U.S. patent application number 10/702755 was filed with the patent office on 2004-05-20 for compositions and methods for protecting animals from lentivirus-associated disease such as feline immunodeficiency virus.
This patent application is currently assigned to Pfizer Inc. Invention is credited to Deng, Ruitang, Sheppard, Michael G..
Application Number | 20040096460 10/702755 |
Document ID | / |
Family ID | 26793496 |
Filed Date | 2004-05-20 |
United States Patent
Application |
20040096460 |
Kind Code |
A1 |
Deng, Ruitang ; et
al. |
May 20, 2004 |
Compositions and methods for protecting animals from
lentivirus-associated disease such as feline immunodeficiency
virus
Abstract
The present invention is directed to a novel strain of feline
immunodeficiency virus, designated herein as FIV-141, and to
attenuated forms of the virus produced by mutating specific regions
of the viral genome. The virus and mutated forms of the virus may
be used to induce the production of antibodies to FIV-141, and in
vaccines designed to protect cats from FIV.
Inventors: |
Deng, Ruitang; (Old Lyme,
CT) ; Sheppard, Michael G.; (Stonington, CT) |
Correspondence
Address: |
PFIZER INC.
PATENT DEPARTMENT, MS8260-1611
EASTERN POINT ROAD
GROTON
CT
06340
US
|
Assignee: |
Pfizer Inc
|
Family ID: |
26793496 |
Appl. No.: |
10/702755 |
Filed: |
November 6, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10702755 |
Nov 6, 2003 |
|
|
|
09378810 |
Aug 23, 1999 |
|
|
|
60097645 |
Aug 24, 1998 |
|
|
|
Current U.S.
Class: |
424/199.1 ;
435/235.1; 435/351 |
Current CPC
Class: |
C12N 2740/15061
20130101; A61K 2039/5254 20130101; A61K 2039/51 20130101; C12N 7/00
20130101; C07K 14/005 20130101; A61K 39/00 20130101; C12N
2740/15021 20130101; C12N 2740/15022 20130101 |
Class at
Publication: |
424/199.1 ;
435/235.1; 435/351 |
International
Class: |
A61K 039/12; C12N
007/00; C12N 005/06 |
Claims
What is claim d is:
1. Substantially purified FIV-141 virus, wherein said virus has a
genomic nucleic acid sequence corresponding to SEQ ID NO:1.
2. A host cell infected with the virus of claim 1.
3. FIV-141 progeny virus produced in the host cell of claim 2.
4. A whole virus vaccine comprising the FIV-141 virus of claim 1,
wherein said virus has been inactivated, and a pharmaceutically
acceptable carrier.
5. A substantially purified virus having a genomic nucleic acid
sequence which is a degenerate variant of a nucleotide sequence
corresponding to SEQ ID NO:1.
6. A substantially purified nucleic acid molecule having a sequence
corresponding to SEQ ID NO:1.
7. A substantially purified nucleic acid molecule having a sequence
which is a degenerate variant of SEQ ID NO:1.
8. A host cell transfected with the nucleic acid of claim 6.
9. A fixed cell vaccine comprising a host cell infected with the
virus of claim 1, or transfected with the nucleic acid molecule of
claim 6, wherein said host cell has been fixed, and a
pharmaceutically acceptable carrier.
10. An attenuated FIV-141 virus which replicates upon entry into a
host cell but which exhibits significantly reduced infectivity to
feline T lymphocytes when compared to the wild type FIV-141 virus,
wherein said attenuated virus is produced by mutating one or more
genes in the FIV-141 genome, which genes are selected from the
group consisting of: Vif, MA, ORF(2), ENV, CA, NC, SU, TMf, CT, IN,
DU, V3/4, V7/8, and RRE.
11. The attenuated FIV-141 virus of claim 10, wherein the one or
more genes are selected from the group consisting of Vif, MA,
ORF(2), and ENV.
12. The attenuated FIV-141 virus of claim 10, wherein the one or
more genes are selected from the group consisting of Vif, MA,
ORF(2), ENV, TMf, V3/4, and IN.
13. The attenuated FIV-141 virus of claim 10, wherein at least two
genes in the FIV-141 genome have been mutated.
14. The attenuated FIV-141 virus of claim 13, wherein the ENV gene
is mutated and one or more other genes in the FIV-141 genome are
mutated.
15. The attenuated FIV-141 virus of claim 14, wherein the one or
more other genes are selected from the group consisting of IN, CA,
NC, Vif and ORF(2).
16. The attenuated FIV-141 virus of claim 13, wherein the genes to
be mutated comprise a combination selected from the group
consisting of: (i) MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; and (iv)
ENV/IN.
17. The attenuated FIV-141 virus of claim 16, wherein the mutated
genes comprise a combination selected from the group consisting of:
(i) MA del/TMf del; (ii) MA del/V3/4 del; (iii) MA del/Vif del; and
(iv) ENV del/IN del.
18. An attenuated virus which replicates upon entry into a host
cell but which exhibits significantly reduced infectivity to feline
T lymphocytes when compared to the wild type FIV-141 virus, wherein
said attenuated virus is produced by mutating one or more genes in
the genome of the virus of claim 5, which genes are selected from
the group consisting of: Vif, MA, ORF(2), ENV, CA, NC, SU, TMf, CT,
IN, DU, V3/4, V7/8, and RRE.
19. A host cell infected with the attenuated virus of claim 10.
20. An attenuated whole virus vaccine, comprising the virus of
claim 10 and a pharmaceutically acceptable carrier.
21. An attenuated host cell vaccine comprising the host cell of
claim 19, and a pharmaceutically acceptable carrier.
22. A substantially purified FIV-141 nucleic acid molecule having a
nucleotide sequence corresponding to SEQ ID NO:1, but wherein said
nucleic acid molecule is mutated in one or more genes selected from
the group consisting of Vif, MA, CA, NC, SU, TMf, ORF(2), CT, ENV,
Vifn, Vifc, IN, DU, V3/4, V7/8, and RRE, such that when the mutated
nucleic acid molecule has been introduced into a host cell, the
host cell produces a virus that replicates but that has
significantly reduced infectivity in peripheral blood mononuclear
cells (PBMCs) relative to wild type FIV-141 virus.
23. The nucleic acid molecule of claim 22, wherein said gene is
selected from the group consisting of: MA, Vif, ORF(2), and
ENV.
24. The nucleic acid molecule of claim 22, wherein said gene is
selected from the group consisting of: MA, Vif, ORF(2), ENV, TMf,
V3/4, and IN.
25. The nucleic acid molecule of claim 22, wherein at least two
genes in the FIV-141 genome have been mutated.
26. The nucleic acid molecule of claim 25, wherein the ENV gene is
mutated and one or more other genes in the FIV-141 genome are
mutated.
27. The nucleic acid molecule of claim 26, wherein the one or more
other genes are selected from the group consisting of IN, CA, NC,
Vif and ORF(2).
28. The nucleic acid molecule of claim 25, wherein the genes to be
mutated comprise a combination selected from the group consisting
of: (i) MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; and (iv) ENV/IN.
29. The nucleic acid molecule of claim 28, wherein the mutated
genes comprise a combination selected from the group consisting of:
(i) MA del/TMf del; (ii) MA del/V3/4 del; (iii) MA del/Vif del; and
(iv) ENV del/IN del.
30. A substantially purified nucleic acid molecule having a
nucleotide sequence which is a degenerate variant of a nucleotide
sequence corresponding to SEQ ID NO:1, but wherein said nucleic
acid molecule is mutated in one or more genes selected from the
group consisting of Vif, MA, CA, NC, SU, TMf, ORF(2), CT, ENV,
Vifn, Vifc, IN, DU, V3/4, V7/8, and RRE, such that when the mutated
nucleic acid molecule has been introduced into a host cell, the
host cell produces a virus that replicates but that has
significantly reduced infectivity in peripheral blood mononuclear
cells (PBMCs) relative to wild type FIV-141 virus.
31. A host cell transfected with the nucleic acid molecule of claim
22.
32. A vaccine comprising the nucleic acid molecule of claim 22 at a
concentration sufficient to induce immunity when administered to a
cat, and a pharmaceutically acceptable carrier.
33. A vaccine comprising the nucleic acid molecule of claim 30 at a
concentration sufficient to induce immunity when administered to a
cat, and a pharmaceutically acceptable carrier.
34. A vaccine comprising the host cell of claim 31, and a
pharmaceutically acceptable carrier.
35. The vaccine of claim 34, wherein said host cell has been
fixed:
36. A method of making an attenuated lentivirus that replicates in
host cells but that has significantly reduced infectivity relative
to its wild type counterpart, or a nucleic acid molecule encoding
said lentivirus, comprising mutating one or more genes of the
lentivirus selected from the group consisting of: MA, CA; NC, DU,
ENV, SU, TMf, CT, V3/4, V7/8, Vif, Vifn, Vifc, IN, RRE, and
ORF(2).
37. The method of claim 36, wherein the one or more genes are
selected from the group consisting of MA, ORF(2), and ENV.
38. The method of claim 36, wherein the one or more genes are
selected from the group consisting of: MA, ORF(2), ENV, TMf, V3/4,
Vif, and IN.
39. The method of claim 36, wherein at least two genes in the
lentivirus genome have been mutated.
40. The method of claim 39, wherein the ENV gene is mutated and one
or more other genes in the viral genome genome are mutated.
41. The method of claim 40, wherein the one or more other genes are
selected from the group consisting of IN, CA, NC, Vif and
ORF(2).
42. The method of claim 39, wherein the genes to be mutated
comprise a combination selected from the group consisting of: (i)
MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; and (iv) ENV/IN.
43. The method of claim 42, wherein the mutated genes comprise a
combination selected from the group consisting of: (i) MA del/TMf
del; (ii) MA del/V3/4 del; (iii) MA del/Vif del; and (iv) ENV
del/IN del.
44. The method of claim 36, wherein said lentivirus is a strain of
FIV.
45. An attenuated lentivirus produced by the method of claim
36.
46. A nucleic acid molecule encoding the attenuated lentivirus of
claim 45.
47. A host cell infected with the attenuated lentivirus of claim
45.
48. An attenuated whole virus vaccine, comprising the virus of
claim 45, and a pharmaceutically acceptable carrier.
49. An attenuated host cell vaccine, comprising the host cell of
claim 47, and a pharmaceutically acceptable carrier.
50. A vaccine comprising the nucleic acid molecule of claim 46 at a
concentration sufficient to induce immunity when administered to a
mammal, and a pharmaceutically acceptable carrier.
51. A method of producing a nucleic acid molecule suitable for use
in a vaccine for lentivirus infection, comprising: a) reverse
transcribing said lentivirus's genomic RNA; b) cloning the reverse
transcript of step (a); c) mutating one or more genes in the cloned
nucleic acid of step (b), wherein said genes are selected from the
group consisting of MA, CA, NC, SU, TMf, ORF(2), CT, ENV, V3/4,
V7/8, Vif, Vifn, Vifc, IN, DU, and RRE; and d) cloning the mutated
nucleic acid of step (c).
52. The method of claim 51, wherein the mutated molecule, upon
introduction into a host cell, produces an attenuated virus that
replicates but that has significantly reduced infectivity relative
to lentivirus made from the unmutated, wild type nucleic acid.
53. The method of claim 52, wherein said lentivirus is a strain of
FIV and said attenuated virus replicates but has significantly
reduced infectivity in feline T-lymphocytes relative to FIV made
from the unmutated, wild type nucleic acid.
54. The method of claim 51, wherein said gene is selected from the
group consisting of: MA, ORF(2), and ENV.
55. The method of claim 51, wherein said gene is selected from the
group consisting of: MA, Vif, ORF(2), ENV, TMf, V3/4, and IN.
56. The method of claim 51, wherein at least two genes in the
FIV-141 genome have been mutated.
57. The method of claim 56, wherein the ENV gene is mutated and one
or more other genes in the FIV-141 genome are mutated.
58. The method of claim 57, wherein the one or more other genes are
selected from the group consisting of IN, CA, NC, Vif and
ORF(2).
59. The method of claim 56, wherein the genes to be mutated
comprise a combination selected from the group consisting of: (i)
MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; and (iv) ENV/IN.
60. The method of claim 59, wherein the mutated genes comprise a
combination selected from the group consisting of: (i) MA del/TMf
del; (ii) MA del/V3/4 del; (iii) MA del/Vif del; and (iv) ENV
del/IN del.
61. A host cell transfected with a nucleic acid molecule prepared
by the method of claim 51.
62. A strain of feline immunodeficiency virus, having ATCC
accession No. VR2619, and progeny virus prepared therefrom.
63. A plasmid designated as pFIV-141-B1, and having ATCC accession
No. 203001.
64. A method of inducing the production of antibodies to FIV-141 in
an animal, comprising administering to the animal: (a) a
substantially purified FIV-141 virus; (b) a host cell infected with
the FIV-141 virus; (c) a nucleic acid molecule having a nucleotide
sequence corresponding to SEQ ID NO:1; (d) a host cell transfected
with a nucleic acid molecule having a nucleotide sequence
corresponding to SEQ ID NO:1; (e) an attenuated FIV-141 virus; (f)
a host cell infected with an attenuated FIV-141 virus; (g) a
nucleic acid molecule encoding an attenuated FIV-141 virus; or (h)
a host cell transfected with a nucleic acid molecule encoding an
attenuated FIV-141 virus.
65. A method of inducing the production of antibodies to a
lentivirus, comprising administering to a mammal: (a) an attenuated
lentivirus; (b) a host cell infected with an attenuated lentivirus;
or (c) a nucleic acid molecule encoding an attenuated
lentivirus.
66. The method of claim 64 or 65, further comprising purifying the
antibody from the animal.
67. An antibody produced by the method of claim 66.
68. A method of inducing an immune response in a cat, comprising
administering the vaccine of claim 4, 9, 20, 21, 32, 34 or 35 to
said cat at a dosage sufficient to induce protective immunity
against subsequent infection with FIV-141.
69. A method of treating a mammal for lentivirus infection,
comprising administering the antibody of claim 67 to said mammal at
a dosage sufficient to reduce one or more symptoms associated with
said infection.
70. A method of inducing an immune response in a mammal, comprising
administering the vaccine of claim 48, 49 or 50 to said mammal at a
dosage sufficient to induce protective immunity against subsequent
infection with at least one strain of said lentivirus.
71. The method of claim 70, wherein said mammal is a cat, said
lentivirus is a strain of FIV and said vaccine is administered at a
dosage sufficient to induce protective immunity against subsequent
infection by at least one strain of FIV.
Description
[0001] This application claims priority from provisional
application Serial No. 60/097,645, filed Aug. 24, 1998.
FIELD OF THE INVENTION
[0002] The present invention is directed to a novel strain of
feline immunodeficiency virus (FIV) and to a variety of mutated
forms of this virus. Compositions and methods are disclosed that
can be used in the protection of animals from lentiviral associated
disease.
BACKGROUND OF THE INVENTION
[0003] Feline immunodeficiency virus (FIV) infection in cats
results in a disease syndrome that is similar to that caused by
human immunodeficiency virus-1 (HIV-1) infection in humans. Disease
progression begins with a transient acute phase (8-10 weeks),
followed by a prolonged asymptomatic phase (lasting from weeks to
years) and a terminal symptomatic phase (Ishida et al., 1990, Jpn.
J. Vet. Sci. 52:645-648). Viral load in plasma has been
demonstrated to correlate with disease stage in infected cats and
can be used to predict disease progression in accelerated FIV
infection (Diehl et al., 1996, J. Virol. 70:2503-2507).
[0004] Structurally, the FIV provirus contains two long terminal
repeats (LTRs), one at either end of the genome (Talbott et al.,
1989, Proc. Nat'l Acad. Sci. USA 86:5743-5747). There are three
large open reading frames (Gag (group antigens); Pol (polymerase);
and ENV (envelope)) and three small open reading frames encoding
regulatory proteins (Rev (regulator of expression of virion, a
protein that binds to "RRE" elements present in all viral
transcripts and promotes their translocation from the nucleus to
the cytoplasm of infected host cells); Vif (virion infectivity
factor); and ORF(2) (open reading frame 2)). The Gag precursor
polypeptide of FIV is processed into three mature structural
proteins: a matrix protein (MA), a capsid protein (CA), and a
nucleocapsid protein (NC). The Pol gene encodes four enzymatic
proteins: a protease (PR), a reverse transcriptase (RT), a
deoxyuridine triphosphatase (DU), and an integrase (IN). Finally,
the ENV precursor polypeptide is processed into two envelope
proteins: a surface protein (SU) and a transmembrane (TM)
protein.
[0005] There have been several attempts to develop a safe and
effective vaccine to FIV. Matteucci found that cats inoculated with
a conventional fixed cell vaccine were protected from challenge
with homologous virus despite an apparent absence of neutralizing
antibodies after vaccination. Protection was found to be
short-lived and difficult to boost (Matteucci et al., 1996, J.
Virol. 70:617-622; Matteucci et al., 1997, J. Virol. 71:8368-8376).
These results may be contrasted with those of Verschoor, who
observed no protection after the administration of a fixed cell
vaccine (Verschoor et a., 1995, Vet. Immunol. Immunopathol.
46:139-149).
[0006] Another type of conventional vaccine that has been tested is
comprised of whole, inactivated FIV virus. Yamamoto reported that
greater than 90% of cats administered a vaccine of this type
exhibited essentially complete protection against homologous
challenge and slight protection against heterologous virus
(Yamamoto et al., 1993, J. Virol. 67:601-605). Both humoral and
cellular immunity against FIV were induced and a high level of
anti-ENV, anti-core and virus neutralizing (VN) antibodies were
observed in the vaccinated cats. In contrast, vaccination of cats
with inactivated whole FIV incorporated into immune stimulating
complexes (ISCOMS) failed to protect animals from homologous
challenge (Hosie et al., 1992, Vet. Immunol. Immunopathol.
35:191-197).
[0007] Another approach to vaccine development has involved the use
of subunit vaccines containing recombinant core protein, synthetic
V3 peptides, and recombinant ENV protein (Elyar et al., 1997,
Vaccine 15:1437-1444). Although significant levels of antibodies
were induced by such vaccines, none were identified that could
protect cats against homologous FIV challenge (Huisman et al.,
1998, Vaccine 16:181-187; Flynn et al., 1997, J. Virol.
71:7586-7592; Tijhaar et al., 1997, Vaccine 15:587-596). The
results suggest that it is likely to be difficult to obtain
protective immunity against FIV using subunit type vaccines.
[0008] Recently, Cuisinier reported on tests conducted on a DNA
vaccine for FIV (Cuisinier et al., 1997, Vaccine 15:1085-1094).
Cats were vaccinated with a plasmid carrying FIV structural genes,
including ENV and p10. Although strong humoral immune responses
were observed, all cats eventually succumbed to homologous
challenge.
SUMMARY OF THE INVENTION
[0009] The present invention is based, in part, upon the isolation
and characterization of a new strain of feline immunodeficiency
virus, designated herein as FIV-141 and deposited as ATCC No.
VR-2619. The complete genomic sequence of the virus has been
determined and is distinct from all other known FIV sequences. A
plasmid encoding FIV-141 has been deposited as ATCC No. 203001.
[0010] A. Compositions and Methods Based Upon the FIV-141 Virus
[0011] In its first aspect, the present invention is directed to a
substantially purified FIV-141 virus having a genomic sequence
corresponding to that of SEQ ID NO:1, to host cells infected with
the virus and to progeny virus produced in the host cells. The term
"substantially purified" means that FIV-141 has been separated from
all other strains of virus and, particularly, from all other
strains of FIV. Host cells are typically cells grown in in vitro
culture. Host cells that may be used for growing virus include
peripheral blood mononuclear cells (PBMCs). Progeny virus may be
isolated using standard procedures as discussed below. The present
invention further provides a substantially purified virus having a
nucleotide sequence which is a degenerate variant of a nucleotide
sequence corresponding to SEQ ID NO:1, as based on the degeneracy
of the genetic code, host cells infected with such a virus, and
progeny virus produced in the host cells, which are useful for all
of the purposes disclosed herein for the substantially purified
FIV-141 virus having a genomic sequence corresponding to that of
SEQ ID NO:1, and for which all of the disclosure provided herein
below is equally applicable.
[0012] The FIV-141 virus and host cells infected with the virus can
be used to infect animals for the purpose of inducing the
production of antibodies that react preferentially with one or more
strains of FIV. "Preferential binding" of antibodies, as used
herein, refers to an antibody having at least a 100-fold greater
affinity for FIV than for any other virus or non-FIV protein.
Antibodies may be generated in any of the animals commonly used for
this purpose (such as, e.g., mice, rabbits, goats, or sheep) but,
preferably, antibodies will be made in domestic cats. When virus is
used to induce antibody production, it may, if desired, be
inactivated prior to infection. Inactivation procedures may involve
treating the virus with formalin, paraformaldehyde, phenol,
lactopropionate, ultraviolet light, heat, psorlens, platinum
complexes, ozone or other viricidal agents. When host cells
expressing FIV-141 are used to induce antibody production, the
cells may be fixed prior to infection. Typically, this will involve
treating the cells with paraformaldehyde as described herein, but
other methods may also be employed. Antibodies made to FIV-141 are
themselves included within the scope of the invention and may be
purified using techniques well known in the art (see, e.g., Harlow
et al, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory, N.Y.).
[0013] In another aspect, the invention is directed to a whole
virus vaccine comprising inactivated FIV-141 virus, or an
inactivated virus encoded by a degenerate variant of a nucleic acid
molecule having a nucleotide sequence corresponding to SEQ ID NO:1.
An immune response may be induced in a cat by administering this
vaccine at a dosage and for a duration sufficient to induce
protective immunity against subsequent infection with FIV-141.
Typically, the vaccine will be administered parenterally with two
or more inoculations being given at intervals of, e.g., two to
eight weeks. The invention also includes a fixed cell vaccine,
which is comprised of a host cell infected with the FIV-141 virus
or a degenerate variant thereof. Administration of this vaccine
will follow the same general procedures as used for the whole virus
vaccine. Standard procedures well known in the art may be used to
optimize immunization protocols.
[0014] B. Compositions and Methods Based Upon FIV-141 Genomic
Nucleic Acid
[0015] In another aspect, the present invention is directed to a
substantially purified nucleic acid molecule (DNA or RNA) having a
sequence corresponding to that of SEQ ID NO:1 or a degenerate
variant thereof. As used in this context, "substantially purified"
means that the desired product is essentially free from
contaminating cellular components. A "substantially pure" nucleic
acid will typically comprise at least 85% of a sample, with greater
percentages being preferred. Contaminants may include proteins,
carbohydrates or lipids. One method for determining the purity of a
nucleic acid is by electrophoresing a preparation in a matrix such
as polyacrylamide or agarose. Purity is evidenced by the appearance
of a single band after staining. Other methods for assessing purity
include chromatography and analytical centrifugation. The FIV-141
nucleic acid may be used in place of the whole virus to transfect
host cells and to thereby induce the production of progeny virus or
viral proteins.
[0016] The invention also encompasses methods of inducing the
production of antibodies to FIV-141 by injecting nucleic acid
directly into an animal or by administering host cells transfected
with the nucleic acid. As with the procedures discussed above in
connection with the whole virus, host cells may be fixed prior to
administration. Antibodies may be substantially purified from
animals and used in assays designed to detect the presence of FIV
in culture medium or in a biological fluid. A "substantially
purified" antibody will typically comprise at least 70% of protein
in a sample, with greater percentages being preferred.
[0017] Host cells transfected with FIV-141 genomic DNA or a
degenerate variant thereof may also be used in a vaccine for
immunizing cats. If desired, such cells may be fixed to reduce
viral infectivity, e.g., by treatment with an agent such as
paraformaldehyde. Vaccines made in this manner may be used to
induce an immune response in a cat. The vaccine may be administered
using a standard immunization protocol optimized for the induction
of protective immunity against subsequent infection with FIV-141
or, if desired, some other strain of FIV.
[0018] C. Attenuated FIV-141 Virus and Vaccines
[0019] Before a whole virus can be administered to an animal as a
vaccine, it must be converted into a non-pathogenic form. As
discussed above, this may be accomplished by inactivating the virus
or fixing host cells. An alternative method involves introducing
mutations into the virus to transform it into an attenuated form.
The phrase "attenuated virus" as used in this context, refers to a
virus that has substantially reduced infectivity compared to its
wild type counterpart. Infectivity may be measured in PBMCs, as
described in the Examples section herein below.
[0020] Thus, the invention is directed to an attenuated FIV-141
virus, or degenerate variant thereof, that exhibits significantly
reduced infectivity for feline T lymphocytes relative to the wild
type (i.e., non-mutated) virus. The attenuated virus is produced by
mutating one or more genes in the FIV-141 genome or degenerate
variant thereof selected from the group consisting of Vif, MA,
ORF(2), ENV, CA, NC, SU, TMf, CT, IN, DU, V3/4, V7/8 and RRE.
Appropriate mutations for each of these genes are described herein.
Examples of several specific mutations that may be used in making
attenuated viruses include MA del, ENV del, V3/4 del, V7/8 del, TMF
del, CT del, Vif del, Vifc del, Vifn del, ORF(2) del, CA del, NC
del, IN del, DU del, SU del, and RRE del. In a preferred
embodiment, the attenuated virus comprises a mutation in the ENV
gene. In a further preferred embodiment, the attenuated virus
comprises a combination of any two or more of the aforementioned
mutations. In specific though non-limiting embodiments, the
attenuated virus comprises double mutations in any of the following
combinations of genes: (i) MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; or
(iv) ENV/IN. In a preferred embodiment, the attenuated virus
comprises any of the following double deletions: (i) MA del/TMf
del; (ii) MA del/V3/4 del; (iii) MA del/Vif del or (iv) ENV del/IN
del. In a further preferred embodiment, the attenuated virus
comprises at least two mutations, one of which is in the ENV gene
such as, e.g., ENV del, with one or more other mutations in any of
the other genes of the virus. In a preferred embodiment, the one or
more other mutations in the other genes of the virus are in genes
selected from the group consisting of IN, CA, NC, Vif and
ORF(2).
[0021] The invention also encompasses host cells infected with the
attenuated virus and the progeny virus produced by such cells. Once
produced, the attenuated virus may be purified. from host cells
using standard procedures.
[0022] Antibody production may be induced by infecting an animal
with the attenuated virus or, alternatively, infected host cells
may be used. If desired, the virus may be inactivated or the host
cells fixed prior to administration to an animal and antibodies may
be purified from animals using standard procedures.
[0023] In addition, the invention encompasses a vaccine that
utilizes the attenuated whole virus discussed above or a host cell
infected with one of these viruses. Again, the attenuated viruses
may be inactivated and the host cells may be fixed. Such treatments
may provide added assurance that vaccines will not themselves cause
infection. Vaccines based upon one or more attenuated FIV-141
viruses or degenerate variants thereof may be used to induce
protective immunity in a cat. Standard immunization protocols may
be followed in administering vaccines so as to optimize the
induction of protective immunity against subsequent challenge with
FIV-141.
[0024] D. Compositions and Methods Based upon Mutated FIV-141
Genomic DNA
[0025] In another aspect, the present invention is directed to a
substantially purified FIV-141 nucleic acid (DNA or RNA) having a
sequence corresponding to SEQ ID NO:1, or degenerate variant
thereof, but which has been mutated to encode an attenuated virus.
Mutations should be to one or more genes selected from the group
consisting of Vif, MA, CA, NC, SU, TMf, ORF(2), CT, ENV, Vifn,
Vifc, IN, DU, V3/4, V7/8, and RRE, and should be made in such a
manner that, upon introduction into a host cell, a virus is made
that has significantly reduced infectivity for feline T lymphocytes
(or other susceptible cell types) relative to the wild type virus.
Examples of several specific mutations that will produce an
appropriate attenuated virus are described herein and include: MA
del, ENV del, V3/4 del, V7/8 del, TMf del, CT del, Vif del, Vifc
del, Vifn del, ORF(2) del, SU del, CA del, NC del, IN del, DU del,
and RRE del. In a preferred embodiment, the attenuated virus
comprises a combination of any two or more of the aforementioned
mutations. In specific though non-limiting embodiments, the
attenuated virus comprises double mutations in any of the following
combinations of genes: (i) MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; or
(iv) ENV/IN. In a preferred embodiment, the attenuated virus
comprises any of the following double deletions: (i) MA del/TMf
del; (ii) MA del/V3/4 del; (iii) MA del/Vif del or (iv) ENV del/IN
del. In a further preferred embodiment, the attenuated virus
comprises at least two mutations, one of which is in the ENV gene
such as, e.g., ENV del, with one or more other mutations in any of
the other genes of the virus. In a preferred embodiment, the one or
more other mutations in the other genes of the virus are in genes
selected from the group consisting of IN, CA, NC, Vif and
ORF(2).
[0026] The invention includes host cells transfected with the
mutated nucleic acid and FIV progeny virus produced by the host
cells.
[0027] Also included within the scope of the invention is a method
of inducing the production of antibodies to FIV in an animal by
injecting either nucleic acid mutated as described above or a host
cell that has been transfected with the nucleic acid. If desired,
the host cell may be fixed prior to administration. The antibodies
produced may be purified using standard methods and used in assays
designed to detect the presence of FIV.
[0028] The nucleic acid, preferably DNA, which has been mutated,
may be used in a vaccine in which it is present at a concentration
sufficient to induce protective immunity upon administration to a
cat. Alternatively, a vaccine may include a host cell transfected
with such DNA and, if desired, the host cell may be fixed after
viral proteins are expressed. The vaccines may be administered to a
cat at a dosage and for a duration sufficient to induce an immune
response in a cat, and immunization protocols may be optimized for
inducing protective immunity against subsequent infection by
FIV-141.
[0029] E. Methods of Making and Using Attenuated Lentiviruses
[0030] The methods disclosed herein in connection with the
production of attenuated FIV-141 may be effectively applied to the
attenuation of other strains of FIV and to other types of
lentivirus. A virus that has significantly reduced infectivity
relative to its unmutated, wild type counterpart may be made by
mutating one or more genes selected from the group consisting of
MA, CA, NC, DU, ENV, SU, TMf, CT, Vif, ORF(2), Vifn, Vifc, IN,
V3/4, V7/8, and RRE. In a preferred embodiment, the attenuated
lentivirus comprises a mutation in the ENV gene. In a further
preferred embodiment, the attenuated virus comprises a combination
of any two or more of the aforementioned mutations. In specific
though non-limiting embodiments, the attenuated virus comprises
double mutations in any of the following combinations of genes: (i)
MA/TMf; (ii) MA/V3/4; (iii) MA/Vif; or (iv) ENV/IN. In a preferred
embodiment, the attenuated virus comprises any of the following
double deletions: (i) MA del/TMf del; (ii) MA del/V3/4 del; (iii)
MA del/Vif del or (iv) ENV del/IN del. In a further preferred
embodiment, the attenuated virus comprises at least two mutations,
one of which is in the ENV gene such as, e.g., ENV del, with one or
more other mutations in any of the other genes of the virus. In a
preferred embodiment, the one or more other mutations in the other
genes of the virus are in genes selected from the group consisting
of IN, CA, NC, Vif and ORF(2).
[0031] Mutations should be designed to eliminate or substantially
reduce the activity of the gene product. This may be accomplished
by deleting the entire gene or by deleting a large (e.g., one
fourth) fraction of the entire gene. The invention encompasses the
attenuated lentiviruses made using the disclosed methods, host
cells infected with these viruses, and methods of inducing antibody
production by injecting the attenuated virus into a mammal. The
antibodies may be purified from infected mammals and used in
immunoassays. Alternatively, the purified antibodies, or
antibody-containing serum derived from animals infected with
attenuated virus, may be used to treat a mammal for lentivirus
infection.
[0032] As used herein, the phrase "induction of protective
immunity", and the like, is used broadly to include the induction
of any immune-based response in response to vaccination, including
either an antibody or cell-mediated immune response, or both, that
serves to protect the vaccinated mammal against the particular
lentivirus. The terms "protective immunity", "protective response",
"protect", and the like, as used herein, refer not only to the
absolute prevention of any of the symptoms or conditions in the
mammal resulting from infection with the particular lentivirus, but
also to any detectable delay in the onset of any such symptoms or
conditions, any detectable reduction in the degree or rate of
infection by the particular lentivirus, or any detectable reduction
in the severity of the disease or any symptom or condition
resulting from infection by the particular lentivirus. Vaccine
preparations according to the present invention should be
administered at a dosage and for a duration sufficient to reduce
one or more clinical signs and viral load associated with the
infection of the mammal. When the lentivirus is a strain of FIV,
the mammal treated will be a cat and the signs associated with the
infection will include immunological abnormalities such as an
abnormally low level of CD4.sup.+ T-lymphocytes or an abnormally
elevated number of CD8.sup.+ T-lymphocytes. Other clinical signs
will typically include alopecia, anemia, chronic rhinitis,
conjunctivitis, diarrhea, emaciation, enteritis, gingivitis,
hematochezia, neurological abnormalities and dermatitis.
[0033] The attenuated lentivirus (e.g., an attenuated strain of
FIV), or host cells infected with such a virus, may be used in
vaccine at a concentration sufficient to induce immunity when
administered to a mammal (e.g., a cat). An immune response may then
be induced by administering such a vaccine at a dosage and for a
duration sufficient to induce protective immunity against
subsequent infection by at least one strain of lentivirus.
[0034] F. Methods of Making and Using Mutated Lentivirus Nucleic
Acid
[0035] The present invention is also directed to a method of
producing a nucleic acid suitable for use in a vaccine against
lentivirus, e.g. FIV, infection. This is accomplished by reverse
transcribing the genomic RNA of the lentivirus; cloning the reverse
transcript; mutating one or more genes selected from the group
consisting of MA, CA, NC, SU, TMf, ORF(2), CT, ENV, Vif, Vifn,
Vifc, V3/4, V7/8, IN, DU, and RRE; and then cloning the mutated
nucleic acid. Preferably, mutations should be such that, upon
introduction into a host cell, an attenuated virus is made that has
significantly reduced infectivity relative to lentivirus produced
by the unmutated, wild type nucleic acid. In the case of FIV,
infectivity should be reduced or eliminated for feline
T-lymphocytes.
[0036] Mutated lentivirus nucleic acid may be purified and used to
transfect host cells, make progeny virus, and make antibody in the
same way as described above for FIV-141. In addition, the nucleic
acid, or host cells transfected with the nucleic acid, may be
incorporated into a vaccine and used to induce protective immunity
in a mammal. Preferably, the nucleic acid will encode an attenuated
strain of FIV that has significantly reduced infectivity in feline
PBMCs, including T-lymphocytes such as FeP2 cells. Under these
circumstances, the immune response will be induced in a cat.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1: FIV Production from Transfected Cells. Crandell
Feline Kidney (CRFK) cells were transfected with a plasmid
comprising the full length FIV-141 genome. Beginning at 24 hours
post-transfection, cell supernatants were harvested and assayed for
the presence of FIV p26 capsid protein using an enzyme
immunoassay.
[0038] FIG. 2: Infection of FeP2 T Lymphocytes by Co-culture. CRFK
cells were grown in six well plates and transfected with plasmid
DNA encoding the full length FIV-141 genome. Forty-eight hours
after transfection, 2.times.10.sup.6 FeP2 cells were introduced
into each well. Beginning 72 hours after co-cultivation, FeP2 cells
were separated and their supernatants were tested for the presence
of FIV p26 capsid protein by ELISA.
[0039] FIG. 3: Infection of FeP2 Cells by Adsorption.
2.times.10.sup.6 FeP2 cells were suspended in 200 ul of FIV-141
virus-containing conditioned medium derived from CRFK cells
transfected with the full length infectious FIV-141 clone.
Beginning at four days post-infection, FeP2 cell supernatants were
tested for the presence of FIV-141 virus using a p26 ELISA
assay.
[0040] FIG. 4: Expression of FIV-141 Viral Protein by Deletion
Clones. A variety of clones mutated to delete FIV genes or
regulatory regions were made and transfected into CRFK cells. After
48 hours, cell supernatants were assayed for the presence of FIV
p26 capsid protein by ELISA. The results for each deletion clone,
as well as the wild type FIV-141 molecular clone, are shown.
[0041] FIGS. 5-10: Infection of FeP2 T Lymphocytes by FIV-141
Mutants. CRFK cells were grown in six well plates and infected with
one of three different FIV-141 deletion clones: TMf del, ENV del,
or NC del. After 48 hours, FeP2 cells were added to each well and
co-cultures were maintained for an additional 72 hours. The FeP2
cells were then separated from the CRFK cells and assayed for the
presence of p26 antigen using an ELISA assay. Monitoring of p26
levels was repeated every 3-4 days and results are shown in FIG. 5.
The experiment was repeated using: Vifn del, Vifc del and Vif del
(FIG. 6); MA del and CA del (FIG. 7); V3/4 del, V7/8 del and CT del
(FIG. 8); ORF(2) del (FIG. 9); and DU del, SU del, IN del, and RRE
del (FIG. 10).
[0042] FIG. 11: Cumulative viral RNA loads detected by QcRT-PCR in
plasma samples obtained from cats vaccinated with plasmids encoding
particular deletion mutants of FIV-141 and then challenged with
FIV-141. Cats in the positive placebo group were vaccinated with
pCR-Script SK(+) vector DNA and then challenged with FIV-141. Cats
in the negative placebo group were vaccinated with pCR-Script SK(+)
vector DNA, but were not challenged with FIV-141.
DETAILED DESCRIPTION OF THE INVENTION
[0043] A. Production of FIV-141 and DNA Encoding the Virus
[0044] The present invention is directed to a novel strain of
feline immunodeficiency virus (designated herein "FIV-141") that is
distinguished from all similar strains based upon its genomic
nucleic acid sequence and biological functions. Although the genome
of FIV-141 consists of RNA, this is reverse transcribed into DNA
and integrated into the genome of an infected host. It will be
understood that references made herein to sequences of FIV and to
mutated forms of such sequences encompass both the reverse
transcribed viral RNA sequences as well as the corresponding DNA
itself.
[0045] It is well known that techniques such as site-directed
mutagenesis may be used to introduce variations into the structure
of nucleic acids. Mutations in the FIV-141 nucleic acid sequence
introduced by this or some similar method are encompassed by the
invention, provided that at least one major biological
characteristic of the resulting virus, e.g., its antigenicity,
remains substantially the same as that of the virus from which it
was derived. In a preferred though non-limiting embodiment,
mutations that detectably reduce the infectivity of FIV-141
compared to that of the wild-type strain fall within the scope of
the invention. For example, a specific mutation in the ENV gene is
described herein below which produces a virus that replicates, but
which shows greatly reduced infectivity. The present invention
includes both this mutation and other mutations that result in
substantially reduced viral infectivity.
[0046] As discussed in the Examples section, the complete FIV-141
genome has been cloned and a plasmid containing the full length
sequence has been deposited as ATCC number 203001. Standard
methodology may be used to isolate this plasmid and transfect it
into host cells capable of supporting virus production. Crandell
feline kidney (CRFK) cells have been found to be suitable for this
purpose, but other cell types such as, e.g., feline T lymphocyte
cells, may be used as well. In some cases, host cells expressing
the virus may be used directly, e.g., they may be harvested and
used to generate antibodies or in a vaccine. Alternatively, the
virus produced in the cells may be isolated in highly purified form
using known separation techniques such as sucrose-gradient
centrifugation. Such. methods are effective both for the wild type
virus and for mutant forms of the virus.
[0047] An alternative method for obtaining the FIV-141 genome is to
perform PCR amplification using primers corresponding to sequence
elements in SEQ. ID NO:1. In general, the primers should be about
20 to 50 bases in length. A strategy may be designed for amplifying
the entire FIV-141 genome or, alternatively, portions of the genome
may be amplified separately and then joined together to form the
full length sequence. The Examples section below describes specific
primers and methods that have been found to be effective, but
alternative procedures may be developed and used as well.
[0048] If virus is being isolated from a natural source, then
primers for PCR should correspond to sequences unique to FIV-141.
Successful amplification using such primers will indicate that a
virus responsible for an infection is, in fact, FIV-141. Thus, PCR
may be used both diagnostically, as well as in methods for
isolating virus.
[0049] B. Production of Inactivated Virus and Fixed Host Cells
[0050] The FIV-141 virus, or a degenerate variant thereof, may be
used to generate antibodies in an appropriate host and in vaccines.
In either case, it will usually be desirable to inactivate the
virus prior to administering it to an animal. Inactivation may be
accomplished by any means known in the art. For example, virus may
be purified and then inactivated by incubation for about 24 hours
in 0.8% formalin or 1.25% paraformaldehyde. Such procedures may be
used either with wild type or mutant viruses.
[0051] Antibodies may also be generated or immunizations
accomplished using host cells infected with FIV-141, mutated forms
of the virus, or degenerate variants thereof. Any host cell capable
of supporting viral replication may be used including peripheral
blood mononuclear cells (PBMCs). Ordinarily, cells should be fixed
prior to administration to an animal. Fixing may be performed by
treating cells with paraformaldehyde (e.g., 1.25%) for a period of
about 24 hours at 37.degree. C. The other methods discussed above
for inactivating virus may also be used for fixing cells, as may
any other method disclosed in the art.
[0052] C. Production of Attenuated Virus
[0053] As discussed above, vaccines may be produced using either
inactivated virus or fixed host cells. An alternative method is to
use a virus that has been attenuated by mutating one or more genes
in the viral genome. The objective is to produce a virus that is
not infectious when administered to a cat. Rates of viral
replication can be determined in vitro by infecting cells (e.g.,
PBMCs) with virus, and then determining how the levels of virus
change with time. Replication can be followed using an
immunological assay that measures an antigen specific for FIV, by
quantitative PCR, or by measuring the activity of an enzyme
specific to the virus (e.g., reverse transcriptase). Infectivity
can be determined by exposing feline T lymphocytes (e.g., FeP2
cells) to virus and determining the extent to which the cells take
up the virus and support replication (see Example 4 below).
[0054] Mutations in the FIV-141 genome may be made by site-directed
mutagenesis. One way to carry this out is to amplify viral genes
with primers that introduce alterations into the normal gene
sequence. For example, unique restriction sites may be introduced
in a selected region of the genome and the sequence between such
sites may then be excised by restriction enzyme digestion. After
excision, the remaining portion of genomic DNA may be religated and
then introduced into an appropriate host cell to produce mutated
virus. A detailed description of the making and testing of mutated
viruses and mutated viral genomes is provided in Examples 3 and 4
below. A summary of various mutations that have been introduced may
be found in Table 1.
1TABLE 1 Mutations in FIV-141 NUCLEOTIDES AMINO ACIDS MUTATION
DELETED DELETED MA del 123 bases, nucleotides 879-1001 41 amino
acids, residues 85-125 at the C- terminus of the MA protein CA del
114 bases, nucleotides 1056-1169 38 amino acids, residues 9-46 at
the N- terminus of the CA protein NC del 242 bases, nucleotides
1635-1876 21 amino acids in the CA region and 51 amino acids in the
NC region, accompanied by a reading frame shift preventing
expression of the terminal portion of the NC protein ENV del 2103
bases deleted, nucleotides 701 amino acids from the middle of the
6577-8679 ENV protein, residues 106-806 SU del 1509 bases,
nucleotides 6577-8085 503 amino acids of the SU protein, residues
106-608 V3/4 del 432 bases, nucleotides 7339-7770 144 amino acids
of the V3 and V4 regions of SU, residues 360-503 V7/8 del 216
bases, nucleotides 8380-8595 72 amino acids from the V7 and V8
variable regions of the TM protein, residues 98-169 TMf del 75
bases, nucleotides 8071-8145 25 amino acids in the cleavage
junction between SU and TM CT del 138 bases, nucleotides 8686-8823
46 amino acids from the cytoplasmic domain of TM DU del 345 bases,
nucleotides 4019-4363 115 amino acids from the DU protein, residues
9-123 IN del 669 bases, nucleotides 4418-5086 223 amino acids of
the IN protein, residues 9-231 Vifn del 150 bases, nucleotides
5286-5435 50 amino acids from the N-terminal portion of the Vif
protein, residues 19-68 Vifc del 438 bases, nucleotides 5436-5873
146 amino acids from the C-terminal portion of Vif, residues 69-214
Vif del 588 bases, nucleotides 5286-5873 196 amino acids from the
Vif protein, residues 19-214 Orf(2) del 237 bases, nucleotides
5988-6224 79 amino acids of the ORF(2) protein RRE del 84 bases,
nucleotides 8827-8910 --
[0055] Examples of several specific mutations that produce
attenuated viruses suitable for administration to animals to induce
antibody production or for use in vaccines are MA del, ENV del,
V3/4 del, V7/8 del, TMf del, CT del, Vif del, Vifc del, Vifn del,
ORF(2) del, CA del, NC del, SU del, IN del, DU del, and RRE del.
Thus, viruses mutated in any of the Vif, MA, ORF(2), ENV, Vifn,
Vifc, V3/4, V7/8, TMf, CT, SU, CA, NC, IN, DU, or RRE genes are
attenuated, and other nucleotide deletions or alterations that
inactivate these genes should produce viruses with similar
characteristics.
[0056] D. Generation of Antibodies to FIV-141 and Treatment of
Infected Cats
[0057] Antibodies to FIV-141 can be produced in any of the animals
typically used for antibody production, including mice, rabbits,
etc. However, it is preferred that the antibodies be produced in
cats. If wild type virus is used as antigen, the virus should be
inactivated prior to administration. When attenuated viruses are
used, e.g., viruses mutated so as to reduce or eliminate their
infectivity, inactivation or the fixing of host cells is not
required, although these procedures may be performed if
desired.
[0058] Compositions containing virus may be administered to animals
by any route, but animals will typically be injected
intramuscularly, subcutaneously or intravenously. Generally, the
virus preparation will include an adjuvant, e.g., Freund's complete
or incomplete adjuvant. Appropriate preparations for injection,
injection schedules and the like are well known in the art and may
be employed for FIV-141 and its mutants (see, e.g, Harlow, et al.,
1988, Antibodies, A Laboratory Manual, Cold Spring Harbor
Laboratory, N.Y.; Klein, 1982, Immunology: The Science of
Self-Nonself Discrimination). Monoclonal antibodies may also be
used, and can be made using standard procedures (Kennett, et a/.,
1980, Monoclonal Antibodies and Hybridomas: A New Dimension in
Biological Analyses; Campbell, 1984, "Monoclonal Antibody
Technology," in: Laboratory Techniques in Biochemistry and
Molecular Biology).
[0059] Antibodies or fragments of antibodies reacting with
specificity to FIV-141 (i.e., having at least a 100 fold greater
affinity for FIV-141 than for any other virus) may also be used in
any of a variety of immunoassays. For example, the antibodies may
be used to detect FIV-141 in radioimmunoassays or in immunometric
assays, also known as "2-site" or "sandwich" assays (see Chard,
1978, "An Introduction to Radioimmune Assay and Related
Techniques," in: Laboratory Techniques in Biochemistry and
Molecular Biology, North Holland Publishing Co. N.Y.). In a typical
immunometric assay, a quantity of unlabeled antibody is bound to a
solid support that is insoluble in the fluid being tested, e.g.,
blood, lymph, cellular extracts, etc. After the initial binding of
antigen to immobilized antibody, a quantity of detectably labeled
second antibody (which may or may not be the same as the first) is
added to permit detection and/or quantitation of antigen (see,
e.g., Kirkham et al. (ed.), 1970, Radioimmune Assay Methods, pp.
199-206, E&S Livingstone, Edinburgh). Many variations of these
types of assays are known in the art and may be employed for the
detection of FIV.
[0060] E. Conventional Vaccines and Vaccination Procedures
[0061] Vaccines and vaccination procedures employing different
strains of FIV or closely related viruses have been discussed by a
number of authors (Elyar et al., 1997, Vaccine 15:1437-1444;
Yamamoto et al., 1993, J. Virol. 67:601-605; Murphey-Corb et al.,
1989, Science 240:1293-1297; Jarrett et al., 1990, AIDS
4:S163-S165; and Desrosiers et al., 1989, Proc. Nat'l Acad. Sci.
USA 86:6353-6357). In the case of FIV-141, there are three types of
vaccines that may be used: inactivated whole virus vaccine, fixed
cell vaccines, and attenuated virus vaccines.
[0062] Typically, a vaccine will contain between about
1.times.10.sup.6 and about 1.times.10.sup.8 virus particles in a
volume of between about 0.5 and 5 ml. Formulation may take place
using standard methods such as those described in Remington's
Pharmaceutical Sciences, 1982, Mack Publishing Co., Easton, Pa.
16th ed. Preparations may contain inactivated virus, fixed host
cells or attenuated virus, together with a pharmaceutically or
veterinarily acceptable carrier as known in the art and one or more
adjuvants. Vaccines will generally be designed for parenteral
administration, although the present invention is compatible with
other forms of administration as well, such as e.g., by oral,
intranasal, intramuscular, intra-lymph node, intradermal,
intraperitoneal, subcutaneous, rectal or vaginal administration, or
by a combination of routes. The skilled artisan will readily be
able to formulate the vaccine composition according to the route
chosen.
[0063] The most preferred vaccines will contain attenuated virus
that is completely, or essentially completely, non-infectious when
administered to cats.
[0064] Immunization procedures will typically involve several
inoculations with vaccine (e.g., 3 inoculations) separated by
intervals of 3 to 10 weeks. Procedures for optimizing inoculation
schedules and the other parameters associated with immunization are
well known in the art.
[0065] F. DNA Vaccines
[0066] References describing vaccines and vaccination procedures
that utilize nucleic acids (DNA or mRNA) include U.S. Pat. No.
5,703,055, U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,589,466,
International Patent Publication WO 98/35562, and various
scientific publications, including Ramsay et al., 1997, Immunol.
Cell Biol. 75:360-363; Davis, 1997, Cur. Opinion Biotech.
8:635-640; Manickan et al., 1997, Critical Rev. Immunol.
17:139-154; Robinson, 1997, Vaccine 15(8):785-787; Robinson et al.,
1996, AIDS Res. Hum. Retr. 12(5):455-457; Lai and Bennett, 1998,
Critical Rev. Immunol. 18:449-484; and Vogel and Sarver, 1995,
Clin. Microbiol. Rev. 8(3):406-410, which are incorporated herein
by reference. These procedures may be utilized to produce a vaccine
against FIV in which nucleic acid corresponding to attenuated
FIV-141, or a degenerate variant thereof, is administered to a cat.
Immunogens delivered in this manner typically evoke both a humoral
and cytotoxic immune response.
[0067] Either DNA or RNA encoding the attenuated FIV-141 genome, or
degenerate variant thereof, may be used in vaccines, but DNA will
generally be preferred. The DNA may be present in a "naked" form or
it may be administered together with an agent facilitating cellular
uptake (e.g., liposomes, or cationic lipids). The polynucleotide
molecule may be associated with lipids to form, e.g., DNA-lipid
complexes, such as liposomes or cochleates. See, e.g.,
International Patent Publications WO 93/24640 and WO 98/58630,
which are incorporated herein by reference.
[0068] The typical route of administration will be by intramuscular
injection of between about 0.1 and 5 ml of vaccine. The total
polynucleotide in the vaccine should generally be between about 0.1
ug/ml and about 5.0 mg/ml. Polynucleotides may be present as part
of a suspension, solution or emulsion, but aqueous carriers are
generally preferred.
[0069] Immunization of cats using DNA vaccines may be performed as
either a single inoculation or as multiple inoculations of divided
doses separated, e.g., by intervals of 3 to 10 weeks. If desired,
serum may be collected from inoculated animals and tested for the
presence of antibodies to FIV-141 or other strains of FIV.
[0070] G. Extension of Methodology to Other Lentiviruses
[0071] The methods discussed above for attenuating FIV-141 and for
producing mutated viral nucleic acids suitable for use in vaccines
may be extended to other strains of FIV and to other types of
lentivirus. In each case, the. viral genome is cloned and mutated
in one or more genes selected from the group consisting of: MA, CA,
NC, DU, ENV, SU, TMf, CT, ORF(2), Vif, Vifn, Vifc, V3/4, V7/8, IN,
and RRE. The mutation should be designed to inactivate the gene
product. This can usually be most easily accomplished by deleting
either the entire gene or a substantial portion of the gene.
Although the specific methodology used for inducing mutations will
vary depending upon the virus, the basic techniques are routine in
the art and, using the procedures disclosed herein as a guide, can
be readily carried out by a skilled molecular biologist. Antibody
production, the making and administration of vaccines, etc., may be
accomplished as discussed in connection with FIV-141 herein, making
minor adaptations as needed.
[0072] In addition, it is contemplated that antibodies to certain
lentiviruses may be used to provide passive immunity to an animal
or human infected with the virus. Either purified antibody or
antibody-containing serum may be used for this purpose, and
preparations may be administered on a periodic basis until an
improvement in one or more signs associated with viral infection is
observed.
EXAMPLES
Example 1
Construction of an Infectious FIV Proviral DNA Clone
[0073] A. Isolation and Cloning of FIV-141
[0074] Virus Isolation
[0075] FIV-141 was isolated from the plasma of an FIV-infected cat.
The virus was amplified. by administering plasma from the infected
animal to a specific pathogen-free (SPF) cat. Infection of the
inoculated cat was confirmed by virus isolation and seroconversion.
The cat was euthanized 12 weeks post challenge, tissues were
collected, and the spleen was used as the source of virus for the
molecular cloning of the FIV-141 genome. Genomic DNA was isolated
from the infected spleen using a DNA extraction kit (Stratagene, La
Jolla, Calif.) according to the protocol provided by the
manufacturer. Purified genomic DNA was dissolved in TE buffer at a
concentration of 1 ug/ml and stored a -70.degree. C.
[0076] PCR Amplification and Cloning of Three Segments of the
FIV-141 Genome
[0077] Three sets of oligonucleotides were designed based upon the
published sequences of other FIV isolates (Talboft et al., 1989,
Proc. Nat'l Acad. Sci. USA, 86:5743-5747; Miyazawa et al., 1991, J.
Virol. 65:1572-1577; Talbott et al., 1990, J. Virol. 64:4605-4613).
These oligonucleotides were used to amplify three segments of the
FIV-141 genome, one at the 5' end, one at the 3' end and one in the
middle of the genome. Because of a low copy number of the FIV
proviral genome in infected tissue, two rounds of PCR amplification
were performed using a semi-nested set of primers for each
segment.
[0078] Three primers were used to clone a segment from the 5' end
of the FIV-141 proviral genome, extending from nucleotides 118 to
646. This region covers most of the 5' long terminal repeat, the
intervening sequence between the 5' long terminal repeat and the
Gag open reading frame, and the N-terminal portion of the Gag gene.
The sequences of the primers were as follows: the forward primer
pr-1 (117-CCGCAAAACCACAT CCTATGTAAAGCTTGC-146, SEQ ID NO:2) and the
two reverse primers, pr-2 (646-CGCCCCTGTCCATTCCCCATGTTGCTGTAG-617,
SEQ ID NO:3) and pr-8 (1047-TTACTGTTTGMTAGGATATGCCTGTGGAG-1018, SEQ
ID NO:4). First round PCR amplification was performed using 200 ng
each of pr-1 and pr-8 as primers and 1 ug of genomic DNA as
template, with a mixture of 0.5 units of Taq DNA polymerase (Gibco,
BRL Gaithersburg, Md.) and 1 unit of Pfu DNA polymerase
(Stratagene, La Jolla, Calif.). Amplification proceeded at
94.degree. C. for one minute; followed by 30 cycles of denaturing
at 94.degree. C., for 45 seconds; annealing at 52.degree. C. for 45
seconds; and extension at 72.degree. C. for two minutes. The second
round amplification was performed using primers pr-1 and pr-2
together with 2 ul of the first round PCR products as template. The
same conditions used in the first round of amplification were
applied in the second round, except that annealing took place at a
temperature of 55.degree. C.
[0079] Three oligonucleotides were also used to clone a segment
from the 3' end of the FIV141 proviral genome. This segment
includes nucleotides 8874 to 9367, consisting of most of the 3'
long terminal repeat and the intervening sequence between the 3'
long terminal repeat and the ENV gene. The sequences of the three
primers were as follows: the two forward primers, pr-5
(8793-GCAATGTGGCATGTCTGAAAAAGAGGAGGA-8822, SEQ ID NO:5) and pr-7
(8874-TCTTCCCTTTGAGGMGATATGTCATATGMTCC-8907, SEQ ID NO:6), and the
reverse primer, pr-6 (9367-TCTGTGGGAGCCTCMGGGAGMCTC-9342, SEQ ID
NO:7). Primers pr-5 and pr-6 were used to perform the first round
amplification, and pr-6 and pr-7 were used to carry out the second
round of amplification. The same conditions were applied to the
present amplification as those used in the amplification of the
segment from the 5' and of FIV-141 described above.
[0080] In order to clone a segment from the middle part of the
FIV-141 genome, extending from nucleotides 5147 to 5631 and
covering the C-terminal portion of the IN gene and the N-terminal
portion of the Vif gene, a first round amplification was performed
using the forward primer, pr-3
(4738-ACAAACAGATAATGGACCAAATTTTAAAAA-4767, SEQ ID NO:8) and the
reverse primer pr-10 (5631-TTTCAATATCATCCCACATAAATCCTGT-5604, SEQ
ID NO:9). A second round amplification was performed using forward
primer pr-9 (5147-TTAAAGGATGMGAGAAGGGATATTTTCTT-5176, SEQ ID NO:10)
and reverse primer-pr-10.
[0081] After the completion of the second round of PCR
amplification, the products were applied to a 1% agarose gel and
the expected bands for all three regions were purified by a Wizard
PCR Preps kit (Promega, Madison, Wis.). The purified PCR fragments
were cloned into pCR-Script Amp SK(+) vectors (Stratagene, La
Jolla, Calif.) according to the procedure recommended by the
manufacturer. Inserts were confirmed by restriction enzyme
digestion followed by sequencing the two strands of the plasmid DNA
(Advanced Genetic Analysis Center, St. Paul, Minn.). In order to
eliminate "errors" in the FIV sequences generated by the DNA
polymerases during amplification, three clones from three
independent PCR amplifications were sequenced for each region. The
consensus sequence from the three independent clones was considered
as the authentic FIV-141 sequence.
[0082] Combining the sequences from the 5' and 3' end segments
suggests that the long terminal repeat of FIV-141 consists of 354
bases, including 208 bases in the U3 region, 79 bases in the R
region and 67 bases in the U5 region. The terminal 2-base inverted
repeats, the TATA box, the polyadenylation signal, and a number of
putative cis-acting enhancer-promoter elements were perfectly
conserved relative to other FIV isolates.
[0083] PCR Amplification and Cloning of the Entire Proviral Genome
of FIV-141
[0084] Sequence information obtained using the three cloned
segments described above was used to design FIV-141 specific
primers that could be used to amplify and clone the entire proviral
genome in two pieces, the 5' half and the 3' half. Each half was
amplified by two rounds of amplification with a semi-nested set of
primers.
[0085] To amplify the 5' half of the FIV-141 genome (from
nucleotide 1 to 5460), the first round of amplification was
performed using forward primer, . pr-11
(1-TGGGAAGATTATTGGGATCCTGAAGAAATA-30, SEQ ID NO:11) and the reverse
primer pr-10. The amplification protocol followed that provided
with the Advantage Genomic PCR Kit from Clonetech (Palo Alto,
Calif.). Briefly, the PCR reaction was set up in a total volume of
50 ul, containing 1 ul of genomic DNA template (1 ug/ul), 1 ul of
each primer (100 ng/ul), 5 ul of the 10.times. Tth PCR reaction
buffer, 2.2 ul of 25 mM Mg (OAc).sub.2, 1 ul of 50.times. dNTP mix
(10 mM each), 1 ul of 50X Advantage Tth Polymerase mix, 1 ul of Pfu
polymerase (2.5 U/ul), and 36.8 ul of sterile water. The reaction
mix was heated at 94.degree. C. for 2 minutes, followed by 30
cycles of amplification: 94.degree. C. for 30 seconds and
68.degree. C. for 6 minutes. The second round amplification was
carried out using 2 ul of the first round PCR product as template,
the same forward primer pr-11 and the reverse primer, pr-12
(5460-CATATCCTATATAATAATCACGCGTATGAMGCTCCACCT-5421, SEQ ID NO:12).
To facilitate the construction of a full length FIV-141 genome from
the two halves, the restriction enzyme site Mlu I (underlined) was
incorporated into the primer pr-12. The same PCR conditions as used
in the first round amplification were applied in the second round
and resulted in the production of an amplification fragment with
the size of 5460 base pairs.
[0086] To clone the 3' half of the FIV-141 proviral genome, three
primers, pr-9, pr-13 and pr-14, were initially used to perform
amplifications. The first round PCR amplification was carried out
using forward primer, pr-9 and reverse primer, pr-14
(9464-TGCGAGGTCCCTGGCCCGGACTCC-9441, SEQ ID NO:13). The second
round amplification was performed using forward primer, pr-13
(5421-AGGTGGAGCTTTCA TACGCGTGATTATTATATAGGATATG-5460, SEQ ID NO:
14) and the same reverse primer pr-14. Primer pr-13 was designed to
overlap with pr-12 primer used in the amplification of the 5' half
of the genome. As in the pr-12 primer, an Mlu I restriction enzyme
site (underlined) was incorporated into pr-13 to facilitate the
construction of the full-length FIV clone. Unfortunately, after two
rounds of PCR amplification, no specific DNA band was observed. It
was concluded that the failure to amplify the 3' half of the
FIV-141 genome was probably due to the high GC content and very
stable secondary structure in primer pr-14. Therefore, a new
primer, pr-16 (9444-CTCCAGGGATTCGCAGGTAAGAGAAATTA- -9416, SEQ ID
NO:15) was designed. This sequence ends 20 bases upstream of the
last base in the FIV-141 genome. 2A-1.sup.+ and the presence of the
20 bases at the extreme 3' end of FIV-141 was confirmed by
nucleotide sequencing.
[0087] Construction of Consensus Sequence in the 5' and 3' Half
Clones
[0088] In order to establish the consensus sequence in the existing
5' and 3' half clones of the FIV-141 genome, SDM was performed. To
introduce sequence changes in the first half of the genome, one of
the 5' half clones (designated as "pFIV5'-D-11") was used as
template. There were a total of 15 nucleotide changes in
pFIV5'-D-11 compared to the consensus sequence. Two changes were
located in the 5' non-coding region, A602G and A612G, and seven
nucleotide changes in the coding region were silent mutations. The
other six changes in the coding region resulted in an amino acid
substitution for each change, three in the RT region (an A2890G
nucleotide change, resulting in an I to M amino acid substitution;
a G3461A change resulting in an E to K substitution; and a G3737A
change resulting in an E to K substitution), one in the DU protein
(a C4383T change, resulting in a T to I substitution), and two in
the IN protein (an A4579G change, resulting in an I to M
substitution; and an A5007T change, resulting in a Q to L
substitution). Seven oligonucleotides were designed to make the two
changes in the non-coding region and six changes in the coding
region leading to amino acid substitutions. The oligonucleotides
are as follows, with mismatches underlined:
2 Oligo pF-1, designed to repair the A602G and A612G errors:
5'-GATTCGTCGGGGGACAGCCAACAAGGTAGGAGAGATTCTACAGCAACATGGGG-3'; (SEQ
ID NO:18) Oligo pF-2, designed to fix the error A2890G:
5'-TCAATATATGGATGATATCTATATAGGATCAAATTTAAGTAA-3'; (SEQ ID NO:19)
Oligo pF-3, designed to repair the error G3461A:
5'-GTGATATAGCTCTAAGGGCATGTTACAAAATAAGAGAAGAATCCATTATAAGAATAGG-3';
(SEQ ID NO:20) Oligo pF-4 was designed to repair the error G3737A:
5'-CGGGCAGATGGCAGGTAATGGAAATAGAAGGAAGTAATCAAAAAGC-3'; (SEQ ID
NO:21) Oligo pF-5, designed to repair the error C4383T:
5'-AGAAAGGGATTTGGGTCAACTGGAGTCTTTTCTTCATGGGTGGA-3'; (SEQ ID NO:22)
Oligo pF-6, designed to repair the error A4579G:
5'-GGGGGACAATTAAAGATTGGACCTGGCATATGGCAAATGGACTGTACACAC-3'; and (SEQ
ID NO:23) Oligo pF-7, designed to repair the error A5007T:
5'-GGCTCCTTATGAATTATACATACAACAGGAATCATTAAGAATACAAGAC- -3'. (SEQ ID
NO:24)
[0089] In order to make sequence changes in the 3' half of the
genome, the 3' half clone "pFIV3'-2A-1.sup.+" was used as a
template in performing SDM. There were nine changes in the
pFIV3'-2A-1.sup.+ clone compared to the consensus sequence. Two
nucleotide changes in the coding region were silent. The other
seven changes all resulted in an amino acid substitution:
3 Oligo pF-8, designed to repair the error T5508C: (SEQ ID NO:25)
5'-CAAAATAGTTTAAGATTGTATGTTTATATAAGCAAT-3'; Oligo pF-9, designed to
repair the error A6041T: (SEQ ID NO:26)
5'-CAGAAAAGTTAGATAGAGAAGCAGCTATTAGATTGTTTAT-3'; Oligo pF-10,
designed to repair the error A6922G: (SEQ ID NO:27)
5'-TAAAAGCAAATGTTAATATAAGTATACAAGAAGGACCTAC-3'; Oligo pF-11,
designed to repair the error G7007T: (SEQ ID NO:28)
5'-AAAAGCTACAAGGCAATGCAGAAGGGGAAGGATATGGAAG-3'; Oligo pF-12,
designed to repair the error A7814G: (SEQ ID NO:29)
5'-AGAGGACCTTATTGTACAATTTAATATGACAAAAGCAGTGGAAA- 3'; Oligo pF-13,
designed to repair the error A8405T: (SEQ ID NO:30)
5'-CCCTCAATCTGTGGACAATGTATAACATGACTATAAATCA-3'- ; Oligo pF-14,
designed to repair the error A8976G: (SEQ ID NO:31)
5'-GACAACGCAGAAGAAGAAAGAAGAAGGCCTTCAAAAAATT-3'.
[0090] Single stranded DNA template preparations for both clones,
pFIV5'-D-11 and pFIV3'-2A-1.sup.+, were made essentially by the
protocol provided by the manufacturer (Promega, Madison, WI).
Briefly, DNA plasmids of the two clones were transfected into the
E. coli strain CJ236. Single stranded (SS) DNA was rescued using
helper phage R408 and purified by phenol/chloroform extraction.
Purified SS DNA was dissolved in TE buffer with its concentration
being estimated by running 2 ul samples of template preparations on
a 1% agarose gel. Oligonucleotides were phosphorylated according to
the protocol provided by the manufacturer (Gibco BRL, Gaithersburg,
Md.).
[0091] Oligonucleotides were annealed to template in a total
reaction volume of 30 ul. This contained 0.2 pmol of
single-stranded DNA template (pFIV5'-D-11 or pFIV3'-2-A-1.sup.+), 4
pmol of each oligonucleotide (i.e., pF-1 to pF-7 for the
pFIV5'-D-11 template and pF-8 to pF-14 for the pFIV3'-2-A-1.sup.+
template), 3 ul of annealing buffer (0.2 M Tris-HCl, pH 7.4, 20 mM
MgCl.sub.2, and 0.5 M NaCl). The mixture was incubated at
85.degree. C. for 5 minutes and then gradually cooled to room
temperature at a rate of approximately 1.degree. C. per minute.
[0092] In order to synthesize the complementary DNA strand, the
following components were added to the annealing mixture: 3 ul of
synthesis buffer (4 mM of each dNTP, 7.5 mM ATP, 175 mM Tris-HCl,
pH 7.4, 37.5 mM MgCl.sub.2, 215 mM DTT), 3 ul of T4 DNA ligase (3
U/ul), and 3 ul of the diluted T7 DNA polymerase (0.5 units per
ul). The reaction was incubated at 37.degree. C. for 3 hours,
followed by heat inactivation at 68.degree. C. for 10 minutes. Two
ul of the SDM reaction mixture were used to transfect E. coli
DH.alpha.-5 competent cells.
[0093] For the 5' half clone, pFIV5'-D-11, incorporation of one of
the mutagenesis oligonucleotides, PF-5, resulted in an addition of
a Hinc II site. A preliminary screening with Hinc II resulted in
the identification of four positive mutants that were designated as
pFIV5'-D-11/M-4, pFIV5'-D-11/M-22, pFIV5'-D-11/M-28 and
pFIV5'-D-11/M-52. These four mutants were completely sequenced to
verify the incorporation of the other seven desired mutations. The
sequencing results revealed that three of the four clones contained
all eight mutations. One clone, pFIV5'-D-11/M-28, had only seven
positions that were mutated.
[0094] Clone pFIV5'-D-11/M-52 was selected as the 5' half clone to
be used to construct the full length FIV-141 clone. For the 3' half
clone, pFIV3'-2-A-1.sup.+, preliminary screening with BspH I
digestion identified 10 mutants in which a BspH I restriction site
was eliminated due to the incorporation of the mutagenesis
oligonucleotide pF13. Complete sequencing revealed that 8 of the 10
clones contained mutations at all seven desired positions. One of
the mutants, "pFIV3'-2-A-1.sup.+/M-21,"contained all of the 8
changes and was selected to be used as the 3' half clone in
constructing the full length FIV-141 clone.
[0095] Construction of the Full Length FIV-141 Clone In order to
construct the full length FIV-141 clone, a 5.5 kb Mlul/Xhol
fragment derived from the 5' half clone, pFIV 5'-D-11/M-52, was
ligated to the 3' half clone pFIV3'-2-A-1.sup.+/M-21, which had
been digested with the same two restriction enzymes. The full
length ligation product was screened by PCR amplification using a
forward primer directed to the 5' half clone and a reverse primer
directed to the 3' half clone. The forward primer, pr-9, had the
sequence: 5'-(5147)-TTAAAGGATGAAGAGAAGGGATATTTTCTT-(5176)-3' (SEQ
ID NO:10). The reverse primer, pr-10, had the sequence:
5'-(5631)-TTTCAATATCATCCCACATAAATCCTGT-(5604)3', (SEQ ID NO:9).
Positive clones were confirmed by restriction digestion and
sequencing. One of the resulting full length clones was designated
as "pFIV-141-B1" and selected for characterization both in vitro
and in vivo.
Example 2
Demonstration that the Full Length Molecular Clone is
Infectious
[0096] Transfection
[0097] Crandell feline kidney (CRFK) cells were grown in six well
plates to a confluency of 40 to 60%. Transfection was accomplished
by introducing 2 ug of plasmid DNA and following the basic protocol
recommended by Trans IT Polyamine Transfection Reagents (Mirus,
Madison, WI). Briefly, 10 ul of TransIT Lt-1 (Panvera) was mixed
with 1 ml RPMI 1640 medium and incubated at room temperature for 15
minutes. Two ug of plasmid DNA was added to the RPMI/Lt-1 solution
and incubated for another 15 minutes at room temperature. Media was
removed from wells, cells were washed once with PBS, and the DNA
cocktails were added to the cell monolayers. After incubation at
37.degree. C. in a CO.sub.2 incubator for four hours, the DNA
cocktails were removed from the wells and 2 ml of RPMI 1650 medium
supplemented with 3% fetal serum (FS) was added to each well.
Twenty-four hours post-transfection, cell supernatants were assayed
for FIV production, reverse transcriptase (RT) activity and viral
infectivity.
[0098] FIV Production from Transfected CRFK Cells
[0099] Supernatants from the transfected CRFK cells were harvested
on a daily basis after the transfection, and were assayed for FIV
capsid protein production using the FIV Antigen Test Kit (IDEXX,
Portland, Me.), according to the protocol recommended by the
manufacturer. This enzyme immunoassay was designed to detect the
predominant group-associated antigen of FIV p26 capsid protein. FIV
antigen p26 was detected at 24 hours post-transfection (PT),
reached a peak at 72 hours PT, and then decreased to background
levels at 11 days PT (see FIG. 1).
[0100] In order to confirm virus production from the transfected
(CRFK) cells, a reverse transcriptase (RT) activity assay
(Boehringer Mannheim, Indianapolis, Ind.) was performed to detect
virion-associated RT activity in the transfected cell supernatants.
Briefly, 200 ul of cell supernatant was harvested and spun 5
minutes in a microfuge to pellet cells and cell debris.
Supernatants were centrifuged at 20,000 g for 20 minutes at
4.degree. C. in a swinging bucket rotor to pellet FIV virus
particles. Viral particle pellets were resuspended in 40 ul of
lysis buffer from the kit, and assays were then performed as
recommended by the manufacturer. Virus production from transfected
cells was demonstrated in cell supernatants 48 hours
post-transfection (PT).
[0101] Infection of CRFK Cells
[0102] FIV-141 wild type virus does not infect CRFK cells. In order
to determine whether the molecular clone virus exhibits similar
behavior, CRFK cells were grown in 6 well plates and inoculated
with 200 ul of p26+ conditioned medium from transfected CRFK cells.
After incubation for 2 hours at 37.degree. C., cells were washed
once with PBS, and 2 ml of RPMI 1640 medium supplemented with 3% FS
was added to each well. Supernatants were then monitored for virus
production by FIV p26 ELISA every 3 to 4 days post-transfection. It
was found that, similar to the wild type virus, the FIV-141 clone
does not infect CRFK cells.
[0103] Infection of FeP2 Cells by Co-Culture with Transfected CRFK
Cells CRFK cells were grown in 6 well plates and transfected as
described above. At 48 hours post-transfection, 2.times.10.sup.6
FeP2 cells were added to each p26+ transfected well. After
co-culture of cells for 72 hours, FeP2 cells (nonadherent) were
separated from CRFK cells (adherent). The supernatants from the
FeP2 cells were harvested and monitored for virus production by FIV
p26 ELISA every 3 to 4 days. Four days post co-cultivation, high
levels of virus production were demonstrated in the FeP2 cell
supernatants (see FIG. 2). Virus titer reached a plateau 6 days
post-transfection, indicating that the FIV-141 molecular clone
virus is infectious in FeP2 cells. The results also suggested that
infection of CRFK cells is blocked in an early stage of virus
infection, i.e, at the time of the entry of virus into cells.
[0104] Overall, it was concluded that, upon transfection into CRFK
cells, the FIV-141 molecular clone can replicate in the cell, and
virus particles released from the cells are infectious for FeP2 T
lymphocytes.
[0105] Infection of FeP2 Cells by Adsorption
[0106] FeP2 cells (2.times.10.sup.6) were suspended in 200 ul of
p26+ conditioned medium obtained from transfected CRFK cells and
incubated at 37.degree. C. for two hours. Cells were washed with
PBS, suspended in 2 ml Opti-MEM medium supplemented with 10% heat
inactivated FCS, and incubated at 37.degree. C. Supernatants were
harvested and monitored for virus production by FIV p26 ELISA every
three to four days. Four days post-infection, virus release from
infected FeP2 cells was detected in the supernatants and reached a
peak by thr e weeks post-infection (FIG. 3). The results indicate
that productive infection of FeP2 cells by FIV-141 can be achieved
through either adsorption or co-culture with transfected CRFK
cells. Compared to infection by co-cultivation, virus production
reached a plateau much more slowly when infection took place by
adsorption (FIGS. 2 and 3).
Example 3
Mutant FIV-141 Clones and Their Use in Vaccines
[0107] In order to develop FIV-141 vaccine candidates, the
infectious FIV-141 wild-type clone was used to construct a number
of gene-deleted clones. The general criteria for making the mutant
clones are:
[0108] 1. The deletions or mutations introduced into the FIV-141
genome must be severe enough so that virus infectivity is
substantially reduced (attenuated) after the clones are transfected
into cultured cells in vitro or administered to cats in vivo.
[0109] 2. The deletions or mutations introduced into the FIV-141
genome should not abolish the replication competency of the viral
genome, or the ability to express viral proteins at high
levels.
[0110] Other factors to be considered are whether the gene-deleted
genome will integrate into host chromosomes, whether defective
virus particles will form, and the level of viral structural
proteins that will be expressed. Based upon these considerations, a
number of genes and elements were targeted for deletion. Because
viral genome replication was to be maintained, neither the RT nor
PR genes of FIV-141 were mutated.
[0111] A. Deletions in the Gag Region
[0112] The Gag polyprotein contains three virion structural
proteins, MA, CA and NC. Three gene-deletion clones were
constructed with a deletion in each of these proteins.
[0113] MA del Mutation
[0114] Site-directed mutagenesis was performed to create two Spe I
restriction sites in the C-terminal portion of the MA protein using
the 5' half clone pFIV5'-D-11/M-52 as template and the mutagenesis
primers: Mpma-1 (5'-AGTAAAGAAATTGACATGGCGATTACTAGTTTAA
AAGTTTTTGCAGTGGC-3', (SEQ ID NO:32); and Mpma-2
(5'-CCATCTATAAAAGAAAGTGG GACTAGTGAAGMGGACCTCCACAGGC- -3', SEQ ID
NO:33).
[0115] The Spe I sites introduced by the primers are underlined in
the sequences. SDM was performed as discussed previously in order
to repair the putative errors in the 5' and 3' half clones. Mutants
were screened by Spe I restriction digestion and positive clones
were used to construct the deletion clone. Spe I digestion was
performed to release the Spe I fragment and the remaining part of
the clone was self ligated to create the deletion clones. These
were screened by PCR amplification using primer sets flanking the
deleted region and confirmation was obtained by nucleotide
sequencing. The 5' half clone with the deletion was ligated to the
3' half clone pFIV3'-2A-1.sup.+/M-21 to generate the full length
clone with the deletion. This clone was named FIV-141 MA deletion
clone and contained a deletion of 123 bases from nucleotide 879 to
nucleotide 1001, corresponding to 41 amino acids from residues 85
to 125 at the C-terminus of MA.
[0116] CA del Mutation
[0117] SDM was performed to create two Spe I sites in the CA region
of FIV-141 using the 5' half clone pFIV5'-D-11/M-52 as template
and, as primers, Mpca-1 (5'-ATTCAAACAGTAAAT
GGAGCAACTAGTTATGTAGCCCTTGATCCAAAAATG-- 3', SEQ ID NO:34) and Mpca-2
(5'-ACAGCCTTTTCAGCTAATTTAAACTAGTACTGATATGGCTA- CATTAATTATG-3', SEQ
ID NO:35). After deletion of the Spe I restriction fragment, the 5'
half clone was ligated to pFIV3'-2A-1.sup.+/M-21 to generate the
gene-deleted full length clone. This clone has a 114 base pair
deletion from nucleotides 1056 to 1169, corresponding to the 38
amino acids from positions 9 to 46 at the N-terminus of the CA
protein.
[0118] NC del Mutation
[0119] The 5' half clone has unique Sca I and Sma I sites at
nucleotides 1635 and 1876 respectively. The clone was digested with
Sca I and Sma I to release a 242 base pair fragment. The remaining
portion of the 5' half clone was self-ligated and then joined to
the 3' half clone to generate the gene-deleted full length clone.
The deletion consists of 63 bases (21 amino acid residues) in the
CA region, 27 bases (9 amino acid residues) between the CA and NC
protein and 152 bases (51 amino acid residues) at the N-terminal
portion of the NC protein. The deletion also caused a -1 reading
frame shift and, therefore, the C-terminal portion of the NC
protein cannot be expressed by this clone.
[0120] B. Deletions in the ENV Region
[0121] The ENV precursor glycoprotein is processed into two mature
proteins: SU and TM. Six deletion clones were constructed in the
ENV region.
[0122] ENV del Mutation
[0123] SDM was performed to create two BstE II sites in the ENV
region using the 3' half clone pFIV3'-2A-1.sup.+/M-21 as template
and, as mutagenesis primers, Mpenv-1
(5'-ACTATAGTCTATTTACTMCTGGTTACCTGAGATATTTAAT- AAGCCATAG-3', SEQ ID
NO:36) and Mpenv-2 (5'-TACTTATATGCTTGCCTACATTGGGTTACC- GTATAAGAA
ACTGTACTAATAAAA-3', SEQ ID NO:37). The BstE II sites in the primer
are underlined. After deletion of the BstE II fragment, the
self-ligated clone was joined to pFIV5'-D-11/M-52. The resulting
clone has a deletion of 2103 bases from nucleotides 6577 to 8679,
corresponding to the middle 701 amino acids of the ENV protein
(residues 106 to 806). Th N-terminal 105 residues, the majority of
which overlaps the first exon of the Rev protein, and the
C-terminal 45 residues which overlaps with the Rev responsible
element (RRE), were maintained in the deletion clone.
[0124] SU del Mutation
[0125] Two Spe I sites were generated in the SU region of FIV-141
by SDM using clone pFIV3'-2A-1.sup.+/M-21 as template and, as
mutagenesis primers, Mpsu-1 (5'-GAGGTATAAAGG
TAAACAAAAACTAGTGCCATTCATATTATG TTAGCCCTTGC-3', SEQ ID NO:38) and
Mpsu-2 (5'-ACTAACTATAGTCTATTTACTAACAACT- AGTTTGAGATATTTAATAAGCCAT
AGAAAC-3', SEQ ID NO:39). The Spe I fragment was deleted by Spe I
digestion followed by self ligation of the large remaining
fragment. The resulting clone was ligated to pFIV5'-D-11/M-52. This
clone has a deletion of 1509 basis from nucleotides 6577 to 8085,
corresponding to a deletion of 503 amino acids (residues 106 to
608) of the SU protein. The clone maintains the N-terminal 105
amino acids of the SU protein.
[0126] V3/4 del Mutation
[0127] SDM was performed to create two Sph I sites flanking the V3
and V4 region of the SU protein. The clone pFIV3'-2A-1.sup.+/M-21
was used as template along with the mutagenesis primers: Mpenv-5
(5'-ATACCGAAATGTGGATGGTGGAATCAGGCATGCTATTATAAT
AATTGTAAATGGGMGAAGC-3', SEQ ID NO:40) and Mpenv-6
(5'-GCACTATGTACAATTG TTCCTTACAGGCATGCTTCACTATGA-
AAATAGAGGACCTTAT-3', SEQ ID NO:41). Sph I sites are underlined.
After digestion to remove the Sph I fragment, the clone was
self-ligated and then joined to pFIV5'-D-11/M-52. This clone
contains a deletion of 432 bases from position 7339 to 7770,
corresponding to a deletion of 144 amino acids (from residue 360 to
503) of the SU protein, covering the V3 and V4 regions.
[0128] V7/8 del Mutation
[0129] SDM was used to create two Sph I sites flanking the V7 and
V8 region of the TM protein. This was accomplished using the clone
pFIV3'-2A-1.sup.+/M-21 as template and the mutagenesis primers
Mpenv-7 (5'-GAATCAATTCTTTTGTAAGATCGCATGC
AATCTGTGGACAATGTATAACATGACTA-3', SEQ ID NO:42) and Mpenv-8
(5'-GGGAAAATTGGGTGGGATGGATAGGTAAGATCGCATGCTATTTAAAAGGA- CTTCTTGGT
AG-3', SEQ ID NO:43). Sph I sites are underlined. Digestion with
Sph I resulted in the elimination of 216 bases from nucleotides
8380 to 8595, and was followed by ligation of the large fragment.
The resulting clone was then joined to the 5' half clone
pFIV5'-D-11/M-52 to generate "V7/8 del." This contains the deletion
of 72 amino acids (from residues 98 to 169) of the TM protein
covering the V7 and V8 various regions.
[0130] TMf del Mutation
[0131] The 3' half clone of FIV-141 has a unique Age I site at
nucleotide 8145. SDM was performed to create a second Age I site at
position 8071. The 3' half clone was used as template along with
the mutagenesis primer, Mpenv-3 (5'-GGAAGAAGTTATGAG
GTATACCGGTAAACAAAAAAGGGCC-3', SEQ ID NO:44). A 75-base fragment
between the two Age I sites was deleted by restriction enzyme
digestion followed by self-ligation of the large restriction
fragment. The resulting clone was ligated to the 5' half clone to
generate "TMf del." This contains a deletion of 25 amino acids in
the cleavage junction between the SU and TM proteins. The deleted
amino acids include 6 C-terminal residues of the SU protein (4 of
which are basic (either K or R) and required for the processing of
the SU/TM cleavage site) and 19 N-terminal residues of the fusion
peptide of the TM protein (required for membrane fusion between
virion envelope and cell membrane).
[0132] CT del Mutation
[0133] was performed to truncate the cytoplasmic tail of the TM
protein using the 3' half clone pFIV3'-2A-1.sup.+/M-21 as template
and the mutagenesis primer, Mpenv4
(5'-CTACTTATATGCTTGCCTACATTGGTCGACTGATAGTGAAAC- TGTACTAATAAAATATTGG
G-3', SEQ ID NO:45). A Sal I restriction site (underlined) was
incorporated into the oligonucleotides by silent mutation to
facilitate the screening of mutants. Three tandemly repeated
translation stop codons (italicized) were incorporated in the
primer right after the transmembrane domain of the TM protein. The
resulting clone was ligated to the 5' half clone to generate "CT
del." This has a 138-base truncation from nucleotides 8686 to 8823
(corresponding to a truncation of 46 amino acids from the
cytoplasmic domain of the TM protein).
[0134] C. Deletions in the Pol Region
[0135] The Pol polyprotein consists of four enzymatic proteins: PR,
RT, DU, and IN. Two deletion clones were constructed in the Pol
region.
[0136] DU del Mutation
[0137] SDM was performed to create two Spe I sites in the DU region
using the 5' half clone. pFIV5'-D-11/M-52 as template and, as
mutagenesis primers, Mpdu-1 (5'-GATGGTTATAGA
AGGTGAAGGAATTACTAGTAAAAGATCAGAAGATGCAGGA- TATG-3', SEQ ID NO: 46)
and Mpdu-2 (5'-GAAATAATAATGGATTCAGAAAGAGGAACTAGTGG-
ATTTGGGTCAACTGGA GTCTTTTC-3', SEQ ID NO:47). Spe I sites in the
primers are underlined. A deletion of 345 bases from nucleotide
4019 to 4363 was achieved by Spe I digestion followed by
self-ligation of the large restriction fragment. The resulting
clone was joined to the clone pFIV3'-2A-1.sup.+/M21 to generate "DU
del." The clone contains a deletion of 115 amino acids
corresponding to almost the entire DU protein.
[0138] IN del Mutation
[0139] Two Spe I sites were created by SDM in the IN region of
FIV-141 using pFIV5'-D11/M-52 as template and the mutagenesis
oligonucleotides, Mpin-1
(5'-CTTCATGGGTGGACAGAATTGAAACTAGTGTATTAAATCATGAAAAATTTCACTCAG-3',
SEQ ID NO:48) and Mpin-2 (5'-GCAATGGGTGTATTATAAAGATCAGACTAGTAA
AAAGTGGAAGGGACCAATGAGAGTAG-3', SEQ ID NO:49). Spe I sites in the
primers are underlined. After deletion of the Spe I fragment and
self ligation, the resulting clone was joined with
pFIV3'-2A-1.sup.30 /M-21 to generate "IN del." This contains a
deletion of 669 bases from nucleotide 4418 to 5036 corresponding to
almost the entire IN protein (223 amino acids, from residue 9 to
231 of IN).
[0140] D. Deletions in Regulatory Genes or Elements
[0141] Three regulatory proteins identified in FIV are Rev, Vif and
ORF2. A Rev-responsible element has been reported at the 3' end of
the FIV genome. Five deletion clones were constructed in these
regions.
[0142] Vifn del Mutation
[0143] A unique Mlu I site was introduced in the middle of the Vif
gene in the 5' half clone pFIV 5'-D-11/M-52. SDM was performed to
create a second Mlu I site at the N-terminus of the Vif gene using
pFIV3'-D-11/M-52 as template and the mutagenesis primer, Mpvif-1
(5'-AG AAGACTCTTTGCAGTTCTCCAATGAACGCGTTAGAGTGCCATGTTATACATATCG-3',
SEQ ID NO:50). The Mlu I site in the primer is underlined. A
restriction fragment of 150 bases from nucleotide 5286 to 5435 was
deleted by Mlu I digestion followed by self ligation of the large
fragment. The resulting deletion clone was joined to
pFIV3'-2A-1.sup.+/M-21 to generate "Vifn del." This contains a
deletion of 50 amino acids (from residue 19 to 68) at the
N-terminal portion of the Vif protein.
[0144] Vifc del Mutation The 3' half clone pFIV3'-2A-1.sup.+/M-21
has a unique Mlu I site within the Vif region. A second Mlu I site
was created by SDM at the C-terminus of the Vif protein using
pFIV3'-2A-1.sup.+/M-21 as template and the mutagenesis primer
Mpvif-2 (5'-CGTGTGGCAAAGAGGC TAAAACGCGTAGAGGCTGTTGTAATCAG-3', SEQ
ID NO:51). The Mlu I site in the primer is underlined. After
deletion of the Mlu I fragment, the resulting clone was ligated to
the 5' half clone pFIV5'-D-11/M-52 to generate "Vifc del." This
contains a deletion of 438 bases from nucleotide 5436 to 5873,
corresponding to a deletion of 146 amino acids (from residue 69 to
214) at the C-terminal portion of the Vif protein.
[0145] Vif del Mutation
[0146] To construct "Vif del," the Xho I/Mlu I restriction fragment
of Vifc del was replaced with a 5.3 kb Xho I/Mlu I fragment of Vifn
del. The resulting clone contains a deletion of 588 bases from
nucleotide 5286 to 5873, corresponding to a deletion of 196 amino
acids (from residue 19 to 214), almost the entire Vif protein.
[0147] ORF(2) del Mutation
[0148] Two Mlu I sites were created by SDM at nucleotides 5988 and
6224 (at the N- and C-termini of ORF(2)). This was accomplished
using pFIV3'-2A-1.sup.+/M-21 as template and, as mutagenesis
primers, Mporf-1 (5'-GTGGACGGGAGAATTATGAACGCGTGAACTAATC
CCACTGTTTAATAAGGTTACAG-3', SEQ ID NO:52) and Mporf-2 (5'-CTACATTATC
CATAAATACTGCCTAGACGCGTTTCTTTT AATATTTCATCTGCAG-3', SEQ ID NO: 53).
Mlu I sites in the primers are underlined. In addition to the two
Mlu I sites created by SDM, there is an Mlu I site at nucleotide
5436 in the clone. To construct "ORF(2) del," a 5.4 kb Mlu I/Xho I
fragment from the 5' half clone pFIV5'-D-11/M-52 was ligated to the
large Mlu I/Xho I fragment of the 3' half clone
pFIV3'-2A-1.sup.+/M-21. A 552 base Mlu I fragment from '5436 to
5988 was then inserted into the resulting clone. ORF(2) del
contains a deletion of 237 bases, covering the entire ORF(2)
gene.
[0149] RRE del Mutation
[0150] SDM was performed to create two Spe I sites in the RRE
region using pFIV3'-2A-1.sup.+/M-21 as template and the mutagenesis
primers, Mprre-1 (5'-GGCATATCTGAA
AAAGAGGAGGAATGAACTAGTATATCAGACCTGTAGAATACA-3', SEQ ID NO:54) and
Mprre-2 (5'-GAGGAGGATGTGTCATATGMTCAAATACTAGTCAAAAATAACAGTAAAAT- CT
ATATTG-3', SEQ ID NO:55). Spe I sites in the primers are
underlined. Deletion of the Spe I fragment was achieved by Spe I
digestion followed by self ligation of the large fragment. The
resulting deletion clone was ligated to pFIV5'-D-11/M-52 to
generate "RRE del." This contains a deletion of 84 bases from
nucleotide 8827 to 8910.
[0151] E. Double Deletions
[0152] FIV-141 MA del clone was digested with Xho I and BstE II,
and a 4.8 kb DNA fragment containing the first half of the FIV-141
genome was purified and used for the construction of the three
double deletion clones, MA del/TMf del, MA del/V3/4 del, and MA
del/Vif del, as follows.
[0153] MA del/Tmf del Mutation
[0154] FIV-141 Tmf del clone was digested with the same two
restriction enzymes and a 7.8 kb fragment, which contains the
second half of the FIV-141, was isolated and purified. Ligation of
the 4.8 kb and 7.8 kb fragments resulted in a double deletion
clone, i.e., FIV-141 MA del/Tmf del, which consists of deletions of
41 amino acids at the C-terminus of the MA and 25 amino acids in
the fusion peptide of TM.
[0155] MA del/V3/4 del Mutation
[0156] FIV-141 V3/4 del clone was digested with Xho I and BstE II,
and a 7.8 kb fragment comprising the second half of the FIV-141
genome was purified and ligated to the 4.8 kb fragment derived from
the FIV-141 MA del clone. The resulting double deletion clone,
i.e., FIV-141 MA del/V3/4 del, contains a deletion of 41 amino
acids at the C-terminus of MA and a deletion of 144 amino acids of
the V3 and V4 regions within the ENV.
[0157] MA del/Vif del Mutation
[0158] FIV-141 Vif del clone was digested with Xho I and BstE II
and a 7.8 kb fragment containing the second half of the genome was
purified and ligated to the same 4.8 kb fragment derived from the
FIV-141 MA del clone. The resulting double deletion clone, i.e.,
FIV-141 MA del/Vif del, has a deletion of 41 amino acids at the
C-terminus of MA and a deletion of 196 amino acids of Vif.
[0159] ENV del/IN del Mutation
[0160] Plasmid DNA comprising the FIV-141 ENV del clone prepared as
above was digested with Mlu I and Sal I, and a 2 kb fragment
containing the second half of the FIV-141 genome with a deletion of
2.1 kb of the ENV gene was isolated and purified. FIV-141 IN del
clone prepared as above was digested with the same two restriction
enzymes, and a 4.7 kb fragment consisting of the first half of the
FIV-141 genome with a deletion of the IN gene was purified. The two
fragments were ligated and cloned into the pCR-Script Amp SK(+)
vector. The resulting double deletion clone, FIV-141 ENV del/IN
del, contains a deletion of 2103 bases in the ENV gene and a
deletion of 669 bases in the IN gene.
Example 4
Characterization of the FIV-141 Gene Deletion Clones
[0161] A. Viral Protein Expression and/or Defective Virus
Production
[0162] Each plasmid of the deletion clones was transfected into
CRFK cells as previously described. FIV p26 ELISA assays were
performed to detect viral protein expression and/or virus particle
production in the transfected cell supernatants. At 48 hours
post-transfection, samples from 13 of the constructs were found to
produce a strong positive signal comparable to that observed for
the wild type FIV-141 molecular clone (see FIG. 4). The highest
levels of virus particle production were observed for the six
deletion clones in the ENV region, including ENV del, TMf del, SU
del, CT del, V3/4 del and V7/8 del.
[0163] Comparable levels of virus particle production were obtained
for seven other deletion clones, including three deletion clones in
the Vif region (Vifn del, Vifc del and Vif del), MA del, DU del, IN
del and ORF(2) del. The results indicate that the deletions carried
by these 13 clones do not interfere with the formation and release
of virus particles from the transfected cells. A relatively weak
positive signal was detected for NC del, indicating that deletion
in this region affects virus particle assembly or release.
[0164] No virus particle production was detected in the
supernatants of cells transfected with CA del or with RRE del. The
deletion in the C-terminus of the CA protein may either abolish
virus particle formation or result in loss of the epitope
recognized by the monoclonal antibody (MAb) used in the p26 ELISA
kit. As expected, deletion in the RRE region resulted in a block of
the export of unspliced viral RNA from the nucleus to the
cytoplasm, leading to either a total lack of, or a dramatic
decrease in, the expression of viral structural proteins.
[0165] B. Intracellular RT-PCR to Detect Viral RNA Expression
[0166] Intracellular RT-PCR was performed to detect viral RNA
expression in the two deletion clones, CA del and RRE del. Plasmid
DNA for each clone was transfected into different CRFK cells.
Forty-eight hours after transfection, total RNA was isolated from
the transfected cells using an RNeasy kit (Qiagen, Chatsworth,
Calif.). The RNA was eluted in 50 ul of DEPC water, and 2 ul of
each RNA sample was used to synthesize the first strand of cDNA
using Superscript II (Gibco BRL, Gaithersburg, Md.).
[0167] A 585 base pair fragment from nucleotides 2958 to 3542 was
amplified using as a forward primer Sp-8
(5'-TATTATGGTGGGGATTTGAAAC-3', SEQ ID NO:56) and, as a reverse
primer, Sp-20 (5'-TAATTAGATTTGATTCCCAGGC-- 3', SEQ ID NO:57). Two
ul of cDNA from each reaction and, as. a control, 2 ul of total RNA
from each preparation, were used as the template in PCR reactions.
Each reaction was performed in a volume of 100 ul using a PCR
amplification kit (Gibco BRL, Gaithersburg). The reaction proceeded
as follows: 25 cycles at 94.degree. C. for 30 seconds; 55.degree.
C. for 30 seconds; and 72.degree. C. for another 30 seconds. Ten ul
from each reaction was loaded on a 1% agarose gel. A specific band
with the expected size was observed for both CA del and RRE del
clones, indicating that viral RNA expression occurred in the cells
transfected with these clones. The results suggest that the failure
to detect p26 protein expression by ELISA for CA del is probably
due to either a failure of virus particle formation or a lack of
the epitope recognized by the antibody used in the p26 ELISA assay.
For the RRE deletion clone, viral gene expression was demonstrated
by intracellular RT-PCR, but no p26 protein expression was detected
using the ELISA assay. The discrepancy may reflect a much higher
sensitivity of RT-PCR assay when compared to the ELISA.
[0168] C. Encapsidation of Viral Genome and RT Enzyme in the
Defective Virus Particles
[0169] Transfection of CRFK cells by the majority of the FIV-141
deletion clones resulted in the production and release of defective
virus particles. In order to determine whether gene-deleted viral
genomes and RT protein were encapsidated into virus particles,
virion-associated RT PCR and RT activity assays were performed.
Briefly, 48 hours post-transfection, 200 ul of the supernatant from
each transfected CRFK culture were harvested and spun 5 minutes in
a microfuge to pellet cells and cellular debris. The virus
particles in the supernatants were pelleted by ultracentrifugation
at 20,000 g for 20 minutes at 4.degree. C. in a swinging bucket
rotor. To test for encapsidation, virus pellets were resuspended in
350 ul RLT buffer from the RNeasy kit, and viral RNA was purified
by elution in 50 ul DEPC water as recommended by the manufacturer.
First strand cDNA was made using Superscript II, and PCR
amplification was performed as described previously using the Sp-8
and Sp-20 primer set.
[0170] Fourteen of 16 deletion clones showed a specific band after
RT-PCR amplification, indicating that transfection of CRFK cells by
these clones produced defective virus particles and that the
gene-deleted viral genomes were encapsidated. The 14 clones
consisted of 6 clones from the ENV region (including ENV del, TMf
del, SU del, CT del, V3/4 del, and V7/8 del); 3 clones from the Vif
region (Vifn del, Vifc del, and Vif del); 2 clones from the Pol
region (DU del and IN del); 2 clones from the regulatory
gene/element region (ORF(2) del and RRE del); and 1 clone from the
Gag region (MA del). Consistent with the p26 ELISA data, CA del
showed a negative signal in the virion-associated RT-PCR assay. The
NC protein is required for the packaging of the viral genome into
the virion and, as expected, no virion-associated gene-deleted
viral RNA genome was detected by RT-PCR for NC del. For RRE del,
virion-associated gene-deleted viral RNA was demonstrated to be
present but no virus particle production was detected using the p26
ELISA assay. The discrepancy in these results may again reflect a
much higher sensitivity of the RT-PCR assay relative to the
ELISA.
[0171] For testing encapsidation of the RT (i.e. reverse
transcriptase) enzyme in defective virus particles, virus pellets
were resuspended in 40 ul of the lysis buffer from the RT ELISA
kit, and the assay was allowed to proceed as recommended by the
manufacturer. Consistent with data obtained using p26 ELISA assays
and virion-associated RT-PCR assays, virion-associated RT activity
could be detected for 14 deletion clones, including ENV del; SU
del; TMf del; V3/4 del; V7/8 del; CT del; MA del; DU del; IN del;
Vifn del; Vifc del; Vif del; ORF(2) del; and NC del. No
virion-associated RT activity was detected in the CA or RRE
deletion clones.
[0172] D. Infectivity of the FIV-141 Gene-Deleted Clones In
Vitro
[0173] CRFK cells were grown in six well plates and transfected as
described previously. Forty-eight hours after transfection,
2.times.10.sup.6 FeP2 cells were added to each well. After
cocultivation of the cells for 72 hours, FeP2 cells.were separated
from CRFK cells and the supernatants from FeP2 cell cultures were
harvested and monitored for virus production using the FIV p26
ELISA assay every 3 to 4 days for a total of 4 to 6 weeks.
[0174] Twelve deletion clones were found to have no significant
level of p26 capsid protein expression during the monitoring
period. These included: ENV del; TMf del; and NC del (FIG. 5); 3
deletion clones from the Vif region (Vifn del; Vifc del; and Vif
del) (FIG. 6); the MA and CA deletion clones (FIG. 7); the V3/4,
V7/8 and CT deletion clones (FIG. 8); and the ORF(2) deletion clone
(FIG. 9). The results indicate that deletions introduced into these
clones totally abolish the infectivity of the virus in the FeP2
cells. Moderate levels of virus replication were detected for four
deletion clones including DU del; SU del; IN del; and RRE del (FIG.
10).
[0175] E. Conclusions
[0176] ENV del
[0177] The ENV deletion clone, which has a deletion of 701 amino
acids in the middle of the ENV protein (residues 106 to 806),
totally lost the ability to infect FeP2 cells. Nevertheless, it
maintained the ability to assemble and release defective virus
particles, to encapsidate the viral genome, and to reverse
transcribe RNA. The primary function of the ENV protein is to
mediate virus entry into target cells during the early stage of
infection. Deletion of the majority of the ENV protein may block
virus entry and, hence, virus infectivity.
[0178] TMf del
[0179] The TMf deletion clone, containing a 25 amino acid deletion
in the cleavage junction between the SU and TM proteins, is
non-infectious in FeP2 cells. The deletion may block the cleavage
processing of the ENV precursor protein, and this may result in a
failure of viral particles to bind to and enter target cells. It
has been reported that removal of the cleavage site of the ENV
glycoprotein of FIV results in the expression of an uncleaved ENV
precursor protein. However, the expressed recombinant protein
maintains its antigenic properties, as evidenced by its interaction
with monoclonal antibodies as determined using Western Blots and
radioimmunoprecipitation assays (Rimmelzwaan et al., 1994, J. Gen.
Virol. 75:2097-2012). Upon transfection into CRFK cells, the
deletion clone produces defective virus particles at a level
comparable to a wild type FIV-141 clone. The defective viral genome
and RT enzymes were encapsidated in the defective virions.
[0180] SU del
[0181] SU del had a deletion of 503 amino acids from residue 106 to
608 of the SU protein. It was found to maintain levels of virus
particle production approximately equal to that of the wild type
clone. Both the gene-deleted viral genome and RT enzyme were
encapsidated. However, in contrast to ENV del, cells transfected by
SU del produced virus particles that are infectious in the FeP2
cells, although to a much lesser extent than the wild type virus.
Thus, it appears that deletion of the SU protein from the FIV-141
genome attenuated the virus. It is believed that FIV binding to
cellular receptors, which is the first step in virus infection, is
mediated by the SU protein when associated with the TM protein. The
mechanism by which the mutant virus binds to and enters target
cells is unknown. An alternative pathway for the mutant virus to
enter host cells may be responsible for the observed lower
infectivity associated with the deletion clone.
[0182] V3/4 del and V7/8 del
[0183] One hundred forty-four amino acids from residues 360 to 503
of the SU protein (covering the V3 and V4 variable regions), and 72
amino acids from residues 98 to 169 of the TM protein (encompassing
the V7 and V8 regions) were deleted in V3/4 del and V7/8 del
respectively. Upon transfection into CRFK cells, each clone
produced defective virus at levels similar to that observed for the
wild type clone. As with other ENV-related deletion clones, V3/4
del and V7/8 del encapsidated their gene-deleted viral genomes and
RT enzymes into virions. The infectivity assay indicated that
deletion of the V3 and V4 region of SU, and deletion of the V7 and
V8 region in the TM protein, totally abolished virus infectivity in
the FeP2 cells. The V3 variable region is the immunodominant domain
and has been reported to be involved in multiple functions,
including virus tropism, viral pathogenesis, and neutralizing
epitopes. It is not presently clear at which step viral infection
was blocked in these two deletion clones.
[0184] CT del
[0185] The TM protein of FIV has a relatively long cytoplasmic tail
(46 amino acids in length). Truncation of this tail in CT del clone
resulted in a loss of infectivity of the virus in FeP2 cells.
However, truncation had no effect on virus particle formation and
encapsidation of the viral genome and RT protein. A specific
functional interaction between MA and the TM cytoplasmic tail has
been reported for FIV as well as for HIV-1. This interaction has
been proposed to be important for the incorporation of the ENV
protein into virions. Truncation of the cytoplasmic domain in CT
del may eliminate the functional interaction between the MA and TM
proteins, thereby blocking the incorporation of ENV.
[0186] MA del
[0187] MA del contains a 41 amino acid deletion from residues 85 to
125 at the C-terminus of the MA protein. Upon transfection into
CRFK cells, the clone produced defective virus at a level
comparable to that produced using the wild type FIV-141 clone. This
indicates that deletion at the C-terminus domain has no significant
effect on virus particle assembly and release. The gene-deleted
viral genome and RT protein were encapsidated in the defective
virus particles. When these virus particles were released from
transfected CRFK cells, they were non-infectious with respect to
FeP2 cells.
[0188] CA del
[0189] A deletion of 38 amino acids from residues 9 to 46 at the
N-terminus of CA protein abolished viral particle formation, as
evidenced by a negative signal in the p26 ELISA assay, the
intra-virion RT PCR assay, and the RT activity assay. However,
intracellular RT PCR from the transfected CRFK cells demonstrated
that the deletion did not block viral RNA expression. Therefore,
the failure to detect p26 protein or defective virus production in
the supernatants of transfected cells is due to the block in viral
particle assembly, not in viral protein expression.
[0190] NC del
[0191] The entire NC protein was deleted in the NC del clone. Cells
transfected with this clone produced defective virus at a
significantly reduced level compared to the wild type clone,
indicating that deletion impaired viral particle assembly or
release. It has been reported that the NC protein of HIV-1 is not
required for the assembly of virus-like particles. The deletion in
the NC clone did not effect the packaging of the RT enzyme into
defective virions. As expected, no viral genome was encapsidated in
the viral particles.
[0192] Vif del, Vifc del and Vifn del
[0193] Three deletion clones were constructed in the Vif gene,
i.e., Vifn del, Vifc del, and Vif del. Vifn had a deletion of 50
amino acids at the N-terminal portion of the Vif protein. Vifc had
a deletion of 146 amino acids at the C-terminal region of the
protein, and Vif del had a deletion of almost the entire Vif
protein. All three clones exhibited similar properties. Cells
transfected with any of the three clones produced virus particles
at a comparable rate to the wild type FIV141 clone. Both viral
genomes and RT enzyme were encapsidated in virions for all three
clones. Virions released from CRFK cells transfected by the three
clones were non-infectious with respect to FeP2 cells, indicating
that Vif is required for virus replication in T lymphocytes.
[0194] ORF(2) del
[0195] The entire open reading frame of ORF(2) was deleted in the
ORF(2) deletion clone. Cells transfected with the clone assembled
and released viral particles at a comparable rate to the wild type
clone. Although both viral genome and RT enzyme were packaged in.
the viral particles, the clone failed to replicate in FeP2 cells,
suggesting that the gene product of ORF(2) is required for virus
production in these cells.
[0196] RRE del
[0197] Eighty-four of the 150 total bases comprising the RRE
sequence of FIV were deleted in RRE del. This deletion severely
impaired viral structural protein expression and the production of
viral particles in transfected cells. No p26 production in the
supernatants of transfected CRFK cells was detected. Similarly, no
packaged RT activity was measured. These results are in good
agreement with the proposal that the RRE sequence is required for
the export of unspliced and single-spliced viral RNA from the
nucleus to the cytoplasm of cells. However, virion-associated viral
genomic RNA was demonstrated to be present by RT PCR and the viral
particles were infectious in FeP2 cells, although at a markedly
reduced level compared with the wild type FIV-141 clone. Taken as a
whole, these results indicate that deletion of the RRE sequence
dramatically decreases the expression of viral structural proteins.
However, it appears that the deletion did not totally abolish
expression, and a trace amount of infectious virion particles was
produced by the transfected cells.
[0198] IN del
[0199] Almost the entire IN protein was deleted in the IN del
clone. Upon transfection into CRFK cells, the clone exhibited a
level of viral protein expression and viral particle production
comparable to that of the wild type clone. Virion-associated RT PCR
and RT activity assays indicated that both viral genomic RNA and RT
enzyme were packaged into viral particles. Surprisingly, the
virions recovered from the cells transfected with the clone were
infectious and could replicate in FeP2 cells, although at a reduced
level compared with the wild type virus. Integration is an obligate
step required for productive infection of a number of retroviruses,
including HIV-1. The data suggest that the IN protein of FIV, in
contrast to HIV, may not be an obligate requirement for viral
protein expression and viral replication in FeP2 cells.
[0200] DU del
[0201] Almost the entire DU gene was deleted in the DU del clone.
The product of this gene converts dUTP into dUMP. Deletion of the
DU gene in the clone did not affect viral protein expression or
viral particle production in transfected CRFK cells. Both viral
genome and RT enzyme were encapsidated, and the virions produced
from transfected cells were infectious for FeP2 cells. However, the
deletion clone replicated in FeP2 at a slower rate than the wild
type FIV-141 virus. This indicates that the DU gene is required for
maximum replication of the virus. The data is consistent with
reports that DU deleted FIV maintains its ability to propagate in T
lymphocytes.
Example 5
Efficacy of Gene-Deleted FIV-141 Vaccines
[0202] Production of gene-deleted FIV-141 plasmid DNA for
vaccination
[0203] Production of bulk purified plasmid DNA for vaccination was
contracted to DNA Technologies, Inc., Gaithersburg, MD. Coded
samples of each clone transformed into Stbl2 E. coli cells were
sent to DNA Technologies, and each clone was grown in approximately
10 liters of LB medium. Supercoiled plasmid DNA was isolated by
double CsCl density gradient centrifugation followed by extensive
dialysis. The final purified DNA was dissolved in phosphate
buffered saline (PBS) with 1 mM EDTA at a concentration of 2-5
.mu.g/.mu.l. Restriction digestion and endotoxin test were
performed for each plasmid DNA preparation.
[0204] Vaccination and Challenge
[0205] Eleven experimental vaccines were prepared from plasmid DNA
described above. The appropriate volume of stock DNA from each
construct was dissolved in sterile PBS (GIBCO) to give 300 .mu.g
DNA in a 2 mL dose (Table 2). Placebo vaccine was also assembled
using the pCR-Script SK(+) vector DNA.
[0206] Antibody-profile defined, barrier-reared domestic shorthair
cats (approximately 8 weeks of age) were obtained from Liberty
Research, Inc.(Waverly, N.Y.). The cats were vaccinated with killed
vaccines to feline herpes virus, feline calicivirus, and feline
parvovirus virus. Ten cats were randomly assigned by litter and sex
to 13 groups prior to vaccination (Table 2)
4TABLE 2 Group Vaccine Vol/Dose Challenge Cat number 1 ENV del 2
ml/300 .mu.g Yes 10 2 CA del 2 ml/300 .mu.g Yes 10 3 Vif del 2
ml/300 .mu.g Yes 10 4 IN del 2 ml/300 .mu.g Yes 10 5 ORF(2) del 2
ml/300 .mu.g Yes 10 6 MA del 2 ml/300 .mu.g Yes 10 7 Tmf del 2
ml/300 .mu.g Yes 10 8 V3/4 del 2 ml/300 .mu.g Yes 10 9 V7/8 del 2
ml/300 .mu.g Yes 10 10 MA del/Tmf del 2 ml/300 .mu.g Yes 10 11 MA
del/V3/4 del 2 ml/300 .mu.g Yes 10 12 Placebo 2 ml/300 .mu.g Yes 10
13 Placebo 2 ml/300 .mu.g No 10
[0207] Three vaccinations were administered at 4-week intervals
when cats were 8, 12 and 16 weeks of age. Vaccines were
administered into the quadriceps muscle (IM). Each 2 ml dose was
divided equally between the muscles on the two hind legs. Four
weeks following the last vaccination, all vaccine groups and one
placebo group were challenged subcutaneously in the nape of the
neck with FIV-141 virus at a dose of 354 TCID50 when cats were 20
weeks of age. The second placebo vaccine group received a placebo
challenge of Hank's balanced salt solution. Cats were observed for
12 weeks post-challenge.
[0208] Evaluation of Vaccine Efficacy
[0209] Similar to HIV-1 disease progression (Graziosi et al., 1993,
Proc. Natl. Acad. Sci 90:6405-6409), FIV RNA load in plasma has
been demonstrated to correlate with disease stage and can predict
disease progression in accelerated FIV infection (Diehl et al.,
1995, J. Virol. 69:2328-2332; Diehl et al., 1996, J. Virol.
70:2503-2507). In this study, peripheral blood was drawn weekly for
monitoring efficacy of the vaccination for 12 weeks post-challenge.
Plasma viral loads were determined by quantitative
competitive-reverse transcription-polymerase chain reaction
(QcRT-PCR).
[0210] 1. Quantitation of Viral RNA in Plasma by QcRT-PCR
[0211] Viral RNA was isolated from plasma samples using a QlAmp
Viral RNA Purification Kit (Qiagen). Each purified RNA sample was
distributed into four tubes, and into each tube was added an
internal competitive RNA template with decreasing amounts of RNA
(from 1000 fg, 100 fg, 10 fg to 1 fg). RNA samples were subjected
to RT-PCR using a Titan One Tube RT-PCR System (Boehringer
Mannheim). A one-step PCR protocol from the manufacturer was
performed with minor modifications to increase the sensitivity of
the assay. The RT-PCR reaction was set up in a total volume of 38.5
.mu.l containing: 6.5 mM DTT, 0.3 units RNase inhibitor, 0.3 mM
dATP, 0.3 mM dGTP, 0.3 mM dTTP, 0.3 mM dCTP, 10.4 ng of each FIV
specific oligonucleotide, i.e., QPCR-11 (forward primer
1392TGTAGAGCATGGTATCTTGMGCATTAGGAAA-1423) (SEQ ID:58) and QPCR-02
(reverse primer 2175-GTTCCTCTCTTTCCGCCTCCTACTCCMTCATATT-2141) (SEQ
ID:59), 1.95 mM MgCl.sub.2, and 1 ul of Titan Enzyme Mix. RT-PCR
amplification conditions were 50.degree. C. for 90 min; 94.degree.
C. for 3 min; followed by 30 cycles of denaturing at 94.degree. C.
for 30 sec, annealing at 55.degree. C. for 1 min, and extension at
72.degree. C. for 2 min; followed by 72.degree. C. for 10 min.
[0212] Each PCR sample was separated on a 1.0% agarose gel and
stained with ethidium bromide. Quantitation of viral RNA load was
determined by comparing the intensity of the positive DNA band with
that of the internal competitive standard control DNA band using
the Gel-Doc system (Bio-Rad Laboratories).
[0213] 2. Viral Load in Plasma Post-Challenge
[0214] Compared with the non-vaccinated (placebo) challenged group,
cumulative viral RNA load in plasma was decreased in most of the
vaccinated groups including those vaccinated with FIV-141 ENV del,
CA del, V3/4 del, Vif del, MA del/Tmf del, MA del/V3/4 del, IN del
and Tmf del vaccines (FIG. 11). The most significant decrease in
plasma viral RNA load was achieved in group 1, which was vaccinated
with FIV-141 ENV del vaccine. Group 1 exhibited a 10-fold decrease
in cumulative plasma viral load over a period of 12 weeks
post-challenge (FIG. 11). Following group 1 in response is group 2,
which was vaccinated with FIV-141 CA del. An approximately 8-fold
decease in plasma viral RNA load was observed in this group. Cats
in groups 8, 10, 11 and 3 vaccinated with FIV-141 V3/4 del, MA
del/Tmf del, MA del/V3/4 del and Vif del, respectively, showed a
decrease of approximately 4-fold in plasma viral load. Cats in
groups 4 and 7 vaccinated with FIV-141 IN del and Tmf del,
respectively, exhibited a 2-3 fold decrease in plasma viral load.
Viral RNA loads were slightly decreased in groups 5 and 9
vaccinated with FIV-141 ORF(2) del and V7/8 del vaccine,
respectively. Vaccination enhancement of viral infectivity was
observed in group 6, which was vaccinated with FIV-141 MA del,
where the plasma viral load was increased about 50% over that of
the non-vaccinated (placebo) challenged group. Thus, decreases in
plasma viral load were demonstrated in several groups vaccinated
with a vaccine of the present invention, especially the group
vaccinated with FIV-141 ENV del vaccine.
[0215] Deposit Of Biological Materials
[0216] The following biological materials were deposited with the
American Type Culture Collection (ATCC) at 12301 Parklawn Drive,
Rockville, Md., 20852, USA, on Jul. 1, 1998, and were assigned the
following accession numbers:
5 ATCC Accession No. Viral strain FIV-141 VR-2619 Plasmid
pFIV-141-B1 203001
[0217] All patents, patent applications, and publications cited
above are incorporated herein by reference in their entirety.
[0218] The present invention is not to be limited in scope by the
specific embodiments described, which are intended as single
illustrations of individual aspects of the invention. Functionally
equivalent compositions and methods are within the scope of the
invention.
Sequence CWU 1
1
59 1 9464 DNA Feline immunodeficiency virus 1 tgggaagatt attgggatcc
tgaagaaata gaaaaaatgc taatggactg aggacgtaca 60 taaacaagtg
acagatggaa acagctgaat atgactcaat gctagcagct gcttaaccgc 120
aaaaccacat cctatgtaaa gcttgccgat gacgtgtatc ttgctccatt ataagagtat
180 ataaccagtg ttttgtaaaa gcttcgagga gtctctctgt tgagggcttt
cgagttctcc 240 cttgaggctc ccacagatac aataaaaaac tgagctttga
gattgaaccc tgtcttgtat 300 ctgtgtaatt tctcttacct gcgaatccct
ggagtccggg ccagggacct cgcagttggc 360 gcccgaacag ggacttgaaa
aggagtgatt agggaagtga agctagagca atagaaagct 420 gtcaagcaga
actcctgcag gccttgtatg gggagcagtt gcagacgctg ctggcagtga 480
gtatctctag tggagcggac ctgagctctg gattaagtca ctgctcacag gcctagataa
540 agattatctg gtgactcttc gcggatcgtc aaaccagggg attcgtcggg
ggacagccaa 600 caaggtagga gagattctac agcaacatgg ggaatggaca
ggggcgagac tggaaaatgg 660 ccattaagag atgtagtaat gttgctgtag
gggtagggag caggagtaaa aaatttggag 720 aaggaaattt tagatgggcc
ataaggatgg ctaatgtaac tacaggacga gaacctggtg 780 atataccaga
gactttagaa cagctaagat caatcatttg tgacttacaa gacagaagag 840
aacaatatgg atctagtaaa gaaattgaca tggcaattac cactttaaaa gtttttgcag
900 tggcaggaat tctaaatatg actgtaacta ctgccacagc agctgaaaat
atgtatgctc 960 agatgggatt agacaccaga ccatctataa aagaaagtgg
gggaaaagaa gaaggacctc 1020 cacaggctta tcctattcaa acagtaaatg
gagcaccaca gtatgtagcc cttgatccaa 1080 aaatggtgtc tatttttatg
gagaaggcaa gagaggggct aggaggtgaa gaagtccaac 1140 tgtggtttac
agccttttca gctaatttaa catcaactga tatggctaca ttaattatgt 1200
ccgcacctgg ctgtgcagca gataaagaaa tcctagatga aacactgaaa cagatgacag
1260 ctgagtatga tcgtacccat cctcctgatg ggcctagacc gctgccctat
ttcactgccg 1320 cagagatcat ggggatagga ttgactcaag aacaacaagc
agaacccagg tttgccccag 1380 ccagaatgca gtgtagagca tggtatcttg
aagcattagg aaagctagcg gccataaaag 1440 ccaaatctcc ccgagcagta
caattgaagc agggagctaa agaggactat tcctcattca 1500 tagatagact
atttgctcaa atagatcaag agcagaacac agctgaggta aagctgtatt 1560
taaaacaatc tttgagcata gcaaatgcta atccagattg taagagagcg atgagtcatc
1620 ttaaaccaga aagtacttta gaagagaaac tgagagcctg ccaggaaata
ggatcgccag 1680 gatacaaaat gcaactattg gcagaggctc ttactagggt
gcaaacagtt caagcaaaag 1740 gaccaaggcc agtatgtttc aattgtaaaa
aaccaggaca cctggccaga caatgtagac 1800 aagcaaagag atgtaataaa
tgtggaaaac ctggtcactt agctgctaac tgttggcaag 1860 gaggtaaaaa
gtccccggga aacggggcga tggggcgagc tgcagcccca gtaaatcaag 1920
tgcagcaagt gataccatct gcacccccgg tagaggagaa attgttagat atgtaaacta
1980 taataaagtg ggtaccacca caactttaga aaaaagacct gaaatacaaa
tattcgtaaa 2040 tgggtatcct ataaaatttt tattagatac aggagcagat
ataacaattt taaacagaaa 2100 agactttcag atagggaatt ctatagaaaa
tgggaaacag aatatgattg gagtaggagg 2160 cggaaagaga ggaacaaatt
atatcaatgt gcatttagaa attagagatg aaaattataa 2220 gacacagtgt
atatttggaa atgtgtgtgt cttggaggat aattcattaa tacaaccatt 2280
attgggaaga gataacatga ttaagttcaa cataaggttg gtaatggctc aaatttcaga
2340 gaaaattcca atagtaaaag taagaatgaa agaccctact caagggcctc
aggtaaaaca 2400 atggccatta tcaaatgaga aaattgaagc tctaactgac
atagtaaaca ggttagaaca 2460 agagggaaag gtaaaaagag ctgatccaaa
taatccttgg aacactcccg tatttgcaat 2520 caagaaaaag aatggtaaat
ggagaatgct catagatttt agggtcctaa ataaattaac 2580 agacaaaggg
gcagaagttc agttaggact ccctcatcct gctggattac aattgaaaaa 2640
acaagtaact gtattggaca taggggacgc atattttact attcctctag atccagatta
2700 tgctccttat actgcattta cactacctag aaaaaacaat gcaggaccag
ggaggagata 2760 catatggtgt agtttaccac aagggtgggt cttgagtcca
ttgatatatc agagtacctt 2820 agacaatata ctccaacctt ttattaaaca
gaatcctgag ttagatattt atcaatatat 2880 ggatgatatc tatataggat
caaatttaag taaaaaggaa cataaactaa aagtagaaga 2940 attaagaaaa
ttgttattat ggtggggatt tgaaaccccg gaagataaat tacaagaaga 3000
gcccccctat aagtggatgg gctatgaatt acatccatta acgtggtcaa tacagcaaaa
3060 gcaattagaa attccagaga gacccacatt aaatgaatta cagaagttag
caggtaagat 3120 taactgggct agtcaaacca ttccagactt gagcataaaa
gaactaacta atatgatgag 3180 aggagatcaa aagttagact caataagaga
atggacgaca gaggccaaga atgaagtgga 3240 gaaagctaag agagcaattg
agacacaggc acagctagga tattatgatc ctaatcgaga 3300 attatatgct
aaattaagtc ttgtgggacc acatcaacta agctatcagg tgtatcataa 3360
aaacccagaa cagatattat ggtatgggaa aatgaatagg cagaagaaaa aagcagaaaa
3420 tacttgtgat atagctctaa gggcatgtta caaaataaga gaagaatcca
ttataagaat 3480 aggaaaagaa ccagtatatg aaatacctac atccagagaa
gcttgggaat caaatctaat 3540 tagatctcca tatcttaagg cctcaccacc
tgaggtggaa tttatacatg ctgccttaaa 3600 tataaaaaga gctctaagca
tgatacaaga tgcccctata ttgggagcag aaacatggta 3660 catagatggg
ggaagaaaac aaggaaaagc agcaagagca gcttattgga cagatacggg 3720
cagatggcag gtaatggaaa tagaaggaag taatcaaaaa gcagaagtac aagctttatt
3780 attggcccta caggcaggac cagaggaaat gaatattata acagattcac
aatatattgt 3840 gaatattatt aatcaacaac cagatttgat ggaaggaatt
tggcaagaag tcttagaaga 3900 aatggaaaag aaagtagcaa tctttataga
ttgggtacct ggacataaag gtattccagg 3960 aaataaagag gtagatgaac
tttgtcaaac gatgatggtt atagaaggtg aaggaatatt 4020 agataaaaga
tcagaagatg caggatatga tttattagct gcacaagaaa tacatctctt 4080
gcctggggag gtaagagtag taccaacaag aacaaagata atgttaccta aaggatattg
4140 gggattaata atgggaaaaa gttcaatggg aagcaaagga ttagatgtat
taggaggagt 4200 tatagatgaa ggatatagag gagaattagg ggtgataatg
attaacctat ctaaaaaatc 4260 aataacatta tcagaaaaac aaaaagtagc
acaattaata atattacctt gtaaacatga 4320 aagcttacaa caaggagaaa
taataatgga ttcagaaaga ggaagaaagg gatttgggtc 4380 aactggagtc
ttttcttcat gggtggacag aattgaggaa gcagaattaa atcatgaaaa 4440
atttcactca gacccacaat acttaagaac agaatttaat ctacccagaa tagtagcaga
4500 ggaaataaaa agaaaatgtc ccttatgtag aatcagaggg gaacaagtag
ggggacaatt 4560 aaagattgga cctggcatat ggcaaatgga ctgtacacac
tttaatggaa aaataattat 4620 tgtcgcagtg catgtggaat caggcttatt
atgggcacag gtaattccac aggagactgc 4680 agattgtaca gttaaagctc
tcatgcaact tatcagtgct cataatgtta cagaactaca 4740 aacagataat
ggaccaaatt ttaaaaatca gaaaatggaa ggactactaa attatatggg 4800
cataaaacac aaattaggta taccaggtaa cccacaatca caagcattag tagaaaatgc
4860 taaccacaca ttaaaatctt ggattcaaaa atttctctca gaaacttctt
ctttggacaa 4920 cgcattggcc ctagccttat actgcctcaa ttttaaacaa
aggggtagac tagggagaat 4980 ggctccttat gaattataca tacaacagga
atcattaaga atacaagact atttttcaca 5040 aattccacaa aaattaatga
tgcaatgggt gtattataaa gatcagaaag ataaaaagtg 5100 gaagggacca
atgagagtag aatattgggg acaaggatca gtattattaa agaatgaaga 5160
gaagggatat tttcttgtac ctaggagaca cataagaaga gtcccagaac cctgcactct
5220 tcctgaaggg gatgagtgac gaagattggc aggtaagtag aagactcttt
gcagttctcc 5280 aaggaggagt aaatagtgcc atgttataca tatcgaattt
acctgaaaca gaacaggcac 5340 aatataaaaa ggactttaag aaaaggctct
tagaaaagga gactggattc atctatagat 5400 taagaaaagc tgaaggaata
aggtggagct ttcatacgcg tgattattat ataggatatg 5460 taagagagat
ggtggctggg tctagcctac aaaatagttt aagattgtat gtttatataa 5520
gcaatccatt gtggcatcag tcataccgtc ctggcctgac aaattttaat acagagtggc
5580 cttttgtaaa tatgtggata aagacaggat ttatgtggga tgatattgaa
agccaaaata 5640 tttgcaaagg aggagagatc tcacatggat ggggacctgg
aatggtggga attgtgataa 5700 aagcatttag ctgtggagaa aggaagatac
aaattactcc tgtcatgatt ataagaggtg 5760 agatagaccc acagaaatgg
tgtggagatt gttggaatct gatgtgtctt aaatattcac 5820 ttccaaatac
attgcagagg cttgctatgc tggcgtgtgg caaagaggct aaagaatgga 5880
gaggctgttg taatcagcgt tttgtttctc ctttcagaac accctgtgat ctagaggtcg
5940 tccagaacaa gcctaaaagg aatttattgt ggacgggaga attatgaatg
gaagaaataa 6000 tcccactgtt taataaggtt acagaaaagt tagatagaga
agcagctatt agattgttta 6060 ttttagctta tcaggtagac agatgcagat
ttattagaat tttacaatta ttactttgga 6120 gagatagatt taagtcaatc
aattctaaat attgtttatg ctggctgtgc tgcaagtctg 6180 cttattggcg
cttgcaatct acattatcca taaatactgc ctagaaatat ttcttttaat 6240
atttcatctg cagatataaa catggcagag ggaggattta ctcaaaatca acaatggata
6300 gggccagaag aagctgaaga attgttagat tttgatatag ctgtacaaat
gaatgaagaa 6360 ggtccattaa acccaggagt aaacccattt agggtaccag
gaattacctc tcaagaaaag 6420 gatgattatt gtcagatttt acaaccaaaa
ctacaagaat taaagaatga aatcaaagag 6480 gtaaaacttg acgaaaacaa
tgcaggtaag tttagaaagg caagatattt aagatattct 6540 gatgagagtg
tactaactat agtctattta ctaacaggat atttgagata tttaataagc 6600
catagaaact taggatcttt aagacatgat atagatatag aagcaccaca acaagagcac
6660 tataatgata aagaaaaggg tactacttta aatataaagt atgggagaag
atgttgtatt 6720 agcacattac ttctatattt aatcctcttc tcagggatag
gaatttggct tggaaccaaa 6780 gcacaagtag tgtggagact ccctccttta
gtagtgccag tagatgagac agaaataata 6840 ttttgggatt gttgggcgcc
agaggaacca gcctgtcaag attttctggg aacaatgata 6900 catttaaaag
caaatgttaa tataagtata caagaaggac ctacattggg aaattgggca 6960
agggaaattt ggtctacatt atttaaaaaa gctacaaggc aatgcagaag gggaaggata
7020 tggaagaaat ggaatgagac tataacagga cctaaaggat gtgcaaataa
tacctgttat 7080 aatatttcag tagtggtacc tgattatcaa tgttatgtag
acagagtaga tacatggctg 7140 caaggaaaag ttaatatctc actatgtttg
acaggaggaa agatgctata taataaaaat 7200 acaaaacaat taagttactg
tacagatcca ttacaaatac cattaattaa ttacacattt 7260 ggacctaacc
aaacttgtat gtggaacaca tctttaatca aagaccctga gataccgaaa 7320
tgtggatggt ggaaccaggc agcctattat aataattgta aatgggaaga agctaatgtg
7380 acatttcaat gtcaaagatc acaaagtcta ccaggatcat gggttaggag
aatctcttca 7440 tggagacaaa gaaacagatg ggagtggagg ccagactttg
aaagtgagaa agtaaaaata 7500 tcattacaat gtaatagtac aaaaaattta
acttttgcaa tgagaagttc aagtgattat 7560 tatgatgtac aaggagcatg
gatagaattt ggatgttata gaaataaatc aagaacccat 7620 acgggagcaa
gatttagaat aagatgtaaa tggaatgaag gaaagaatct atctctcatt 7680
gatacatgtg ggactacttc aaatgtgaca ggagccaacc ctgtagattg tactatgaaa
7740 acaagcacta tgtacaattg ttccttacaa gatagtttca ctatgaaaat
agaggacctt 7800 attgtacaat ttaatatgac aaaagcagtg gaaatgtata
atattgctgg gaattggtct 7860 tgtacatctg atttaccaac agggtgggga
tatatgaaat gtaattgtac aaatgccact 7920 gatggggaga ataaaatgaa
atgccctagg aatcagggta ttttaagaaa ctggtacaat 7980 ccagttgcag
gactaagaca agctcttatg aagtatcaag tagtaaaaca accagaatat 8040
ttggtggtac cggaagaagt tatgaggtat aaaggtaaac aaaaaagggc cgctattcat
8100 attatgttag cccttgctac ggtgttatct atagctggag caggaaccgg
tgccactgct 8160 attgggatgg tgacacacta tcagcaagtt ttggctaccc
atcagcaggc attggacaaa 8220 ataactgagg cactgaaaat aaacaactta
aggttaatca ctttagaaca tcaagtatta 8280 gtgatagggt taaaagtaga
ggctatagaa aaattcctat atacagcttt tgctatgcaa 8340 gaattaggat
gtaatcagaa tcaattcttt tgtaagattc ccctcaatct gtggacaatg 8400
tataacatga ctataaatca tacactatgg aatcatggaa atataacttt gggagaatgg
8460 tataatcaaa caaaaagttt acaagaaaaa ttttatgaga taattatgga
tatagaacaa 8520 aataatgtac aagggaaaaa tggaatacaa caattacaaa
aatgggaaaa ttgggtggga 8580 tggataggca aaatccctca atatttaaaa
ggacttcttg gtagtgtgtt gggaatagga 8640 ctaggaatct tactactact
tatatgcttg cctacattag tagattgtat aagaaactgt 8700 actaataaaa
tattgggata tacagttatt gcaatgcctg aaatagatga tgaggaagta 8760
cacccatcag tggaattgag gagaaatggc aggcaatgtg gcatatctga aaaagaggag
8820 gaatgatgga gcatttcaga cctgtagaat acaggagtaa tgctgagctg
agttcttccc 8880 tttgaggagg atgtgtcata tgaatccatt tcaaatcaaa
aataacagta aaatctatat 8940 tgtaaggcaa acgaaaaaga caacgcagaa
gaagaaagaa gaaggccttc aaaaaattga 9000 tgctggattt agaggctcga
tttaaagcgt tgtttgaaac accttcagct acagaatata 9060 ctgcagacga
gacagaagaa gagactcttg aaaaagaaaa aagggtggac tgggaagatt 9120
attgggatcc tgaagaaata gaaaaaatgc taatggactg aggacgtaca taaacaagtg
9180 acagatggaa acagctgaat atgactcaat gctagcagct gcttaaccgc
aaaaccacat 9240 cctatgtaaa gcttgccgat gacgtgtatc ttgctccatt
ataagagtat ataaccagtg 9300 ttttgtaaaa gcttcgagga gtctctctgt
tgagggcttt cgagttctcc cttgaggctc 9360 ccacagatac aataaaaaac
tgagctttga gattgaaccc tgtcttgtat ctgtgtaatt 9420 tctcttacct
gcgaatccct ggagtccggg ccagggacct cgca 9464 2 30 DNA Feline
immunodeficiency virus 2 ccgcaaaacc acatcctatg taaagcttgc 30 3 30
DNA Feline immunodeficiency virus 3 cgcccctgtc cattccccat
gttgctgtag 30 4 30 DNA Feline immunodeficiency virus 4 ttactgtttg
aataggatat gcctgtggag 30 5 30 DNA Feline immunodeficiency virus 5
gcaatgtggc atgtctgaaa aagaggagga 30 6 34 DNA Feline
immunodeficiency virus 6 tcttcccttt gaggaagata tgtcatatga atcc 34 7
26 DNA Feline immunodeficiency virus 7 tctgtgggag cctcaaggga gaactc
26 8 30 DNA Feline immunodeficiency virus 8 acaaacagat aatggaccaa
attttaaaaa 30 9 28 DNA Feline immunodeficiency virus 9 tttcaatatc
atcccacata aatcctgt 28 10 30 DNA Feline immunodeficiency virus 10
ttaaaggatg aagagaaggg atattttctt 30 11 30 DNA Feline
immunodeficiency virus 11 tgggaagatt attgggatcc tgaagaaata 30 12 40
DNA Feline immunodeficiency virus 12 catatcctat ataataatca
cgcgtatgaa agctccacct 40 13 24 DNA Feline immunodeficiency virus 13
tgcgaggtcc ctggcccgga ctcc 24 14 40 DNA Feline immunodeficiency
virus 14 aggtggagct ttcatacgcg tgattattat ataggatatg 40 15 29 DNA
Feline immunodeficiency virus 15 ctccagggat tcgcaggtaa gagaaatta 29
16 49 DNA Feline immunodeficiency virus 16 ttacaagaat tcaactgcag
tgggaagatt attgggatcc tgaagaaat 49 17 42 DNA Feline
immunodeficiency virus 17 ttcaaggagc tcttttgtcg acaactgcga
ggtccctggc cc 42 18 53 DNA Feline immunodeficiency virus 18
gattcgtcgg gggacagcca acaaggtagg agagattcta cagcaacatg ggg 53 19 42
DNA Feline immunodeficiency virus 19 tcaatatatg gatgatatct
atataggatc aaatttaagt aa 42 20 58 DNA Feline immunodeficiency virus
20 gtgatatagc tctaagggca tgttacaaaa taagagaaga atccattata agaatagg
58 21 46 DNA Feline immunodeficiency virus 21 cgggcagatg gcaggtaatg
gaaatagaag gaagtaatca aaaagc 46 22 44 DNA Feline immunodeficiency
virus 22 agaaagggat ttgggtcaac tggagtcttt tcttcatggg tgga 44 23 51
DNA Feline immunodeficiency virus 23 gggggacaat taaagattgg
acctggcata tggcaaatgg actgtacaca c 51 24 49 DNA Feline
immunodeficiency virus 24 ggctccttat gaattataca tacaacagga
atcattaaga atacaagac 49 25 36 DNA Feline immunodeficiency virus 25
caaaatagtt taagattgta tgtttatata agcaat 36 26 40 DNA Feline
immunodeficiency virus 26 cagaaaagtt agatagagaa gcagctatta
gattgtttat 40 27 40 DNA Feline immunodeficiency virus 27 taaaagcaaa
tgttaatata agtatacaag aaggacctac 40 28 40 DNA Feline
immunodeficiency virus 28 aaaagctaca aggcaatgca gaaggggaag
gatatggaag 40 29 44 DNA Feline immunodeficiency virus 29 agaggacctt
attgtacaat ttaatatgac aaaagcagtg gaaa 44 30 40 DNA Feline
immunodeficiency virus 30 ccctcaatct gtggacaatg tataacatga
ctataaatca 40 31 40 DNA Feline immunodeficiency virus 31 gacaacgcag
aagaagaaag aagaaggcct tcaaaaaatt 40 32 50 DNA Feline
immunodeficiency virus 32 agtaaagaaa ttgacatggc gattactagt
ttaaaagttt ttgcagtggc 50 33 47 DNA Feline immunodeficiency virus 33
ccatctataa aagaaagtgg gactagtgaa gaaggacctc cacaggc 47 34 51 DNA
Feline immunodeficiency virus 34 attcaaacag taaatggagc aactagttat
gtagcccttg atccaaaaat g 51 35 51 DNA Feline immunodeficiency virus
35 acagcctttt cagctaattt aactagtact gatatggcta cattaattat g 51 36
50 DNA Feline immunodeficiency virus 36 actatagtct atttactaac
tggttacctg agatatttaa taagccatag 50 37 54 DNA Feline
immunodeficiency virus 37 tacttatatg cttgcctaca ttgggttacc
gtataagaaa ctgtactaat aaaa 54 38 54 DNA Feline immunodeficiency
virus 38 gaggtataaa ggtaaacaaa aaactagtgc cattcatatt atgttagccc
ttgc 54 39 58 DNA Feline immunodeficiency virus 39 actaactata
gtctatttac taacaactag tttgagatat ttaataagcc atagaaac 58 40 62 DNA
Feline immunodeficiency virus 40 ataccgaaat gtggatggtg gaatcaggca
tgctattata ataattgtaa atgggaagaa 60 gc 62 41 58 DNA Feline
immunodeficiency virus 41 gcactatgta caattgttcc ttacaggcat
gcttcactat gaaaatagag gaccttat 58 42 56 DNA Feline immunodeficiency
virus 42 gaatcaattc ttttgtaaga tcgcatgcaa tctgtggaca atgtataaca
tgacta 56 43 61 DNA Feline immunodeficiency virus 43 gggaaaattg
ggtgggatgg ataggtaaga tcgcatgcta tttaaaagga cttcttggta 60 g 61 44
40 DNA Feline immunodeficiency virus 44 ggaagaagtt atgaggtata
ccggtaaaca aaaaagggcc 40 45 62 DNA Feline immunodeficiency virus 45
ctacttatat gcttgcctac attggtcgac tgatagtgaa actgtactaa taaaatattg
60 gg 62 46 56 DNA Feline immunodeficiency virus 46 gatggttata
gaaggtgaag gaattactag taaaagatca gaagatgcag gatatg 56 47 59 DNA
Feline immunodeficiency virus 47 gaaataataa tggattcaga aagaggaact
agtggatttg ggtcaactgg agtcttttc 59 48 57 DNA Feline
immunodeficiency virus 48 cttcatgggt ggacagaatt gaaactagtg
tattaaatca tgaaaaattt cactcag 57 49 59 DNA Feline immunodeficiency
virus 49 gcaatgggtg tattataaag atcagactag taaaaagtgg aagggaccaa
tgagagtag 59 50 57 DNA Feline immunodeficiency virus 50 agaagactct
ttgcagttct ccaatgaacg cgttagagtg ccatgttata catatcg 57 51 44 DNA
Feline immunodeficiency virus 51 cgtgtggcaa agaggctaaa acgcgtagag
gctgttgtaa tcag 44 52 56 DNA Feline immunodeficiency virus 52
gtggacggga gaattatgaa cgcgtgaact aatcccactg tttaataagg ttacag 56 53
55 DNA Feline immunodeficiency virus 53 ctacattatc cataaatact
gcctagacgc gtttctttta atatttcatc tgcag 55 54 54 DNA Feline
immunodeficiency virus 54 ggcatatctg aaaaagagga ggaatgaact
agtatatcag acctgtagaa taca 54 55 59 DNA Feline immunodeficiency
virus 55 gaggaggatg tgtcatatga atcaaatact agtcaaaaat
aacagtaaaa tctatattg 59 56 22 DNA Feline immunodeficiency virus 56
tattatggtg gggatttgaa ac 22 57 22 DNA Feline immunodeficiency virus
57 taattagatt tgattcccag gc 22 58 32 DNA Feline immunodeficiency
virus 58 tgtagagcat ggtatcttga agcattagga aa 32 59 35 DNA Feline
immunodeficiency virus 59 gttcctctct ttccgcctcc tactccaatc atatt
35
* * * * *