U.S. patent application number 10/665602 was filed with the patent office on 2004-05-06 for human criptin growth factor.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Coleman, Timothy A., Meissner, Paul S..
Application Number | 20040086967 10/665602 |
Document ID | / |
Family ID | 23871366 |
Filed Date | 2004-05-06 |
United States Patent
Application |
20040086967 |
Kind Code |
A1 |
Meissner, Paul S. ; et
al. |
May 6, 2004 |
Human criptin growth factor
Abstract
A human Criptin Growth Factor polypeptide (CGF) and DNA (RNA)
encoding such polypeptide and a procedure for producing such
polypeptide by recombinant techniques is disclosed. Also disclosed
are methods for utilizing such polypeptide for wound healing or
tissue regeneration, stimulating implant fixation and angiogenesis.
Antagonist against such polypeptides and their use as a therapeutic
to treat and/or prevent neoplasia such as tumors is also disclosed.
Diagnostic assays for identifying mutations in CGF nucleic acid
sequences and altered levels of the CGF for the detection of cancer
are also disclosed.
Inventors: |
Meissner, Paul S.;
(Barnesville, MD) ; Coleman, Timothy A.; (Derwood,
MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
20850
|
Family ID: |
23871366 |
Appl. No.: |
10/665602 |
Filed: |
September 22, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10665602 |
Sep 22, 2003 |
|
|
|
09393023 |
Sep 9, 1999 |
|
|
|
09393023 |
Sep 9, 1999 |
|
|
|
08471371 |
Jun 6, 1995 |
|
|
|
5981215 |
|
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 514/1.9; 514/13.3; 514/19.3; 514/8.2; 514/8.5;
514/8.9; 514/9.1; 514/9.4; 514/9.6; 530/399; 536/23.5 |
Current CPC
Class: |
C07K 14/475 20130101;
C07K 14/52 20130101; A61K 48/00 20130101 |
Class at
Publication: |
435/069.1 ;
435/320.1; 435/325; 514/012; 530/399; 536/023.5 |
International
Class: |
A61K 038/18; C07K
014/475; C07H 021/04 |
Claims
What is claimed is:
1. An isolated polynucleotide comprising a member selected from the
group consisting of: a. a polynucleotide encoding the polypeptide
comprising amino acid 1 to amino acid 223 as set forth in SEQ ID
NO:2; b. a polynucleotide encoding the polypeptide comprising amino
acid 24 to amino acid 223 as set forth in SEQ ID NO:2; c. a
polynucleotide encoding the polypeptide comprising amino acid 24 to
amino acid 173 as set forth in SEQ ID NO:2; d. a polynucleotide
encoding the polypeptide comprising amino acid 24 to amino acid 128
as set forth in SEQ ID NO:2; e. a polynucleotide capable of
hybridizing to and which is at least 70% identical to the
polynucleotide of (a), (b), (c) or (d); and f. a polynucleotide
fragment of the polynucleotide of (a), (b), (c) or (d).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. An isolated polynucleotide comprising a member selected from the
group consisting of: a. a polynucleotide which encodes a mature
polypeptide encoded by the DNA contained in ATCC Deposit No. 97142;
b. a polynucleotide which encodes a polypeptide expressed by the
DNA contained in ATCC Deposit No. 97142; c. a polynucleotide
capable of hybridizing to and which is at least 70% identical to
the polynucleotide of (a) or (b); and d. a polynucleotide fragment
of the polynucleotide of (a), (b) or (c).
4. The polynucleotide of claim 2 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 1 to nucleotide 672.
5. The polynucleotide of claim 2 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 62 to nucleotide 672 .
6. The polynucleotide of claim 2 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 69 to nucleotide 672.
7. The polynucleotide of claim 2 comprising the sequence as set
forth in SEQ ID NO:1 from nucleotide 201 to nucleotide 672.
8. A vector containing the DNA of claim 2.
9. A host cell genetically engineered with the vector of claim
8.
10. A process for producing a polypeptide comprising: expressing
from the host cell of claim 9 the polypeptide encoded by said
DNA.
11. A process for producing cells capable of expressing polypeptide
comprising genetically engineering cells with the vector of claim
8.
12. A polypeptide comprising a member selected from the group
consisting of (i) a polypeptide having the amino acid sequence of
SEQ ID NO:2 and fragments, analogs and derivatives thereof; and
(ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 97142
and fragments, analogs and derivatives of said polypeptide.
13. A compound which activates a receptor for the polypeptide of
claim 12.
14. A compound which inhibits the polypeptide of claim 12.
15. An antibody against the polypeptide of claim 12.
16. A process for identifying compounds which inhibit activation of
the polypeptide of claim 12 comprising: contacting cells which
express a CGF receptor on the surface thereof with labeled CGP and
a compound to be screened under conditions suitable for binding of
ligands to said receptor; and determining the extent of binding of
labeled CGF to the receptor by measuring the amount of label
attached to the receptor.
17. A process for identifying compounds which inhibit activation of
the polypeptide of claim 12 comprising: contacting cells which
express a CGF receptor on the surface thereof with a compound to be
screened under conditions suitable for binding of ligands to said
receptor; and determining the extent of binding of the compound to
the receptor and the lack of a signal generated by the binding.
18. A process for identifying compounds which activate a receptor
to the polypeptide of claim 12 comprising: contacting cells which
express a CGF receptor on the surface thereof with a compound to be
screened under conditions suitable for binding of ligands to said
receptor; and determining the extent of binding of the compound to
the receptor and the presence of a signal generated by the
binding.
19. A process for diagnosing a disease or a susceptibility to a
disease related to a mutation in the polynucleotide of claim 1
comprising: determining a mutation in the polynucleotide of claim
1.
20. A diagnostic process comprising: analyzing for the presence of
the polypeptide of claim 12 in a sample derived from a host.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 09/393,023, filed Sep. 9, 1999, which is a divisional of U.S.
application Ser. No. 08/471,371, filed Jun. 6, 1995, now U.S. Pat.
No. 5,981,215, issued Nov. 9, 1999. Each of these applications is
hereby incorporated by reference in its entirety.
[0002] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention has been putatively identified
as a human Criptin Growth Factor, sometimes hereinafter referred to
as "CGF". The invention also relates to inhibiting the action of
such polypeptides.
[0003] Growth factors and other nitrogens, including transforming
oncogenes, are capable of rapidly inducing a complex set of genes
to be expressed by certain cells (Lau, L. F. and Nathans, D.,
Molecular Aspects of Cellular Regulation, 6:165-202 (1991). These
genes, which have been named immediate early or early response
genes, are transcriptionally activated within minutes after contact
with a growth factor or mitogen, independent of de novo protein
synthesis. A group of these immediate early genes encodes secreted,
extracellular proteins which are needed for coordination of complex
biological processes such as differentiation and proliferation,
regeneration and wound healing (Ryseck, R. P. et al, Cell Growth
Differ., 2:235-233 (1991).
[0004] The expression of these immediate early genes act as "third
messengers" in the cascade of events triggered by growth factors.
It is also thought that they are needed to integrate and coordinate
complex biological processes, such as differentiation and wound
healing in which cell proliferation is a common event.
[0005] The criptin growth factor is overexpressed and secreted by
certain types of cancer cells, for example, by pancreatic
cancers.
[0006] The CGF of the present invention shows amino acid sequence
homology to the cripto growth factor disclosed in U.S. Pat. No.
5,256,643 which is hereby incorporated by reference in its
entirety. The cripto growth factor is one of the useful tumor
markers known. Cripto is often upregulated in colon cancers and is
expressed in pancreatic cancers.
[0007] In accordance with one aspect of the present invention,
there is provided a novel mature polypeptide, as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof.
[0008] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding the
polypeptide of the present invention including mRNAs, DNAs, cDNAs,
genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments and derivatives
thereof.
[0009] In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
nucleic acid sequence encoding a polypeptide of the present
invention, under conditions promoting expression of said protein
and subsequent recovery of said protein.
[0010] In accordance with yet a further aspect of the present
invention, there is provided a process of utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic purposes, for example, to treat muscle wasting
diseases, osteoporosis, to aid in implant fixation, to stimulate
wound healing and tissue regeneration, to promote angiogenesis and
to stimulate proliferation of vascular smooth muscle and
endothelial cell production.
[0011] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0012] In accordance with yet another aspect of the present
invention, there are provided antagonists to such polypeptides,
which may be used to inhibit the action of such polypeptides, for
example, to limit the production of excess connective tissue during
wound healing or pulmonary fibrosis.
[0013] In accordance with yet a further aspect of the present
invention, there are also provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to the polynucleotide sequences of the present
invention.
[0014] In accordance with still another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases related to expression of the polypeptide of the present
invention and mutations in the nucleic acid sequences encoding such
polypeptide.
[0015] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA vectors.
[0016] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
[0017] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows the cDNA (SEQ ID:1) and corresponding deduced
amino acid sequence (SEQ ID:2) of the polypeptide of the present
invention. The standard one letter abbreviations for amino acids
are used. Sequencing was performed using a 373 Automated DNA
sequencer (Applied Biosystems, Inc.).
[0019] FIG. 2 shows the amino acid sequence homology between the
polypeptide of the present invention (top line) and the cripto
growth factor (bottom line) (SEQ ID:7).
[0020] In accordance with an aspect of the present invention, there
are provided isolated nucleic acids (polynucleotides) which encode
for the mature polypeptide having the deduced amino acid sequence
of FIG. 1 (SEQ ID NO:2) or for the mature polypeptide encoded by
the cDNA of the clone(s) deposited as ATCC Deposit No. 97142 on May
11 , 1995.
[0021] The ATCC number referred to above is directed to a
biological deposit with the ATCC, 10801 University Boulevard,
Manassas, Va. 20110-2209. The strain referred to is being
maintained under the terms of the Budapest Treaty and will be made
available to a patent office signatory to the Budapest Treaty.
[0022] A polynucleotide encoding a polypeptide of the present
invention was discovered in a cDNA library derived from human
pancreatic cancer tissue. It is structurally related to the human
cripto growth factor. It contains an open reading frame encoding a
protein of 223 amino acid residues of which approximately the first
23 amino acids residues are the putative leader sequence such that
the mature protein comprises 200 amino acids. As shown in FIG. 2
the polypeptide of the present invention has conserved cysteine
residues in common with cripto growth factor.
[0023] Moreover, the polypeptide of the present invention has a
putative soluble portion comprising amino acid 45 to amino acid 128
of SEQ ID NO:2, such that amino acid 129 to amino acid 223 is a
putative transmembrane portion.
[0024] An initial Northern blot analysis has shown very high
expression in pancreatic cancer cells.
[0025] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded, and if single stranded may be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide may be identical to the coding sequence
shown in FIG. 1 (SEQ ID NO:1) or that of the deposited clone or may
be a different coding sequence which coding sequence, as a result
of the redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of FIG. 1 (SEQ ID NO:1) or the
deposited cDNA.
[0026] The polynucleotide which encodes for the mature polypeptide
of FIG. 1 (SEQ ID No. 2) or for the mature polypeptide encoded by
the deposited cDNA may include: only the coding sequence for the
mature polypeptide; the coding sequence for the mature polypeptide
and additional coding sequence such as a leader or secretory
sequence or a proprotein sequence; the coding sequence for the
mature polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0027] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0028] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIG. 1 (SEQ ID No. 2) or the polypeptide encoded
by the cDNA of the deposited clone. The variant of the
polynucleotide may be a naturally occurring allergic variant of the
polynucleotide or a non-naturally occurring variant of the
polynucleotide.
[0029] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIG. 1 (SEQ ID No.
2) or the same mature polypeptide encoded by the cDNA of the
deposited clone as well as variants of such polynucleotides which
variants encode for a fragment, derivative or analog of the
polypeptide of FIG. 1 (SEQ ID No. 2) or the polypeptide encoded by
the cDNA of the deposited clone. Such nucleotide variants include
deletion variants, substitution variants and addition or insertion
variants.
[0030] As herein above indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allergic variant of
the coding sequence shown in FIG. 1 (SEQ ID NO:1) or of the coding
sequence of the deposited clone. As known in the art, an allergic
variant is an alternate form of a polynucleotide sequence which may
have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptide.
[0031] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains. Thus, for
example, the polynucleotide of the present invention may encode for
a mature protein, or for a protein having a prosequence or for a
protein having both a prosequence and a presequence (leader
sequence).
[0032] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0033] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0034] Fragments of the full length CGF gene may be used as a
hybridization probe for a cDNA library to isolate the full length
CGF gene and to isolate other genes which have a high sequence
similarity to the gene or similar biological activity. Probes of
this type preferably have at least 30 bases and may contain, for
example, 50 or more bases. The probe may also be used to identify a
cDNA clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete CGF gene including
regulatory and promotor regions, exons, and introns. An example of
a screen comprises isolating the coding region of the CGF gene by
using the known DNA sequence to synthesize an oligonucleotide
probe. Labeled oligonucleotides having a sequence complementary to
that of the gene of the present invention are used to screen a
library of human cDNA, genomic DNA or MRNA to determine which
members of the library the probe hybridizes to.
[0035] The present invention further relates to polynucleotides
which hybridize to the herein above-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the herein above-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the herein above described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIG. 1 (SEQ ID NO:1) or
the deposited cDNA(s).
[0036] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as herein above described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0037] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0038] The deposit(s) referred to herein were deposited with the
ATCC (American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209) on May 11, 1995, and will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as convenience
to those of skill in the art and are not an admission that a
deposit is required under 35 U.S.C. .sctn.112. The sequence of the
polynucleotides contained in the deposited materials, as well as
the amino acid sequence of the polypeptides encoded thereby, are
incorporated herein by reference and are controlling in the event
of any conflict with any description of sequences herein. A license
may be required to make, use or sell the deposited materials, and
no such license is hereby granted.
[0039] The present invention further relates to a polypeptide which
has the deduced amino acid sequence of FIG. 1 (SEQ ID No. 2) or
which has the amino acid sequence encoded by the deposited cDNA, as
well as fragments, analogs and derivatives of such polypeptide.
[0040] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIG. 1 (SEQ ID No. 2) or that
encoded by the deposited cDNA, means a polypeptide which retains
essentially the same biological function or activity as such
polypeptide. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0041] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0042] The fragment, derivative or analog of the polypeptide of
FIG. 1 (SEQ ID No. 2) or that encoded by the deposited cDNA may be
(i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence or (v) splice
variants of the mature polypeptide which are lacking certain amino
acid residues yet still retain biological activity. Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0043] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0044] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or polypeptide, separated
from some or all of the coexisting materials in the natural system,
is isolated. Such polynucleotides could be part of a vector and/or
such polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0045] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least a 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least a 90% similarity (more preferably
at least 90% identity) to the polypeptide of SEQ ID NO:2 and still
more preferably at least a 95% similarity (still more preferably at
least a 95% identity) to the polypeptide of SEQ ID NO:2 and also
include portions of such polypeptides with such portion of the
polypeptide generally containing at least 30 amino acids and more
preferably at least 50 amino acids.
[0046] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0047] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0048] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0049] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the CGF
genes. The culture conditions, such as temperature, pH and the
like, are those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan.
[0050] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0051] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0052] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda PL promoter and other promoters
known to control expression of genes in prokaryotic or eukaryotic
cells or their viruses. The expression vector also contains a
ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0053] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0054] The vector containing the appropriate DNA sequence as herein
above described, as well as an appropriate promoter or control
sequence, may be employed to transform an appropriate host to
permit the host to express the protein.
[0055] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; plant cells, etc. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0056] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX 174, pbluescript SK, pBSKS, pNH8A, pNH16a,
pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540,
pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0057] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV
immediate early, HSV thymidine kinase, early and late SV40, LTRs
from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0058] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0059] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0060] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0061] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0062] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), a-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0063] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0064] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0065] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0066] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0067] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0068] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0069] The polypeptides of the present invention can be recovered
and purified from recombinant cell cultures by methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps.
[0070] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0071] The CGF gene of the present invention may be labeled and
used as a probe for the analysis of Southern blots containing
endonuclease digested DNA preparations to ascertain if there are
amplification, rearrangement, deletions or restrictiion fragment
length polymorphisms of the criptin gene in normal versus tumor
tissue.
[0072] The labeled criptin gene can be employed for the analysis of
Northern blots that contain RNA to determine the relative levels of
mRNA expression in various normal and pathologic tissue sample.
[0073] The CGF gene may be employed to generate a probe suitable
for in situ RNA:RNA hybridization for histologic localization in
normal or pathologic cells expressing CGF mRNA.
[0074] CGF oligonucleotides (sense-strand) may be employed to
detect levels of CGF mRNA in various tissues.
[0075] CGF polypeptide is over expressed and secreted by certain
types of cancer cell, for example, pancreatic cancers. Therefore,
detection of CGF gene transcription or an excessive amount of CGF
protein allows a pancreatic cancer diagnosis. Accordingly, an
anti-CGF antibody could be used to diagnose neovascularization
associated with tumor formation since an altered level of this
polypeptide may be indicative of such disorders.
[0076] A competition assay may be employed wherein antibodies
specific to CGF are attached to a solid support and labeled CGF and
a sample derived from the host are passed over the solid support
and the amount of label detected attached to the solid support can
be correlated to a quantity of CGF in the sample.
[0077] A "sandwich" assay is similar to an ELISA assay. In a
"sandwich" assay the CGF polypeptide is passed over a solid support
and binds to antibody attached to a solid support. A second
antibody is then bound to the CGF polypeptide. A third antibody
which is labeled and specific to the second antibody is then passed
over the solid support and binds to the second antibody and an
amount can then be quantified.
[0078] The polypeptide of the present invention may be employed in
wound-healing and associated therapies concerned with re-growth of
tissue, such as connective tissue, skin, bone, cartilage, muscle,
lung or kidney.
[0079] The polypeptide may also be employed to stimulate
angiogenesis, for example, to enhance the growth of vascular smooth
muscle and endothelial cells. The increase in angiogenesis would be
beneficial to ischemic tissues and to collateral coronary
development in the heart subsequent to coronary stenosis.
[0080] The polypeptide of the present invention may also be
employed during implant fixation to stimulate the growth of cells
around the implant and therefore, facilitate its attachment to its
intended site.
[0081] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, as a
research reagent for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, for the
purpose of developing therapeutics and diagnostics for the
treatment of human disease.
[0082] This invention provides a method for identification of the
receptor for the polypeptide of the present invention. The gene
encoding the receptor can be identified by numerous methods known
to those of skill in the art, for example, ligand panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2),
Chapter 5, (1991)). Preferably, expression cloning is employed
wherein polyadenylated RNA is prepared from a cell responsive to
CGF polypeptides, and a cDNA library created from this RNA is
divided into pools and used to transfect COS cells or other cells
that are not responsive to CGF. Transfected cells which are grown
on glass slides are exposed to labeled CGF. CGF can be labeled by a
variety of means including iodination or inclusion of a recognition
site for a site-specific protein kinase. Following fixation and
incubation, the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and
retransfected using an iterative sub-pooling and rescreening
process, eventually yielding a single clone that encodes the
putative receptor.
[0083] As an alternative approach for receptor identification,
labeled CGF can be photoaffinity linked with cell membrane or
extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE and exposed to X-ray
film. The labeled complex containing the CGF-receptor can be
excised, resolved into peptide fragments, and subjected to protein
microsequencing. The amino acid sequence obtained from
microsequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify the
gene encoding the putative receptor.
[0084] This invention is also related to a method of screening
compounds to identify those which bind to and activate the CGF
receptors. An example of such a screening method measures
stimulation of the proliferation of endothelial cells in the
presence of the comitogen Con A. Human umbilical vein endothelial
cells are obtained and cultured in 96-well flat-bottomed culture
plates (Costar, Cambridge, Mass.) and supplemented with a reaction
mixture appropriate for facilitating proliferation of the cells,
the mixture containing Con-A (Calbiochem, La Jolla, Calif.). Con-A
and the compound to be screened are added and after incubation at
37.degree. C., cultures are pulsed with .sup.3[H]-thymidine and
harvested onto glass fiber filters (PhD; Cambridge Technology,
Watertown, Mass.). Mean .sup.3[H]-thymidine incorporation (cpm) of
triplicate cultures is determined using a liquid scintillation
counter (Beckman Instruments, Irvine, Calif.). Significant
.sup.3[H]-thymidine incorporation indicates stimulation of
endothelial cell proliferation.
[0085] To assay for antagonist compounds, the assay described above
is performed, however, in this assay CGF is added along with the
compound to be screened and the ability of the compound to inhibit
.sup.3[H]-thymidine incorporation in the presence of CGF, indicates
that the compound is an antagonist to CGF.
[0086] Alternatively, CGF antagonists may be detected by combining
labeled CGF and a potential antagonist compound with membrane-bound
CGF receptors or recombinant receptors under appropriate conditions
for a competitive inhibition assay. CGF can be labeled, such as by
radioactivity, such that the number of CGF molecules bound to the
receptor can determine the effectiveness of the potential
antagonist.
[0087] Alternatively, the response of a known second messenger
system following interaction of a potential antagonist compound and
receptor would be measured. Such second messenger systems include
but are not limited to, cAMP guanylate cyclase, ion channels or
phosphoinositide hydrolysis. The compound may be labeled to detect
binding. A compound which binds but which does not elicit a second
messenger response is an effective antagonist compound.
[0088] Examples of potential CGF antagonist compounds include an
antibody, or in some cases, an oligonucleotide, which binds to the
polypeptide itself or to the receptor for the polypeptide.
Alternatively, a potential antagonist may be a closely related
protein, for example, a mutated form of CGF, which recognizes the
CGF receptor but imparts no effect, thereby competitively
inhibiting the action of CGF.
[0089] Another potential CGF antagonist is an antisense construct
prepared using antisense technology. Antisense technology can be
used to control gene expression through triple-helix formation or
antisense DNA or RNA, both of which methods are based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion
of the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple helix-see Lee
et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)),
thereby preventing transcription and the production of CGF. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of the mRNA molecule into the CGF
(antisense-Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of CGF.
[0090] Potential CGF antagonists include small molecules which bind
to the active site of the polypeptide, the receptor binding site,
or other growth factor binding site of the polypeptide thereby
blocking the normal biological activity of CGF. Examples of small
molecules include but are not limited to small peptides or
peptide-like molecules.
[0091] The antagonists may be employed to inhibit tumor growth,
directly or indirectly, e.g., by antagonizing CGF activity and/or
antagonizing neovascularization and the neointimal proliferation of
smooth muscle cells prevalent in atherosclerosis and restenosis
subsequent to balloon angioplasty.
[0092] The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0093] The CGF polypeptides and antagonist compounds of the present
invention may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide or antagonist
compound and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
administration.
[0094] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the pharmaceutical compositions
may be employed in conjunction with other therapeutic
compounds.
[0095] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 mg/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 mg tkg to about 1 mg tkg body weight daily,
taking into account the routes of administration, symptoms,
etc.
[0096] CGF in combination with other growth factors including but
not limited to, PDGF, IGF, FGF, EGF or TGF-.beta. may accelerate
physiological responses as seen in wound healing.
[0097] The CGF polypeptide and agonists and antagonists which are
polypeptides, may also be employed in accordance with the present
invention by expression of such polypeptides in vivo, which is
often referred to as "gene therapy."
[0098] Thus, for example, cells from a patient may be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptide. Such methods are well-known in the
art. For example, cells may be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding a
polypeptide of the present invention.
[0099] Similarly, cells may be engineered in vivo for expression of
a polypeptide in vivo by, for example, procedures known in the art.
As known in the art, a producer cell for producing a retroviral
particle containing RNA encoding the polypeptide of the present
invention may be administered to a patient for engineering cells in
vivo and expression of the polypeptide in vivo. These and other
methods for administering a polypeptide of the present invention by
such method should be apparent to those skilled in the art from the
teachings of the present invention. For example, the expression
vehicle for engineering cells may be other than a retrovirus, for
example, an adenovirus which may be used to engineer cells in vivo
after combination with a suitable delivery vehicle.
[0100] Retroviruses from which the retroviral plasmid vectors
herein above mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0101] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0102] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or hetorologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAl
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs herein above
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the genes encoding the polypeptides.
[0103] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .PSI.-2, .PSI.-AM, PA12, T19-14X,
VT-19-17-H2, .PSI.CRE, .PSI.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0104] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0105] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0106] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0107] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0108] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0109] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0110] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0111] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0112] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0113] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0114] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0115] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0116] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0117] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0118] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0119] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0120] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0121] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0122] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0123] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMLE 1
Bacterial Expression and Purification of CGF
[0124] The DNA sequence encoding CGF, ATCC #97142, was initially
amplified using PCR oligonucleotide primers corresponding to the 5'
sequences of the processed CGF protein (minus the signal peptide
sequence) and the vector sequences 3' to the CGF gene. Additional
nucleotides corresponding to CGF were added to the 5' and 3'
sequences respectively. The 5' oligonucleotide primer has the
sequence 5' ACTCTTGGATCCAATTTGGGAAACAGCTAT- CAAAGA 3' (SEQ ID NO:3)
contains a BamHI restriction enzyme site (in bold) followed by CGF
coding sequence starting from the presumed terminal amino acid of
the processed protein codon (underlined). The 3' oligonucleotide
primer 5' TACAACTCTAGACTATTATTTACAACATAGAAAATTAAAGGC 3' (SEQ ID
NO:4) contains an Xba I restriction site (in bold) followed by the
reverse complement of nucleotides corresponding to the
carboxy-terminal 5 amino acids and the translational stop codon
(underlined). The restriction enzyme sites correspond to the
restriction enzyme sites on the bacterial expression vector pQE
(Qiagen, Inc. Chatsworth, Calif., 91311). pQE-9 encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQE-9 was then
digested with Hind III and Xba I. The amplified sequences were
ligated into pQE-9 and were inserted in frame with the sequence
encoding for the histidine tag and the RBS. The desired
recombinants would contain the CGF coding sequence inserted
downstream from the histidine tag and the ribosome binding site.
The ligation mixture was then used to transform E. coli strain
M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989). M15/rep4 contains multiple copies of the
plasmid pREP4, which expresses the lac d repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants are identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected.Plasmid DNA was isolated and
confirmed by restriction analysis. Clones containing the desired
constructs were grown overnight (O/N) in liquid culture in LB media
supplemented with both Amp (100 .mu.g/ml) and Kan (25 .mu.g/ml).
The O/N culture was used to inoculate a large culture at a ratio of
1:100 to 1:250. The cells were grown to an optical density 600
(O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells were grown an extra 2.5 hours such that there is an
exponential growth culture present. Cells were then harvested by
centrifugation. The CGF/6-Histidine-containing M15[pREP4] cells
were lysed in 6M GnHCl,50 mM NaPO.sub.4 at pH 8.0. The lysate was
loaded on a Nickel-Chelate column and the flow-through collected.
The column was washed with 6M GnHCl, 50 mM NaPO.sub.4 at pH 8.0,
6.0 and 5.0. The CGF fusion protein (>90% pure) was eluted at pH
2.0. For the purpose of renaturation, the pH 2.0 eluate was
adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10
mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized).
After incubation in this solution for 12 hours the protein was
dialyzed to 10 mmolar sodium phosphate. To run the gel, the pellets
were resuspended in SDS/NaOH and 2.times.SDS-PAGE loading buffer,
heat denatured, then electrophoresed on a 4-20% SDS-PAGE gel. The
proteins were visualized with Coomassie Brilliant Blue R-250
stain.
EXAMPLE 2
Cloning and Expression of CGF Using the Baculovirus Expression
System
[0125] The DNA sequence encoding the full length CGF protein, ATCC
#97142, is amplified with the PCR primers containing 5' BamHI and
3' XbaI. The primer sequences are 5'
ACTCTTGGATCCGCCATCATGACCTGGAGGCACCAT 3' (SEQ ID NO:5) and 5'
TACAACTCTAGACTATTATTTACAACATAGAAAATTAAAGGC 3' (SEQ ID NO:4). The
BamHI-XbaI fragment contains the entire CGF coding region including
the signal sequence for secretion. This fragment, designated F2, is
isolated from a 1% agarose gel using a commercially available kit
("Geneclean", BIO 101 Inc., La Jolla, Calif.).
[0126] The vector pA2 is used for the expression of the CGF protein
using the baculovirus expression system (for review see: Summers,
M. D. and Smith, G. E. 1987, A manual of methods for baculovirus
vectors and insect cell culture procedures, Texas Agricultural
Experimental Station Bulletin No. 1555). This expression vector
contains the strong polyhedrin promoter of the Autographa
californica nuclear polyhidrosis virus (AcMNPV) followed by the
recognition sites for the restriction endonucleases BamHI and XbaI.
The polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E.coli is inserted in the
same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of cotransfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pA2 such as, pRG1, pAc373, pVL941 and pAcIM1 (Luckow, V. A. and
Summers, M. D., Virology, 170:31-39).
[0127] The pA2 plasmid is digested with the restriction enzymes
BamHI and XbaI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA is then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA is
designated V2.
[0128] BamHI-XbaI cleaved fragment F2 and the dephosphorylated
plasmid V2 are ligated with T4 DNA ligase. E.coli strain XL1 Blue
(Stratagene Cloning Systems, 11011 North Torrey Pines Road La
Jolla, Calif. 92037) are then transformed and bacteria identified
that contained the plasmid (pBac CGF) with the CGF cDNA using the
enzymes BamHI and XbaI. The sequence of the cloned fragment is
confirmed by DNA sequencing.
[0129] 5 .mu.g of the plasmid pBac CGF is cotransfected with 1.0
.mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci.
USA, 84:7413-7417 (1987)).
[0130] 1.mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac CGF are mixed in a sterile well of a microtiter plate
containing 50 .mu.l of serum free Grace's medium (Life Technologies
Inc., Gaithersburg, Md.). Afterwards 10 .mu.l Lipofectin plus 90
.mu.l Grace's medium are added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture is added
dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm
tissue culture plate with 1 ml Grace' medium without serum. The
plate is rocked back and forth to mix the newly added solution. The
plate is then incubated for 5 hours at 27.degree. C. After 5 hours
the transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum is
added. The plate is put back into an incubator and cultivation
continued at 27.degree. C. for four days.
[0131] After four days the supernatant is collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0132] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculoviruses is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0133] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-CGF at a multiplicity of infection (MOI) of 2. Six
hours later the medium is removed and replaced with SF900 II medium
minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) are added. The cells are
further incubated for 16 hours before they are harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant CGF in CHO Cells
[0134] The vector pN346 is used for the expression of the CGF
protein. Plasmid pN346 is a derivative of the plasmid pSV2-dhfr
[ATCC Accession No. 37146]. Both plasmids contain the mouse dhfr
gene under control of the SV40 early promoter. Chinese hamster
ovary or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Lift Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplication of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification
of the DHFR gene. If a second gene is linked to the dhfr gene it is
usually co-amplified and overexpressed. Subsequently, when the
methotrexate is withdrawn, cell lines contain the amplified gene
integrated into the chromosome(s).
[0135] Plasmid pN346 contains for the expression of the gene of
interest a strong promoter of the long terminal repeat (LTR) of the
Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular
Biology, March 1985, 438-447) plus a fragment isolated from the
enhancer of the immediate early gene of human cytomegalovirus (CMV)
(Boshart et al., Cell 41:521-530, 1985). Downstream of the promoter
are the following single restriction enzyme cleavage sites that
allow the integration of the genes: BamHI, Pvull, and Nrul. Behind
these cloning sites the plasmid contains translational stop codons
in all three reading frames followed by the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other high
efficient promoters can also be used for the expression, e.g., the
human .beta.-actin promoter, the SV40 early or late promoters or
the long terminal repeats from other retroviruses, e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g.,
from the human growth hormone or globin genes can be used as
well.
[0136] Stable cell lines carrying a gene of interest integrated
into the chromosome can also be selected upon co-transfection with
a selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g. G418 plus methotrexate.
[0137] The plasmid pN346 is digested with the restriction enzyme
BamHI and then dephosphorylated using calf intestinal phosphatase
by procedures known in the art. The vector is then isolated from a
1% agarose gel.
[0138] The DNA sequence encoding the full length CGF protein, ATCC
#97142, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0139] The 5' primer has the sequence 5'
ACTCTTGGATCCGCCATCATGACCTGGAGGCAC- CAT 3' (SEQ ID NO:5) and
contains a BamHI restriction enzyme site (in bold) followed by 6
nucleotides resembling an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950, (1987)). The remaining nucleotides correspond to the
amino terminal 6 amino acids including the translational initiation
codon. The 3' primer has the sequence 5'
TACAACCAGCTGCTATTATTTACAACATAG 3' (SEQ ID NO:8) and contains a
PvuII restriction site and 18 nucleotides that are the reverse
complement of 3' CGF DNA starting at the translational stop codon.
The PCR product is digested with BamHI-PuvII and purified on a 1%
agarose gel using a commercially available kit ("Geneclean", BIO
101 Inc., La Jolla, Calif.). This fragment is then ligated to
BamHI-PvuII digested, phosphatased pN346 plasmid with T4 DNA
ligase. Xl1Blue (Stratagene) E. coli are transformed and plated on
LB, 50 .mu.g/ml ampicillin plates. Colonies bearing the desired
recombinant in the proper orientation are screened for by PCR with
a 5' primer which corresponds to the Rous sarcoma virus promoter
and a 3' primer which corresponds to the reverse complement of CGF
codons 73-79. The sequence of the cloned fragment is confirmed by
DNA sequencing.
[0140] Transfection of CHO-dhfr-cells
[0141] Chinese hamster ovary cells lacking an active DHFR enzyme
are used for transfection. 5 .mu.g of the expression plasmid
pN346CGF are cotransfected with 0.5 .mu.g of the plasmid pSVneo
using the lipofectin method (Felgner et al., supra). The plasmid
pSV2-neo contains a dominant selectable marker, the gene neo from
Tn5 encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) and cultivated from 10-14 days. After this period, single
clones are trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25, 50 nm, 100 nm, 200
nm, 400 nm). Clones growing at the highest concentrations of
methotrexate are then transferred to new 6-well plates containing
even higher concentrations of methotrexate (500 nM, 1 .mu.M, 2
.mu.M, 5 .mu.M). The same procedure is repeated until clones grew
at a concentration of 100 .mu.M.
[0142] The expression of the desired gene product is analyzed by
Western blot analysis and SDS-PAGE.
EXAMPLE 4
[0143] Expression via Gene Therapy
[0144] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0145] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0146] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer contains an EcoRI site and
the 3' primer also includes a Hind il site. Equal quantities of the
Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0147] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0148] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0149] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0150] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
* * * * *