U.S. patent application number 10/727000 was filed with the patent office on 2004-05-13 for beta2 microglobulin fusion proteins and high affinity variants.
This patent application is currently assigned to The Government of the USA as represented by the Secretary of the Dept. of Health & Human Services. Invention is credited to Ribaudo, Randall K., Shields, Michael.
Application Number | 20040091492 10/727000 |
Document ID | / |
Family ID | 30117683 |
Filed Date | 2004-05-13 |
United States Patent
Application |
20040091492 |
Kind Code |
A1 |
Ribaudo, Randall K. ; et
al. |
May 13, 2004 |
Beta2 microglobulin fusion proteins and high affinity variants
Abstract
.beta..sub.2-microglobulin fusion proteins and modified forms of
.beta..sub.2-microglobulin are disclosed. The fusion proteins are
shown to incorporate onto the surface of MHC I expressing mammalian
cells and to cause an increased cytotoxic T-cell response to
antigens presented by such cells. The fusion proteins are useful in
methods of tumor therapy. Modified forms of human
.beta..sub.2-microglobulin, particularly a form having a serine to
valine transition at amino acid position 55 of the mature protein
are shown to have an enhanced affinity for MHC I heavy chain, and
are useful both in the disclosed fusion proteins and as a vaccine
adjuvant where enhanced cytotoxic T-cell response is desired.
Inventors: |
Ribaudo, Randall K.; (Silver
Spring, MD) ; Shields, Michael; (Encinitas,
CA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
One World Trade Center, Suite 1600
121 S. W. Salmon Street
Portland
OR
97204
US
|
Assignee: |
The Government of the USA as
represented by the Secretary of the Dept. of Health & Human
Services
|
Family ID: |
30117683 |
Appl. No.: |
10/727000 |
Filed: |
December 2, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10727000 |
Dec 2, 2003 |
|
|
|
09719243 |
Mar 19, 2001 |
|
|
|
6682741 |
|
|
|
|
09719243 |
Mar 19, 2001 |
|
|
|
PCT/US99/12309 |
Jun 3, 1999 |
|
|
|
60088813 |
Jun 10, 1998 |
|
|
|
Current U.S.
Class: |
424/178.1 ;
435/320.1; 435/328; 435/69.1; 530/391.1; 536/23.53 |
Current CPC
Class: |
C07K 14/70539 20130101;
A61K 38/00 20130101; C07K 2319/02 20130101; C07K 14/70525 20130101;
A61K 39/39 20130101; A61K 2039/57 20130101; C07K 14/70528 20130101;
C07K 2319/00 20130101; A61K 2039/55516 20130101; C07K 14/70532
20130101 |
Class at
Publication: |
424/178.1 ;
435/069.1; 435/328; 435/320.1; 530/391.1; 536/023.53 |
International
Class: |
A61K 039/395; C07H
021/04; C07K 016/46; C12N 005/06 |
Claims
We claim:
1. A fusion protein comprising a first amino acid sequence and a
second amino acid sequence, wherein the second amino acid sequence
is a .beta..sub.2-microglobulin.
2. A fusion protein according to claim 1 wherein the second amino
acid sequence is a human .beta..sub.2-microglobulin.
3. A fusion protein according to claim 1 wherein the second amino
acid sequence is h.beta..sub.2m S55V.
4. A fusion protein comprising first and second domains, wherein
the second domain is .beta..sub.2m.
5. A fusion protein according to claim 4 wherein the first domain
joined to the amino terminal of the second domain.
6. A fusion protein according to claim 4 wherein the second domain
is h.beta..sub.2m.
7. A fusion protein according to claim 4 wherein the first domain
is a co-stimulatory protein.
8. A fusion protein according to claim 7 wherein the co-stimulatory
protein is selected from the group consisting of B7.1 and B7.2.
9. A fusion protein according to claim 4 wherein the first domain
is an integrin, a cytokine or a cell adhesion molecule.
10. A fusion protein according to claim 6 wherein the
h.beta..sub.2m is h.beta..sub.2m S55V.
11. A fusion protein according to claim 4 wherein the first and
second domains are linked by a peptide linker.
12. A fusion protein according to claim 4 wherein the fusion
protein further comprises a signal peptide joined to the N terminus
of the first domain.
13. A fusion protein according to claim 12 wherein the signal
peptide is a .beta..sub.2m signal peptide.
14. A fusion protein according to claim 10 wherein the
h.beta..sub.2m S55V has an amino acid sequence as shown in Seq.
I.D. No. 10.
15. A fusion protein according to claim 6 wherein the protein has
an amino acid sequence selected from the group consisting of the
sequences shown in Seq. I.D. Nos. 2 and 3.
16. A recombinant nucleic acid molecule encoding a protein
according to claim 4.
17. A vector comprising a nucleic acid molecule according to claim
16.
18. A transgenic cell comprising a nucleic acid molecule according
to claim 16.
19. A cell having a cell membrane comprising a fusion protein
according to claim 4.
20. A cell according to claim 19 wherein the cell is a tumor
cell.
21. A protein comprising a structure X--Y wherein X is a protein
domain and Y is a beta-2 microglobulin.
22. A protein according to claim 21 comprising a structure X-L-Y
wherein L is a linker peptide.
23. A protein according to claim 22 comprising S--X-L-Y wherein S
is a signal peptide.
24. A protein according to claim 23 wherein the signal peptide is a
.beta..sub.2m signal peptide.
25. A nucleic acid molecule encoding a protein according to claim
21.
26. A protein according to claim 21 wherein the protein has an
amino acid sequence as shown in Seq. I.D. No. 2 or Seq. I.D. No.
3.
27. A method of enhancing the immune response of a mammal to an
antigen presented on the surface of a cell, the method comprising:
(a) contacting the cell with a fusion protein according to claim 4
such that the fusion protein is presented on the surface of the
cell; and (b) administering the cell to a mammal.
28. The method of claim 27 wherein the first amino acid sequence is
a co-stimulatory molecule.
29. The method of claim 28 wherein the co-stimulatory molecule is
B7.1 orB7.2.
30. The method of claim 29.wherein the cell is a tumor cell.
31. A method of enhancing the immune response of a mammal to an
antigen presented on the surface of a cell, the method comprising:
(a) transforming the cell with a nucleic acid molecule according to
claim 16, such that expression of the nucleic acid molecule results
in expression of a fusion protein encoded by the nucleic acid
molecule being presented on the surface of the cell; and (b)
administering the cell to a mammal.
32. The method of claim 31 wherein the first amino acid sequence is
a co-stimulatory molecule.
33. The method of claim 32 wherein the co-stimulatory molecule is
B7.1 or B7.2.
34. The method of claim 33 wherein the cell is a tumor cell.
35. A human .beta..sub.2-microglobulin molecule having a valine
residue at position 55.
36. A human .beta..sub.2-microglobulin molecule according to claim
35, wherein the molecule comprises the amino acid sequence shown in
Seq. I.D. No. 10.
37. A vaccine preparation comprising at least one antigen and a
molecule selected from the group consisting of (a) a human
.beta..sub.2-microglobu- lin molecule having a valine at position
55; and (b) a fusion protein comprising a first amino acid sequence
and a second amino acid sequence, wherein the second amino acid
sequence is a .beta..sub.2-microglobulin.
38. A vaccine preparation according to claim 37(b) wherein the
.beta..sub.2-microglobulin is h.beta..sub.2m S55V.
39. A vaccine preparation according to claim 37 wherein the antigen
is selected from the group consisting of bacterial, viral and tumor
antigens.
40. A method of vaccinating a mammal, comprising administering to
the mammal a vaccine preparation according to claim 37.
41. A method of vaccinating a mammal, comprising administering to
the mammal an antigen and a microglobulin protein selected from the
group consisting of: (a) a human .beta..sub.2-microglobulin protein
having a valine at position 55; and (b) a fusion protein comprising
a first amino acid sequence and a second amino acid sequence,
wherein the second amino acid sequence is a
.beta..sub.2-microglobulin.
42. A method of stimulating a tumor-reactive cytotoxic T-cell
response, comprising: (a) isolating T-cells from a patient having a
tumor; (b) isolating tumor cells from the patient; (c) incubating
the tumor cells with a fusion protein according to claim 4, such
that the fusion protein is presented on the surface of the tumor
cells; (d) incubating the T-cells in the presence of the fusion
protein-presenting tumor cells to increase the number of
tumor-reactive T-cells; and (e) administering a therapeutically
effective dose of the tumor-reactive T-cells to the patient.
Description
FIELD OF THE INVENTION
[0001] This invention relates to compositions based on .beta..sub.2
microglobulin, and the use of such compositions in immunological
methods pertaining to the targeting of proteins to cell surfaces.
The disclosed compositions and methods have particular application
to vaccination and tumor therapy.
BACKGROUND OF THE INVENTION
MHC I and Activation of Cytotoxic T-Cells
[0002] The beta-2 microglobulin (.beta..sub.2m) protein is a
component of the class I major histocompatibility complex (MHC I).
MHC I is formed by the association of .beta..sub.2m and an alpha
protein (also known as the "heavy" chain), which comprises three
domains, a1, a2 and a3. MHC I is found on the surface of most types
of nucleated cells, where it presents antigens derived from
proteins synthesized in the cytosol to CD8.sup.+ T-cells. Two
signals are required for activation of naive CD8.sup.+ T-cells. The
first signal is provided by the interaction of the T-cell receptor
(TCR) with the MHC I-antigen complex on the antigen-presenting cell
surface. The second signal is generated by the interaction of a
ligand on the antigen-presenting cell (APC) with a second receptor
present on the T-cell surface. This second signal is termed
co-stimulation, and the APC ligand is often referred to as a
co-stimulatory molecule. The best characterized co-stimulatory
molecules on APCs are the structurally related glycoproteins B7.1
(CD80) and B7.2 (CD86) which interact with the CD28 receptor on the
T-cell surface. Activation of CD8.sup.+ T-cells by these two
signals leads to the proliferation of antigen-specific cytotoxic
T-cells, which recognize and destroy cells presenting the signaling
antigen. These cytotoxic T-cells play an important role in the
immunological defense against intracellular pathogens such as
viruses, as well as tumors. A detailed presentation of the
immunological basis of the cytotoxic T-cell response can be found
in Janeway and Travers (Immunobiology: the immune system in health
and disease, Current Biology Ltd./Garland Publishing, Inc. New
York, 1997).
[0003] The failure of an exogenous (non-self) antigen to stimulate
a cytotoxic T-cell response can result from a block in the
above-described cytotoxic T-cell activation pathway at one of many
points (see Ploegh, 1998, Science 280:248-53). Failure of the
cytotoxic T-cell activation pathway is of great significance in two
particular areas of medicine: vaccination and tumor immunology.
Cytotoxic T-Cells and Vaccination
[0004] Vaccine technology has focused in recent years on sub-unit
vaccines. Sub-unit vaccines comprise isolated pathogen components,
such as viral capsid or envelopes, or synthetic peptides that mimic
an antigenic determinant of a pathogen-related protein. For
example, U.S. Pat. No. 4,974,168 describes leukemia associated
immunogens that are peptides based on envelope proteins of a
leukemia-associated virus. However, while sub-unit vaccines can
stimulate CD4.sup.+ helper T-cells (which play a key role in
humoral immunity), attempts to stimulate CD8.sup.+ cytotoxic
T-cells in vivo with such vaccines have been largely unsuccessful.
It has been postulated that the reason for this is the inability of
the exogenously administered vaccine peptide to associate with the
MHC I molecules on the cell surface (Liu, 1997, Proc. Natl. Acad
Sci. USA 94:10496-8). In other words, the block in the cytotoxic
T-cell activation pathway occurs at the stage where the antigen is
loaded into the MHC I molecule.
[0005] One proposed solution to this problem is to combine the
antigenic peptide with a molecule that is readily taken up into
cells (reviewed by Liu, 1997, Proc. Natl. Acad. Sci. USA
94:10496-8). Thus, this strategy is based on getting the antigen
into the cytosol so that it can join the normal pathway by which
antigens are processed for presentation by MHC I. In contrast, Rock
et al. (J. Immunol. 150:1244-52, 1993) adopted a strategy of
enhancing the binding of the vaccine peptide to MHC I already
present on the cell surface. Rock et al. (J. Immunol. 150:1244-52,
1993) report that the administration of exogenous purified
.beta..sub.2m along with the vaccine peptide produces enhanced
loading of the peptide onto MHC I in vivo and thereby stimulates a
cytotoxic T-cell response against the peptide. The use of exogenous
.beta..sub.2m as a vaccine adjuvant is also described in U.S. Pat.
No. 5,733,550 (to Rock et al.), which is incorporated herein by
reference.
Tumor Cells and Immune System Evasion
[0006] Tumor cell immunity is primarily cell-mediated, involving
both CD8.sup.+ cytotoxic T-cells and CD4.sup.+ helper T-cells.
However, despite the fact that tumor cells express tumor-specific
proteins that are not recognized as self-antigens by the immune
system, they often escape recognition by the immune system. A
number of factors may contribute to the ability of tumor cells to
evade immune recognition, including the down-regulation of
expression of co-stimulatory proteins. TCR stimulation in the
absence of co-stimulatory molecules can result in failure to
activate the T-cell and the induction of clonal anergy. Thus,
down-regulation of co-stimulatory proteins in tumor cells prevents
normal activation of T-cells that do bind to tumor antigens on the
cell surface, permitting the tumor cell to escape recognition.
[0007] Several research groups have attempted to address this issue
by removing tumor cells from a patient, providing exogenous
co-stimulatory molecules on the surface of the removed tumor cells
and then reintroducing the tumor cells to the patient so that
immune recognition can occur. For example, European patent
application number 96302009.4 describes a method by which tumor
cells are removed from a patient, transfected to express both B7
and CD2 (a co-receptor involved in T-cell adhesion and activation)
on the tumor cell surface, and then reintroduced to the patient.
The reintroduced cells are reported to stimulate a broad
immunological response against both the reintroduced transfected
tumor cells and the non-transfected tumor cells within the
patient's body, resulting in tumor regression.
[0008] Adopting an alternative approach to this problem, Gerstmayer
et al. (J. Immunol. 158:4584-90, 1997) describe a chimeric
B7-antibody protein, in which the antibody is specific for the
erbB2 proto-oncogene product. This chimeric molecule localizes
specifically on the surface of erbB2 expressing tumor cells, and
presents the B7 co-stimulatory molecule to cytotoxic T-cells,
resulting in enhanced proliferation of cytotoxic-cells. Gerstmayer
et al. (J. Immunol. 158:4584-90, 1997) thus propose that fusion
proteins comprising an anti-tumor antibody and a co-stimulatory
molecule could be useful as tumor immunotherapeutics. However, this
approach would require prior knowledge and characterization of
tumor-specific antigens expressed on the tumor cells of each
individual patient, and the use of an antibody specific for that
particular type of tumor cell.
SUMMARY OF THE INVENTION
[0009] The present invention employs various forms of beta-2
microglobulin to address the problems associated with failure of
the cytotoxic T-cell activation pathway in both vaccination and
tumor therapy. The invention also provides compositions and methods
based on .beta..sub.2m that are broadly applicable to achieve
expression of any desired target protein on the surface of any
mammalian cell.
[0010] In one embodiment, the invention provides fusion proteins
comprising a first amino acid sequence and a second amino acid
sequence, wherein the second amino acid sequence is a
.beta..sub.2-microglobulin. In particular applications, the first
amino acid sequence may be a co-stimulatory protein, such as B7.1
or B7.2, or another protein having immunological activity, such as
a cytokine, an integrin or a cellular adhesion molecule. Examples
of such proteins include interleukins (e.g., IL-2, IL-12),
granulocyte-macrophage colony-stimulating factor (GM-CSF),
lymphocyte function-associated proteins (e.g., LFA-1, LFA-3) and
intercellular adhesion molecules (e,g., ICAM-1, ICAM-2). In other
embodiments, the first amino acid sequence of the fusion protein
may be any protein that is desired to be expressed on the surface
of a cell. It is shown that these fusion proteins are an effective
way to target a desired protein, such as B7, to the outer membrane
of a cell. ("B7" is used generically to refer to either B7.1 or
B7.2).
[0011] With respect to tumor therapy, it is shown that expressing
on the surface of a tumor cell a fusion protein comprising a
.beta..sub.2m joined to a co-stimulatory protein can significantly
increase the immune response of an animal to the tumor cell. In one
example, a fusion protein comprising h.beta..sub.2m joined to the
co-stimulatory protein B7 (and termed B7-.beta..sub.2m) is targeted
to the surface of tumor cells, such that the tumor cells present
the B7-.beta..sub.2m fusion protein to T-cells. These cells are
then attenuated and introduced into mice. T-cells removed from
these mice were shown to be significantly more active against the
same type of tumor cells than equivalent cells from mice treated
with tumor cells presenting .beta..sub.2m only.
[0012] The .beta..sub.2m fusion proteins provided by the invention
have wide application in that they are useful to target any desired
protein to the outer membrane of a cell. These fusion proteins may
be targeted to the surface of a cell in a number of ways. In one
approach, cells that express MHC I are simply incubated with a
preparation of the fusion protein, resulting in the incorporation
of the fusion protein onto the cell surface. Alternatively, the
fusion protein may be introduced into the cell so that it is
incorporated into the MHC I pathway. In another approach, a nucleic
acid molecule encoding the fusion protein is introduced into a cell
by transformation. Expression of this nucleic acid molecule results
in the fusion protein being produced within the cell and exported
to the cell membrane. Where the fusion protein is to be introduced
into the cytosol for export to the outer membrane, or where it will
be expressed by a nucleic acid molecule within the cell, it is
desirable to include a signal peptide at the N-terminus of the
fusion peptide so that the fusion protein is transported to the
outer membrane of the cell. The .beta..sub.2m signal peptide may be
used for this purpose. In all of these approaches, the result is
that the .beta..sub.2m fusion protein is presented on the surface
of the cell.
[0013] In one embodiment, the invention includes nucleic acid
molecules encoding the disclosed fusion proteins, as well as
nucleic acid vectors comprising such nucleic acid molecules.
Transgenic cells comprising these nucleic acid molecules are also
provided by the invention.
[0014] Methods of expressing a .beta..sub.2m fusion protein on the
surface of a cell are provided by the invention. Such methods
include contacting a cell with a fusion protein comprising a first
amino acid sequence and a second amino acid sequence wherein the
second amino acid sequence is a .beta..sub.2m. An alternative
method provided by the invention comprises transforming the cell
with a nucleic acid molecule encoding such a fusion protein.
[0015] The invention further provides methods of enhancing the
immune response of an animal to an antigen presented on the surface
of a cell. Such methods comprise providing a .beta..sub.2m fusion
protein on the surface of the cell and administering the cell to
the animal. In such applications, the fusion protein preferably
comprises .beta..sub.2m fused to a co-stimulatory protein, such as
B7, or another protein having immunological activity. Expressing
the .beta..sub.2m fusion protein on the surface of the cell may be
accomplished by contacting the cell with the fusion protein, or
transforming the cell with a nucleic acid molecule encoding the
protein. These methods may be applied to the treatment of tumors;
in such treatments, the antigen against which an enhanced immune
response is desired is a tumor antigen, and the cell bearing the
antigen is a tumor cell. The tumor cell may be removed from the
body of a mammal having a tumor, or may be derived from an in vitro
propagated tumor cell line. The .beta..sub.2m fusion protein is
introduced to the tumor cell (e.g., by incubation of the tumor cell
with the protein, or by transformation of the tumor cell with a
nucleic acid encoding the fusion protein), such that the tumor cell
presents the fusion protein on its surface. The tumor cell carrying
the fusion protein is then administered to a mammal. In certain
embodiments, the tumor cell may be attenuated prior to being
administered to the mammal; such attenuation may be accomplished
using standard 35 means such as radiation, heat or chemical
treatment. Once in the body of the mammal, the combination of tumor
antigens and the .beta..sub.2m -fusion protein on the surface of
the tumor cells are recognized by CD8.sup.+ T-cells, resulting in
T-cell activation, proliferation and thereby an enhanced cytolytic
T-cell response against both the introduced tumor cells and other
tumor cells in the mammal that express the same tumor antigen.
[0016] The present invention also provides modified human
.beta..sub.2m (h.beta..sub.2m) proteins having an enhanced affinity
for MHC I. Such proteins are shown to bind to the alpha chain of
MHC I with higher affinity than wild-type h.beta..sub.2m and to
enhance T-cell recognition of APCs bearing the modified
h.beta..sub.2m. In particular embodiments, the modified
h.beta..sub.2m proteins have a valine residue at position 55 in
place of the serine residue that is found in the mature form of
naturally occurring (i.e., wild-type) h.beta..sub.2m. Such modified
h.beta..sub.2m proteins are referred to as h.beta..sub.2m S55V.
[0017] h.beta..sub.2m S55V is useful as a vaccine adjuvant in place
of wild-type h.beta..sub.2m. Thus, one aspect of the invention is a
vaccine preparation comprising at least one antigen and
h.beta..sub.2m S55V. h.beta..sub.2m S55V may also be utilized in
place of wild-type h.beta..sub.2m in the fusion proteins discussed
above. Additionally, .beta..sub.2m fusion proteins may also be
employed in such vaccine preparations, either using a wild-type
.beta..sub.2m or, in the case of h.beta..sub.2m, h.beta..sub.2m
S55V.
Sequence Listing
[0018] The nucleic and amino acid sequences listed in the Sequence
Listing are shown using standard letter abbreviations for
nucleotide bases, and three letter code for amino acids. Only one
strand of each nucleic acid sequence is shown, but the
complementary strand is understood to be included by any reference
to the displayed strand.
[0019] Seq. I.D. No. 1 shows the amino acid sequence of wild-type
(naturally occurring) h.beta..sub.2m.
[0020] Seq. I.D. No. 2 shows the amino acid sequence of the
B7-.beta..sub.2m fusion protein (comprising the B7.2 co-stimulatory
molecule).
[0021] Seq. I.D. No. 3 shows the amino acid sequence of the
B7-.beta..sub.2m fusion protein having the .beta..sub.2m signal
sequence joined to the N-terminal of the B7 domain.
[0022] Seq. I.D. Nos. 4-7 show primers used to construct
h.beta..sub.2m S55V.
[0023] Seq. I.D. Nos. 8 and 9 show primers used to amplify the B7.2
protein.
[0024] Seq. I.D. No. 10 shows the amino acid sequence of mature
h.beta..sub.2m S55V.
[0025] Seq. I.D. Nos. 11 and 12 show the amino acid linker
sequences that can be used between the two domains of a fusion
protien.
[0026] Seq. I.D. Nos. 13 and 14 show amino acid sequences of signal
peptides that can be used to direct the expression of a protein in
a cell.
[0027] Seq. I.D. No. 15 shows the amino acid sequences for a c-myc
tag.
[0028] Seq. I.D. Nos. 16-20 show the amino acid sequences for
peptides used in the HLA stabilization assay.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 shows the amino acid sequence of naturally occurring
(i.e., wild-type) h.beta..sub.2m; the signal peptide is double
underlined and the amino acid numbering starts at the isoleucine
residue that is the first residue of the mature protein. The serine
at position 55 that is changed to valine in S55V is shown in
bold.
[0030] FIG. 2 is a schematic representation of the
B7.2-.beta..sub.2 microglobulin fusion peptide construct.
[0031] FIG. 3 shows the sequence of the B7.2-.beta..sub.2m fusion
peptide. Residue 1 is a methionine required for expression,
residues 2-220 are the extracellular portion of murine B7-2,
residues 221-225 (italics) are a sequence created by the insertion
of a restriction site into the nucleic acid sequence, residues
226-240 (underlined) are the linker sequence, and residues 241-339
are the mature form of h.beta..sub.2m.
[0032] FIG. 4 shows the sequence of a B7-.beta..sub.2m fusion
peptide having the h.beta..sub.2m signal sequence (residues 1-20,
double underlined). Residues 21-239 are the extracellular portion
of murine B7-2, residues 240-244 (italics) are a sequence created
by the insertion of a restriction site into the nucleic acid
sequence, residues 245-259 (underlined) are the linker sequence,
and residues 260-358 are the mature form of h.beta..sub.2m.
[0033] FIG. 5 is a graph showing the effect of plate-bound
B7-.beta..sub.2m on BALB/c splenic T-cell proliferation in the
presence of a suboptimal concentration of soluble 2C11.
[0034] FIG. 6 is a graph showing the efficacy of P815
antigen-primed T-cells (primed with P815 cells presenting only P815
antigens, or P815 antigens and either B7-.beta..sub.2m or
.beta..sub.2m) to lyse P815 tumor cells.
[0035] FIG. 7 is a graph illustrating the stabilization of
cell-surface HLA-A1 (a), -A2 (b), and -A3 (c) by mutant
h.beta..sub.2m and peptide. All values are expressed as mean
fluorescence intensity.
[0036] FIG. 8 shows the inhibition of myc-.beta..sub.2m binding by
S55V and h.beta..sub.2m to cell-surface HLA-A1 (a), -A2 (b), and
-A3 (c). All values are expressed as mean fluorescence
intensity.
[0037] FIG. 9 illustrates that the S55V mutant enhances CTL
recognition better than wild-type h.beta..sub.2m in both
Hmy2.C1R-A2 (a) and Hmy2.C1R-A3 (b) target cells.
DETAILED DESCRIPTION OF THE INVENTION
Abbreviations and Definitions
[0038] To facilitate review and understanding of the invention as
described herein, the following explanation of abbreviations and
definitions of terms are provided:
[0039] .beta..sub.2m: beta-2 microglobulin. This term encompasses
any mammalian beta-2 microglobulin protein, including human and
murine beta-2 microglobulins. The term "h.beta..sub.2m" refers
specifically to human beta-2 microglobulin. cDNAs and genes
encoding mammalian .beta..sub.2ms are well known in the art, as are
the corresponding .beta..sub.2m protein sequences. Examples include
those sequences described in: Parnes and Seidman (Cell 29:661-9,
1982), Gates et al. (Proc. Natl. Acad Sci. USA 78:554-8, 1981)
(murine); Suggs et al. (Proc. Natl. Acad Sci. USA 78:6613-7, 1981),
Guessow et al. (J. lmmunol. 139:3132-8, 1987), Cunningham et al.
(Biochem. 12:4811-22, 1973) (human); and Ellis et al.
(Immunogenetics 38:310, 1993) (bovine). These sequences are also
available on GenBank at
http://www.ncbi.nlm.nih.gov/Entrez/index.html.
[0040] The terms "wild-type .beta..sub.2m" and "naturally occurring
.beta..sub.2m" refer to the .beta..sub.2m protein that is isolated
from the particular species of mammal in question. For example,
wild-type h.beta..sub.2m refers to a beta-2 microglobulin protein
having an amino acid sequence of h.beta..sub.2m isolated from a
human source (e.g., serum). Thus, an example of a wild-type
.beta..sub.2m is the h.beta..sub.2m protein disclosed in Cunningham
et al. (Biochem. 12:4811-4822, 1973), which is also available on
GenBank under accession number A90371 and is shown in FIG. 1 and
Seq. I.D. No. 1. The term "modified .beta..sub.2m" refers to a
beta-2 microglobulin protein having an amino acid sequence that has
been modified from a wild-type .beta..sub.2m amino acid sequence.
By way of example, h.beta..sub.2m S55V is a mutant form of
h.beta..sub.2m in which the serine residue present at position 55
in mature wild-type h.beta..sub.2m (see FIG. 1 and Seq. I.D. No. 1)
is replaced with a valine residue. The term h.beta..sub.2m S55V
encompasses forms of hp2m that differ from wild-type h.beta..sub.2m
by the substitution of the position 55 serine for a valine, as well
as forms of h.beta..sub.2m that have the S55V modification and
additional amino acid sequence modifications..
[0041] Fusion protein: A protein comprising two amino acid
sequences that are not found joined together in nature. The term
".beta..sub.2m fusion protein" refers to a protein that comprises a
first amino acid sequence and a second amino acid sequence, wherein
the second amino acid sequence is a .beta..sub.2-microglobulin. The
.beta..sub.2m amino acid sequence and the first amino acid sequence
may alternatively be referred to as domains of the fusion protein.
Thus, for example, the present invention provides fusion proteins
comprising first and second domains, wherein the second domain is a
.beta..sub.2m protein. The link between the first and second
domains of the fusion protein is typically, but not necessarily, a
peptide linkage. In particular .beta..sub.2m fusion proteins, the
two domains may be joined by means of a linker peptide. In
.beta..sub.2m fusion proteins, the first domain is preferably, but
not necessarily, linked to the N-terminus of the .beta..sub.2m
domain.
[0042] These fusion proteins may also be represented by the formula
X--Y wherein X is a protein, such as a co-stimulatory protein, and
Y is a .beta..sub.2m protein. In a further embodiment of the fusion
proteins disclosed, a signal peptide sequence may be linked to the
N-terminus of the first protein. Such a three part protein can thus
be represented as S--X--Y wherein S is the signal peptide, X is a
protein, such as a co-stimulatory protein and Y is a .beta..sub.2m
protein. Where the fusion protein is being expressed in a
eukaryotic cell, the signal peptide is preferably a eukaryotic.
signal peptide that functions to target expression of the fusion
protein to the cell membrane. While a number of signal peptides may
be used for this purpose, the preferred signal peptide is the
.beta..sub.2m signal peptide (shown in FIG. 1). Where the fusion
protein is being expressed in a prokaryotic cell, the signal
peptide is preferably a prokaryotic signal peptide that results in
the secretion of the fusion peptide into the growth medium from
where it can be readily harvested and purified. Suitable
prokaryotic signal peptides are well known in the art. Where the X
protein and .beta..sub.2m are joined by a peptide linker, the
fusion protein may be represented as X-L-Y or, if a signal peptide
is present, S--X-L-Y, where L is the linker peptide.
[0043] Certain .beta..sub.2m fusion proteins of the present
invention include, as their .beta..sub.2m component, the
h.beta..sub.2m S55V protein. Particular residues in the
.beta..sub.2m component of such fusion proteins may be referred to
by the number of residues that they are away from the first residue
of the mature h.beta..sub.2m (which is isoleucine). Thus, the
A.sub.2m component of a fusion protein that includes h.beta..sub.2m
S55V may be referred to as a human .beta..sub.2-microglobulin
having a valine at position 55.
[0044] Transformed: A transformed cell is a cell into which has
been introduced a nucleic acid molecule by molecular biology
techniques. As used herein, the term transformation encompasses all
techniques by which a nucleic acid molecule might be introduced
into such a cell, including transfection with viral vectors,
transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, and particle gun acceleration.
[0045] Isolated: An "isolated" biological component (such as a
nucleic acid or protein) has been substantially separated or
purified away from other biological components in the cell of the
organism in which the component naturally occurs, i.e., other
chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic
acids and proteins which have been "isolated" thus include nucleic
acids and proteins purified by standard purification methods. The
term also embraces nucleic acids and proteins prepared by
recombinant expression in a host cell as well as chemically
synthesized nucleic acids.
[0046] Vector: A nucleic acid molecule as introduced into a host
cell, thereby producing a transformed host cell. A vector may
include nucleic acid sequences that permit it to replicate in the
host cell, such as an origin of replication. A vector may also
include one or more selectable marker genes and other genetic
elements known in the art.
[0047] Purified: The term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified .beta..sub.2m protein preparation is one in
which the .beta..sub.2m protein is more pure than the protein in
its natural environment within a cell. Preferably, a preparation of
a protein is purified such that the protein represents at least 50%
of the total protein content of the preparation.
[0048] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein coding regions, in the same reading frame.
[0049] Recombinant: A recombinant nucleic acid is one that has a
sequence that is not naturally occurring or has a sequence that is
made by an artificial combination of two otherwise separated
segments of sequence. This artificial combination is often
accomplished by chemical synthesis or, more commonly, by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques.
[0050] Tumor Cell: A neoplastic cell that may be either malignant
or non-malignant. Tumor cells include cells from both solid and
non-solid tumors (such as hematologic malignancies). Tumors may be
primary tumors originating in a particular organ (such as breast,
prostate, bladder or lung). Tumors of the same tissue type may be
divided into tumors of different sub-types (a classic example being
bronchogenic carcinomas (lung tumors) which can be an
adenocarcinoma, small cell, squamous cell, or large cell
tumor).
[0051] Mammal: This term includes both human and non-human mammals.
Similarly, the term "patient" includes both human and veterinary
subjects.
Production and Use of .beta..sub.2m Fusion Proteins
[0052] Standard molecular biology, biochemistry and immunology
methods are used in the present invention unless otherwise
described. Such standard methods are described in Sambrook et al.
(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New
York, 1989), Ausubel et al. (Current Protocols in Molecular
Biology, Greene Publishing Associates and Wiley-lntersciences,
1987), Innis et al. (PCR Protocols, A Guide to Methods and
Applications, Innis et al. (eds.), Academic Press, Inc., San Diego,
Calif., 1990) and Harlow and Lane (Antibodies, A Laboratory Manual,
Cold Spring Harbor Laboratory, New York, 1988). Methods of
producing nucleic acid sequences expressing fusion proteins, as
well as methods of expressing and purifying fusion proteins are
well known in the art, and are described, for example, in U.S. Pat.
Nos. 5,580,756 and 5,698,679. The following paragraphs are provided
by way of guidance.
[0053] Standard techniques may be employed to make genetic
constructs expressing .beta..sub.2m fusion proteins, including
restriction endonuclease digestion, ligation and the polymerase
chain reaction. Any mammalian gene or cDNA encoding .beta..sub.2m
may be used as the source of the .beta..sub.2m coding sequence.
Such sequences are known in the art and are available on public
databases such as GenBank. By way of example, the sequence of the
human .beta..sub.2m cDNA is described in Guessow et al. (J.
Immunol. 139:3132-8, 1987, GenBank accession number: M17986).
Notably, this cDNA sequence includes regions coding for the signal
peptide of h.beta..sub.2m (see FIG. 1).
[0054] Similarly, nucleic acid sequences coding for proteins that
may be selected as the second domain of the fusion protein are well
known in the art. While the selection of the second domain protein
will typically be a co-stimulatory protein or a protein having some
other immunological activity, fusion proteins may be constructed
using .beta..sub.2m as the second domain, and any protein that is
desired to be delivered to the surface of a cell as the first
domain. Examples of cDNAs encoding proteins having co-stimulatory
activity include those encoding human B7.1 (Freeman et al., 1989,
J. Immunol. 143:2714-22, GenBank accession number: M27533), B7.2
(Azuma et al., 1993, Nature 366:76-9, GenBank accession number
L25259), LFA-3 (Wallner et al., 1987, J Exp. Med 166:923-32,
GenBank accession number Y00636) and ICAM-1 (Simmons et al., 1988,
Nature 331:624-7, GenBank accession number X06990). Examples of
other immunologically active proteins include, ICAM-3 (Fawcett et
al., 1992, Nature 360:481-4, GenBank accession number S50015),
VCAM-1 (Damle et al., 1992, J Immunol. 148:1985-92), CD59 (Menu et
al., 1994, J. Immunol. 153:2444-56), CD40 (Hancock et al., 1996,
Proc. Natl. Acad Sci. USA 93:13967-72) and GM-CSF (Takashi et al.,
JP 1991155798-A, GenBank accession number E02975). Proteins having
other activities, such as tumor necrosis factor (TNF, Masaaki et
al., JP 1985185799, GenBank accession number E00423) may also be
employed as the first domain in the fusion protein. By way of
example, proteins that induce apoptosis (such as TNF) or anergy may
be employed to delete certain classes of antigen-specific activated
T-cells. Thus, myelin basic protein (MBP)-specific autoreactive
T-cells that are found at the site of inflammation in multiple
sclerosis patients may be deleted by introducing into the patient
target cells that express MBP and which also present a
TNF-.beta..sub.2m fusion protein.
[0055] cDNA clones encoding .beta..sub.2m and the second protein
may be obtained as described in the cited references, or by PCR
amplification from mRNA (or cDNA libraries) of cells that express
the particular protein. cDNA amplification is performed as
described by Innis et al. (PCR Protocols, A Guide to Methods and
Applications, Innis et al. (eds.), Academic Press, Inc., San Diego,
Calif., 1990) using primers designed to amplify the desired
portions of the cDNA. For example, cDNA primers may be designed to
amplify only that portion of the .beta..sub.2m cDNA that encodes
the mature form of .beta..sub.2m. PCR may also be used to adapt the
amplified fragments for ligation.
[0056] In addition to a .beta..sub.2m domain and a second protein
domain (e.g., B7), .beta..sub.2m fusion proteins may also include
additional elements, such as a linker sequence between the
.beta..sub.2m domain and the second domain, and a signal peptide.
The linker sequence is generally between 10 and 25 amino acids in
length, and serves to provide rotational freedom in the fusion
construct, thereby facilitating appropriate conformational folding
of the two adjacent protein domains. Such linker sequences are well
known in the art and include the glycine(4)-serine spacer
(GGGGS.times.3, Seq. I.D. No. 11) described by Chaudhary et al.
(Nature 339:394-397, 1989). A version of this linker in which the
third repeat of the linker motif is modified to GGGAS (Seq. I.D.
No. 12) is also shown in FIG. 3 and Seq. I.D. No. 2. Other linker
sequences may also be used to construct the .beta..sub.2m fusion
proteins.
[0057] Signal peptides serve to direct expression of a particular
protein to a specified location in the cell. Depending on whether
the fusion protein is to be expressed in a prokaryotic or
eukaryotic cell, a prokaryotic or eukaryotic signal peptide will be
selected. Prokaryotic signal peptides that direct secretion of
peptides into the medium may be particularly useful where large
amounts of the fusion peptide are to be produced. Examples of such
signal sequences include the prokaryotic signal sequence of the
pectate lyase gene pelB (Power et al., 1992, Gene 113:95-9
(KYLLPTAAAGLLLLAAQPAMA, Seq. I.D. No. 13)), and the outer membrane
protein ompT (Ouzzine et al., 1994, FEBS Lett 339:195-9
(MRAKLLGIVLTPIAISFAST, Seq. I.D. No. 14)). Eukaryotic signal
peptides that direct expression of a peptide to the cell surface
are useful where the fusion protein is to be presented on the
surface of the cell. The signal peptide of .beta..sub.2m (shown in
FIG. 3 and Seq. I.D. No. 2) is particularly suitable for this
purpose.
[0058] In their most basic form, nucleic acids encoding
.beta..sub.2m fusion proteins will comprise x-y wherein x is a
nucleic acid sequence encoding the first protein domain (e.g., B7)
and y is a nucleic acid sequence encoding the .beta..sub.2m protein
domain. Where a linker sequence is to be included, the nucleic acid
may be represented as x-l-y, wherein l is a nucleic acid sequence
encoding the linker peptide. Where a signal sequence is to be
included, the nucleic acid may be represented as s-x-l-y wherein s
is a nucleic acid sequence encoding the signal peptide. Preferably,
although not necessarily, the relative orientation of the nucleic
acid sequences is such that in the encoded fusion protein, the
N-terminal of the .beta..sub.2m protein is linked to the C-terminal
of the second protein domain. In all instances, the various nucleic
acid sequences that comprise the .beta..sub.2m fusion protein
construct (e.g., s, l, x and y) are operably linked such that the
elements are situated in a single reading frame.
[0059] Nucleic acid constructs expressing fusion proteins may also
include regulatory elements such as promoters, enhancers and 3'
regulatory regions, the selection of which will be determined based
upon the type of cell in which the protein is to be expressed. The
constructs are the introduced into a vector suitable for expressing
the .beta..sub.2m fusion protein in the selected cell type.
[0060] A selected .beta..sub.2m fusion protein may be obtained by
expression in a prokaryotic or eukaryotic expression system, many
of which are well known in the art. Heterologous proteins can be
produced 20 in prokaryotic cells by placing a strong, regulated
promoter and an efficient ribosome binding site upstream of the
.beta..sub.2m fusion protein construct. Suitable promoter sequences
include the beta-lactamase, tryptophan (trp), and lambda derived
P.sub.L promoters. Prokaryotic expression vectors and expression
systems suitable for producing high levels of protein bacterial
cells are available commercially and include the pBAD, P.sub.L and
Superlinker expression systems produced by Invitrogen (Carlsbad,
Calif.) and the pMAL expression system produced by New England
Biolabs (Beverly, Mass.). In addition, methods and plasmid vectors
for producing heterologous proteins in bacteria are described in
Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor, New York, 1989). Often, proteins expressed at high
levels are found in insoluble inclusion bodies; methods for
extracting proteins from these aggregates are described by Sambrook
et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor,
New York, 1989, ch. 17). Vectors suitable for the production of
intact native proteins include pKC30 (Shimatake and Rosenberg,
1981, Nature 292:128), pKK177-3 (Amann and Brosius, 1985, Gene
40:183) and pET-3 (Studiar and Moffatt, 1986, J. Mol. Biol.
189:113). Suitable prokaryotic cells for expression of large
amounts of .beta..sub.2m fusion proteins include Escherichia coli
and Bacillus subtilis.
[0061] Eukaryotic cells such as Chinese Hamster ovary (CHO), monkey
kidney (COS), HeLa, Spodoptera frugiperda, and Saccharomyces
cerevisiae may also be used to express .beta..sub.2m fusion
proteins. Regulatory regions suitable for use in these cells
include, for mammalian cells, viral promoters such as those from
CMV, adenovirus and SV40, and for yeast cells, the promoter for
3-phosphoglycerate kinase and alcohol dehydrogenase. Eukaryotic
cell expression systems are also commercially available, and
include Pichia pastoris, Drosophila, Baculovirus and Sindbis
expression systems produced by lnvitrogen (Carlsbad, Calif.).
[0062] The transfer of DNA into eukaryotic, in particular human or
other mammalian cells, is now a conventional technique. The vectors
are introduced into the recipient cells as pure DNA (transfection)
by, for example, precipitation with calcium phosphate (Graham and
vander Eb, 1973, Virology 52:466) or strontium phosphate (Brash et
al., 1987, Mol. Cell Biol. 7:2013), electroporation (Neumann et
al., 1982, EMBO J 1:841), lipofection (Felgner et al., 1987, Proc.
Natl. Acad. Sci USA 84:7413), DEAE dextran (McCuthan et al., 1968,
J. Natl. Cancer Inst. 41:351), microinjection (Mueller et al.,
1978, Cell 15:579), protoplast fusion (Schafner, 1980, Proc. Natl.
Acad. Sci. USA 77:2163-7), or pellet guns (Klein et al., 1987,
Nature 327:70). Alternatively, the nucleic acid molecules can be
introduced by infection with virus vectors. Systems are developed
that use, for example, retroviruses (Bernstein et al., 1985, Gen.
Engr'g 7:235), adenoviruses (Ahmad et al., 1986, J. Virol. 57:267),
or Herpes virus (Spaete et al., 1982, Cell 30:295).
[0063] The .beta..sub.2m fusion protein produced in mammalian cells
may be extracted following release of the protein into the
supernatant and may be purified using an immunoaffinity column
prepared using anti-.beta..sub.2m antibodies. Alternatively, the
.beta..sub.2m fusion protein may be expressed as a chimeric protein
with, for example, .beta.-globin. Antibody to .beta.-globin is
thereafter used to purify the chimeric protein. Corresponding
protease cleavage sites engineered between the .beta.-globin gene
and the nucleic acid sequence encoding the .beta..sub.2m fusion
protein are then used to separate the two polypeptide fragments
from one another after translation. One useful expression vector
for generating .beta.-globin chimeric proteins is pSG5
(Stratagene).
[0064] By way of example cDNA encoding a .beta..sub.2m fusion
protein with an N-terminal methionine to initate translation may be
subcloned into pET21-d (Novagen) which directs recombinant protein
to inclusion bodies. Alternatively, commercially available insect
cell expression systems such as the Baculovirus Expression Vector
System from Pharmingen (San Diego, Calif.) can be used for the
combined expression and folding of .beta..sub.2m and Nth fusion
proteins, where the expressed proteins will require only subsequent
purification.
[0065] Proteins expressed as described above may be further
purified by immunoaffinity column and used directly to treat
mammalian cells. Alternatively, expression of a .beta..sub.2m
fusion protein in a mammalian cell may be obtained by introducing a
vector carrying a nucleic acid sequence encoding the protein into
the cell. Nucleic acid molecules encoding .beta..sub.2m fusion
proteins carrying a signal sequence, such as the .beta..sub.2m
signal sequence are particularly preferred for this purpose.
[0066] In one aspect of the invention, the .beta..sub.2m fusion
proteins are used as immunotherapeutics, and the mammalian cell is
a tumor cell. In many cancer patients, tumor cells escape immune
recognition by downregulating MHC and/or co-stimulatory molecule
expression. Accordingly, one method of treatment previously
proposed is to remove tumor cells from a patient, introduce into
the cells a co-stimulatory molecule such as B7 and then return the
cells to the patient (see for example European Patent Application
publication number EP 0 733 373 A2). Applying the discovery
disclosed herein to those methods, introducing a .beta..sub.2m
fusion protein into tumor cells is expected to provide considerable
benefit.
[0067] Obtaining .beta..sub.2m fusion protein expression on the
surface of tumor cells may be achieved either by directly
incubating tumor cells with a purified preparation of the fusion
protein, or by introducing into the cells a vector that expresses
the fusion protein. All types of tumor are potentially amenable to
treatment by this approach including, for example, carcinoma of the
breast, lung, pancreas, ovary, kidney, colon and bladder, as well
as melanomas and sarcomas.
[0068] Incorporation of the .beta..sub.2m fusion protein onto the
surface of tumor cells by incubation of the purified fusion protein
with the cells, may be achieved by incubation of the tumor cells
with the recombinant protein (1-5 .mu.M) in serum-free medium for
2-16 hours. Additionally, tumor cells can be treated briefly with a
low pH buffer (pH 2.5 to 3.5) to strip endogenous .beta..sub.2m and
peptide from cell-surface MHC I molecules followed by
reconstitution with the .beta..sub.2m fusion protein and relevant
MHC I binding peptides for 1-16 hours.
[0069] Where a nucleic acid encoding the fusion protein is to be
introduced into the tumor cell, the nucleic acid is preferably
incorporated into a suitable expression vector. Suitable vectors
include plasmid, cosmid and viral vectors, such as retroviruses,
adenoviruses and herpesviruses. Disabled viruses, such as those
described in U.S. Pat. No. 5,665,362 may be employed for this
purpose. Because of the high efficiency with which viral vectors
infect mammalian cells, viral vectors are expected to offer
advantages over other vector types. The vector is then introduced
into the tumor cell by one of a range of techniques, such as
electroporation, lipofection, co-cultivation with virus-producing
cells, or other standard means. In a preferred embodiment, the
tumor cells are cells removed from the patient to be treated, but
the tumor cells may alternatively be cells from a tumor cell line,
such as the human tumor cell lines available from the American Type
Culture Collection (ATCC, Manassas, Va.). If it is desired to
screen the cells to select those into which the vector was
introduced, this may be achieved by a number of means, including
selecting for expression of the selectable marker if one is used,
or screening for expression of the .beta..sub.2m fusion protein on
the surface of the cells. This latter procedure may be conveniently
performed using a fluorescence activated cell sorter (FACS).
[0070] The tumor cells are subsequently administered to the patient
in combination with a suitable carrier such as buffered water,
saline, or glycine. In a preferred embodiment, where the tumor
cells are cells originally removed from the patient, they are
attenuated before being administered to the patient. An attenuated
cell is one which is metabolically active but which is no longer
able to proliferate. Methods for attenuating tumor cells are well
known and include those described in EP 0 733 373 A2.
[0071] In an alternative embodiment, cell membranes from the tumor
cells, which include the .beta..sub.2m fusion protein, may be
administered to the patient instead of intact tumor cells. A cell
membrane preparation can readily be prepared by disrupting or
lysing the cells using standard techniques, such as a French Press,
freeze-thawing, or sonication. Following disruption of the cells, a
membrane enriched fraction may be obtained by centrifugation.
[0072] The present invention also encompasses other immunotherapy
methods for treating conditions such as cancer, including adoptive
immunotherapy. As is known in the art, adoptive immunotherapy
involves obtaining lymphoid cells exposed to a particular antigen,
culturing those cells ex vivo under conditions whereby the activity
of the cells is enhanced, and then administering the cells to an
individual. The lymphoid cells are preferably T-cells removed from
a cancer patient, for example T-cells from a draining lymph node.
These T-cells are incubated with tumor cells removed from the
patient which have been treated as described above so as to present
a .beta..sub.2m fusion protein on their cell surface. Accordingly,
one aspect of the present invention is a form of adoptive
immunotherapy in which the incubation of lymphoid cells ex vivo is
performed in a medium containing tumor cells presenting a
.beta..sub.2m fusion protein prior to administration of the cells
to a patient. The technical details of methods for obtaining
lymphoid cells, ex vivo cultivation of such cells with immune
stimulants, and administration to patients are known in the field
and are described, for example in U.S. Pat. Nos. 4,690,915
("Adoptive immunotherapy as a treatment modality in humans"),
5,229,115 ("Adoptive immunotherapy with interleukin-7"), 5,631,006
("Inmmunotherapy protocol of culturing leukocytes in the presence
of interleukin-2 in a hollow fiber cartridge"), and 4,902,288
("Implantable immunotherapy system using stimulated cells"), and
references cited therein.
Production and Use of h.beta..sub.2m S55V and .beta..sub.2m Fusion
Proteins in Vaccine Preparations
[0073] Methods for the production and use of .beta..sub.2m as a
vaccine adjuvant are known in the art and include those described
in U.S. Pat. No. 5,733,550, which is incorporated herein by
reference. Such methods may be applied for the use of
h.beta..sub.2m S55V as well as .beta..sub.2m fusion proteins in
vaccine preparations as well as methods of vaccination.
[0074] .beta..sub.2m fusion proteins may be produced as described
above. Nucleic acid molecules encoding forms of h.beta..sub.2m
carrying the S55V amino acid substitution may be produced using
standard mutagenesis techniques, such as site directed mutagenesis,
or by PCR as described in Example 4 below. The encoded
h.beta..sub.2m S55V may be expressed in and purified from
prokaryotic or eukaryotic expression systems, as described above
for the .beta..sub.2m fusion proteins.
[0075] .beta..sub.2m fusion proteins and h.beta..sub.2m S55V may be
used as adjuvants in vaccine preparations, in which case they may
be combined with an antigen in a vaccine preparation, or they may
be administered to a patient either shortly before or after
administration of a conventional vaccine preparation. Preferably,
the .beta..sub.2m fusion protein or h.beta..sub.2m S55V is
administered at the same location and contemporaneously with the
antigen preparation. Where a h.beta..sub.2m fusion protein is used
as a vaccine adjuvant, the h.beta..sub.2m component of the protein
may be a S55V form of h.beta..sub.2m. The protein to which the
h.beta..sub.2m is fused will preferably be a co-stimulatory protein
such as B7.
[0076] Typically, the antigen administered to a patient in
conjunction with a .beta..sub.2m preparation of the present
invention (i.e., a preparation of a .beta..sub.2m fusion molecule
or a S55V .beta..sub.2m) will be a peptide antigen that can bind to
class 1 MHC molecules of the patient. Peptide antigens that may be
employed include tumor antigens, as well as antigens from
pathogenic organisms, including viruses and bacteria. Examples of
suitable antigens include HIV gp120, sub-units of influenza
nucleoprotein or hemagglutinin, and tumor antigens as discussed by
Boon et al., (Ann. Rev. Immunol. 12:337-65, 1994); Finn (Curr.
Opin. Immunol. 5:701-8, 1993) and Sligluff et al. (Curr. Opin.
Immunol. 6:733-40, 1994). Such antigens may be isolated or
extracted from an original source (e.g., tumor cells), or may be
produced by recombinant means, or may be chemically synthesized.
Vaccination may be accomplished by administering a single peptide
antigen or a cocktail of antigens derived from, one or more antigen
sources.
[0077] The .beta..sub.2m that forms the basis of the .beta..sub.2m
fusion protein or .beta..sub.2m S55V used in the vaccine.
compositions and methods of the present invention may be any
mammalian .beta..sub.2m. It may be preferable to use a
.beta..sub.2m derived from the same species of mammal as the mammal
to be vaccinated so as to reduce the risk of immune response to the
administered .beta..sub.2m preparation. However, since xenogeneic
.beta..sub.2m is typically not inflammatory in vivo, this may not
be necessary.
[0078] Vaccine preparations according to the present invention may
be administered by any known means, including intramuscular and
intravenous injection. In its simplest form, the .beta..sub.2m
preparation administered to the mammal is administered in
conventional dosage form, preferably combined with a pharmaceutical
excipient, carrier or diluent. Suitable pharmaceutical carriers may
be solids or liquids, and may include buffers, anti-oxidants such
as ascorbic acid, other polypeptides or proteins such as serum
albumin, carbohydrates, chelating agents and other stabilizers and
excipients. Suitable solid carriers include lactose, magnesium
stearate, terra alba, sucrose, talc, stearic acid, gelatin, agar,
pectin, acacia and cocoa butter. The amount of a solid carrier will
vary widely depending on which carrier is selected, but preferably
will be from about 25 mg to about 1 g per dose of active agent.
Suitable liquid carriers include neutral buffered saline,
optionally with suitable preservatives, stabilizers and excipients.
The carrier or diluent may also include time delay material well
known to the art such as, for example, glycerol distearate, either
alone or with a wax. The foregoing examples of suitable
pharmaceutical carriers are only exemplary and one of skill in the
art will recognize that a very wide range of such carriers may be
employed. Liposome-based delivery systems may also be employed to
deliver .beta..sub.2m preparations. Liposome-based systems, which
may be employed to provide a measured release of the agent over
time into the bloodstream, are well known in the art and are
exemplified by the systems described in U.S. Pat. No. 4,356,167
("Liposome drug delivery systems"), U.S. Pat. No. 5,580,575
("Therapeutic drug delivery systems"), U.S. Pat. No. 5,595,756
("Liposomal compositions for enhanced retention of bioactive
agents") and U.S. Pat. No. 5,188,837 ("Lipospheres for controlled
delivery of substances"), and documents cited therein.
[0079] The formulation of the .beta..sub.2m preparation with a
pharmaceutical carrier can take many physical forms, but is
preferably a sterile liquid suspension or solution, suitable for
direct injection. Preferably, the patient will be administered the
h.beta..sub.2m preparation in a formulation as described above
(i.e. in combination with a pharmaceutical carrier), wherein the
formulation includes a clinically effective amount of the agent. In
the context of vaccination, "a clinically effective amount" of the
.beta..sub.2m preparation is an amount sufficient to provide an
enhancement of the immune response to the target antigen, i.e., to
produce a cytotoxic T-cell response greater than would be presented
absent administration of the .beta..sub.2m preparation.
Quantification of the immune response arising from a vaccination
may be achieved in any standard way, e.g., lymphoproliferation in
response to test antigen in vitro or lysis of target cells by
specific cytotoxic T-lymphocytes.
[0080] It will be appreciated that a clinically effective dose of a
.beta..sub.2m preparation will vary depending upon the actual
.beta..sub.2m being used (e.g., whether it is a .beta..sub.2m
fusion protein or h.beta..sub.2m S55V alone), and the
characteristics of the patient (age, weight, other medications
being taken etc.). Thus, the assessment of a clinically effective
dosage will ultimately be decided by a physician, veterinarian, or
other health care worker familiar with the patient. Typically,
administering a .beta..sub.2m preparation to a mammal as a
component of a vaccination regimen will involve administration of
from about 10 ng to 1 g of .beta..sub.2m preparation per dose, with
single dose units of from about 10 mg to 100 mg being commonly
used, and specific dosages of up to 1 mg or 10 mg also being within
the commonly used range. The amount of antigen included in the
vaccine preparation that employs a .beta..sub.2m adjuvant will
typically be the same as would be included in vaccine preparations
without the .beta..sub.2m adjuvant, although greater or lesser
amounts of antigen may be employed as clinically appropriate.
[0081] Where the .beta..sub.2m is administered to the mammal in a
single preparation with the vaccine antigens, the preparation may
be formulated simply, by mixing a clinically effective amount of
the .beta..sub.2m with the antigen preparation. Vaccines comprising
tumor antigens and a .beta..sub.2m may be prepared from tumor cells
which have been transformed to express the .beta..sub.2m.
EXAMPLES
[0082] The following examples serve to illustrate the
invention.
Example 1
Production of .beta..sub.2m-B7 Fusion Protein
[0083] The murine B7.2: human .beta..sub.2m fusion protein
(mB7.beta..sub.2) was made in multiple steps as follows. The
extracellular domain of murine B7.2 (Freeman et al., 1993, J. Exp.
Med 178:2185-92, GenBank accession number L25606) was amplified by
PCR from the plasmid mB7-2 (from Richard Hodes, NIH) using the
following two oligonucleotides:
[0084] mB7-2 5' PCR Oligo: AGGGTACCATGGTTTCCGTGGAGACGCAAGC (Seq.
I.D. No. 8) and
[0085] mB7-2 3' PCR Oligo: TCGAATTCATGATGCTAGCCCAATACGTTTGAGGAGATGG
(Seq. I.D. No. 9) which have embedded restriction sites for cloning
(bold): Kpn1: GAATTC; Nco1: CCATGG; and BspH1: TGATCA.
[0086] The resulting PCR fragment was cut with Nco1 and BspH1, and
ligated as an amino terminal extension into an Nco1cut bluescript
SK vector containing the signal peptide of h.beta..sub.2m (Guessow
et al., 1987, J. Immunol. 139:3132-8, GenBank accession number:
M17986), the c-myc tag EQKLISEEDLN (Zhou et al., 1996, Mol Immunol.
33:1127-34, Seq. I.D. No. 15), and full length h.beta..sub.2m
(plasmid #267). The resulting construct (plasmid #392) was then cut
with NheI to linearize it 5' of the myc sequence. Synthetic
oligonucleotides encoding a [gly4ser].sub.3 spacer were engineered
with NheI compatible ends and ligated into the linearized vector to
create plasmid #396. Finally, the entire coding sequence of
wild-type h.beta..sub.2m (without a myc tag) was PCR amplified from
a h.beta..sub.2m cDNA, with the addition of NheI site 5' and a Not
I site 3' of the coding sequence. This product was digested with
NheI and NotI, and subcloned into plasmid #396 that had also been
digested with NheI and NotI to generate plasmid #406. This plasmid
contained the signal sequence of h.beta..sub.2m, followed by the
extracellular domain of mB7.2, a 15 amino acid spacer, then mature
h.beta..sub.2m. For expression in bacteria, the eukaryotic signal
sequence was removed. Thus, plasmid #406 was digested with NcoI and
NotI to liberate the fusion protein without the signal peptide
present, and this was then subcloned into the bacterial expression
vector pET21 -d that had been linearized with NcoI and NotI.
[0087] Following transfection of the BL21 (DE3) strain of E. coli,
protein synthesis is induced with IPTG, cells were havested, lysed,
and inclusion bodies washed and solubilized. Following refolding of
the recombinant material, it was further purified by gel filtration
and/or affinity chromatography with anti-.beta..sub.2m antibodies.
Experiments in which acid-stripped cells expressing only HLA-A2
were incubated under various conditions with the B7-.beta..sub.2m
fusion protein produced as described above, and then subjected to
FACS analysis using conformationally-sensiti- ve antibodies of
varying specificities confirmed the following: (1) that the B7
domain of the fusion protein is natively folded; (2) that the
.beta..sub.2m domain of the fusion protein is natively folded; and
(3) that the .beta..sub.2m domain of the fusion protein functions
to stabilize MHC I expression (data not shown).
Example 2
The B7-.beta..sub.2m Fusion Protein Co-Stimulates T-Cells
[0088] The ability of B7-.beta..sub.2m to co-stimulate splenic
T-cells was determined in vitro. Antibodies specific for the B7
receptor CD28 were used as a control. .beta..sub.2m, recombinant
B7-.beta..sub.2m, or anti-CD28 was added to the wells of a
microtiter plate and incubated at 37.degree. C. for 2 hours to
promote binding. Thereafter the plates were washed to remove excess
reagent, and splenic T-cells from BALB/c mice were added to the
wells in the presence of sub-optimal concentrations of the soluble
anti-T-cell receptor 2C11. The plates were incubated for 48 hours
and then .sup.3H-thymidine was added and allowed to incorporate
into the proliferating cells for 20 hours. At the end of the time
period, the cells were removed and the amount of .sup.3H-thymidine
taken up was measured.
[0089] The results of these experiments showed that while no T-cell
proliferation was observed in wells containing .beta..sub.2m alone,
recombinant B7-.beta..sub.2m provides co-stimulation to the T-cells
at least as effectively as the anti-CD28 antibody. A typical result
is shown in FIG. 5.
Example 3
Treatment of Tumor Cells with the .beta..sub.2m-B7 Fusion Protein
Boosts the Generation of Tumor-Specific Cytotoxic T-Cells
[0090] The ability of the B7-.beta..sub.2m fusion protein to
stimulate T-cell recognition and response against tumor cell
antigens was compared to the corresponding activity of
h.beta..sub.2m alone. DBA/2 mice were each vaccinated with
3.times.10.sup.6 syngeneic P815 tumor cells that had been
previously incubated in serum-free Iscove's Modified Dulbecco's
Medium (SF IMDM) with either 0.2 .mu.M B7-.beta..sub.2m, 0.2 .mu.M
h.beta..sub.2m alone, or no additional reagent. Samples of each
type were analyzed by how cytometry to show that they stained for
B7 or h.beta..sub.2m. These tumor cells were then irradiated with
20,000 Rads and injected into the mice. One week later the mice
were reimmunized with identically prepared cells. After an
additional week, the mice were sacrificed and their spleen cells
were restimulated in culture with irradiated P815 stimulator cells
for one week. The resulting cultured T-cells were then assayed for
ability to kill untreated P815 tumor cells.
[0091] The results, depicted in FIG. 6, show that the spleen cells
from the mice immunized with the B7-.beta..sub.2m fusion
protein-treated tumor cells were three fold more effective at
killing tumor cells than cells from mice immunized with either the
h.beta..sub.2m treated or untreated tumor cells. These data show
that the presence of the fusion protein on the tumor cell surface
enhances the immune system response to the tumor antigens present
on the tumor cell surface.
Example 4
Production of High Affinity Variant of h.beta..sub.2m
[0092] A number of variant forms of h.beta..sub.2m were created and
tested for activity using MHC stabilization, T-lymphocyte lysis and
myc-h.beta..sub.2m binding and inhibition assays. The hydrophilic
serine 55 (S55) residue of h.beta..sub.2m that is buried at the
h.beta..sub.2m/heavy chain interface and is situated directly
adjacent to an ordered water molecule was identified as the target
residue for mutagenesis. This residue was mutagenized to
hydrophobic residues of increasing mass (valine, isoleucine,
phenylalanine) in order to promote hydrophobic interactions and
exclude the ordered water.
[0093] The h.beta..sub.2m sequence variants were constructed by
mutating h.beta..sub.2m cDNA in Bluescript SK (Stratagene, La
Jolla, Calif.) using the ExSite mutagenesis system (Stratagene)
according to the manufacturer's protocol. The mutated cDNAs were
subcloned into the bacterial expression vector pET-21d(+) (Novagen,
Madison, Wis.) using engineered Nco1and BamHI sites at the 5' and
3' end of the mature protein sequence, respectively.
Oligonucleotides used to create variants of the h.beta..sub.2m
sequence were as follows:
1 Sense S55F: 5' TTC TTC AGC AAG GAG TGG TCT TTC 3' (Seq. I.D. No.
4) Sense S551: 5' ATT TTC AGC AAG GAG TGG TCT TTC 3' (Seq. I.D. No.
5) Sense S55V: 5' GTG TTC AGC AAG GAG TGG TCT TTC 3' (Seq. I.D. No.
6) Common antisense: 5' TAA GTC TGA ATG CTC GAG TTT TTC 3' (Seq.
I.D. No. 7)
[0094] Expression and purification of the mutated h.beta..sub.2ms
was performed as previously described by Shields et al. (J.
Immunol. 160:2297-307, 1998). Briefly, h.beta..sub.2m constructs in
pET-21d(+) were transformed into the BL21(DE3) strain of E. coli.
At an O.D..sub.600nm of 0.6, cultures were induced with 1 mM IPTG
for four hours, and inclusion bodies isolated by centrifugation
after sonication of bacteria in 200 mM Tris, 2 mM EDTA, 10% Triton
X-100, pH 7.6 and washing in 200 mM Tris, 2 mM EDTA, pH 7.6.
Inclusion bodies were solubilized in 6 M Guanidine-HCl containing
0.3 M DTT, 100 mM Tris, pH 8.0, and a mixture of protease
inhibitors (5 .mu.g/ml Leupeptin, 0.5 mM AEBSF, 1% Aprotinin).
Following overnight dialysis in 6 M Guanidine pH 2.0, recombinant
protein was refolded over 72 h in 0.4 M Arginine, 5 mM oxidized
glutathione, 100 mM Tris, 2 mM EDTA at 10.degree. C. Following
refolding, preparations were dialyzed exhaustively against 0.4 M
Arginine, 100 mM Tris, 2 mM EDTA, pH 8.0 and then PBS at 4.degree.
C. Preparations were purified as a single peak by preparative FPLC
on a Superdex 75 pg gel filtration column (Pharmacia, Uppsala,
Sweden), concentrated using Centriprep-3 concentrating units
(Amicon, Beverly, Mass.), sterile filtered and concentrations
calculated based on O.D..sub.280nm readings. Recombinant
h.beta..sub.2m was judged to be 95% pure based on analysis by
SDS-PAGE, and analytical FPLC.
Example5
h.beta..sub.2m S55V Produces Enhanced MHC I Stabilization
[0095] An HLA stabilization assay was used to screen the
h.beta..sub.2m variants. A number of HLA alleles, HLA-A1, HLA-A2,
and HLA-A3, were analyzed in order to determine whether any of the
point mutants exhibited allele-specific effects.
[0096] In this and the following experiments, cell lines,
monoclonal antibodies (mAbs) and peptides used were as follows:
[0097] Cell Lines and antibodies: Hmy2.C1R cells (Storkus et al.,
1987, J. Immunol. 138:1657) were stably transfected with HLA-A1,
-A2, and -A3 as previously described (Winter et al., 1991, J.
Immunol. 146:3508; DiBrino et al., 1993, J. Immunol. 151:5930).
HLA-A2/HTLV-1 TAX 11-19 peptide-specific CTL clone N1218 and
HLA-A3/lnfluenza NP 265-273 peptide clone 2G12 were isolated and
restimulated as previously described by Biddison et al. (J.
Immunol. 159:2018, 1997). All mAbs were used as culture
supernatants grown in DMEM supplemented with 10% fetal calf serum,
20 mM HEPES, 2 mM L-glutamine, 1% non-essential amino acids, 1%
Pen-strep, and 0.04 mg/ml of Gentamicin sulfate (complete DMEM).
GAP.A3 (HLA-A3 specific), and BB7.5 (pan-HLA-ABC specific)
hybridomas were obtained from the American Type Culture Collection
(Manassas, Va.). The myc-specific 9E10 hybridoma has been
previously described by Evan et al. (Mol Cell Biol. 5:3610-6,
1985). Unless otherwise noted all solutions used for cell growth
were obtained from Biofluids (Rockville, Md.).
[0098] Peptides: The peptides used were the HLA-A1 binding
ornithine decarboxylase 309-317 (OD 309): SSEQTFMYY (Seq. I.D. No.
16); the HLA-A2 binding HTLV-1 TAX 11-19: LLFGYPVYV (SEQ. I.D. No.
17) and HIV gag 77-85: SLYNTVATL (Seq. I.D. No. 18); and the HLA-A3
binding pn2a.A3: KLYEKVYTYK (Seq. I.D. No. 19) and influenza NP
265-273: ILRGSVAHK (Seq. I.D. No. 20) (DiBrino et al., 1993, Proc.
Natl. Acad. Sci USA 90:1508; DiBrino et al., 1994, J. Immunol.
152:620; Honma et al., 1997, J. Neuroimmunol. 73:7; Parker et al.,
1992, J. Immunol. 149:3580; Parker et al., 1994, J. Immunol.
152:163; and Parker et al., 1995, Immunol. Res. 14:34). These
peptides were purchased from Bachem (Torrance, Calif.) or provided
by Dr. John E. Coligan (Natl. Inst. of Allergy and Infectious
Diseases, NIH). All peptides were purified by reverse phase HPLC
and were >95% pure as determined by analytical HPLC and mass
spectrometry.
[0099] The MHC stabilization was done essentially as described
previously (Bremers et al., 1995, J. Immunol. Emphasis Tumor
Immunol. 18:77; van der Burg et al., 1995, Hum. Immunol. 44:189;
Sugawara et al., 1987, J. Immunol. Methods 100:83) with minor
modifications. Briefly, Hmy2.C1R cells (Storkus et al., 1987, J.
Immunol. 138:1657) were stably transfected with HLA-A1, -A2, and
-A3 as previously described (Winter et al., 1991; J. Immunol.
146:3508; DiBrino et al., 1993, J. Immunol. 151:5930). Hmy2.C1R-A1,
-A2, and -A3 cells were washed twice with PBS, resuspended in 0.13
M citric acid, 66 mM Na.sub.2HPO.sub.4, pH 2.9 (pH 3.2 for A2
cells), for 90 seconds at 4.degree. C., washed with two 50 ml
changes of IMDM, and resuspended in SF IMDM (identical to SF DMEM
using IMDM instead). 10.sup.5 cells per well were added to a 96
well microtiter plate containing hybridoma supernatants, peptide,
and h.beta.2m dilutions in a total volume of 150 .mu.l. HLA-A1
transfected Hmy2.C1R cells were combined with BB7.5 mAb and 10
.mu.g/ml A1-binding OD 309 peptide. HLA-A2 transfected Hmy2.C1R
cells were combined with BB7.5 mAb and 2.5 .mu.g/ml A2-binding HIV
gag peptide. HLA-A3 transfected Hmy2.C1R cells were combined with
GAP.A3 mAb and 1.25 .mu.g/ml A3-binding pn2a.A3 peptide. After a
four hour incubation at 23.degree. C., cells were washed twice with
FACS buffer (PBS, 2 mg/ml BSA, 0.02% NaN,) and stained with
FITC-conjugated goat anti-mouse IgG (H+L) F(ab').sub.2 fragment
(Cappel/Organon Teknika, Durham, N.C.) for one hour at 4.degree. C.
Cells were washed twice with FACS buffer and fixed in 1%
formaldehyde in PBS followed by flow cytometric analysis on a
FACScan II machine (Becton Dickinson, Mountain View, Calif.).
[0100] FIG. 7 demonstrates the ability of the S55 variant
h.beta..sub.2m to stabilize HLA-A1 (FIG. 7a), HLA-A2 (FIG. 7b), and
HLA-A3 (FIG. 7c) in the presence of a specific binding peptide and
an appropriate HLA-specific antibody. The S55V variant ("X" symbol
in FIG. 7) stabilized HLA-A1 and HLA-A3 approximately 2-fold and
3-fold better respectively, than wild-type h.beta..sub.2m
(diamonds) at a molar level, and effects on HLA-A2 stabilization by
S55V were slightly better than those observed with wild-type
h.beta..sub.2m. S55F (squares) was similar to wild-type
h.beta..sub.2m for all alleles tested, while the effects of S551
(triangles) varied depending on the allele (better with HLA-A1 and
worse with -A2 and -A3).
Example 6
h.beta..sub.2m S55V Binds to MIHCl with a Higher Affinity that
Wild-Type h.beta..sub.2m
[0101] The antibodies used in the experiments in the previous
Example were selected due to their dependence on both
h.beta..sub.2m and peptide in order to detect "complete" molecules,
i.e. heavy chain/h.beta..sub.2m /peptide natively folded trimeric
complexes. Since this binding assay requires the presence of an
antibody in addition to h.beta..sub.2m and peptide (van der Burg,
1995, Hum. Immunol. 44:189), there was the possibility that the
antibody itself exerted an effect that is specific for a particular
h.beta..sub.2m mutant. Due to concerns regarding the potential
contribution of the antibodies to the stabilization of cell-surface
MHC I complexes, a binding inhibition assay was developed that
directly measures the relative abilities of h.beta..sub.2m s to
bind to MHC I molecules. This assay format requires a labeled
h.beta..sub.2m to measure the inhibition. Methods of labeling such
as biotinylation and iodination are random reactions and create
multiply labeled species needing further purification prior to use
in a proper competition assay (Hochman et al., 1988, J. Immunol.
140:2322). However, endogenous labeling with an epitope tag creates
an uniquely labeled species of h.beta..sub.2m. Additionally,
tyrosine and lysine residues (common targets of biotinylation and
iodination) known to be at the MHC heavy chain/h.beta..sub.2m
interface would not be affected with an endogenous label. Therefore
an epitope tag (myc) was engineered onto the amino terminus of
h.beta..sub.2m and the ability of the various h.beta..sub.2m
mutants to compete with the myc-h.beta..sub.2m for cell-surface
binding using the anti-myc mAb 9E10 was studied.
[0102] To establish the functional activity of the
myc-h.beta..sub.2m itself, direct binding studies were performed.
Briefly, Hmy2.C1R transfectant cells at 2.5.times.10.sup.5 per tube
in a 500 .mu.l volume were incubated at 37.degree. C. for 16 hours
in SF IMDM with 2.5 .mu.M myc-.beta..sub.2m, 20 .mu.g/ml peptide
and the indicated concentrations of inhibitor .beta..sub.2m. The OD
309 peptide was used for HLA-A1, the HIV gag peptide for HLA-A2,
and the pn2a.A3 peptide for HLA-A3. Cells were washed three times
in plain IMDM followed by incubation with 9E10 (anti-myc) hybridoma
supernatant at 4.degree. C. for one hour. After washing with IMDM,
cells were stained for one hour with FITC anti-mouse IgG at
4.degree.. Cells were washed a final time in FACS buffer and
analyzed by flow cytometry, gating on live (propidium
iodide-excluding) cells. In the presence of an appropriate peptide
there was concentration-dependent myc-.beta..sub.2m binding for all
alleles studied. However, when cells were incubated with
myc-.beta..sub.2m in the absence of peptide, no appreciable
myc-h.beta..sub.2m binding was observed.
[0103] The relative abilities of wild-type h.beta..sub.2m and S55V
to inhibit the binding of myc-h.beta..sub.2m to HLA molecules were
next compared using an inhibition assay. The inhibition assay was
identical to the binding assay with the following modifications:
2.5 .mu.M myc-h.beta..sub.2m was used in all cases and different
concentrations of non-myc labeled recombinant h.beta..sub.2m were
included to inhibit myc-h.beta..sub.2m binding to cell surface MHC
molecules. Percent inhibition was calculated by the following
equation: (1-((experimental-background)/(no
inhibitor-background))).times.100. 10-20,000 gated events per
sample were counted, and all experiments were repeated at least
twice. Compared with wild-type h.beta..sub.2m, the S55V mutant
inhibited mych.beta..sub.2m binding about 2.5-fold better at a
molar level for HLA-A1, -A2, and -A3 (FIG. 8). These results
demonstrate the higher relative affinity of the S55V mutant
compared to wild-type h.beta..sub.2m for HLA-A1 (FIG. 8a), -A2
(FIG. 8b) and -A3 (FIG. 8c).
Example 7
h.beta..sub.2m S55V Enhances CTL Recognition of Target Cells
[0104] The effectiveness of h.beta..sub.2m in facilitating
exogenous peptide loading of MHC I molecules was measured using a
CTL lysis assay (Depierreux et al., 1997, J. Immunol. Methods
203:77) as follows: Hmy2.C1R cells transfected with HLA-A2 or
HLA-A3 were resuspended to 4.times.10.sup.6 cells/ml in complete
DMEM supplemented with 20 .mu.M BATD (which forms a fluorescent
chelate with Europium; Wallac, Gaithersburg, Md.) and incubated at
37.degree. C. for 30-60 minutes. Cells were resuspended in 10 ml of
serum free (SF) CTL medium (IMDM supplemented with 5 mg/ml bovine
serum albumin (Sigma, St. Louis, Mo.), 2 mM L-glutamine, 1.25 mM
sulfinpyrazone (Sigma), and 1% Pen-strep), centrifuged and washed
once more with SF CTL medium. Cells were then pulsed with peptide
and/or .beta..sub.2m in SF CTL medium for 60-90 minutes at
37.degree. C. Cells were washed twice in SF CTL medium, resuspended
in CTL medium (5% fetal calf serum in lieu of BSA) and combined at
the designated effector:target ratio with CTL clones in round
bottom microtiter plates (CTL clone N1218 at an E:T ratio of 4:1
(FIG. 9a) or the NP-specific HLA-A3 restricted CTL clone 2711 at an
E:T ratio of 2:1 (FIG. 9b)). Plates were gently centrifuged at
100.times.g for 2 minutes and then incubated at 37.degree. C. for 2
hours. Finally, plates were centrifuged at 300.times.g and 20 .mu.l
per well was transferred to 200 .mu.l of 0.3 M acetic acid, 60 mM
sodium acetate, 7.5 .mu.g/ml Europium (Aldrich, Milwaukee, Wis.),
and the plate read on a Wallac 1234 DELFIA Fluorometer. Percent
specific lysis was calculated with the following equation:
100.times.((experimental-blank)-(spontaneous-blank))/((maximum-blank)-(spo-
ntaneous-blank)).
[0105] In this assay, target cell lysis not only correlates with
the loading of a specific peptide antigen, but it also demonstrates
that the peptide is bound in an immunologically relevant manner.
Hmy2.C1R-A2 target cells (a human lymphoblastoid cell essentially
null for HLA molecules except for the transfected HLA-A2.1)
(Winteret al., 1991; J. Immunol. 146:3508; DiBrino et al., 1993, J.
Immunol. 151:5930) were pulsed with a suboptimal concentration of
HTLV-1 TAX peptide (9.3.times.10.sup.-12 M/l) or control A2-binding
HIV gag peptide at 1.times.10.sup.-9 M/l for 90 minutes in
serum-free CTL medium in the absence or presence of increasing
concentrations of purified, recombinant h.beta..sub.2m and then
used as targets in a conventional lysis assay. The presence of
wild-type h.beta..sub.2m dramatically increased the specific lysis
by the TAX-specific CTL clone in a dose-dependent fashion. Using
this suboptimal concentration of peptide there was 20% lysis in the
absence of h.beta..sub.2m. Addition of 8 .mu.M h.beta..sub.2m
increases the lysis to the maximal observed at this E:T ratio. In
the absence of h.beta..sub.2m 100 fold higher concentration of
peptide would be required to achieve comparable levels of lysis
(data not shown).
[0106] Having established the ability of wild-type h.beta..sub.2m
to enhance the loading of antigenic peptide onto cells, the
activity of the S55V variant in this assay was examined. Two CTL
clones, specific for an HTLV-1 TAX peptide in the context of HLA-A2
and an influenza nucleoprotein peptide in the context of HLA-A3,
were used in the assay described above using Hmy2.C1R transfectants
pulsed with a suboptimal concentration of antigenic peptide (NP
265-273, 1.times.10.sup.-10 M/l) or control A3-binding pn2a.A3
peptide at 1.times.10.sup.-6 M/l. The S55V mutant was 4-fold more
effective at a molar level than wild-type h.beta..sub.2m at
enhancing target cell lysis for HLA-A2 (FIG. 9a) and 6 to 7-fold
better for HLA-A3 (FIG. 9b). Controls with irrelevant -A2 and -A3
binding peptides with the highest concentrations of h.beta..sub.2m
used resulted in only background levels of killing. Additionally,
multiple TAX-specific A2-restricted clones displayed similar levels
of S55V enhanced killing relative to wild-type .beta..sub.2m (data
not shown).
[0107] In view of the many possible embodiments to which the
principles of the invention may be applied, it will recognized that
the foregoing examples are offered for purposes of illustration and
do not limit the scope of the invention. Rather, the scope of the
invention is defined by the following claims. We therefore claim as
our invention all that comes within the scope and spirit of these
claims.
Sequence CWU 0
0
* * * * *
References