is a composition
which may be a powder or a liquid for the administration of the
human insulin derivative in the form of a nasal spray.
[0389] The injectable human insulin compositions of the invention
can be prepared using the conventional techniques of the
pharmaceutical industry which involves dissolving and mixing the
ingredients as appropriate to give the desired end product.
[0390] Thus, according to one procedure, the human insulin
derivative is dissolved in an amount of water which is somewhat
less than the final volume of the composition to be prepared. An
isotonic agent, a preservative and a buffer is added as required
and the pH value of the solution is adjusted--if necessary--using
an acid, e.g. hydrochloric acid, or a base, e.g. aqueous sodium
hydroxide as needed. Finally, the volume of the solution is
adjusted with water to give the desired concentration of the
ingredients.
[0391] Examples of isotonic agents are sodium chloride, mannitol
and glycerol.
[0392] Examples of preservatives are phenol, m-cresol, methyl
p-hydroxybelnzoate and benzyl alcohol.
[0393] Examples of suitable buffers are sodium acetate and sodium
phosphate.
[0394] A composition for nasal administration of an insulin
derivative according to the present invention may, for example, be
prepared as described in European Patent No. 272097 (to Novo
Nordisk A/S).
[0395] The insulin compositions of this invention can be used in
the treatment of diabetes. The optimal dose level for any patient
will depend on a variety of factors including the efficacy of the
specific human insulin derivative employed, the age, body weight,
physical activity, and diet of the patient, on a possible
combination with other drugs, and on the severity of the case of
diabetes. It is recommended that the daily dosage of the human
insulin derivative of this invention be determined for each
individual patient by those skilled in the art in a similar way as
for known insulin compositions.
[0396] Where expedient, the human insulin derivatives of this
invention may be used in mixture with other types of insulin, e.g.
human insulin or porcine insulin or insulin analogues with a more
rapid onset of action. Examples of such insulin analogues are
described e.g. in the European patent applications having the
publication Nos. EP 214826 (Novo Nordisk A/S), EP 375437 (Novo
Nordisk A/S) and EP 383472 (Eli Lilly & Co.).
[0397] The present invention is further illustrated by the
following examples which, however, are not to be construed as
limiting the scope of protection. The features disclosed in the
foregoing description and in the following examples may, both
separately and in any combination thereof, be material for
realizing the invention in diverse forms thereof.
EXAMPLES
[0398] Plasmids and DNA Material
[0399] All expression plasmids are of the cPOT type. Such plasmids
are described in EP patent application No. 171 142 and are
characterized in containing the Schizosaccharomyces pombe triose
phosphate isomerase gene (POT) for the purpose of plasmid selection
and stabilization. A plasmid containing the POT-gene is available
from a deposited E. coli strain (ATCC 39685). The plasmids
furthermore contain the S. cerevisiae triose phosphate isomerase
promoter and terminator (P.sub.TPI and T.sub.TPI). They are
identical to pMT742 (Egel-Mitani, M. et al., Gene 73 (1988)
113-120) (see FIG. 1) except for the region defined by the
ECoRI-XbaI restriction sites encompassing the coding region for
signal/leader/product.
[0400] Synthetic DNA fragments were synthesized on an automatic DNA
synthesizer (Applied Biosystems model 380A) using phosphoramidite
chemistry and commercially available reagents (Beaucage, S. L. and
Caruthers, M. H., Tetrahedron Letters 22 (1981) 1859-1869).
[0401] All other methods and materials used are common state of the
art knowledge (see, e.g. Sambrook, J., Fritsch, E. F. and Maniatis,
T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York, 1989).
[0402] Analytical
[0403] Molecular masses of the insulins prepared were obtained by
MS (mass spectroscopy), either by PDMS (plasma desorption mass
spectrometry) using a Bio-Ion 20 instrument (Bio-Ion Nordic AB,
Uppsala, Sweden) or by ESMS (electrospray mass spectrometry) using
an API III Biomolecular Mass Analyzer (Perkin-Elmer Sciex
Instruments, Thornhill, Canada).
Example 1
[0404] Synthesis of Ala.sup.A21 Asp.sup.B3 Human Insulin Precursor
from Yeast Strain yEA002 Using the LaC212spx3 Signal/Leader.
[0405] The following oligonucleotides were synthesized:
[0406] #98
5'-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACT-
TGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT-3' (Asp.sup.B3)
(SEQ ID NO:3)
[0407] #128
5'-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTA-
CAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3' (Ala.sup.A21) (SEQ ID
NO:4)
[0408] #126 5'-GTCGCCATGGCTAAGAGATTCGTTG-3' (Asp.sup.B3) (SEQ ID
NO:5)
[0409] #16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID NO:6)
[0410] The following Polymerase Chain Reaction (PCR) was performed
using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk,
Conn. 06859, USA) according to the manufacturer's instructions. In
all cases, the PCR mixture was overlayed with 100 .mu.l of mineral
oil (Sigma Chemical Co., St. Louis, Mo., USA).
[0411] 2.5 .mu.l of oligonucleotide #98 (2.5 pmol)
[0412] 2.5 .mu.l of oligonucleotide #128 (2.5 pmol)
[0413] 10 .mu.l of 10.times.PCR buffer
[0414] 16 .mu.l of dNTP mix
[0415] 0.5 .mu.l of Taq enzyme
[0416] 58.5 .mu.l of water
[0417] One cycle was performed: 94.degree. C. for 45 sec.,
49.degree. C. for 1 min 72.degree. C. for 2 min.
[0418] Subsequently, 5 .mu.l of oligonucleotides #16 and #126 was
added and 15 cycles were performed: 94.degree. C. for 45 sec.,
45.degree. C. for 1 min, 72.degree. C. for 1.5 min. The PCR mixture
was loaded onto a 2.5% agarose gel and subjected to electrophoresis
using standard techniques (Sambrook et al., Molecular cloning, Cold
Spring Harbour Laboratory Press, 1989). The resulting DNA fragment
was cut out of the agarose gel and isolated using the Gene Clean
Kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif. 92038, USA)
according to the manufacturer's instructions. The purified PCR DNA
fragment was dissolved in 10 .mu.l of water and restriction
endonuclease buffer and cut with the restriction endonucleases NcoI
and Xba I according to standard techniques, run on a 2.5% agarose
gel and purified using the Gene Clean Kit as described.
[0419] The plasmid pAK188 consists of a DNA sequence of 412 bp
composed of a EcoRI/NcoI fragment encoding the synthetic yeast
signal/leader gene LaC212spx3 (described in Example 3 of WO
89/02463) followed by a synthetic NcoI/XbaI fragment encoding the
insulin precursor M15, which has a SerAspAspAlaLys bridge
connecting the B29 and the A1 amino acid residues (see SEQ ID NOS.
14, 15 and 16), inserted into the EcoRI/XbaI fragment of the vector
(phagemid) pBLUESCRIPT IIsk(+/-) (Stratagene, USA). The plasmid
pAK188 is shown in FIG. 1.
[0420] The plasmid pAK188 was also cut with the restriction
endonucleases NcoI and XbaI and the vector fragment of 3139 bp
isolated. The two DNA fragments were ligated together using T4 DNA
ligase and standard conditions (Sambrook et al., Molecular Cloning,
Cold Spring Harbour Laboratory Press, 1989). The ligation mixture
was transformed into a competent E. coli strain (R-, M+) followed
by selection for ampicillin resistance. Plasmids were isolated from
the resulting E. coli colonies using standard DNA miniprep
technique (Sambrook et al., Molecular Cloning, Cold Spring Harbour
Laboratory Press, 1989), checked with appropriate restrictions
endonucleases i.e. EcoRI, XbaI, NcoI and Hpal. The selected plasmid
was shown by DNA sequencing analyses (Sequenase, U.S. Biochemical
Corp.) to contain the correct sequence for the Ala.sup.A21,
Asp.sup.B3 human insulin precursor and named pEA5.3.
[0421] The plasmid pKFN1627 is an E. coli-S. cerevisiae shuttle
vector, identical to plasmid pKFN.sub.1003 described in EP patent
No. 375718, except for a short DNA sequence upstream from the
unique XbaI site. In pKFN1003, this sequence is a 178 bp fragment
encoding a synthetic aprotinin gene fused in-frame to the yeast
mating factor alpha 1 signal-leader sequence. In pKFN1627, the
corresponding 184 bp sequence encodes the insulin precursor M15
(Glu.sup.B1, Glu.sup.B28) (i.e. B(1-29,
Glu.sup.B1,Glu.sup.B28)-SerAspAspAlaLys-A(1-21) fused in-frame to
the mating factor alpha 1 sequence (see SEQ ID NOS. 17, 18 and 19).
The vector pKFN1627 is shown in FIG. 1.
[0422] pEA5.3 was cut with the restriction endonucleases EcoRI and
XbaI and the resulting DNA fragment of 412 bp was isolated. The
yeast expression vector pKFN1627 was cut with the restriction
endonucleases NcoI and XbaI and with NcoI and EcoRI and the DNA
fragment of 9273 bp was isolated from the first digestion and the
DNA fragment of 1644 bp was isolated from the second. The 412 bp
EcoRI/XbaI fragment was then ligated to the two other fragments,
that is the 9273 bp NcoI I/XbaI fragment and the 1644 bp NcoI/EcoRI
fragment using standard techniques.
[0423] The ligation mixture was transformed into E. coli as
described above. Plasmid from the resulting E. coli was isolated
using standard techniques, and checked with appropriate restriction
endoniucleases i.e. EcoRI, XbaI, NcoI, Hpa 1. The selected plasmid
was shown by DNA sequence analysis (using the Sequenase kit as
described by the manufacturer, U.S. Biochemical) to contain the
correct sequence for the Ala.sup.A21Asp.sup.B3 human insulin
precursor DNA and to be inserted after the DNA encoding the
LaC212spx3 signal/leader DNA. The plasmid was named pEA5.3.2 and is
shown in FIG. 1. The DNA sequence encoding the LaC212spx3
signal/leader/Ala.sup.A21 Asp.sup.B3 human insulin precursor
complex and the amino acid sequence thereof are SEQ ID NOS. 20, 21
and 22. The plasmid pEA5.3.2 was transformed into S. cerevisiae
strain MT663 as described in European patent application having the
publication No. 214826 and the resulting strain was named
yEA002.
Example 2
[0424] Synthesis of Ala.sup.A21 Thr.sup.B3 Human Insulin Precursor
from Yeast Strain yEA005 Using the LaC212spx3 Signal/Leader.
[0425] The following oligonucleotides were synthesized:
3 #101 5'-TGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCACTT (SEQ ID NO:7)
GGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACA
CTCCAAAGTCTGACGACGCT-3' (Thr.sup.B3) #128
5'-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAA (SEQ ID NO:4)
GAACAGATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCG TCAGACTTTGG-3'
(Ala.sup.A2121) #15 5'-GTCGCCATGGCTAAGAGATTCGTTA-3' (Thr.sup.B3)
(SEQ ID NO:8) #16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID
NO:6)
[0426] The DNA encoding Ala.sup.A21 ThrB.sup.3 human insulin
precursor was constructed in the same manner as described for the
DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in
Example 1. The DNA sequence encoding the LaC212spx3
signal/leader/Ala.sup.A21 Thr.sup.B3 human insulin precursor
complex and the amino acid sequence thereof are SEQ ID NOS. 23, 24
and 25. The plasmid pEA8.1.1 was shown to contain the desired
sequence, transformed into S. cerevisiae strain MT663 as described
in Example 1 and the resulting strain was named yEA005.
Example 3
[0427] Synthesis of Gly.sup.A21 Asp.sup.B3 human insulin precursor
from Yeast strain yEA007 using the LaC212spx3 signal/leader.
[0428] The following oligonucleotides were synthesized:
4 #98 5'-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTG (SEQ ID NO:3)
GTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCT
ACACTCGAAAGTCTGACGACGCT-3' (Asp.sup.B3) #127
5'-CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAA (SEQ ID NO:9)
AGAACAGATAGAAGTACAACATTGTTCAACGATACCCT TAGCGTCGTCAGACTTTGG-3'
(Gly.sup.A21) #126 5'-GTCGCCATGGCTAAGAGATTCGTTG-3' (Asp.sup.B3)
(SEQ ID NO:5) #16 5'-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3' (SEQ ID
NO:6)
[0429] The DNA encoding Gly.sup.A21 Asp.sup.B3 human insulin
precursor was constructed in the same manner as described for the
DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in
Example 1. The DNA sequence encoding the LaC212spx3
signal/leader/Gly.sup.A21 Asp.sup.B3 human insulin precursor
complex and the amino acid sequence thereof are SEQ ID NOS. 26, 27
and 28. The plasmid pEAI.5.6 was shown to contain the desired
sequence, transformed into S. cerevisiae strain MT663 as described
in Example 1 and the resulting strain was named yEA007.
Example 4
[0430] Synthesis of Gly.sup.A21 Thr.sup.B3 human insulin precursor
from Yeast strain yEA006 using the LaC212spx3 signal/leader.
[0431] The following oligonucleotides were synthesized:
5 #101 5'-TGGCTAAGAGATTCGTTACTCAACACTTGTGCCGTTCTCACTTGGTTGAAG (SEQ
ID NO:7) CTTTCTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAA- GTCTCACC
ACCCT-3' (Thr.sup.B3) #127
5'-CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAAAGAACAG (SEQ ID NO:9)
ATACAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3' (Gly.sup.A21)
#15 5'-GTCGCCATGGCTAAGAGATTCGTTA-3' (Thr.sup.B3) (SEQ ID NO:8) #16
5'-CTGCTCTAGAGCCTGCGGGCTGc- GTcT-3' (SEQ ID NO:6)
[0432] The DNA encoding Gly.sup.A21 Thr.sup.B3 human insulin
precursor was constructed in the same manner as described for the
DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in
Example 1. The DNA sequence encoding the LaC212spx3
signal/leader/Gly.sup.A21 Thr.sup.B3 human insulin precursor
complex and the amino acid sequence thereof are SEQ ID NOS. 29, 30
and 31. The plasmid pEA4.4. 11 was shown to contain the desired DNA
sequence, transformed into S. cerevisiae strain MT663 as described
in Example 1 and the resulting strain was named yEA006.
Example 5
[0433] Synthesis of Arg.sup.B-1 Arg.sup.B31 Single Chain Human
Insulin Precursor Having an N-Terminal Extension
(GluGluAlaGluAlaGluAlaArg) from Yeast Strain yEA113 Using the Alpha
Factor Leader.
[0434] A) The following oligonucleotides were synthesized:
6 #220 5'-ACGTACGTTCTAGAGCCTGCGGGCTGC-3' (SEQ ID NO: 10) #263
5'-CACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAACAGGTTTC (SEQ ID NO:11)
TTCTACACTCCAAAGACTAGAGGTATCCTTGAA-3' #307
5'-GCTAACGTCGCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGCT (SEQ ID NO:12)
AGATTCGTTAACCAACAC-3'
[0435] The following Polymerase Chain Reaction (PCR) was performed
using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk,
Conn. 06859, USA) according to the manufacturer's instructions. In
all cases, the PCR mixture was overlayed with 100 .mu.l of mineral
oil (Sigma Chemical Co, St. Louis, Mo., USA). The plasmid pAK220
(which is identical to pAK188) consists of a DNA sequence of 412 bp
encoding the synthetic yeast signal/leader LaC212spx3 (described in
Example 3 of WO 89/02463) followed by the insulin precursor MI5
(see SEQ ID NOS. 14, 15 and 16) inserted into the vector (phagemid)
pBLUESCRIPT IIsk(+/-) (Stratagene, USA).
[0436] 5 .mu.l of oligonucleotide #220 (100 pmol)
[0437] 5 .mu.l of oligonucleotide #263 (100 pmol)
[0438] 10 .mu.l of 10.times.PCR buffer
[0439] 16 .mu.l of dNTP mix
[0440] 0.5 .mu.l of Taq enzyme
[0441] 0.5 .mu.l of pAK220 plasmid (identical to pAK188) as
template (0.2 .mu.g of DNA)
[0442] 63 .mu.l of water
[0443] A total of 16 cycles were performed, each cycle comprising 1
minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes
at 72.degree. C. The PCR mixture was then loaded onto a 2% agarose
gel and subjected to electrophoresis using standard techniques. The
resulting DNA fragment was cut out of the agarose gel and isolated
using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla,
Calif. 92038, USA) according to the manufacture's instructions. The
purified PCR DNA fragment was dissolved in 10 .mu.l of water and
restriction endonuclease buffer and cut with the restriction
endonucleases HindIII and XbaI according to standard techniques.
The HindIII/XbaI DNA fragment was purified using The Gene Clean Kit
as described.
[0444] The plasmid pAK406 consists of a DNA sequence of 520 bp
comprising an EcoRI/HindIII fragment derived from pMT636 (described
in WO 90/10075) encoding the yeast alpha factor leader and part of
the insulin precursor ligated to the HindIII/XbaI fragment from
pAK188 encoding the rest of the insulin precursor MI5 (see SEQ ID
NOS. 32, 33 and 34) inserted into the vector cPOT. The vector
pAK406 is shown in FIG. 2.
[0445] The plasmid pAK233 consists of a DNA sequence of 412 bp
encoding the synthetic yeast signal/leader LaC212spx3 (described in
Example 3 of WO 89/02463) followed by the gene for the insulin
precursor B(1-29)-GluLysArg-A(1-21) (A21-Gly) (see SEQ ID NOS. 35,
36 and 37) inserted into the vector cPOT. The plasmid pAK233 is
shown in FIG. 2.
[0446] The plasmid pAK233 was cut with the restriction
endonucleases NcoI and XbaI and the vector fragment of 9273 bp
isolated. The plasmid pAK406 was cut with the restriction
endonucleases NcoI and HindIII and the vector fragment of 2012 bp
isolated. These two DNA fragments were ligated together with the
HindIII/XbaI PCR fragment using T4 DNA ligase and standard
conditions. The ligation mixture was then transformed into a
competent E. coli strain (R-, M+) followed by selection for
ampicillin resistance. Plasmids were isolated from the resulting E.
coli colonies using a standard DNA miniprep technique and checked
with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI,
HindIII. The selected plasmid was shown by DNA sequencing analyses
to contain the correct sequence for the Arg.sup.B31 single chain
human insulin precursor DNA and to be inserted after the DNA
encoding the S. cerevisiae alpha factor DNA. The plasmid was named
pEA108 and is shown in FIG. 2. The DNA sequence encoding the alpha
factor leader/Arg.sup.B31 single chain human insulin precursor
complex and the amino acid sequence thereof are SEQ ID NOS. 38, 39
and 40. The plasmid pEA 108 was transformed into S. cerevisiae
strain MT663 as described in Example 1 and the resulting strain was
named yEA108.
[0447] B) The following Polymerase Chain Reaction (PCR) was
performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761
Main Avewalk, Conn. 06859, USA) according to the manufacturer's
instructions. In all cases, the PCR mixture was overlayed with 100
.mu.l of mineral oil (Sigma Chemical Co., St. Louis, Mo., USA)
[0448] 5 .mu.l of oligonucleotide #220 (100 pmol)
[0449] 5 .mu.l of oligonucleotide #307 (100 pmol)
[0450] 10 .mu.l of 10.times.PCR buffer
[0451] 16 .mu.l of dNTP mix
[0452] 0.5 .mu.l of Taq enzyme
[0453] 0.2 .mu.l of pEA 108 plasmid as template (0.1 ug DNA)
[0454] 63 .mu.l of water
[0455] A total of 16 cycles were performed, each cycle comprising 1
minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes
at 72.degree. C. The PCR mixture was then loaded onto an 2% agarose
gel and subjected to electrophoresis using standard techniques. The
resulting DNA fragment was cut out of the agarose gel and isolated
using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla,
Calif. 92038, USA) according to the manufacture's instructions. The
purified PCR DNA fragment was dissolved in 10 .mu.l of water and
restriction endonuclease buffer and cut with the restriction
endonucleases NcoI and XbaI according to standard techniques. The
NcoI/XbaI DNA fragment was purified using The Gene Clean Kit as
described.
[0456] The plasmid pAK401 consists of a DNA sequence of 523 bp
composed of an EcoRI/NcoI fragment derived from pMT636 (described
in WO 90/10075) (constructed by by introducing a NcoI site in the
3'-end of the alpha leader by site directed mutagenesis) encoding
the alpha factor leader followed by a NcoI/XbaI fragment from
pAK188 encoding the insulin precursor MI5 (see SEQ ID NOS. 41, 42
and 43) inserted into the vector (phagemid) pBLUESCRIPT IIsk(+/-)
(Stratagene, USA). The plasmid pAK401 is shown in FIG. 3.
[0457] The plasmid pAK401 was cut with the restriction
endonucleases NcoI and XbaI and the vector fragment of 3254 bp
isolated and ligated together with the NcoI/XbaI PCR fragment. The
ligation mixture was then transformed into a competent E. coli
strain and plasmids were isolated from the resulting E. coli
colonies using a standard DNA miniprep technique and checked with
appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI. The
selected plasmid, named p113A (shown in FIG. 3), was cut with EcoRI
and XbaI and the fragment of 535 bp isolated.
[0458] The plasmid pAK233 was cut with the restriction
endonucleases NcoI and XbaI, and with EcoRI/NcoI and the fragments
of 9273 and 1644 bp isolated. These two DNA fragments were ligated
together with the EcoRI/XbaI fragment from p113A using T4 DNA
ligase and standard conditions. The ligation mixture was then
transformed into a competent E. coli strain (R-, M+) followed by
selection for ampicillin resistance. Plasmids were isolated from
the resulting E. coli colonies using a standard DNA miniprep
technique and checked with appropriate restriction endonucleases
i.e. EcoRI, XbaI, NcoI, HindIII. The selected plasmid was shown by
DNA sequencing analyses to contain the correct sequence for the
Arg.sup.B31 single chain human insulin precursor DNA with the
N-terminal extension GluGluAlaGluAlaGluAlaArg and to be inserted
after the DNA encoding the S. cerevisiae alpha factor DNA. The
plasmid was named pEA113 and is shown in FIG. 3. The DNA sequence
encoding the alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single
chain human insulin precursor having an N-terminal extension
(GluGluAlaGluAlaGluAlaArg) and the amino acid sequence thereof are
SEQ ID NOS. 44, 45 and 46. The plasmid pEA113 was transformed into
S. cerevisiae strain MT663 as described in Example 1 and the
resulting strain was named yEA113.
Example 6
[0459] Synthesis of Arg.sup.B-1 Arg.sup.B31 single chain human
insulin precursor having an N-terminal extension
(GluGluAlaGluAlaGluAlaGluArg) from Yeast strain yEA136 using the
alpha factor leader.
[0460] The following oligonucleotide was synthesized:
7 (SEQ ID NO:13) #389 5'-GCTAACGTCGCGATGGCTAAGAGAGAAGAAGCTG-
AAGCGAAG CTCAAAGATTCGTTAACCAACAC-3'
[0461] The following PCR was performed using the Gene Amp PCR
reagent kit
[0462] 5 .mu.l of oligonucleotide #220 (100 pmol)
[0463] 5 .mu.l of oligonucleotide #389 (100 pmol)
[0464] 10 .mu.l of 10.times.PCR buffer
[0465] 16 .mu.l of dNTP mix
[0466] 0.5 .mu.l of Taq enzyme
[0467] 2 .mu.l of pEA113 plasmid as template (0.5 ug DNA)
[0468] 63 .mu.l of water
[0469] A total of 12 cycles were performed, each cycle comprising 1
minute at 95.degree. C.; 1 minute at 37.degree. C.; and 2 minutes
at 72.degree. C.
[0470] The DNA encoding alpha factor leader/Arg.sup.B-1 Arg.sup.B31
single chain human insulin precursor having an N-terminal extension
(GluGluAlaGluAlaGluAlaGluArg) was constructed in the same manner as
described for the DNA encoding alpha factor leader/Arg.sup.B-1
Arg.sup.B31 single chain human insulin precursor having an
N-terminal extension (GluGluAlaGluAlaGluAlaArg) in Example 5. The
plasmid was named pEA136. The DNA sequence encoding the alpha
factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin
precursor having an N-terminal extension
(GluGluAlaGluAlaGluAlaGluArg) and the amino acid sequence thereof
are SEQ ID NOS. 47, 48 and 49. The plasmid pEA136 was transformed
into S. cerevisiae strain MT663 as described in Example 1 and the
resulting strain was named yEA136.
Example 7
[0471] Synthesis of (A1,B1)-diBoc Human Insulin.
[0472] 5 g of zinc-free human insulin was dissolved in 41.3 ml of
DMSO. To the solution was added 3.090 ml of acetic acid. The
reaction was conducted at room temperature and initiated by
addition of 565 mg of di-tert-butyl pyrocarbonate dissolved in
5.650 ml of DMSO. The reaction was allowed to proceed for 51/2 hour
and then stopped by addition of 250 .mu.l of ethanolamine. The
product was precipitated by addition of 1500 ml of acetone. The
precipitate was isolated by centrifugation and dried in vacuum. A
yield of 6.85 g material was obtained.
[0473] (A1,B1)-diBoc insulin was purified by reversed phase HPLC as
follows: The crude product was dissolved in 100 ml of 25% ethanol
in water, adjusted to pH 3.0 with HCl and applied to a column (5 cm
diameter, 30 cm high) packed with
octadecyidimethylsilyl-substituted silica particles (mean particle
size 15 .mu.m, pore size 100 .ANG.) and equilibrated with elution
buffer. The elution was performed using mixtures of ethanol and 1
mM aqueous HCl, 0.3 M KCl at a flow of 2 l/h. The insulin was
eluted by increasing the ethanol content from 30% to 45%. The
appropriate fraction was diluted to 20% ethanol and precipitated at
pH 4.8. The precipitated material was isolated by centrifugation
and dried in vacuum. Thus 1.701 g of (A1,B1)-diBoc human insulin
was obtained at a purity of 94.5%.
Example 8
[0474] Synthesis of (N.sup..epsilon.B29-benzo Human Insulin).sub.6,
3Zn.sup.2+.
[0475] 400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml
of DMSO. To the solution was added 748 .mu.l of a mixture of
N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted
at 15.degree. C. and initiated by addition of 14.6 mg of benzoic
acid N-hydroxysuccinimide ester dissolved in 132 .mu.l DMF. The
reaction was stopped after 2 hours by addition of 100 ml of
acetone. The precipitated material was isolated by centrifugation
and dried in vacuum. 343 mg of material was collected.
[0476] The Boc protecting groups were eliminated by addition of 4
ml of TFA. The dissolved material was incubated for 30 minutes and
then precipitated by addition of 50 ml of acetone. The precipitate
was isolated by centrifugation and dried in vacuum.
[0477] N.sup..epsilon.B29-benzoyl human insulin was purified by
reversed phase HPLC as described in Example 7. A yield of 230 mg
was obtained. Recrystallization from 15% aqueous ethanol containing
6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the
title compound which were isolated by centrifugation and dried in
vacuum. The yield was 190 mg.
[0478] Molecular mass, found by MS: 5911, theory: 5911.
Example 9
[0479] Synthesis of (N.sup..epsilon.B29-lithocholoyl Human
Insulin).sub.6, 3Zn.sup.2+.
[0480] 400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml
of DMSO. To the solution was added 748 .mu.l of a mixture of
N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted
at 15.degree. C. and initiated by addition of 31.94 mg of
lithocholic acid N-hydroxysuccinimide ester dissolved in 300 .mu.l
of DMF. The reaction was stopped after 2 hours by addition of 100
ml of acetone. The precipitated material was isolated by
centrifugation and dried in vacuum. 331 mg of material was
obtained.
[0481] The Boc protecting groups were eliminated by addition of 4
ml of TFA. The dissolved material was incubated for 30 minutes and
then precipitated by addition of 50 ml of acetone. The precipitate
was isolated by centrifugation and dried in vacuum. The yield was
376 mg.
[0482] B29-lithocholoyl insulin was purified by reversed phase HPLC
as described in Example 7. A final yield of 67 mg was obtained at a
purity of 94%. Recrystallization from 15% aqueous ethanol
containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals
of the title compound which were isolated by centrifugation and
dried in vacuum. The yield was 49 mg.
[0483] Molecular mass, found by MS: 6160, theory: 6166.
Example 10
[0484] Synthesis of (N.epsilon.B29-decanoyl Human Insulin).sub.6,
3Zn.sup.2+.
[0485] 400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml
of DMSO. To the solution was added 748 .mu.l of a mixture of
N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted
at 15.degree. C. and initiated by addition of 18.0 mg of decanoic
acid N-hydroxysuccinimide ester dissolved in 132 .mu.l of DMF. The
reaction was stopped after 60 minutes and the product precipitated
by addition of 100 ml of acetone. The precipitated material was
isolated by centrifugation and dried in vacuum. 420 mg of
intermediate product was collected.
[0486] The Boc protecting groups were eliminated by addition of 4
ml of TFA. The dissolved material was incubated for 30 minutes and
the product was then precipitated by addition of 50 ml of acetone.
The precipitate was isolated by centrifugation and dried in vacuum.
The yield of crude product was 420 mg.
[0487] The crude product was purified by reversed phase HPLC as
described in Example 7. A final yield of 254 mg of the title
product was obtained. The purity was 96.1%. Recrystallization from
15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at
pH 5.5 gave crystals of the title compound which were isolated by
centrifugation and dried in vacuum. The yield was 217 mg.
[0488] Molecular mass, found by MS: 5962, theory: 5962.
Example 11
[0489] Synthesis of des(B30) Human Insulin.
[0490] Synthesis of des(B30) human insulin was carried out as
described by Markussen (Methods in diabetes research, Vol. 1,
Laboratory methods, part B, 404-410. Ed: J. Larelr and S. Phol,
John Wiley & Sons, 1984). 5 g of human insulin was dissolved in
500 ml of water while the pH value of the solution was kept at 2.6
by addition of 0.5 M sulphuric acid. Subsequently, the insulin was
salted out by addition of 100 g of ammonium sulphate and the
precipitate was isolated by centrifugation. The pellet was
dissolved in 800 ml of 0.1 M ammonium hydrogen carbonate and the pH
value of the solution was adjusted to 8.4 with 1 M ammonia.
[0491] 50 mg of bovine carboxypeptidase A was suspended in 25 ml of
water and isolated by centrifugation. The crystals were suspended
in 25 ml of water and 1 M ammonia was added until a clear solution
was obtained at a final pH of 10. The carboxypeptidase solution was
added to the insulin solution and the reaction was allowed to
proceed for 24 hours. A few drops of toluene were added to act as
preservative during the reaction.
[0492] After 24 hours the des(B30) human insulin was crystallized
by successive addition of 80 g of sodium chloride while the
solution was stirred. The pH value was then adjusted to 8.3 and the
crystallization was allowed to proceed for 20 hours with gentle
stirring. The crystals were isolated on a 1.2 .mu.m filter, washed
with 250 ml of ice cold 2-propanol and finally dried in vacuum.
Example 12
[0493] Synthesis of (A1,B1)-diBoc des(B30) Human Insulin.
[0494] The title compound was synthesized by a method similar to
that described in Example 7, using des(B30) porcine insulin as the
starting material. The crude product was precipitated by acetone
and dried in vacuum. The (A1,B1)-diBoc des(B30) human insulin was
purified by reversed phase HPLC as described in Example 7.
Example 13
[0495] Synthesis of N.sup..epsilon.B29-decanoyl des(B30) Human
Insulin.
[0496] 400 mg of (A1,B1)-diBoc des(B30) human insulin was used as
starting material for the synthesis of N.sup..epsilon.B29-decanoyl
des(B30) human insulin, following the procedure described in
Example 10. The crude product was precipitated by acetone, dried in
vacuum and deprotected using TFA. The resulting product was
precipitated by acetone and dried in vacuum.
N.sup..epsilon.B29-decanoyl des(B30) human insulin was then
purified by reversed phase HPLC as described in Example 10.
[0497] Molecular mass, found by MS: 5856, theory: 5861.
Example 14
[0498] Synthesis of N.sup..epsilon.B29-dodecanoyl des(B30) Human
Insulin.
[0499] a. Immobilization of A lyticus Protease
[0500] 13 mg of A lyticus protease, dissolved in 5 ml of aqueous
0.2 M NaHCO.sub.3 buffer, pH 9.4, was mixed with 4 ml of settled
MiniLeak.RTM. Medium gel, which had been washed with the same
buffer (MiniLeak is a divinylsulfone activated Sepharose CL 6B,
obtained from KemEnTec, Copenhagen). The gel was kept in suspension
by gentle stirring for 24 hours at room temperature. Then, the gel
was isolated by filtration, washed with water, and suspended in 20
ml of 1 M ethanolamine buffer, pH 9.4, and kept in suspension for
24 hours at room temperature. Finally, the gel was washed with
water followed by 0.1 M acetic acid and stored at 4.degree. C. The
enzyme activity in the filtrate was 13% of that in the initial
solution, indicating a yield in the immobilization reaction of
about 87%.
[0501] b. Immobilization of Porcine Trypsin
[0502] Porcine trypsin was immobilized to MiniLeak.RTM. Low to a
degree of substitution of 1 mg per ml of gel, using the conditions
described above for immobilization of A. lyticus.
[0503] c. Synthesis of Glu(GluAla).sub.3Arg-B(1-29), ThrArg-A(1-21)
Insulin Using Immobilized A. lyticus Protease
[0504] To 200 mg of Glu(GluAla).sub.3Arg-B(1-29)-ThrArg-A(1-21)
single-chain human insulin precursor, dissolved in 20 ml of 0.1 M
NaHCO.sub.3 buffer, pH 9.0, was added 4 ml of the gel carrying the
immobilized A. lyticus protease. After the gel had been kept in
suspension in the reaction mixture for 6 hours at room temperature
the hydrolysis was complete, rendering
Glu(GluAla).sub.3-Arg-B(1-29), ThrArg-A(1-21) human insulin (the
reaction was followed by reversed phase HPLC). After the
hydrolysis, the gel was removed by filtration. To the filtrate was
added 5 ml of ethanol and 15 .mu.L of 1 M ZnCl.sub.2 and the pH was
adjusted to 5.0 using HCl. The precipitation of the product was
completed on standing overnight at 4.degree. C. with gentle
stirring. The product was isolated by centrifugation. After one
washing with 1 ml of ice cold 20% ethanol and drying in vacuo the
yield was 190 mg.
[0505] d. Synthesis of
N.sup..alpha.A1,N.sup..alpha.B1,N.sup..epsilon.B29-- tridodecanoyl
Glu(GluAla).sub.3Arg-B(1-29), Thr-Arg-A(1-21) Human Insulin Using
Dodecanoic Acid N-hydroxysuccinimide Ester
[0506] 190 mg (30 .mu.mol) of Glu(GluAla).sub.3Arg-B(1-29),
ThrArg-A(1-21) insulin was dissolved in 1 ml of DMSO and 1.05 ml of
a 0.572 M solution of N,N-diisopropylethylamine in DMF. The
solution was cooled to 15.degree. C. and 36 mg (120 .mu.mol) of
dodecanoic acid N-hydroxysuccinimide ester dissolved in 0.6 ml of
DMSO was added. The reaction was completed within 24 hours. The
lipophilic title compound was not isolated.
[0507] e. Synthesis of N.sup..epsilon.B29-dodecanoyl des(B30)
Insulin
[0508] The product from the previous step, d., contained in
approximately 2.65 ml of DMSO/DMF/N,N-diisopropylethylamine was
diluted with 10.6 ml of a 50 mM glycine buffer comprising 20%
ethanol and the pH adjusted to 10 with NaOH. After standing for 1
hour at room temperature 1 ml of MiniLeak gel, carrying 1 mg of
immobilized trypsin per ml of gel, was added. The reaction mixture
was stirred gently for 48 hours at room temperature. In order to
isolate the desired product, the reaction mixture was applied to a
reversed phase HPLC column (5 cm in diameter, 30 cm high), packed
with octadecyldimethylsilyl-substituted silica particles (mean
particle size 15 .mu.m, pore size 100 .ANG.). For the elution was
used 20 mM Tris/HCl buffers, adjusted to pH 7.7 and comprisilg an
increasing concentration of ethanol, from 40% to 44% (v/v), at a
rate of 2000 ml/h. The major peak eluting at about 43-44% of
ethanol contained the title compound. The fractions containing the
major peak were pooled, water was added to reduce the ethanol
concentration to 20% (v/v), and the pH was adjusted to 5.5. The
solution was left overnight at -20.degree. C., whereby the product
precipitated. The precipitate was isolated by centrifugation at
-8.degree. C. and dried in vacuo. The yield of the title compound
was 90 mg.
[0509] Molecular mass, found by MS: 5892, theory: 5890.
Example 15
[0510] Synthesis of
N.sup..epsilon.B29-(N-myristoyl-.alpha.-glutamyl) Human
Insulin.
[0511] 500 mg of (A1,B1)-diBoc human insulin was dissolved in 2.5
ml of DMSO and 428 .mu.l of ethyl diisopropylamine, diluted with
2.5 ml of DMSO/DMF 1/1 (v/v), was added. The temperature was
adjusted to 15.degree. C. and 85 mg of N-myristoyl-Glu(OBut)
N-hydroxysuccinimide ester, dissolved in 2.5 ml of DMSO/DMF 1/1
(v/v), was added. After 30 mill the reaction mixture was poured
into 60 ml of water, the pH adjusted to 5 and the precipitate
isolated by centrifugation. The precipitate was dried in vacuo. The
dried reaction mixture was dissolved in 25 ml of TFA, and the
solution was left for 30 min at room temperature. The TFA was
removed by evaporation in vacuo. The gelatinous residue was
dissolved in 60 ml of water and the pH was adjusted to 11.2 using
concentrated ammonia. The title compound was crystallized from this
solution by adjustment of the pH to 8.5 using 6 N HCl. The product
was isolated by centrifugation, washed once by 10 ml of water, and
dried in vacuo. Yield 356 mg. Purity by HPLC 94%.
[0512] The product of this example is thus human insulin wherein
the .epsilon.-amino group of LyS.sup.B29 has a substituent of the
following structure:
CH.sub.3(CH.sub.2).sub.12CONHCH(CH.sub.2CH.sub.2COOH)CO--.
[0513] Molecular mass, found by MS: 6146, theory: 6148.
Example 16
[0514] Synthesis of N.sup..epsilon.B29-undecanoyl des(B30) Human
Insulin.
[0515] The title compound was synthesized analogously to
N.sup..epsilon.B29-dodecanoyl des(B30) human insulin as described
in Example 14, by using undecanoic acid N-hydroxysuccinimide ester
instead of dodecanoic acid N-hydroxysuccinimide ester.
[0516] Molecular mass of the product found by MS: 5876, theory:
5876.
Example 17
[0517] Synthesis of N.sup..epsilon.B29-tridecanoyl des(B30) Human
Insulin.
[0518] The title compound was synthesized analogously to
N.sup..epsilon.B29-dodecanoyl des(B30) human insulin as described
in Example 14, by using tridecanoic acid N-hydroxysuccinimide ester
instead of dodecanoic acid N-hydroxysuccinimide ester.
[0519] Molecular mass of the product found by MS: 5899, theory:
5904.
Example 18
[0520] Synthesis of N.sup..epsilon.B29-myristoyl des(B30) Human
Insulin.
[0521] The title compound was synthesized analogously to
N.sup..epsilon.B29-dodecanoyl des(B30) human insulin as described
in Example 14, by using myristic acid N-hydroxysuccinillide ester
instead of dodecanoic acid N-hydroxysuccinimide ester.
[0522] Molecular mass of the product found by MS: 5923, theory:
5918.
Example 19
[0523] Synthesis of N.sup..epsilon.B29-palmitoyl des(B30) Human
Insulin.
[0524] The title compound was synthesized analogously to
N.sup..epsilon.B29-dodecanoyl des(B30) human insulin as described
in Example 14, by using palmitic acid N-hydroxysuccinimlide ester
instead of dodecanoic acid N-hydroxysuccinimide ester.
[0525] Molecular mass of the product found by MS: 5944, theory:
5946.
Example 20
[0526] Synthesis of N.sup..epsilon.B29-suberoyl-D-thyroxine Human
Insulin.
[0527] a. Preparation of N-(succinimidylsuberoyl)-D-thyroxine.
[0528] Disuccinimidyl suberate (1.0 g, Pierce) was dissolved in DMF
(50 ml), and D-thyroxine (2.0 g, Aldrich) was added with stirring
at 20.degree. C. The thyroxine slowly dissolved, and after 20 hours
the solvent was removed by evaporation in vacuo. The oily residue
was crystallized from 2-propanol to yield 0.6 g of
N-(succinimidylsubeloyl)-D- -thyroxine, m.p. 128-133.degree. C.
[0529] b. Reaction of (A1,B1)-diBoc Human Insulin with
N-(succinimidylsuberoyl)-D-thyroxinie.
[0530] (A1,B1)-diBoc human insulin (200 mg) was dissolved in dry
DMF (10 ml) by addition of triethylamine (20 .mu.l) at room
temperature. Then, N-(succinimidylsuberoyl)-D-thyroxine (80 mg) was
added. The reaction was monitored by reversed phase HPLC and when
the reaction was about 90% complete, the solvent was removed in
vacuo. To the evaporation residue, anhydrous trifluoroacetic acid
(5 ml) was added, and the solution was kept for 1 hour at room
temperature. After removal of the trifluoroacetic acid in vacuo,
the residue was dissolved in a mixture of 1M acetic acid (5 ml) and
acetonitrile (1.5 ml), is purified by preparative reversed phase
HPLC and desalted on a PD-10 column. The yield of
N.sup..epsilon.B29-suberoyl-D-thyroxine human insulin was 50
mg.
[0531] The product of this example is thus human insulin wherein
the .epsilon.-amino group of Lys.sup.B29 has a substituent of the
following structure: Thyrox-CO(CH.sub.2).sub.6CO--, wherein Thyrox
is thyroxine which is bound to the octanedioic acid moiety via an
amide bond to its .alpha.-amino group.
[0532] Molecular mass of the product found by MS: 6724, theory:
6723.
Example 21
[0533] Synthesis of N.sup..epsilon.B29-(2-succinylamido)myristic
Acid Human Insulin.
[0534] a. Preparation of .alpha.-aminomyristic Acid Methyl Ester,
HCl.
[0535] To methanol (5 ml, Merck) at -10.degree. C., thionyl
chloride (0.2 ml, Aldrich) was added dropwise while stirring
vigorously. Then, .alpha.-aminomyristic acid (0.7 g, prepared from
the .alpha.-bromo acid by reaction with ammonia) was added. The
reaction mixture was stirred at room temperature overnight, and
then evaporated to dryness. The crude product (0.7 g) was used
directly in step b.
[0536] b. Preparation of N-succinoyl-.alpha.-aminomyristic Acid
Methyl Ester.
[0537] .alpha.-Aminomyristic acid methyl ester, HCl (0.7 g) was
dissolved in chloroform (25 ml, Merck). Triethylamine (0.35 ml,
Fluka) was added, followed by succinic anhydride (0.3 g, Fluka).
The reaction mixture was stirred at room temperature for 2 hours,
concentrated to dryness, and the residue recrystallized from ethyl
acetate/petroleum ether (1/1). Yield: 0.8
[0538] c. Preparation of
N-(succinimidylsuccinoyl)-.alpha.-aminomyristic Acid Methyl
Ester.
[0539] N-succinoyl-.alpha.-amiiinomyristic acid methyl ester (0.8
g) was dissolved in dry DMF (10 ml, Merck, dried over 4 .ANG.
molecular sieve). Dry pyridine (80 .mu.l Merck), and
di(N-succinimidyl)carbonate (1.8 g, Fluka) were added, and the
reaction mixture was stirred overnight at room temperature. The
evaporation residue was purified by flash chromatography on silica
gel 60 (Merck), and recrystallized from 2-propanol/petroleum ether
(1/1). Yield of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic
acid methyl ester: 0.13 g, m.p. 64-66.degree. C.
[0540] d. Reaction of (A1,B1)-diBoc Human Insulin with
N-(succinimidylsuccinoyl)-.alpha.-aminomyristic Acid Methyl
Ester.
[0541] The reaction was carried out as in Example 20 b., but using
N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester
(16 mg) instead of N-(succinimidylsuberoyl)-D-thyroxine. After
removal of the trifluoroacetic acid in vacuo, the evaporation
residue was treated with 0.1M sodium hydroxide at 0 C. to saponify
the methyl ester. When the saponification was judged to be complete
by reversed phase HPLC, the pH value in the solution was adjusted
to 3, and the solution was lyophilized. After purification by
preparative reversed phase HPLC and desalting on a PD-10 column,
the yield of N.sup..epsilon.B29-(2-succinyla- mido)myristic acid
human insulin was 39 mg.
[0542] The product of this example is thus human insulin wherein
the .epsilon.-amino group of Lys.sup.B29 has a substituent of the
following structure:
CH.sub.3(CH.sub.2).sub.11CH(COOH)NHCOCH.sub.2CH.sub.2CO--.
[0543] Molecular mass of the product found by MS: 6130, theory:
6133.
Example 22
[0544] Synthesis of N.sup..epsilon.B29-octyloxycarbonyl Human
Insulin.
[0545] The synthesis was carried out as in Example 20 b., but using
n-octyloxycarbonyl N-hydroxysuccinimide (9 mg, prepared from
n-octyl chloroformate (Aldrich) and N-hydroxysuccinimide), instead
of N-(succinimidylsuberoyl)-D-thyroxine. The yield of
N.sup..epsilon.B329-octyloxycarbonyl human insulin was 86 mg.
[0546] The product of this example is thus human insulin wherein
the .epsilon.-amino group of Lys.sup.B29 has a substituent of the
following structure: CH.sub.3(CH.sub.2).sub.7OCO--.
[0547] Molecular mass of the product found by MS: 5960, theory:
5964.
Example 23
[0548] Synthesis of N.sup..epsilon.B29-(2-succinylainido)palmitic
Acid Human Insulin.
[0549] a. Preparation of N-(succinimidylsuccinoyl)-.alpha.-amino
Palmitic Acid Methyl Ester.
[0550] This compound was prepared as described in Example 21 a.-c.,
using .alpha.-amino palmitic acid instead of .alpha.-amino myristic
acid.
[0551] b. Reaction of (A1,B1)-diBoc Human Insulin with
N-(succinimidylsuccinoyl)-.alpha.-aminopalmitictic Acid Methyl
Ester.
[0552] The reaction was carried out as in Example 21 d., but using
N-(succinimidylsuccinoyl)-.alpha.-aminopaliiiitic acid methyl ester
instead of N-(succinimidylsuccinoyl)-.alpha.-aminopalmitic acid
methyl ester to give N.sup..epsilon.B29-(2-succinylamido)palmitic
acid human insulin.
[0553] The product of this example is thus human insulin wherein
the .epsilon.-amino group of Lys.sup.B29 has a substituent of the
following structure:
CH.sub.3(CH.sub.2).sub.13CH(COOH)NHCOCH.sub.2CH.sub.2CO--.
Example 24
[0554] Synthesis of
N.sup..epsilon.B29-(2-succinylamidoethyloxy)palmitic Acid Human
Insulin.
[0555] a. Preparation of N-(succinimidylsuccinoyl)-2-aminoethyloxy
Palmitic Acid Methyl Ester.
[0556] This compound was prepared as described in Example 21 a.-c.
but using 2-aminoethyloxy palmitic acid (synthesized by the general
procedure described by R. TenBrink, J. Org. Chem. 52 (1987) 418-422
instead of .alpha.-amino myristic acid.
[0557] b. Reaction of (A1,B1)-diBoc Human Insulin with
N-(succinimidylsuccinoyl)-2-aminoethyloxypalmitictic Acid Methyl
Ester.
[0558] The reaction was carried out as in Example 21 d., but using
N-(succinimidylsuccinoyl)-2-aminoethyloxypalmitic acid methyl ester
instead of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid
methyl ester to give
N.sup..epsilon.B.sup.29-(2-succinylamidoethyloxy)palmitic acid
human insulin.
[0559] The product of this example is thus human insulin wherein
the .epsilon.-amino group of Lys.sup.B29 has a substituent of the
following structure:
CH.sub.3(CH.sub.2).sub.13CH(COOH)NHCH.sub.2CH.sub.2OCOCH.sub.2-
CH.sub.2CO--.
Example 25
[0560] Synthesis of
N.sup..epsilon.B29-lithocholoyl-.alpha.-glutamyl des(B30) Human
Insulin.
[0561] The synthesis was carried out as in Example 13 using
N-lithocholoyl-L-glutalmlic acid .alpha.-N-hydroxysuccinimide
ester, .gamma.-tert-butyl ester instead of decanoic acid
N-hydroxysuccinimide ester.
[0562] The product of this example is thus des(B30) human insulin
wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent
of the following structure:
lithocholoyl-NHCH(CH.sub.2CH.sub.2COOH)CO--.
[0563] Molecular mass of the product found by MS: 6194, theory:
6193.
Example 26
[0564] Synthesis of
N.sup..epsilon.B29-3,3',5,5'-tetraiodothyroacetyl Human
Insulin.
[0565] The synthesis was carried out as in Example 10 using
3,3',5,5'-tetraiodothyroacetic acid N-hydroxysuccinimide ester,
instead of decanoic acid N-hydroxysuccinimide ester.
[0566] Molecular mass of the product found by MS: 6536, theory:
6538.
Example 27
[0567] Synthesis of N.sup..epsilon.B29-L-thyroxyl Human
Insulin.
[0568] The synthesis was carried out as in Example 10 using
Boc-L-thyroxine N-hydroxysuccinimide ester, instead of decanoic
acid N-hydroxysuccinimide ester.
[0569] Molecular mass of the product found by MS: 6572, theory:
6567.
Example 28
[0570] A pharmaceutical composition comprising 600 nmol/ml of
N.sup..epsilon.B29-decanoyl des(B30) Human Insulin, 1/3Zn.sup.2+ in
Solution.
[0571] N.sup..epsilon.B29-decanoyl des(B30) human insulin (1.2
.mu.mol) was dissolved in water (0.8 ml) and the pH value was
adjusted to 7.5 by addition of 0.2 M sodium hydroxide. 0.01 M zinc
acetate (60 .mu.l) and a solution containing 0.75% of phenol and 4%
of glycerol (0.8 ml) was added. The pH value of the solution was
adjusted to 7.5 using 0.2 M sodium hydroxide and the volume of the
solution was adjusted to 2 ml with water.
[0572] The resulting solution was sterilized by filtration and
transferred aseptically to a cartridge or a vial.
Example 29
[0573] A Pharmaceutical Composition Comprising 600 nmol/ml of
N.sup..epsilon.B29-decanoyl Human Insulin, 1/2Zn.sup.2+ in
Solution.
[0574] 1.2 .mu.mol of the title compound was dissolved in water
(0.8 ml) and the pH value was adjusted to 7.5 by addition of 0.2 M
sodium hydroxide. A solution containing 0.75% of phenol and 1.75%
of sodium chloride (0.8 ml) was added. The pH value of the solution
was adjusted to 7.5 using 0.2 M sodium hydroxide and the volume of
the solution was adjusted to 2 ml with water.
[0575] The resulting solution was sterilized by filtration and
transferred aseptically to a cartridge or a vial.
Example 30
[0576] A Pharmaceutical Composition Comprising 600 nmol/ml of
N.sup..epsilon.B29-lithocholoyl Human Insulin in Solution.
[0577] 1.2 .mu.mol of the title compound was suspended in water
(0.8 ml) and dissolved by adjusting the pH value of the solution to
8.5 using 0.2 M sodium hydroxide. To the solution was then added
0.8 ml of a stock solution containing 0.75% cresol and 4% glycerol
in water. Finally, the pH value was again adjusted to 8.5 and the
volume of the solution was adjusted to 2 ml with water.
[0578] The resulting solution was sterilized by filtration and
transferred aseptically to a cartridge or a vial.
Example 31
[0579] A Pharmaceutical Composition Comprising a Solution of 600
nmol/ml of N.sup..epsilon.B29-hexadecan Human Insulin, 1/3 Zinc Ion
Per Insulin Monomer, 16 mM m-cresol. 16 mM phenol, 1.6% Glycerol.
10 mM Sodium Chloride and 7 mM Sodium Phosphate.
[0580] 1.2 .mu.mol of N.sup..epsilon.B29-hexadecanoyl human insulin
was dissolved in water (0.5 ml) by addition of 0.2 M sodium
hydroxide to pH 8.0 and 40 .mu.l of 0.01 M zinc acetate was added.
To the solution was further added 100 .mu.l of 0.32 M phenol, 200
.mu.l of 0.16 M m-cresol, 800 .mu.l of 4% glycerol, 33.3 .mu.l of
0.6 M sodium chloride, and 140 .mu.l of 0.1 M sodium phosphate (pH
7.5). The pH value of the solution was adjusted to 7.5 with 0.1 M
hydrochloric acid and the volume adjusted to 2 ml with water.
Example 32
[0581] Solubility of Various Compositions Comprising
N.sup..epsilon.B29-tetradecanoyl des(B30) Human Insulin and
N.sup..epsilon.B29-hexadecanoyl Human Insulin.
[0582] The solubility of N.sup..epsilon.B29-tetradecanoyl des(B30)
human insulin and N.sup..epsilon.B29-hexadecanoyl human insulin in
different compositions was tested. The compositions were prepared
as described in Example 31 with the necessary adjustment of the
amount of the components. Zinc acetate was either left out or an
amount corresponding to 1/3 Zn.sup.2+ per insulin monomer was used.
Sodium chloride was used in amounts which resulted in a final
concentration of 5, 25, 50, 75, 100 or 150 mM of sodium chloride.
Zinc-free insulin was added to give a final amount in the
composition of 1000 nmol/ml. In some cases a precipitate formed.
The resulting solutions and suspensions were kept at 4.degree. C.
for a week and the concentration of insulin in solution in each
composition was then measured by high performance size exclusion
chromatography relative to a standard of human insulin (column:
Waters ProteinPak 250.times.8 mm; eluent: 2.5 M acetic acid, 4 mM
arginine, 20% acetonitrile; flow rate: 1 ml/min; injection volume:
40 .mu.l; detection: UV absorbance at 276 nm). The results, in
nmol/ml, are given in the table below:
8 Solubility of insulins (nmol/ ml) in 16 mM phenol, 16 mM
m-cresol, 1.6% glycerol, 7 mM sodium phosphate, and pH 7.5, varying
zinc acetate Sodium chloride and sodium chloride (mM) 5 25 50 75
100 150 concentrations at 4.degree. C. mM mM mM mM mM mM
N.sup..epsilon..sup..sup.B2- 9-tetradecanoyl des (B30) 82 115 54 77
74 84 human insulin, zinc-free.
N.sup..epsilon..sup..sup.B29-tetradecanoyl des (B30) >950
>950 >950 >950 >950 485 human insulin, 1/3 Zn.sup.2+
per insulin monomer. N.sup..epsilon..sup..sup.B29- -hexadecanoyl
human >890 >950 283 106 45 29 insulin, zinc-free.
N.sup..epsilon..sup..sup.B29-hexadecanoyl human >950 >950
>950 >950 920 620 insulin, 1/3 Zn.sup.2+ per insulin
monomer.
[0583] In conclusion it appears that the solubility of the acylated
insulins is increased by the addition of zinc. This is contrary to
published data on human, porcine and bovine insulin (J Brange:
Galenics of Insulin, page 19, Springer Verlag (1987); J Markussen
et al. Protein Engineering 1 (1987) 205-213).
Example 33
[0584] Preparative Vrystallization of Zinc-Free
N.sup..epsilon.B29-tetrade- canoyl des(B30) Human Insulin.
[0585] 10 g of N.sup..epsilon.B29-tetradecanoyl des(B30) human
insulin was dissolved in 120 ml of 0.02 M NH.sub.4Cl buffer
adjusted to pH 9.0 with NH.sub.3 in ethanol/water (1:4, v/v).
Gentle stirring was maintained throughout the crystallization.
Crystallization was initiated at 23.degree. C. by addition of 20 ml
of 2.5 M NaCl dissolved in ethanol/water (1:4, v/v). A slight
turbidity appeared in the solution. Further, 20 ml of 2.5 M sodium
chloride dissolved in ethanol/water (1:4, v/v) was added at a
constant rate of 5 ml/h, which caused the crystallization to
proceed slowly. In order to decrease the solubility of the insulin,
the pH value was then adjusted to 7.5 using 1 N hydrochloric acid.
Finally, the temperature was lowered to 4.degree. C. and the
stirring continued overnight. The crystals were collected by
filtration, washed twice with 25 ml of 0.2 M NaCl in ethanol/water
(1:4, v/v), sucked dry and lyophilized.
[0586] The weight of the wet filter cake was 19.33 g.
[0587] The weight of lyophilized filter cake was 9.71 g.
Example 34
[0588] Synthesis of Lys.sup.B29
(N.sup..epsilon.-[N.sup..alpha.-tetradecan- oyl-Glu-Gly-]) des(B30)
Human Insulin.
[0589] 500 mg of (A1,B1)-diBoc human insulin was dissolved in a
mixture of 186 .mu.l of 4-methylmorpholine and 3814 .mu.l of DMSO.
The reaction was initiated by addition of 144 mg of
tetradecanoyl-Glu(.gamma.-OtBu)-Gly-OS- u dissolved in 1000 .mu.l
of DMF. The reaction conducted at 15.degree. C. and it was stopped
after 4.5 hours by addition of 100 ml of acetone. The reaction
product precipitated by addition of a few drops of concentrated HCl
was subsequently isolated by centrifugation. The precipitate was
then suspended in 100 ml of acetone, isolated by centrifugation and
dried in vacuum. 637 mg of material was obtained.
[0590] The Boc protecting groups were eliminated by addition of 5
ml of TFA. The dissolved material was incubated for 30 minutes and
then precipitated by addition of 100 ml of acetone and a few drops
of concentrated HCl. The precipitate was then suspended in 100 ml
acetone and isolated by centrifugation. The precipitated material
was dissolved in 200 ml of 25% ethanol at pH 8 by addition of
NH.sub.4OH and purified by reversed phase HPLC. The dissolved
material was applied to a column (5 cm diameter, 30 cm high) packed
with octadecyldimethylsilyl-substituted silica particles (mean
particle size 15 .mu.m, pore size 100 .ANG.) and equilibrated with
0.02 M Bis-Tris, 30% ethanol adjusted to pH 7.3 with hydrochloric
acid at a temperature of 40.degree. C. The elution was performed
using mixtures of 70% ethanol in water and Bis-Tris buffer. The
flow was 2 l/h. The insulin was eluted by increasing the ethanol
content from 30% to 50% and the effluent was monitored by its UV
absorbance at 280 nm. The appropriate fraction was diluted to 20%
ethanol adjusted to pH 4.5 and frozen at -20.degree. C. The
precipitated material was isolated after equilibration of the
sample at 1.degree. C. and subsequent centrifugation at the same
temperature. The precipitate was dried in vacuum. Thus 292 mg of
the title compound was obtained at a purity of 95.5%.
[0591] Molecular mass, found by MS: 6102.+-.6, theory: 6103.
[0592] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=20. The determination was carried out as
described on page 23 of the description.
[0593] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 11.9
hours. The determination was carried out as described on page 24 of
the description using a composition similar to those described in
Table 2 on page 26 of the description.
Example 35
[0594] Synthesis of Lys.sup.B29(N.sup..epsilon.-tetradecanoyl-Glu-)
des(B30) Human Insulin.
[0595] 500 mg of (A1,B1)-diBoc human insulin was dissolved in a
mixture of 186 .mu.l of 4-methylmorpholine and 3814 .mu.l of DMSO.
The reaction was initiated by addition of 85 mg of
N.sup..alpha.-tetradecanoyl-Glu(OtBu)-O- Su dissolved in 1000 .mu.l
of DMF. The reaction was conducted at 15.degree. C. and it was
stopped after 4.5 hours. The remaining process steps were performed
as described in Example 34. The intermediate product was isolated
and the protection groups were removed by TFA before purification
by RP-HPLC and final isolation by precipitation and vacuum
drying.
[0596] Thus 356 mg of the title compound was obtained at a purity
of 94.1%. Molecular mass, found by MS: 6053.+-.6, theory: 6046.
[0597] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=24. The determination was carried out as
described on page 23 of the description.
[0598] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 8.8
hours. The determination was carried out as described on page 24 of
the description using a composition similar to those described in
Table 2 on page 26 of the description.
Example 36
[0599] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-tetradecano-
yl-Glu(-)--OH]) Human Insulin.
[0600] 400 mg of (A1,B1)-diBoc human insulin was dissolved in a
mixture of 232 .mu.l of ethyldiisopropylamine, 1880 .mu.l of DMSO
and 2088 .mu.l of 1-methyl-2-pyrrolidone. The reaction was
initiated by addition of 138 mg of
N.sup.a-tetradecanoyl-Glu(OSu)-OtBu dissolved in 800 .mu.l of
1-methyl-2-pyrrolidone. The reaction was conducted at 15.degree. C.
and it was stopped after 4.5 hours. The remaining process steps
were performed as described in Example 34. The protection groups
were removed from the intermediate product by TFA before
purification by RP-HPLC and final isolation by precipitation and
vacuum drying.
[0601] Thus 222 mg of the title compound was obtained at a purity
of 95.5%. Molecular mass, found by MS: 6150.+-.6, theory: 6147.
[0602] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=21. The determination was carried out as
described on1 page 23 of the description.
[0603] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 8.0
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 37
[0604] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-hexadecanoy-
l-Glu(-)--OH]) Human Insulin.
[0605] 400 mg of (A1,B1)-diBoc human insulin was dissolved in a
mixture of 232 .mu.l of ethyldiisopropylamine, 880 .mu.l of DMSO
and 2088 of 1-methyl-2-pyrrolidone. The reaction was initiated by
addition of 73 mg of N.sup..alpha.-hexadecanoyl-Glu(OSu)-OtBu
dissolved in 800 .mu.l of DMF. The reaction was conducted at
15.degree. C. and it was stopped after 4.5 hours. The remaining
process steps were performed as described in Example 34. 476 mg of
intermediate product was obtained. The protection groups were
removed from the intermediate product by TFA before purification by
RP-HPLC and final isolation by precipitation and vacuum drying.
[0606] Thus 222 mg of the title compound was obtained at a purity
of 81.2%. Molecular mass, found by MS: 6179.+-.6, theory: 6175.
[0607] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=67. The determination was carried out as
described on page 23 of the description.
[0608] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 13.0
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 38
[0609] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-octadecanoy-
l-Glu(-)--OH]) des(B30) Human Insulin.
[0610] 400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved
in a mixture of 232 .mu.l of ethyldiisopropylamine, 3000 .mu.l of
DMSO and 268 .mu.l of dimetylformamide. The reaction was initiated
by addition of 114 mg N.sup..alpha.-octadecanoyl-Glu(OSu)-OtBu
dissolved in 500 .mu.l of DMF. The reaction was conducted at
15.degree. C. and it was stopped after 4.5 hours. The remaining
process steps were performed as described in Example 34. 420 mg of
intermediate product was obtained. The protection groups were
removed from the intermediate product by TFA before purification by
RP-HPLC and final isolation by precipitation and vacuum drying.
[0611] Thus 169 mg of the title compound was obtained at a purity
of 98.3%. Molecular mass, found by MS: 6103.+-.5, theory: 6102.
[0612] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=185. The determination was carried out as
described on page 23 of the description.
[0613] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 9.7
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 39
[0614] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-tetradecano-
yl-Glu(-)--OH]) des(B30) Human Insulin.
[0615] 400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved
in a mixture of 232 .mu.l of ethyldiisopropylamine and 3000 .mu.l
of DMSO. The reaction was initiated by addition of 138 mg of
N.sup..alpha.-tetradecano- yl-Glu(OSu)-OtBu dissolved in 768 .mu.l
of DMF. The reaction was conducted at 15.degree. C. and it was
stopped after 4.5 hours. The remaining process steps were performed
as described in Example 34. 505 mg of intermediate product was
obtained. The protection groups of the intermediate product were
removed by TFA before purification by RP-HPLC and final isolation
by precipitation and vacuum drying.
[0616] Thus 237 mg of the title compound was obtained at a purity
of 96.7%. Molecular mass, found by MS: 6053.+-.6, theory: 6046.
[0617] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=21. The determination was carried out as
described on page 23 of the description.
[0618] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 12.8
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 40
[0619] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-hexadecanoy-
l-Glu(-)--OH]) des(B30) Human Insulin.
[0620] 400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved
in a mixture of 232 .mu.l of ethyldiisopropylamine, 3000 .mu.l of
DMSO and 400 .mu.l of dimetylformamide. The reaction was initiated
by addition of 73 mg of N.sup..alpha.-hexadecanoyl-Glu(OSu)-OtBu
dissolved in 400 .mu.l of DMF. The reaction was conducted at 15 C.
and it was stopped after 4.5 hours. The remaining process steps
were performed as described in Example 34. The protection groups of
the intermediate product were removed by TFA before purification by
RP-HPLC and final isolation by precipitation and vacuum drying.
[0621] Thus 153 mg of the title compound was obtained at a purity
of 95.2%. Molecular Mass, found by MS: 6073.+-.6, thory: 6074.
[0622] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=67. The determination was carried out as
described on page 23 of the description.
[0623] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 18.0
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 41
[0624] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-lithocholyi-
-Glu(-)--OH]) des(B30) Human Insulin.
[0625] 400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved
in a mixture of 148 .mu.l 4-methylmorpholine and 3452 .mu.l of
DMSO. The reaction was initiated by addition of 132 mg of
N.sup..alpha.-lithocholoy- l-Glu(OSu)-OtBu dissolved in 400 .mu.l
of DMF. The reaction was conducted at 15.degree. C. and it was
stopped after 4.5 hours. The remaining process steps were performed
as described in Example 34. 493 mg of intermediate product was
obtained. The protection groups of the intermediate product were
removed by TFA before purification by RP-HPLC and final isolation
by precipitation and vacuum drying.
[0626] Thus 209 mg of the title compound was obtained at a purity
of 97.4%. Molecular Mass, found by MS: 6185.+-.10, theory:
6194.
Example 42
[0627] Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-tetradecanoyl
Aad(-)--OH]) des(B30) Human Insulin.
[0628] Aad is 5-aminohexadioic acid. 347 mg of (A1,B1)-diBoc
des(B30) human insulin was dissolved in a mixture of 129 .mu.l of
4-methylmorpholine and 2645 .mu.l of DMSO. The reaction was
initiated by addition of 58 mg of
N.sup..alpha.-tetradecanoyl-Aad(OSu)-OtBu dissolved in 694 .mu.l of
DMF. The activated ester was prepared in analogy with chemistry
well-known from as aspartic acid derivatisationi (L. Benoiton: Can.
J. Chem. 40,570-72,1962, R. Roeske: J. Org. Chem 28 1251-93
(1963)). The reaction was conducted at 15.degree. C. and it was
stopped after 4.5 hours. The remaining process steps were performed
as described in Example 34. The protection groups of the
intermediate product were removed by TFA before purification by
RP-HPLC and final isolation by precipitation and vacuum drying.
[0629] Thus 149 mg of the title compound was obtained at a purity
of 97.9%. Molecular Mass, found by MS: 6061.+-.2, thory: 6060.
[0630] The lipophilicity of the title compound, relative to human
insulin, k'.sub.rel=21. The determination was carried out as
described on page 23 of the description.
[0631] The disappearance half-life, T.sub.50%, of the title
compound after subcutaneous injection in pigs was found to be 16.1
hours. The determination was carried out as described on page 24 of
the description using a composition similar to the one described in
the present Example 31.
Example 43
[0632] Synthesis of
Lys.sup.B29(N.sup..epsilon.-[N.sup..alpha.-tetradecano-
yl-.gamma.-carboxy-Glu-]) des(B30) Human Insulin.
[0633] 400 mg of (A1,B1)-diBoc des(B30) human insulin was dissolved
in a mixture of 190 .mu.l of triethylamine and 3000 .mu.l of DMSO.
The reaction was initiated by addition of 83 mg of .gamma.-carboxy
Glu N-tetradecansyre .gamma.,.gamma.'-di(OtBu) .alpha.-(OSu) (i.e.
(tBuOCO).sub.2CHCH.sub.2--CH(COOSu)-NH--CO(CH.sub.2).sub.12CH.sub.3)
dissolved in 800 .mu.l of DMF. The reaction was conducted at
15.degree. C. and it was stopped after 4.5 hours. The remaining
process steps were performed as described in Example 34. The
protection groups of the intermediate product were removed by TFA
before purification by RP-HPLC and final isolation by precipitation
and vacuum drying.
[0634] 63 mg of the title compound were obtained. Molecular Mass,
found by MS: 6090.+-.3, theory: 6091.
[0635] The lipophilicity of the title compound, relative to human
insulin, k .sub.rel=10. The determination was carried out as
described on page 23 of the description.
Sequence CWU 1
1
* * * * *