U.S. patent application number 10/640274 was filed with the patent office on 2004-06-03 for further use of protein kinase n beta.
This patent application is currently assigned to Atugen AG. Invention is credited to Kaufmann, Jorg, Klippel-Giese, Anke.
Application Number | 20040106569 10/640274 |
Document ID | / |
Family ID | 31979830 |
Filed Date | 2004-06-03 |
United States Patent
Application |
20040106569 |
Kind Code |
A1 |
Klippel-Giese, Anke ; et
al. |
June 3, 2004 |
Further use of protein kinase N beta
Abstract
The present invention is related to use of protein kinase N beta
or a fragment or derivative thereof as a downstream target of the
PI 3-kinase pathway, preferably as a downstream drug target of the
PI 3-kinase pathway.
Inventors: |
Klippel-Giese, Anke;
(Berlin, DE) ; Kaufmann, Jorg; (Berlin,
DE) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE
Suite 300
1666 K Street, NW
Washington
DC
20006
US
|
Assignee: |
Atugen AG
Robert-Rossle-Str. 10
Berlin
DE
D-13125
|
Family ID: |
31979830 |
Appl. No.: |
10/640274 |
Filed: |
August 14, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60409570 |
Sep 11, 2002 |
|
|
|
Current U.S.
Class: |
514/44A ;
424/146.1; 514/17.7; 514/19.4; 514/19.5; 514/19.8; 514/7.5 |
Current CPC
Class: |
A61K 38/4866 20130101;
C12N 2310/14 20130101; C12Q 1/6883 20130101; A61K 38/17 20130101;
C12Q 2600/158 20130101; A61P 35/00 20180101; G01N 2500/04 20130101;
C12Q 2600/106 20130101; G01N 33/573 20130101; G01N 2333/9121
20130101; C12Q 1/6886 20130101; C12N 2320/30 20130101; C12Y
207/11013 20130101; C12N 15/113 20130101; C12Q 2600/136 20130101;
A61P 35/04 20180101; G01N 2800/52 20130101; G01N 33/57484 20130101;
C12N 15/1137 20130101; A61K 38/45 20130101 |
Class at
Publication: |
514/044 ;
514/012; 424/146.1 |
International
Class: |
A61K 048/00; A61K
039/395 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 14, 2002 |
EP |
EP 02018572.4 |
Claims
What is claimed is:
1. A method of treating a disease or pathological condition
associated with dysregulation of the PI-3 kinase pathway,
comprising administering to a subject suffering from said disease
an effective amount of a composition that inhibits the activity of
protein kinase N beta.
2. The method according to claim 1, wherein said dysregulation of
said PI-3 pathway is associated with increased activity of protein
kinase N beta.
3. The method according to claim 1, wherein said disease or
pathological condition is cancer or a precancerous growth.
4. The method according to claim 3, wherein said disease or
pathological condition is selected from the group consisting of
endometrial cancer, colorectal carcinoma, glioma, endometrial
cancer, adenocarcinoma, endometrial hyperplasia, Cowden's syndrome,
hereditary non-polyposis colorectal carcinoma, Li-Fraumeni
syndrome, breast cancer, thyroid cancer, ovarian cancer, and
prostate cancer.
5. The method according to claim 2, wherein said disease of
pathological condition is selected from the group consisting of
Bannayan-Zonana syndrome, Lhermitte-Duklos' syndrome, a
hamartoma-macrocephaly diseases, a mucocutaneous lesion,
macrocephaly, mental retardation, gastrointestinal hamiatoma,
lipoma, thyroid adenomas, fibrocystic disease of the breast, and
cerebellar dysplastic gangliocytoma.
6. The method according to claim 1, wherein said composition
comprises at least one agent selected from the group consisting of
a peptide, a protein, an antibody, an anticaline, a functional
nucleic acid, and a small molecule drug.
7. The method according to claim 6, wherein said agent is a
functional nucleic acid selected from the group consisting of an
aptamer, an aptazyme, a ribozyme, a spiegelmer, an antisense
oligonucleotide and an siRNA.
8. The method according to claim 7, wherein said agent is an
antisense oligonucleotide having a sequence selected from the group
consisting of SEQ ID NOS 1-12.
9. The method according to claim 7, wherein said agent is an siRNA
comprising a sequence selected from the group consisting of 5'
actgagcaagaggctttggag and 5' aaattccagtggttcattcca.
10. The method according to claim 1, wherein said subject is a
human.
11. A method for identifying an agent suitable for treating a
disease or pathological condition associated with dysregulation of
the PI-3 kinase pathway, comprising contacting a test system
comprising a protein having protein kinase N beta activity with a
composition comprising a candidate compound, and determining if
protein kinase N beta activity is reduced in the presence of said
candidate compound.
12. The method according to claim 11, wherein reduction in protein
kinase N beta activity is measured by measuring protein kinase N
beta enzymatic activity.
13. The method according to claim 11, wherein reduction in protein
kinase N beta activity is measured by measuring a change in
expression of said protein having protein kinase N beta
activity.
14. The method according to claim 11, wherein said test system
comprises a cell that expresses said protein having protein kinase
N activity.
15. The method according to claim 11 wherein said candidate
compound is selected from the group consisting of a peptide, a
protein, an antibody, an anticaline, a functional nucleic acid, a
small molecule drug, an aptamer, an aptazyme, a ribozyme, a
spiegehner, an antisense oligonucleotide and an siRNA.
16. The method according to claim 11, wherein said composition
comprises a plurality of candidate compounds.
17. A method for diagnosing a disease associated with a
dysregulated PI-3 kinase pathway in a subject suspected of
suffering from said disease, comprising measuring protein kinase N
beta activity in a sample obtained from said subject and comparing
said activity with a control level of activity, wherein an increase
in protein kinase N beta activity indicates the presence of
disease.
18. The method according to claim 17, wherein protein kinase N beta
activity is measured by determining expression of protein kinase N
beta protein.
19. The method according to claim 17, wherein protein kinase N beta
activity is measured by determining enzymatic activity of protein
kinase N beta.
20. The method according to claim 17, wherein said control level of
activity is measured in a control tissue obtained from said subject
and wherein said control tissue is not suspected of having a
dysregulated PI-3 kinase pathway.
21. The method according to claim 17, wherein said control level of
activity is taken from a database of control levels.
22. A method for determining the efficacy of a therapeutic
treatment regimen in a subject, comprising: measuring protein
kinase N beta activity in a first sample obtained from the subject,
thereby generating an initial level; administering the treatment
regimen to the subject; measuring protein kinase N beta activity in
a second sample from the patient at a time following administration
of the treatment regimen, thereby generating a test level; and
comparing the initial and test levels, wherein a decrease in
protein kinase N beta activity in the test level relative to the
initial level indicates that the treatment regimen is effective in
the patient.
23. A method for selecting test agents having a therapeutic effect
in a subject, comprising: measuring protein kinase N beta activity
in a first sample obtained from the subject, thereby generating a
pre-treatment level; administering a test agent to the subject;
measuring protein kinase N beta activity in a second sample from
the patient at a time following administration of the test agent,
thereby generating data for a test level; and comparing the
pre-treatment level to the test level, wherein data showing no
decrease in the test level relative to the pre-treatment level
indicates that the test agent is not effective in the patient; and
eliminating the test agent from further evaluation or study.
24. A pharmaceutical composition comprising at least one agent that
inhibits the activity of protein kinase N beta and a
pharmaceutically acceptable carrier.
25. The composition according to claim 24, wherein said agent is
selected from the group consisting of agents that inhibit the
enzymatic activity of protein kinase N beta.
26. The composition according to claim 24, wherein said agent is
selected from the group consisting of agents that inhibit the
expression of protein kinase N beta.
27. The composition according to claim 24, wherein said agent is
selected from the group consisting of small molecules that interact
with protein kinase N beta, antibodies that specifically bind
protein kinase N beta, polypeptides that bind to protein kinase N
beta, and functional nucleic acids.
28. The composition according to claim 27, wherein said functional
nucleic acid is selected from the group consisting of an aptamer,
an aptazyme, a ribozyme, a spiegelmer, an antisense oligonucleotide
and an siRNA.
Description
[0001] This application claims priority from U.S. provisional
application serial No. 60/409,570, filed Sep. 11, 2002, the
entirety of which is hereby incorporated by reference. The
disclosure of European Patent Application No. 02018572.4, filed
Aug. 14, 2002, for which benefit under 35 USC .sctn. 119 is
claimed, also is expressly incorporated herein in its entirety.
FIELD OF THE INVENTION
[0002] The invention provides compositions and methods related to
the use of protein kinase N beta.
BACKGROUND OF THE INVENTION
[0003] Modern drug development no longer relies on a more or less
heuristic approach but typically involves the elucidation of the
molecular mechanisms underlying a disease or a condition, the
identification of candidate target molecules and the evaluation of
said target molecules. Once such a validated target molecule, which
is herein referred to also as target, is available, drug candidates
directed thereto may be tested. In many cases such drug candidates
are members of a compound library which may consist of synthetic or
natural compounds. Also the use of combinatorial libraries is
common. Such compound libraries are herein also referred to as
candidate compound libraries. Although in the past this approach
has proven to be successful, it is still time and money consuming.
A variety of technologies currently are applied for target
identification and target validation.
[0004] Still, numerous tumours and cancers pose a significant
threat to human health. In order to create safer and more powerful
drugs having less side effects, it is necessary to identify target
molecules which, upon being addressed by appropriate compounds, may
specifically and selectively be influenced in their activity or
presence. Because of the preferably selective and specific
interaction between the compound, which may be a potential or
candidate drug, and the target, the target's function in a disease
or diseased condition such as, for example, cancer, tumorigenesis
and metastasis, may be influenced and thus the disease treated or
prevented and the diseased condition ameliorated.
[0005] It is apparent that new targets suitable for development of
new therapeutic approaches in the treatment of tumorigenesis and
cancer are greatly to be desired. It also is apparent that new
methods of therapeutic intervention directed at those targets are
greatly to be desired.
SUMMARY OF THE INVENTION
[0006] It is therefore an object of the invention to provide new
targets for therapeutic invention and the treatment of disease. It
is a further object of the invention to provide compositions and
methods suitable for therapeutic intervention against these new
targets.
[0007] In accordance with these objects, there has been provided,
in accordance with a first aspect of the invention, the use of
protein kinase N beta or a fragment or derivative thereof as a
downstream target of the PI 3-kinase pathway, preferably as a
downstream drug target of the PI 3-kinase pathway.
[0008] In accordance with a second aspect of the invention there
are provided compositions and methods for using protein kinase N
beta or a fragment or derivative thereof for the manufacture of a
medicament for the treatment and/or prevention of a disease and/or
for the manufacture of a diagnostic agent for the diagnosis of a
disease, whereby the disease is selected from the group comprising
cancers, metastatic cancers and any pathological conditions
involving the PI 3-kinase pathway.
[0009] In an embodiment of the use according to the first and
second aspect of the present invention protein kinase N beta has an
amino acid sequence according to SEQ ID NO. 1 or according to
databank entry PID g7019489 or databank entry gi 7019489, or a part
or derivative thereof.
[0010] In accordance with a third aspect of the invention there is
provided a use of a nucleic acid coding for protein kinase N beta,
or a fragment or a derivative thereof for the treatment and/or
prevention of a disease and/or for the manufacture of a diagnostic
agent for the diagnosis of a disease, whereby the disease is
selected from the group comprising cancers, metastatic cancers and
any pathological conditions involving the PI 3-kinase pathway.
[0011] In an embodiment of the use according to the third aspect of
the present invention protein kinase N beta has an amino acid
sequence according to SEQ ID NO. 1 or according to databank entry
PID g7019489 or databank entry gi 7019489, or a part or derivative
thereof.
[0012] In another embodiment of the use according to the third
aspect of the present invention the nucleic acid is a nucleic acid
according to SEQ ID NO. 2 or according to databank entries gi
7019488 or NM.sub.--01335, preferably NM.sub.--01335.1.
[0013] In another embodiment of the use according to the any of the
aspects of the present invention protein kinase N beta is coded by
a nucleic acid according to SEQ ID NO. 2 or according to databank
entries gi 7019488 or NM.sub.--01335, preferably
NM.sub.--01335.1.
[0014] In a preferred embodiment of the use according to the third
aspect of the present invention the nucleic acid sequence, but for
the degeneracy of the genetic code, would hybridize to the
inventive nucleic acid subject to the third aspect of the present
invention.
[0015] In a further embodiment of the use according to the any of
the aspects of the present invention the nucleic acid sequence is a
sequence which hybridizes under stringent conditions to the nucleic
acid sequence or part thereof, according to SEQ ID NO. 2 or
according to databank entries gi 7019488 or NM.sub.--01335,
preferably NM.sub.--01335.1.
[0016] In a preferred embodiment of the use according to any of the
aspects of the present invention the disease is characterized such
that the cells being involved in said disease, lack PTEN activity,
show an increased aggressive behaviour, or are cells of a late
stage tumor.
[0017] In another preferred embodiment of the use according to the
third aspect of the present invention the disease is a late stage
tumor.
[0018] In accordance with another aspect of the invention there is
provided a method for the screening of an agent for the treatment
and/or prevention of a disease and/or for the manufacture of a
diagnostic agent for the diagnosis of a disease, whereby the
disease is selected from the group comprising cancers, metastatic
cancers and any pathological conditions involving the PI 3-kinase
pathway comprising the steps:
[0019] a) providing a candidate compound,
[0020] b) providing an expression system for protein kinase N beta
and/or a system detecting the activity of protein kinase N
beta;
[0021] c) contacting of the candidate compound with the expression
system for protein kinase N beta and/or the system detecting
activity of protein kinase N beta;
[0022] d) determining if the expression and/or the activity of
protein kinase N beta is changed under the influence of the
candidate compound.
[0023] In an embodiment of the method according to the fourth
aspect of the present invention the candidate compound is contained
in a library of compounds.
[0024] In another embodiment of the method according to the fourth
aspect of the present invention the candidate compound is selected
from the group of classes of compounds comprising peptides,
proteins, antibodies, anticalines, functional nucleic acids,
natural compounds and small molecules.
[0025] In a preferred embodiment of the method according to the
fourth aspect of the present invention the functional nucleic acids
are selected from the group which comprises aptamers, aptazymes,
ribozymes, spiegelmers, antisense oligonucleotides and siRNA.
[0026] In a further preferred embodiment of the method according to
the fourth aspect of the present invention protein kinase N beta or
the nucleic acid coding for protein kinase N beta are the ones
described in connection with any other aspect of the present
invention.
[0027] In accordance with a fifth aspect of the invention there is
provided the use of protein kinase N beta or a part or derivative
thereof and/or nucleic acid or a part or derivative thereof coding
for protein kinase N beta as target molecule for the development
and/or manufacture of a medicament for the treatment and/or
prevention of a disease and/or for the manufacture of a diagnostic
agent for the diagnosis of a disease, whereby the disease is
selected from the group comprising cancers, metastatic cancers and
any pathological conditions involving the PI 3-kinase pathway.
[0028] In an embodiment of the use according to the fifth aspect of
the present invention the medicament and/or the diagnostic agent
comprises an agent, which is selected from the group comprising
antibodies, peptides, anticalines, small molecules, antisense
molecules, aptameres, spiegelmers and RNAi molecules.
[0029] In a preferred embodiment of the use according to the fifth
aspect of the present invention the agent interacts with the
protein kinase N beta or a part or derivative thereof.
[0030] In an alternative embodiment of the use according to the
fifth aspect of the present invention the agent interacts with the
nucleic acid coding for protein kinase N beta or a part or
derivative thereof, in particular with MRNA, genomic nucleic acid
or cDNA for protein kinase N beta.
[0031] In accordance with a sixth aspect of the invention there is
provided the use of a polypeptide which interacts with protein
kinase N beta or a part or derivative thereof, for the development
or manufacture of a medicament for the treatment and/or prevention
of a disease and/or for the manufacture of a diagnostic agent for
the diagnosis of a disease, whereby the disease is selected from
the group comprising cancers, metastatic cancers and any
pathological conditions involving the PI 3-kinase pathway.
[0032] In an embodiment of the use according to the sixth aspect of
the present invention the polypeptide is selected from the group
which comprises antibodies against protein kinase N beta or a part
or derivative thereof and polypeptides binding protein kinase N
beta or a part or derivative thereof.
[0033] In accordance with a seventh aspect of the invention there
is provided the use of a nucleic acid which interacts with protein
kinase N beta or a part or derivative thereof, for the development
or manufacture of a medicament for the treatment and/or prevention
of a disease and/or for the manufacture of a diagnostic agent for
the diagnosis of a disease, whereby the disease is selected from
the group comprising cancers, metastatic cancers and any
pathological conditions involving the PI 3-kinase pathway.
[0034] In an embodiment of the use according to the seventh aspect
of the present invention the nucleic acid is selected from the
group which comprises aptamers and spiegelmers.
[0035] In accordance with an eighth aspect of the invention there
is provided the use of a nucleic acid which interacts with a
nucleic acid coding for protein kinase N beta or a part or
derivative thereof, for the development or manufacture of a
medicament for the treatment and/or prevention of a disease and/or
for the manufacture of a diagnostic agent for the diagnosis of a
disease, whereby the disease is selected from the group comprising
cancers, metastatic cancers and any pathological conditions
involving the PI 3-kinase pathway.
[0036] In an embodiment of the use according to the eighth aspect
of the present invention the interacting nucleic acid is an
antisense oligonucleotide, a ribozyme and/or siRNA.
[0037] In a further embodiment of the use according to the eighth
aspect of the present invention the nucleic acid coding for protein
kinase N beta or a part or derivative thereof is the cDNA, mRNA or
hnRNA.
[0038] In an embodiment of the use according to the eighth aspect
of the present invention the protein kinase N beta and/or the
nucleic acid coding for protein kinase N beta is the one described
in connection with any aspect of the present invention.
[0039] In accordance with a ninth aspect of the invention there is
provided a pharmaceutical composition comprising at least one agent
selected from the group comprising protein kinase N beta or a part
or derivative thereof, small molecules interacting with protein
kinase N beta or a part or derivative thereof or with a nucleic
acid coding for protein kinase N beta or a part or derivative
thereof, antibodies specific for protein kinase N beta or a part or
derivative thereof, polypeptides interacting with protein kinase N
beta or a part or derivative thereof, a nucleic acid coding for
protein kinase N beta or a part or derivative thereof, nucleic
acids interacting with protein kinase N beta or a part or
derivative thereof or nucleic acids interacting with a nucleic acid
coding for protein kinase N beta or a part or derivative thereof,
and at least one pharmaceutically acceptable carrier, preferably
for the prevention and/or the treatment of a disease whereby the
disease is selected from the group comprising cancers, metastatic
cancers and any pathological conditions involving the PI-3 kinase
pathway.
[0040] In accordance with a stenth aspect of the invention there is
provided a kit for the characterisation of a disease or a condition
which is selected from the group comprising cancers, metastatic
cancers and any pathological conditions involving the PI-3 kinase
pathway, comprising at least one agent which is selected from the
group comprising protein kinase N beta or a part or derivative
thereof, antibodies specific for protein kinase N beta or a part or
derivative thereof, polypeptides interacting with protein kinase N
beta or a part or derivative thereof, polypeptides interacting with
a nucleic acid coding for protein kinase N beta or a part or
derivative thereof, nucleic acids interacting with protein kinase N
beta or a part or derivative thereof, nucleic acids interacting
with a nucleic acid coding for protein kinase N beta or a part or
derivative thereof, and optionally at least one other compound.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The present invention is now further illustrated by the
following figures and examples which are not intended to limit the
scope of protection. From these figures and examples further
features, embodiments and advantages may be taken, wherein
[0042] FIG. 1 shows a schematic representation of growth factor
induced activation of the PI 3-kinase pathway. Growth factor
stimulation of cells leads to activation of their cognate receptors
at the cell membrane, which in turn associate with and activate
intracellular signalling molecules such as PI 3-kinase. The tumor
suppressor PTEN interferes with PI 3-kinase mediated downstream
responses and ensures that activation of the pathway occurs in a
transient manner. LY294002 is a small molecule inhibitor of PI
3-kinase. One of the known downstream genes of PI 3-K is mTOR
(mammalian target of Rapamycin) which can be inhibited by the
clinically approved drug rapamycin (Rapamune). PI 3-K is involved
in the regulation of cell proliferation, cell survival, glucose
transport, translation, metastasis and migration. X are indicating
downstream effectors which represent potential drug targets that
are predicted to be involved in promoting metastatic behavior of
cancer cells. This class of effector molecules which act further
downstream in the pathway are likely to represent better drug
targets than more "upstream" targets such as mTOR, since they have
fewer pleiotropic effects.
[0043] FIG. 2 shows the measurement of lymph node metastasis in an
orthotopic PC-3 mouse model after treatment with rapamycin;
[0044] FIG. 3 shows the experimental approach to identify PKNbeta
as a downstream drug target of the PI 3-Kinase pathway;
[0045] FIG. 4 shows a primary GeneBloc screen on PKNbeta;
[0046] FIG. 5 shows the growth of PC3 cells transfected with
PKNbeta specific GB on matrigel;
[0047] FIG. 6 shows RNA interference by transient expression of
siRNA in HeLaB cells: (A) siRNA molecules were generated by
promoter (U6+2) driven expression of target specific sequences
(template derived from gene of interest containing a 21-mer sense
and reverse complementary sequences linked by 12-mer poly A
stretch. Upon transcription RNAs are likely to form double-stranded
siRNA molecules; (B) Template sequences of targeted genes for siRNA
expression. Corresponding sequence were introduced into expression
vectors carrying the U6+2 promoter cassette; (C) Effect of siRNA
expression on cell growth and proliferation. Constructs (see above)
were transiently expressed by transfection in HeLaB cells for RNAi
interference experiments. Cells were harvested 48 hour after
transfected and subsequently seeded (80000 cells per well) on
"matrigel" gel. The effect of RNA interference on the expression of
corresponding genes was analyzed by assaying transfected cells for
growth/proliferation on matrigel. Expression of siRNA targeted to
PTEN had no affect on HeLaB cell growth on matrigel (right panel),
whereas expression of siRNA specific to p110beta and PKNbeta
severely disturbed the behaviour of HeLaB growth on matrigel
(middle and right panels).;
[0048] FIG. 7 shows photographs of human prostate cells and human
prostate cancer cells upon hybridisation using protein kinase N
beta antisense and sense sequences as probes;
[0049] FIG. 8 shows a diagram depicting the volume of primary
tumors in an orthotopic prostate tumor model using two different
siRNA constructs (FIG. 8A), a diagram depicting the volume-of lymph
node metastases in an orthotopic prostate tumor model using two
different siRNA constructs (FIG. 8B), and photographs of prostate
and lymph nodes in an orthotopic prostate tumor model using control
siRNA (FIG. 8C1) and a protein kinase N beta specific siRNA
construct (FIG. 8C2);
[0050] FIG. 9 shows a Western-blot analysis of different protein
kinase N beta derivatives and their activities using MPB as a
standard phosphorylation substrate upon transient overexpression in
HeLa cells and anti-protein kinase N beta antibody (anti-PK) for
detecting the relative expression levels of the kinase derivatives
(FIG. 9A), a further Western-blot analysis of different protein
kinase N beta derivatives using an antibody specific for the
phosphorylated form of protein kinase N beta (FIG. 9B), and a
schematic representation of the various protein kinase N beta
derivatives used (FIG. 9C);
[0051] FIG. 10 shows a Western Blot of various protein kinase N
beta derivatives (FIG. 10A) to monitor the expression levels
thereof in HeLa cells and a gel analysis of the phosphorylation of
the protein kinase N beta derivatives (FIG. 10B);
[0052] FIG. 11 shows the results of immunoprecipitation assays to
detect phosphorylation of protein substrates for protein kinase N
beta detecting the phosphorylated form thereof by Western blotting
(FIG. 11A) or the incorporation of .sup.32P-labelled phosphate by
autoradiography (FIG. 11B). To ensure that comparable amounts of
PKNbeta were present in the respective immune precipitates the
filter shown in FIG. 11A was reprobed using an anti-PKNbeta
antibody ("kinase", FIG. 11C).
[0053] FIG. 12 shows a Western Blot analysis comparing the
expression of endogenous protein kinase N beta in samples that were
treated with LY294002 for different times in HeLa and PC-3 cells.
The level of phosphorylated AKT was monitored in parallel to
confirm efficacy of the PI 3-kinase inhibitor.
[0054] FIG. 13 shows the relative protein amounts and kinase
activities of various recombinant PKNbeta derivatives present in
immuno-complexes. The cells expressing the respective recombinant
proteins had been treated with he PI 3-kinase inhibitor LY294002
prior to lysis for the indicated times.
[0055] FIG. 14 shows a panel of pictures, whereby the cellular
distribution of PKN beta and derivatives thereof such as PKN beta
wildtype (FIG. 14A), PKN beta derivative TA (FIG. 14B), PKN beta
derivative KE (FIG. 14C) and PKN beta deltaN (FIG. 14D) was
investigated by confocal fluorescence microscopy. HA-tagged
recombinant derivatives of PKNbeta were transiently expressed in
HeLa cells for 48 h. After fixing and permeabilization, expression
of the recombinant proteins was detected by using an anti-HA
antibody followed by an FITC-conjugated anti-mouse antibody. The
cells were counterstained by labelling the cytoskeletal actin with
rhodamin-phalloidin.
DETAILED DESCRIPTION
[0056] The present inventors have surprisingly found that protein
kinase N beta, also referred to herein as PKN beta, is a valuable
target in connection with cancer and tumours. More particularly,
the present inventors have discovered that protein kinase N beta is
a downstream target of the PI-3 kinase/PTEN pathway. Still more
surprisingly the present inventors have discovered that protein
kinase N beta is linked to tumorigenesis and metastasis.
[0057] This latter effect in particular seems to be strongly
related to the loss of suppressor function, more particularly PTEN
tumour suppressor function. As will be shown in the examples,
protein kinase N beta is up-regulated under conditions where PTEN
which is an inhibitor to the PI-3 kinase pathway, is not active.
Cells in which up-regulation of protein kinase N beta occurs show
an increase in metastatic behaviour and migrational behaviour. This
means that inhibitors of protein kinase N beta can be used to
control metastatic and migrational behaviour of cells and therefore
provide methods of treating tumors and cancers, more particularly
those tumors and cancers which are metastatic and the cells of
which show a metastatic and/or migrational behaviour which are
generally referred to herein as `the disease as described herein`
or as `diseased condition as described herein`.
[0058] The disease as described herein as well as the diseased
condition as described herein also includes tumorigenesis and
metastasis. This applies particularly to those diseases as
described herein and those diseased conditions as described herein,
where the cells involved in such diseases or diseased conditions
are PTEN negative which means that the tumor suppressor PTEN is not
active or has a reduced level of activity. The diseases also
comprise those diseases in which the PI 3-kinase pathway is in
general involved.
[0059] Besides metastatic tumors in particular, diabetes falls
within this kind of diseases and diseased condition, respectively.
Accordingly, cells, particularly those which are involved in the
disease or diseased condition as described herein and which are
PTEN negative, may be treated by a drug that reduces or eliminates
the activity of protein kinase N beta in the respective cells
involved. Accordingly, patients whose tumors are characterized by a
preferably hyperactivated PI 3-kinase pathway, including but not
limited to, either through amplification or mutation of genes
encoding components of the PI 3-kinase pathway (p110, Akt) or are
PTEN negative or who have cells which are PTEN negative,
particularly if these cells are involved in the disease as
described herein or in the diseased condition as described herein,
can advantageously be treated using said drugs.
[0060] The reduction in activity may stem either from a reduction
at the transcription level or at the level of the translation, i.e.
the enzymatic activity of protein kinase N beta. Without wishing to
be bound by any theory, the latter aspect, i.e. modifying the
activity of the protein kinase N beta is also a result from an
insight of the inventors in relation to the characteristics of
PKNbeta, namely that the enzymatic activity of PKNbeta can also be
up- and down-regulated, more preferably down-regulated.
[0061] A further group of patients who can advantageously be
treated using these drugs are those who suffer from cancers which
have a high incidence for loss of PTEN function, especially in late
stage tumors (Cantley, L. C. and Neel, B. G. (1999). New insights
into tumor suppression: PTEN suppresses tumor formation by
restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl
Acad Sci USA 96, 4240-4245; Ali, I. U. (2000). Gatekeeper for
endometrium: the PTEN tumor suppressor gene. J Natl Cancer Inst 92,
861-863). Loss of PTEN correlates with increased aggressive and
invasive behavior of the respective tumor cells. Because of this,
in preferred embodiments of the present invention those diagnostic
agents which may also be used as analytical tools or means in
connection with the various aspects of the present invention, and
therapeutic agents, respectively, directed to protein kinase N beta
or nucleic acids coding therefore, can be used for any tumor
provided that the aforementioned prerequisite is met, namely that
PTEN correlates with increased aggressive and invasive
behaviour.
[0062] This kind of drug may be designed, screened or manufactured
on the basis of the disclosure given herein, namely that protein
kinase N beta is a downstream drug target and that protein kinase N
beta is a target for tumorigenesis and metastasis and diseases
related thereto or arising therefrom.
[0063] Because of the involvement of protein kinase N beta in the
mechanisms as outlined above, it can also be used as a marker for
diagnosing the status of a cell or patient having in his body such
kind of cells whether it will undergo metastasis and tumorigenesis,
respectively. An illustration that this kind of approach works and
is applicable for that purpose is, e.g., ICAM-1. ICAM-1 is used in
the prognosis of gastric cancers to undergo metastasis (Maruo Y,
Gochi A, Kaihara A, Shimamura H, YamadaT, TanakaN, OritaK.Int J
Cancer. 2002 Aug. 1;100(4):486-490 ) where s-ICAM-1 levels were
found to be elevated in pateinets with liver metasasis. In another
example, osteopontin is used as a prognostic marker for breast
cancer (Rudland P S, Platt-Higgins A, El-Tanani M, De Silva Rudland
S, Barraclough R, Winstanley J H, Howitt R, West C R. Cancer Res.
2002 Jun. 15;62(12):3417-3427 ). In so far the presence or the
level of presence (protein or mRNA) or the level of activity of
protein kinase N beta may be used as a marker and any compound more
or less specifically interacting with protein kinase N beta will
therefore be an appropriate diagnostic agent.
[0064] Methods and design principles for drugs and diagnostic
agents which in any case specifically and/or selectively interact
with protein kinase N beta will be disclosed in the following.
[0065] In the light of these findings kinase N beta proves to be a
suitable downstream drug target which allows the selective
modulation of only some aspects which are typically related to PI-3
kinase pathway, namely metastasis and migration, and a selective
and specific diagnostic approach, i.e. detection, of processes
typically related to a dysregulated PI 3-kinase pathway, more
particularly metastasis and migration.
[0066] The PI-3 Kinase Pathway
[0067] The PI 3-kinase pathway is characterized by a PI 3-kinase
activity upon growth factor induction and a parallel signalling
pathway. Growth factor stimulation of cells leads to activation of
their cognate receptors at the cell membrane which in turn
associate with and activate intracellular signalling molecules such
as PI 3-kinase. Activation of PI 3-kinase (consisting of a
regulatory p85 and a catalytic p110 subunit) results in activation
of Akt by phosphorylation, thereby supporting cellular responses
such as proliferation, survival or migration further downstream.
PTEN is thus a tumor suppressor which is involved in the
phosphatidylinositol (PI) 3-kinase pathway and which has been
extensively studied in the past for its role in regulating cell
growth and transformation (for reviews see, Stein, R. C. and
Waterfield, M. D. (2000). PI3-kinase inhibition: a target for drug
development? Mol Med Today 6, 347-357; Vazquez, F. and Sellers, W.
R. (2000). The PTEN tumor suppressor protein: an antagonist of
phosphoinositide 3-kinase signaling. Biochim Biophys Acta 1470,
M21-35; Roymans, D. and Slegers, H. (2001). Phosphatidylinositol
3-kinases in tumor progression. Eur J Biochem 268, 487-498).
[0068] The tumor suppressor PTEN functions as a negative regulator
of PI 3-kinase by reversing the PI 3-kinase-catalyzed reaction and
thereby ensures that activation of the pathway occurs in a
transient and controlled manner. Chronic hyperactivation of PI
3-kinase signalling is caused by functional inactivation of PTEN.
PI 3-kinase activity can be blocked by addition of the small
molecule inhibitor LY294002. The activity and downstream responses
of the signalling kinase MEK which acts in a parallel pathway, can,
for example, be inhibited by the small molecule inhibitor
PD98059.
[0069] A chronic activation of the PI 3-kinase pathway through loss
of PTEN function is a major contributor to tumorigenesis and
metastasis indicating that this tumor suppressor represents an
important checkpoint for a controlled cell proliferation. PTEN
knock out cells show similar characteristics as cells in which the
PI 3-kinase pathway has been chronically induced via activated
forms of PI 3-kinase (Di Cristofano, A., Pesce, B., Cordon-Cardo,
C. and Pandolfi, P. P. (1998). PTEN is essential for embryonic
development and tumour suppression. Nat Genet 19, 348-355. Klippel,
A., Escobedo, M. A., Wachowicz, M. S., Apell, G., Brown, T. W.,
Giedlin, M. A., Kavanaugh, W. M. and Williams, L. T. (1998).
Activation of phosphatidylinositol 3-kinase is sufficient for cell
cycle entry and promotes cellular changes characteristic of
oncogenic transformation. Mol Cell Biol 18, 5699-5711. Kobayashi,
M., Nagata, S., Iwasaki, T., Yanagihara, K., Saitoh, I., Karouji,
Y., Ihara, S. and Fukui, Y. (1999). Dedifferentiation of
adenocarcinomas by activation of phosphatidylinositol 3-kinase.
Proc Natl Acad Sci USA 96, 4874-4879).
[0070] PTEN is involved in several pathways which are also referred
to as PTEN related pathways such as the PI3K/PTEN pathway, the Akt
pathway, the EGF-related autocrine loop and the mTOR pathway. A
P13-kinase pathway is actually any pathway which involves PI
3-kinase, either directly or indirectly. PI 3-kinase may act either
as an inhibitor or as an activator in such pathway, or it may as
such be regulated by other elements of the pathway.
[0071] Diseases and conditions involving dysregulation of the PI
3-kinase pathway are well known. Any of these conditions and
diseases may thus be addressed by the inventive methods and the
drugs and diagnostic agents the design, screening or manufacture
thereof is taught herein. For reasons of illustration but not
limitation it is referred to the following: endometrial cancer,
colorectal carcinomas, gliomas, endometrial cancers,
adenocarcinomas, endometrial hyperplasias, Cowden's syndrome,
hereditary non-polyposis colorectal carcinoma, Li-Fraumene's
syndrome, breast-ovarian cancer, prostate cancer (Ali, I. U.,
Journal of the National Cancer Institute, Vol. 92, no. 11, Jun. 7,
2000, page 861-863), Bannayan-Zonana syndrome, LDD
(Lhermitte-Duklos' syndrome) (Macleod, K., supra)
hamartoma-macrocephaly diseases including Cow disease (CD) and
Bannayan-Ruvalcaba-Rily syndrome (BRR), mucocutaneous lesions (e.g.
trichilemmonmas), macrocephaly, mental retardation,
gastrointestinal harmatomas, lipomas, thyroid adenomas, fibrocystic
disease of the breast, cerebellar dysplastic gangliocytoma and
breast and thyroid malignancies (Vazquez, F., Sellers, W. R.,
supra.)
[0072] In view of this, protein kinase N beta is a valuable
downstream drug target of the PI 3-kinase pathway which can be
addressed by drugs which will have less side effects than other
drugs directed to targets upstream of protein kinase N beta.
Insofar the present invention provides a drug target which is
suitable for the design, screening, development and manufacture of
pharmaceutically active compounds which are more selective than
those known in the art, such as, for example, LY 294002. By having
control over this particular fraction of effector molecules, i.e.
the protein kinase N beta and any further downstream molecule
involved in the pathway, only a very limited number of parallel
branches thereof or further upstream targets in the signalling
cascade are likely to cause unwanted effects. Therefore, the other
activities of the PI-3 kinase/PTEN pathway related to cell cycle,
DNA repair, apoptosis, glucose transport, translation will not be
influenced. Also, the insulin signalling is not induced which means
that the diabetic responses or other side effects observed in
connection with the use of LY294002 are actually avoided.
[0073] LY294002 (2-(4-morpholinyl)8-phenylchromone) is one of
several chromone derivatives small molecule inhibitor developed by
Lilly Research Laboratories (Indianapolis) as an inhibitor for
PI-3K (Vlahos et al. 1994, J Biol Chem. 269, 5241-5248). It targets
the catalytic subunit of the PI-3K molecule, p110 and functions by
competing with ADP binding in the catalytic centre. However,
LY294002 cannot distinguish between different isoforms of p110
(alpha, beta, gamma, delta) which are suggested to have different
cellular functions.
[0074] Protein kinase N beta is also further downstream of mTOR
which is addressed by rapamycin. mTOR (mammalian Target Of
Rapamycin), also known as Raft or FRAP, is acting downstream of PI
3-kinase to regulate processes such as the pp70S6 kinase dependent
entry into the cell cycle. mTOR acts as a sensor for growth factor
and nutrient availability to control translation through activating
pp70S6 kinase and initiation factor 4E. mTOR function is inhibited
by the bacterial macrolide rapamycin which blocks growth of T-cells
and certain tumor cells (Kuruvilla and Schreiber 1999, Chemistry
& Biology 6, R129-R136).
[0075] The fact that rapamycin and its derivatives are suitable
drugs currently being used in the clinic proves that a drug target
is the more helpful and has the less side effects, the more
specific it is for a particular molecular mechanism as, e.g.,
demonstrated by Yu et al. (Yu, K. et al (2001) Endrocrine-RelatCanc
8, 249).
[0076] Protein kinase N beta is a member of the protein kinase C
family all of which are said to be protein-serine/threonine
kinases. Typically, this kind of protein kinase comprises one
regulatory and one catalytic subunit and uses calcium ions and
phospholipids as co-factors. Diacyl glycerols act as activators of
this kind of protein kinase family. Members of the protein kinase C
family are involved in several signalling pathways linked to
hormones or neurotransmitters. These protein kinases regulate the
activity of their target proteins by phosphorylation. It is known
in the art that unphysiological continued activation of protein
kinase C results in the transformed cellular phenotype that might
lead to the generation of cancer.
[0077] Protein Kinase N Beta and Its Derivatives
[0078] The complete sequence of protein kinase N beta as MnRNA is
available in databanks, e.g., under accession numbers gi 7019488 or
NM.sub.--013355. Using the genetic code, the particular amino acid
sequence may be deduced from this mRNA. Also, the amino acid
sequence of protein kinase N beta is available in databanks under
the accession number gi 7019489 or NP.sub.--037487.1. It is within
the present invention that derivatives or truncated versions
thereof may be used according to the present invention as long as
the desired effects may be realised. The extent of derivatization
and truncation can thus be determined by one skilled in the art by
routine analysis.
[0079] In the context of the present invention, the term nucleic
acid sequences encoding protein kinase N beta also includes nucleic
acid which hybridise to nucleic acid sequences specified by the
aforementioned accession numbers or any nucleic acid sequence which
may be derived from the aforementioned amino acid sequences. Such
hybridization is known to the one skilled in the art. The
particularities of such hybridisation may be taken from Sambrook,
J. Fritsch, E. F. and Maniats, T. (1989) Molecular Cloning: A
Laboratory Manual, 2.sup.nd ed. Cold Spring Harbor: Cold Spring
Harbor Laboratory. In a preferred embodiment the hybridization is a
hybridization under stringent conditions, for example, under the
stringent conditions specified in Sambrook supra.
[0080] In addition, a nucleic acid coding for a protein kinase N
beta is also a nucleic acid sequence which contains sequence
homologous to any of the aforementioned nucleic acid sequences,
whereby the degree of sequence homology is preferably 75, 80, 85,
90 or 95%. Further references related to to protein kinase N beta
are, among others Shibata H. et al., J. Biochem. (Tokyo) July 2001;
130 (1): 23-31; Dong, L Q, Proc Natl Acad Sci USA, 2000, May 9,
1997 (10): 5089-5094; and Oishi, K., Biochem Biophys Res Commun.
1999, Aug. 11; 261 (3): 808-814.
[0081] Homologues to human protein kinase N beta may be found,
among others, in M. musculus, R norvegicus, A. thaliana, C.
elegans, D. melanogaster and S. cerevisiae. The percent identity
and length of the aligned region is 67% and 279 amino acids, 51%
and 866 amino acids, 38% and 305 amino acids, 36% and 861 amino
acids, 63% and 296 amino acids and 44% and 362 amino acids,
respectively, for the various species mentioned before. It will be
acknowledged by the ones skilled in the art that any of these or
other homologues will in principle be suitable for the practice of
the present invention provided the drug or diagnostic agent
generated using such homologue may still interact with the human
protein kinase N beta or any other intended protein kinase N
beta.
[0082] The human amino acid sequence may also be taken from
ProtEST, accession number pir: JC7083 where the respective protein
kinase N beta is referred to as JC7083 protein kinase. The gene for
human protein kinase N beta is located on human chromosome number
9. cDNA sources for protein kinase N beta are in general a number
of cancers and various fetal or embryonic tissues, more
particularly, among others, stomach, adenocarcinoma, brain, breast,
Burkitt's lymphoma, cervix, chondrosarcoma, colon, fetal eyes,
fetal lens, fetal eye anterior segment, fetal optic nerve, fetal
retina, fetal retina foveal, fetal macular fetal choroid,
fibrotheoma, germ line, nead neck, heart, kidney, large cell
carcinoma, leiomyosarcoma metastatic chondrosarcoma, ovary,
parathyroid, retinoblastoma, rhabdomyosarcoma, small cell
carcinoma, squamous cell carcinoma, testis, and uterus.
[0083] From this list it is apparent that a drug (which is also
referred to herein as a medicament), and the diagnostic agent,
including a staging agent, i.e. antibody agent which can be used to
differentiate the status of a patient with regard to the stage of a
disease from which he might suffer, as well as for monitoring the
effectiveness of a treatment applied to a patient, respectively, to
be designed, screened or manufactured according to the technical
teaching given herein may in addition to any of the other diseases
as disclosed herein and the diseased conditions as disclosed herein
also be used for the treatment, prevention, diagnosis, prognosis
and monitoring of these diseases or any disease involving the
specific cells, tissues or organs. These diseases and diseased
conditions are also understood in the context of the invention to
be included within the term "disease as described herein".
[0084] Use of Protein Kinase N Beta as a Medicament
[0085] In view of the surprising findings disclosed herein, protein
kinase N beta as such may be used as a medicament for the
prevention and/or treatment of the various diseases and diseased
conditions as described herein, and for the manufacture of a
medicament for such purpose and for the manufacture of a diagnostic
agent.
[0086] When protein kinase N beta or a fragment or derivative
thereof as defined above is used as a medicament itself, it is
preferably used as a competitor to the naturally occurring protein
kinase N beta, thereby preventing the normal biological function
thereof. It is particularly preferred that the protein kinase N
beta used for that purpose is catalytically defective. This kind of
protein kinase N beta may either be applied to the organism and
cell, respectively, or may be introduced into the organism and
respective cells by means of gene therapy.
[0087] Use of Protein Kinase N Beta as a Target
[0088] Apart from being a potential drug itself, protein kinase N
beta may be used as a target against which chemical compounds which
may be used as drugs or drug candidates or as diagnostic agents,
are directed. Suitable chemical compounds belonging to different
classes of compounds such as antibodies, peptides, anticalines,
aptamers, spiegelmers, ribozymes, antisense oligonucleotides and
siRNA as well as small molecules may be used. The compounds are
designed, selected, screened generated and/or manufactured by
either using protein kinase N beta itself as a physical or chemical
entity, or information related to protein kinase N beta.
[0089] In the design, selection, screening, generation and/or
manufacturing process of said classes of compounds protein kinase N
beta will also be referred to as the target which is used in the
process rather than in the final application of the respective
compound to a patient in need thereof. In the processes which
provide the various classes of compounds, either the protein
protein kinase N beta, also referred to herein as protein kinase N
beta or a nucleic acid coding for protein kinase N beta may be
used. The term protein kinase N beta as used herein comprises any
fragment or derivative of protein kinase N beta which allows the
design, selection, screening, generation and/or manufacture of said
classes of compounds of the respective class(es) of compounds which
in turn are/is upon their/its application as a medicament or as a
diagnostic agent active as such.
[0090] The term nucleic acid coding for protein kinase N beta as
used herein shall comprise any nucleic acid which contains a
nucleic acid which codes for protein kinase N beta as defined
above, or a part thereof. A part of a nucleic acid coding for
protein kinase N beta is regarded as such as long as it is still
suitable for the design, selection, screening, generation and/or
manufacture of said classes of compounds which in turn are/is upon
their/its application as a medicament or as a diagnostic agent
active as such. The nucleic acid coding for protein kinase beta N
may be genomic nucleic acid, hnRNA, mRNA, cDNA or part of each
thereof.
[0091] As outlined above it is within the present invention that
apart from protein kinase N beta or a part or derivative thereof or
a nucleic acid sequence therefore, as described herein, also other
means or compounds may be used in order to create or to suppress
the effects arising from protein kinase N beta or the nucleic acid
coding protein kinase N beta. Such means may be determined or
selected in a screening method. In such screening method a first
step is to provide one or several so called candidate compounds.
Candidate compounds as used herein are compounds the suitability of
which is to be tested in a test system for treating or alleviating
the various diseases as described herein and diseased conditions as
described herein or to be used as a diagnostic means or agent for
this kind of diseases and diseased conditions.
[0092] If a candidate compound shows a respective effect in a test
system said candidate compound is a suitable means or agent for the
treatment of said diseases and diseased conditions and, in
principle, as well a suitable diagnostic agent for said diseases
and diseased conditions. In a second step the candidate compound is
contacted with a protein kinase N beta expression system or a
protein kinase N beta gene product, preferably a respective gene
expression product, such as a hnRNA or MRNA, or a protein kinase N
beta activity system or a protein kinase N beta. The protein kinase
N beta activity system is also referred to herein as and/or is
preferably also active in the meaning of a system detecting the
activity of protein kinase N beta.
[0093] The protein kinase N beta screening methodology described
herein also is useful to eliminate non-functional or inactive
compounds from further consideration. Thus protein kinase N beta
activity can be measured in a first sample obtained from a subject
or test system, generating a pre-treatment level, followed by
administering a test agent to the subject or test system and
measuring protein kinase N beta activity in a second sample from
the subject or test system at a time following administration of
the test agent, thereby generating data for a test level. The
pre-treatment level can be compared to the test level, and data
showing no decrease in the test level relative to the pre-treatment
level indicates that the test agent is not effective in the
subject, and the test agent may be eliminated from further
evaluation or study. Conversely, a change in values can indicate
that the test agent is suitable for use as a PKN beta inhibitor or
for further study.
[0094] A protein kinase N beta expression system as that term is
used herein is basically an expression system that shows or
displays the expression of protein kinase N beta, whereby the
extent or level of expression may be changed. Preferably, a protein
kinase N beta activity system is essentially an expression system
whereby the activity or condition of activity is measured rather
than the expression of protein kinase N beta. Alternatively, a
protein kinase activity system is a protein kinase N beta the
activity of which can be measured, or a system providing or
comprising protein kinase N beta.
[0095] Detection and Inhibition of Protein Kinase N Beta
Activity
[0096] In any of these systems it is determined whether under the
influence of a candidate compound the activity of protein kinase N
beta or of the nucleic acid coding protein kinase N beta is
different from the situation without the candidate compound.
Regardless whether the particular system is either an expression
system or an activity system, it is within the scope of the present
invention that either an increase or a decrease of the activity and
expression, respectively, may occur and be measured. Typically, the
expression system and/or activity system is an in vitro reaction,
such as a cell extract or a fraction of the cell extract such as a
nuclear extract. A protein kinase N beta expression system as used
herein may also be a cell, preferably a cell of a tissue or organ
involved in the diseases as described herein and diseased
conditions as described herein.
[0097] Whether there is an increase or decrease in the activity
system or expression system may be determined at each level of the
expression, for example by measuring the increase or decrease of
the amount of nucleic acid coding for protein kinase N beta, more
particularly mRNA, or the increase or decrease of protein kinase N
beta polypeptide expressed under the influence of the candidate
compound. The techniques required for such measurements, more
particularly the quantitative measurement of these kinds of
changes, such as for the MRNA or the protein are known to the one
skilled in the art. Also known to the one skilled in the art are
methods to determine the amount of or content of protein kinase N
beta, e.g. by detection using appropriate antibodies. Antibodies
may be generated as known to the one skilled in the art and
described, e.g. by Harlow, E., and Lane, D., "Antibodies: A
Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.,(1988). Suitable antibodies may also be generated by
other well known methods, for example, by phage display selection
from libraries of antibodies.
[0098] In case of a protein kinase N beta expression system an
increase or decrease of the activity of protein kinase N beta may
be determined, preferably in a functional assay.
[0099] Contacting the candidate compound and the expression system
and activity system, respectively, usually is performed by adding
an aqueous solution of the candidate compound to a respective
reaction system which is generally referred to herein as the test
system. Besides aqueous solutions, suspensions or solutions of the
candidate compound in organic solvents or in mixtures of organic
and aqueous solvents may be used. The aqueous solution is
preferably a buffer solution.
[0100] Preferably, in each run using the expression system and
activity system, respectively, only a single candidate compound is
used. However, it is also within the present invention that several
of this kind of tests are performed in parallel in a high
throughput system using methods known in the art.
[0101] A further step in the method according to the present
invention resides in determining whether under the influence of the
candidate compound the expression or activity of the expression
system and activity system, respectively, in relation to protein
kinase N beta or a nucleic acid coding therefore is changed.
Typically this is done by comparing the system's reaction upon
addition of the candidate compound relative to the one without
addition of the candidate compound. Preferably, the candidate
compound is a member of a library of compounds.
[0102] Basically any library of compounds is suitable for the
purpose of this invention regardless of the class of compounds.
Suitable libraries of compounds are, among others, libraries
composed of small molecules, of peptides, proteins, antibodies,
anticalines and functional nucleic acids. The latter compounds may
be generated as known to the one skilled in the art and outlined
herein.
[0103] Antibodies
[0104] The manufacture of an antibody specific for the protein of
protein kinase N beta or for the nucleic acid coding for protein
kinase N beta, is known to the one skilled in the art and, for
example, described in Harlow, E., and Lane, D., "Antibodies: A
Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.,(1988). Monoclonal antibodies may be used in
connection with the present invention which may be manufactured
according to the protocol of Cesar and Milstein and further
developments based thereon, for example by selection from antibody
libraries by, for example, phage display. See for example, U.S.
Pat. No. 5,969,108, the disclosure of which is hereby incorporated
by reference in its entirety. Antibodies as used herein, include,
but are not limited to, complete antibodies, antibody fragments or
derivatives such as Fab fragments, Fc fragments and single-stranded
antibodies, as long as they are suitable and capable of binding to
protein kinase N beta. Apart from monoclonal antibodies also
polyclonal antibodies may be used and/or generated. The generation
of polyclonal antibodies is also known to the one skilled in the
art and, for example, described in Harlow and Lane supra.
Preferably, the antibodies used for therapeutic purposes are
humanized or human antibodies as defined above.
[0105] The antibodies which may be used according to the present
invention may have one or several markers or labels. Such markers
or labels may be useful to detect the antibody either in its
diagnostic application or its therapeutic application. Preferably
the markers and labels are selected from the group comprising
avidine, streptavidine, biotin, gold and fluorescein and used,
e.g., in ELISA methods. These and further markers as well as
methods are, e.g. described in Harlow and Lane, supra.
[0106] It is also within the present invention that the label or
marker exhibits an additional function apart from detection, such
as interaction with other molecules. Such interaction may be, e.g.,
specific interaction with other compounds. These other compounds
may either be those inherent to the system where the antibody is
used such as the human or animal body or the sample which is
analysed by using the respective antibody. Appropriate markers may,
for example, be biotin or fluorescein with the specific interaction
partners thereof such as avidin and streptavidin and the like being
present on the respective compound or structure to interact with
the thus marked or labelled antibody.
[0107] Peptides
[0108] A further class of medicaments as well as diagnostic agents
which may be generated using the protein of protein kinase N beta
or the nucleic acid coding for protein kinase beta, are peptides
which bind thereto. Such peptides may be generated by using methods
according to the state of the art such as phage display. Basically,
a library of peptides is generated and displayed on the surface of
phage, and the displayed library is contacted with the target
molecule, in the present case, for example, the protein kinase N
beta. Those peptides binding to the target molecule are
subsequently removed, preferably as a complex with the target
molecule, from the respective reaction. It is known to the one
skilled in the art that the binding characteristics, at least to a
certain extend, depend on the particularly realized experimental
set-up such as the salt concentration and the like. After
separating those peptides binding to the target molecule with a
higher affinity or a bigger force, from the non-binding members of
the library, and optionally also after removal of the target
molecule from the complex of target molecule and peptide, the
respective peptide(s) may subsequently be characterized.
[0109] Prior to the characterisation optionally an amplification
step is realized such as, e.g. by propagating the peptide coding
phages. The characterization preferably comprises the sequencing of
the target binding peptides. Basically, the peptides are not
limited in their lengths, however, preferably peptides having a
lengths from about 8 to 20 amino acids are preferably obtained in
the respective methods. The size of the libraries may be about
10.sup.2 to 10.sup.18, preferably 10.sup.8 to 10.sup.15 different
peptides, however, is not limited thereto.
[0110] Anticalines
[0111] A particular form of target binding polypeptides are the
so-called "anticalines" which are, among others, described in
German patent application DE 197 42 706, the disclosure of which is
hereby incorporated by reference.
[0112] According to the present invention the protein of protein
kinase N beta as well as the nucleic acid coding for protein kinase
N beta may be used as the target for the manufacture or development
of a medicament for the treatment of the diseases described herein
and of the diseased conditions described herein, as well as for the
manufacture and/or development of means for the diagnosis of said
diseases and said conditions, in a screening process, whereby in
the screening process small molecules or libraries of small
molecules are used. This screening comprises the step of contacting
the target molecule with a single small molecule or a variety (such
as a library) of small molecules at the same time or subsequently,
preferably those from the library as specified above, and
identifying those small molecules or members of the library which
bind to the target molecules which, if screened in connection with
other small molecules may be separated from the non-binding or
non-interacting small molecules.
[0113] The binding and non-binding may strongly be influenced by
the particular experimental set-up. In modifying the stringency of
the reaction parameters it is possible to vary the degree of
binding and non-binding which allows a fine tuning of this
screening process. Preferably, after the identification of one or
several small molecules which specifically interact with the target
molecule, this small molecule may be further characterized. This
further characterisation may, for example, reside in the
identification of the small molecule and determination of its
molecule structure and further physical, chemical, biological
and/or medical characteristics. Preferably, the natural compounds
have a molecular weight of about 100 to 1000 Da. Also preferably,
small molecules are those which comply with the Lepinsky rules of
five known to the ones skilled in the art. Alternatively, small
molecules may also be defined such that they are
synthetic-small-molecule- s, preferably arising from combinatorial
chemistry, in contrast to natural products which preferably are
non-synthetic. However, it is to be noted that these definitions
are only subsidiary to the general understanding of the respective
terms in the art. Like all kinases, protein kinase N beta contains
an ATP-binding site and drugs that are known to bind to such sites
are therefore suitable candidate compounds for inhibiting protein
kinase N beta. Examples if suitable compounds include, but are not
limited to, Y-27632, Ro-3 1-8220, and HA 1077, all of which are
available from Calbiochem (La Jolla, Calif.).
[0114] Aptamers and Speigelmers
[0115] It is also within the present invention to use the protein
kinase N beta and/or a nucleic acid coding for protein kinase N
beta as a target molecule for the manufacture or selection of
aptamers and spiegelmers which may then be used directly or
indirectly either as medicament or as diagnostic agents.
[0116] Aptamers are D-nucleic acids which are either single
stranded or double stranded and which specifically interact with a
target molecule. The manufacture or selection of aptamers is, e.g.,
described in European patent EPO 533 838, the specification of
which is hereby incorporated by reference in its entirety.
Basically the following steps are realized. First, a mixture of
nucleic acids, i.e. potential aptamers, is provided whereby each
nucleic acid typically comprises a segment of several, preferably
at least eight, subsequent randomised nucleotides. This mixture is
subsequently contacted with the target molecule whereby the nucleic
acid(s) bind to the target molecule, such as based on an increased
affinity towards the target or with a bigger force thereto,
compared to the candidate mixture. The binding nucleic acid(s)
are/is subsequently separated from the remainder of the mixture.
Optionally, the nucleic acid(s) thus obtained is amplified using,
e.g. a polymerase chain reaction. These steps may be repeated
several times giving at the end a mixture having an increased ratio
of nucleic acids specifically binding to the target from which the
final binding nucleic acid is then optionally selected. These
specifically binding nucleic acid(s) are referred to aptamers.
[0117] It is apparent that at any stage of the method for the
generation or identification of the aptamers samples of the mixture
of individual nucleic acids may be taken to determine the sequence
thereof using standard techniques. It is within the present
invention that the aptamers may be stabilized -such as, e.g., by
introducing defined chemical groups which are known to the one
skilled in the art of generating aptamers. Such modification may
for example reside in the introduction of an amino group at the
2'-position of the sugar moiety of the nucleotides. Aptamers are
currently used as therapeutical agents.
[0118] However, it is also within the present invention that the
thus selected or generated aptamers may be used for target
validation and/or as lead substance for the development of
medicaments, preferably of medicaments based on small molecules.
This is actually done by a competition assay whereby the specific
interaction between the target molecule and the aptamer is
inhibited by a candidate drug whereby upon replacement of the
aptamer from the complex of target and aptamer it may be assumed
that the respective drug candidate allows a specific inhibition of
the interaction between target and aptamer, and if the interaction
is specific, said candidate drug will, at least in principle, be
suitable to block the target and thus decrease its biological
availability or activity in a respective system comprising such
target. The small molecule thus obtained may then be subject to
further derivatisation and modification to optimise its physical,
chemical, biological and/or medical characteristics such as
toxicity, specificity, biodegradability and bioavailability.
[0119] The generation or manufacture of spiegelmers which may be
used or generated according to the present invention using protein
kinase N beta or a nucleic acid coding for protein kinase N beta,
is based on a similar principle. The manufacture of spiegelmers is
described in the international patent application WO 98/08856.
Spiegelmers are L-nucleic acids, which means that they are composed
of L-nucleotides rather than aptamers which are composed of
D-nucleotides as aptamers are. Spiegelmers are characterized by the
fact that they have a very high stability in biological system and,
comparable to aptamers, specifically interact with the target
molecule against which they are directed. In the purpose of
generating spiegelmers, a heterogonous population of D-nucleic
acids is created and this population is contacted with the optical
antipode of the target molecule, in the present case for example
with the D-enantiomer of the naturally occurring L-enantiomer of
the protein kinase N beta. Subsequently, those D-nucleic acids are
separated which do not interact with the optical antipode of the
target molecule. However, those D-nucleic acids interacting with
the optical antipode of the target molecule are separated,
optionally determined and/or sequenced and subsequently the
corresponding L-nucleic acids are synthesized based on the nucleic
acid sequence information obtained from the D-nucleic acids. These
L-nucleic acids which are identical in terms of sequence with the
aforementioned D-nucleic acids interacting with the optical
antipode of the target molecule, will specifically interact with
the naturally occurring target molecule rather than with the
optical antipode thereof. Similar to the method for the generation
of aptamers it is also possible to repeat the various steps several
times and thus to enrich those nucleic acids specifically
interacting with the optical antipode of the target molecule.
[0120] Ribozymes, Antisense Oligonucleotides and siRNA.
[0121] A further class of compounds which may be manufactured or
generating based on protein kinase N beta or a nucleic acid coding
for protein kinase beta, as the target molecule as disclosed
herein, are ribozymes, antisense oligonucleotides and siRNA.
[0122] It is a common feature of all of the aforementioned nucleic
acids that they do not interact with the target molecule at the
level of the translation product which is in the present case the
protein kinase N beta, but rather interact with the transcription
product, i.e. the nucleic acid coding for protein kinase beta such
as the genomic nucleic acid or any nucleic acid derived therefrom
such as the corresponding hnRNA, cDNA and MRNA, respectively.
Insofar, the target molecule of the aforementioned class of
compounds is preferably the mRNA of protein kinase N beta.
[0123] Ribozymes
[0124] Ribozymes are catalytically active nucleic acids which
preferably consist of RNA which basically comprises two moieties.
The first moiety shows a catalytic activity whereas the second
moiety is responsible for the specific interaction with the target
nucleic acid, in the present case the nucleic acid coding for
protein kinase N beta. Upon interaction between the target nucleic
acid and the second moiety of the ribozyme, typically by
hybridisation and Watson-Crick base pairing of essentially
complementary stretches of bases on the two hybridising strands,
the catalytically active moiety may become active which means that
it catalyses, either intramolecularly or intermolecularly, the
target nucleic acid in case the catalytic activity of the ribozyme
is a phosphodiesterase activity. Subsequently, there may be a
further degradation of the target nucleic acid which in the end
results in the degradation of the target nucleic acid as well as
the protein derived from the said target nucleic acid which in the
present case is protein kinase N beta due to a lack of newly
synthesized protein kinase N beta and a turn-over of prior existing
protein kinase N beta. Ribozymes, their use and design principles
are known to the one skilled in the art, and, for example described
in Doherty and Doudna (Ribozyme structures and mechanism. Annu Rev.
Biophys. Biomolstruct. 2001; 30 :457-75) and Lewin and Hauswirth
(Ribozyme Gene Therapy: Applications for molecular medicine. 20017:
221-8).
[0125] Antisense Oligonucleotides
[0126] The use of antisense oligonucleotides for the manufacture of
a medicament and as a diagnostic agent, respectively, is based on a
similar mode of action. Basically, antisense oligonucleotides
hybridise based on base complementarity, with a target RNA,
preferably with a mRNA, thereby activating RNase H. RNase H is
activated by both phosphodiester and phosphorothioate-coupled DNA.
Phosphodiester-coupled DNA, however, is rapidly degraded by
cellular nucleases but phosphorothioate-coupled DNA is more stable.
These resistant, non-naturally occurring DNA derivatives do not
inhibit RNase H upon hybridisation with RNA. In other words,
antisense polynucleotides are only effective as DNA RNA hybrids
complexes. Examples for this kind of antisense oligonucleotides are
described, among others, in U.S. Pat. Nos. 5,849,902 and 5,989,912.
In other words, based on the nucleic acid sequence of the target
molecule which in the present case is the nucleic acid coding for
protein kinase N beta, either from the target protein from which a
respective nucleic acid sequence may in principle be deduced, or by
knowing the nucleic acid sequence as such, particularly the mRNA,
suitable antisense oligonucleotides may be designed base on the
principle of base complementarity.
[0127] Particularly preferred are antisense-oligonucleotides which
have a short stretch of phosphorothioate DNA (3 to 9 bases). A
minimum of 3 DNA bases is required for activation of bacterial
RNase H and a minimum of 5 bases is required for mammalian RNase H
activation. In these chimeric oligonucleotides there is a central
region that forms a substrate for RNase H that is flanked by
hybridising "arms" comprised of modified nucleotides that do not
form substrates for RNase H. The hybridising arms of the chimeric
oligonucleotides may be modified such as by 2'-O-methyl or
2'-fluoro. Alternative approaches used methylphosphonate or
phosphoramidate linkages in said arms. Further embodiments of the
antisense oligonucleotide useful in the practice of the present
invention are P-methoxyoligonucleotides, partial
P-methoxyoligodeoxyribonucleotides or
P-methoxyoligonucleotides.
[0128] Of particular relevance and usefulness for the present
invention are those antisense oligonucleotides as more particularly
described in the above two mentioned U.S. patents. These
oligonucleotides contain no naturally occurring 5'.fwdarw.3'-linked
nucleotides. Rather the oligonucleotides have two types of
nucleotides: 2'-deoxyphosphorothioate, which activate RNase H, and
2'-modified nucleotides, which do not. The linkages between the
2'-modified nucleotides can be phosphodiesters, phosphorothioate or
P-ethoxyphosphodiester. Activation of RNase H is accomplished by a
contiguous RNase H-activating region, which contains between 3 and
5 2'-deoxyphosphorothioate nucleotides to activate bacterial RNase
H and between 5 and 10 2'-deoxyphosphorothioate nucleotides to
activate eucaryotic and, particularly, mammalian RNase H.
Protection from degradation is accomplished by making the 5' and 3'
terminal bases highly nuclease resistant and, optionally, by
placing a 3' terminal blocking group.
[0129] More particularly, the antisense oligonucleotide comprises a
5' terminus and a 3' terminus; and from 11 to 59
5'.fwdarw.3'-linked nucleotides independently selected from the
group consisting of 2'-modified phosphodiester nucleotides and
2'-modified P-alkyloxyphosphotriester nucleotides; and wherein the
5'-terminal nucleoside is attached to an RNase H-activating region
of between three and ten contiguous phosphorothioate-linked
deoxyribonucleotides, and wherein the 3'-terminus of said
oligonucleotide is selected from the group consisting of an
inverted deoxyribonucleotide, a contiguous stretch of one to three
phosphorothioate 2'-modified ribonucleotides, a biotin group and a
P-alkyloxyphosphotriester nucleotide.
[0130] Also an antisense oligonucleotide may be used wherein not
the 5' terminal nucleoside is attached to an RNase H-activating
region but the 3' terminal nucleoside as specified above. Also, the
5' terminus is selected from the particular group rather than the
3' terminus of said oligonucleotide.
[0131] Suitable and useful antisense oligonucleotides are also
those comprising a 5' terminal RNase H activating region and having
between 5 and 10 contiguous deoxyphosphorothioate nucleotides;
between 11 to 59 contiguous 5'.fwdarw.3'-linked
2'-methoxyribonucleotides; and an exonuclease blocking group
present at the 3' end of the oligonucleotide that is drawn from the
group consisting of a non-5 '-3'-phosphodiester-linked nucleotide,
from one to three contiguous 5'-3'-linked modified nucleotides and
a non-nucleotide chemical blocking group.
[0132] Two classes of particularly preferred antisense
oligonucleotides can be characterized as follows:
[0133] The first class of antisense oligonucleotides, also referred
to herein as second generation of antisense oligonucleotides,
comprises a total of 23 nucleotides comprising in 5'.fwdarw.3'
direction a stretch of seven 2'-O-methylribonucleotides, a stretch
of nine 2'-deoxyribonucleotides, a stretch of six
2'-O-methylribonucleotides and a 3'-terminal
2'-deoxyribonucleotide. From the first group of seven
2'-O-methylribonucleotides the first four are phosphorothioate
linked, whereas the subsequent four 2'-O-methylribonucleotides are
phosphodiester linked. Also, there is a phosphodiester linkage
between the last, i.e. the most 3 '-terminal end of the
2'-O-methylribonucleotides and the first nucleotide of the stretch
consisting of nine 2'-deoxyribonucleotides. All of the
2'-deoxyribonucleotides are phosphorothioate linked. A
phosphorothioate linkage is also present between the last, i.e. the
most 3 '-terminal 2 '-deoxynucleotide, and the first 2
'-O-methylribonucleotid- e of the subsequent stretch consisting of
six 2'-O-methylribonucleotides. From this group of six
2'-O-methylribonucleotides the first four of them, again in
5'.fwdarw.3' direction, are phosphodiester linked, whereas the last
three of them, corresponding to positions 20 to 22 are
phosphorothioate linked. The last, i.e. terminal 3'-terminal
2'-deoxynucleotide is linked to the last, i.e. most 3'-terminal
2'-O-methylribonucleotide through a phosphorothioate linkage.
[0134] This first class may also be described by reference to the
following schematic structure: RRRnnnnNNNNNNNNNnnnRRRN. Hereby, R
indicates phosphorothioate linked 2'-O-methyl ribonucleotides (A,
G, U, C); n stands for 2'-O-methyl ribonucleotides (A, G, U, C); N
represents phosphorothioate linked deoxyribonucleotides (A, G, T,
C).
[0135] The second class of particularly preferred antisense
oligonucleotides, also referred to herein as third generation (of)
antisense oligonucleotides or GeneBlocs, also comprises a total of
17 to 23 nucleotides with the following basic structure (in
5'.fwdarw.3' direction).
[0136] At the 5'-terminal end there is an inverted abasic
nucleotide which is a structure suitable to confer resistance
against exonuclease activity and, e.g., described in WO 99/54459.
This inverted abasic is linked to a stretch of five to seven
2'-O-methylribonucleotides which are phosphodiester linked.
Following this stretch of five to seven 2'-O-methylribonucleotides
there is a stretch of seven to nine 2'-deoxyribonucleotides all of
which are phosphorothioate linked. The linkage between the last,
i.e. the most 3'-terminal 2'-O-methylribonucleotide and the first
2'-deoxynucleotide of the 2'-deoxynucleotide comprising stretch
occurs via a phosphodiester linkage. Adjacent to the stretch of
seven to nine 2'-deoxynucleotides a stretch consistent of five to
seven 2'-O-methylribonucleotides S is connected. The last
2'-deoxynucleotide is linked to the first 2'-O-methylribonucleotide
of the latter mentioned stretch consisting of five to seven
2'-O-methylribonucleotides occurs via a phosphorothioate linkage.
The stretch of five to seven 2'-O-methylribonucleotides are
phosphodiester linked. At the 3'-terminal end of the second stretch
of five to seven 2'-O-methylribonucleotide another inverted abasic
is attached.
[0137] This second class may also be described by reference to the
following schematic structure: (GeneBlocs representing the 3rd
generation of antisense oligonucleotides have also the following
schematic structure:)
cap-(n.sub.p).sub.x(N.sub.s).sub.y(n.sub.p).sub.z-cap or
cap-nnnnnnnNNNNNNNNnnnnnnn-cap. Hereby, cap represents inverted
deoxy abasics or similar modifications at both ends; n stands for
2'-O-methyl ribonucleotides (A, G, U, C); N represents
phosphorothioate-linked deoxyribonucleotides (A, G, T, C); x
represents an integer from 5 to 7; y represents an integer from 7
to 9; and z represents an integer from 5 to 7.
[0138] It is to be noted that the integers x, y and z may be chosen
independently from each other although it is preferred that x and z
are the same in a given antisense oligonucleotide. Accordingly, the
following basic designs or structures of the antisense
oligonucleotides of the third generation can be as follows:
cap-(n.sub.p).sub.5(N.sub.s).sub.7(n.- sub.p).sub.5-cap,
cap-(n.sub.p).sub.6(N.sub.s).sub.7(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.7(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.5(N.sub.s).sub.8(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.6(N.sub.s).sub.8(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.8(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.5(N.sub.s).sub.9(n.sub.p)s-cap,
cap-(n.sub.p).sub.6(NS)- .sub.9(n.sub.p)S-cap,
cap-(n.sub.p).sub.7(NS)g(n.sub.p).sub.5-cap,
cap-(n.sub.p).sub.5(NS).sub.7(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.6(N.s- ub.s).sub.7(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.7(n.sub.p- ).sub.6-cap,
cap-(n.sub.p).sub.5(N.sub.s).sub.8(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.6(N.sub.s).sub.8(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.8(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.5(N.sub.s).sub.9(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.6(N.sub.s).sub.9(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.9(n.sub.p).sub.6-cap,
cap-(n.sub.p).sub.5(N.sub.s).sub.7(n.sub.p).sub.7-cap,
cap-(n.sub.p).sub.6(N.sub.s).sub.7(n.sub.p).sub.7-cap,
cap-(n.sub.p).sub.7(N.sub.s).sub.7(n.sub.p).sub.7cap,
cap-(n.sub.p).sub.5(NS)s(n.sub.p).sub.7-cap,
cap-(n.sub.p).sub.6(N.sub.s)- .sub.8(n.sub.p).sub.7-cap,
cap-(n.sub.p).sub.7(N.sub.s)g(n.sub.p).sub.7-ca- p,
cap-(n.sub.p).sub.5(N.sub.s).sub.9(n.sub.p).sub.7-cap,
cap-(n.sub.p).sub.6(N.sub.5).sub.9(n.sub.p).sub.7-cap and
cap-(n.sub.p).sub.7(NS).sub.9(n.sub.p).sub.7-cap.
[0139] siRNA Molecules and RNAi
[0140] A further class of compounds which may be generated based on
the technical teaching given herein and which may be used as
medicaments and/or diagnostic agents are small interfering RNA
(siRNA) directed to the nucleic acid, preferably MRNA, coding for
protein kinase N beta. siRNA is a double stranded RNA having
typically a length of about 21 to about 23 nucleotides. The
sequence of one of the two RNA strands corresponds to the sequence
of the target nucleic acid such as the nucleic acid coding for
protein kinase N beta, to be degraded. In other words, knowing the
nucleic acid sequence of the target molecule, in the present case
protein kinase N beta, preferably the MRNA sequence, a double
stranded RNA may be designed with one of the two strands being
complementary to said, e.g. MRNA of protein kinase N beta and, upon
application of said siRNA to a system containing the gene, genomic
DNA, hnRNA or MRNA coding for protein kinase N beta, the respective
target nucleic acid will be degraded and thus the level of the
respective protein be reduced. The basic principles of designing,
constructing and using said siRNA as medicament and diagnostic
agent, respectively, is, among others, described in international
patent applications WO 00/44895 and WO 01/75164.
[0141] Based on the aforementioned design principles, it is
possible to generate such siRNA, antisense oligonucleotide and
ribozyme, respectively, once the nucleic acid sequence coding for
protein kinase N beta is known. This is also true for precursor
molecules of nucleic acid such as hnRNA, cDNA and the like,
including genomic nucleic acid. Of course, also knowing the
respective antisense strand may allow the design of such nucleic
acid based compounds given the basic principle of base pair
complementarity, preferably based on Watson-Crick base pairing.
Accordingly, a further aspect of the present invention is related
to specific siRNAs, ribozymes and antisense nucleotides which are
directed against or specific for protein kinase N-beta. In the
following, this is further illustrated by siRNA, however, this
applies to antisense oligonucleotides and ribozymes as well, as
will be acknowledged by the ones skilled in the art.
[0142] Such siRNA comprises preferably a length of from 15 to 25
nucleotides, whereby this means actually any length comprising 15,
16, 17, 18, 20, 21, 22, 23, 24 or 25 nucleotides. In further
embodiments, the siRNA may even exhibit more nucleotides. According
the design principles well known in the art, respective siRNA can
be generated. Accordingly, the siRNA claimed herein comprises a
stretch of preferably any nucleotide length from 15 to 25
consecutive nucleotides which is either at least partially
complementary to the sense or to the antisense strand encoding
PKN-beta, and a second ribonucleotide strand which is at least
partially complementary to the first one and thus to the antisense
strand and sense strand respectively, encoding protein kinase
N-beta. Any design principle known in the art of generation or
manufacture of siRNA may be applied to this kind of duplex
structure. The siRNA space disclosed herein comprises siRNA
molecules the antisense strand of which starts with a nucleotides
which corresponds to nucleotide no. 1 of a PKN-beta encoding
sequence as specified above. Further such siRNA molecules start
with a nucleotide which corresponds to-nucleotide no 2 of a
PKN-beta encoding sequence as specified above, and so on. This kind
of scanning over the PKN-beta encoding sequence is repeated so as
to provide all possible siRNA molecules which can be directed
against PKN-beta. The length of any of the siRNA molecules thus
generated may be any length suitable for siRNA, more particularly
any length as specified above. Preferably, the various siRNA
molecule of the siRNA molecule space disclosed herein, overlap
except the most 5'terminal nucleotide of the antisense strand or
sense strand. It is obvious that the thus obtained antisense
sequences have to complemented through base pairing so as to form
the at least partially double-stranded structure required for a
functionally active siRNA
[0143] Pharmaceutical and Diagnostic Compositions
[0144] Based on the mode of action of the aforementioned classes of
compounds, such as antibodies, peptides, anticalines, aptamers,
spiegelmers, ribozymes, antisense oligonucleotides as well as
siRNA, it is thus also within the present invention to use any of
these compounds targeting protein kinase N beta and the nucleic
acid coding therefore, respectively, for the manufacture of a
medicament or a diagnostic agent for any of the diseases as
described herein and any of the diseased conditions described
herein. Furthermore, these agents may be used to monitor the
progression of said diseases and diseased conditions and the
success of any therapy applied, respectively.
[0145] The various classes of compounds designed according to the
present invention such as antibodies, peptides, anticalines, small
molecules, aptamers, spiegelmers, ribozymes, antisense
oligonucleotides and siRNA may also be contained in a
pharmaceutical composition. Preferably such pharmaceutical
composition is used for the treatment of the diseases as described
herein or the diseased conditions described herein. The
pharmaceutical composition may comprise in an embodiment one or
several of the aforementioned classes of compounds and/or one or
more members of a single class, and optionally a further
pharmaceutical active compound, and a pharmaceutically acceptable
carrier. Such carrier may be either liquid or solid, for example a
solution, a buffer, an alcoholic solution or the like. Suitable
solid carriers are, among others, starch and the like. It is known
to the one skilled in the art to provide respective formulations
for the various compounds according to the aforementioned classes
of compounds in order to realize the particular route of
administrations such as oral, parenteral, subcutaneous,
intravenous, intramuscular and the like.
[0146] The various compounds of the different classes of compounds
as mentioned above, may also be, either alone or in combination,
subject to or contained in a kit. Such kit comprises apart from the
respective compound(s) additionally one or several further elements
or compounds whereby the elements are selected from the group
comprising buffers, negative controls, positive controls and
instructions on the use of the various compounds. Preferably, the
various compounds are present in either dry or liquid form,
preferably as a unit dosage for a single administration each. The
kit may particularly be used for the therapy, diagnosis or
monitoring of the progress of the disease or applied therapies in
relation to the diseases and diseased conditions as described
herein.
[0147] The invention is further exemplified by the following
examples, which are not limiting of the scope of the invention.
EXAMPLE 1
[0148] Materials and Methods
[0149] Cell Culture
[0150] Human prostate carcinoma PC-3 cells were obtained from the
American Type Culture Collection (ATCC). Cells were cultured in
FI2K Nutrient Mixture (Kaighn's modification) containing, 10% fetal
calf serum (CS), gentamycin (50 .mu.g/ml) and amphotericin (50
ng/ml).
[0151] Transfections were carried out in 96 well or 10-cm plates
(at 30% to 50% confluency) by using various cationic lipids such as
Oligofectarnine, Lipofectamine (Life Technologies), Argfectin50 or
Profectin50 (Atugen/GOT Berlin, Germany), or FuGene 6 (Roche)
according to the manufacturer's instructions. GeneBlocs were
transfected by adding pre-formed 5.times. concentrated complex of
GeneBloc and lipid in serum-free medium to cells in complete
medium. The total transfection volume was 100 .mu.l for cells
plated in 96 wells and 10 ml for cells in 10 cm plates. The final
lipid concentration was 0.8 to 1.2 .mu.g/ml depending on cell
density; the GeneBloc concentration is indicated in each
experiment.
[0152] Cultivated cells were trypsinized and harvested following
stopping the trypsin effect by medium. The cells were washed (PBS;
Centrifugation 5 min/1.000 rpm) and, finally, the pellet was
resuspended at a concentration that depended on the cell number and
volume to be inoculated.
[0153] Determination of the Relative Amounts of RNA Levels by
Taqman Analysis.
[0154] RNA from cells transfected in 96-wells was isolated and
purified using the Invisorb RNA HTS 96 kit (InVitek GmbH, Berlin).
Inhibition of PKN beta mRNA expression was detected by real time
RT-PCR (Taqman) analysis using 300 nM PKNbeta 5' primer, 300 nM
PKNbeta 3' primer and 100 nM of the PKNbeta Taqman probe Fam-Tainra
labelled. The reaction was carried out in 50 gl and assayed on the
ABI PRISM 7700 Sequence detector (Applied Biosystems) according to
the manufacturer's instructions under the following conditions:
48.degree. C. for 30 min, 95.degree. C. for 10 min, followed by 40
cycles of 15 sec at 95.degree. C. and 1 min at 60.degree. C.
[0155] In Vitro Growth on Matrigel Matrix.
[0156] PC3 cells were tretated with 5 .mu.M LY294002 or DMSO when
seeded on Matrigel. If cells were trnasfected previous to seeding
cells were transfected with GeneBloc and trypsinized 48 h post
transfection. The cells were washed in medium and seeded into
duplicate 24-wells (100.000 cells per well) pre-coated with 250
.mu.l matrigel basement membrane matrix (Becton Dickinson). After
incubation for 24 to 72 h photographs were taken at 5.times.
magnification with an Axiocam camera attached to an Axiovert S100
microscope (Zeiss).
[0157] Affymetrix
[0158] Total RNA from cells grown on Matrigel was prepared using
Totally RNA kit (AMBION) following manufacturers protocol. In the
final step precipitated total RNA was resuspended in Invisorb lysis
buffer and purified using the Invisorb spin cell-RNA kit (INVITEK).
Biotin-labeled cRNA was prepared following Affymetrix protocols and
15 .mu.g cRNA were hybridized onto Affymetrix GeneChip set
HG-U95.
[0159] Data Analysis
[0160] Raw data were analyzed using Affymetrix GeneChip software
Microarray Suite v4.0. The intensity of each probe set is
calculated as difference of the hybridization signal of perfect
match oligonucleotides compared to mismatch oligonucleotides
averaged over the set of 16 to 20 probe pairs corresponding to one
transcript. The average difference of a probe set is proportional
to the abundance of a transcript. Total signal intensities of
different arrays were scaled to the same value before comparison.
Fold changes were calculated using the Affymetrix software by
pairwise comparison of the intensities of corresponding probe pairs
from experiment and baseline arrays. Using decision matrices
described by Affymetrix the software also generates absolute calls
(transcript is absent, marginal or present in an experiment) and
difference calls (abundance of a transcript in one experiment
compared to another: increase, marginal increase, no change,
marginal decrease, decrease). Results were exported to Microsoft
Excel (absolute call, difference call, fold change) and filtered.
All probe sets with absent calls or a no change call were discarded
and the table sorted by the fold change.
[0161] Animal Studies
[0162] The in vivo experiments were conducted corresponding the
Good Laboratory Practice for Nonclinical Laboratory Studies (GLP
Regulations) of the Food and Drug Administration and in accordance
with the German animal protection law as legal basis.
[0163] Male Shoe:NMRI-nu/nu mice (Tierzucht Sch6nwalde GmbH)
maintained under SPF conditions (Laminar air flow equipment,
Scantainer, Scanbur) served as recipients for the human prostate
carcinoma cells. The animals, aged 6-8 weeks and weighing 28-30 g,
were inoculated 2.times.10.sup.6/0,03 ml tumor cells into both, the
left dorsolateral lobe of the prostatic gland (iprost; Orthotopic)
or the tip of the Lobus lateralis sinister of the liver (ihep;
Ectopic). For this purpose, the mice received a total body
anaesthesia using a mixture of Ketanest (Parke-Davis GmbH) and
Rompun (Bayer Vital GmbH) 80:1 with dosages of 100 mg/kg and 5
mg/kg, respectively. Following the thorough sterilization of the
ventral body surface an incision was carried out through the
abdominal skin and peritoneal wall beginning near the border of the
preputial gland and measuring about 1 cm. By means of a pair of
tweezers and a cotton swab the prostatic gland was visualized. The
orthotopic cell challenges followed with the help of a magnifying
glas and by usage of a 1 ml syringe (Henke Sass Wolf GmbH) bearing
30G 0,30.times.13 microlance needles (Becton Dickinson). An
administration was successful observing a marked bleb at the
inoculation site. The wound was closed by suture material (PGA
Resorba, Franz Hiltner GmbH) concerning the peritoneal wall and
Michel clamps 11.times.2 mm (Heiland) for the abdominal skin. Wound
spray (Hansaplast Spruhpflaster, Beiersdorf AG) covered the lesion.
During the postsurgical phase the animals were maintained in a
warmed environment until the complete waking up. The animals were
randomised according to the number of treatment groups consisting
of 5-10 animals per group each. They were inspected successively
inclusive of protocolling the findings. Ssniff NM-Z, 10 mm,
autoclavable (ssniff Spezialdiaten GmbH) is administered as
fortified diet and drinking water is acidified by HCl, both ad
libitum.
[0164] Evaluations
[0165] To receive the actual dosage level body weights were
registered on the treatment days. At the same time, it can be
derived from body weight development to recognize influences of
treatment modalities on the whole organism.
[0166] Blood punctures were carried out on day 0 (Base line); 14;
28; and 35 (Sacrificing). Blood was drawn from the orbital vein of
the short term anaesthesized animal (Diethylether, Otto Fischar
GmbH). Evaluation parameters giving data to the compatibility and
side effects of the treatments are the following: Leukocyte
numbers; Thrombocyte numbers; Enzymes. Further blood borne
parameters were bilirubin; creatinine; protein; urea; uric
acid.
[0167] All sacrificed animals were completely dissected and
photographically documented. Tumors (Prostatic gland) and
metastases (Caudal, lumbar, renal lymph node metastases) were
measured in two dimensions by means of a pair of callipers. The
volume was calculated according to V (mm.sup.3)=ab.sup.2/2 with
b<a. In general, the cell number performed for therapy
approaches causes a 100% tumor take concerning the prostatic gland.
The weights of some organs (Liver; Spleen; Kidney) were registered
in order to find out additional data concerning the knowledge about
secondary side effects.
[0168] For histological analysis samples of tumor tissues, i.e.
prostate tumor and lymph node metastases, were fixed in 5%
formaldehyde and paraffin embedded. Routinely, the sections were HE
stained, if necessary specific stainings were made (Azan, PAS).
[0169] To detect the human origin of tumor and metastatic cells
adequate tissue samples were frozen in liquid nitrogen. When using
PCR and Taqman analysis with huHPRT specific amplicon we could
detect 50 human cells in Smg tissue.
[0170] The therapeutic results were statistically verified by the
u-test of Mann and Whitney.
EXAMPLE 2
[0171] Experimental Proof-Of-Concept on the Suitability of
Downstream Drug Targets
[0172] As outlined in the introductory part of this specification
which is incorporated herein by reference, targets linked
downstream to a signalling pathway are valuable for the design or
development of both medicaments and diagnostic agents. It is
obvious that, if the particular target is linked to different other
pathways or due to its position within the signalling pathway is
linked to a number of biological phenomena such as, e.g. metastasis
and migration, growth translation apoptosis, cell cycle, DNA repair
and the like as in the case of PI-3 kinase, any compound addressing
this target is likely to have a number of side effects which may be
detrimental to the system and undesired from the medical point of
view. Accordingly, targets that act further downstream should be
the first choice for therapeutic intervention.
[0173] The present inventors have found that under the control of
the PI 3-kinase pathway further possible drug targets apart from
mTOR are involved, which are specific for controlling the phenomena
of metastasis and migration and thus tumorigenesis. In the
pharmaceutical industry it has been found that rapamycin, sold
under the trade name of Rapamune is suitable to inhibit metastasis
and migration. This confirms the suitability of the strategy to
address downstream drug targets.
[0174] As may be taken from FIG. 2 rapamycin is suitable to reduce
the volume of lymphnode metastasis and is insofar comparable in its
effect to the well known PI 3-kinase inhibitor LY294002. As
depicted in FIG. 2 A the tumor take model was used and treatment
with Rapamune started on day 1. Both concentrations used, i.e. 0.4
mg/kg/dose-2 mg/kg/dose led to a tremendous decrease of the extent
of lymphnode metastasis, expressed as measured volume of metastasis
(mm.sup.3) compared to the negative control which was phosphate
buffered saline.
[0175] For histological analysis samples of tumor tissues, i.e.
prostate tumor and lymph node metastases, were fixed in 5%
formaldehyde and paraffin embedded. Routinely, the sections were HE
stained, if necessary specific stainings were made (Azan, PAS).
[0176] The same results were basically also obtained in case of
Rapamune treatment of an established tumor model with the treatment
starting on day 28.
[0177] Lymph node metastasis in an orthotopic PC-3 mouse model
after treatment with rapamycin (Rapamune) was measured. In FIG. 2
(A) the results of the (A), tumor take model are shown. Nude
Shoe:NMRI--nu/nu mice (8 per group) were injected with
2.times.10.sup.6 PC3 cells in 0.03 ml intraprostatic and treatment
was carried out using Rapamune intraperitoneally daily for 28 days
at doses of 2 mg/kg and 0.4 mg/kg. PBS served as a control.
[0178] For the treatment of established tumors (B), cells were
allowed to grow ipros for 28 days and treatment was carried out
orally using Rapamune on days 29 to 50 after implantation. Doses
were chosen as outline in A. Animals were sacrificed on day 29 and
51, respectively and total lymph node metastasis were
determined
EXAMPLE 3
[0179] Identification of PKN Beta as Downstream Drug Target Within
the PI 3-Kinase Pathway
[0180] The basic experimental approach is shown in FIG. 3. PC3
cells grown on Matrigel were either treated with DMSO or the PI 3-K
inhibitor LY294002 and total RNA was isolated from each sample.
Differential Affymetrix gene expression profiling was performed and
expression was confirmned using real time RT-PCR Taqman assay.
p110.alpha. was used as a non-differential standard. PC3 cells are
PTEN -/- which means that the tumor suppressor PTEN is factually
lacking in these cells so that the PI 3-kinase pathway is
permanently activated which leads to an increased metastatic
activity or behaviour of the cells which is expressed by their
growth pattern in the matrigel assay. Cells with invasive growth
potential exhibit enhanced growth on basement membrane such as
matrigel matrix. (Petersen, O. W., Ronnov-Jessen, L., Howlett, A.
R. and Bissell, M. J. (1992) Interaction with basement membrane
serves to rapidly distinguish growth and differentiation pattern of
normal and malignant human breast epithelial cells. Proc Natl Acad
Sci USA, 89, 9064-9068. (Auch: Stemberger et al., 2002 Antisense
& Nucleic acid drug development 12:131-143)
[0181] In connection therewith it is to be noted that the PC3 cells
were grown on matrigel and taken this as a model system which is
close to the in vivo environment the RNA isolated therefrom is
assumed to be closer to the in situ situation or results than any
preparation obtained from cells grown in a non-matrigel environment
such as a conventional cell culture plate.
EXAMPLE 4
[0182] Screening for Optimum Antisense Oligonucleotides Directed to
Protein Kinase N Beta.
[0183] PC3 cells were transfected with different GeneBloc
concentrations as described and mRNA levels were determined 24 hrs
post transfection using Taqman assays with 300 nM of PKNbeta
specific forward and reverse primer and 100 nM probe and 40 nM
forward and reverse primer and 100 nM probe for human .beta.-actin.
mRNA levels are standardized to internal actin levels and amounts
are shown relative to GBC (cells transfected with a Gene Bloc
Control).
[0184] The result thereof is shown in FIG. 4. From FIG. 4 as
particularly advantageous antisense oligonucleotides GeneBlocs
70210 and 70211 were selected for further studies.
[0185] In connection with the GeneBloc as used herein in the
various examples it is to be noted that they are all third
generation antisense oligonucleotide as specified herein which
means, as also obvious from table 1, that the upper case letters
represent the deoxyribonucleotides which were linked through a
phosphorothioate rather than a phosphodiester linkage
1TABLE 1 Overview of the various GeneBlocs used, their alias,
mismatches relative to the target nucleic acid and their sequence
and structured characteristics GeneBloc No Alias MM Sequence 70669
PKNbeta:706L21 0 ggagguCCAGTTTCTgagagg 70670 PKNbeta:377L21 0
uguuucACCTTCAGCuccaca 24536 PKNbeta:2021L23 0
aggacaaCACAAGCCAcgtagaa 24537 PKNbeta:2665L23 0
gctctgaCACAAAGTCgaagtcc 24538 PKNbeta:2322L23 0
gcagtcaAACACCTCTtcctctg 70210 PKNbeta:1034L21 0
caacacGGTTGTCCAccttta 70211 PKNbeta:1784L21 0 tcagtgCTTTGATGGcgtagt
70671 PKNbeta:183L21 0 cuucucGCAGTACAGgcucuc 70676 PKNbeta:1034L21
4 caagacGCTTGTGCAcgttta 70677 PKNbeta:1784L21 4
tcagagCTTAGTTGGcgttgt
[0186] The various GeneBlocs correspond to the following SEQ. ID.
Nos:
2 70669: SEQ. ID. No. 3 70670: SEQ. ID. No. 4 24536: SEQ. ID. No. 5
24537: SEQ. ID. No. 6 24538: SEQ. ID. No. 7 70210: SEQ. ID. No. 8
70211: SEQ. ID. No. 9 70671: SEQ. ID. No. 10 70676: SEQ. ID. No. 11
70677: SEQ. ID. No. 12
[0187] In addition it is to be noted that any of the "t" above are
actually "u" given the fact that the above antisense
oligonucleotides are GeneBlocs, i.e. third generation antisense
oligonucleotides.
EXAMPLE 5
[0188] Selective Knock Down of Protein Kinase N Beta
[0189] In order to prove that protein kinase N beta is a suitable
downstream drug target of the PI 3-kinase pathway the two
particularly advantageous GeneBlocs as obtained from example 4 were
used in a matrigel based growth experiment. The matrigel growth
experiment is taken as a surrogate model which shows the metastasis
and migration behaviour of the respective cell. A more confluent
growth of the cells is taken as an indication that their metastasis
and migration behaviour is increased which allows the cells to
spread over the three-dimensional structure provided by the
matrigel.
[0190] PC3 cells were transfected and seeded on matrigel as
described and growth was monitored. siRNA was isolated from an
aliquot of the cells seeded on matrigel and analysed using Taqman
assay (left panel). PKNbeta specific mRNA was standardized to
endogenous p110.alpha. mRNA levels. A PTEN specific GeneBloc is
used as a negative control in the PTEN.sup.-/- PC-3 cells and a
p110.beta. specific GeneBloc is used as a positive control for
growth in extracellular matrix. Specific growth inhibition is shown
by comparing growth of cells treated with PKN beta specific
GeneBloc 70210 or 70211 versus their corresponding mismatched
oligonucleotides 70676 and 70677, respectively.
[0191] The respective results are also illustrated in FIG. 5. From
this it may be taken that the gene block 70211 and 70210 may be
suitable compounds for the manufacture of a medicament or
diagnostic agent for the treatment of diseases and diseased
conditions as described herein.
EXAMPLE 6
[0192] RNA Interference by Transient Expression of siRNA in HeLaB
Cells
[0193] This experiment is an example of the successful design of
siRNA which allows that specifically the downstream drug target
protein kinase N beta is addressed. As illustrated in FIG. 6 (A)
siRNA molecules were generated by promoter (U6+2) driven expression
of target specific sequences (template derived from gene of
interest containing a 21-mer sense and reverse complementary
sequences linked by 12-mer poly A stretch. Upon transcription RNAs
are likely to form double-stranded siRNA molecules.
[0194] The various constructs such as p110beta and PTEN were used
as positive and negative control, respectively in the same vector
construct as the siRNA designed against the mRNA sequence of
PKNbeta. The respective design is shown in FIG. 6 (B) were the
template sequences of targeted genes for siRNA expression were
introduced into expression vectors carrying the U6+2 promoter
cassette.
[0195] The constructs were transiently expressed by transfection
into HeLaB cells for RNAi interference experiments. Cells were
harvested 48 hour after transfected and subsequently seeded (80000
cells per well) on matrigel. The effect of RNA interference on the
expression of corresponding genes was analyzed by assaying
transfected cells for growth/proliferation on matrigel. Expression
of siRNA targeted to PTEN had no affect on HeLaB cell growth on
matrigel (right panel), whereas expression of siRNA specific to p11
Obeta and PKNbeta severely disturbed the behaviour of HeLaB growth
on matrigel (middle and right panels).
[0196] In view of this, the particular siRNA sequence proves to be
an efficient means for the treatment of the disease and disease
conditions as disclosed herein.
EXAMPLE 7
[0197] Detection of Protein Kinase N Beta in Human Prostate
Tumor
[0198] In order to give further evidence that protein kinase N beta
is a suitable target in the treatment of prostate tumor, respective
human prostate tissue was subjected to in situ hybridisation.
[0199] For the in situ hybridisation both sense and antisense
strands were prepared from nucleotide positions 1672 to 2667 from
sequence NM 013355 in pCR4 Topo vector, whereupon T7 and T3
polymerase was used for amplification purposes. The human prostate
tumor cells (PC-3) were grown in mice. After dissection, the tissue
was frozen at -20.degree. C. in isopentane solution, slices cut at
-15.degree. C. and stored at -80.degree. C. Prior to hybridisation
slices were fixed in paraformaldehyde. Human tumor specimen were
fixed in paraformaldehyde and paraffine-embedded. Tumor specimens
were treated with proteinase K and acetylated. Nucleic acid probes
were double-labelled with .sup.35S-ATP and .sup.35S-UTP and
incubated with tissues at 58.degree. C. in a hybridisation buffer
(0.4 M NaCl, 50% formamide, 1.times. Denhardt's, 10 mM Tris, 1
mM_EDTA, 10% dextran sulfate, 10 .mu.g/ml of each tRNA and salmon
sperm DNA, 10 mM DTT) containing 50% formamide.
[0200] The result of the in situ hybridisation is depicted in FIG.
7. Using protein kinase N beta antisense probe for in situ
hybridisation of prostate tumor the glands are intensively stained
(FIG. 7A). In contrast to this, healthy prostate tissue is less
stained and provides for a background signal only, again using the
antisense probe (FIG. 7C). In contrast to this, the use of the
sense probe in connection with both tissues, did not provide any
signal.
EXAMPLE 8
[0201] In Vivo Reduction of Primary Tumor and Lymph Node Metastases
by siRNA
[0202] This example is related to target gene validation in vivo
using an orthotopic prostate tumor model in which it could be shown
that by using siRNA directed to protein kinase N beta a reduction
of both primary tumor and lymph node metastases could be realised.
The results are depicted in FIGS. 8A to 8C.
[0203] In the diagram of FIG. 8A the volume of primary tumors,
determined as described in example 1, in an orthotopic prostate
tumor model could be significantly reduced using any of the
following two siRNA constructs:
3 5'actgagcaagaggctttggag or 5'aaattccagtggttcattcca.
[0204] As negative control siRNA against p110-.alpha. subunit was
used and as positive control siRNA against p110-.beta. subunit. The
positive control thus addresses the upstream regulator of protein
kinase N beta PTEN.
[0205] A further set of two independent siRNA molecules was used
for degrading the MRNA encoding for protein kinase N beta in lymph
node metastases. Lymph node metastases are secondary tumors found
in the following lymph nodes: Caudal, Lumbar, Renal and mediastinal
lymph nodes whereby caudal lymph nodes are closest to the prostate
and mediastinal lymph nodes are most distanct to the implantation
tumor. As in the case of the primary tumor, the siRNA constructs
were obviously successfully reducing the mRNA coding for protein
kinase N beta and thus reducing the tumor volume (FIG. 8B).
Positive and negative controls were as discussed in connection with
the reduction of primary tumor.
[0206] In both cases, i.e. for primary tumor and lymph node
metastases, the human prostate tumor cells were genetically
engineered to express the respective siRNA molecules from a
polymerase III U6 promoter.
[0207] Apart from these results, a clear phenotypic analysis as
depicted in FIG. 8C1 and FIG. 8C2 shows that upon activation of the
transcription of the siRNA construct in the human prostate tumor
cells, lymph node metastases could be significantly reduced and the
swollen lymph node depicted in FIG. 8C1 is not present in the
tissue treated with siRNA as depicted in FIG. 8C2.
EXAMPLE 9
[0208] Functional Characterisation of the Protein Kinase N Beta
[0209] This example is related to the functional characterisation
of protein kinase N beta and more particularly to the impact of
derivatisation, i.e. truncation or mutation of fluctional amino
acid residues, of protein kinase N beta on its kinase activity and
on the regulation of its kinase activity by phosphorylation.
[0210] The following protein kinase N beta derivatives were
generated as also at least partially depicted schematically in FIG.
9C with the amino acid residues referring to the wild type sequence
as disclosed herein:
[0211] a) kinase domain comprising amino acids 535-889;
[0212] b) AN comprising amino acids 288-889;
[0213] c) kinase domain having a mutation at position 588 from
lysine to arginine;
[0214] d) kinase domain having a mutation at position 588 from
lysine to glutamic acid;
[0215] derivatives of the kinase domain having mutations at the
phosphorylation site (AGC activation loop consensus) with the
threonine residue at amino acid position 718 being either changed
to alanine (TA718) or to aspartic acid or glutamic acid (TD718 or
TE718); and
[0216] full length wildtype PKNbeta molecule (889 amino acids).
[0217] The respective fragments were transiently epressed in HeLa
cells. Their relative expression was determined by Western-blot
analysis of Hela cell extracts using an anti-PKNbeta antibody.
[0218] The polyclonal anti-PKNbeta antiserum was generated after
overexpressing the C-terminal amino acids (609-889)of PKNbeta in E.
coli. The respective protein fragment was gel-purified from
inclusion bodies, recovered and concentrated according to standard
procedures.
[0219] Protein kinase N beta has homologies to AGC-type kinase
molecules in its catalytic domain at the C-terminus. The family of
kinases is characterised by a conserved threonine residue in the
activation loop of the catalytic domain that needs to be
phosphorylated for enzymatic activity. Due the high conservation of
this threonine and the surrounding amino acid context in the
activation loop, anti-phospho antibodies against this site are
available from commercial sources. The respective antibodies are
referred to as anit-P*-PRK in FIG. 9 and as anti-P*-AGC kinase in
FIG. 10.
[0220] MPB is myelin basic protein which is a standard in vitro
phosphorylation substrate.
[0221] The following results were obtained:
4 Protein kinase N beta derivative Activity Full length wt ++*
Kinase domain comprising amino acids 535-889 +* .DELTA.N comprising
amino acids 288-889 -* Kinase domain having a mutation at position
588 from lysine to -* arginine (KR 588) Kinase domain having a
mutation at position 588 from lysine to -* glutamic acid (KR 588)
TA718 -* TD718 or TE718 -*! * +active -inactive !no "hyper
activation" was observed as one might have expected from comparable
mutations in other kinases (Morgan and Debond, 1994)
[0222] The results are depicted in FIG. 9.
[0223] FIG. 9A shows a gel analysis of different protein kinase N
beta derivatives and their activities using MPB as a standard
phosphorylation substrate upon transient overexpression in HeLa
cells. As may be taken from FIG. 9A apart from the full-length
protein kinase N beta only the kinase domain in its otherwise
wildtype form is active in phosphorylating MPB.
[0224] Using the same protein kinase N beta derivatives it can be
observed that except the derivative comprising kinase domain having
the mutation T/A at position 718, all other derivatives displayed
were also phosphorylated regardless of their further intrinsic
activities.
[0225] The data indicates that the presence of a functional kinase
domain and phosphorylation at position 718 are pre-requisites for
PKNbeta kinase activity. However, as can be concluded from the
inability of the AN version to act as a kinase, they are not
sufficient. The data also indicates that PKNbeta does not
autophosphorylate at amino acid 718, but instead, requires
phosphorylation by another kinase molecule, since the kinase
defective KR588 mutant protein retains phosphorylation at position
718.
EXAMPLE 10
[0226] Characterization of Full Length PKNbeta
[0227] In order to analyse mutations of functional amino acid
residues of protein kinase N beta in the context of the full length
molecule, the following experiments were carried out as shown in
FIGS. 10 and 11:
[0228] For measuring the kinase activity of PKNbeta in vitro,
recombinant HA- or Myc-tagged PKNbeta derivatives were transiently
expressed in HeLa or COS-7 cells. The smaller kinase domain
derivative served as a control. The cell extracts containing the
recombinant versions of protein kinase N beta were probed in
parallel with anti-protein kinase N-beta antibody (FIG. 1OA) as
described in example 9 to demonstrate comparable expression levels,
and an anti-phospho AGC site antibody (also referred to as
anti-P*-AGC-kinase) (FIG. 10B) to show the different degree of
phosphorylation of the protein kinase N beta derivatives in
vivo.
EXAMPLE 11
[0229] Phosphorylation Requirements for the Activity of Full Length
Protein Kinase N Beta and Development of a Non-Radioactive
In-Vitro-Kinase Assay--Suitability of Protein Kinase N Beta for HTS
Assays
[0230] The PKNbeta-derived molecules were immune-precipitated from
the cell extracts shown in FIG. 10 by using anti-tag antibodies.
The immune precipitates were washed as described (Klippel et al.,
1996) and divided in two halfs. One half was incubated with 5 .mu.g
MBP (UBI) as a phosphorylation substrate, 4 mM MgCl.sub.2 and gamma
.sup.32P-ATP in a buffered solution for 10 min at room temperature.
In addition, phosphatase inhibitors and inhibitors against
unspecifically acting kinases were added as in Klippel et al.,
1998. Incorporation of radioactive phosphate was detected by
autoradiography after separating the reaction products by 16%
SDS-PAGE (FIG. 11B).
[0231] The second half of the immune precipitates was incubated
with 1 .mu.g GST-GSK3 fusion protein (Cell Signaling Technology) as
a phosphorylation substrate in the presence of 200 .mu.M rATP. The
reaction mixture was subsequently analyzed by 8-16% gradient
SDS-PAGE and Western blotting using the anti-phospho GSK3alpha
antibody (Cell Signaling Technology) (FIG. 11A). The filter was
then stripped and re-probed with anti-PKNbeta antiserum to confirm
the presence of comparable amounts of PKNbeta proteins in the
respective immune precipitates (FIG. 11C).
[0232] The specificity of the in vitro phosphorylation reactions
was controlled by analyzing kinase defective variants (e.g.
containing mutations in the ATP binding site, see above) in
parallel to active protein.
[0233] The lack of signal in case of the TA mutation variant at
amino acid 718 of protein kinase N beta otherwise being the full
length wildtype protein kinase N beta indicates that this amino
acid residue is indeed the position of phosphorylation detected by
the antibody (FIG. 10B). The fact that the kinase deficient
variants (KE or KR mutation as shown in FIG. 10 and FIG. 9,
respectively) are phosphorylated at this site indicates that
threonine 718 is not a substrate for autophosphorylation. Rather
another kinase in the cells must be responsible for phosphorylation
of this site; whereby PDK1 is a possible candidate.
[0234] Also, from this experiment in combination with the one of
example 9 it is revealed that phosphorylation of protein kinase N
beta at position 718 is pre-requisite for protein kinase N beta
activity; all mutations tested at this site prevented
phosphorylation and resulted in an inactive kinase molecule.
Insofar a particularly preferred protein kinase N beta which can be
used in connection with any aspects of the invention as disclosed
herein is a protein kinase N beta being phosphorylated at position
718 or a derivative thereof, including the derivative which
comprises the kinase domain only as described herein. The data
further indicates that also full length PKNbeta does not
autophosphorylate at amino acid 718, but instead, requires
phosphorylation by another kinase molecule, since the kinase
defective KE588 mutant protein retains phosphorylation at position
718.
[0235] As may be taken from FIG. 11, assaying the activity of
protein kinase N beta can be adapted into a format which allows the
screening of protein kinase N beta inhibitors into a high
throughput system.
[0236] In a first step, the suitability of a non-radioactive
screening formate was determined, whereby the various protein
kinase N beta derivatives as already discussed in connection with
example 10, were used for phosphorylating a suitable substrate.
Such substrate may, for example, be MBP or a GSK3 peptide which is
typically immobilised on a suitable carrier such as agarose- or
sepharose beads or on plastic surfaces. In the present case and as
depicted in FIG. 11A, the substrate is a GSK3-derived peptide fused
to paramyosin. The first row indicates that all of the various
assays using different protein kinase N beta derivatives actually
contained said derivatives. Only the full length wildtype protein
kinase N beta or the kinase domain as defined in example 9 were
suitable to phosphorylate the substrate. The phosphorylated
substrate in the present case was detected by anti-phospho GSK3
alpha antibody (mentioned above).
[0237] To make sure that the non-radioactive approach as depicted
in FIG. 11A is sensitive enough the radioactive approach was
carried out in parallel with half of the immune precipitates using
the MBP as a phosphorylation substrate. The efficacy of the kinase
activity can be taken from the amount of the generated
phosphorylated substrate as indicated by autoradiography upon
[.sup.32P] incorporation. As can be seen from FIGS. 11A and 11B,
the full length wildtype protein kinase N beta as well as the
kinase domain show activity, whereas no (FIG. 11A) or background
activity of unspecific kinases (FIG. 11B) were detected with the
full length KE and full length TA mutatant proteinss,
respectively.
[0238] To summarise, the use of both full length wildtype protein
kinase N beta as well as the kinase domain as disclosed herein, are
suitable targets or means for the design of a screening procedure
in HTS format. The respective steps would accordingly comprise
[0239] a) generating purified recombinant protein kinase N beta
protein by expression in a non-bacterial expression system such as
insect cell system (example for different kinase in Klippel et al.,
1997) in view of the fact that the protein needs to be
phosphorylated for exhibiting kinase activity, which cannot easily
be accomplished by expression in bacterial systems;
[0240] b) immobilisation of GSK3-derived substrate or similar
substrate, and incubating the substrate with purified protein
kinase N beta in the presence of rATP, MgCl.sub.2 and inhibitors in
a buffered solution;
[0241] c) detecting phosphorylation of the substrate by an
appropriate detection means such as an antibody like the
anti-phopho-GSK3 antibody optionally upon after serial washes and
further optionally subsequently developing in Delfia or Lance assay
systems (Perkin Elmer), whereby the phosphorylation site is bound
by a Europium-labelled antibody. The amount of bound Europium is
then quantitated by time-resolved fluorescence analysis.
EXAMPLE 12
[0242] Determination of the Expression Level of Endogenous
PKN-Beta
[0243] In this example experimental evidence is given that PKN-beta
is expressed in a P13-kinase dependent manner. The PI
3-kinase-dependent expression of PKNbeta RNA shown in FIG. 3 is
here further confirmed on protein level.
[0244] PC-3 cells were cultivated as described in example 1 herein.
Said PC-3 cells are PTEN -/-. HeLa cells were obtained from the
American Type Culture Collection (ATCC) and grown as described in
Sternberger et al. (2002). Transfections were carried out in 10-cm
plates (at 30% to 50% confluency) using Fugene 6 (Roche, Nutley,
N.J.) according to the manufacturer's instructions. Cultivated
cells were trypsinated and harvested following stopping the trypsin
effect by medium.
[0245] Both cell types, i.e. PC-3 cells and HeLa cells were treated
for the indicated times with 10 gM LY294002 or DMSO, whereby DMSO
was used as the solvent for LY294002 and, because of this, as
negative control.
[0246] The resulting extracts were fractionated by SDS-PAGE and
subsequently analysed by Western-blotting. The levels of the
indicated proteins such as p110, which served as a loading control,
endogenous PKN-beta and phosphorylated Akt were detected using the
respective antibodies. Phosphorylated Akt (P*-Akt) serves as a
control for the efficacy of the LY294002-mediated treatment.
[0247] The results are depicted in FIG. 12.
[0248] In PC-3 cells inhibition of PI-3-kinase caused a visible
reduction of endogenous PKNbeta expression after 24 h, the protein
levels were further reduced after 48 h treatment. In HeLa cells,
which express higher amounts of PKNbeta protein, this effect is
less dramatic, but reduced amounts can be detected after 48 h
treatment with LY294002.
[0249] From this it can be concluded, that P13-kinase controls the
expression of PKN-beta.
EXAMPLE 13
[0250] PKN-Beta Activity Requires P13-Kinase
[0251] Recombinant wildtype PKN-beta or derivatives of PKN-beta (as
described in FIGS. 10-11) were transiently expressed in HeLa cells.
Said derivatives were PKN-beta derivative TA and derivative KE as
described in example 10 herein. The PKN-beta was modified in each
case by a myc-tag as described above which allowed the
precipitation of PKN-beta and its derivatives using an anti-Myc
antibody.
[0252] For the assessment of the activity of PKN-beta an in vitro
kinase activity using the immune precipitates was carried out as
described above. Half of the precipitates were subjected to the in
vitro kinase reaction, the second half was analyzed by
Western-blotting using anti-phospho-PRK antibodies. The filter was
stripped and reprobed using the anti-PKN-beta antiserum.
Phospho-p70 S6 Kinase levels were analyzed from aliquots of cell
lysates, that were withdrawn earlier, to confirm the efficacy of
the LY294002 treatment even after only 3 h treatment. The
anti-phospho p70 antibody was obtained from Cell signaling.
[0253] As can be seen from FIG. 13 LY294002 treatment leads to
strong inhibition of the kinase activity of PKNbeta, measured here
again by phosphorylation of MBP. This effect was visible after only
3 h of treatment, at 24 h PKNbeta activity was almost completely
inhibited. The phosphorylation of PKNbeta at position 718 was also
compromised after inhibition of PI 3-kinase by LY294002, however,
this effect was less pronounced than the effect on the kinase
activity.
[0254] The TA derivative of PKN-beta serves as inactive control as
shown above, and as control for the specificity of the anti-phospho
PRK antibody for phospho-threonine at position 718 (P*-PK)
[0255] PKN-beta derivative KE serves as kinase-deficient control as
described above. Its phosphorylation status appeared also to some
extent affected by LY294002 treatment. This indicates that the
kinase, which is responsible for phosphorylating PKNbeta at
position 718, does so in a PI 3-kinase-dependent fashion.
[0256] Most importantly, this experiment shows that PKNbeta is not
only regulated by PI 3-kinase via its expression level (see FIGS. 3
and 12), it is also regulated at its activation level. These
findings indicate that PKNbeta represents a "perfect" downstream
target for interference with a hyperactive PI 3-kinase pathway for
therapeutic intervention, since it is equisitely dependent on PI
3-kinase being regulated by it at various levels. This allows the
generation of compounds which exhibit a distinct effect on both the
protein PKN-beta and the nucleic acid coding therefor. Even more
important, this kind of activity modulation of PKN-beta at the
translation rather than transcription level, i.e. at the level of
the expressed protein, seems to be more prominent and longer
lasting than the impact at the transcription level.
[0257] The further screening method according to the present
invention is based on this particular insight and uses preferably
the radioactive or nonradioactive in vitro kinase assay as
read-out.
EXAMPLE 14
[0258] Localization Signals of PKN-Beta
[0259] In this experiment the localization of various PKN-beta
derivatives was compared to the localization of wildtype PKN-beta.
FIG. 14 shows pictures, whereby the cellular distribution of
PKNbeta and derivatives thereof such as PKN beta wildtype (FIG.
14A), PKN beta derivative TA (FIG. 14B), PKN beta derivative KE
(FIG. 14C) and PKN beta deltaN (FIG. 14D) was investigated by
confocal fluorescence microscopy. HA-tagged recombinant derivatives
of PKNbeta were transiently expressed in HeLa cells for 48 h. After
fixing and perneabilization, expression of the recombinant proteins
was detected by using an anti-HA antibody followed by an
FITC-conjugated anti-mouse antibody. The cells were counterstained
by labelling the cytoskeletal actin with rhodamin-phalloidin.
[0260] The results are depicted in FIGS. 14A to 14D, whereby the
respective picture on each left side of the duplex of the pictures
is related to a picture of cells upon FITC-specific excitation and
the right picture illustrates the same cells upon excitation using
a wavelength specific for Rhodamin-phalloidin. The FITC-staining
indicates cells transfected with the respective recombinant
protein. The Rhodamin-phalloidin staining shows transfected and
unstransfected cells.
[0261] As may be taken from FIG. 14A, wildtype PKN-beta localizes
predominantly to the nucleus of the cells. The phosphorylation site
mutant of PKN-beta TA and the KE mutant, both are kinase-deficient,
are no longer concentrated within the nucleus compared to wildtype
PKN-beta, but rather spread over the entire cell. Finally, as
depicted in FIG. 14D the PKN-beta derivative .DELTA.N, which lacks
the N-terminal third of the molecule and is also kinase-defective
(see FIG. 9), is essentially excluded from the nucleus.
[0262] These data indicate that proper nuclear localization of
PKNbeta to the nucleus is dependent on its ability to act as an
active kinase molecule and involves the presence of its N-terminal
domain. This implicates that PI-3 kinase might regulate also its
cellular localization.
[0263] The features of the present invention disclosed in the
specification, the sequence listing, the claims and/or the drawings
may both separately and in any combination thereof be material for
realizing the invention in various forms thereof.
Sequence CWU 1
1
12 1 889 PRT Homo sapiens MISC_FEATURE (1)..(889) protein kinase N
beta (PKN beta) 1 Met Glu Glu Gly Ala Pro Arg Gln Pro Gly Pro Ser
Gln Trp Pro Pro 1 5 10 15 Glu Asp Glu Lys Glu Val Ile Arg Arg Ala
Ile Gln Lys Glu Leu Lys 20 25 30 Ile Lys Glu Gly Val Glu Asn Leu
Arg Arg Val Ala Thr Asp Arg Arg 35 40 45 His Leu Gly His Val Gln
Gln Leu Leu Arg Ser Ser Asn Arg Arg Leu 50 55 60 Glu Gln Leu His
Gly Glu Leu Arg Glu Leu His Ala Arg Ile Leu Leu 65 70 75 80 Pro Gly
Pro Gly Pro Gly Pro Ala Glu Pro Val Ala Ser Gly Pro Arg 85 90 95
Pro Trp Ala Glu Gln Leu Arg Ala Arg His Leu Glu Ala Leu Arg Arg 100
105 110 Gln Leu His Val Glu Leu Lys Val Lys Gln Gly Ala Glu Asn Met
Thr 115 120 125 His Thr Cys Ala Ser Gly Thr Pro Lys Glu Arg Lys Leu
Leu Ala Ala 130 135 140 Ala Gln Gln Met Leu Arg Asp Ser Gln Leu Lys
Val Ala Leu Leu Arg 145 150 155 160 Met Lys Ile Ser Ser Leu Glu Ala
Ser Gly Ser Pro Glu Pro Gly Pro 165 170 175 Glu Leu Leu Ala Glu Glu
Leu Gln His Arg Leu His Val Glu Ala Ala 180 185 190 Val Ala Glu Gly
Ala Lys Asn Val Val Lys Leu Leu Ser Ser Arg Arg 195 200 205 Thr Gln
Asp Arg Lys Ala Leu Ala Glu Ala Gln Ala Gln Leu Gln Glu 210 215 220
Ser Ser Gln Lys Leu Asp Leu Leu Arg Leu Ala Leu Glu Gln Leu Leu 225
230 235 240 Glu Gln Leu Pro Pro Ala His Pro Leu Arg Ser Arg Val Thr
Arg Glu 245 250 255 Leu Arg Ala Ala Val Pro Gly Tyr Pro Gln Pro Ser
Gly Thr Pro Val 260 265 270 Lys Pro Thr Ala Leu Thr Gly Thr Leu Gln
Val Arg Leu Leu Gly Cys 275 280 285 Glu Gln Leu Leu Thr Ala Val Pro
Gly Arg Ser Pro Ala Ala Ala Leu 290 295 300 Ala Ser Ser Pro Ser Glu
Gly Trp Leu Arg Thr Lys Ala Lys His Gln 305 310 315 320 Arg Gly Arg
Gly Glu Leu Ala Ser Glu Val Leu Ala Val Leu Lys Val 325 330 335 Asp
Asn Arg Val Val Gly Gln Thr Gly Trp Gly Gln Val Ala Glu Gln 340 345
350 Ser Trp Asp Gln Thr Phe Val Ile Pro Leu Glu Arg Ala Arg Glu Leu
355 360 365 Glu Ile Gly Val His Trp Arg Asp Trp Arg Gln Leu Cys Gly
Val Ala 370 375 380 Phe Leu Arg Leu Glu Asp Phe Leu Asp Asn Ala Cys
His Gln Leu Ser 385 390 395 400 Leu Ser Leu Val Pro Gln Gly Leu Leu
Phe Ala Gln Val Thr Phe Cys 405 410 415 Asp Pro Val Ile Glu Arg Arg
Pro Arg Leu Gln Arg Gln Glu Arg Ile 420 425 430 Phe Ser Lys Arg Arg
Gly Gln Asp Phe Leu Arg Arg Ser Gln Met Asn 435 440 445 Leu Gly Met
Ala Ala Trp Gly Arg Leu Val Met Asn Leu Leu Pro Pro 450 455 460 Cys
Ser Ser Pro Ser Thr Ile Ser Pro Pro Lys Gly Cys Pro Arg Thr 465 470
475 480 Pro Thr Thr Leu Arg Glu Ala Ser Asp Pro Ala Thr Pro Ser Asn
Phe 485 490 495 Leu Pro Lys Lys Thr Pro Leu Gly Glu Glu Met Thr Pro
Pro Pro Lys 500 505 510 Pro Pro Arg Leu Tyr Leu Pro Gln Glu Pro Thr
Ser Glu Glu Thr Pro 515 520 525 Arg Thr Lys Arg Pro His Met Glu Pro
Arg Thr Arg Arg Gly Pro Ser 530 535 540 Pro Pro Ala Ser Pro Thr Arg
Lys Pro Pro Arg Leu Gln Asp Phe Arg 545 550 555 560 Cys Leu Ala Val
Leu Gly Arg Gly His Phe Gly Lys Val Leu Leu Val 565 570 575 Gln Phe
Lys Gly Thr Gly Lys Tyr Tyr Ala Ile Lys Ala Leu Lys Lys 580 585 590
Gln Glu Val Leu Ser Arg Asp Glu Ile Glu Ser Leu Tyr Cys Glu Lys 595
600 605 Arg Ile Leu Glu Ala Val Gly Cys Thr Gly His Pro Phe Leu Leu
Ser 610 615 620 Leu Leu Val Cys Phe Gln Thr Ser Ser His Ala Arg Phe
Val Thr Glu 625 630 635 640 Phe Val Pro Gly Gly Asp Leu Met Met Gln
Ile His Glu Asp Val Phe 645 650 655 Pro Glu Pro Gln Ala Arg Phe Tyr
Val Ala Cys Val Val Leu Gly Leu 660 665 670 Gln Phe Leu His Glu Lys
Lys Ile Ile Tyr Arg Asp Leu Lys Leu Asp 675 680 685 Asn Leu Leu Leu
Asp Ala Gln Gly Phe Leu Lys Ile Ala Asp Phe Gly 690 695 700 Leu Cys
Lys Glu Gly Ile Gly Phe Gly Asp Arg Thr Ser Thr Phe Cys 705 710 715
720 Gly Thr Pro Glu Phe Leu Ala Pro Glu Val Leu Thr Gln Glu Ala Tyr
725 730 735 Thr Gln Ala Val Asp Trp Trp Ala Leu Gly Val Leu Leu Tyr
Glu Met 740 745 750 Leu Val Gly Glu Cys Pro Phe Pro Gly Asp Thr Glu
Glu Glu Val Phe 755 760 765 Asp Cys Ile Val Asn Met Asp Ala Pro Tyr
Pro Gly Phe Leu Ser Val 770 775 780 Gln Gly Leu Glu Phe Ile Gln Lys
Leu Leu Gln Lys Cys Pro Glu Lys 785 790 795 800 Arg Leu Gly Ala Gly
Glu Gln Asp Ala Glu Glu Ile Lys Val Gln Pro 805 810 815 Phe Phe Arg
Thr Thr Asn Trp Gln Ala Leu Leu Ala Arg Thr Ile Gln 820 825 830 Pro
Pro Phe Val Pro Thr Leu Cys Gly Pro Ala Asp Leu Arg Tyr Phe 835 840
845 Glu Gly Glu Phe Thr Gly Leu Pro Pro Ala Leu Thr Pro Pro Ala Pro
850 855 860 His Ser Leu Leu Thr Ala Arg Gln Gln Ala Ala Phe Arg Asp
Phe Asp 865 870 875 880 Phe Val Ser Glu Arg Phe Leu Glu Pro 885 2
2670 DNA Homo sapiens mRNA (1)..(2670) mRNA / cDNA of PKN beta 2
atggaggagg gggcgccgcg gcagcctggg ccgagccagt ggcccccaga ggatgagaag
60 gaggtgatcc gccgggccat ccagaaagag ctgaagatca aggagggggt
ggagaacctg 120 cggcgcgtgg ccacagaccg ccgccacttg ggccatgtgc
agcagctgct gcggtcctcc 180 aaccgccgcc tggagcagct gcatggcgag
ctgcgggagc tgcacgcccg aatcctgctg 240 cccggccctg ggcctggccc
agctgagcct gtggcctcag gaccccggcc gtgggcagag 300 cagctcaggg
ctcggcacct agaggctctc cggaggcagc tgcatgtgga gctgaaggtg 360
aaacaggggg ctgagaacat gacccacacg tgcgccagtg gcacccccaa ggagaggaag
420 ctccttgcag ctgcccagca gatgctgcgg gacagccagc tgaaggtggc
cctgctgcgg 480 atgaagatca gcagcctgga ggccagtggg tccccggagc
cagggcctga gctactggcg 540 gaggagctac agcatcgact gcacgttgag
gcagcggtgg ctgagggcgc caagaacgtg 600 gtgaaactgc ttagtagccg
gagaacacag gaccgcaagg cactggctga ggcccaggcc 660 cagctacagg
agtcctctca gaaactggac ctcctgcgcc tggccttgga gcagctgctg 720
gagcaactgc ctcctgccca ccctttgcgc agcagagtga cccgagagtt gcgggctgcg
780 gtgcctggat acccccagcc ttcagggaca cctgtgaagc ccaccgccct
aacagggaca 840 ctgcaggtcc gcctcctggg ctgtgaacag ttgctgacag
ccgtgcctgg gcgctcccca 900 gcggccgcac tggccagcag cccctccgag
ggctggcttc ggaccaaggc caagcaccag 960 cgtggccgag gcgagcttgc
cagtgaggtg ctggctgtgc taaaggtgga caaccgtgtt 1020 gtggggcaga
cgggctgggg gcaggtggcc gaacagtcct gggaccagac ctttgtcatc 1080
ccactggagc gagcccgtga gctggagatt ggggtacact ggcgggactg gcggcagcta
1140 tgtggcgtgg ccttcctgag acttgaagac ttcctggaca atgcctgtca
ccaactgtcc 1200 ctcagcctgg taccgcaggg actgcttttt gcccaggtga
ccttctgcga tcctgtcatt 1260 gagaggcggc cccggctgca gaggcaggaa
cgcatcttct ctaaacgcag aggccaggac 1320 ttcctgaggc gttcgcagat
gaacctcggc atggcggcct gggggcgcct cgtcatgaac 1380 ctgctgcccc
cctgcagctc cccgagcaca atcagccccc ctaaaggatg ccctcggacc 1440
ccaacaacac tgcgagaggc ctctgaccct gccactccca gtaatttcct gcccaagaag
1500 acccccttgg gtgaagagat gacaccccca cccaagcccc cacgcctcta
cctcccccag 1560 gagccaacat ccgaggagac tccgcgcacc aaacgtcccc
atatggagcc taggactcga 1620 cgtgggccat ctccaccagc ctcccccacc
aggaaacccc ctcggcttca ggacttccgc 1680 tgcttagctg tgctgggccg
gggacacttt gggaaggtcc tcctggtcca gttcaagggg 1740 acagggaaat
actacgccat caaagcactg aagaagcagg aggtgctcag ccgggacgag 1800
atagagagcc tgtactgcga gaagcggatc ctggaggctg tgggctgcac agggcaccct
1860 ttcctgctct ccctccttgt ctgcttccag acctccagcc atgcccgctt
tgtgactgag 1920 tttgtgcctg gtggtgacct catgatgcag atccacgagg
atgtcttccc cgagccccag 1980 gcccgcttct acgtggcttg tgttgtcctg
gggctgcagt tcttacacga gaagaagatc 2040 atttacaggg acctgaagtt
ggataacctt ctgctggatg cccagggatt cctgaagatc 2100 gcagactttg
gactctgcaa ggaagggatc ggcttcgggg accggactag caccttctgt 2160
ggcaccccgg agttcctggc tcccgaggtg ctgacccagg aggcatacac acaggccgtc
2220 gactggtggg cgctgggtgt gctgctctac gagatgctgg tgggtgagtg
cccgttccca 2280 ggggacacag aggaagaggt gtttgactgc atcgtcaaca
tggacgcccc ctaccccggc 2340 tttctgtcgg tgcaagggct tgagttcatt
cagaagctcc tccagaagtg cccggagaag 2400 cgcctcgggg caggtgagca
ggatgccgag gagatcaagg tccagccatt cttcaggacc 2460 accaactggc
aagccctgct cgcccgcacc atccagcccc ccttcgtgcc taccctgtgt 2520
ggccctgcgg acctgcgcta ctttgagggc gagttcacag ggctgccgcc tgccctgacc
2580 ccacctgcac cccacagcct cctcactgcc cgccaacagg ccgccttccg
ggacttcgac 2640 tttgtgtcag agcgattcct ggaaccctga 2670 3 21 DNA
Artificial Sequence antisense oligonucleotide 3 ggagguccag
tttctgagag g 21 4 21 DNA Artificial Sequence antisense
oligonucleotide 4 uguuucacct tcagcuccac a 21 5 23 DNA Artificial
Sequence antisense oligonucleotide 5 aggacaacac aagccacgua gaa 23 6
23 DNA Artificial Sequence antisense oligonucleotide 6 gcucugacac
aaagtcgaag ucc 23 7 23 DNA Artificial Sequence antisense
oligonucleotide 7 gcagucaaac acctctuccu cug 23 8 21 DNA Artificial
Sequence antisense oligonucleotide 8 caacacggtt gtccaccuuu a 21 9
21 DNA Artificial Sequence antisense oligonucleotide 9 ucagugcttt
gatggcguag u 21 10 21 DNA Artificial Sequence antisense
oligonucleotide 10 cuucucgcag tacaggcucu c 21 11 21 DNA Artificial
Sequence antisense oligonucleotide 11 caagacgctt gtgcacguuu a 21 12
21 DNA Artificial Sequence antisense oligonucleotide 12 ucagagctta
gttggcguug u 21
* * * * *