U.S. patent application number 10/335774 was filed with the patent office on 2004-05-06 for expression of immunogenic hepatitis b surface antigens in transgenic plants.
This patent application is currently assigned to Boyce Thompson Institute. Invention is credited to Arntzen, Charles Joel, Mason, Hugh S., Ritcher, Lizabeth, Thanavala, Yasmin.
Application Number | 20040086530 10/335774 |
Document ID | / |
Family ID | 22351735 |
Filed Date | 2004-05-06 |
United States Patent
Application |
20040086530 |
Kind Code |
A1 |
Mason, Hugh S. ; et
al. |
May 6, 2004 |
Expression of immunogenic hepatitis B surface antigens in
transgenic plants
Abstract
Plant expression vectors comprising at least two expression
cassettes are provided which function to reduce transcriptional
silencing of polynucleotide expression. Further, novel plant
expression vectors for expression of immunogenic polypeptides,
including HBsAg, are provided. The plant expression vectors can be
used to produce immunogenic polypeptides, including HBsAg, in
edible plant tissues. The edible plant tissues can be used to
elicit an immune response in humans and animals when the plant
tissues are consumed.
Inventors: |
Mason, Hugh S.; (Ithaca,
NY) ; Thanavala, Yasmin; (Williamsville, NY) ;
Arntzen, Charles Joel; (Ithaca, NY) ; Ritcher,
Lizabeth; (Ithaca, NY) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Assignee: |
Boyce Thompson Institute
|
Family ID: |
22351735 |
Appl. No.: |
10/335774 |
Filed: |
January 2, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10335774 |
Jan 2, 2003 |
|
|
|
09471573 |
Dec 23, 1999 |
|
|
|
6551820 |
|
|
|
|
60113827 |
Dec 23, 1998 |
|
|
|
Current U.S.
Class: |
424/227.1 ;
435/419; 800/288 |
Current CPC
Class: |
C12N 15/8257 20130101;
C07K 14/005 20130101; A61K 39/00 20130101; A61P 31/12 20180101;
C12N 2730/10122 20130101 |
Class at
Publication: |
424/227.1 ;
800/288; 435/419 |
International
Class: |
A61K 039/29; A01H
001/00; C12N 015/82; C12N 005/04 |
Claims
We claim:
1. A plant cell transformed with a plant expression vector
comprising two expression wherein the first expression cassette
comprises a first polynucleotide sequence encoding an antigen
polypeptide and wherein the second expression cassette comprises a
second polynucleotide sequence encoding said antigen polypeptide
sequence encoded by said first polynucleotide sequence, wherein
said first polynucleotide sequence is non-identical to said second
polynucleotide sequence.
2. The plant cell of claim 1 wherein virus like particles are
assembled in the cell.
3. The plant cell of claim 1 wherein the plant cell is selected
from the group consisting of tomato, potato, banana and carrot
cells.
4. The plant cell of claim 1 wherein the plant expression vector is
integrated into the nuclear genome of the plant cell.
5. A plant seed comprising a plant expression vector comprising two
expression cassettes, wherein the first expression cassette
comprises a first polynucleotide sequence encoding an antigen
polypeptide and wherein the second expression cassette comprises a
second polynucleotide sequence encoding said antigen polypeptide
sequence encoded by said first polynucleotide sequence, wherein
said first polynucleotide sequence is non-identical to said second
polynucleotide sequence.
6. A transgenic plant cell comprising a polynucleotide comprising a
nucleic acid sequence encoding a hepatitus B surface antigen
(HBsAg) operably linked to: (i) a plant functional promoter; (ii) a
translation enhancement sequence; and (iii) a termination sequence
wherein the polynucleotide lacks an untranslated region between the
translation enhancement sequence and the HBsAg encoding
sequence.
7. The transgenic plant cell of claim 6 wherein a virus like
particle is assembled in the cell.
8. The plant cell of claim 6 wherein the plant cell is selected
from the group consisting of tomato, potato, banana and carrot
cells.
9. The plant cell of claim 6 wherein the plant expression vector is
integrated into the nuclear genome of the plant cell.
10. A plant seed comprising a plant expression vector comprising a
polynucleotide comprising a nucleic acid sequence encoding a
hepatitus B surface antigen (HBsAg) operably linked to: (i) a plant
functional promoter; (ii) a translation enhancement sequence; and
(iii) a termination sequence wherein the polynucleotide lacks an
untranslated region between the translation enhancement sequence
and the HBsAg encoding sequence.
11. An immunogenic composition comprising the plant cell of claim 1
or 6.
12. The immunogenic composition of claim 11 wherein the plant cell
is present in a plant tissue selected from the group consisting of
a fruit, leaf, tuber, plant organ, seed protoplast, and callus.
13. The immunogenic composition of claim 11 comprising juice or
extract of the plant cell.
14. The immunogenic composition of claim 11 further comprising an
adjuvant.
15. The immunogenic composition of claim 14 wherein the adjuvant is
expressed as a fusion protein with an antigen of the immunogenic
composition.
16. A method of eliciting an immune response in mammal comprising
the step of administering the composition of claim 11 to a mammal,
wherein an immune response is elicited.
17. The method of claim 16 wherein the composition is administered
orally.
18. The method of claim 16 wherein the administration comprises
consuming the transgenic plant cell.
19. The method of claim 16 wherein the polypeptide is administered
by a technique selected from the group consisting of intramuscular,
oral, intradermal, intraperitoneal, subcutaneous, and
intranasal.
20. The method of claim 16 further comprising the step of
administering an adjuvant.
21. The method of claim 20 wherein the adjuvant is selected from
the group consisting of cholera toxin (CT), E. coli heat labile
toxin (LT), anti-idiotypic antibody 2F10, colonization factor,
shiga-like toxin and intimin.
22. The method of claim 16 wherein the immune response elicited is
selected from the group of immune responses consisting of the
humoral; mucosal; cellular; humoral and mucosal; humoral and
cellular; mucosal and cellular; and humoral, mucosal and cellular
immunogenic compositions.
23. A method of isolating a recombinant HBsAg polypeptide expressed
in a plant material comprising the step of subjecting the plant
material to a detergent having a concentration of greater than 0.1%
and less than 0.5%, whereby a recombinant HBsAg is isolated.
24. A transgenic plant or plant cell that, when consumed as a
foodstuff in four or less feedings, elicits an immune response
comprising anti-HBsAg serum antibodies of greater than 50 mIU/mL in
a mammal.
25. The transgenic plant or plant cell of claim 24, wherein the
immune response is a primary immune response.
26. The transgenic plant cell of claim 24, wherein the plant cell
comprises: a) an Agrobacterium cell transformed with a plant
expression vector comprising two expression cassettes, wherein the
first expression cassette comprises a first polynucleotide sequence
encoding an antigen polypeptide and wherein the second expression
cassette comprises a second polynucleotide sequence encoding said
antigen polypeptide sequence encoded by said first polynucleotide
sequence, wherein said first polynucleotide sequence is
non-identical to said second polynucleotide sequence from claim 1,
or b) an Agrobacterium cell transformed with an expression vector
comprising a nucleic acid sequence encoding a hepatitus B surface
antigen (HBsAg) operably linked to: (i) a plant functional
promoter; (ii) a translation enhancement sequence; and (iii) a
termination sequence wherein the polynucleotide lacks an
untranslated region between the translation enhancement sequence
and the HBsAg encoding sequence further comprising a helper Ti
plasmid.
27. A transgenic plant or plant cell that, when consumed as a
foodstuff in four or less feedings, elicits an anti-HBsAg boosting
immune response that increases serum anti-HBsAg antibody levels at
least four-fold or to levels greater than 500 mIU/mL in a
mammal.
28. The transgenic plant or plant cell of claim 27, wherein the
plant cell comprises the plant cell of claim 1 or 6.
Description
RELATED APPLICATION
[0001] This application claims the benefit of U.S. application Ser.
No. 60/113,827; which is incorporated in its entirety by
reference.
TECHNICAL FIELD
[0002] The present invention relates to oral vaccines, particularly
those provided by edible plants. The invention employs genetic
engineering techniques to produce transgenic plants capable of
expressing immunogenic polypeptides, including hepatitis B antigen
(HBsAg) in quantities sufficient to elicit an immune response in a
human or animal that consumes all or a part of the plant.
BACKGROUND OF THE INVENTION
[0003] A vaccine for hepatitis B was the first "new generation"
recombinant vaccine licensed by the FDA for human use. The
immunogenic subunit in this formulation is produced by expressing
the gene encoding HBsAg in recombinant yeast; the protein is
purified from the genetically engineered yeast and is used for
parenteral delivery. In the developed world, the recombinant
vaccine has displaced the use of an earlier vaccine derived from
the plasma of infected individuals. Both plasma-derived and rHBsAg
vaccines are shown to be reasonably safe and effective in high-risk
adult populations and newborn infants. However, the cost of the
rHBsAg vaccine prevents its extensive availability in developing
countries.
[0004] The envelope of the hepatitis B virus (HBV) contains three
size classes of proteins that share carboxy-terminal sequences.
These proteins, called hepatitis B surface antigens (HBsAgs),
include large (L, containing a pre-S.sub.2 domain), medium (M.sub.1
containing a pre-S.sub.1 domain), and small (S, containing only the
S domain) size classes. All three proteins are found in infectious
virions (often referred to as Dane particles) recovered as 42 nm
spheres from the serum of infected patients. Serum samples also
contain empty spherical particles averaging 22 nm, which contain
primarily S class proteins. Mammalian cell lines transfected
exclusively with DNA encoding the S protein release 20 nm empty
spheres similar to those from infected cells. Moreover, yeast cells
transformed with the same gene form analogous spheres, which are
found to be equally immunogenic as the 22 nm spheres from infected
cells. The yeast-derived material forms the active constituents of
the currently available commercial vaccines ENGERIX (SKB) and
RECOMBIVAX (Merck).
[0005] In mammalian cells, newly synthesized L, M, or S proteins
insert into the membrane of the endoplasmic reticulum (ER). The S
protein consists of 226 amino acids; its N and C-termini are
thought to be on the ER lumen side and it has four transmembrane
helices. All three proteins have a glycosylation site at position
146 of the S domain. The three proteins differ in the available
sites for and the extent of glycosylation. Improper glycosylation
can prevent virion formation, presumably due to misfolding of the
proteins. Also, multiple disulfide bonds among cysteines in the
proteins are known to be important to the structure of the
assembled virion or particles and to the structure of antigenic
loops in the protein. Incorrectly assembled particles may interact
with cellular chaperones because of the incorrect folding to
prevent secretion.
[0006] Higher levels of preS1 and preS2 are present in HBV than in
17-25 nm HBsAg particles therefore, immunization with HBsAg
particles may not generate high titer antibodies to the preS
sequences expressed on HBV. During the course of HBV infection in
humans the levels of preS proteins increase during active
replication, and anti-preS antibodies and T cells are generated
prior to S protein-specific responses. Once anti-HBsAg antibodies
rise, anti-preS antibodies decline.
[0007] The roles of preS1 and preS2 in virus attachment and
neutralization have led to the development of vaccines containing
these sequences as well as the entire S region. Vaccines
incorporating preS sequences include HEPAGEN (Merck) and BIO-HEP-B
(BTG); both are produced in mammalian cell lines. In formulating
whole particles that contain S and preS proteins it is important to
note that the relative amounts of S, M, and L proteins affect HBsAg
assembly, e.g., high levels of L protein reduce the amount of HBsAg
particle formation and secretion.
[0008] The assembly of the S, M and L surface proteins into
particles occurs during budding of the complex into the ER,
followed by transport of the particles through the Golgi apparatus
to the exterior of the cells. Nanometer scale biological
structures, such as viral capsids, assemble through polymerization
of similarly folded protein subunits using a small number of
well-defined bonding contacts. The driving force for polymerization
is the formation of favorable bonding interactions as free subunits
are incorporated into the growing polymer. For envelope proteins
such as HBsAg, essential steps in the polymerization process are
appropriate integration of the polypeptide into the ER membrane
followed by establishment of contact among the protein subunits.
Normal cellular transport and sorting of proteins in the
endomembrane system may contribute to this process.
[0009] U.S. Pat. No. 4,710,463 to Murray proposes a method of
producing a polypeptide having the antigenicity of a hepatitis B
core or surface antigen, which employs a unicellular host. U.S.
Pat. No. 5,738,855 to Szu et al. proposes a modified
oligosaccharide immunogen similar to the Vi antigen of Salmonella
typhi, which can be conjugated to a carrier, such as hepatitis B
surface antigen. U.S. Pat. No. 4,847,080, EU 0154902 B1, and
subsequent papers of Neurath et al. identify peptide epitopes in
the preS1 and preS2 regions for both hepatocyte binding and
neutralization, as well as peptides that can be included in a
vaccine.
[0010] Mammals infected by a pathogen mount an immune response when
overcoming the invading microorganism by initiating at least one of
three branches of the immune system: mucosal, humoral, or cellular
immunity. Mucosal immunity largely results from the production of
secretory IgA antibodies in secretions that bathe mucosal surfaces
in the respiratory tract, the gastrointestinal tract, the
genitourinary tract, and the secretory glands. These mucosal
antibodies act to limit colonization of the pathogen on mucosal
surfaces, thus establishing a first line of defense against
invasion. The production of mucosal antibodies can be initiated by
local immunization of the secretory gland or tissue or by
presentation of the antigen to either the gut-associated lymphoid
tissues (GALT; Peyer's Patches) or the bronchial-associated
lymphoid tissue (BALT).
[0011] Mucosal immunization can be achieved by oral presentation of
antigens. Specialized epithelial cells (M cells) overlying
organized mucosal lymphoid tissues along the intestinal tract
sample the antigens by taking up (by endocytosis) infectious
bacteria, viruses, and macromolecules. These are passed to the
underlying follicles where immune responses are initiated and cells
are dispersed to both mucosal and systemic immune compartments.
Epithelial cells are also an integral component of the regulatory
cytokine network, including those that are important in the
differentiation of B cells.
[0012] Oral immunization also induces strong humoral immune
responses. Humoral immunity results from the production of
circulating antibodies in the serum (especially IgG and IgM),
precipitating phagocytosis of invading pathogens, neutralization of
viruses, or complement-mediated cytotoxicity against the pathogen.
A well-documented relationship exists between HBV protection and
the amplitude of the systemic antibody and T cell response to HBsAg
proteins, and this protection is likely to be achieved by oral
immunization.
[0013] In contrast to the large variety of currently available
injectable vaccines that provide systemic immunity, vaccines
administered non-systemically to stimulate mucosal immunity are
rare. Recently, however, there has been a surge of interest in
developing novel strategies for vaccine development with oral
delivery as the preferred route of delivery. In the design of a
successful oral vaccine, two aspects deserve special attention--the
use of an appropriate adjuvant and the development of an
appropriate antigen delivery system.
[0014] Most protein antigens studied for use as adjuvants when
administered orally in large doses fail to provoke a mucosal
antibody response, but instead induce a state of unresponsiveness
or oral tolerance. Cholera toxin (CT) and E. coli heat-labile toxin
(LT) are exceptions. The feeding of either CT or LT does not induce
tolerance for antibody response and additionally can prevent
induction of oral tolerance to unrelated antigens that are
administered orally along with the CT or LT (Elson, C. et al., J.
Immunol. 133:2892-2887 (1984)). These results suggest that CT/LT
direct the overall outcome in favor of responsiveness rather than
tolerance. In other studies, it is found that CT does not increase
the immune response against an antigen that has been previously fed
without CT (Xu-Amano, J. Exp. Med. 178:1309-1320 (1993)). This is
significant because it indicates that no immune response is mounted
against normal dietary antigens in the presence of CT. Generally,
two different approaches are taken to induction of tolerance versus
immunization following the oral administration of antigen: for the
induction of oral tolerance, soluble or aqueous antigen is
administered alone; whereas for vaccination protocols, antigens are
usually administered in conjunction with mucosal adjuvants.
[0015] Recent advances in genetic engineering have provided the
tools necessary to transform plants as relatively low-cost
candidates for the expression of immunogenic proteins. Both
monocotyledonous and dicotyledonous plants have been stably
transformed. For instance, tobacco, a dicot, has been transformed
with a gene encoding the S protein and the cells can be disrupted
to release spheres (or virus-like particles; VLPs) (Mason et al.,
PNAS USA, 89: 11745-11749 (1992)). When injected into mice, the
particles qualitatively mimic the immunogenic properties of the
commercial vaccine (Thanavala et al., PNAS USA, 92: 3358-3361
(1995)). This suggests that the process of protein synthesis and
assembly may be similar in plant and mammalian cells.
Unfortunately, low rates of protein synthesis in the transgenic
plants have precluded detailed studies of the formation of the VLPs
in vivo.
[0016] U.S. Pat. No. 5,679,880 to Curtiss, III proposes a
transgenic plant that expresses an antigen or antigenic determinant
of a pathogenic microorganism that may elicit a secretory immune
response in an animal. U.S. Pat. Nos. 5,484,719 and 5,612,487 to
Lam et al. disclose obtaining antigenic particles from transgenic
tobacco transformed to express HBsAg. Presently, no method exists
to predict the efficiency by which newly synthesized HBsAg proteins
will polymerize into antigenic structures in plant cells since the
rate-limiting factor(s) are not known. Accordingly, previous
studies showing particle formation in transgenic plants may involve
non-specific insertion of the newly synthesized protein into
various cellular membranes, which could explain the low level of
particles accumulating in transgenic plants described to date.
[0017] It is desired to develop an inexpensive, safe, and highly
effective oral vaccine that elicits systemic, and preferably,
mucosal immunity to prevent hepatitis B virus infection. Such a
vaccine should be based upon a hepatitis B antigen or primary
epitope thereof. An approach that could increase formation of HBsAg
virus like particles can employ fusion proteins designed to alter
the cellular targeting of the newly synthesized protein subunits.
The fusion proteins can have, for instance, a N-terminal leader
peptide known to enter the endomembrane system or a C-terminal KDEL
(SEQ ID NO:22) extension known to regulate microsomal retention. A
particularly satisfactory approach for application in developing
countries would be the development of transgenic plants having
edible parts that consistently establish oral immunity against HBV
when consumed.
SUMMARY OF THE INVENTION
[0018] It is an object of the invention to provide plant expression
vectors comprising at least two expression cassettes that function
to reduce transcriptional silencing of polynucleotide expression.
It is another object of the invention to provide novel plant
expression vectors for expression of immunogenic polypeptides,
including HBsAg. The plant expression vectors can be used to
produce immunogenic polypeptides, including HBsAg, in edible plant
tissues. It is a further object of the invention to provide such
immunogenic polypeptides in edible plant tissue to elicit an immune
response in humans and animals when the plant tissues are consumed.
These and other objects of the invention are provided by one or
more of the embodiments described below.
[0019] One embodiment of the invention provides a plant expression
vector comprising two expression cassettes. The first cassette
comprises a polynucleotide encoding an antigen and the second
expression cassette comprises a polynucleotide encoding the same
antigen as the polynucleotide of the first expression cassette. The
polynucleotide of the second expression cassette is non-identical
to the polynucleotide of the first expression cassette. The first
cassette can optionally comprise a polynucleotide encoding a
hepatitis B surface antigen (HBsAg) and the second expression
cassette can comprise a non-identical polynucleotide encoding a
HBsAg. Optionally the first expression cassette can comprise a
polynucleotide encoding a plant-optimized HBsAg polypeptide,
preferably, with at least one plant optimized codon, and wherein
the second expression cassette comprises a polynucleotide encoding
a native virus-derived HBsAg polypeptide. Even more preferably, the
polynucleotide of the first expression cassette comprises SEQ ID
NO:3 and the polynucleotide of the second expression cassette
comprises SEQ ID NO:1.
[0020] Preferably, gene silencing, including RNA-mediated
transcriptional gene silencing, is reduced or eliminated when both
polynucleotides are expressed in a cell. Optionally, the plant
expression vector can have a polynucleotide of the first cassette
and a polynucleotide of the second cassette wherein said
polynucleotides comprise no more than 90 or no more than 60
contiguous identical nucleotides.
[0021] The plant expression vector may further comprise a first
expression cassette further comprising a 5' transcribed,
untranslated region and a second expression cassette comprising a
non-identical 5' transcribed, untranslated region. The plant
expression vector can also comprise a first expression cassette
further comprising a 3' transcribed, untranslated region and a
second expression cassette comprising a non-identical 3'
transcribed, untranslated region. Additionally, the plant
expression vector can comprise a first expression cassette further
comprising a 5' transcribed, untranslated region and a 3'
transcribed, untranslated region. The second expression cassette
can comprise a non-identical 5' transcribed, untranslated region
and a non-identical 3' transcribed, untranslated region as compared
to the first expression cassette. The first expression cassette can
comprise a TEV 5' transcribed, untranslated region and a vspB 3'
transcribed, untranslated region, and a second expression cassette
comprising a TMV 5' transcribed, untranslated region and a pin2 3'
transcribed, untranslated region. The plant expression vector can
additionally comprise a first expression cassette comprising a
plant-optimized HBsAg polypeptide and a second expression cassette
comprising a native virus-derived HBsAg polypeptide.
[0022] In still another embodiment of the invention, an E. coli
cell is transformed with the plant expression vector described
above. Virus like particles can assemble in the cell.
[0023] In yet another embodiment of the invention, an Agrobacterium
cell is transformed with the plant expression vector described
above. Virus like particles can assemble in the cell.
[0024] In another embodiment of the invention a plant cell is
transformed with the plant expression vector described above. Virus
like particles can assemble in the cell. Preferably the plant cell
is selected from the group consisting of tomato, potato, banana,
and carrot cells. Even more preferably, the plant expression vector
is integrated into the nuclear genome of the plant cell.
[0025] In even another embodiment of the invention a plant seed
comprising the plant expression vector described above is
provided.
[0026] In still another embodiment of the invention a
polynucleotide comprising a nucleic acid sequence encoding a
hepatitis B surface antigen (HBsAg) is provided. The polynucleotide
is operably linked to a plant functional promoter; a translation
enhancement sequence; and a termination sequence. The
polynucleotide lacks an untranscribed region between the
translation enhancement sequence and the HBsAg encoding sequence.
The nucleic acid sequence encoding the HBsAg can comprise at least
one altered codon, wherein the altered codon is a plant preferred
codon. The plant-functional promoter can be selected from the group
consisting of cauliflower mosaic virus (CaMV) 35S, tomato E8,
ubiquitin, mannopine synthase, patatin, and granule-bound starch
synthase (GBSS) promoters. The promoter may include a dual enhancer
region. The translation enhancement sequence can be selected from
the group consisting of tobacco etch virus (TEV) and tobacco mosaic
virus (TMV) omega translation enhancers. The termination sequence
may be selected from the group consisting of a nopaline synthase
(nos), a vegetative storage protein (vsp), or a proteinase
inhibitor--2 (pin2) termination sequence.
[0027] Further the polynucleotide may lack an untranscribed region
between the HBsAg encoding sequence and the termination sequence.
The polynucleotide can further comprise a nucleic acid sequence
encoding a microsomal retention signal operably linked to the 3'
end of the HBsAg encoding sequence. The microsomal retention signal
can be Ser-Glu-Lys-Asp-Glu-Leu (SEQ ID NO:4). The polynucleotide
can lack an untranscribed region between the microsomal retention
signal and the termination sequence. The polynucleotide can further
comprise a nucleic acid sequence encoding a signal polypeptide
operably linked to the 5' end of the HBsAg encoding sequence. The
signal peptide can be selected from the group consisting of a
vegetative storage protein (VSP) .alpha.S signal peptide and a VSP
.alpha.L signal peptide.
[0028] Additionally, the polynucleotide can comprise an HBsAg
encoding sequence further comprising a pre-S region. Optionally,
the polynucleotide can comprise an HBsAg encoding sequence which
comprises the nucleic acid sequence optimized for expression in
plants shown in SEQ ID NO:3. The polynucleotide can be selected
from the group of polynucleotides consisting of HB104, HB105,
HB106, HB107, HB111, HB114, HB115, HB116, HB117, HB118, HB119,
HB120, HB121, HB122, HB123, HB131, HB140.3 HB145 and HB165.
[0029] In yet another embodiment of the invention an expression
vector comprising a polynucleotide described above is provided. The
expression vector can comprise a selectable marker, an E. coli
origin of replication, and/or an Agrobacterium tumefaciens origin
of replication.
[0030] In another embodiment of the invention an E. coli cell
transformed with the expression vector described above is provided.
A virus like particle can assemble in the cell.
[0031] In even another embodiment of the invention an Agrobacterium
cell is transformed with the expression vector described above. A
virus like particle can assemble in the cell. The Agrobacterium
cell can further comprise a helper Ti plasmid.
[0032] In still another embodiment of the invention a transgenic
plant cell comprising the polynucleotide, as described above, is
provided. A virus like particle can be assembled in the cell. The
plant cell can be selected from the group consisting of tomato,
potato, banana, and carrot cells. The plant expression vector can
be integrated into the nuclear genome of the plant cell.
[0033] In yet another embodiment of the invention a plant seed
comprises the plant expression vector as described above.
[0034] In still another embodiment of the invention an immunogenic
composition comprising any of the plant cells described above is
provided. The plant cell can be present in plant tissue selected
from the group consisting of a fruit, leaf, tuber, plant organ,
seed protoplast, and callus. The immunogenic composition can
comprise juice or extract of the plant cell. The immunogenic
composition can also comprise an adjuvant. The adjuvant can be
expressed as a fusion protein with an antigen of the immunogenic
composition.
[0035] In yet another embodiment of the invention a method of
eliciting an immune response in a mammal is provided. The method
comprises the step of administering the composition described above
to a human or animal. An immune response is elicited. The
composition can be administered orally. The administration can
comprise consuming the transgenic plant cell. The polypeptide can
be administered by a technique selected from the group consisting
of intramuscular, oral, intradermal, intraperitoneal, subcutaneous,
and intranasal. Optionally an adjuvant can be administered. The
adjuvant can be selected from the group consisting of cholera toxin
(CT), E. coli heat labile toxin (LT), anti-idiotypic antibody 2F10,
colonization factor, shiga-like toxin, and intimin. The immune
response elicited can be selected from the group of immune
responses consisting of humoral; mucosal; cellular; humoral and
mucosal; humoral and cellular; mucosal and cellular; and humoral,
mucosal and cellular.
[0036] In another embodiment of the invention a method of isolating
a recombinant HBsAg polypeptide expressed in a plant material is
provided. The method comprises subjecting the plant material to a
detergent having a concentration of greater than 0.1% and less than
0.5%.
[0037] In even another embodiment of the invention a transgenic
plant or plant cell is provided. When the transgenic plant or plant
cell is consumed as a foodstuff in four or less feedings, it
elicits an immune response comprising anti-HBsAg serum antibodies
of greater than 50 mIU/mL in a mammal. The immune response can be a
primary immune response. The transgenic plant cell can comprise any
plant cell described above.
[0038] Still another embodiment of the invention provides a
transgenic plant or plant cell that, when consumed as a foodstuff
in four or less feedings, elicits an anti-HBsAg boosting immune
response that increases serum anti-HBsAg antibody levels at least
four-fold or to levels greater than 500 mIU/mL in a mammal. The
transgenic plant or plant cell can comprise any plant cell
described above.
[0039] As used herein, an "antigen" is a macromolecule capable of
eliciting an immune response in a human or in an animal.
[0040] An "epitope" is a portion of an antigen that comprises the
particular part of the antigen to which the antibody binds.
[0041] A "colonization or virulence antigen" is an antigen of a
pathogenic microorganism that is associated with the ability of the
microorganism to colonize or invade its host.
[0042] A "polynucleotide," "nucleic acid," and the like is a
polynucleotide that encodes a polypeptide. The polynucleotide or
nucleic acid can include introns, marker genes, signal sequences,
regulatory elements, such as promoters, enhancers and termination
sequences, and the like.
[0043] A first polynucleotide is "non-identical" to a second
polynucleotide where at least one nucleotide, and up to and
including 85% of overall identity of the first polynucleotide, is
different from that of the second polynucleotide.
[0044] An "expression vector" is a plasmid, such as pBR322, pUC, or
ColE1; a virus such as an adenovirus, Sindbis virus, simian virus
40, alphavirus vectors, and cytomegalovirus and retroviral vectors,
such as murine sarcoma virus, mouse mammary tumor virus, Moloney
murine leukemia virus, and Rous sarcoma virus. Bacterial vectors,
such as Salmonella ssp., Yersinia enterocolitica, Shigella spp.,
Vibrio cholerae, Mycobacterium strain BCG, and Listeria
monocytogenes can be used. Minichromosomes such as MC and MC1,
bacteriophages, virus particles, virus-like particles, cosmids
(plasmids into which phage lambda cos sites have been inserted) and
replicons (genetic elements that are capable of replication under
their own control in a cell) can also be used as expression
vectors. Preferably, an expression vector is capable of
transforming eukaryotic cells, including, for example plant
tissue.
[0045] A "foodstuff" or "edible plant material" and the like is any
plant material that can be directly ingested by animals or human as
a nutritional source or dietary complement. An edible plant
material includes a plant or any material obtained from a plant,
which is suitable for ingestion by mammal or other animals
including humans. This term is intended to include raw plant
material that may be fed directly to animals or processed plant
material that is fed to animals, including humans.
[0046] An "immune response" comprises the response of a host to an
antigen. A humoral immune response comprises the production of
antibodies in response to an antigen or antigens. A cellular immune
response includes responses such as a helper T-cell (CD4.sup.+)
response and a cytotoxic T-cell lymphocyte (CD8.sup.+) response. A
mucosal immune response (or secretory immune response) comprises
the production of secretory (sIgA) antibodies. An immune response
can comprise one or a combination of these responses.
[0047] An "immunogenic agent" or immunogenic polypeptide" is an
antigen or antigens capable of eliciting an immune response.
Preferably, the immune response is elicited in a human or animal
upon oral ingestion of a eukaryotically expressed antigen. An
"immunogenic composition" contains one or more immunogenic agents,
optionally in combination with a carrier, adjuvant, or the
like.
[0048] A "fusion protein" is a protein containing at least 2, 3, 4,
5, 10, or more same or different amino acid sequences linked in a
polypeptide where the sequences are not natively expressed as a
single protein. Fusion proteins can be produced by well known
genetic engineering techniques.
DESCRIPTION OF THE FIGURES
[0049] FIG. 1A depicts diagrams of expression cassettes of the
present invention. Abbreviations: 35S=35S promoter of cauliflower
mosaic virus; GBSS=granule bound starch synthase promoter specific
for activity in tubers; TEV=tobacco etch virus, .OMEGA.=tobacco
mosaic virus omega untranslated leader sequence; NOS=nopaline
synthase; VSP=vegetative storage protein; PIN2=proteinase inhibitor
2; TPSS=transit peptide signal sequence for the small sub-unit of
rubisco. VSP .alpha.S and .alpha.L are signal peptides with
.alpha.L including a putative vacuolar targeting signal. FIG. 1B
shows a map of pHB131 and pHB140.3 with selected restriction
endonuclease sites indicated.
[0050] FIG. 2A depicts a restriction map of plasmid pHB103.
[0051] FIG. 2B depicts a restriction map of plasmid pHB114.
[0052] FIG. 2C depicts a restriction map of plasmid pHB117.
[0053] FIG. 3 depicts anti-HBsAg antibody responses elicited in
mice following oral feeding with HBsAg transgenic potatoes (5
g/mouse) plus 10 .mu.g CT on days 0, 10, 20 and challenged with
yeast-derived rHBsAg (Merck, Sharpe & Domme) 0.5 .mu.g i.p. on
day 60. A control group received control potato (5 g/mouse) plus
the same adjuvant and recombinant challenge on day 60. Both
experimental and control groups of mice were fasted overnight prior
to feeding the potatoes. Individual mice were monitored to verify
consumption of the entire dose. Results are expressed as OD 492:660
nm.
[0054] FIGS. 4A-E depict the results of various immunization
protocols on mice fed with transgenic potato slices. Feeding Balb/c
mice with 5 g recombinant potato coated with 10 .mu.g cholera toxin
(CT) three times at weekly intervals gave peak antibody titers of
70-110 mIU/mL, which could be boosted to titers of 1700-3400 mIU/mL
by a single sub-immunogenic i.p. dose of HBsAg purified from
recombinant yeast (Merck) (actual titers are related to HBsAg
expression levels in potato). The level of response was
dose-related with potatoes delivering 1.1 .mu.g HBsAg per gram of
potato (FIG. 4A) giving a lower and less prolonged response than
potatoes delivering 8.3 .mu.g/g (FIG. 4B). The same feeding regime
(8.3 .mu.g/g) was found to boost a single s.c. dose of HBsAg
purified from recombinant yeast to give peak antibody titers of
1000 mIU/mL (FIG. 4C). Boiled tubers (5 min, 100.degree. C.) gave
no detectable immune response (FIG. 4D) but a significant boost was
observed on subsequent administration of a single i.p. dose of
HBsAg purified from recombinant yeast (FIG. 4E).
[0055] FIG. 5 depicts a plant-optimized coding sequence for the
pre-S (pre-S1/S2) peptide and the corresponding amino acid
sequence. To obtain the depicted sequence, the wild-type coding
sequence for pre-S was examined and one RNA polymerase II
termination sequence as well as twelve "CG" potential methylation
sites were found. The plant-optimized sequence contains no cryptic
signals and no CG sequences.
[0056] FIG. 6 shows a plasmid map of pHB117.
[0057] FIG. 7 shows a plasmid map of pHB118.
[0058] FIG. 8 shows a plasmid map of pHB119.
[0059] FIG. 9 shows a plasmid map of pHB120.
[0060] FIG. 10 shows a plasmid map of pHB121.
[0061] FIG. 11 shows a plasmid map of pHB122.
[0062] FIG. 12 shows a plasmid map pHB123.
[0063] FIG. 13 shows a graph demonstrating that sucrose gradients
of HB114-16 tubers produce virus like particles.
[0064] FIG. 14 shows a western blot of an HB114-6 tuber
extract.
[0065] FIG. 15 shows a northern blot of HB114-16 tuber and leaf
RNA.
[0066] FIG. 16 shows a gel of genomic DNA of HV114-16 subjected to
PCR, which verifies the presence of the transgene.
[0067] FIG. 17 shows a Southern blot of HB114-6 demonstrating at
least four insertions of HB114.
[0068] FIG. 18 shows a graph demonstrating the stability of HBsAg
transformed tubes stored for 9 months.
[0069] FIG. 19 shows a western blot analysis of transgenic NT1
cells expressing 3 different forms of HBsAg.
[0070] FIG. 20 shows a western blot analysis of transgenic NT1
cells expressing 6 different forms of HBsAg.
[0071] FIG. 21 shows synthetic HBsAg constructs of the
invention.
[0072] FIG. 22A shows a wild-type HBsAg nucleotide sequence and a
plant optimized HBsAg nucleotide sequence.
[0073] FIG. 23 shows wild-type HBsAg amino acid sequence (SEQ ID
NO:2) and a plant-optimized HBsAg amino acid sequence SEQ ID
NO:40.
DETAILED DESCRIPTION OF THE INVENTION
Immunogenic Polypeptides of the Invention
[0074] The invention comprises bacterial, viral, and parasitic
antigens capable of eliciting an immune response in an animal such
as a mouse, rabbit, guinea pig, chicken, goose, duck, chimpanzee,
macaque, baboon or a human. Preferably, the immune response is
elicited in a mammal.
[0075] Viral antigens can be derived from viruses such as
Orthomyxoviruses, such as influenza virus (hemagglutinin and
nucleoprotein antigens, for example); Retroviruses, such as RSV and
SIV, Herpesviruses, such as EBV, CMV, or herpes simplex virus (for
example, the thymidine kinase antigen); Lentiviruses, such as
HIV(for example, Nef, p24, gp120, gp41, Tat, Rev, and Pol
antigens); Rhabdoviruses, such as rabies; Picornoviruses, such as
poliovirus; Poxviruses, such as vaccinia; Rotavirus; Parvoviruses
and Hepadnaviruses, such as hepatitis B virus (for example,
HBsAg).
[0076] Bacterial antigens can be derived from, for example,
Mycobacterium spp., Helicobacter pylori, Salmonella spp., Shigella
spp. (such as the Shigella sonnei form 1 antigen), E. coli (such as
the CFA/I fimbrial antigen and the heat labile toxin), Rickettsia
spp., Listeria spp., Legionella pneumoniae, Pseudomonas spp.,
Vibrio spp. (such as the O-antigen or cholera toxin), Borellia
burgdorferi, Bordetella pertussis (such as pertactin and adenylate
cyclase-hemolysin), and Clostridium tetani (such as the tetnus
toxin).
[0077] Parasitic antigens can be derived from, for example
Plasmodium spp. (for example, circumsporozoite antigens, merozoite
surface antigen), Trypanosome spp., Giardia spp., Boophilus spp.,
Babesia spp., Entamoeba spp. (such as the galactose specific
lectin), Eimeria spp., Leishmania spp. (such as gp63), Schistosome
spp. (such as triose-phosphate isomerase), Brugia spp. (such as
paramyosin), Fascida spp., Dirofilaria spp., Wuchereria spp., and
Onchocerea spp.
[0078] In a preferred embodiment of the invention an immunogenic
polypeptide comprises a hepatitis B surface antigen (HBsAg). The
nucleic acid sequence of an HBsAg is shown in SEQ ID NO:1 (FIG. 22)
and the amino acid sequence of an HBsAg is shown in SEQ ID NO:2
(FIG. 23). HBsAg epitopes are contained in three HBV-encoded
envelope polypeptides and in their respective glycosylated forms.
The two smallest polypeptides (24,000 and 27,000 daltons) represent
a 226 amino acid polypeptide and the glycosylated form of the same
polypeptide. These polypeptides are encoded by the S region of the
S open reading frame of HBV. Two other proteins are a 33,000
dalton, 281 amino acid polypeptide comprising 55 amino acids
encoded by the pre-S2 region of HBV and 226 amino acids encoded by
the S region, and the glycosylated form of the same polypeptide
(36,000 daltons). Two other proteins are a 39,000 dalton (389-400
amino acids) polypeptide comprising about 119 amino acids of the
pre-S1 region of HBV and sequences encoded by the pre-S2 and S
regions, and a glycosylated form of the same polypeptide. All of
these proteins are found in infectious virions (often referred to
as Dane particles) recovered as 42 nm spheres from the serum of
infected patients. Serum samples also contain empty spherical
particles averaging 22 nm, which contain primarily S class
proteins. Mammalian cell lines transfected exclusively with DNA
encoding the S protein release 20 nm empty spheres similar to those
from infected cells. Moreover, yeast cells transformed with the
same gene form analogous spheres, which are as immunogenic as the
22 nm spheres from infected cells.
[0079] The immunogenic polypeptides of the invention comprise at
least one epitope that is recognized by an antibody. Epitopes
within the polypeptides can be identified by several methods. For
example, a polypeptide of the invention can be isolated by methods
such as immunoaffinity purification using a monoclonal antibody for
the polypeptide. The isolated polypeptide sequence can then be
screened. A series of short peptides, which together span the
entire polypeptide sequence, can be prepared by proteolytic
cleavage. By starting with, for example, 50-mer polypeptide
fragments, each fragment can be tested for the presence of epitopes
recognized in, for example, an anti-HBsAg enzyme-linked
immunosorbent assay (ELISA). Progressively smaller and overlapping
fragments can then be tested from an identified 50-mer to map the
epitope of interest.
[0080] An HBsAg polypeptide of this invention can comprise an S
polypeptide and can further comprise a pre-S1 polypeptide. An HBsAg
polypeptide of the invention can further comprise a pre-S2
polypeptide. An HBsAg can comprise any combination of S, pre-S1,
and pre-S2 polypeptides. Optionally, an HBsAg polypeptide can
comprise more than one S, Pre-S1, or pre-S2 polypeptides. The S,
Pre-S1, and pre-S2 polypeptides may be derived from the same or
different isolates of HBV. Also, S, pre-S1, and pre-S2 polypeptides
can be prepared a as fusion protein or as separate
polypeptides.
[0081] Some epitopes within the pre-S1 and pre-S2 regions are
effective in binding hepatocyte and can be neutralized. Neurath et
al. U.S. Pat. No. 4,847,080 and EU-B1-0154902. Pre-S1 sequences
spanning residues 1-21, 12-32, 21-47, 27-49, 32-53, 94-117, and
120-153 have been identified as immunogenic. (Neurath et al. 1986).
Similarly, pre-S2 sequences spanning residues 120-145 are
identified as being immunogenic. Therefore, these residues are
useful as immunogenic polypeptides according to the invention.
Other peptides involving insertions, deletions, or substitutions of
an aforementioned sequence can also be expected to show
immunogenicity, and synthesis of such mutants by site-directed
mutagenesis is within the skill of the practitioner (Maniatis, T.
(1988) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory). It should be appreciated that to effect immunogenicity
it may be necessary to conjugate an epitope to a carrier, such as
KLH or a liposome. It is not known precisely how the aforementioned
epitopes signal an immune response, however, it is postulated that
the IgA receptor, the IL-6 receptor, the asialoglycoprotein
receptor, and GAPD may be involved.
[0082] A preferred polypeptide of the invention comprises a 15
amino acid peptide, as well as an inclusive 8 residue peptide,
which is partially homologous to the group specific "a" determinant
of HBsAg. This peptide, which has the sequence AVYYCTRGYHGSSLY (SEQ
ID NO:6), reportedly has antigenic properties similar to the group
specific "a" determinant, and can duplicate the B and T cell
stimulatory activities of anti-idiotypic antibody 2F10 and HBsAg
(see, e.g., U.S. Pat. Nos. 5,744,153; 5,531,990; 5,668,253 to
Thanavala, Y. et al.). Accordingly, this peptide, and variants
thereof, can be an HBsAg immunogenic polypeptide as discussed
herein, and a polynucleotide encoding such a peptide is
contemplated within the present invention. The polypeptide can
serve as an adjuvant itself, similarly to antibody 2F10, when
administered with another HBsAg or an immunogenic polypeptide of
the invention.
[0083] Some of polypeptides of the invention differ from previously
obtained polypeptides by virtue of the various leader and retention
signals employed to sort the protein. For instance, one such
polypeptide comprises an HBsAg amino acid sequence covalently
linked to a C-terminal Ser-Glu-Lys-Asp-Glu-Leu sequence (SEQ ID
NO:4), with the latter sequence believed to target the protein to
the ER. The polypeptides of the present invention in some instances
can also differ from previous proteins by virtue of having
different glycosylation patterns, which may be a result of their
retention time in the ER or the different glycosylation enzymes
that may be present in the ER. Accordingly, immunogenic
polypeptides obtained can vary somewhat in their immunogenic
properties from previous proteins. However, as long as such
immunogens share a sufficient number of epitopes with those of the
native immunogenic polypeptide, an immune response can be mounted
that is sufficiently cross-reactive with the antigen.
[0084] Preferably, an HBsAg polypeptide of the invention is capable
of forming virus like particles (VLPs). Even more preferably an
HBsAg polypeptide of the invention is capable of forming VLPs when
produced by a plant cell. In a preferred embodiment of the
invention an HBsAg polypeptide is capable of forming cross-linked
monomers via disulfide bridges. Highly crosslinked HBsAg can be
more stable and more immunogenic. See example 12.
[0085] Various strains and isolates of hepatitis and other
organisms providing the antigens of the invention occur and
polypeptides of any of these strains and isolates can be used in
the present invention. Immunogenic polypeptides of the invention,
such as HBsAg, can either be full-length polypeptides, fragments of
polypeptides, or truncated segments of polypeptides. For example
fragments of immunogenic polypeptides can comprise at least 6, 10,
25, 50, 75, 100, 150, 200, 250, 300, or 350, 400, 500, 750, 1000,
or 1500 amino acids or more of immunogenic polypeptides. The
invention further comprises a mutation or mutations, i.e., amino
acid substitutions, additions, deletions, truncations, or
combinations thereof, in an immunogenic polypeptide.
[0086] An immunogenic polypeptide of the invention can be combined
or synthesized with another truncated immunogenic polypeptide, a
fragment of another immunogenic polypeptide, or a full-length
immunogenic polypeptide. For example a fragment of an immunogenic
polypeptide can comprise at least 6, 10, 25, 50, 75, 100, 200, 300,
4000, 500, or 1000 amino acids of an immunogenic polypeptide. The
two immunogenic polypeptides may be from the same or different
strains. Further, one or more (i.e., 2, 3, 4, 5, 10, 25, or 50)
immunogenic polypeptides of the invention, from the same or
different strains can be combined.
[0087] Preferably, a polypeptide of the invention is produced
recombinantly. A polynucleotide encoding a polypeptide of the
invention can be introduced into an expression vector which can be
expressed in a suitable expression system using techniques well
known in the art. A variety of bacterial, yeast, plant, mammalian,
and insect expression systems are available in the art and any such
expression system can be used. A polypeptide of the invention can
be isolated and purified from for example, a eukaryotic cell, such
as a plant cell, by methods well known in the art such as
immunoaffinity purification. Optionally, a polynucleotide encoding
a polypeptide of the invention can be translated in a cell-free
translation system.
[0088] If desired, a polypeptide of the invention can be produced
as a fusion protein, which can also contain other amino acid
sequences, such as amino acid linkers or signal sequences, as well
as ligands useful in protein purification, such as
glutathione-S-transferase, histidine tag, and staphylococcal
protein A. Optionally, one or more antigens such as HBsAg,
colonization antigens, virulence antigens, and epitopes thereof,
and other compositions useful for the stimulation of animmune
response in an animal or human can be present in a fusion protein.
More than one immunogenic polypeptide, such as HBsAg can be present
in a fusion protein. If desired, various combinations of, for
example HBsAg polypeptides from different hepatitis strains or
isolates can be included in a fusion protein.
Polynucleotides Encoding Immunogenic Polypeptides
[0089] Polynucleotides of the invention contain less than an entire
bacterial, viral, or protozoan genome and can be single- or
double-stranded DNA. Preferably, the polynucleotides are purified
free of other components, such as proteins. The polynucleotides
encode the immunogenic polypeptides described above.
Polynucleotides of the invention can be isolated from a genomic
library derived from nucleic acid sequences present in, for
example, bacterial, virus, or protozoan cell cultures. Preferably,
a polynucleotide is isolated from nucleic acid sequences present
in, for example, the plasma, serum, or liver of an HBV infected
individual or a cell culture infected with HBV. An amplification
method such as PCR can be used to amplify polynucleotides from
either bacterial, viral, or protozoan genomic RNA or cDNA encoding
an immunogenic polypeptide. The polynucleotides can also be
synthesized in the laboratory, for example, using an automatic
synthesizer. If desired, the polynucleotides can be cloned into an
expression vector and transformed into, for example, bacterial,
yeast, insect, plant, or mammalian cells so that the polypeptides
of the invention can be expressed in and isolated from cell
culture.
[0090] The polynucleotides can comprise coding sequences for
naturally occurring immunogenic polypeptides or can encode altered
immunogenic polypeptides, which do not occur in nature. A mutation
or mutations in an immunogenic polynucleotide can be made by
site-directed mutagenesis using conventional techniques. A library
of mutant polynucleotides comprising single, double, or higher
mutations, can also be prepared using random mutagenesis
techniques. Mutagenesis techniques are described generally, e.g.,
in Current Protocols in Molecular Biology, Ausubel, F. et al. eds.,
John Wiley (1998), and random mutagenesis (also referred to as "DNA
shuffling") is the subject of U.S. Pat. Nos. 5,605,793, 5,811,238,
5,830,721, 5,834,252, and 5,837,458 to Stemmer et al. A
polynucleotide comprising mutations of an immunogenic polypeptide
can also be synthesized in a laboratory.
[0091] Preferably, an immunogenic polynucleotide of the invention
is engineered such that the bacterial codons are systematically
replaced by plant-preferred codons. For example, the coding
sequence of an HBsAg, or a portion thereof, can be analyzed for its
codon usage. This codon usage can then be compared with the
frequency of codon usage in abundant proteins found in a particular
plant. See, e.g. WO 96/12801. The codons of a polynucleotide which
have low or zero frequency of use in a plant can be modified by,
for example, site directed mutagenesis or a polynucleotide can be
synthesized in the laboratory. The codon modifications are made to
conform with the plant codons used in the genes for the abundantly
expressed plant proteins. Further, segments of codons with possible
poly-A signal sequences can be modified to other codons for the
same amino acids. Further, cryptic signal sequences, intron splice
sites, and potential methylation sites can be modified. See WO
96/12801; SEQ ID NO:3 (FIG. 22) (showing a nucleic acid sequence
encoding HBsAg that has been optimized for expression in plants).
The replacement or substitution of plant-preferred codons for the
corresponding viral, bacterial, or protozoan-preferred codons can
enhance the expression of the immunogenic polynucleotides and can
facilitate expression of the encoded polypeptide or polypeptides in
a particular part, e.g., the fruit or tuber, of the plant. An
immunogenic polynucleotide sequence, such as HBsAg, which has had
at least 1, 2, 3, 4, 5, 10, 20, 50, or more codons modified to
plant-preferred codons is said to be plant-optimized. Preferably,
plant-optimization further comprises modification of codons
encoding possible signal sequences, intron splice sites, and
methylation sites.
[0092] Preferably, a polynucleotide of the invention encoding an
immunogenic polypeptide, such as HBsAg, is operably linked to a
plant functional promoter. As used herein, "operably linked" refers
to the coding sequence for an immunogenic polypeptide, being fused
in-frame to a promoter, transcription or translation enhancer,
termination sequence, and the like, so that the respective coding
sequences are faithfully transcribed and translated. Accordingly,
the respective nucleotide sequences need not be contiguously fused,
i.e., covalently, to adjoining defined sequences, but may be
provided with synthetic adaptors and linkers, and the like, to
facilitate assembly of the construct and expression vectors.
[0093] A promoter can be a constitutive promoter, whereby
expression of an immunogenic polypeptide continually takes place
within a cell. Alternatively, a promoter can be inducible, whereby
a chemical inducing agent or a tissue-specific agent activates the
promoter, such as upon the plant reaching a desired stage of
differentiation. Inducible promoters comprise any promoter capable
of increasing the amount of polynucleotide product produced by a
given polynucleotide in response to exposure to an inducer.
Inducible promoters include, but are not limited to a heat shock
promoter, a glucocorticoid system, wound inducible, steroid
inducible, phosphate deficiency inducible, and any
chemically-inducible promoter, including, but not limited to
tetracycline, ethylene, copper, salicylic acid, and
benz-1,2,3,-thiadiazol. See, e.g., U.S. Pat. Nos. 5,942,662,
5,977,441, 5,684,239, and 5,922,564.
[0094] A preferred plant promoter is CaMV 35S containing a dual
enhancer region. This promoter is a constitutive promoter and is
effective in causing expression in leaves and tubers. Other
preferred promoters include patatin, mas, tomato E8 (Giovanni et
al., Plant Cell, 1:53-63 (1989)), ubiquitin (Quail et al. U.S. Pat.
No. 5,510,474), mannopine synthase (Ellis et al., Mol. Gen. Genet.
195: 466-473 (1984)), nopaline synthase (Ebert et al. PNAS,
84:5745-5749 (1987)), figwort mosaic virus (FMV) (Rogers, U.S. Pat.
No. 5,378,619), sucrose synthase (Yang et al. PNAS, 87:4144-4148
(1990)), actin (Wang et al., Mol. Cell. Biol., 12:3399-3406
(1992)), isocitrate lyase (Harada et al. U.S. Pat. No. 5,689,040),
and granule-bound starch synthase (GBSS) promoters. Preferably, the
promoter includes a dual (or double) enhancer. See Artzen, U.S.
Pat. No. 5,914,123; Lam, U.S. Pat. No. 5,612,487; and Maiti, U.S.
Pat. No. 5,994,521.
[0095] Some exemplary plant functional promoters, which can be used
to express a structural gene of the present invention, are among
the following: U.S. Pat. No. 5,352,605 and U.S. Pat. No.
5,530,196--CaMV 35S and 19S promoters; U.S. Pat. No.
5,436,393--patatin promoter; U.S. Pat. No. 5,436,393--B33 promoter
sequence of a patatin gene derived from Solanum tuberosum, and
which leads to a tuber specific expression of sequences fused to
the B33 promoter; WO 94/24298--tomato E8 promoter; U.S. Pat. No.
5,556,653--tomato fruit promoters; U.S. Pat. No. 5,614,399 and
5,510,474--plant ubiquitin promoter system; U.S. Pat. No.
5,824,865--5' cis-regulatory elements of abscisic acid-responsive
gene expression; U.S. Pat. No. 5,824,857--promoter from badnavirus,
rice tungro bacilliform virus (RTBV); U.S. Pat. No.
5,789,214--chemically inducible promoter fragment from the 5'
flanking region adjacent the coding region of a tobacco PR-1a gene;
U.S. Pat. No. 5,783,394--raspberry drul promoter; WO 98/31812
strawberry promoters and genes; U.S. Pat. No. 5,773,697--napin
promoter, phaseolin promoter, and DC3 promoter.; U.S. Pat. No.
5,723,765--LEA promoter; U.S. Pat. No. 5,723,757--5'
transcriptional regulatory region for sink organ specific
expression; U.S. Pat. No. 5,723,751--G-box related sequence motifs,
specifically Iwt and PA motifs, which function as cis-elements of
promoters, to regulate the expression of heterologous genes in
transgenic plants; U.S. Pat. No. 5,633,440--P 119 promoters and
their use; U.S. Pat. No. 5,608,144--Group 2 (Gp2) plant promoter
sequences; U.S. Pat. No. 5,608,143--nucleic acid promoter fragments
derived from several genes from corn, petunia and tobacco; U.S.
Pat. No. 5,391,725--promoter sequences from the nuclear gene for
chloroplast GS2 glutamine synthetase and from two nuclear genes for
cytosolic GS3 glutamine synthetase in the pea plant, Pisum sativum;
U.S. Pat. No. 5,378,619--full-length transcript promoter from
flagwort mosaic virus (FMV); U.S. Pat. No. 5,689,040--isocitrate
lyase promoter; U.S. Pat. No. 5,633,438--microspore-specific
regulatory element; U.S. Pat. No. 5,595,896--expression of
heterologous genes in transgenic plants and plant cells using plant
asparagine synthetase promoters; U.S. Pat. No. 4,771,002--promoter
region that drives expression of a 1450 base TR transcript in
octopine-type crown gall tumors; U.S. Pat. No. 4,962,028--promoter
sequences from the gene from the small subunit of
ribulose-1,5-bisphosphate carboxylase; U.S. Pat. No.
5,491,288--Arabidopsis histone H4 promoter; U.S. Pat. No.
5,767,363--seed-specific plant promoter; U.S. Pat. No.
5,023,179--21 bp promoter element which is capable of imparting
root expression capability to a rbcS-3A promoter, normally a green
tissue specific promoter; U.S. Pat. No. 5,792,925--promoters of
tissue-preferential transcription of associated DNA sequences in
plants, particularly in the roots; U.S. Pat. No.
5,689,053--Brassica sp. polygalacturonase promoter; U.S. Pat. No.
5,824,863--seed coat-specific cryptic promoter region; U.S. Pat.
No. 5,689,044--chemically inducible nucleic acid promoter fragment
isolated from the tobacco PR-1a gene is inducible by application of
a benzo-1,2,3-thiadiazole, an isonicotinic acid compound, or a
salicylic acid compound; U.S. Pat. No. 5,654,414--promoter fragment
isolated from a cucumber chitinase/lysozyme gene that is inducible
by application of benzo-1,2,3-thiadiazole; U.S. Pat. No.
5,824,872--constitutive promoter from tobacco that directs
expression in at least ovary, flower, immature embryo, mature
embryo, seed, stem, leaf and root tissues; U.S. Pat. No.
5,223,419--alteration of gene expression in plants; U.S. Pat. No.
5,290,924--recombinant promoter for gene expression in
momocotyledenous plants; WO 95/21248--method for using TMV to
overproduce peptides and proteins; WO 98/05199--nucleic acid
comprising shoot meristem-specific promoter and regulated sequence;
EP-B-0122791--phaseolin promoter and structural gene; U.S. Pat. No.
5,097,025--plant promoters (sub domain of CaMV 35S); WO
94/24294--use of tomato E8-derived promoters to express
heterologous genes, e.g. 5-adenosylmethionine hydrolase in ripening
fruit; U.S. Pat. No. 5,801,027--method of using transactivation
proteins to control gene expression in transgenic plants; U.S. Pat.
No. 5,821,398--DNA molecules encoding inducible plant promoters and
tomato Adh2 enzyme; WO 97/47756--synthetic plant core promoter and
upstream regulatory element; U.S. Pat. No. 5,684,239--monocot
having dicot wound inducible promoter; U.S. Pat. No.
5,110,732--selective gene expression in plants; U.S. Pat. No.
5,106,739--CaMV 35S enhanced mannopine synthase promoter and method
for using the same; U.S. Pat. No. 5,420,034--seed specific
transcription regulation; U.S. Pat. No. 5,623,067--seed specific
promoter region; U.S. Pat. No. 5,139,954--DNA promoter fragments
from wheat; WO 95/14098--chimeric regulatory regions and gene
cassettes for use in plants; WO 90/13658--production of gene
products to high levels; U.S. Pat. No. 5,670,349--HMG promoter
expression system and post harvest production of gene products in
plants and plant cell cultures; U.S. Pat. No. 5,712,112--gene
expression system comprising the promoter region of the alpha
amylase genes in plants.
[0096] A preferred polynucleotide comprises a tobacco mosaic virus
(TMV) 5' transcribed, untranslated region (UTR) (omega) (Gallie et
al. Nucleic Acids Res 20: 4631-4638 (1992)) or a tobacco etch virus
(TEV) 5' transcribed, untranslated region (Carrington, et al., J.
Virol. 64:1590-1597 (1990)) or fragments thereof, between the
promoter and a polynucleotide sequence encoding an immunogenic
polypeptide. A TMV 5' UTR facilitates translation of the coding
sequence. A polynucleotide may further comprise a TMV 3'-UTR or
fragments thereof, which can further facilitate translation.
Zeyenko et al., FEBS Lett. 354:271-273 (1994); Leathers et al.,
Mol. Cell. Biol. 13:5331-5347 (1993); Gallie et al., Nucl. Acids
Res. 20:4631-4638 (1992).
[0097] Preferably, an expression vector comprises one or more
enhancers. Some enhancers that can be used with the present
invention are among the following: U.S. Pat. No. 5,424,200 and U.S.
Pat. No. 5,196,525--CaMV 35S enhancer sequences; U.S. Pat. No.
5,359,142, U.S. Pat. No. 5,322,938, U.S. Pat. No. 5,164,316, and
U.S. Pat. No. 5,424,200--tandemly duplicated CaMV 35S enhancers; WO
87/07664--.OMEGA.' region of TMV; WO 98/14604--intron 1 and/or
intron 2 of the PAT1 gene.; U.S. 5,593,874--HSP70 introns that when
present in a non-translated leader of a chimeric gene enhance
expression in plants; U.S. Pat. No. 5,710,267, U.S. Pat. No.
5,573,932, and U.S. Pat. No. 5,837,849--plant enhancer element
capable of being bound by an OCS transcription factor; U.S. Pat.
No. 5,290,924--a maize Adh1 intron; JP 8256777--translation
enhancer sequence.
[0098] A polynucleotide of the present invention can also include a
transcription termination sequence functional in a plant host.
Exemplary termination sequences include nopaline synthase (nos)
(Bevan, Nucleic Acids Res., 12: 8711-8721(1984)), vegetative
storage protein (vsp) (Mason et al., Plant Cell. 5:241-251 (1993))
and proteinase inhibitory-2 (pin2)termination sequences (An et al.
Plant Cell 1:115-122 (1989)). These sequences are transcribed, but
untranslated.
[0099] A polynucleotide of the invention can also encode a
microsomal retention signal sequence, such as SEKDEL
(Ser-Glu-Lys-Asp-Glu-Leu) (SEQ ID NO:4) or KDEL (SEQ ID NO:22), in
order to increase retention of the expressed polypeptide in the
cell. For example, concentration of HBsAg antigen complex can be
obtained by providing the nascent polypeptide with a microsomal
retention signal, which signals that the protein is to be recycled
to the endoplasmic reticulum (ER) or other organelle. The
microsomal retention signal sequence can be operably linked to the
3' end of the immunogenic polypeptide. Preferably, the
polynucleotide lacks an untranscribed region between the microsomal
retention signal and the termination sequence. The signal can be
separated from the immunogenic polypeptide by, for example, a hinge
region.
[0100] Further, a polynucleotide of the invention can comprise a
signal polypeptide operably linked to the 5' end of the immunogenic
polypeptide. Signal polypeptides include, for example, a vegetative
storage protein (VSP) .alpha.S signal peptide or a VSP .alpha.L
signal peptide. Mason et al., Plant Mol. Biol. 11:845-856 (1988). A
signal peptide serves to sort a protein along a predefined pathway,
such as to the ER or putative storage vesicles in the cell. A
signal peptide thereby permits accumulation and/or further
processing of a polypeptide at a targeted site. A signal peptide
can be physically separated from an immunogenic polypeptide coding
sequence by a hinge region.
[0101] In a preferred embodiment, a polynucleotide of the invention
comprises a nucleic acid sequence encoding an immunogenic
polypeptide, such as HBsAg, operably linked to a plant functional
promoter, a translation enhancement sequence, and a termination
sequence. Even more preferably, a polynucleotide of the invention
lacks an untranscribed region between the translation enhancement
sequence and the immunogenic polypeptide encoding sequence. That
is, a RNA polymerase that transcribes the translation enhancement
sequence does not terminate transcription, but continues on to
transcribe the immunogenic polypeptide encoding sequence. Even more
preferably, the polynucleotide lacks an untranscribed region
between the immunogenic polypeptide sequence and the termination
sequence.
[0102] Preferably, a polynucleotide of the invention comprises a
native virus-derived (or wild-type) HBsAg-encoding nucleotide
sequence shown in SEQ ID NO: 1. The corresponding HBsAg amino acid
sequence is shown in SEQ ID NO: 2. An HBsAg encoding sequence can
be synthesized directly by assembly of synthetic oligomers, or can
be derived from a cDNA library, plasmid carrying the sequence, or
other vector, such as those discussed hereinbelow.
[0103] Alternatively, a polynucleotide of the invention can
comprise a synthetic version of the HBsAg encoding sequence, which
incorporates one or more insertions, deletions, or mutations
designed to improve the efficiency of transformation,
transcription, or translation in an eukaryotic expression system,
e.g., a plant cell. One such synthetic sequence encoding the HBsAg
S protein is shown in SEQ ID NO: 3 (FIG. 22); the corresponding
amino acid sequence is shown in SEQ ID NO:40 (FIG. 23). Another
such sequence adapted for expression in plants, which encodes the
preS peptide, is shown in FIG. 5 (SEQ ID NO:5).
[0104] Nucleotide sequences having a high degree of homology to
these HBsAg sequences are also contemplated. Preferably, the
encoded amino acid sequence remains substantially or wholly
unchanged. In particular, sequences at least 80%, more preferably
90%, homologous with an HBsAg polynucleotide are contemplated. In
the calculation of a percent homology, the percentage of identical
base pairs with reference to a polynucleotide is determined, taking
into account any occurrence of insertions, deletions, or
substitutions in the nucleic acid sequence. Further, the invention
contemplates polynucleotides encoding epitopes of an HBsAg
polypeptide essential for generating an immune response.
Accordingly, C-terminal, N-terminal or any other fragments of the
HBsAg protein comprising an epitope are contemplated within the
invention. Such fragments can be encoded in a polynucleotide of the
invention as a single or repeat sequence. Fragments can be at least
12, 15, 25, 50, 75, 100, 200, 300, 400, 500, 750, or 1000 nucleic
acids in length.
[0105] Particularly preferred polynucleotides of the invention
include those designated herein as HB103, HB104, HB105, HB106,
HB107, HB111, HB114, HB115, HB116, HB117, HB 118, HB 119, HB120,
HB121, HB122, HB123, HB145, and HB165, HB131 and HB140.3, which
contain various combinations of the structural features mentioned
above. The relevant expression cassettes of these plasmids are
shown in FIGS. 1A and 1B. Most preferred is construct HB114, which
uses a 35S promoter and a TEV translation enhancer, as well as a
proteinase inhibitor 2 (pin2) termination sequence. The kanamycin
resistance gene is used as a selectable marker in this plasmid. The
vector is derived from a binary vector in A. tumefaciens, such as
pBIN19 (Bevan 1984) or (pGPTV-KAN) (Becker et al. Plant Mol. Biol.
20:1195-1197(1992)). The 35S promoter is "constitutive" and has a
dual enhancer (Mason et al. 1992).
[0106] Preferably, the polynucleotide of the invention comprises an
expression cassette. That is, the polynucleotide is operably linked
to a promoter. Optionally, a translation enhancement sequence,
and/or a termination polynucleotide sequence can be included in an
expression cassette. Other polynucleotides can also be present in
an expression cassette, such as a signal sequences.
[0107] In a preferred expression cassette of the invention a
polynucleotide encoding a plant optimized or wild-type immunogenic
polynucleotide, such as HBsAg, is operably linked to a plant
functional promoter, such as CaMV 35S or tomato E8. Further, a
cassette can comprise a tobacco etch virus (TEV) or tobacco mosaic
virus (TMV) omega translation enhancer, which is transcribed, but
untranslated. A cassette can also comprise a 3' transcribed,
untranslated region such as nopaline synthase (nos), a vegetative
storage protein (vsp), or a proteinase inhibitor such as pin2. An
expression cassette can lack an untranscribed region between the
translation enhancement sequence and the immunogenic polypeptide
encoding sequence and/or between the 3' transcribed, untranslated
region. (Mason, 1992).
[0108] Expression cassettes of the invention can be designed to
comprise promoters that direct polypeptide expression in particular
parts of the plant. For example, expression cassettes including the
CaMV 35S promoter and a polynucleotide of the invention can be used
to constitutively transform plants so that a polypeptide expressed
by a polynucleotide of the invention is produced in the leaves of
the plant. This allows for rapid analysis of polynucleotide
expression and biochemical characterization of polynucleotide
products.
[0109] Expression cassettes comprising a 2S albumin promoter and a
polynucleotide of the invention can be used to cause seed-specific
polynucleotide expression to create the production of a polypeptide
of the invention in seed tissues, for example canola (Brassica
napus) seeds.
[0110] Expression cassettes comprising a patatin promoter or a
soybean vspB promoter and a polynucleotide of the invention can be
used to cause tuber-specific polynucleotide expression and tuber
specific production of a polypeptide in tuber tissues such as
potato (Solanum tuberosum).
[0111] Expression cassettes comprising fruit ripening specific
promoters and polynucleotides of the invention can be used to
transform plants that produce a polypeptide of the invention in
ripened fruit, such as banana (Musa acuminata).
Expression Vectors
[0112] If desired, a polynucleotide or an expression cassette
comprising polynucleotides of the invention can be cloned into an
expression vector and transformed into, for example, bacterial,
yeast, insect, plant, or mammalian cells so that the polypeptides
of the invention can be expressed in and isolated from cell
culture. The polynucleotides can be contained within a plasmid,
such as pBR322, pUC, or ColE1, or an adenovirus vector, such as an
adenovirus Type 2 vector or Type 5 vector. Optionally, other
vectors can be used, including but not limited to Sindbis virus,
simian virus 40, alphavirus vectors, and cytomegalovirus and
retroviral vectors, such as murine sarcoma virus, mouse mammary
tumor virus, Moloney murine leukemia virus, and Rous sarcoma virus.
Bacterial vectors, such as Salmonella ssp., Yersinia
enterocolitica, Shigella spp., Vibrio cholerae, Mycobacterium
strain BCG, Listeria monocytogenes, and Agrobacterium spp. can be
used. Minichromosomes such as MC and MC1, bacteriophages, virus
particles, virus-like particles, cosmids (plasmids into which phage
lambda cos sites have been inserted) and replicons (genetic
elements that are capable of replication under their own control in
a cell) can also be used.
[0113] Preferably, an expression vector comprises a selectable
marker in addition to a polynucleotide of the invention. Examples
of selectable markers include a kanamycin gene, a
.beta.-glucuronidase gene, a neomycin transferase gene, a tfdA
gene, a Pat gene, a hyg gene, a methotrexate-resistant DHFR gene, a
dehalogenase gene, and a bar gene. An expression vector can also
comprise an E. coli origin of replication, for example the ColE1 or
pBR322 origin of replication, to facilitate replication of the
vector in E. coli. An expression vector of the invention can also
comprise an A. tumefaciens origin of replication, to permit
replication of the vector therein, such as when A. tumefaciens is
to be used for plant transformation.
[0114] Gene silencing can affect the level of expression of a
polynucleotide of the invention. There are two different kinds of
gene silencing: transcriptional gene silencing (TGS) and
post-transcriptional gene silencing (TPGS). Vaucheret et al. Plant
J. 16:651-9. One type of TGS is cis-inactivation in which a DNA
locus that is methylated affects the DNA connected to it. In
plants, methylation may spread from adjacent sequences into
transgenes and cause gene silencing. Prols and Meyer, Plant J.
2:463-75 (1992). A plant optimized sequence will have a reduced
number of sites or no sites upon which methylation can occur,
therefore, this type of gene silencing may be minimized by use of a
plant optimized sequence for the transgenic protein. Another type
of cis-inactivation occurs with multiple copies of the same
nucleotide sequence integrated at one locus. Again, the mechanism
of silencing seems to involve methylation (Ye and Signer, PNAS USA
93:10881-6 (1996). A plant optimized sequence without potential
methylation sites may avoid this type of silencing.
[0115] Post-transcriptional gene silencing can occur when transgene
RNA is produced at high levels. If more than one copy of a
transgene is producing RNA, then RNA may accumulate to a threshold
level that will stimulate post-transcriptional gene silencing
(Vaucheret et al. Plant J. 16:651-9 (1998). Some studies suggest
that as little as 60 bp of sequence identity within the transcribed
region can mediate this process. Depicker & Van Mantagu, Curr.
Opin. Cell. Biol. 9:373-82 (1997). Combining non-identical copies
of a coding sequence in a transgenic plant can thus increase levels
of mRNA that encode the same polypeptide without stimulation of the
RNA-mediated silencing process.
[0116] In a preferred embodiment, an expression vector comprises
two expression cassettes. The first expression cassette can
comprise a polynucleotide encoding an immunogenic polypeptide (or
antigen). The second expression cassette can comprise a
non-identical polynucleotide encoding the same immunogenic
polypeptide. For example, the first expression cassette can
comprise a polynucleotide encoding HBsAg wherein the polynucleotide
has been plant-optimized. See, e.g., SEQ ID NO:3 (FIG. 22). The
second expression cassette can then comprise a polynucleotide
encoding a native virus-derived (wild-type) HBsAg. An expression
vector comprising two or more expression cassettes encoding the
same immunogenic polypeptide will increase the production of the
immunogenic polypeptide by increasing the copy number. However,
sequence duplication from multiple copies or an identical sequence
can lead to undesirable post-transcriptional gene silencing.
Depicker & Van Montagu, Curr. Opin. Cell Biol. 9:373-82 (1997);
Vaucheret et al., Plant J. 16:651-9 (1998). Therefore, it is an
object of the invention to reduce or eliminate transcriptional gene
silencing, such as RNA-mediated post-transcriptional gene
silencing, by providing two or more expression cassettes in an
expression vector that each comprise non-identical polynucleotides
encoding the same immunogenic polypeptide. Preferably, the
cassettes comprise further minimal sequence identity by the use of
different or non-identical promoters, and 5' and 3' transcribed,
untranslated regions, such as translation enhancement sequences and
termination sequences. The expression cassettes can further
comprise different polynucleotides encoding, for example, signal
peptides.
[0117] Preferably, each expression cassette combined into one plant
expression vector shares no length of sequence identity with
another expression cassette that is greater than 90 base pairs, and
more preferably no length of sequence identity with another
expression cassette that is greater than 60 base pairs, and most
preferably no length of sequence identity with another expression
cassette that is greater than 30 base pairs. That is, no greater
than 90 base pairs (or 60 base pairs, or 30 base pairs) are
identical within any length of the expression cassette, when each
component of one expression cassette (i.e., nucleic acids encoding
a promoter, immunogenic polypeptide, 5' and 3' transcribed,
untranslated regions, and any other components) is compared to each
component of a second expression cassette.
[0118] A difference in transcriptional gene silencing can be
measured by construction of a plant expression vector comprising
for example, two identical expression cassettes each comprising a
polynucleotide encoding an immunogenic polypeptide of interest. The
amount of expression of this immunogenic polypeptide in a plant
cell can be compared to the amount of expression of the immunogenic
polypeptide when it is expressed by a plant expression vector
comprising for example, two non-identical expression cassettes
encoding the polypeptide of interest. A greater amount of the
immunogenic polypeptide expressed by the plant expression vector
comprising two non-identical expression cassettes indicates that
post-transcriptional gene silencing has been reduced or has not
been activated in the plant cell. Preferably, transcriptional gene
silencing is reduced by at least 10, 25, 50, 75, or 100%.
[0119] Further, each expression cassette in a plant expression
vector may comprise the same or different promoters, translation
enhancement sequences, and termination sequences. Each expression
cassette can also comprise other polynucleotide sequences encoding,
for example, a signal sequence. Preferably, when two or more
expression cassettes are used in one plant expression vector, each
expression cassette comprises a non-identical immunogenic
polypeptide, a non-identical or different translation enhancement
sequence, and a non-identical or different termination
sequence.
[0120] In another preferred embodiment, separate non-identical
expression vectors that each contain an expression cassette for the
same polypeptide (or antigen) can be used to transform a plant
sequentially. Further, two transgenic plants that harbor
non-identical expression cassettes for the same polypeptide (or
antigen) can be sexually crossed to combine the two expression
cassettes within the genomes of selected progeny. Similarly,
breeding of different progeny lines, each containing multiple
non-identical expression cassettes for the same polypeptide (or
antigen) can yield even greater numbers of non-identical expression
cassettes within the genome of the same individual plant. Thus the
multiple expression cassettes need not be present on the same
expression vector, but can be introduced separately by either
sequential transformation or by sexual crossing.
[0121] Preferably, a plant expression vector of the invention
comprises at least 2, 3, 4, 5, 10, or more expression cassettes.
Each expression cassette can comprise the same polynucleotides or
different polynucleotides.
Transformation and Regeneration of Plants with Polynucleotides and
Expression Vectors
[0122] A further aspect of the present invention is a eukaryotic or
prokaryotic cell that comprises, e.g., is transformed with, a
polynucleotide of the invention or a expression cassette comprising
a polynucleotide of the invention. Preferably, the cell is a plant
cell, but other types of cells, such as insect, mammalian, and
bacterial cells are contemplated. Whenever a plant cell is
employed, it is preferred that the polynucleotide is integrated
into the nuclear genome of the plant cell to ensure its stability
and passage into the germline. A polynucleotide of the invention
can also in some cases be maintained outside the chromosome, such
as in the mitochondrion, chloroplast or cytoplasm. A preferred mode
of transfer of a polynucleotide to an insect cell is via viral
transport, where replication can be maintained extrachromosomally
or by integration. Methods of transfer of polynucleotides into
mammalian and bacterial cells are well known in the art.
[0123] A transformed plant cell is preferably one from a plant that
can be consumed as a foodstuff or that expresses the desired
protein or polypeptide in a readily isolateable form.
Representative plants include tobacco, banana, tomato, potato,
carrot, soybean, corn, rice, wheat, and sunflower. Particularly
preferred potato hosts include varieties "Desiree" and FL 1607
("Frito Lay 1607"), which can be obtained from Frito-Lay, Inc.,
Rhinelander, Wis. A preferred tomato line, TA234, can be obtained
from Steven Tanksley, Dept. of Plant Breeding, Cornell University,
Ithaca, N.Y. 14853. A transgenic plant seed transformed with a
polynucleotide of the invention, which is obtained by propagation
of a transgenic plant, is yet a further aspect of the
invention.
[0124] Among the principal methods for effecting transfer of
foreign nucleic acid constructs into plants is the A. tumefaciens
transformation technique. This method is based upon the etiologic
agent of crown gall, which afflicts a wide range of dicotyledons
and gymnosperms. Where the target plant host is susceptible to
infection, the A. tumefaciens system provides high rates of
transformation and predictable chromosome integration patterns.
[0125] Agrobacterium, which normally infects a plant at wound
sites, carries a large extrachromosomal element called Ti (tumor
inducing) plasmid. Ti plasmids contain two regions required for
tumor induction. One region is the T-DNA (transferred DNA), which
is the DNA sequence that is ultimately stably transferred to plant
genomic DNA. The other region is the vir (virulence) region, which
has been implicated in the transfer mechanism. Although the vir
region is required for stable transformation, the vir region DNA is
not transferred to the infected plant. Transformation of plant
cells mediated by infection with Agrobacterium and subsequent
transfer of the T-DNA have been well documented. Bevan et al., Int.
Rev. Genet. 16:357 (1982). The Agrobacterium system is well
developed and permits routine transformation of DNA into the plant
genome of a variety of plant tissues. For example, tobacco, tomato,
sunflower, cotton, rapeseed, potato, poplar, and soybean can be
transformed with the Agrobacterium system.
[0126] Preferably, where A. tumefaciens-mediated transformation of
plants with a polynucleotide of the invention is used, flanking
T-DNA border regions of A. tumefaciens are provided. T-DNA border
regions are 23-25 base pair direct repeats involved in the transfer
of T-DNA to the plant genome. The flanking T-DNA border regions
bracket the T-DNA and signal the polynucleotide that is to be
transferred and integrated into the plant genome. Preferably, a
polynucleotide or expression vector of the invention comprises at
least one T-DNA border, particularly the right T-DNA border.
Optionally, a polynucleotide to be delivered to a plant genome is
sandwiched between the left and right T-DNA borders. The borders
may be obtained from any Ti or Ri (see below) plasmid and may be
joined to an expression vector or polynucleotide by any
conventional means.
[0127] Typically, a vector containing the polynucleotide to be
transferred is first constructed and replicated in E. coli. This
vector contains at least one right T-DNA border region, and
preferably a left and right border region flanking the desired
polynucleotide. A selectable marker (such as a gene encoding
resistance to an antibiotic such as kanamycin) can also be present
to permit ready selection of transformed cells. The E. coli vector
is next transferred to Agrobacterium, which can be accomplished via
a conjugation mating system or by direct uptake. Once inside the
Agrobacterium, the vector containing the polynucleotide can undergo
homologous recombination with a Ti plasmid of the Agrobacterium to
incorporate the T-DNA into a Ti plasmid. A Ti plasmid contains a
set of inducible vir genes that effect transfer of the T-DNA to
plant cells.
[0128] Alternatively, the vector comprising the polynucleotide can
be subjected in trans to the vir genes of the Ti plasmids. In a
preferred aspect, a Ti plasmid of a given strain is "disarmed,"
whereby the onc genes of the T-DNA is eliminated or suppressed to
avoid formation of tumors in the transformed plant, but the vir
genes provided in trans still effect transfer of T-DNA to the plant
host. See, e.g., Hood, Transgenic Res. 2: 208-218 (1993); Simpson,
Plant Mol. Biol. 6: 403-415 (1986). For example, in a binary vector
system, an E. coli plasmid vector is constructed comprising a
polynucleotide of interest flanked by T-DNA border regions and a
selectable marker. The plasmid vector is transformed into E. coli
and the transformed E. coli is then mated to Agrobacterium by
conjugation. The recipient Agrobacterium contains a second Ti
plasmid (helper Ti plasmid) that contains vir genes, but has been
modified by removal of its T-DNA fragment. The helper Ti plasmid
will supply proteins necessary for plant cell infection, but only
the E. coli modified T-DNA plasmid will be transferred to the plant
cell.
[0129] The A. tumefaciens system permits routine transformation of
a variety of plant tissues. See, e.g., Chilton, Scientific American
248:50 (1983); Gelvin, Plant Physiol. 92: 281-285 (1990); Hooykaas,
Plant Mol Biol. 13: 327-336 (1992); Rogers et al., Science 227:
1229-1231 (1985). Representative plants that have been transformed
with this system and representative references are listed in Table
1. Other plants having edible parts, or which can be processed to
afford isolated protein, can be transformed by the same methods or
routine modifications thereof.
1TABLE 1 Plant Reference Tobacco Barton, K. et al., (1983) Cell 32,
1033 Tomato Fillatti, J. et al., (1987) Bio/Technology 5, 726-730
Potato Hoekema, A. et al., (1989) Bio/Technology 7: 273-278
Eggplant Filipponee, E. et al., (1989) Plant Cell Rep. 8: 370-373
Pepino Atkinson, R. et al., (1991) Plant Cell Rep. 10: 208-212 Yam
Shafer, W. et al., (1987) Nature. 327: 529-532 Soybean Delzer, B.,
et al., (1990) Crop Sci. 30: 320-322 Pea Hobbs, S. et al., (1989)
Plant Cell Rep. 8: 274-277 Sugar beet Kallerhoff, J. et al., (1990)
Plant Cell Rep. 9: 224-228 Lettuce Michelmore, R., et al., (1987)
Plant Cell Rep. 6: 439-442 Bell pepper Liu, W. et al., (1990) Plant
Cell Rep. 9: 360-364 Celery Liu, C-N. et al., (1992) Plant Mol.
Biol. 1071-1087 Carrot Liu, C-N. et al., (1992) Plant Mol. Biol.
1071-1087 Asparagus Delbriel, B. et al., (1993) Plant Cell Rep. 12:
129-132 Onion Dommisse, E. et al., (1990) Plant Sci. 69: 249-257
Grapevine Baribault, T., et al., (1989) Plant Cell Rep. 8: 137-140
Muskmelon Fang, G., et al., (1990) Plant Cell Rep. 9: 160-164
Strawberry Nehra, N. et al., (1990) Plant Cell Rep. 9: 10-13 Rice
Raineri, D. et al., (1990) Bio/Technology. 8: 33-38 Sunflower
Schrammeijer, B. et al., (1990) Plant Cell Rep. 9: 55-60 Rapeseed/
Pua, E. et al., (1987) Bio/Technology 5. 815 Canola Wheat Mooney,
P. et al., (1991) Plant Cell Tiss. Organ Cult. 25: 209-218 Oats
Donson, J. et al., (1988) Virology. 162: 248-250 Maize Gould, J. et
al., (1991) Plant Physiol. 95: 426-434 Alfalfa Chabaud, M. et al.,
(1988) Plant Cell Rep. 7: 512-516 Cotton Umbeck, P. et al., (1987)
Bio/Technology. 5: 263-266 Walnut McGranahan, G. et al., (1990)
Plant Cell Rep. 8: 512-516 Spruce/ Ellis, D. et al., (1989) Plant
Cell Rep. 8: 16-20 Conifer Poplar Pythoud, F. et al., (1987)
Bio/Technology 5:1323 Apple James, D. et al., (1989) Plant Cell
Rep. 7: 658-661
[0130] Other Agrobacterium strains such as A. rhizogenes can be
used as a vector for plant transformation. A. rhizogenes, which
incites root hair formation in many dicotyledonous plant species,
carries a large extra-chromosomal element called a Ri
(root-including) plasmid, which functions in a manner analogous to
the Ti plasmid of A. tumefaciens. Transformation using A.
rhizogenes has developed analogously to that of A. tumefaciens and
has been used successfully, e.g., to transform alfalfa and poplar.
Sukhapinda et al., Plant Mol. Biol. 8:209 (1987).
[0131] Methods of inoculation of the plant tissue vary depending
upon the plant species and the Agrobacterium delivery system. A
convenient approach is the leaf disc procedure which can be
performed with any tissue explant that provides a good source for
initiation of whole plant differentiation. The addition of nurse
tissue may be desirable under certain conditions. Other procedures
such as in vitro transformation of regenerating protoplasts with A.
tumefaciens may be followed to obtain transformed plant cells as
well.
[0132] Direct gene transfer procedures can be used to transform
plants and plant tissues without the use of Agrobacterium plasmids.
Potrykus, Bio/Technology. 8:535-542 (1990); Smith et al. Crop Sci.,
35: 01-309 (1995). Direct transformation involves the uptake of
exogenous genetic material into plant cells or protoplasts. Such
uptake can be enhanced by use of chemical agents or electric
fields. For example, a polynucleotide of the invention can be
transformed into protoplasts of a plant by treatment of the
protoplasts with an electric pulse in the presence of the
protoplast using electroporation. For electroporation, the
protoplasts are isolated and suspended in a mannitol solution.
Supercoiled or circular plasmid DNA comprising a polynucleotide of
the invention is added. The solution is mixed and subjected to a
pulse of about 400 V/cm at room temperature for about 10 to 100
microseconds. A reversible physical breakdown of the membrane
occurs such that the foreign genetic material is transferred into
the protoplasts. The foreign genetic material can then be
integrated into the nuclear genome. Several monocot protoplasts
have also been transformed by this procedure including rice and
maize.
[0133] Liposome fusion is also an effective method for
transformation of plant cells. In this method, protoplasts are
brought together with liposomes carrying a polynucleotide of the
invention. As the membranes merge, the foreign gene is transferred
to the protoplasts. Dehayes et al., EMBO J. 4:2731 (1985).
Similarly, direct gene transfer using polyethylene glycol (PEG)
mediated transformation has been carried out in N. tabacum (a
dicot) and Lolium multiflorum (a monocot). Direct gene transfer is
effected by the synergistic interaction between Mg.sup.+2, PEG, and
possibly Ca.sup.+2. Negrutiu et al., Plant Mol. Biol. 8: 363
(1987). Alternatively, exogenous DNA can be introduced into cells
or protoplasts by microinjection of a solution of plasmid DNA
comprising a polynucleotide of the invention directly into the cell
with a finely pulled glass needle.
[0134] Direct gene transfer can also be accomplished by particle
bombardment (or microparticle acceleration), which involves
bombardment of plant cells by microprojectiles carrying a
polynucleotide of the invention. Klein et al., Nature 327:70
(1987); Sanford, Physiol. Plant. 79: 206-209 (1990). In this
procedure, chemically inert metal particles, such as tungsten or
gold, are coated with a polynucleotide of the invention and
accelerated toward the target plant cells. The particles penetrate
the cells, carrying with them the coated polynucleotide.
Microparticle acceleration has been shown to lead to both transient
expression and stable expression in cells suspended in cultures,
protoplasts, and immature embryos of plants, including onion,
maize, soybean, and tobacco. McCabe et al., Bio/Technology. 6: 923
(1988).
[0135] Additionally, DNA viruses can be used as gene vectors in
plants. For example, a cauliflower mosaic virus carrying a modified
bacterial methotrexate-resistance gene has been used to infect a
plant. The foreign gene systematically spreads throughout the
plant. Brisson et al., Nature 310:511 (1984). The advantages of
this system are the ease of infection, systemic spread within the
plant, and multiple copies of the gene per cell.
[0136] Once plant cells have been transformed, there are a variety
of methods for regenerating plants. The particular method of
regeneration will depend on the starting plant tissue and the
particular plant species to be regenerated. Many plants can be
regenerated from callus tissue derived from plant explants,
including, but not limited to corn, rice, barley, wheat, rye,
sunflower, soybean, cotton, rapeseed, and tobacco. Regeneration of
plants from tissue transformed with A. tumefaciens has been
demonstrated in plants including, but not limited to sunflower,
tomato, white clover, rapeseed, cotton, tobacco, potato, maize,
rice, and numerous vegetable crops. Plant regeneration from
protoplasts is a particularly useful technique and has been
demonstrated in plants including, but not limited to tobacco,
potato, poplar, corn, and soybean. Evans et al., Handbook of Plant
Cell Culture 1, 124 (1983).
[0137] Preliminary studies of transformation protocols, and the
like, can be explored through the use of a reporter gene to gauge
the efficiency of expression afforded by a given construct.
Exemplary reporter genes encode .beta.-glucuronidase (GUS),
chloramphenicol acetyl transferase, .beta.-galactosidase, green
fluorescent protein, and luciferase. Plant cells transformed with a
reporter gene or polynucleotide of the present invention can be
assayed for levels of expression in a number of ways. For instance,
standard Southern or Northern blotting, PCR, and immunoassay
techniques can be performed on selected plant tissues.
Plants Expressing the Immunogenic Polypeptides of the Invention
[0138] The invention includes whole plants, plant cells, plant
organs, plant tissues, plant seeds, protoplasts, callus, cell
cultures, and any group of plant cells organized into structural
and/or functional units capable of expressing at least a
polynucleotide of the invention. Preferably, whole plants, plant
cells, plant organs, plant tissues, plant seeds, protoplasts,
callus, cell cultures, and any group of plant cells produce at
least 0.001, 0.01, 1, 5, 10, 25, 50, 100, 500, or 1000 .mu.g of
polypeptide of the invention per gram of total soluble plant
material. Preferably, a plant used in accordance with the invention
should contain at least 5 .mu.g and preferably from about 7 .mu.g
to about 15 .mu.g of HBsAg per gram of plant material to be
ingested. The animal, e.g. a human, will usually ingest sufficient
plant material to provide from about 2 to about 5 grams of plant
material per kilogram of body weight. The invention further
comprises immunogenic polypeptides of the invention, such as HBsAg,
isolated, purified, or partially purified from the plant cells, or
plant tissue in which they were produced.
[0139] Extracts of plant tissue can be assayed for expression of
immunogenic polypeptides by ELISA. Briefly, an antibody in buffer
to the immunogenic polypeptide can be coated on, using various
techniques, for example, polystyrene ELISA plates. After an
approximately 1 hour incubation at room temperature the buffer is
washed off with for example, PBS and the wells blocked for
non-specific binding with 5% milk in PBS. Plant extract samples to
be assayed are loaded into the wells. To obtain a standard curve
for quantification of the immunogenic polypeptides different
dilutions of bacterially derived immunogenic polypeptides can be
loaded on the same plate. The plates are washed with buffer after 1
hour incubation at room temperature. Anti-serum, such as
oat-antiserum or rabbit antiserum to the immunogenic polypeptide,
are diluted in buffer and BSA and incubated in the well for 1 hour
at room temperature. After washing 4 times with buffer, the wells
are probed with, for example rabbit antiserum against goat IgG
conjugated with alkaline phosphatase diluted in buffer and BSA.
After washing with buffer, the wells are incubated with nitrophenyl
phosphate substrate in diethanolamime buffer. After incubation for
10-30 minutes the reaction is stopped by adding NaOH and the
absorbance read at 410 nm.
[0140] The toxic effect of the polypeptides of the invention on a
plant in which the polypeptides are produced can be tested by
comparing the growth of plants producing the polypeptides of the
invention to plants that do not produce the polypeptides.
Preferably, plants producing the polypeptides of the invention have
a same or similar rate of growth as plants that do not produce the
polypeptides.
Compositions Comprising Immunogenic Polypeptides of the
Invention
[0141] The invention provides immunogenic polypeptide compositions,
such as HBsAg in whole plants, plant cells, plant organs, plant
seeds, protoplasts, callus, cell cultures, and any group of plant
cells organized into structural and/or functional units capable of
expressing at least a polynucleotide of the invention. The plant
matter, such as leaves, fruit, and tubers, is preferably
administered to a human or animal orally. The invention further
comprises immunogenic polypeptides of the invention that have been
isolated, processed, purified, or partially purified from the plant
cells, or plant tissue in which they were produced. For example,
The plant material can be extracted, ground, pulverized,
desiccated, homogenized, and the like, to produce a final product
in the form of, for example, an extract, juice, liquid, powder,
tablet. It is particularly advantageous in certain disease
prevention protocols for human infants to produce a vaccine in a
juice for ease of administration such as juice of tomato, soybean,
and carrot, or milk. The plant material can alternatively be
processed in a way that renders it more palatable through the
addition of flavor components. It may also be processed so as to
concentrate or purify the antigenic components of the plant in
order to enhance the immunogenic effect of the composition.
Although it is generally not preferred to do so, extracts of the
plant material can be obtained, sterilized, and reconstituted as an
injectable liquid, which can be administered parenterally if
desired.
[0142] Preferably, any processing steps used to concentrate or
condition the plant material avoids significant denaturing of the
immunogenic polypeptides, e.g. HBsAg particles, so that antigenic
properties are not lost. The likely immunogenic properties of the
composition can be tested ex vivo by screening with anti-HBsAg
antibodies. The invention also provides compositions comprising
polynucleotides of the invention.
[0143] Compositions of the invention can comprise a
pharmaceutically acceptable carrier. The carrier should not itself
induce the production of antibodies harmful to the host.
Pharmaceutically acceptable carriers are well known to those in the
art. Such carriers include, but are not limited to, large, slowly
metabolized, macromolecules, such as proteins, polysaccharides such
as latex functionalized sepharose, agarose, cellulose, cellulose
beads and the like, polylactic acids, polyglycolic acids, polymeric
amino acids such as polyglutamic acid, polylysine, and the like,
animo acid copolymers, peptoids, lipitoids, and inactive virus
particles.
[0144] Pharmaceutically acceptable salts can also be used in
compositions of the invention, for example, mineral salts such as
hydrochlorides, hydrobromides, phosphates, or sulfates, as well as
salts of organic acids such as acetates, proprionates, malonates,
or benzoates. Especially useful protein substrates are serum
albumins, keyhole limpet hemocyanin, immunoglobulin molecules,
thyroglobulin, ovalbumin, tetanus toxoid, and other proteins well
known to those of skill in the art. Compositions of the invention
can also contain liquids or excipients, such as water, saline,
glycerol, dextrose, malodextrin, ethanol, or the like, singly or in
combination, as well as substances such as wetting agents,
emulsifying agents, or pH buffering agents. Liposomes can also be
used as a carrier for a composition of the invention.
[0145] If desired, co-stimulatory molecules, which improve
immunogen presentation to lymphocytes, such as B7-1 or B7-2, or
cytokines such as IL-2, and IL-12, can be included in a composition
of the invention. Optionally, adjuvants can also be included in a
composition. Adjuvants which can be used include, but are not
limited to MF59-0, aluminum hydroxide,
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637), referred
to as nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dil-
palmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP
19835A, referred to as MTP-PE) bacterial plasmid DNA, anti-HB
antibody, oligodeoxynucleotides containing immunostimulatory CpG,
lypophilic derivative of muramyl dipeptide (MDP-Lys (L18)),
aluminum phosphate or aluminum sulfate, core protein of hepatitis
C, and RIBI, which contains three components extracted from
bacteria, monophosphoryl lipid a, trehalose dimycolate and cell
wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion.
[0146] Preferred adjuvants include cholera toxin (CT), E. coli
heat-labile enterotoxin (LT), anti-idiotypic antibody 2F10,
colonization factor, shiga-like toxin, intimin, monophosphoryl
lipid a, OPTIVAX (U.S. Pat. No. 5,622,649), outer surface protein a
(OspA), sodium fluoride, chitosan, subunits thereof, and mutants
thereof. (Clements et al., Vaccine. 6:269-277 (1988); de Haan et
al., Vaccine. 14: 260-266 (1996); De Magistris, "Non-toxic
derivatives of heat-labile toxins act as mucosal adjuvants,"
Mucosal Immunization: Genetic Approaches & Adjuvants. IBC
Biomedical Library, Southborough, Mass., pp. 1.8.1-1.8.12 (Based on
a presentation at the IBC Conference, Oct. 16-18, 1995, Rockville,
Md.) 1996; Dickinson et al., Infect. Immun. 63:1617-1623 (1995); Di
Tommaso et al. Infect. Immun. 64: 974-979 (1996); Fontana et al.,
Infect. Immun. 63: 2356-2360 (1995); Holmgren et al. Vaccine,
11:1179-1184 (1993); Nedrud et al. Reg. Immunol, 3:217-222 (1991);
Pride et al., J. Exp. Med. 177:127-134 (1993); and U.S. patents to
Thanavala et al.)
[0147] The adjuvant can be provided concurrently with, or shortly
before or after, provision of the immunogenic composition. Also,
the adjuvant can be provided integrally with the immunogenic
composition, e.g., as a coexpressed product of the transgenic
plant, or it can be provided separately in a convenient form, e.g.,
as a liquid, to be taken with the product. Preferably, the adjuvant
is an immunologically acceptable adjuvant, i.e., one that promotes
an immune response without serious deleterious effect.
[0148] The compositions of the invention can comprise a sustained
release formulation, enteric formulations, tablets, chewable
tablets, capsules, solutions, parenteral solutions, intranasal
sprays or powders, troches, suppositories, transdermal patches and
suspensions. In general, compositions contain at least 0.01, 0.1,
1, 3, 5, 10, 20, 30, 40, 50, 60, 70, or 80% of the polypeptides or
polynucleotides of the invention in total, depending on the desired
doses and the type of composition to be used.
Method of Eliciting an Immune Response
[0149] Immunogenic polypeptides of the invention can be used to
elicit an immune response in animals such as cattle, swine, mice,
guinea pigs, rabbits, fowl, such as chickens, ducks, and geese,
chimpanzees, baboons, and macaques, and in humans. Preferably, the
immunogenic polypeptides of the invention elicit IgG and/or IgA
antibodies (see examples 21 and 23) and/or a cell-mediated immune
response (see example 24).
[0150] In a preferred aspect, an immunogenic polypeptide of the
invention is a mucosal immunogen, such as HBsAg. For the purposes
of the invention, a mucosal immunogen is one that has the ability
to specifically prime the mucosal immune system. In an even more
preferred embodiment, a mucosal immunogen of the invention is one
that primes the mucosal immune system and/or stimulates the humoral
immune response in a dose-dependent manner, without inducing
systemic tolerance and without the need for excessive doses of
antigen. Systemic tolerance is defined herein as a phenomenon
occurring with certain antigens which are repeatedly fed to a
mammal resulting in a specifically diminished subsequent
anti-antigen response.
[0151] A mucosal response to an immunogen of the invention is
understood to include any response generated when the immunogen
stimulates the mucosal immune system. Typically, the gut-associated
lymphoid tissue (GALT) will be activated by feeding of the
immunogen orally to a subject mammal. Using this route of
introduction of the immunogen to the mucosal membranes provides
access to the small intestine M cells which overlie the Peyer's
Patches and other lymphoid clusters of the GALT. However, any
mucosal membrane accessible for contact with an immunogen of the
invention is specifically included within the definition of such
membranes (e.g., mucosal membranes of the air passages accessible
by inhaling, mucosal membranes of the terminal portions of the
large intestine accessible by suppository, etc.).
[0152] Elicitation of antibodies by the immunogenic polypeptides of
the invention can be used, inter alia, to provide model systems to
optimize, for example anti-HBsAg antibody responses to HBV and to
provide prophylactic or therapeutic treatment against HBV, or other
bacteria, viruses or protozoans. For example, detection and/or
quantification of anti-HBsAg antibody titers after delivery of an
HBsAg polypeptide can be used to identify HBsAg epitopes that are
particularly effective at eliciting anti-HBsAg antibody titers.
HBsAg epitopes responsible for a strong HBsAg antibody response
against HBV can be identified by eliciting HBsAg antibodies
directed against HBsAg polypeptides of different lengths.
Anti-HBsAg antibodies elicited by a particular HBsAg polypeptide
epitope can then be tested using an anti-HBV ELISA assay to
determine which polypeptides contain epitopes that are most
effective at generating a strong response. HBsAg polypeptides or
fusion proteins which contain these epitopes or polynucleotides
encoding the epitopes can then be constructed and used to elicit a
strong HBsAg antibody response.
[0153] An immunogenic polypeptide can be administered to an animal
or human to elicit an immune response in vivo. Oral delivery of an
immunogenic polypeptide is preferred. Administration of a
polypeptide can be by any means known in the art, including oral,
intramuscular, intradermal, intraperitoneal, or subcutaneous
injection, including injection using a biological ballistic gun
("gene gun"). Administration may also be intranasal. Preferably, an
immunogenic polypeptide is accompanied by a protein carrier for
oral administration. A combination of administration methods may
also be used to elicit an anti-HBsAg immune response. For example,
one dose of the immunogenic composition may be administered by one
route, such as oral, while another dose or booster may be
administered by transdermal, subcutaneous, intravenous,
intramuscular, intranasal, or intrarectal route.
[0154] A composition of the invention comprising an immunogenic
polypeptide, or a combination thereof is administered in a manner
compatible with the particular composition used and in an amount
which is effective to elicit an immune response to the immunogenic
polypeptide, for example an anti-HBsAg antibody titer as detected
by an ELISA.
[0155] The particular dosages of an antigenic composition of the
invention will depend on many factors including, but not limited to
the species, age, and general condition of the human or animal to
which the composition is administered, and the mode of
administration of the composition. An effective amount of the
composition of the invention can be readily determined using only
routine experimentation. In vitro and in vivo models described
herein can be employed to identify appropriate doses. Generally, at
least 0.001, 0.001, 0.1, 1.0, 1.5, 2.0, 5, or 10 mg/kg of an
antigen will be administered to a large mammal, such as a baboon,
chimpanzee, or human. Preferably, 10-100 .mu.g/kg is administered.
If desired, co-stimulatory molecules or adjuvants can also be
provided before, after, or together with the antigenic
compositions. Immunogenic polypeptides of the invention can be
administered therapeutically or prophylactically. Generally, it is
desired that the amount of plant or portion thereof to be consumed
be sufficient to provide an amount of immunogenic polypeptide, such
as HBsAg, comprises at least 0.1, 1, 2, 5, 10, 50, 100, 500 .mu.g/g
of food consumed by the animal or human. Further, extracts of the
plant material can be prepared and/or concentrated to increase the
amount of polypeptide per gram of prepared or concentrated food
material, which can then be consumed. Immune responses, including
elicitation of IgG and/or IgA antibodies and/or a cell mediated
immune response, in an animal or human generated by the delivery of
a composition of the invention can be enhanced by varying the
dosage, route of administration, or boosting regimens. Compositions
of the invention may be given in a single dose schedule, or
preferably in a multiple dose schedule in which a primary course of
vaccination includes 1-10 separate doses, followed by other doses
given at subsequent time intervals required to maintain and/or
reenforce an immune response, for example, at 1-4 months for a
second dose, and if needed, a subsequent dose or doses after
several months. Preferably, at least one of these administrations
is performed orally to elicit a mucosal immune response as well as
to take advantage of cost and convenience. Oral administration
comprises consuming a transgenic plant or plant part of the
invention. Preferably a series of ingestions of the plant material
is undertaken, e.g. a series of three four, five, ten, or more,
each ingestion being separated by at least three, and preferably by
at least about seven to fourteen days.
[0156] Administration of immunogenic polypeptides can elicit an
antibody titer and/or cellular immune response in the animal or
human that lasts for at least 1 week, 2 weeks, 1 month, 2 months, 3
months, 4 months, 6 months, 1 year, or longer. Optionally, an
immune response can be maintained in an animal or human by
providing one or more booster injections of the immunogenic
polypeptide at 1 month, 2 months, 3 months, 4 months, 5 months, 6
months, 1 year, or more after the primary administration.
Optionally, the administration of the polypeptides of the invention
as plant matter or foodstuff is used as a booster after a primary
injection of a composition that elicits an immune response. A
desired immunization regimen can include administering one or more
booster amounts of the present antigenic complex in order to
increase the immune response of the subject. Accordingly,
administration of an instant transgenic plant as a primary
immunogen, or as a "booster" to the same or other immunogen, is
contemplated. For instance, the results of administering transgenic
potato slices with CT adjuvant, followed 7-16 weeks later with
yeast-derived rHBsAg (commercial) administered i.p. or s.c. are
shown in FIGS. 4A-E. Similarly, transgenic potato and CT can be
administered as a booster to an initial immunization with rHBsAg,
with antibody titers being increased. Initially, an oral booster
vaccine for use with individuals who have been primed by parenteral
administration of current vaccines is demonstrated. More preferred
is an oral vaccine that can be used alone in a vaccination regime
for effective protection. The frequency and amount of complex
consumed should not be so great as to provoke toleration of the
antigen, and this condition can be determined through routine
experimentation.
[0157] To determine the immunogenicity of plant-derived immunogenic
polypeptides of the invention when fed orally, extracts or plant
tissues from plants expressing the immunogenic polypeptides of the
invention can be fed to animals, such as mice or humans. For
example, one group of mice can be fed an extract of a plant or a
plant tissue where the plant expresses a polypeptide of the
invention. Another group of mice can be given recombinant
polypeptides purified from E. coli expressing the same antigen from
a recombinant plasmid. Serum and mucosal antibody responses can be
examined by ELISA.
[0158] It is known that HBsAg antibody titers of 10 mIU/mL are
protective in humans. It is recommended that current vaccines
generate antibody titers of at least 100 mIU/mL to allow for a
decline in titers with time. Preferably, a primary immune response
elicited by an HBsAg immunogenic polypeptide of the invention
achieves an anti-HBsAg serum antibody level greater than 50 mIU/mL
in four or less feedings. Where the compositions of the invention
serve as a booster it is preferred that the anti-HBsAg serum
antibody level increases at least four fold or greater than 500
mIU/mL in four or less feedings.
[0159] In oral HBsAg immunization studies, cholera toxin (CT, 10
.mu.g/dose) or LT has been used as an adjuvant. For example, CT is
placed onto potato tuber slices expressing the HBsAg and consumed
by animals in conjunction with the antigen. The CT is effective in
enhancing the immune response associated with HBsAg. Preliminary
data indicate that CT is a more effective oral adjuvant for HBsAg
than the E. coli heat labile toxin LT.sub.R192G mutant developed by
John Clements of Tulane University. Significantly, secretory IgA
antibodies can be detected following feeding of recombinant tubers;
which are not elicited with parenteral administration of HBsAg.
[0160] Illustrative of the invention is the feeding of mice with 5
g of recombinant potato coated with 10 .mu.g CT three times at
weekly intervals. This program gives peak antibody titers of 70-110
mIU/mL, which can be boosted to titers of 1700-3400 mIU/mL by a
single sub-immunogenic i.p. dose of HBsAg purified from recombinant
yeast (Merck). The actual titers measured are correlated to HBsAg
expression levels in potato. The level of dose response is
dose-related with potatoes delivering 1.1 .mu.g/g HBsAg giving a
lower and less prolonged response than potatoes delivering 8.3
.mu.g/g. The same feeding regime is found to boost a single s.c.
dose of HBsAg purified from recombinant yeast to give peak antibody
titers of 1000 mIU/mL. Boiled tubers (5 min, 100.degree. C.) gave
no detectable immune response but a significant boost was observed
on subsequent administration of a single i.p. dose of HBsAg
purified from recombinant yeast.
[0161] The following are provided for exemplification purposes only
and are not intended to limit the scope of the invention described
in broad terms above. All references cited in this disclosure are
incorporated herein by reference.
EXAMPLES
Example 1
Construction of HB101 and HB102 Vectors
[0162] pHB101: The HBsAg coding region on the Pst I/HindIII
fragment from pMT-SA (kindly provided by Li-he Guo, Chinese Academy
of Sciences) was subcloned into pBluescript KS (Stratagene) to form
pKS-HBS. The HBsAg gene in pKS-HBS was opened 116 base pairs (bp)
3' to the termination codon with BstBI and the resulting ends were
blunted by filling with Klenow enzyme and dCTP/dGTP. The entire
coding region was then excised 16 bp upstream of the Pst I site
with BamHI. pBI121 (Clontech Laboratories, Palo Alto, Calif.) was
digested with Sac I and the ends were blunted with mung bean
nuclease. The GUS coding region was then released with BamHI and
the vector was isolated. The HBsAg coding fragment was ligated into
the GUS-less pBI121 to yield pHB101, where its expression is driven
by the cauliflower mosaic virus (CaMV) promoter derived from
pBI121.
[0163] pHB102 (FIG. 1A): The CaMV 35S promoter with duplicated
enhancer linked to the tobacco etch virus (TEV) 5' untranslated
leader sequence, which acts as a translational enhancer
(Carrington, et al. J. Virol., 64:1590-1597 (1990), was excised
from pRTL2-GUS (Carrington et al. Plant Cell 3:953-962 (1991)) as
follows. pRTL2-GUS was digested with Nco I and the ends were
blunted with mung bean nuclease. The promoter-leader fragment was
then released by digestion with HindIII. pHB101 was digested with
HindIII and Sma I to release the 35S promoter fragment, and the
vector was purified. The promoter-leader fragment was then ligated
into the HindIII/Sma I-digested pHB101 to yield pHB102. The HBsAg
coding region lies upstream of the nopaline synthase terminator in
both constructs. The plasmids contain the left and right border
regions, which denote the limits of the DNA that is integrated into
the plant genomic DNA via Agrobacterium tumefaciens-mediated
transformation, as well as the neomycin phosphotransferase gene,
which allows selection with kanamycin.
Example 2
Deletion from HB102 of Native 5' and 3' Untranslated Regions of
HBsAg cDNA
[0164] pHB103 (FIG. 1A): Construction of plasmid HB102 is described
above and in Mason, H., et al. (1992). Deletion of selected viral
untranslated sequences was observed to improve accumulation of the
recombinant protein in plants. Thus, construct HB103 is identical
to HB102 except for deletion of the noncoding viral sequences,
which might decrease transcription rate or translation efficiency.
The HBsAg coding region from plasmid pKS-HBS (Mason et al., 1992)
was amplified by PCR with the oligos HBNco ( 5'
CATGCCATGGAGAACACAACATCA GG 3') (SEQ ID NO:7) and HBSac (5' GCC GGA
GCT CAA ATG TAT ACC CAA AGA CA 3')(SEQ ID NO:8). These introduced
an NcoI site at the start codon and a SacI site at the stop codon
of the coding region. The PCR fragment was cloned using the NcoI
and SacI sites into the intermediate vector designated pIBT210.1
(Haq et al., Science 268:714-716 (1995)), which resulted in the
plasmid pIBT210.1HBsC#10.
[0165] The XhoI to SacI fragment from pIBT210.1HBsC#10 was
subcloned into pBluescript SK+ to create the intermediate
pBSSKHBsC#6. The unmodified XhoI to SacI fragment was subcloned
into pIBT211.1 to form the intermediate pIBT211.1HBsC#9. Vector
pIBT211.1 was made by ligation of the Nos terminator fragment
obtained by digestion of pBI101 (Clontech; Jefferson et al., EMBO
J. 13:3901-3907 (1987)) with SacI and EcoRI into the same sites of
pIBT210.1, with elimination of the VSP terminator. The
HindIII/EcoRI fragment from pIBT211.1HBsC#9 was subcloned into the
plant transformation vector pBI101 to create pHB103. This plasmid
contains the 35S promoter with duplicated enhancer, TEV leader,
HBsAg coding region, and Nos terminator between the HindIII and
EcoRI sites. The expression cassette and restriction map of HB103
are shown in FIG. 1A and FIG. 2A, respectively.
Example 3
Modifications of HB103
[0166] The following constructs are all modifications of HB103 in
which a 35S promoter is operably linked to native virus-derived
(wild-type) HBsAg cDNA. Relevant cassettes are shown in FIG.
1A.
35S-TEV-HBsAg-SEKDEL-NOS Construct
[0167] pHB105 (FIG. 1A) contains a deletion of the C-terminal Ile
codon of the HBsAg coding sequence and an insertion encoding the
C-terminal extension SEKDEL (SEQ ID NO:4). An intermediate clone
was constructed by a three-fragment ligation consisting of the XhoI
to AccI fragment from pIBT210.1HBsC#10, the AccI to SacI fragment
obtained by annealing two oligonucleotides: (aSEKDELs-F:
5'ATACTCTGAGAAAGATGAGCTATGAGAGCT3' (SEQ ID NO:9) and aSEKDELs-R: 5'
CTCATAGCTCATCTTTCTCAGAGT 3' (SEQ ID NO:10) with a XhoI to SacI
fragment of pBluescript SK+. The resulting plasmid, pBSSKHBsCK#3,
was subcloned as described above for pHB 103 by the XhoI/SacI
fragment into pIBT211.1, and then the HindIII/EcoRI fragment into
pBI101 to give pHB105.
35 S-TEV-VSP.alpha.S-HBsAg-NOS Construct
[0168] pHB106 (FIG. 1A) contains an insertion encoding the soybean
VSP ".alpha.S" signal peptide (Mason et al., 1988), creating an
N-terminal extension of the HBsAg coding sequence with 21 amino
acids encoded by:
CCATGGCAATGAAGGTCCTTGTTTTCTTCGTTGCTACAATTTTGGTAGCATG GCAATGCCATACC
(SEQ ID NO:11). pBSSKHBsC#6 was digested with NcoI and ligated with
the 67 bp NcoI fragment from pVSP-alpha-Sig-GUS (DeWald, Ph.D.
Thesis, Dept. of Biochemistry & Biophysics, Texas A&M
University, College Station, Tex. (1992)). The resulting plasmid,
pSKHBsC-alphaS#90, was subcloned as described above for pHB103 by
the XhoI/SacI fragment into pIBT211.1, and then the HindIII/EcoRI
fragment into pBI101 to give pHB106.
35S-TEV-VSP.alpha.L-HBsAg-NOS Construct
[0169] pHB107 (FIG. 1A) contains an insertion encoding the soybean
VSP ".alpha.L" signal peptide (Mason et al., 1988), creating an
N-terminal extension of the HBsAg coding sequence with 34 amino
acids encoded by: CCATGGCAATGAAGGTCCTTGTTTTCTTCGTTGCTACAATTTTGGTA
GCATGGCAATGCCATGCGTA CGATATGTTCCCTCTCCGAATGAACACTGGCTATGGTGCC (SEQ
ID NO:12). pBSSKHBsC#6 was digested with NcoI and ligated with the
106 bp NcoI fragment from pVSP-alpha-Leader-GUS (DeWald, 1992). The
resulting plasmid, pSKHBsC-alphaL#L1, was subcloned as described
above for pHB103 by the XhoI/SacI fragment into pIBT211.1, and then
the HindIII/EcoRI fragment into pBI101 to give pHB107.
35S-TEV-VSP.alpha.S-HBsAg-SEKDEL-NOS Construct
[0170] pHB108 contains an insertion into pHB105 encoding the
soybean VSP ".alpha.S" signal peptide (Mason et al., 1988),
creating an N-terminal extension of the HBsAg coding sequence with
21 amino acids encoded by:
CCATGGCAATGAAGGTCCTTGTTTTCTTCGTTGCTACAATTTTGGT AGCATGGCAATGCCATACC
(SEQ ID NO:13). pBSSKHBsCK#3 was digested with NcoI and ligated
with the 67 bp NcoI fragment from pVSP-alpha-Sig-GUS (DeWald,
1992). The resulting plasmid, pSKHBsCKalphaS#23, was subcloned as
described above for pHB103 by the XhoI/SacI fragment into
pIBT211.1, and then the HindIII/EcoRI fragment into pBI101 to give
pHB 108.
35S-TEV-VSP.alpha.L-HBsAg-SEKDEL-NOS Construct
[0171] pHB109 contains an insertion into pHB105 encoding the
soybean VSP ".alpha.L" signal peptide (Mason et al., 1988),
creating an N-terminal extension of the HBsAg coding sequence with
34 amino acids encoded by: CCATGGCAATGAAGGTCCTTGTTTTCTTCGTT
GCTACAATTTTGGTAGCATGGCAATGCCATGCGTACGATA-
TGTTCCCTCTCCGAATGAACACTGGCT ATGGTGCC (SEQ ID NO:14). pBSSKHBsCK#3
was digested with NcoI and ligated with the 106 bp NcoI fragment
from pVSP-alpha-Leader-GUS (DeWald, 1992). The resulting plasmid,
pSKHBsCKalphaL#29, was subcloned as described above for pHB103 by
the XhoI/SacI fragment into pIBT211.1, and then the HindIII/EcoRI
fragment into pBI101 to give pHB109.
35S-TEV-TPSS-HBsAg-NOS Construct
[0172] pHB110 (FIG. 1A) contains an insertion into pHB103 encoding
the transit peptide and partial mature peptide from the N-terminus
of pea rbcS (Nawrath et al., "Plastid targeting of the enzymes
required for the production of polyhydroxybutyrate in higher
plants," In "Biodegradable Plastics and Polymers, eds. Doi Y,
Fukuda K, Elsevier, Amsterdam, pp. 136-149 (1994)), creating an
N-terminal extension of the HBsAg coding sequence with 82 amino
acids encoded by:
[0173]
ccatggcttctatgatatcttcttccgctgtgacaacagtcagccgtgcctctagggggcaatccgc-
cgcaatggctccattcggcggc
ctcaaatccatgactggattcccagtgaagaaggtcaacacttgacattac-
ttccattacaagcaatggtggaagagtaaagtgcatgcaggtgtg
gcctccaattggaaagaagaagtttgag-
actctttcctatttgccaccattgaccagagattccatgg (SEQ ID NO:15).
[0174] pUC-TPSS (Nawrath et al., 1994) was subjected to PCR with
the primers 5'TPSS (5'-GGATCCATGGCTTCTATGATATCTT-3' (SEQ ID NO:16))
and 3'TPSS (5'-GGATCCATGGAATCTCTGGT CAATGGTGG-3' (SEQ ID NO:17))
that were designed to add NcoI sites to each end of the rbcS
sequence. pBSSKHBsC#6 was digested with NcoI and ligated with the
NcoI-digested PCR product containing the TPSS coding region. The
resulting plasmid, pHB211.1TPSS#23, was subcloned as described
above for pHB 103 by the XhoI/SacI fragment into pIBT211.1, and
then the HindIII/EcoRI fragment into pGPTV-Kan (Becker et al.,
1992) to give pHB110.
Example 4
Alternative Termination Sequences Affect Protein Accumulation
[0175] The constructs discussed in Example 3 contain the tobacco
etch virus (TEV) untranslated leader and the nos 3' end. Vectors
pHB104 (FIG. 1A) and pHB114 (FIG. 1A), respectively, contain the
vsp and pin2 3' terminal ends instead of the nos 3' end. These
vectors displayed a higher level of protein accumulation per mRNA
than HB103. pHB104 was obtained by subcloning the fragment from
SacI to EcoRI from pIBT210.1HBsC#10 into pHB103 to replace the Nos
terminator with the VSP terminator. The expression cassettes are
shown in FIG. 1.
[0176] pHB114 contains the 400 bp potato pin2 terminator (An et
al., 1989). pDP687 (Pioneer Hi-Bred International; Johnson City,
Iowa) was digested with BamHI and EcoRI and the 400 bp pin2
terminator subcloned into pBluescriptKS. The resulting pBlueKS-pin2
was digested with SacI and EcoRI to obtain the pin2 terminator
fragment, which was ligated with pHB103 digested with SacI and
EcoRI to form pHB114.
Example 5
Construct with TMV .OMEGA. Leader
[0177] pHB111 (FIG. 1A) contains the tobacco mosaic virus ".OMEGA."
UTR (Gallie et al., 1992) instead of the TEV UTR. An EcoRV/XhoI
fragment from plasmid pBSG660 (Biosource Technologies, Inc.,
Vacaville, Calif.) containing the 3' end of the 35S promoter and
the .OMEGA.-UTR was subcloned into the EcoRV/Xho I sites of
pIBT211.1HBsC#9 to create the intermediate plasmid
pHB211.OMEGA.-5'. In order to delete the TEV leader,
pHB211.OMEGA.-5' was digested with XhoI and NcoI, followed by mung
bean nuclease to blunt the ends, and blunt ligation. The resulting
plasmid pHB211 was digested with HindIII to EcoRI and the
expression cassette was cloned into pGPTV-KAN (Becker et al. 1992)
to give pHB111.
Example 6
Alternative Promoter Sequences
[0178] The 35S promoter from cauliflower mosaic virus is a strong
constitutive promoter that expresses in almost all plant tissues.
Other promoters tested are the promoter for patatin, which is the
major storage protein in potato, and the promoter for granule bound
starch synthase (GBSS). Both promoters drive strong expression in
the tuber. These constructs are identified as HB145 (FIG. 1A) and
HB165 (FIG. 1A) and shown in FIG. 1. Microtuber formation must be
induced to test expression levels because leaf tissue cannot be
analyzed with these constructs.
A. Patatin-TEV-HBsAg-SEKDEL-NOS Construct
[0179] pHB145 contains the potato tuber-specific patatin gene
promoter in place of the CaMV 35S promoter in pHB105. pIBT240.1 was
obtained by subcloning the HindIII/BamHI patatin fragment from
pPS20-GUS (Wenzler et al., Plant Mol. Biol., 12:41-50 (1989) into
the HindIII/XhoI sites of pIBT210.1. The NcoI/SacI fragment from
pBSSKHBsCK#3 was ligated to pIBT240.1 digested with NcoI and SacI,
and the HindIII to EcoRI fragment of the resulting plasmid was
subcloned into pBI101 to give pHB145.
B. GBSS-TEV-HBsAg-SEKDEL-NOS Construct
[0180] pHB165 contains the tuber-specific granule-bound starch
synthase (GBSS) promoter (Visser et al., Plant Mol. Biol.,
17:691-699 (1991)) in place of the CaMV 35S promoter in pHB105.
pPGB1 (Visser et al., 1991) was digested with SalI and SacI and
ligated with the XhoI to SacI fragment from pBSSKHBsCK#3 to form
pHB165.
C. Pin2-TMV.OMEGA.-HBsAg-pin2 Construct
[0181] pHB131 contains the native HBsAg coding sequence driven by
the potato pin2 promoter fused to the tobacco mosaic virus (TMV)
".OMEGA." 5' UTR (Gallie et al., 1992), and terminated by the
potato pin2 3' element. The pin2 promoter is wound-inducible and
may allow controlled expression of HBsAg in tubers. The
construction involved an intermediate step to obtain the pin2-3'
element on a SacI-EcoRI fragment, in which the SacI-PstI fragment
of pRT38 was subcloned in pBluescriptKS to form pKS-RT38. The pin2
promoter (Palm et al., Proc. Natl. Acad. Sci. USA 87:603-607
(1990)) was obtained from pRT24 (Robert Thornburg, Dept. of
Biochemistry & Biophysics, Iowa State University, Ames, Iowa
50011). The HindIII-BamHI fragment of pRT24 (1 kb) and the
pKS-.OMEGA.HB/BamHI-SacI (750 bp) fragments were ligated into pUC-V
(containing the soybean vspB terminator) digested with HindIII/SacI
to obtain pHB231. The SacI-EcoRI fragment of pKS-RT38 (Robert
Thornburg, Dept. of Biochemistry & Biophysics, Iowa State
University, Ames, Iowa 50011) containing pin2-3' terminator was
then obtained and ligated with pHB231/HindIII-NcoI containing the
pin2-TMV .OMEGA. promoter-leader element, the pHB103/Nco1-Sac1
fragment containing the HBsAg coding sequence, and
pGPTV-Kan/HindIII-EcoR1 to give pHB131.
D. Patatin-TMV.OMEGA.-HBsAg-vspB Construct
[0182] pHB140.3 contains the native HBsAg coding sequence driven by
the potato tuber-specific patatin gene promoter fused to the
tobacco mosaic virus (TMV) ".OMEGA." 5' UTR (Gallie et al., 1992),
and terminated by the soybean vspB 3' element. A BamHI site was
created at the 5' end of the TMV .OMEGA. UTR using the mutagenic
primer "Omega-Bam" (5'-GATCGGATCCTTACAACAATTACCAAC-3'(SEQ ID
NO:18)). Using pHB211 as a source of the TMV .OMEGA. 5'-UTR, PCR
was performed using the "Omega-Bam" primer and a downstream primer,
"NOS" (5'-CGGCAACAGGATTCAATC-3' (SEQ ID NO:19)), and a PCR fragment
of approximately 800 bp was cloned into T-tailed pBluescriptKS to
give pKS-.OMEGA.HB. The pPS20/HindIII-BamHI fragment (2.35 kb
patatin promoter) was ligated with pKS-.OMEGA.HB/BamHI-SacI (750
bp) and pUC19/HindIII-Sac1 (2.7 kb) to give pPS-.OMEGA.HB. Finally,
the pUC-V/SacI-EcoR1 fragment containing the soybean vspB
terminator was ligated into pPS-.OMEGA.HB to give pHB240.3, which
contains the patatin promoter fused to the TMV ".OMEGA." 5' UTR,
and terminated by the soybean vspB 3' element. The expression
cassette was obtained by digestion of pHB240.3 with HindIII and
EcoRI, and ligated into pGPTV-Kan to give pHB140.3.
Example 7
Plant-Optimized Codons for HBsAg
[0183] The preference for codon usage varies among plants and
animals and many signals within the DNA sequence are not conserved
(Ausubel, F. et al., eds. (1994) Current Protocols in Molecular
Biology, vol. 3, pp. A.1C.3). For instance, a 10-20 fold increase
in expression of a synthetic gene over the native bacterial
sequence has been expressed in plants.
[0184] Analysis of the native HBsAg gene reveals that 9.7% of the
codons are unfavorable for monocots and 8.8% are unfavorable for
dicots (such as potatoes). In particular, there is a RNA Pol II
termination sequence near the beginning of the gene, 29 CnG trimers
and 16 CG dimers. These signals may affect elongation and stability
of the transcript, and therefore decrease HBsAg protein. Therefore,
unfavorable codons and undesirable signal sequences, splice sites,
and methylation sites can be changed while maintaining the same or
similar native amino acid sequence. For HBsAg a total of 160 of 681
bases were changed while maintaining the native amino acid sequence
of the protein. See SEQ ID NO:3 (FIG. 22) and SEQ ID NO:5 (FIG. 5).
The resulting AT content is 52.42% and unfavorable signal have been
altered. The vectors are provided with the VSP 3' termination
signal discussed above and an .alpha.L signal peptide has been
provided in one. These vectors are designated HB115-HB117 (FIGS. 1A
and 21)
A. 35S-TEV-sHBsAg-VSP Construct
[0185] pHB115 (FIGS. 1A and 21) contains a synthetic
plant-optimized sequence encoding the HBsAg protein. The HBsAg
native sequence was scanned for codon use and for potential problem
sequences, including spurious mRNA processing signals such as
polyadenylation signals, splices sites, and transcription
termination signals, mRNA destabilizing sequences such as "ATTTA"
(Ohme-Takagi et al., Proc. Natl. Acad. Sci. USA 90:11811-11815
(1993)) and "DST" sequences (Newman et al., Plant Cell 5:701-714
(1993)), and the cytosine methylation motif "CCGG".
[0186] A plant-optimized gene was designed that uses
plant-preferred codons and lacks the potential problem sequences.
The designed gene was then assembled from overlapping
oligonucleotides using the method described by Stemmer et al.,
1992. The final product was digested with NcoI and SacI and cloned
into pGem5Zf+. The clones #7 and #3 had one mistake each so the 5'
from #7 was combined with the 3' of #3. A HincII/SacI fragment was
isolated from #7 and a NcoI/BbsI fragment was isolated from #3.
These fragments were cut with BfaI and ligated together with the
pGEM5Zf+ vector cut with NcoI and SacI. The resulting clone, #8 was
sequenced, named psHB312, and subcloned into pIBT210.1 at the NcoI
and SacI sites (mini #18), then subcloned into pGPTV-Kan at the
HindIII and EcoRI sites to make pHB115. This clone was subsequently
found to contain one nucleotide error (nt 595 is "G" instead of
"T", which causes a single amino acid substitution Gly for Trp) in
the HB coding region which led to the creation of a corrected
version, pHB117 (see below).
[0187] pHB117 (FIGS. 6 and 21) is the same as pHB115 with the
nucleotide correction in the HBsAg gene. The incorrect nucleotide
in psHB312 (position 595 "G") was corrected to "T" by site-directed
mutagenesis (Axis Genetics p1c, Cambridge, England) and named
pHBV10. The NcoI to SacI fragment was subcloned into pIBT210.1 to
create pIBT210.1HBV then the HindIII/EcoRI fragment subcloned into
pGPTV-Kan to give pHB117.
B. 35S-TEV-VSP.alpha.L-sHBsAg-VSP Construct
[0188] pHB116 (FIGS. 1A and 21) contains the soybean VSP ".alpha.L"
sequence inserted at the 5' of the synthetic HBsAg gene contained
in pHB115. The NcoI fragment from pSKHBsC-alphaL#29 was ligated to
the NcoI to SacI fragment of psHB312 and the vector pIBT210.1
digested with NcoI and SacI (mini #4 alphaL), then subcloned into
pGPTV-Kan (Becker, D., et al. 1992) at the HindIII and EcoRI
sites.
C. 35S-TEV-.alpha.S-sHBsAg-VSP Construct
[0189] pHB118 (FIGS. 7 and 21) contains the soybean ".alpha.S"
sequence inserted at the 5' of the synthetic HBsAg of pHB 117. The
NcoI fragment containing the ".alpha.S" from pIBT210.1HBsCKaS
(pHB308) was ligated to psHB317 to make psHB318. The HindIII to
EcoRI fragment was then ligated to pGPTV-Kan to make pHB118.
D. 35S-TEV-.alpha.L-sHBsAg-VSP Construct
[0190] pHB119 (FIGS. 8 and 21) contains the soybean ".alpha.L"
sequence inserted at the 5' of the synthetic HBsAg of pHB117. The
NcoI fragment containing the ".alpha.L" from pIBT210.1HBsCK.alpha.L
(pHB309) was ligated to psHB317 to make psHB319. The HindIII to
EcoRI fragment was then ligated to pGPTV-Kan to make pHB119.
E. E8-sHBsAg-pin2 Construct
[0191] pHB120 (FIGS. 9 and 21) contains the E8 promoter linked to
the sHBsAg with the pin2 3' end. The NcoI to SacI fragment
containing sHBsAg gene from psHBV10 was ligated to the EcoRI to
NcoI E8 promoter and pBluescript II SK+ digested with EcoRI and
SacI to make psHB520. The HindIII to SacI fragment from psHB520 was
ligated to HindIII and SacI digested HB131 containing the pin2
terminator resulting in pHB120.
F. 35S-TEV-sHBsAg-SEKDEL-pin2
[0192] pHB121 (FIGS. 10 and 21) contains the endoplasmic retention
signal inserted at the 3' of the sHBsAg gene. The oligos 5'
ATCTCTGAGAAGGATGAGCTTTAA 3' (SEQ ID NO:20) and 3' GACTCTTC
CTACTCGAAATTTAGA 5' (SEQ ID NO:21) were hybridized and ligated to
psHBV10 digested with BbsI resulting in psHB521. The NcoI to SacI
fragment from psHB521 was ligated to the HindIII to SacI fragment
from HB131 including the pGPTV Kan vector with the pin2 terminator
and ligated to the HindIII to NcoI fragment from pIBT210.1
containing the 35 S promoter to create pHB121.
G. 35S-TEV-aS-sHBsAg-SEKDEL-pin2
[0193] pHB122 (FIGS. 11 and 21) combines the .alpha.S signal with
the KDEL (SEQ ID NO:22) signal on the sHBsAg. The BstXI fragment
from pHB121 containing the 3' end of the sHBsAg with SEKDEL (SEQ ID
NO:4) and the pin2 terminator was ligated into pHB118 replacing the
3' end of the sHBsAg gene and the vsp terminator to make
pHB122.
H. 35S-TEV-aL-sHBsAg-SEKDEL -pin2
[0194] pHB123 (FIGS. 12 and 21) combines the .alpha.L signal with
the KDEL (SEQ ID NO:22) signal on the sHBsAg. The BstXI fragment
from pHB121 containing the 3' end of the sHBsAg with SEKDEL (SEQ ID
NO:4) and the pin2 terminator was ligated into pHB119 replacing the
3' end of the sHBsAg gene and the vsp terminator to make
pHB123.
Example 8
Transformation of Potato Plants
[0195] Stable transformation of potato (Solanum tuberosum
"Frito-Lay 1607") is achieved by axenic leaf disc co-cultivation.
Haq, T. et al. (1995); Wenzler, H. et al. (1989). The steps are
summarized as follows: Explants are cut and put abaxial side up on
LCI plates for 3-4 days. Explants are placed in agro dilution for
10 minutes (agitation by hand), then blotted on sterile paper
towel. After blotting, explants are put abaxial side up back on LCI
plates for 3-4 days. After cocultivation, explants are put on LC1CK
plates containing kanamycin and carbenicillin for 5-7 days until
callus is developed. Explants with well developed callus are placed
in LC2CK boxes for 2 weeks; after 2 weeks explants are placed on
fresh LC2CK media and shoots are developed. When the shoots are
about 1.5 cm in length, they are transferred to cm media for root
formation. Carbenicillin is added to cm media to prevent bacterial
growth in excess.
[0196] Growing Agrobacterium--LB stock: One colony is cultured
overnight in presence of kanamycin; YM stock: one colony is
cultured over 36-48 hour period in presence of kanamycin.
[0197] Because some variation in expression among independent
transformation events is expected due to random site of insertion,
independent transgenic lines are screened by Northern blot using
coding region-specific probes. When a 35S promoter is used, the
total RNA from leaves is screened. When the patatin promoter is
used, RNA is obtained from microtubers developed in axenic culture.
The patatin promoter constructs are screened from microtubers
generated by subculture of stem node cuttings from nascent
transformed shoots on media high in sucrose. The most promising
transformed lines are propagated by axenic culture of node
cuttings; and rooted plantlets are transplanted to soil and grown
in the greenhouse.
[0198] To obtain tubers, the plants are grown in a two-stage
protocol: (1) for the first 1.5-2 months, or until sufficient
vegetative growth develops, using long day (16 h) lighting with
supplemental lighting in winter, and (2) for an additional 1.5-2
months under short day (12 h) conditions. The tubers are typically
recovered in yields of 600-800 g per 3-gallon pot after this 3-4
month regime. Tubers harvested from the first crop can be used to
initiate new plants after a 1-month dormancy period.
Example 9
Increase of HBsAg Accumulation in Plant Cells
[0199] The level of HBsAg expression in plant cells can be
increased by incorporating improvements in the plant expression
vector that increase transcription/translation of the foreign gene.
Transcription, mRNA processing and accumulation, translation,
post-translational processing and accumulation can be affected by
components of the expression vector. Preliminary studies have
demonstrated a critical cellular threshold concentration at which
assembly of VLPs consisting of HBsAg subunits is accelerated, and
that VLPs are more stable than unassembled subunits. HBsAg mRNA
(measured by densitometry of Northern blot signal) is linear when
plotted against rHBsAg protein (measured by ELISA) for the
constructs HB103 and HB107. A possible explanation for this result
is that the HBsAg is more stable/resistant to plant cytoplasmic
proteases if it is effectively directed to the ER.
Example 10
[0200] Transformed potato plants are grown in pots in a glasshouse
or growth. Transgenic plants expressing HBsAg showed an altered
growth habit although tubers were produced, which could limit
absolute levels of antigen expression in plants. The results of
HBsAg protein assays in leaf tissue and tuber tissue of potatoes
transformed with the various constructs shown in FIG. 1 are given
in Table 2. The level of HBsAg is shown as % total soluble protein
for the highest expressing individual transformant for each
construct. There is considerable variation in HBsAg expression
levels between lines transformed with pHB114, varying from 0.2 to
16 .mu.g per g tuber. The HBsAg protein forms particles in planta
and may be glycosylated. Three potential N-glycosylation sequences
occur in the antigen, along with numerous possible locations for
O-linked glycosylation. It is believed that only one of the
N-linked sites is glycosylated in mammalian systems and only to
40-50%. Data from earlier studies in transgenic tobacco show that
plants can assemble HBsAg into virus-like particles (VLPs) similar
in size to VLPs derived from recombinant yeast and from sera of
infected individuals (although the size distribution differs). The
precise localization of the antigen within a tuber is not known,
although protein levels are thought to be highest in the layer just
underneath the skin. Amounts of purified/extracted HBsAg can be
increased by addition of .beta.-mercaptoethanol to the extraction
buffer.
2TABLE 2 slope mRNA HBsAg expression in best individual Construct
vs protein leaf tissue (%) tuber tissue (.mu.g/g) HB1020.001 0.016
0.18 HB1030.001 0.023 0.33 HB1050.004 0.048 1.25 HB1060.004 0.035
0.8 HB1070.005 0.11 2.4 HB110ND 0 ND HB1040.004 0.19 6.5 HB1140.005
0.22 16 HB145ND 0.063 1.1 HB165ND 0.021 -- HB111ND 0.041 0.33
HB115ND 0.13 2 HB116ND 0.176 2
Example 11
Characterization of Tubers of Transgenic Potato Line HB114-16.
[0201] This example describes experiments designed to characterize
the recombinant HBsAg produced in tubers of potato "FL1607" line
HB114-16, which is transformed with pHB114. These data indicate
that HBsAg produced in these tubers has the structure expected for
an immunogenic vaccine protein, comparable to the yeast recombinant
HBsAg used for the commercial vaccine. Specifically, the assembled
virus-like particle (VLP) form of HBsAg is more stable and
immunogenic than unassembled subunits, and is thus considered a
crucial characteristic of the vaccine antigen.
[0202] VLP content by sucrose gradient. We examined extracts from
HB114-16 tubers and control nontransgenic tubers by sucrose
gradient sedimentation to determine whether HBsAg aggregated as
VLPs as described for tobacco expression (Mason et al. 1992). A
crude extract of a tuber was obtained by powdering a tuber in
liquid nitrogen in a blender, then adding two volumes by weight of
1.times.PBS (pH 7.2), 0.1% Triton X-100, 10 mM EDTA. The buffer
froze upon mixing with the frozen powder and was allowed to slowly
thaw upon ice. The resuspended extract was centrifuged at
14,000.times.g for 5 min at 4.degree. C., and 0.5 ml of the
supernatant was layered above a 5-30% linear sucrose gradient in 10
mM sodium phosphate pH 7.0, 0.15 M NaCl. Gradients containing 2
.mu.g purified yeast-derived recombinant HBsAg (rHBsAg) particles
in 0.5 ml of 1.times.PBS (pH 7.2), 0.1% Triton X-100, 10 mM EDTA
either with or without FL1607 tuber extract were run at the same
time for comparison. The gradients were centrifuged in the Beckman
SW41 rotor at 33,000 rpm for 5 h at 4.degree. C. ELISA for HBsAg
(Auszyme monoclonal, Abbott Laboratories) was performed on gradient
fractions, and the % sucrose plotted vs. the ELISA OD. FIG. 13
shows that all HBsAg samples sedimented in a rather broad peak
between approximately 8% and 22% sucrose. The profile for the tuber
material is shifted slightly toward higher density, but in all
samples the greatest proportion of HBsAg sediments between 10 and
15% sucrose. Yeast rHBsAg added to an extract of nontransgenic
FL1607 tubers showed a profile similar to purified yeast rHBsAg,
but the ELISA signals were somewhat lower. Nontransgenic FL1607
tubers showed no ELISA signals on the gradient. These data show
that the tuber-derived HBsAg co-sediments with yeast-derived HBsAg,
and suggest that the tuber-derived HBsAg assembles as VLPs.
[0203] Western Blot. We performed a Western blot to observe HBsAg
polypeptides in HB114-16 tubers that react with antibodies. Samples
were denatured in reducing SDS-PAGE sample buffer (100 mM DTT, 2%
SDS,) by boiling 5 minutes, electrophoresed, blotted to PVDF
membrane and probed with polyclonal rabbit antiserum against HBsAg.
FIG. 14 shows the Western blot and a duplicate gel run at the same
time stained with Coomassie. The stained gel indicates that similar
amounts of total tuber protein were loaded for both HB114-16 (lane
HB) and nontransgenic FL1607 (lane -) samples. On the Western blot,
the 10 ng of yeast-derived rHBsAg (lane +) yielded a monomer of
about 25 kDa as expected and a dimer at M.sub.r about 40 kDa (bands
marked "Y" at left). The tuber-derived material (lane HB) contains
a monomer of about 28 kDa and larger bands that may represent
dimers (bands marked "P" at left). The tuber-derived monomer is
likely glycosylated and therefore of a larger size than the
yeast-derived monomer. In nontransgenic tubers (lane -) several
faint nonspecific bands showed, but did not cross-react in the
region of monomer and dimer. Interestingly, the relative proportion
of dimers to monomers in the tuber material is much higher than
that for yeast rHBsAg. Although this analysis was performed under
reducing conditions, the substantial proportion of dimers in tuber
material indicates that it is more highly and stably disulfide
crosslinked, and thus potentially more resistant to degradation,
especially when delivered orally.
[0204] A Northern blot was performed on total RNA prepared from
tubers of potato line HB114-16 as described (Mason et al., 1996).
As a negative control, RNA from tubers of nontransgenic potato line
FL1607 was examined. Five .mu.g of each sample were denatured with
formaldehyde in MOPS/acetate/EDTA buffer at 65.degree. C. for 15
min, electrophoresed on a 1% agarose gel, and transferred to
ZetaProbe membrane (BioRad) by capillary blotting. The membrane was
fixed by UV irradiation in a Stratalinker (Stratagene) and then was
stained with methylene blue to verify RNA integrity and loading
density. A probe was prepared using random primed labeling of a 700
bp DNA fragment (comprising the HBsAg coding sequence) obtained by
digesting pHB114 with NcoI and SacI. The blot was hybridized with
the probe at 65.degree. C. in 0.25 M sodium phosphate, pH 7.2; 7%
SDS; 1 mM EDTA for 16 h. The membrane was washed with wash buffer 1
(40 mM sodium phosphate, pH 7.2; 1 mM EDTA; 5% SDS) 2 times for 30
minutes each at 65.degree. C. The membrane was wrapped in plastic,
and quantitatively imaged with a PhosphorImager (Molecular
Dynamics).
[0205] FIG. 15 shows the results obtained. Duplicate lanes were run
containing the same amount of each RNA sample; one set of lanes was
methylene blue stained after blotting. The photograph at right
shows the methylene blue-stained blot of half of the gel, which
indicates that more total RNA from leaf samples were loaded than
from tuber samples. The quality of the RNA is good as judged by
integrity of the ribosomal RNA bands. The photograph at the left
shows the hybridization pattern obtained. HB114-16 RNA has one
major band at approximately 1 kb in both the tuber and leaf samples
representing the full-length HBsAg transcript. The smear underneath
the 1 kb band may represent degraded RNA. The faint band at
approximately 3 kb in the leaf RNA sample may represent readthrough
transcription of the HBsAg unit due to a novel insertion site.
Neither nontransgenic FL1607 tuber nor leaf RNAs showed
hybridization signals.
[0206] PCR analysis was performed on genomic DNA isolated from
HB114-16 leaves. FIG. 16 shows a single major band was obtained
using primers TEV (5'-GCATTCTACTTCTATTGCAGC) (SEQ ID NO:23) and
PIN2 flanking the HBsAg gene at 5' and 3' ends, respectively. This
band was the same size as that amplified from the plasmid pHB114
and was not visible in the control FL1607 genomic DNA. The PCR
fragment was excised from the gel and sequenced to verify that
there were no mutations from the pHB114 sequence. The sequences
were identical. This shows there was no mutation or change in the
HBsAg gene upon transforming the HB114-16 line.
[0207] A Southern blot was performed on the same genomic DNA
samples used for PCR analysis. Fifteen .mu.g of each DNA sample,
and 10 ng of pHB114 plasmid were digested with various restriction
enzymes or left undigested before fractionation on a 0.8% agarose
gel, depurination by treatment with HCl, neutralization, and
transfer to ZetaProbe membrane (BioRad) by capillary blotting. The
membrane was fixed by UV irradiation in a Stratalinker
(Stratagene). A probe was prepared using random primed labeling of
a 2 kb DNA fragment (comprising the S35 promoter, TEV 5-UTR and the
HBsAg coding sequence) obtained by digesting pHB203 with HindIII
and SacI. The blot was hybridized with the probe at 65.degree. C.
in 0.25 M sodium phosphate, pH 7.2; 7% SDS; 1 mM EDTA for 16 h. The
membrane was washed with wash buffer 1 (40 mM sodium phosphate, pH
7.2; 1 mM EDTA; 5% SDS) 2 times for 30 minutes each at 65.degree.
C. The membrane was wrapped in plastic, and quantitatively imaged
with a PhosphorImager (Molecular Dynamics). FIG. 17 shows the
resulting pattern of hybridization, the ethidium bromide stain of
the gel before transfer to Zetaprobe, a map of the T-DNA cassette,
and the part of the DNA used as the probe. The digests NcoI and
HincII result in a fragment internal to the T-DNA cassette that
hybridize to the probe (INT) as well as another fragment that
extends into the insertion site of the T-DNA. In the HB114-16 lanes
digested with NcoI or HincII, at least four bands other than the
internal band can be counted (see numbers to right of lane "Nco"
and to left of lane "HincII"). The most likely explanation of these
data is that there are at least 4 copies of the T-DNA containing
the HBsAg expression cassette integrated at different sites in
HB114-16 nuclear genomic DNA (see numbers on bands). The lanes
containing FL1607 DNA did not hybridize to the probe. The EcoRV
digest yielded unexpected results, perhaps due to partial digestion
or star activity, and was thus ignored.
[0208] Stability of the HBsAg in tubers stored 9 months. Several
pots of HB114-16 tubers were harvested in May 1998. The tubers were
stored at 4.degree. C. in separate paper bags for each pot. One
tuber from each of 11 pots was assayed by ELISA for HBsAg (Auszyme
monoclonal, Abbott Laboratories) within two weeks of the harvest.
Nine months later, two tubers from the same 11 pots were assayed.
The bar graph in FIG. 18 shows the amount of HBsAg measured in May
1998 with black bars and the amount measured in February 1999 in
white bars. The tubers had significantly more HBsAg after aging for
nine months, based on tuber fresh weight. This may be explained by
partial dehydration of the tubers such that the weight of a tuber
is lower after storage than when it is first harvested. Another
explanation may be that some HBsAg is present at harvest as
improperly folded monomer subunits, and that during storage these
subunits fold correctly and assemble to form VLPs, thus allowing
more of the HBsAg to be detected. Finally, it is possible that
further synthesis of monomers occurred during storage and that
these assembled into forms detectable by the ELISA. (It is known
that potato tuber cells are physiologically active during storage
at 4.degree. C., as evidenced by changes in starch and sugar
content, and ultimately sprouting of the eyes and growth of
shoots.) These data show that the HBsAg produced in transgenic
tubers is stable for at least nine months upon storage at 4.degree.
C.
Example 12
Expression of Modified Versions of HBsAg in Tobacco Cells and
Analysis of Disulfide Crosslinking
[0209] This example describes the stable expression in transgenic
tobacco NT1 cells of the synthetic plant-optimized HBsAg gene
modified in different ways for subcellular targeting. These studies
show that certain modifications cause a significantly greater
extent of crosslinking of monomers via disulfide bridges. Since
more highly crosslinked HBsAg is potentially more stable and more
immunogenic, an enhancement of crosslinking is expected to yield a
better vaccine antigen. Further, since yeast-derived recombinant
HBsAg (rHBsag) is not highly crosslinked unless extracted and
treated with chemicals that drive disulfide bridge formation
(Wampler, D., Lehman, E., Boger, J., McAleer, W. & Scolnick, E.
Multiple chemical forms of the hepatitis B surface antigen produced
in yeast. Proc Nat Acad of Sci, USA 1985; 82, 6830-6834), the
plant-derived HBsAg represents a potentially more immunogenic
material when delivered orally without purification and/or chemical
treatment.
[0210] We created transgenic tobacco NT1 cell lines by
Agrobacterium-mediated DNA delivery with plasmids pHB117, pHB118,
pHB119, pHB121, pHB122, and pHB123. These constructs are described
more fully in Example 7, but we briefly describe their
modifications in Table 3 below. All contain the synthetic
plant-optimized HBsAg gene described in Example 7, which has been
modified here by either a N- or C-terminal extension, or both. Our
rationale suggests that a N-terminal plant signal peptide may more
effectively target the nascent HBsAg polypeptide to the ER and
allow more efficient folding of monomers and assembly of
crosslinked virus-like particles (VLPs). The .alpha.S signal
peptide contains 21 amino acids, while the .alpha.L signal peptide
comprises an additional 14 residues from the same soybean vspA gene
that contains a potential vacuolar localization signal (Mason et
al. 1988). Further, a C-terminal ER retention signal "SEKDEL" (SEQ
ID NO:4) may concentrate the subunits in the ER by salvage from
downstream endomembrane compartments, and thereby drive more
effective association and crosslinking of monomers.
3TABLE 3 Plasmids used in this Example Name N-terminal extension
C-terminal extension pHB117 None None pHB118 vspA .alpha.S signal
peptide None pHB119 vspA .alpha.L signal peptide None pHB121 None
SEKDEL pHB122 vspA .alpha.S signal peptide SEKDEL pHB123 vspA
.alpha.L signal peptide SEKDEL
[0211] We used these plasmids to transform tobacco NT1 cells
essentially as described (Newman T C, Ohme-Takagi M, Taylor C B,
Green P J. DST sequences, highly conserved among plant SAUR genes,
target reporter transcripts for rapid decay in tobacco. Plant Cell
1993; 5:701-714). Callus cell colonies selected for growth on 300
mg/L kanamycin were assayed for expression of HBsAg. Cells were
extracted with 2 ml per g cells in buffer (PBS, pH 7.2; 50 mM
sodium ascorbate, 10 mM EDTA, 0.2 mM PMSF, 0.1% Triton-X-100).
Extracts were clarified by centrifugation at 16,000.times.g for 3
min at 4.degree. C., and supernatants tested for total soluble
protein (TSP) by Bradford assay (BioRad) and for HBsAg by Auszyme
monoclonal ELISA (Abbott Laboratories). Expression varied greatly
among the lines, but the lines that expressed the highest levels
for each construct were propagated and used for further study.
Table 4 below shows expression data from a representative
experiment in which a selected line from each construct were
assayed. All lines expressed similar levels of TSP. All of the
modified forms were expressed to higher levels of HBsAg than the
unmodified form in line HB117-9, with line HB118-3 giving the
highest level. We must interpret the data with caution, since we
did not quantify mRNA levels, which would have accounted for some
differences. However, these lines were selected as the best lines
from 20 random events for each transformation experiment, and thus
it is likely that the modified forms perform at least as well as
the unmodified HBsAg.
4TABLE 4 HBsAg and total protein in transgenic NT1 cell lines TSP
HBsAg Line (mg/ml) (ng/mg TSP) HB117-9 4.78 67 HB118-3 4.28 261
HB119-5 3.88 121 HB121-11 3.40 118 HB122-8 4.80 133 HB123-1 4.46
155 NT1 control 3.12 0
Immunoprecipitation and Analysis of Crosslinking
[0212] We examined the NT1 cell extracts for multimeric forms of
HBsAg by Western blot after fractionation of immunoprecipitates
under partial reducing conditions. Cells were extracted and assayed
as above for TSP and HBsAg. Samples containing 1 mg TSP were
diluted 10-fold with PBS containing 1% Triton-x-100, 0.5% sodium
deoxycholate, and 0.1% SDS, then mixed with 1 .mu.g of goat
anti-HBsAg (Fitzgerald Industries, Concord, Mass.). The reaction
was incubated for 1 h at 23.degree. C., and then mixed with 15
.mu.l Protein G Plus-Agarose (Calbiochem) and incubated on a
rotating mixer at 4.degree. C. for 16 h. The agarose matrix was
pelleted and washed according to the supplier's instructions before
suspending in 25 .mu.l of 1.5.times.SDS-PAGE sample buffer
containing 80 mM DTT. Samples of yeast rHBsAg were
immunoprecipitated in the same way.
[0213] In Experiment 1, samples from lines HB117-9, HB118-3, and
HB121-11 were examined. The immunoprecipitated (IP) samples in
SDS-PAGE sample buffer were heated at 50.degree. C. for 5 min
(partial reducing condition), centrifuged 16,000.times.g for 2 min,
and 10 .mu.l of supernatant loaded on a 4-20% gradient minigel
(BioRad). The remaining material was resuspended and heated at
100.degree. C. for 20 min (stringent reducing condition),
centrifuged 16,000.times.g for 2 min, and 10 .mu.l of supernatant
loaded on a second gel. Samples were electrophoresed,
electroblotted to PVDF membranes, and probed with the same goat
anti-HBsAg serum used for IP. FIG. 19 shows the Western blots
obtained. Panel A shows samples that were subjected to partial
reducing condition (50.degree. C. for 5 min), and panel B shows
samples given stringent condition (100.degree. C. for 20 min).
Yeast rHBsAg (50 ng) in lanes 1 shows a ladder of multimers under
partial reduction, which is much less pronounced under stringent
reduction. Similar patterns are seen for the yeast rHBsAg purified
by IP (lanes 2), although the recovery yield was less than
expected. Note that all lanes contain a signal at approximately 50
kDa that represents the heavy chain of the goat IgG that was used
both as the IP hook and the Western blot probe, and included in
lanes 7 as control. The HBsAg dimer and trimer signals bracket this
signal and are well resolved from it. The HBsAg monomer in sample
HB117-9 (unmodified HBsAg) co-migrates with the yeast rHBsAg
monomer, and is present with dimer and faint multimer signals under
partial reduction. This indicates that HBsAg readily crosslinks to
form multimers when expressed in plant cells. Even under stringent
reduction, a strong dimer signal is evident in sample HB117-9. A
pair of faint lower M.sub.r signals is seen in the HB117-9 sample
that is not present in the yeast-derived material, suggesting a
single cleavage event that yields 2 HBsAg fragments. Further study
is needed to determine whether this cleavage occurs in the living
cells or as a result of extraction. The nontransgenic NT1 cell
sample (lanes 6) shows a faint nonspecific signal that runs between
the HBsAg monomer and dimer and is well resolved from both.
[0214] Lanes 4 contain NT1 cell sample HB118-3 with the HBsAg
modified with the N-terminal ".alpha.S" plant signal peptide
extension. The monomer signal in this sample runs at slightly
higher M.sub.r, which suggests that the plant signal peptide is not
cleaved in these NT1 cells. Most interestingly, the dimer signal in
partially reduced sample HB118-3 is more intense than the monomer,
and multimers up to a pentamer can be distinguished, with a smear
upwards indicating substantially higher-order multimers are
present. Even with stringent reducing condition, the trimer and
tetramer signals are easily distinguished, showing that the
disulfide crosslinks between monomers are quite stable and
resistant to reduction in HB118-3 cells. Like sample HB117-9, 2
faint lower M.sub.r signals suggest a partial proteolytic
cleavage.
[0215] Lanes 5 in Experiment 1 contain samples from NT1 cell line
HB121-11 with the HBsAg modified by the C-terminal extension
"SEKDEL" (SEQ ID NO:4). The partially reduced sample shows a
monomer that runs at slightly higher M.sub.r, which is consistent
with the C-terminal extension. Further, multimers up to tetramer
are easily observed showing substantially greater degree of
crosslinking than in the HB117-3 cells. Stringent reduction
converts most multimers to monomers, but a strong dimer signal is
still present. Like HB117 and HB118 lines, 2 faint lower M.sub.r
signals suggest a partial proteolytic cleavage in sample HB121.
[0216] In Experiment 2, samples from all 6 transgenic lines were
examined. In this case, separate IP reactions were performed for
the partial reduction (50.degree. C..times.5 min) and stringent
reduction (100.degree. C..times.20 min), in order to obtain a more
quantitative result. FIG. 20 shows the results; again Panel A
samples are partially reduced and Panel B samples are stringently
reduced. Samples HB117-9, HB118-3, and HB121-11 show results
consistent with Experiment 1, although the resolution of
higher-order multimers is less defined under partial reduction. The
HB118-3 sample in Panel B (stringent reduction) again shows highly
resistant crosslinking with tetramers evident and higher-order
multimers likely in the smear at higher Mr.
[0217] Lanes 4 in Experiment 2 contain NT1 cell sample HB118-3 with
the HBsAg modified with the N-terminal ".alpha.L" plant signal
peptide extension. In Panel A signal peptide-processed monomer is
apparent in approximately equimolar ratio with a larger signal that
likely represents the unprocessed form. Multimers are also present,
which are largely shifted to monomers and dimers in the stringent
reducing condition.
[0218] Lanes 6 and 7 contain samples HB122-8 and HB123-1,
respectively, in which the HBsAg is extended on both N- and
C-termini. In these samples (Panel B), tetramers are evident even
under stringent reducing condition. Line HB123-1, which carries the
".alpha.L" plant signal peptide extension and the C-terminal SEKDEL
(SEQ ID NO:4) extension, showed apparent partial processing of the
signal peptide, like line HB119-5 that carries the ".alpha.L" plant
signal peptide alone. Thus it appears that the longer ".alpha.L"
signal peptide is more efficiently processed than the shorter
".alpha.S" signal peptide in these NT1 cells.
[0219] In conclusion, HBsAg expressed in cultured tobacco NT1 cells
readily forms disulfide-crosslinked multimers. Crosslinking is
greatly enhanced when either ".alpha.S" or ".alpha.L" forms of the
soybean vspA signal peptide is fused to the N-terminus of the
Plant-optimized HBsAg gene. These data indicate that plant-produced
HBsAg, especially when fused to a plant signal peptide, is a
superior vaccine antigen for use in oral delivery of crude or
unprocessed host material.
Example 13
Expression of Oral Adjuvant in Potato
[0220] The E. coli LT B subunit can be expressed in potato tubers
in a form that is immunogenic when fed directly to mice without
preparation other than slicing, with the amino acid sequence SEKDEL
(SEQ ID NO:4) increasing expression (Haq, T. et al. 1995). As
mentioned herein the LT-B protein can be used as a vaccine carrier.
Expression of the LT-B protein can be greatly enhanced still
further by employing plant-optimized codons of the coding sequence
of the protein. The differential expression levels are shown in
Table 5.
5TABLE 5 LT-B, ng/mg total soluble Coding region (plasmid)
Modification(s) protein Native LT-B (pLTB110) Optimize translation
start site 70 LTB-SEKDEL (pLTK110) C-terminal SEKDEL extension 190
Synthetic LT-B (pTH110)* Plant-optimized codons, eliminate 4640
spurious polyadenylation and splicing signals
[0221] *Construction of pTH110 is described in Mason, H., et al.
(1998), Vaccine, 16: 1336-1343.
Example 14
Transgenic Potato Plants that Coexpress HBsAg and Mucosal Adjuvant
E. coli Mutant LT in Tubers
[0222] In order to avoid the logistical problems involved in mixing
and stabilizing preparations containing vaccine antigen and
adjuvant, it is convenient to provide edible material having both
components without need for preparation. To this end, transgenic
potato plants, which coexpress and accumulate HBsAg and E. coli
mutant LT in their tubers, can be produced.
[0223] Plasmid vectors permitting the co-expression in plants of A
and B subunits of E. coli heat labile enterotoxin (LT) and mutants
thereof have been constructed. These are also the subject of
co-pending application U.S. Ser. No. 60/113,507. In order to
co-express HBsAg with LT in potato plants, a potato plant is
transformed with a plasmid used as a host for transformation with a
binary vector that contains an HBsAg expression cassette and
confers antibiotic resistance. An example of the former plasmid is
pSLT102, which expresses assembled LT-K63 (S62 to K63 mutation in
LT-A) and carries the kanamycin-resistance NPT-II gene. Examples of
suitable plasmids for preparing a vector having antibiotic
resistance are pGPTV-HYG (hygromycin) and pGPTV-BAR
(phosphinothricin) (Becker, D. et al. 1992). The desired plasmid is
constructed by digestion of pHB117 with HindIII and EcoRI to obtain
the HBsAg cassette, and ligation with pGPTV-HYG or pGPTV-BAR
digested likewise. The resulting binary vector is then used to
transform the host LT-K63-expressing potato line using selection on
media containing 20 mg/L hygromycin or 1 mg/L phosphinothricin.
Example 15
Oral Immunization of Mice with HBsAg Expressed in Potato Tubers
[0224] BALB/c mice are fed potato slices (5 g potato/feed/animal)
expressing HBsAg. As shown in FIGS. 3 and 4A-E, the mice developed
serum IgM and IgG responses that are specific to HBsAg. A group of
control animals fed non-transformed potatoes failed to generate
antibodies. Cholera toxin (Sigma, St. Louis, Mo.) was used as an
oral adjuvant in these studies. Ten .mu.g of adjuvant is placed on
the potato slices and consumed by the animals along with the
antigen. This experiment was repeated twice with a total of 10 mice
in both the experimental and control groups. The potato tubers in
these experiments expressed only 1.1 .mu.g HBsAg/gm potato.
Therefore, each animal received only 5.5 .mu.g HBsAg per feed. This
likely directly reflects the modest primary response elicited. Even
so, when both groups of mice were challenged with a sub-immunogenic
dose of yeast-derived rHBsAg on day 60, only those fed with the
transgenic potatoes made a secondary anti-HBsAg response,
confirming that a memory cell response had been established. When
the immune response was analyzed in terms of immunoglobulin class
and subclass, an IgM response followed by IgG response was observed
in all subclasses. No serum IgA response could be measured.
Example 16
Transformation of Tomato Plants
[0225] Tomato plants can be transformed according to the protocol
of Frary/Fillati et al. (1987) Biotechnology 5:726-730), as
modified herein:
[0226] Seeds (100 seeds-380 mg.) (Tanksley TA234TM2R) are
sterilized and immersed in 20% CHLOROX bleach for 20 min. The seeds
are rinsed well with sterile milli-Q water (2 or more times) and
sowed in Magenta boxes containing 1/2 MSO (approximately 30
seeds/box). One day prior to cutting cotyledons, 2 mL of a one week
old NT-1 suspension culture is pipetted onto a KCMS media plate.
(NT-1 cells are subcultured weekly (2:48) in KCMS liquid medium.).
The suspension is covered with a sterile Whatman filter and
cultured in the dark, overnight. The cotyledons are cut 8 days
after sowing. Seedlings are placed on a sterile paper towel
moistened with sterile water. The cotyledons are excised at the
petiole and the tips cut off. They are cut in half again if size of
cotyledon is greater than 1 cm. The explants are placed on feeder
plates adaxial side down and cultured at 25.degree. C., 16 hour
photoperiod, overnight.
[0227] For the transformation, Agrobacterium is streaked onto LB
selective media plate about 1 week prior to transformation and
incubated at 30.degree. C. Liquid selective medium is inoculated
with the Agrobacterium by picking a single colony off of the
streaked plate, and inoculating 3 mL YM medium with 150 .mu.g
kanamycin sulfate. The culture is vigorously shaken at 30.degree.
C. for 48 hours. One mL of the culture is inoculated into 49 mL YM
medium with 2.5 mg kanamycin sulfate and cultured in a 250 mL flask
shaken vigorously at 30.degree. C. for 24 h. The optical density is
measured at 600 nm. Optimum O.D. is considered to be 0.5 to
0.6.
[0228] The Agrobacterium culture is centrifuged at 8,000 rpm
(Sorvall centrifuge, ss34 rotor) for 10 min. The YM is poured off
and the pellet resuspended in MS-O, 2%. The final O.D. should be
between 0.5 and 0.6. Twenty five mL of the Agrobacterium culture is
pipetted into a sterile Magenta box. The explants are transferred
from 2 to 3 plates into inoculum in a magenta box and incubated for
5 min. with occasional shaking. The explants are removed to a
sterile paper towel. The explants are returned to feeder plates,
adaxial side down and the plates are sealed with Nesco film. The
explants are cocultivated for a 16-hour photoperiod at 25.degree.
C. for approximately 24 h. The explants are transferred to
selection media (2Z) adaxial side up. The plates are sealed with
micropore tape and returned to 25.degree. C., for a 16-hour
photoperiod.
[0229] The explants are transferred to new IZ selection medium
plates every 3 weeks. When shoots begin to appear they are
transferred to IZ Magenta boxes.
Example 17
Regeneration of Transgenic Tomatoes
[0230] Within 4 to 6 weeks initial shoots should appear. Shoots are
excised from the explants when shoots are at least 2 cm and include
at least 1 node. They are placed in Magenta boxes (4/box)
containing Tomato Rooting Media with selective agents. Roots should
begin to appear in about 2 weeks. Standard Greenhouse growth
conditions are employed: 16 hour day; average temperature:
24.5.degree. C.; fertilized each time watered: 100 ppm. EXCELL
(15-5-15) with extra calcium and magnesium; potatoes grown in
METRO-MIX 360; tomatoes grown in Cornell Mix+OSMO; biological
controls are used whenever possible to improve overall plant
quality.
Example 18
ELISA Assay for Measurement of Serum Anti-HBsAg Specific
Antibodies
[0231] Mouse sera is evaluated for anti-HBsAg-specific antibodies
using a commercially available AUSAB enzyme immunoassay (EIA)
diagnostic kit (Abbott Diagnostics, Chicago, Ill.) using the
methods described elsewhere (Pride, M. et al., 1998). Use of the
AUSAB quantitation panel permits conversion of absorbance values to
mIU/mL.
Example 19
Isotype Distribution of the Anti-HBsAg Response
[0232] The isotype distribution of the anti-HBsAg response is
determined using the mouse typer sub-isotyping kit (Bio-Rad;
Richmond, Calif.). Sera, saliva, and fecal extracts are incubated
on HBsAg-coated beads (from the Abbott EIA kit) and bound antibody
is detected using rabbit anti-mouse subclass-specific antiserum
(Bio-Rad, enzyme immunoassay (EIA) grade Mouse Typer panel).
Example 20
Detection of CT (LT) Specific Antibody Production by ELISA
[0233] This assay is included to serve as a positive control. The
systemic antibody responses obtained following the oral
administration of CT/LT are well documented, and therefore allow
evaluation if the responses are comparable. CT-B is assayed as
described by Mason et al., 1992, 1998).
Example 21
Measurement of Antibody Responses in Mucosal Secretions
[0234] To measure antibody levels in mucosal secretions stool and
saliva samples are collected as follows:
[0235] Stools: Freshly voided fecal pellets are collected from
individual animals and stored in Eppendorf tubes at -70.degree. C.
Prior to the assay, pellets are resuspended in PBS (50 .mu.L per
pellet), the tubes then allowed to stand at room temperature for 15
mins, then vortexed vigorously and incubated at 20.degree. C. for
15 min. Samples then re-vortexed, and centrifuged at 1,000.times.g
for 5 min. The supernatant is collected and used immediately in an
ELISA assay. This method is essentially as described by deVos &
Dick. J. Immunol. Methods. 141:285-288(1991).
[0236] Saliva: Saliva is collected in capillary tubes following
i.p. injection of mice with 0.1 mL of a 1 mg/mL solution of
pilocarpine. Care is taken to collect the first flush of saliva in
all cases. Samples are transferred to Eppendorf tubes and stored at
-70.degree. C. until assayed.
Example 22
Preparation of Single-Cell Suspensions
[0237] Single-cell suspensions are obtained from spleens by gently
teasing the tissue through a sterile stainless steel screen.
Peyer's Patches (PP) lymphoid cells are isolated by excising the PP
from the small intestine wall. Cells are dissociated in Joklik's
modified medium (GIBCO, Grand Island, N.Y.) containing 1.5 mg of
the neutral protease enzyme Dispase (Boehringer Mannheim
Biochemicals, Indianapolis, Ind.) per mL or 0.5 mg/mL collagenase
as described previously (Kiyono, H. et al. PNAS USA 79:596-600
(1982)).
Example 23
B cell ELISPOT
[0238] This assay is performed using cells isolated as described
above from the spleen and Peyer's Patches allowing for comparison
of the responses seen in systemic (spleen), and mucosal induction
(Peyer's Patches). Antigen-specific and total IgM, IgA, and IgG
spot-forming cells (SFC) are enumerated in cell suspensions by
antigen-specific ELISPOT as described elsewhere (see, e.g., Current
Protocols in Immunology).
Example 24
Analysis of Th1 and Th2 Cells in Murine Systemic and Gut-Associated
Tissues Following Oral Ingestion of Transgenic Potatoes
[0239] The nature and kinetics of the T cell response generated as
a consequence of feeding mice transgenic plants expressing HBsAg or
any immunogenic polypeptide can be examined. Using T cells enriched
from the spleen or Peyer's Patches of mice immunized orally with a
synthetic microencapsulated peptide elicited antigen-specific T
cell proliferative responses. Similar studies can be performed in
mice fed the transgenic potatoes.
[0240] The frequency of Th1 and Th2 type cells in both systemic and
mucosa-associated tissues of mice fed transgenic HBsAg expressing
plants can also be analyzed. The frequency of Th1 or Th2 cells in
mucosal tissues such as Peyer's Patches could influence the isotype
specific responses that occur. Three approaches can be taken: (i)
cytokine-specific single cell assays to quantitate the number of
antigen-specific cells secreting a particular cytokine, (ii)
measurement of secreted cytokines using specific ELISA assays, and
(iii) cytokine specific PCR analysis. The first two approaches
permit determining the level of synthesis and secretion of the
various cytokines whereas the third approach will determine if
these are concomitant changes in mRNA production. The combination
of these approaches will allow determination if an increase in a
particular cytokine is a direct consequence of increase in cytokine
mRNA expression.
[0241] In Vitro Proliferation of Splenic and Peyer's Patches T
Cells. One week after the third feeding the animals are sacrificed,
the spleen collected, and the cells purified as described
previously (Pride, M. et al. 1993). The Peyer's Patches are
collected and cells dissociated as described above. The enriched T
cells (2.5.times.10.sup.5 cells per well) are plated in 96-well
flat-bottomed plates along with 5.times.10.sup.5 irradiated
syngeneic spleen cells as a source of antigen-presenting cells.
Following addition of antigen, the cells are cultured for 120 h as
described. Proliferation, as measured by [.sup.3H]thymidine
incorporation, are determined by liquid scintillation spectroscopy.
Results are expressed as the mean cpm of [.sup.3H]-TdR incorporated
of triplicate wells.
[0242] Enumeration of Cytokine producing T cells. Enumeration of
cytokine producing cells within in vitro restimulated
antigen-specific T cell cultures is determined by ELISPOT using
matched pairs anti-cytokine monoclonal antibodies
[0243] Cytokine specific ELISA assays. The amount of cytokines
produced in culture supernatants of spleen cells and Peyer's
Patches T cells is assessed by an ELISA (Current Protocols in
Immunology) using the same anti-cytokine mAbs as used in the
ELISPOT assays.
[0244] Cytokine-specific PCR analysis. For the detection of
IFN-.gamma., IL-2, IL-4, IL-5, and IL-6 specific mRNA in CD4+ T
cells (spleen cells and Peyer's Patches), a standard RT-PCR
amplification protocol is employed and modified as previously
described (Kiyono, H. et al. 1982). For the isolation of RNA, the
method of acid guanidium thiocyanate phenol chloroform extraction
procedure is used (Chomczynski & Sacchi, Anal. Biochem. 162:156
(1987)). RNA is extracted and then subjected to the
cytokine-specific RT-PCR using 2.5 U/.mu.L Superscript II Reverse
Transcriptase (Life Technologies). PCR products separated by
electrophoresis in 2% agarose gels are stained with ethidium
bromide (0.5 .mu.g/mL) and visualized under UV light.
[0245] For quantitation of IFN-.gamma. and IL-4-specific mRNA, a
RT-PCR has been adopted using recombinant mRNA (rcRNA) as internal
standard. A connected rcRNA for IFN-.gamma., IL-4, and .beta.-actin
has been constructed as described elsewhere (Wang et al. PNAS USA
86: 9717-9721 (1989)). The PCR reaction is conducted in 50 .mu.L of
PCR buffer, 3 mM MgCl.sub.2, 0.2 mM of each dNTPs, 30 pmol of mRNA
forward and reverse primers for IFN-.gamma., IL-4, and
.beta.-actin, 200 ng genomic DNA (spacer gene) and 2.5 units Taq
polymerase (Perkin-Elmer Cetus, Foster City, Calif.) at 85.degree.
C. Suitable primers are listed in Table 6. After heating at
94.degree. C. for 3 min, samples are cycled 30 times with a 30-s
denaturing step (94.degree. C.), a second annealing process
(59.degree. C.), and a 45-s extension step (72.degree. C.) in a
thermal cycler (Perkin-Elmer Cetus). A 5-min extension step
(72.degree. C.) is performed at the end of the procedure. The PCR
products are purified with the Wizard PCR Preps DNA Purification
System (Promega Corp., Madison, Wis.). After construction of this
synthetic gene containing IFN-.gamma., IL-4, and .beta.-actin, the
PCR product is inserted into a pGEM-T Vector containing the T7
polymerase promotor (Promega). Transformation is performed by using
Escherichia coli JM109. To obtain rcRNA, a purified synthetic gene
is linearized by Spe1 (Promega). To obtain purified rcRNA, the
transcripts are treated with RQIDNase (Promega) and then further
purified by using Oligotex-dT latex particles (Oligotex-dT mRNA
kits, Qiagen, Chatsworth, Calif.).
6TABLE 6 List of primers for specific PCR cytokine .beta.-Actin
(349 bp): 5'Primer 5'-TGGAATCCTGTGGCATCCATGAAAC-3' (SEQ ID NO:24)
3'Primer 5'-TAAAACGCAGCTCAGTAACAGTCCG-3' (SEQ ID NO:25) IFN-.gamma.
(460 bp): 5'Primer 5'-TGA ACG CTA CAC ACT GCA TCT TGG-3 (SEQ ID
NO:26) 3'Primer 5'-CGA CTC CTT TTC CGC TTC CTG AG-3' (SEQ ID NO:27)
IL-2(502 bp): 5'Primer 5'-ATG TAC AGC ATG CAG CTC GCA TC-3' (SEQ ID
NO:28) 3'Primer 5'-GGC TGG TTG AGA TGA TGC TTT GAC A-3' (SEQ ID
NO:29) IL-4 (399 bp): 5'Primer 5'-ATG GGT CTC AAC CCC CAG GAA
GTC-3' (SEQ ID NO:30) 3'Primer 5'-GCT CTT TAG GCT TTC CAG GAA
GTC-3' (SEQ ID NO:31) IL-5 (243 bp): 5'Primer 5'-ATG ACT GTG CCT
CTG TGC CTG GAG C-3' (SEQ ID NO:32) 3'Primer 5'-CTG TTT TTC CTG GAG
TAA ACT GGG G-3' (SEQ ID NO:33) IL-6(155 bp): 5'Primer 5'-CTG TTT
TTC CTG GAG TAA ACT GGG G-3' (SEQ ID NO:34) 3'Primer 5'-5'-TCT GAC
CAC AGT GAG GAA TGT CCA C-3' (SEQ ID NO:35) IL-10(237 bp): 5'Primer
5'-ACC TGG TAG AAG TGA TGC CCC AGG C-3' (SEQ ID NO:36) 3'Primer
5'-CTA TGC AGT TGA AGA TGT CAA A-3' (SEQ ID NO:37) TNF-.alpha.(354
bp): 5'Primer 5'-TTCTGTCTACTGAACTTCGGGGTGATCGGTCC-3' (SEQ ID NO:38)
3'Primer 5'-GTATGAGATAGCAAATCGGCTGACGGTGTGCC-3' (SEQ ID NO:39)
[0246] For competitive RT-PCR, total RNA is run with
cytokine-specific rcRNA as a competitive template. Aliquots of
total RNA (8-630 ng for IFN-.gamma., 11-900 ng for IL-4, and
0.19-15 .mu.g for .beta.-actin) are spiked with a series of diluted
rnRNA internal standards. A standard RT-PCR is then performed (see
Table 7). Quantitation is achieved by addition of 5 .mu.Ci of
[.sup.32P]dCTP (Amersham, Arlington Heights, Ill.) to the PCR
reaction mixture. Duchmann et al., DNA and Cell Biol. 12:217. 1993.
Finally, the PCR products are electrophoresed as described above.
The [.sup.32P]dCTP content of IFN-.gamma., IL-4, and
.beta.-actin-specific bands is determined by liquid scintillation
counting.
7 TABLE 7 RT Condition PCR Condition 42.degree. C. 15 min
95.degree. C. 2 min 1 cycle 99.degree. C. 5 min 95.degree. C. 1 min
60.degree. C. 1 min 35 cycle 5.degree. C. 5 min 60.degree. C. 7 min
1 cycle 4.degree. C. soak
Example 25
Effect of Detergent Concentration on Extraction of HBsAg from
Plants
[0247] A potato virus X (PVX) strain DX based plant virus vector
was used to express hepatitis B surface antigen (HBsAg) in plants.
The synthetic HBsAg gene, optimized for in planta expression, was
amplified by polymerase chain reaction from the plasmid psHB312
described in Example 7 under pHB115, using oligonucleotide primers
into which sites for the restriction enzymes ClaI and XhoI had been
introduced. The amplification product was digested with these
enzymes and the digestion product containing the HBsAg gene was
ligated to the nine kilobase pair fragment of the plasmid pDX10a
digested with the same enzymes. Plasmid pDX10a is a derivative of
pUC19 having ClaI/XhoI restriction sites that bracket the coat
protein coding sequence of the PVX genome. This produced a plasmid,
pDX10a-HBV6, that contained a full-length infectious cDNA clone of
PVX strain DX, under the control of a T7 promoter, in which the
coat protein gene of PVX was replaced with the gene for HBsAg. The
construct was designed so that HBsAg expression would be driven
through the production of a mRNA encoding HBsAg from the subgenomic
promoter that naturally directs the production of the subgenomic
mRNA for the PVX coat protein.
[0248] The pDX10a-HBV6 DNA was linearized with the restriction
enzyme SpeI and the linearized DNA transcribed in vitro with T7
polymerase using an Ambion T7 mMessage mMachine kit according to
the manufacturer's instructions. Transcription products were
manually inoculated onto Nicotiana benthamiana plants
transgenically expressing the PVX coat protein. The modified form
of the virus produced systemic infections on plants when
transgenically complemented for the deleted viral gene, the coat
protein. SDS-PAGE and Western blot analysis of extracts from
infected plants demonstrated the expression of two proteins that
were immunoreactive with HBsAg specific antiserum: these were
presumed to represent glycosylated and non-glycosylated forms of
the virally expressed HBsAg protein.
[0249] Purification of the in planta, virally expressed HBsAg
protein was attempted using a modified form of the procedure
described by Mason et al. (1992) to permit its characterization.
Systemically infected leaf tissue was homogenized in four volumes
of extraction buffer using a pestle and mortar. The homogenate was
centrifuged at 1000.times.g for 5 minutes, and the supernatant was
centrifuged at 27,000.times.g for 15 minutes. The 27,000.times.g
supernatant was centrifuged at 100,000.times.g for 1 hour. Aliquots
of the crude homogenate and supernatants from each of the
centrifugation steps were taken for SDS-PAGE and Western blot
analysis with HBsAg specific antiserum. Visual inspection of the
western blot showed that there was no significant pelleting of the
HBsAg during the first low speed centrifugation, but that there was
significant loss of the expressed protein during the second
centrifugation step and that the majority of the residual soluble
HBsAg was pelleted during the third high speed centrifugation. The
observation that substantial quantities of HBsAg were lost during
the intermediate speed centrifugation suggested that the protein
was inefficiently extracted with the buffer used, possibly because
of its known membrane associating characteristics. Therefore to
test whether extraction of the protein could be enhanced its
extraction was attempted with buffers containing different levels
of detergent.
[0250] Systemically infected leaf tissue was homogenized in two
volumes of buffer containing 0.1M sodium phosphate (pH 7.0) and
0.1M sodium ascorbate using a pestle and mortar. Aliquots of 5 mL
of the crude homogenate were taken and homogenized for a further 2
minutes in pestle and mortars with an equal volume of buffer
supplemented with either 0.2%, 1%, 2%, 5% or 10% Triton X-100, as a
representative non-ionic detergent. The homogenates were incubated
on ice for one hour and then subjected to centrifugation at
27,000.times.g for 15 minutes. Equal quantities of crude homogenate
and supernatants from each of the five extraction procedures were
taken for SDS-PAGE and western blot analysis with HBsAg specific
antiserum. Visual inspection of the western blot showed that in the
absence of detergent HBsAg was recovered with very low efficiency
in the supernatant after centrifugation, but that extraction with a
final concentration of 1% or higher Triton X-100 resulted in
efficient recovery. Thus, increasing the level of detergent up to
1% resulted in more efficient extraction of the desired
protein.
[0251] However the efficacy of HBsAg as an immunogen is dependent
upon its aggregation state, the particulate form being more
immunogenic that free protein. Therefore, HBsAg extracted with
0.1%, 0.5% and 1.0%, final concentration, Triton X-100 was further
analyzed by rate zonal centrifugation discontinuous 32 mL sucrose
gradients were made in 10 mM sodium phosphate (pH 7.0) and 0.15M
sodium chloride (8 mL each of 5%, 13.3%, 21.6% and 30% sucrose) and
left to diffuse overnight at 4.degree. C. 2 mL of the
27,000.times.g supernatants were loaded onto gradients and
centrifuged in a Sorvall AH629 rotor at 29,000 rpm for 6 hours at
5.degree. C. 2 mL fractions were collected from the three gradients
and aliquots analyzed by SDS-PAGE and Western blotting. Inspection
of the Western blot of the fractions from the gradient loaded with
material extracted with 1% Triton X-100 showed that virtually all
the HBsAg related protein was present in the four fractions from
the top of the gradient indicating that the HBsAg lipoprotein
complexes had been completely solubilized with this level of
detergent. In contrast, the Western blot of the fractions from the
gradient loaded with material extracted with 0.1% Triton X-100
showed a broad peak in the fractions from the middle of the
gradient indicating that the HBsAg extracted was in the desired
particulate form. Inspection of the western blot of the fractions
from the third sucrose gradient showed that the majority of the
HBsAg had been completely solubilized by extraction with this level
of detergent, as with the 1% Triton X-100.
[0252] Therefore, although the level of HBsAg extraction can be
improved by increasing the level of detergent above the 0.1% used
by Mason et al., use of 0.5% or higher concentrations of Triton
X-100 results in disruption of the particulate form of HBsAg that
may be most efficacious for use as a vaccine. Thus, levels of
detergent less than 0.5% should be used for antigen purification
unless it is intended to reconstitute particles or completely
solubilized protein is desired. In conclusion, levels of greater
than or equal to 0.1%, but less than 0.5% Triton X-100 appear
optimal for extraction of the particulate form of HBsAg expressed
in planta.
Example 26
[0253] An immune response to hepatitis B surface antigen (HBsAg)
can be obtained when the antigen is expressed in a plant and the
plant material is fed to the animal when the animal is
immunoreceptive to the HBsAg. An animal may be made immunoreceptive
toHBsAg by administering the plant material containing HBsAg in
conjunction with a suitable adjuvant. The animal may also be
immunoreceptive due to a prior, e.g. primary, immunization in which
case an immune response to HBsAg may be boosted in the animal by
feeding the animal the plant material containing the HBsAg.
[0254] The lines of potatoes expressing HBsAg selected for use in
accordance with examples 27 to 30 are transformed lines from S.
tuberosum L. c.v. Frito-Lay 1607 HB-7. The transformed lines are
designated FL-1607 HB-7 and HB114-16. To obtain these lines, the
HBsAg gene from a pMT-SA clone of a Chinese adr isolate of HBV was
inserted into transformation plasmid vectors (pHB-7 and pHB114)
that were mobilized into Agrobacterium tumefaciens (LBA4404) that
was then used to transform Solanum tuberosum L cv. "Frito-Lay
1607." The plasmid vectors used to construct the potato lines pHB-7
and pHB114-16 used in these examples both contain the gene for
neomycin phosphotransferase (NPTII, also known as APH(3')II). This
gene also becomes integrated into the potato genome and is
expressed in the potato cells. E. coli derived NPTII has been shown
to be biochemically equivalent to plant expressed NPTII. The E.
coli derived NPTII degrades rapidly under conditions of simulated
mammalian digestion and has been shown to cause no deleterious
effects when purified protein was fed to mice at up to 5 g/kg body
weight. The transformed FL-1607 was cured of the A. tumefaciens and
clonally propagated and the FL-1607 HB-7 and HB114-16 lines were
selected for their high level of HBsAg expression. Extracts of the
FL-1607 transformed lines were tested for HBsAg concentration by
ELISA techniques. HB-7 averaged 1100 ng HBsAg per gram of tuber
weight and HB114-16 averaged 8500 ng.+-.2100 ng of HBsAg per gram
of tuber weight.
[0255] The extracted HBsAg spontaneously forms virus like particles
(VLPs) that sediment at the same density as yeast derived HBsAg
VLPs. Electrophoretic mobility and western blot analysis indicate
that the tuber expressed antigen is indistinguishable from yeast
derived antigen.
[0256] The lines were clonally propagated to multiply the number of
plants and potted in soil to produce the tubers used in the
examples. The transformed lines were maintained by in vitro clonal
propagation.
[0257] The untransformed parent potato line, FL-1607, was
maintained by clonal propagation and potted to produce tubers that
were used as the placebo control. The tissues from these tubers do
not express any proteins that are reactive with reagents to detect
HBsAg.
Example 27
[0258] BALB/c mice were fed either peeled HB-7 potato slices or
control non-transformed potatoes. Each group of mice was given
three 5 gm feedings of potato on days 0, 7, and 14. The B subunit
of cholera toxin (CT) (Sigma) was used as an oral adjuvant. Ten
.mu.g of the adjuvant was placed on the potato slices (both
experimental and control) and consumed by the animals in
conjunction with the antigen. The animals fed HB-7 therefore
received an average of 5.5 .mu.g HBsAg per feeding, or a total
average does of 16.5 .mu.g HBsAg over the 3 feedings provided.
[0259] Mice fed HB-7 developed serum IgM and IgG responses that
were specific to HBsAg, whereas the group of animals fed control
non-transformed potatoes failed to make any antibodies. After the
third feeding an immune response was observed that peaked at around
70 mIU/ml. After a single i.p. inoculation of 0.5 .mu.g of yeast
derived recombinant HBsAg (rHBsAg) in alum (a normally
subimmunogenic dose) a strong secondary response was observed that
peaked at around 1700 mIU/ml. This response was predominantly IgG.
No primary or secondary response was seen in the control mice fed
non-transgenic potato and CT. Without the oral adjuvant, there was
no significant response to HBsAg.
Example 28
[0260] In the Frito-Lay 1607 HB114-16 line expression is driven
from the 35S promoter and average tuber expression in the lot used
for these experiments was 8.37 .mu.g HBsAg/gm wet weight of
tuber.
[0261] Groups of BALB/c mice (5/group) were fed either with
HB114-16 or with control non-transgenic potato. In both cases 10
.mu.g CT was added to the potato. The feeding was repeated one and
two weeks later. The total average dose to each mouse of HBsAg in
the transgenic potato was 125.55 .mu.g over the 3-week period.
Then, at the later of 70 days following the first feed or at 3-6
weeks after the initial immune response had returned to baseline
levels, the mice were immunized with a sub-immunogenic (0.5 .mu.g)
dose of rHBsAg (Merck) delivered in aluminum adjuvant by
subcutaneous (s.c.) injection.
[0262] At these dose levels an initial immune response was seen
immediately after the second feeding. This immune response
continued to rise and peaked at around 6 weeks at 100 mIU/ml. A
titer of only 10 mIU/ml in a human after a three dose of a current
licensed injectable hepatitis B vaccine is considered to reflect
successful immunization. The response returned to baseline at 13
weeks and at 16 weeks the animals were given the boost dose of
rHBsAg. This led to an immediate rise in immune titer to >3000
mIU/ml, which remained over 1000 mIU/ml for the remainder of the
experiment (40 weeks). This established that the primary
immunization generated antigen specific immune memory cells that
were rapidly and strongly recalled upon secondary boosting.
[0263] The control animals for this experiment that were given
non-transgenic potato+CT did not develop a significant immune
response to HBsAg and upon secondary challenge with the
subimmunogenic dose, as described above, no secondary response was
seen, establishing the specificity of the HBsAg results. Controls
given transgenic potato without CT only developed a low level, i.e.
10 mIU/ml titer for a primary response that returned to baseline in
only one week. Further challenge with the subimmunogenic dose as
described above only gave a secondary response of 50 mIU/ml and
return to only 10 mIU/ml in only two weeks.
Example 29
[0264] The transgenic potato has also been used to boost a
pre-existing sub-immunogenic dose of rHBsAg in mice. In this
experiment groups of BALB/c mice (5/group) were immunized with a
sub-immunogenic dose of rHBsAg (Merck) delivered s.c. in alum. 5
weeks later each mouse was fed either with HB114-16 or with control
non-transgenic potato. In both cases 10 .mu.g CT was added to the
potato. The feeding was repeated one and two weeks later. The total
average dose to each mouse was 125.55 .mu.g over the 3-week
period.
[0265] A secondary response developed that had started to appear at
the time of the third feeding and which rose to approximately 1000
mIU/ml 11 weeks after the initial priming immunization before
declining. In a control group no immune response developed in the
group fed the non-transgenic potato.
Example 30
[0266] Forty two human subjects testing free of HIV and being
previously immunized with a commercial HB vaccine and after an
extended time having anti-HBsAg titers below 115 mIU/ml, were fed
potatoes containing HBsAg or an HBsAg free potato control in a
randomized double blind study. When the code was broken, it was
determined that Group 1 was a control group that received three
doses of 100 grams of nontransgenic potato FL-1607. Group 2
received two doses of 100 grams each of transgenic potato FL-1607
HB114-16 and one dose of nontransgenic FL-1607 potato. Group 3
received three doses of 100 grams each of transgenic potato FL-1607
HB114-16.
[0267] Available pre-clinical data indicate that (1) on a weight
basis, mice freely consume of up to 25% of their body weight in
potato without evidence of toxicity and (2) a 50 .mu.g dose of
HBsAg in 5 gm of potato is immunogenic as a primary series with an
oral adjuvant. The available clinical data with other potato
vaccines indicate that (1) consumption of 100 gm of raw potato is
generally well tolerated and (2) on a weight basis, 100 gm consumed
by a 70 kg person would represent 0.14% of body weight. This amount
is approximately 178-fold less than has been consumed, by weight,
in mice in pre-clinical experiments.
[0268] Thus, in the example for humans, 100 to 110 gm of potato was
ingested by volunteers per dose. The clinical lot scheduled for use
in this study contained 8.5.+-.2.1 .mu.g of HBsAg per gm of potato.
Subjects who received two 100 gm doses of transgenic potato
received a total dose of 1,280 to 2,120 .mu.g of HBsAg and subjects
receiving three doses received a total of 1,920 to 3,180 .mu.g of
HBsAg over the course of 28 days.
[0269] On each day of dosing (days 0, 14 and 28) the appropriate
number of potatoes for each group (placebo and control) were
separately removed and processed into individual 100 to 110 gm
doses by pharmacy personnel using clean techniques. Briefly,
selected potatoes were washed, peeled, diced and placed into an
ice-cold water bath. Peeling of the potatoes was done to remove the
skin that contains the alkaloid solanine. This alkaloid can cause
abdominal discomfort or nausea and may cause a bitter taste.
Following peeling and dicing, 100 to 110 gm doses of potato was
weighed out for each study subject according to group assignment
and Subject Identification Number (SID). Peels and any unused
portions of potatoes were collected and processed for destruction.
Aliquots of potato for each study subject was kept under water to
prevent browning from oxidation between the time the potato was
diced until the study subject consumed it. An appropriate sample of
processed potato from each group at each feeding was retained and
frozen for further processing to verify antigen content.
[0270] The subjects were tested for anti-HBsAg titer on the days
shown in Tables 8, 9, and 10. The results clearly show an increased
response to the administered HBsAg antigen as a result of ingesting
of the genetically transformed potatoes. Over 60 percent of the
subjects receiving three doses of potatoes containing HBsAg showed
a significant increase in immune response. The tables clearly
indicate that, in many cases, ingesting of plant material
containing genetically expressed HBsAg can act as an effective
booster for primary HB vaccination. None of the control subjects
that received three doses of non-transgenic control potatoes had
any change in antibody titer over the entire course of the
observation.
8TABLE 8 Group 1 (Received 3 doses of Nontransgenic potato tuber)
Titer (lm/ml) Day Day Day Day Day Day Volunteers Day 0 Day 7 14 21
28 35 42 56 1 72 64 73 74 78 78 63 57 2 17 14 12 12 2 5 10 * 3 63
51 56 67 69 74 88 89 4 66 78 52 62 54 74 67 69 5 0 0 0 1 0 0 * 7 6
12 9 12 18 18 16 17 19 7 34 28 24 32 33 29 34 33 8 9 11 12 11 8 7 9
9 9 104 99 83 110 120 100 99 92 *No Sample Drawn
[0271]
9TABLE 9 Group 2 (Received 2 doses of Transgenic & 1 dose of
Nontransgenic potato tuber) Titer (mlU/ml) Day Day Day Day Day Day
Volunteers Day 0 Day 7 14 21 28 35 42 56 1 29 29 29 29 29 29 47 93
2 8 15 27 49 41 40 73 79 3 170 161 158 144 130 144 * 132 4 32 32 31
34 33 23 * 42 5 13 15 15 14 11 11 17 17 6 43 37 46 77 69 85 85 78 7
67 37 47 57 80 89 77 73 8 11 7 114 114 136 176 191 200 9 104 126
262 269 318 313 357 390 10 33 26 22 21 21 25 25 29 11 107 92 96 89
93 83 95 90 12 21 22 55 112 120 219 395 458 13 65 68 66 63 89 103
137 258 14 20 24 18 15 12 12 15 20 15 0 0 0 0 0 0 0 0 16 97 93 112
109 128 294 454 432 17 26 34 197 330 353 360 707 863 *No Sample
Drawn
[0272]
10TABLE 10 Group 3 (Received 3 doses of Transgenic potato tuber)
Titer (mlU/ml) Day Day Day Day Day Day Volunteers Day 0 Day 7 14 21
28 35 42 56 1 17 20 70 140 269 428 401 463 2 94 87 100 99 88 79 87
88 3 33 34 32 33 27 34 31 32 4 0 0 0 0 0 0 0 0 5 9 9 53 74 74 85 65
61 6 20 41 57 84 452 475 897 652 7 85 76 496 1212 3058 3572 4152
4526 8 13 19 19 15 28 14 20 21 9 120 236 282 390 605 667 1583 1717
10 9 11 14 13 13 18 11 15 11 0 0 0 0 0 0 0 0 12 72 77 137 270 349
523 1098 1226 13 85 76 84 74 111 215 175 163 14 40 35 39 71 119 122
330 430 15 56 51 59 85 252 407 520 745 16 115 213 511 1054 1964
3069 2966 3449
[0273]
Sequence CWU 1
1
41 1 681 DNA Hepatitis B virus misc_feature Hepatitis B surface
antigen 1 atggagaaca caacatcagg attcctagga cccctgctcg tgttacaggc
ggggtttttc 60 ttgttgacaa gaatcctcac aataccacag agtctagact
cgtggtggac ttctctcaat 120 tttctagggg gagcacccac gtgtcttggc
caaaattcgc agtccccaac ctccaatcac 180 tcaccaacct cttgtcctcc
aatttgtcct ggttatcgtt ggatgtgtct gcggcgtttt 240 atcatattcc
tcttcatcct gctgctatgc ctcatcttct tgttggttct tctggactac 300
caaggtatgt tgcccgtttg tcctctactt ccaagaacat caactaccag cacgggacca
360 tgcaagacct gcacgattcc tgctcaagga acctctatgt ttccctcttg
ttgctgtaca 420 aaaccttcgg acggaaactg cacttgtatt cccatcccat
catcttgggc tttcgcaaga 480 ttcctatggg agtgggcctc agtccgtttc
tcctggctca gtttactagt gccatttgtt 540 cagtggttcg tagggctttc
ccccactgtt tggctttcag ttatatggat gatgtggtat 600 tgggggccaa
gtctgtacaa catcttgagt ccctttttac ctctattacc aattttcttt 660
tgtctttggg tatacatttg a 681 2 226 PRT Hepatitis B virus
misc_feature Wild-type HBsAg amino acid sequece 2 Met Glu Asn Thr
Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln 1 5 10 15 Ala Gly
Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu 20 25 30
Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Ala Pro Thr Cys 35
40 45 Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr
Ser 50 55 60 Cys Pro Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu
Arg Arg Phe 65 70 75 80 Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu
Ile Phe Leu Leu Val 85 90 95 Leu Leu Asp Tyr Gln Gly Met Leu Pro
Val Cys Pro Leu Leu Pro Arg 100 105 110 Thr Ser Thr Thr Ser Thr Gly
Pro Cys Lys Thr Cys Thr Ile Pro Ala 115 120 125 Gln Gly Thr Ser Met
Phe Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp 130 135 140 Gly Asn Cys
Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Arg 145 150 155 160
Phe Leu Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Leu Ser Leu Leu 165
170 175 Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp
Leu 180 185 190 Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu
Tyr Asn Ile 195 200 205 Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe
Phe Cys Leu Trp Val 210 215 220 Tyr Ile 225 3 700 DNA Artificial
Sequence Plant optimized HBsAg sequence 3 cgaccatgga gaacacaaca
tcaggattct tgggacccct cttggtgctc caagctggat 60 tcttcttgtt
gacaagaatc ctcacaatcc cacaatcttt ggactcttgg tggacttctc 120
tcaacttctt gggaggagca cccacttgtc ttggccaaaa tagccaatcc ccaacctcca
180 accactcacc aacctcttgt cctccaattt gtcctggtta taggtggatg
tgtttgagga 240 ggttcatcat cttcctcttc atcctcctct tgtgcctcat
cttcttgttg gttcttttgg 300 actaccaagg tatgttgcca gtttgtcctc
tccttccaag aacatcaact actagcactg 360 gaccatgcaa gacttgcacc
atccctgctc aaggaacctc tatgttcccc tcttgttgtt 420 gtacaaagcc
ttctgatgga aattgcactt gtatccccat cccatcatct tgggcttttg 480
caagattctt gtgggagtgg gcctcagtga ggttctcttg gttgagcctc ttggtgccat
540 ttgttcaatg gtttgtggga ctttccccca ctgtttggct ttcagttatt
tggatgatgt 600 ggtattgggg accaagcctc tacaacatct tgagcccctt
cctccctctc ctcccaatct 660 tcttttgtct ttgggtgtac atctaagtct
tcgagctccc 700 4 6 PRT Artificial Sequence Microsomal retention
signal 4 Ser Glu Lys Asp Glu Leu 1 5 5 492 DNA Artificial Sequence
Plant optimized sequence for pre-S (pre-S1/S2) 5 atgggacaaa
atctttcaac cagcaatcct ttgggattct ttccagacca ccaacttgat 60
ccagccttca gagcaaacac tgcaaatcca gattgggact tcaatcccaa caaggacacc
120 tggccagatg ccaacaaggt gggagctgga gcatttggat tgggtttcac
cccaccacat 180 ggtggccttt tgggatggag ccctcaagct caaggcatct
tgcaaacttt gccagcaaat 240 ccacctcctg cctcaaccaa tagacaatca
ggaaggcaac ctaccccatt gtctccacct 300 ttgagaaaca ctcatcctca
agccatgcaa tggaactcaa caaccttcca ccaaactttg 360 caagatccca
gagtgagagg cttgtatttc cctgctggtg gctcaagctc aggaacagtg 420
aaccctgttt tgactactgc ctctcccttg tcctcaatct tcagcagaat tggagaccct
480 gctttgaaca tg 492 6 12 PRT Artificial Sequence Isolated peptide
homologous to "a" determinant of HBsAg 6 Ala Val Cys Thr Arg Gly
His Gly Ser Ser Leu Tyr 1 5 10 7 26 DNA Artificial Sequence
Synthetic oligonucleotide HBNco 7 catgccatgg agaacacaac atcagg 26 8
29 DNA Artificial Sequence Synthetic oligonucleotide HBSac 8
gccggagctc aaatgtatac ccaaagaca 29 9 30 DNA Artificial Sequence
Synthetic oligonucleotide aSEKDELs-F 9 atactctgag aaagatgagc
tatgagagct 30 10 24 DNA Artificial Sequence Synthetic
oligonucleotide aSEKDELs-R 10 ctcatagctc atctttctca gagt 24 11 65
DNA Unknown Sequence encoding soybean VSP "alpha-S" signal peptide
11 ccatggcaat gaaggtcctt gttttcttcg ttgctacaat tttggtagca
tggcaatgcc 60 atacc 65 12 107 DNA Unknown Sequence encoding 34
amino acid VSP "alpha-L" signal peptide 12 ccatggcaat gaaggtcctt
gttttcttcg ttgctacaat tttggtagca tggcaatgcc 60 atgcgtacga
tatgttccct ctccgaatga acactggcta tggtgcc 107 13 65 DNA Unknown
Sequence encoding 21 amino acid VSP "alpha-S" signal peptide 13
ccatggcaat gaaggtcctt gttttcttcg ttgctacaat tttggtagca tggcaatgcc
60 atacc 65 14 107 DNA Unknown Sequence encoding 34 amino acid VSP
"alpha-L" signal peptide 14 ccatggcaat gaaggtcctt gttttcttcg
ttgctacaat tttggtagca tggcaatgcc 60 atgcgtacga tatgttccct
ctccgaatga acactggcta tggtgcc 107 15 253 DNA Unknown Sequence
encoding 82 amino acids of pea rbcS 15 ccatggcttc tatgatatct
tcttccgctg tgacaacagt cagccgtgcc tctagggggc 60 aatccgccgc
aatggctcca ttcggcggcc tcaaatccat gactggattc ccagtgaaga 120
aggtcaacac ttgacattac ttccattaca agcaatggtg gaagagtaaa gtgcatgcag
180 gtgtggcctc caattggaaa gaagaagttt gagactcttt cctatttgcc
accattgacc 240 agagattcca tgg 253 16 25 DNA Artificial Sequence
Synthetic oligonucleotide PCR primer 5'TPSS 16 ggatccatgg
cttctatgat atctt 25 17 29 DNA Artificial Sequence Synthetic
oligonucleotide PCR primer 3'TPSS 17 ggatccatgg aatctctggt
caatggtgg 29 18 27 DNA Artificial Sequence Synthetic
oligonucleotide Mutagenic primer "Omega-Bam" 18 gatcggatcc
ttacaacaat taccaac 27 19 18 DNA Unknown Synthetic oligonucleotide
PCR primer "NOS" 19 cggcaacagg attcaatc 18 20 24 DNA Artificial
Sequence Synthetic oligonucleotide cleavage recognition site 20
atctctgaga aggatgagct ttaa 24 21 24 DNA Artificial Sequence
Synthetic oligonucleotide cleavage recognition site 21 gactcttcct
actcgaaatt taga 24 22 4 PRT Unknown Microsomal retention signal 22
Lys Asp Glu Leu 1 23 21 DNA Artificial Sequence Synthetic
oligonucleotide PCR primer TEV 23 gcattctact tctattgcag c 21 24 25
DNA Artificial Sequence Synthetic oligonucleotide Beta-actin
forward PCR primer 24 tggaatcctg tggcatccat gaaac 25 25 25 DNA
Artificial Sequence Synthetic oligonucleotide Beta-actin reverse
PCR primer 25 taaaacgcag ctcagtaaca gtccg 25 26 24 DNA Artificial
Sequence Synthetic oligonucleotide IFN-gamma forward PCR primer 26
tgaacgctac acactgcatc ttgg 24 27 23 DNA Artificial Sequence
Synthetic oligonucleotide INF-gamma reverse PCR primer 27
cgactccttt tccgcttcct gag 23 28 23 DNA Artificial Sequence
Synthetic oligonucleotide IL-2 forward PCR primer 28 atgtacagca
tgcagctcgc atc 23 29 25 DNA Artificial Sequence Synthetic
oligonucleotide IL-2 reverse PCR primer 29 ggctggttga gatgatgctt
tgaca 25 30 24 DNA Artificial Sequence Synthetic oligonucleotide
IL-4 forward PCR primer 30 atgggtctca acccccagga agtc 24 31 24 DNA
Artificial Sequence Synthetic oligonucleotide IL-4 reverse PCR
primer 31 gctctttagg ctttccagga agtc 24 32 25 DNA Artificial
Sequence Synthetic oligonucleotide IL-5 forward PCR primer 32
atgactgtgc ctctgtgcct ggagc 25 33 25 DNA Artificial Sequence
Synthetic oligonucleotide IL-5 reverse PCR primer 33 ctgtttttcc
tggagtaaac tgggg 25 34 25 DNA Artificial Sequence Synthetic
oligonucleotide IL-6 forward PCR primer 34 ctgtttttcc tggagtaaac
tgggg 25 35 25 DNA Artificial Sequence Synthetic oligonucleotide
IL-6 reverse PCR primer 35 tctgaccaca gtgaggaatg tccac 25 36 25 DNA
Artificial Sequence Synthetic oligonucleotide IL-10 forward PCr
primer 36 acctggtaga agtgatgccc caggc 25 37 22 DNA Artificial
Sequence Synthetic oligonucleotide IL-10 reverse PCR primer 37
ctatgcagtt gaagatgtca aa 22 38 32 DNA Artificial Sequence Synthetic
oligonucleotide TNF-alpha forward PCR primer 38 ttctgtctac
tgaacttcgg ggtgatcggt cc 32 39 32 DNA Artificial Sequence Synthetic
oligonucleotide TNF-alpha reverse PCR primer 39 gtatgagata
gcaaatcggc tgacggtgtg cc 32 40 226 PRT Unknown Plant optimized
HBsAg amino acid sequence 40 Met Glu Asn Thr Thr Ser Gly Phe Leu
Gly Pro Leu Leu Val Leu Gln 1 5 10 15 Ala Gly Phe Phe Leu Leu Thr
Arg Ile Leu Thr Ile Pro Gln Ser Leu 20 25 30 Asp Ser Trp Trp Thr
Ser Leu Asn Phe Leu Gly Gly Ala Pro Thr Cys 35 40 45 Leu Gly Gln
Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser 50 55 60 Cys
Pro Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe 65 70
75 80 Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu
Val 85 90 95 Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu
Leu Pro Arg 100 105 110 Thr Ser Thr Thr Ser Thr Gly Pro Cys Lys Thr
Cys Thr Ile Pro Ala 115 120 125 Gln Gly Thr Ser Met Phe Pro Ser Cys
Cys Cys Thr Lys Pro Ser Asp 130 135 140 Gly Asn Cys Thr Cys Ile Pro
Ile Pro Ser Ser Trp Ala Phe Ala Arg 145 150 155 160 Phe Leu Trp Glu
Trp Ala Ser Val Arg Phe Ser Trp Leu Ser Leu Leu 165 170 175 Val Pro
Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu 180 185 190
Ser Val Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Asn Ile 195
200 205 Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp
Val 210 215 220 Tyr Ile 225 41 164 PRT Unknown Plant optimized
pre-S (pre-S1/S2) amino acid sequence 41 Met Gly Gln Asn Leu Ser
Thr Ser Asn Pro Leu Gly Phe Phe Pro Asp 1 5 10 15 His Gln Leu Asp
Pro Ala Phe Arg Ala Asn Thr Ala Asn Pro Asp Trp 20 25 30 Asp Phe
Asn Pro Asn Lys Asp Thr Trp Pro Asp Ala Asn Lys Val Gly 35 40 45
Ala Gly Ala Phe Gly Leu Phe Gly Thr Pro Pro His Gly Gly Leu Leu 50
55 60 Gly Trp Ser Pro Gln Ala Gln Gly Ile Leu Gln Thr Leu Pro Ala
Asn 65 70 75 80 Pro Pro Pro Ala Ser Thr Asn Arg Gln Ser Gly Arg Gln
Pro Thr Pro 85 90 95 Leu Ser Pro Pro Leu Arg Asn Thr His Pro Gln
Ala Met Gln Trp Asn 100 105 110 Ser Thr Thr Phe His Gln Thr Leu Gln
Lys Pro Arg Val Arg Gly Leu 115 120 125 Tyr Phe Pro Ala Gly Gly Ser
Ser Ser Gly Thr Val Asn Pro Val Leu 130 135 140 Thr Thr Ala Ser Pro
Leu Ser Ser Ile Phe Ser Arg Ile Gly Asp Pro 145 150 155 160 Ala Leu
Asn Met
* * * * *