U.S. patent application number 10/706466 was filed with the patent office on 2004-04-29 for products and methods for gaucher disease therpy.
Invention is credited to Callahan, John W., Clarke, Joe T.R., Mahuran, Don J..
Application Number | 20040082535 10/706466 |
Document ID | / |
Family ID | 31498866 |
Filed Date | 2004-04-29 |
United States Patent
Application |
20040082535 |
Kind Code |
A1 |
Mahuran, Don J. ; et
al. |
April 29, 2004 |
Products and methods for gaucher disease therpy
Abstract
The invention relates to products and methods for medical
treatment of Gaucher disease and, in particular, an improved Gcc
DNA for insertion into any applicable expression vector for gene
therapy treatment. The invention includes an isolated Gcc DNA
molecule, wherein nucleic acid molecules have been modified at
cryptic splice sites to prevent or decrease splicing of mRNA
produced from the DNA molecule, while preserving the ability of the
DNA to express functional Gcc polypeptides.
Inventors: |
Mahuran, Don J.; (Toronto,
CA) ; Clarke, Joe T.R.; (Toronto, CA) ;
Callahan, John W.; (Mississauga, CA) |
Correspondence
Address: |
SYNNESTVEDT & LECHNER, LLP
2600 ARAMARK TOWER
1101 MARKET STREET
PHILADELPHIA
PA
191072950
|
Family ID: |
31498866 |
Appl. No.: |
10/706466 |
Filed: |
November 12, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10706466 |
Nov 12, 2003 |
|
|
|
09586216 |
Jun 2, 2000 |
|
|
|
6696272 |
|
|
|
|
60137598 |
Jun 3, 1999 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/366; 536/23.2 |
Current CPC
Class: |
C12N 9/2402 20130101;
A01K 2217/05 20130101; C12Y 302/01045 20130101; A61K 48/005
20130101 |
Class at
Publication: |
514/044 ;
435/366; 536/023.2 |
International
Class: |
A61K 048/00; C07H
021/04; C12N 005/08 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 2, 1999 |
CA |
2,272,055 |
Claims
We claim:
1. An isolated Gcc DNA molecule, wherein the DNA molecule has a
modification in at least one nucleotide that disrupts a splicing
consensus sequence and prevents splicing of mRNA produced from the
DNA molecule, while preserving the ability of the DNA to express
active Gcc.
2. The DNA molecule of claim 1, wherein the modification impairs a
consensus nucleotide sequence needed to induce splicing.
3. The DNA molecule of claim 2, wherein the DNA molecule is
modified at two cryptic splice sites.
4. The DNA molecule of claim 1 or 3, comprising a mutation in the
3' junction site.
5. The DNA molecule of claim 4, wherein the mutation is as shown in
the 3' junction site in Table 1, or a functionally equivalent
mutation.
6. The DNA molecule of claim 1 or 3, comprising a mutation in the
5' splice junction site
7. The DNA molecule of claim 6, wherein the mutation is as shown in
the 5' junction site in Table 1, or a functionally equivalent
mutation.
8. The DNA molecule of claim 1, comprising all or part of the
nucleotide sequence shown in FIG. 4(b).
9. A vector comprising the DNA molecule of any of claims 1 to
8.
10. The vector of claim 9, comprising a promoter that is functional
in a mammalian cell.
11. mRNA produced from the DNA molecule of any of claims 1 to 8 or
the vector of claim 9 or claim 10.
12. A method of medical treatment of Gaucher disease in a mammal,
comprising administering to the mammal an effective amount of the
nucleic acid molecule of any of claims 1 to 8 or the vector of
claim 9 or claim 10 and expressing an effective amount of the
polypeptide encoded by the nucleic acid molecule for alleviating
clinical symptoms of Gaucher disease.
13. A host cell, or progeny thereof, comprising the nucleic acid
molecule of any of claims 1 to 8 or the vector of claim 9 or claim
10.
14. The host cell of claim 13, selected from the group consisting
of a mammalian cell, a human cell and a Chinese Hamster Ovary
cell.
15. A method for producing a recombinant host cell capable of
expressing a Gcc nucleic acid molecule, the method comprising
introducing into the host cell the vector of claim 9 or 10.
16. A method for expressing a Gcc polypeptide in the host cell of
claim 13 or 14 comprising culturing the host cell under conditions
suitable for DNA molecule expression.
17. A method for producing a transgenic cell that expresses
elevated levels of Gcc polypeptide relative to a non-transgenic
cell, comprising transforming a cell with the vector of claim 9 or
10.
18. An isolated polypeptide encoded by and/or produced from the
nucleic acid molecule of any of claims 1 to 8, or the vector of
claim 9 or 10.
19. A method of producing a genetically transformed cell which
expresses or overexpresses a Gcc polypeptide, comprising: (a)
preparing a Gcc nucleic acid molecule according to any of claims
1-18; (b) inserting the nucleic acid molecule in a vector so that
the nucleic acid molecule is operably linked to a promoter; (c)
inserting the vector into a cell.
20. A transgenic cell produced according to the method of claim
19.
21. A pharmaceutical composition, comprising a carrier and (i) the
nucleic acid molecule of any of claims 1 to 8 (ii) the vector of
claims 9 or 10 or (iii) Gcc polypeptide produced from (i) or (ii),
in an effective amount for reducing clinical symptoms of Gaucher
disease.
22. The composition of claim 21, wherein the carrier comprises a
liposome.
Description
FIELD OF THE INVENTION
[0001] The invention relates to products and methods for medical
treatment of Gaucher disease and, in particular, nucleic acid
molecules, polypeptides and vectors for polypeptide or gene therapy
treatment.
BACKGROUND OF THE INVENTION
[0002] Gaucher disease is a lysosomal storage disease caused by the
deficiency of functional glucocerebrosidase (Gcc) enzyme. Gcc is
present in all cell types. The defective enzyme cannot break down a
fatty substance, glucocerebroside, which is an important component
of cell membranes. The fat accumulates in macrophages (which are
known as the "Gaucher cells"). The fat-laden macrophages are found
typically in the liver, spleen, bone marrow and lungs. The amount
of the enzyme deficiency varies from person to person as do the
symptoms. Some patients may show no clinical symptoms, while others
may die from the disease. The symptoms of the disease and mutant
forms of Gcc that cause Gaucher disease are described, for example,
in U.S. Pat. No. 5,266,459 (Beutler) and U.S. Pat. No. 5,234,811
(Beutler and Sorge).
[0003] There are therapies for Gaucher disease. Ceredase is a form
of the Gcc enzyme from placenta that is able to metabolize the fat
in Gaucher cells. The enzyme restores normal function to a Gaucher
cell. The amount of enzyme used in treatment varies. As much as
30-60 units per kilogram of bodyweight (U/kg/bw) may be given every
other week. Positive results have been reported with 2.3 U/kg/bw
given three times a week. Lower doses, such as 1-5 U/kg/bw twice
weekly, have also been used with success, but this is less
frequent. The intarcellular half life of the enzyme is up to 60
hours. A large number of placentas are needed to make sufficient
Ceredase, so this form of therapy is very expensive. It has been
almost completely replaced by treatment with a recombinant form of
the enzyme, Cerezyme but this therapy is also expensive. Cerezyme
is dispensed as a powder whereas Ceredase comes as a liquid.
Sterile water must be added to the Cerezyme bottle to dissolve the
powder. The shelf life of the drugs is short (<3 months), and
splitting doses is cumbersome and wasteful. Allergic reactions to
Ceredase are common, but rarely life-threatening. Adverse reactions
to Cerezyme appear to be less common, but experience with the drug
is still very limited.
[0004] Gcc has been structurally modified in order to obtain
improved pharmacokinetics over naturally occurring Gcc (which is
derived from placenta). These modifications include amino acid
modifications as well as carbohydrate changes. For example, U.S.
Pat. No. 5,549,892 discloses a recombinant polypeptide that differs
from naturally occurring Gcc by the presence of histidine in place
of arginine at position 495. In another embodiment, the
carbohydrate remodeled recombinant Gcc has increased fucose and
N-acetyl glucosamine residues compared to remodeled naturally
occurring Gcc. The increased pharmacokinetics of these compounds
provides a therapeutic effect at doses that are lower than those
required using remodeled, naturally occurring Gcc. However, this
Gcc remains expensive to provide. Furthermore, improved
pharmacokinetics does not necessarily compensate for inadequate
bioavailability of Gcc.
[0005] Gene therapy has been administered to Gaucher patients. All
experiments carried out to date have been undertaken using ex vivo,
retrovirus-mediated transfection, which requires sophisticated
laboratory facilities and is very expensive. Although transgene
expression could be demonstrated in mice undergoing this procedure,
experiments in humans have been disappointing. No clinically
significant Gcc gene expression has been reported in humans
undergoing retrovirus-mediated transfection with existing Gcc gene
preparations. One problem of gene therapy is in reproducibly
obtaining high-level, tissue-specific and enduring expression from
genes transferred into cells. Currently, there is no suitable gene
therapy vector that expresses at a high level for Gaucher disease
gene therapy.
SUMMARY OF THE INVENTION
[0006] The invention includes a modified Gcc cDNA insert that can
be inserted into any mammalian expression vector for use in the
medical treatment of Gaucher disease. In a preferred embodiment,
the modified cDNA was inserted into a vector named pINEX2.0 which
was then used to transfect mammalian cells. When pINEX2.0
containing the unmodified Gcc cDNA coding sequence, pINEX5'GCC3',
was transfected into cells, their RNA purified from cell lysates
and subjected to reverse transcription followed by the polymerase
chain reaction (RT-PCR), two distinct major bands were observed
after agarose gel electrophoresis (FIG. 1). Isolation, purification
and sequencing of the RT-PCR products identified a major aberrantly
spliced mRNA species which encodes only a 19 amino acid peptide
before encountering a STOP codon. Surprisingly, this aberrant
splicing event occurred completely within the Gcc cDNA coding
sequence (FIG. 2), i.e. no vector sequences were involved. Site
directed mutagenesis was performed to modify the nucleotide
sequence in the region of aberrant mRNA splicing without affecting
polypeptide coding (FIG. 3). Modifications were aimed at disrupting
the known consensus sequences for RNA-splicing (Krawczak et al.
1992). The effectiveness of these modifications were tested by
transient transfection into CHO cells, followed by our
human-specific immunoprecipitation assay for Gcc. Data (n=18)
indicate a 5.+-.1 (Std. Error)-fold increase in Gcc activity was
achieved when the modified replaced the unmodified insert in the
pINEX2.0 expression vector.
[0007] The invention relates to an isolated Gcc DNA molecule,
wherein the DNA molecule has a modification in at least one
nucleotide that disrupts a splicing consensus sequence and prevents
splicing of mRNA produced from the DNA molecule, while preserving
the ability of the DNA to express active Gcc. The modification
impairs a consensus nucleotide sequence needed to induce splicing.
The DNA molecule is preferably modified at two cryptic splice
sites. The DNA preferably includes a mutation in the 3' junction
site. In one embodiment, the mutation is as shown in the 3'
junction site in Table 1, or a functionally equivalent mutation. In
another embodiment, the DNA molecule includes a mutation in the 5'
splice junction site. The mutation is preferably as shown in the 5'
junction site in Table 1, or a functionally equivalent
mutation.
[0008] The DNA molecule preferably includes all or part of the
nucleotide sequence shown in FIG. 4(b).
[0009] Another aspect of the invention relates to a vector
including a DNA molecule of the invention. The vector preferably
includes a promoter that is functional in a mammalian cell.
[0010] The invention also includes mRNA produced from the DNA
molecule or vector of the invention.
[0011] Another aspect of the invention relates to a method of
medical treatment of Gaucher disease in a mammal, including
administering to the mammal an effective amount of a nucleic acid
molecule of the invention or a vector of the invention and
expressing an effective amount of the polypeptide encoded by the
nucleic acid molecule for alleviating clinical symptoms of Gaucher
disease.
[0012] The invention includes a host cell, or progeny thereof,
including a nucleic acid molecule of the invention. The host cell
is preferably selected from the group consisting of a mammalian
cell, a human cell and a Chinese Hamster Ovary cell. The invention
also includes a method for producing a recombinant host cell
capable of expressing a Gcc nucleic acid molecule, the method
including introducing into the host cell a vector of the invention.
The invention also includes a method for expressing a Gcc
polypeptide in a host cell including culturing the host cell under
conditions suitable for DNA molecule expression. Another aspect of
the invention relates to a method for producing a transgenic cell
that expresses elevated levels of Gcc polypeptide relative to a
non-transgenic cell, including transforming a cell with a vector of
the invention.
[0013] The invention includes an isolated polypeptide encoded by
and/or produced from a nucleic acid molecule of th invention, or a
vector of the invention.
[0014] The invention includes a method of producing a genetically
transformed cell which expresses or overexpresses a Gcc
polypeptide, including: a) preparing a Gcc nucleic acid molecule
according to any of claims 1-18; b) inserting the nucleic acid
molecule in a vector so that the nucleic acid molecule is operably
linked to a promoter; c) inserting the vector into a cell. The
invention includes a transgenic cell produced according to the
method of the invention.
[0015] The invention also includes a pharmaceutical composition,
including a carrier and (i) a nucleic acid molecule of the
invention (ii) a vector of the invention or (iii) Gcc polypeptide
produced from (i) or (ii), in an effective amount for reducing
clinical symptoms of Gaucher disease. The carrier preferably
carrier includes a liposome.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Preferred embodiments of the invention will be described in
relation to the drawings in which:
[0017] FIG. 1. Separation of RT-PCR products from CHO cell
permanently transfected with pINEX5'-GCC-3'.
[0018] FIG. 2. Diagrammatic Representation of possible RT-PCR
products representing mRNA splice variants from
pINEX-5'-GCC-3'.
[0019] FIG. 3. Comparison of consensus splice site donor/acceptor
site and "Cryptic" splice sites in Gcc cDNA. Sequences of (a)
unmodified Gcc cDNA contained in pINEX5'Gcc3' (b) In a preferred
embodiment, this sequence represents modified Gcc cDNA contained in
pINEX-WEIRD. The translated amino acid sequence for either the
modified or unmodified Gcc cDNAs is also given, note that the
modified nucleotides had no effect on the amino acid sequence.
[0020] FIG. 4. (a) The sequences of the aberrantly processed
transcript from the unmodified Gcc cDNA insert in pINEX5'Gcc3' and
its translated polypeptide (b) Modified DNA and its translated
polypeptide. In a preferred embodiment, this sequence represents
modified Gcc cDNA.
DETAILED DESCRIPTION OF THE INVENTION
[0021] The invention satisfies the need for a DNA (preferably a
cDNA) that when inserted into any mammalian expression vector
transcribes RNA that is resistant to aberrant processing in the
transfected or transduced target cells and thus, is much more
likely to translate the functional full length Gcc protein.
Therefore, such a modified insert would improve the levels of Gcc
expression when used in any vectors designed for in vivo or ex vivo
gene therapy treatments of Gaucher disease. As well, when inserted
into any efficient mammalian expression vector, such as pINEX2.0,
the modified Gcc cDNA as compared to the unmodified cDNA will
increase the production levels of recombinate Gcc polypeptide for
use in enzyme replacement therapy for Gaucher disease. Thus, the
modified insert directs a higher level of Gcc expression through a
mechanism that is independent of the mammalian expression vector
used whether in vivo or in vitro. The modified insert is safe as
preferably no change in the amino acid sequence of Gcc is encoded
by the nucleotide changes, and should confer a sustained and
appropriate level of cell-specific expression for gene therapy when
coupled with the appropriate vector and transfection or
transduction methodologies. The expressed DNA insert is preferably
a modified Gcc cDNA or a modified fragment of a Gcc cDNA that
express a polypeptide having Gcc activity which is effective for
treatment of Gaucher disease. The DNA is modified to prevent
aberrant cellular splicing of its mRNA produced when expressed in
mammalian cells. The modified DNA insert may be used with any
expression vector to transfect or transduce any mammalian cell
type, such as CHO cells for the expression of human Gcc for enzyme
replacement. These would also include human stem cells for ex vivo
gene therapy or macrophages for in vivo gene therapy.
[0022] The invention also includes the methods of making the
modified DNA. The methods may be applied to a Gcc DNA from any
source that requires modification to avoid undesirable splicing
including humans, other mammals or synthetic DNA.
[0023] During the search to improve the efficiency of human Gcc
expression it was determined that a major amount of the RNA
transcribed from any vector was aberrantly spliced due to cryptic
5' and 3' splice sites contained in the human Gcc cDNA (FIGS. 1
& 2). Since this RNA species encodes only a 19 amino acid
peptide, it is far less stable than the properly spliced product
encoding the complete 536 residues of Gcc (Maquat 1996), and
therefore transcribed at a much higher level than is indicated from
our steady-state RT-PCR data (FIG. 1). We modified the two cryptic
sites in a manner that conserved the wild type amino acid sequence
while destroying the consensus nucleotide sequences needed to
induce splicing (FIG. 3). Transient expression of this modified
insert indicated a 5-fold increase in Gcc expression. Such an
increase in expression efficiency is not only valuable for any gene
therapy approach, but also useful in decreasing the cost of enzyme
replacement since the enzyme source is now Gcc-transfected
mammalian cells.
[0024] Treatment using any vector containing a modified insert to
prevent aberrent transcript processing (by gene therapy or by
administration of polypeptide produced from a vector) will lower
the cost of the present enzyme replacement therapy (currently as
much as about US$100,000 per yr. for a patient) by increasing the
yield of functional Gcc protein.
[0025] The modified insert when used with any appropriate
expression vector is also used to direct the expression of Gcc for
use in research and characterization of the enzyme's function.
[0026] Other useful DNA inserts include a nucleic acid molecule
having at least about: 50%, 60%, 70%, 80%, 90%, 95%, 99% or 99.5%
sequence identity to the modified Gcc nucleic acid molecule (the
Gcc sequence in FIG. 4(b)) wherein the molecule having sequence
identity has a modification in at least one nucleotide (preferably
two nucleotides) that disrupts a splicing consensus sequence and
prevents splicing of mRNA while it encodes a polypeptide having Gcc
activity. Changes in the Gcc nucleotide sequence which result in
production of a chemically equivalent (for example, as a result of
redundancy of the genetic code) or chemically similar amino acid
(for example where sequence similarity is present), may also be
made to produce high levels of unspliced transcript from the Gcc
cDNA for therapeutic use. The DNA molecule or DNA molecule fragment
may be isolated from a native source (in sense or antisense
orientations) and modified or synthesized (with or without
subsequent modification). It may be a mutated native or synthetic
sequence or a combination of these in order to prevent or decrease
aberrently spliced transcripts.
[0027] Selection of Vector
[0028] Separating the Gcc activity derived from transfected human
cDNA from the endogenous Gcc activity of the host cells, e.g. CHO,
was done to determine the efficiency of expression vectors. A high
level of expression is needed not only for any in vivo or ex vivo
gene therapy approach, but also for the efficiency of producing Gcc
for enzyme replacement therapy now being done in transfected cells
(Grabowski et al. 1995). We have developed an immunoprecipitation
assay that is specific for the human enzyme and have used it to
evaluate several expression vectors. The vector producing the
highest level of Gcc in transiently transfected CHO cells was
pINEX2.0 from INEX Pharmaceuticals. The vector contains a CMV-based
promoter and a potential intron prior to the initiating ATG of the
Gcc cDNA. In general our results indicated that a CMV-based
promoter gave the highest level of expression and that the
placement of the vector's intron at the 5' end of th insert was
supperior to placing it at the 3' end. Other suitable vectors will
be apparent to a skilled person.
[0029] After some initial modifications to the 5' untranslated end
of the cDNA construct to ensure a match with the consensus
sequences for protein initiation (Kozak 1987) and the 3' end to
eliminate most of the untranslated nucleotides prior to the
vector's polyadenylation signal, a lysate from transiently
transfected CHO cells still produced low levels of Gcc specific
activity, requiring our immunoprecipitation assay to detect the
increase in human activity in the cells' total Gcc pool. A line of
permanently-transfected CHO cells was prepared in order to analyzed
the sequence(s) of the Gcc mRNA(s) being transcribed from the
expression vector.
[0030] Identification and Characterization of Differentially
Spliced RNA
[0031] Cells Expressing Differentially Spliced RNA
[0032] A CHO cell line was permanently co-transfected with the
pINEX-5'-GCC-3' construct and a construct containing a selectable
marker, pREP10. After selection and isolation of individual clones,
the clones were assayed to determine specific activity of Gcc (in
nmole/hr/mg total lysate protein). One clone, termed A7, was grown
in larger scale and RNA isolated from it. A reverse transcription
reaction followed by PCR, RT-PCR, was performed on total cellular
RNA from CHO control cells and A7 clone cells. Following agarose
gel electrophoresis, two major bands were observed (see FIG.
1).
[0033] Restriction Digest Analysis
[0034] The major bands of the RT-PCR reaction were
electrophoretically separated on a larger scale and the band(s)
excised. The purified cDNA was ligated into the pCR2.1 cloning
vector. Restriction digest analysis of the clones obtained using
Stu I and Eco RI, revealed a series of different patterns,
consistent with possible aberrant splicing (data not shown).
[0035] Sequencing Analysis
[0036] Sequencing of representative clones of each pattern,
obtained from the high- and/or low-molecular weight bands, revealed
a number of differentially spliced products. In the high-molecular
weight band, 5 out of 10 clones contained product that was spliced
at the upstream site in the vector only, producing wild-type
message. One out of 10 contained a completely unspliced product,
and another 1 out of 10 contained a product with a restriction map
consistent with both upstream (vector) and downstream (insert)
splice events taking place (FIG. 2). Remaining clones contained
unidentifiable restriction maps and were therefore not sequenced.
Sequencing and restriction digest analysis of the low-molecular
weight band revealed that in 7 of 10 clones both splices had taken
place, and in 2 out of 10 only the upstream splice event (wild-type
message) had occurred.
[0037] Sequencing results confirmed that the major alternatively
spliced species resulted from the removal of sequences within the
Gcc cDNA itself, through the recognition of cryptic 5' and 3'
splice sites roughly corresponding to the known consensus sequences
that induce RNA splicing in mammalian cells (Krawczak et al. 1992).
The deduced amino acid sequence from this RNA species predicts a
reading frame shift after Arg.sup.17 and an early stop two codons
later (FIG. 3). This would encode only a 19 amino acid peptide
lacking even a complete signal sequence, necessary for targeting
the protein to the cell's endoplasmic reticulum. In order to
eliminate aberrant splicing, the Gcc cDNA was modified by
site-directed mutagenesis to alter some of the critical nucleotides
making up the consensus sequences (Krawcza et al. 1992) to ensure
that the cryptic splice sites no longer be recognized by the RNA
processing mechanism. Care was taken to preserve the amino acid
coding sequence. FIG. 3 shows the consensus sequence for the 5' or
3' splice junctions (Krawczak et al. 1992), the original nucleotide
sequence of the Gcc cDNA, the deduced amino acid sequence, and the
modifications undertaken to destroy the consensus splicing
sequences. Other modifications to destroy the consensus splicing
sequences will be apparent.
[0038] Transfection Experiments
[0039] Eighteen independent transient transfection experiments were
performed to compare Gcc expression levels between pINEX-5'-GCC-3'
to pINEX-WEIRD. After correcting for transfection efficiency with
.beta.-galactosidase (see Methods), pINEX-WEIRD produced 5.+-.1
(standard error) fold higher levels of Gcc activity (see example in
Table 2).
[0040] Future work will confirm that all aberrent processing of the
Gcc transcript from the modified Gcc cDNA is eliminated. If not,
other modifications based on the known consensus splice-sites
sequences will be undertaken.
[0041] Modified DNA/DNA Having Sequence Identity
[0042] Many modifications may be made to the vector and Gcc DNA
sequences and these will be apparent to one skilled in the art. The
invention includes nucleotide modifications of the sequences
disclosed in this application (or fragments thereof) that are
capable of expressing Gcc in in vivo or in vitro cells. For
example, the regulatory sequences may be modified or a nucleic acid
sequence to be expressed may be modified using techniques known in
the art. Modifications include substitution, insertion or deletion
of nucleotid s or altering the relativ positions or order of
nucleotides. The invention includes DNA which has a sequenc with
sufficient identity to a nucleotide sequence described in this
application to hybridize under moderate to high stringency
hybridization conditions. Hybridization techniques are well known
in the art (see Sambrook et al. Molecular Cloning: A Laboratory
Manual, Most Recent Edition, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.). High stringency washes have low salt
(preferably about 0.2% SSC), and low stringency washes have high
salt (preferably about 2% SSC). A temperature of about 37.degree.
C. or about 42.degree. C. is considered low stringency, and a
temperature of about 50-65.degree. C. is high stringency. The
modified inserts encoding Gcc of the invention also include DNA
molecules (or a fragment thereof) having at least 50% identity, at
least 70% identity, at least 80% identity, at least 90% identity,
at least 95% identity, at least 96% identity, at least 97%
identity, at least 98% identity or, most preferred, at least 99%,
99.5% or 99.8% identity to a modified Gcc nucleic acid molecule
acid as shown in FIG. 4(a), which have a modified consensus
sequence to prevent splicing and which are capable of expressing
DNA molecules in vivo or in vitro. Identity refers to the
similarity of two nucleotide sequences that are aligned so that the
highest order match is obtained. Identity is calculated according
to methods known in the art. For example, if a nucleotide sequence
(called "Sequence A") has 90% identity to the Gcc sequence in FIG.
4(b)], then Sequence A will be identical to the referenced portion
of FIG. 4(b) except that Sequence A may include up to 10 point
mutations (such as deletions or substitutions with other
nucleotides) per each 100 nucleotides of the referenced portion of
FIG. 4(b). The invention also includes DNA sequences which are
complementary to the aforementioned sequences. "Sequence identify"
may be determined, for example, by the Gap program. The algorithm
of Needleman and Wunsch (1970 J Mol. Biol. 48:443-453) is used in
the Gap program.
[0043] The DNA has a modification in at least one nucleotide that
disrupts a splicing consensus sequence and prevents splicing of
mRNA while it encodes a polypeptide having Gcc activity. This means
an enzyme that can both convert the natural substrate,
glucocerebroside (D-glucosylceramide), to ceramide and glucose
under the appropriate conditions, and also hydrolyzed an artificial
substrate, 4-methylumbelliferyl-.alpha.-D-glucopyranoside, at a
rate of greater than 10 pmoles/hr/mg of purified Gcc
polypeptide.
[0044] Functionally Equivalent Nucleic Acid Molecules Identified by
Hybridization
[0045] Other functionally equivalent forms of the modified Gcc DNA
of the invention can be identified using conventional DNA-DNA or
DNA-RNA hybridization techniques. Thus, the present invention also
includes nucleotide sequences that hybridize to the sequence in
FIG. 4(b) or its complementary sequence, wherein the molecule that
hybridizes to the Gcc portion in 4(b) has a modification in at
least one nucleotide (more preferably at least two nucleotides)
that disrupts a splicing consensus sequence and prevents aberrant
splicing of mRNA while it encodes a polypeptide having Gcc
activity. Such nucleic acid molecules preferably hybridize to the
Gcc sequence in FIG. 4(b) under moderate to high stringency
conditions For example, high stringency washes have low salt
(preferably about 0.2% SSC), and low stringency washes have high
salt (preferably about 2% SSC). A temperature of about 37.degree.
C. or about 42.degree. C. is considered low stringency, and a
temperature of about 50-65.degree. C. is high stringency (see
Sambrook et al. Molecular Cloning: A Laboratory Manual, Most Recent
Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.).
[0046] A nucleic acid molecule is considered to be functionally
equivalent to the modified Gcc nucleic acid molecules of the
present invention if the nucleic acid molecule has a modification
in at least one nucleotide that disrupts a splicing consensus
sequence and prevents splicing of mRNA while it encodes a
polypeptide having Gcc activity (Gcc activity means an enzyme that
can both convert the natural substrate, glucocerebroside
(D-glucosylceramide), to ceramide and glucose under the appropriate
conditions, and also hydrolyzed an artificial substrate,
4-methylumbelliferyl-.beta.-D-glucopyranoside, at a rate of greater
than 10 .mu.moles/hr/mg of purified Gcc polypeptide.).
[0047] Cells Containing a Vector of the Invention
[0048] The invention relates to a host cell (isolated cell in vitro
or a cell in vivo, or a cell treated ex vivo and returned to an in
vivo site) containing a vector and modified Gcc sequence of the
invention. The preparation of transformed cells is done according
to known techniques (see Materials and Methods for example of CHO
cells containing a vector). The invention includes methods of
expressing Gcc in the cell.
[0049] Pharmaceutical Compositions
[0050] The pharmaceutical compositions of this invention used to
treat patients having Gaucher Disease could include an acceptable
carrier, auxiliary or excipient. Polypeptides may be administered
in pharmaceutical compositions in enzyme replacement therapy or in
gene therapy.
[0051] The pharmaceutical compositions can be administered by ex
vivo and in vivo methods such as electroporation, DNA
microinjection, liposome DNA delivery, and virus vectors that have
RNA or DNA genomes including retrovirus vectors, lentivirus
vectors, Adenovirus vectors and Adeno-associated virus (MAV)
vectors. Dosages to be administered depend on patient needs, on the
desired effect and on the chos n route of administration. The
vectors may b introduced into the cells or their precursors using
in vivo deliv ry vehicles such as liposomes or DNA or RNA virus
vectors. They may also be introduced into these cells using
physical techniques such as microinjection or chemical methods such
as coprecipitation. The vector may be introduced into any mammalian
cell type, such as CHO cells or human cells.
[0052] The pharmaceutical compositions can be prepared by known
methods for the preparation of pharmaceutically acceptable
compositions which can be administered to patients, and such that
an effective quantity of the vector or polypeptide is combined in a
mixture with a pharmaceutically acceptable vehicle. Suitable
vehicles are described, for example in Remington's Pharmaceutical
Sciences (Remington's Pharmaceutical Sciences, Mack Publishing
Company, Easton, Pa., USA).
[0053] On this basis, the pharmaceutical compositions could include
an active compound or substance, such as a polypeptide, in
association with one or more pharmaceutically acceptable vehicles
or diluents, and contained in buffered solutions with a suitable pH
and isoosmotic with the physiological fluids. The methods of
combining the vectors with the vehicles or combining them with
diluents is well known to those skilled in the art. The composition
could include a targeting agent for the transport of the active
compound to specified sites within the mammalian cells.
[0054] Method of Medical Treatment of Gaucher Disease
[0055] Any vectors containing the DNA molecules of the invention
may be administered to mammals, preferably humans, in gene therapy
using techniques described below. The polypeptide produced from the
modified inserts may also be administered to mammals, preferably
humans, in enzyme replacement therapy.
[0056] Gene Therapy
[0057] Gene therapy to replace Gcc expression (Nolta et al. 1992;
Tsai et al. 1992; Sidransky et al. 1993; Schuening et al. 1997;
Dunbar et al. 1998) may be useful to modify the development or
progression of Gaucher disease. The invention includes methods for
providing gene therapy for treatment of diseases, disorders or
abnormal physical states characterized by insufficient Gcc
expression or inadequate levels or activity of Gcc polypeptide.
[0058] The invention includes methods and compositions for
providing a nucleotide sequence encoding Gcc or biologically
functional equivalent nucleotide sequence to the cells of an
individual such that expression of Gcc in the cells provides the
biological activity or phenotype of Gcc polypeptide to those cells.
Sufficient amounts of the nucleotide sequence are administered and
expressed at sufficient levels to provide the biological activity
or phenotype of Gcc polypeptide to the cells. For example, the
method can involve a method of delivering a gene encoding Gcc to
the cells of an individual having a disease, disorder or abnormal
physical state, comprising administering to the individual a vector
comprising DNA encoding Gcc wherein the DNA has modified sites to
prevent undesirable splicing. The method may also relate to a
method for providing an individual having a disease, disorder or
abnormal physical state with biologically active Gcc polypeptide by
administering DNA encoding Gcc. The method may be performed ex vivo
or in vivo. Gene therapy methods and compositions are demonstrated,
for example, in U.S. Pat. Nos. 5,672,344, 5,645,829, 5,741,486,
5,656,465, 5,547,932, 5,529,774, 5,436,146, 5,399,346 and
5,670,488, 5,240,846.
[0059] The method also relates to a method for producing a stock of
recombinant virus by producing virus suitable for gene therapy
comprising modified DNA encoding Gcc. This method preferably
involves transfecting cells permissive for virus replication (the
virus containing modified Gcc) and collecting the virus
produced.
[0060] Typically, a male or female is treated with the vector
containing the invention (subject age will typically range from 1
to 60 years of age). At the time of treatment, he typically will
have bone involvement, bone thinning and bone pain and will have an
enlarged spleen and liver. The vector containing the invention is
administered intravenously in order to achieve a desired level of
enzyme in the patient. Treatments are repeated as deemed
appropriate by a physician to ameliorate the clinical symptoms of
Gaucher disease. Such treatments may be lifelong.
[0061] Patients report significant improvement in bone involvement,
pain and thinning, with reduction in frequency and/or intensity of
pain episodes, or complete disappearance of skeletal pain often
within the first six months of treatment. Patients also show
improvement in cortical bone thickness. Enlargement of the spleen
and liver are reduced. One of the disease markers, the enzyme
chitotriosidase, shows a dramatic reduction during the course of a
year.
[0062] Administration of Gcc Polypeptide
[0063] The Gcc polypeptide is administered in pharmaceutical
compositions in enzyme replacement therapy, examples of which are
described above (Beutler et al. 1991; Barton et al. 1992; Fallet et
al. 1992; Brady et al. 1994; Grabowski et al. 1995; Rosenthal et
al. 1995).
[0064] Typically, a male or female is treated with the polypeptide
of the invention (subject age will typically range from 1 to 60
years of age). At the time of treatment, he typically will have
bone involvement, bone thinning and bone pain and may have an
enlarged spleen and liver. The polypeptide of the invention is
administered intravenously at about 30 U/kg every 2 weeks in order
to achieve a desired level of enzyme in the patient.
[0065] Patients report significant improvement in bone involvement,
pain and thinning, with reduction in frequency and/or intensity of
pain episodes, or complete disappearance of skeletal pain often
within the first six months of treatment. Patients also show
improvement in cortical bone thickness. Enlargement of the spleen
and liver are reduced. One of the disease markers, the enzyme
chitotriosidase, shows a dramatic reduction during the course of a
year.
[0066] Research Tool
[0067] Mammals and cell cultures transfected or transduced with
vectors containing the invention are useful as research tools.
Mammals and cell cultures are used in research according to
numerous techniques known in the art. For example, one may obtain
cells or mice (Tybulewicz et al. 1992) that express low levels of
the normal or mutant Gcc polypeptide and use them in experiments to
assess expression of a recombinant Gcc nucleotide sequence. In an
example of such a procedure, experimental groups of mice are
transformed with vectors containing recombinant Gcc genes to assess
the levels of polypeptide produced, its functionality and the
phenotype of the cells or mice (for example, physical
characteristics of the cell structure). Some of the changes
described above to optimize expression may be omitted if a lower
level of expression is desired. It would be obvious to one skilled
in the art that changes could be made to alter the levels of
polypeptide expression.
[0068] In another example, a cell line (either an immortalized cell
culture or a stem cell culture) is transformed with a DNA molecule
of the invention (or variants) to measure levels of expression of
the DNA molecule and the activity of the DNA molecule. For example,
one may obtain mouse or human cell lines or cultures bearing the
vector of the invention and obtain expression after the transfer of
the cells into immunocompromised mice.
[0069] Using Exogenous Agents In Combination With the Hybrid
Gene
[0070] Cells transfected or transduced with a DNA molecule or
polypeptide according to the invention may, in appropriate
circumstances, be treated with conventional medical treatment of
Gaucher disease, such as enzyme replacement therapy. The
appropriate combination of treatments would be apparent to a
skilled physician.
[0071] Material and Meth ds
[0072] Reagents:
[0073] All reagents used during the course of these experiments w r
of research grade or molecular biology grades, as appropriate.
Substrate for the acid .beta.-glucosidase (Gcc) activity,
4-methylumbelliferyl-.beta.-D- -glucopyranoside (MUGc), was
purchased from Sigma and purified additionally as described below.
Oligonucleotide primers were obtained, as a lyophilized powder,
from the Hospital for Sick Children Biotechnology Service Centre's
DNA Synthesis Service. Tissue culture media (alpha-MEM) was
obtained from the University of Toronto Media Preparation Service.
Fetal bovine serum were obtained from CanSera through the Hospital
for Sick Children Tissue Culture Service.
[0074] Lac Z. Neutral .beta.-Galactosidase Assay
[0075] Samples of cell lysates were diluted into water to a final
volume of 60 .mu.L. Substrate solution (190 .mu.L), prepared by
dissolving 19 mg of 4-MU-.beta.-gal
(4-methylumbelliferyl-.beta.-galactoside) in 100 ml of pH 7.0 0.1 M
citrate buffer, was added. The mixture was incubated at 37.degree.
C. for 30 minutes and then stopped by the addition of 2.0 ml of 0.1
M MAP. Fluorescence of standard quantities of free 4-MU in 0.1 MAP
(2-methyl-2-amino-1-propanol) and the assay mixtures were
determined on a fluorescence spectrophotometer using 365 nm
excitation and 450 nm emission wavelengths. Polypeptide
concentration of the cell lysates were determined by the Bio-Rad
method. Specific activity of the lysates were determined as nmole
MU/mg polypeptide.
[0076] Acid .beta.-Glucosidase (Gcc) Activity (Specific or
Total):
[0077] Samples were prepared by freeze-thaw lysis (5.times.) in PBS
containing 0.1% sodium taurocholate (NaTC), usually 100 .mu.L for a
P100 dish of confluent CHO cells. A sample of the lysate (5-20
.mu.L) was diluted with 0.25% BSA to a total volume of 100 .mu.L.
Reagents were added in the following order citrate/phosphate buffer
(1 M/2M, pH 4.5), 25 .mu.L; 2% NaTC in ddH.sub.2O, 25 .mu.L; and 20
mM of the MUGc substratesolution, 100 .mu.L. The reaction was
typically allowed to proceed for 1 hour at 37.degree. C. and then
stopped by the addition of 3.0 ml of 0.1 M MAP, pH 10.5.
Fluorescence of the released 4-MU was measured with the use of on a
Perkin Elmer LS 30 Luminescence Spectrometer with sipper
attachment. Polypeptide content was determined using the BioRad
Protein Assay reagent.
[0078] Substrate solution (20 mM) was prepared by dissolving MUGc
in ddH.sub.2O and heating to 40-50.degree. C. for 15-20 minutes
with occasional agitation. The solution was cooled and then
extracted 3.times. with an equal volume of ethyl acetate. The final
aqueous solution was bubbled with N.sub.2 gas (to remove residual
ethyl acetat) and aliquoted into tubes which were then frozen and
stored at -20.degree. C. until needed. The substrate solution was
thawed for use in a beaker of warm water, then vortexed vigorously
to ensure complete dissolution of any solid material.
[0079] Immunoprecipitation Assay:
[0080] For each immunoprecipitation assay, 125 .mu.L of Goat
anti-rabbit IgG coated magnetic beads (hereafter called "beads")
were isolated from suspension using a permanent magnet stand
(Advanced Magnetics). Beads were washed 3 times with
phosphate-buffered saline containing 0.05% bovine serum albumin
(PBS/BSA) by resuspension, and removal from suspension using a
magnetic stand, followed by removal of the supernatant. After the
final wash the beads were resuspended in 100 .mu.L of PBS/BSA and
an appropriate amount of the rabbit anti-Gcc IgG (#5470), usually 4
.mu.g per assay, was added. The mixture was placed in an
appropriately sized tube, depending on volume, and allowed to
incubate with rotation for 4 hours at 4.degree. C. The
bead-antibody complex was precipitated with the permanent magnet
stand and washed 3 times with PBS/BSA to remove any remaining free
antibody and finally resuspended in 100 .mu.L of PBS/BSA. Cell
lysates were prepared as above and diluted into a minimum of 400
.mu.L (to allow for adequate mixing). The washed antibody-bead
complex (100 .mu.L) was added to the diluted sample and allowed to
incubate overnight at 4.degree. C. with rotation. The samples were
placed on ice in the permanent magnet stand and allowed to
precipitate for .about.30 minutes. The beads in each sample were
washed (750 .mu.L) with PBS/BSA containing 0.1% Triton X-100, then
twice with PBS/BSA containing 0.2% NaTC. After the final wash, the
beads were resuspended in PBS/BSA/Triton and assayed for Gcc
activity (as described above).
[0081] Expression of Gcc in Transiently Transfected CHO Cells
[0082] CHO cells were co-transfected with either 8 .mu.g of
pINEX-5'-GCC-3' or pINEX-WEIRD and 2 .mu.g pCMV-Lac Z (encoding E.
coli .beta.-galactosidase as a control for transfection efficiency)
using Superfect Reagent (QIAGEN GmBH, Germany), according to the
manufacturer's protocol. Cells were harvested after 2 days and the
lysates analyzed for Gcc (using the immunoprecipitation assay) and
.beta.-galactosidase activity. Final Gcc levels were adjusted based
on the relative levels of .beta.-galactosidase activity in each
lysate sample.
[0083] Cloned CHO Cells Permanently-Transfected with
pINEX-5'-GCC-3':
[0084] CHO cells were co-transfected with 8 .beta.g of
pINEX-5'-GCC-3' and 2 .mu.g pREP10 (containing a hygromycin
resistence gene). Selective medium, containing 200 .mu.g/mL
hygromycin was added, and the cells were allowed to grow for
approximately two weeks, splitting as necessary. After two we ks
the cells were harvested by trysinization, counted using a
hemocytometer and diluted as necessary to isolate single cells
using 96-well dishes. After 10 days, clones that were growing well
were transferred into 100 mm dishes and allowed to grow for a
further 10 days, splitting as necessary. Cells from each clone were
harvested and assayed for Gcc activity. The final clone selected,
termed A7, had the highest Gcc activity of all the clones
examined.
[0085] RNA Isolation and Reverse Transcription and PCR
(RT-PCR):
[0086] Cells were grown in large dishes (P150), and RNA was
isolated from control CHO cells and the A7 clone, according to the
one-step guanidinium isothiocyanate procedure(Chomczynski and
Sacchi 1987). RNA (1 .mu.g), primer (SPR2 (see Table 1), 200 pmol),
RNase inhibitor, and ddH.sub.2O (to 12.5 .mu.L total), were mixed
and incubated at 65.degree. C. for 20 minutes. After cooling on ice
for 5 minutes, the remaining components of the RT reaction cocktail
were added (RT buffer, DTT, dNTPs, RNase inhibitor, and reverse
transcriptase). The reaction cocktail (total 25 .mu.L) was
incubated at 37.degree. C. for 90 min.
[0087] PCR was performed using the RT reaction products (1 .mu.L)
as template. After addition of ddH.sub.2O, and primers (SPF and
53GCC2000R (see Table 1), 20 pmol each), the reaction was incubated
at 95.degree. C. for 5 minutes to inactivate the reverse
transcriptase. The remaining reaction components (dNTPs, MgCl2, and
Taq polymerase (Gibco BRL)) were used at manufacturers suggested
levels. Thermocycling was performed under the following conditions:
94.degree. C./3 min; 30 cycles of 94.degree./1.5 min, 55.degree./1
min, 72.degree./1.5 min; 72.degree./10 min. Samples of the PCR
reaction (10 .mu.L) were loaded onto a 1.5% agarose gel using
Tris-Acetate-EDTA buffer (TAE, 40 mM Tris-acetate/2 mM EDTA),
electrophoresed and visualized using ethidium bromide.
[0088] Cloning of RT-PCR Products:
[0089] Electrophoresis of the RT-PCR products from the A7 clone
cell line showed two major bands. One full RT-PCR reaction mixture
(100 .mu.L) was separated eletrbphoretically on an agarose gel, and
the two major product bands were excised and purified using the
Qiaex II Gel Extraction Kit (QIAGEN GmBH, Germany). The fragments
were cloned into the TA cloning vector (pCR2.1) according to the
manufacturer's directions (Invitrogen, Carlsbad, Calif.). The
inserts were sequenced using either .sup.33S-T7 Sequencing Kit or
.sup.33P-cycle Sequencing Kit (Amersham Pharmacia Biotech, Sweden)
from either the M13 forward or M13 reverse primer location on the
vector. Sequencing gels were exposed to BioMaxMR film (Kodak)
overnight and subsequently read.
[0090] Site-Directed Mutagenesis (Internal "Weird" Spice Fix):
[0091] The cryptic splice site located within the Gcc cDNA was
modified by site-directed mutagenesis in order to remove potential
consensus splice junction sites from the Gcc cDNA. A PCR product
was obtained using one oligonucleotide primer which mutagenized a
number of bases in the putative 3' junction site (3'-junction (see
Table 1)) and another for the putative 5'-splice junction site
(5'-junction (see Table 1)). The PCR reaction contained:
1.times.Pfu reaction buffer (10.times. stock provided by
manufacturer), 0.4 mM dNTP, 10 ng template DNA (pINEX-5'GCC-3'),
500 ng of each oligo, and 2.5U Pfu DNA Polymerase in a final volume
of 50 .mu.L in the appropriate buffer.
[0092] Amplification was performed using a Robocycler 40
Temperature Cycler (Stratagene) for 30 cycles, with temperatures
and times as follows: 94.degree. C./45 sec., 59.degree. C./1 min.
and 72.degree. C./1 min. 20 sec. The PCR product was used as a
mega-primer in the second round of PCR. The second PCR reaction
consisted of: 5 .mu.L of the above PCR reaction mixture,
1.times.Pfu reaction buffer (10.times. stock provided by
manufacturer), 0.4 mM dNTPs, 50 ng template (pINEX-5'-GCC-3'), 500
ng upstream oligo (SPF) and 5U Pfu DNA polymerase in a final
reaction volume of 100 .mu.L. Reaction temperature conditions used
were the same as for the initial PCR above. The PCR products were
digested with 10U of Dra III and Xho I for 3 hr at 37.degree. C.
The plasmid pINEX-5'GCC-3' was digested in parallel using the same
method. Digested products were electrophoretically separated on an
agarose gel, and the appropriate pieces were excised and purified
as described above. Ligation was performed in a 20 .mu.L final
volume using 5U of T4 DNA Ligase (MBI Fermentas, Lithuania),
incubating overnight at 16.degree. C. to produce pINEX-WEIRD. DNA
was transformed into DH5 E. coli cells (Gibco BRL) and plated onto
appropriate LB agar plates containing antibiotics. Plasmid DNA was
isolated and screened by restriction digest and sequencing to
confirm that they contained the appropriate insert.
[0093] The present invention has been described in detail and with
particular reference to the preferred embodiments; however, it will
be understood by one having ordinary skill in the art that changes
can be made thereto without departing from the spirit and scope of
the invention.
[0094] All publications, patents and patent applications are
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety.
REFERENCES
[0095] Barton N W, Brady R O, Dambrosia J M, Doppelt S H, Hill S C,
Holder C A, Mankin H J, et al (1992) Dose-dependent responses to
macrophage-targeted glucocerebrosidase in a child with Gaucher
disease. J Pediatr 1:277-280
[0096] Beutler E, Kay A C, Saven A, Garver P, Thurston D W,
Rosenbloom B E (1991) Enzyme-replacement therapy for Gaucher's
disease. N EngI J Med 325:1809-1810
[0097] Brady R O, Murray G J, Barton N W (1994) Modifying exogenous
glucocerebrosidase for effective replacement therapy in Gaucher
disease. J Inherited Metab Dis 17:510-519
[0098] Chomczynski P, Sacchi N (1987) Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal. Biochem. 162:156-9
[0099] Dunbar C E, Kohn D B, Schiffmann R, Barton N W, Nolta J A,
Esplin J A, Pensiero M, et al (1998) Retroviral transfer of the
glucocerebrosidase gene into CD34+cells from patients with Gaucher
disease: In vivo detection of transduced cells without
myeloablation. Hum Gene Ther 9:2629-2640
[0100] Fallet S, Grace M E, Sibille A, Mendelson D S, Shapiro R S,
Hermann G, Grabowski G A (1992) Enzyme augmentation in moderate to
life-threatening Gaucher disease. Pediatr Res 31:496-502
[0101] Grabowski G A, Barton N W, Pastores G, Dambrosia J M,
Banerjee T K, McKee M A, Parker C, et al (1995) Enzyme therapy in
type 1 Gaucher disease: Comparative efficacy of mannose-terminated
glucocerebrosidase from natural and recombinant sources. Ann.
Intern. Med. 122:33-39
[0102] Kozak M (1987) At least six nucleotides preceding the AUG
initiator codon enhance translation in mammalian cells. J. Mol.
Biol. 196:947-950
[0103] Krawczak M, Reiss J, Cooper D N (1992) The mutational
spectrum of single base-pair substitutions in mRNA splice junctions
of human genes: causes and consequences. Hum. Genet. 90:41-54
[0104] Maquat L E (1996) Defects in RNA splicing and the
consequence of shortened translational reading frames. Am. J. Hum.
Genet. 59:279-286
[0105] Nolta J A, Yu X J, Bahner I, Kohn D B (1992)
Retroviral-mediated transfer of the human glucocerebrosidase gene
into cultured Gaucher bone marrow. J Clin Invest 90:342-348
[0106] Rosenthal D I, Doppelt S H, Mankin H J, Dambrosia J M,
Xavier R J, McKusick K A, Rosen B R, et al (1995) Enzyme
replacement therapy for Gaucher disease: Skeletal responses to
macrophage-targeted glucocerebrosidase. Pediatrics 96:629-637
[0107] Schuening F, Longo W L, Atkinson M E, Zaboikin M (1997)
Retrovirus-mediated transfer of the cDNA for human
glucocerebrosidase into peripheral blood repopulating cells of
patients with Gaucher's disease. Hum Gene Ther 8:2143-2160
[0108] Sidransky E, Martin B, Ginns E I (1993) Treatment of
Gaucher's disease. N EngI J Med 328:1566-1566
[0109] Tsai P, Lipton J M, Sahdev I, Najfeld V, Rankin L R, Slyper
A H, Ludman M, et al (1992) Allogenic bone marrow transplantation
in severe Gaucher disease. Pediatr Res 31:503-507
[0110] Tybulewicz V, Tremblay M L, LaMarca M E, Willemsen R,
Stubblefield B K, Winfield S, Zablocka B, et al (1992) Animal model
of Gaucher's disease from targeted disruption of the mouse
glucocerebrosidase gene. Nature 357:407-410
1TABLE 1 Sequence of Oligos Used in this Study: Oligo Nam Olig S qu
nc * (5' to 3') SPR2 GCCAGTGTGATGGATATCTGC SPF
GACCGATCCAGCCTCCGGACTCT 53GCC2000R GCCGCACACTCTGCTCCCAGAA
3-junction CATCCGTCGCCCACTGCGTGTACTCTCATAGCGGGAAAA TGTCAGGGCAGG
5'junction CCTTTGAGTAGAGTCTCCATCATGGCTGGC = Bases underlined
indicate bases changed in site-directed mutagenesis PCR
procedures.
[0111]
2TABLE 2 One of 18 Transient Expression Experiment Comparing the
Wild-Type Gcc cDNA (plnex5'3'Gcc) with the Gcc cDNA Modified to
Remove the Cryptic Splice Sites (plnexWEIRD) Lac-Z Corection Fact
Total Gcc Human Gcc Vector (pmoles/ (C.F.) (pmoles/hr/.mu.g)
(pmoles/hr/.mu.g) C.F. X Hum % plnex5'3'G None 35 N/A 67 1.6 N/A 15
plnex5'3'Gcc 1550 1 101 10.5 8.8 100 plnexWEIRD 185 10.1 63 6.8
52.5 597
[0112]
Sequence CWU 1
1
19 1 10 RNA Homo sapiens m=1-2 m=c or a 1 mmagguaagu 10 2 41 DNA
Homo sapiens 2 aagccgttga gtagggtaag catcatggct ggcagcctca c 41 3
14 PRT Homo sapiens 3 Lys Pro Leu Ser Arg Val Ser Ile Met Ala Gly
Ser Leu Thr 1 5 10 4 41 DNA Homo sapiens 4 aagccgttga gtagagtctc
catcatggct ggcagcctca c 41 5 15 RNA Homo sapiens misc_difference
y=1-10; n=11 y=c or u; n=any nucleotide 5 yyyyyyyyyy ncagg 15 6 40
DNA Homo sapiens 6 tttcctgccc ttggtacctt cagccgctat gagagtacac 40 7
14 PRT Homo sapiens 7 Phe Pro Ala Leu Gly Thr Phe Ser Arg Tyr Glu
Ser Thr Arg 1 5 10 8 40 DNA Homo sapiens 8 tttcctgccc tgggaacatt
ttcccgctat gagagtacac 40 9 32 DNA Homo sapiens 9 aagccgttga
gtaggccgct atgagagtac ac 32 10 7 PRT Homo sapiens 10 Lys Pro Leu
Ser Arg Pro Leu 1 5 11 1741 DNA Homo sapiens CDS (37)..(1647)
misc_difference n=1 n=any nucleotide 11 ngcggccgct tagcttgact
taagaaggcc gacgcc atg gag ttt tca agt cct 54 Met Glu Phe Ser Ser
Pro 1 5 tcc aga gag gaa tgt ccc aag cct ttg agt agg gta agc atc atg
gct 102 Ser Arg Glu Glu Cys Pro Lys Pro Leu Ser Arg Val Ser Ile Met
Ala 10 15 20 ggc agc ctc aca ggt ttg ctt cta ctt cag gca gtg tcg
tgg gca tca 150 Gly Ser Leu Thr Gly Leu Leu Leu Leu Gln Ala Val Ser
Trp Ala Ser 25 30 35 ggt gcc cgc ccc tgc atc cct aaa agc ttc ggc
tac agc tcg gtg gtg 198 Gly Ala Arg Pro Cys Ile Pro Lys Ser Phe Gly
Tyr Ser Ser Val Val 40 45 50 tgt gtc tgc aat gcc aca tac tgt gac
tcc ttt gac ccc ccg acc ttt 246 Cys Val Cys Asn Ala Thr Tyr Cys Asp
Ser Phe Asp Pro Pro Thr Phe 55 60 65 70 cct gcc ctt ggt acc ttc agc
cgc tat gag agt aca cgc agt ggg cga 294 Pro Ala Leu Gly Thr Phe Ser
Arg Tyr Glu Ser Thr Arg Ser Gly Arg 75 80 85 cgg atg gag ctg agt
atg ggg ccc atc cag gct aat cac acg ggc aca 342 Arg Met Glu Leu Ser
Met Gly Pro Ile Gln Ala Asn His Thr Gly Thr 90 95 100 ggc ctg cta
ctg acc ctg cag cca gaa cag aag ttc cag aaa gtg aag 390 Gly Leu Leu
Leu Thr Leu Gln Pro Glu Gln Lys Phe Gln Lys Val Lys 105 110 115 gga
ttt gga ggg gcc atg aca gat gct gct gct ctc aac atc ctt gcc 438 Gly
Phe Gly Gly Ala Met Thr Asp Ala Ala Ala Leu Asn Ile Leu Ala 120 125
130 ctg tca ccc cct gcc caa aat ttg cta ctt aaa tcg tac ttc tct gaa
486 Leu Ser Pro Pro Ala Gln Asn Leu Leu Leu Lys Ser Tyr Phe Ser Glu
135 140 145 150 gaa gga atc gga tat aac atc atc cgg gta ccc atg gcc
agc tgt gac 534 Glu Gly Ile Gly Tyr Asn Ile Ile Arg Val Pro Met Ala
Ser Cys Asp 155 160 165 ttc tcc atc cgc acc tac acc tat gca gac acc
cct gat gat ttc cag 582 Phe Ser Ile Arg Thr Tyr Thr Tyr Ala Asp Thr
Pro Asp Asp Phe Gln 170 175 180 ttg cac aac ttc agc ctc cca gag gaa
gat acc aag ctc aag ata ccc 630 Leu His Asn Phe Ser Leu Pro Glu Glu
Asp Thr Lys Leu Lys Ile Pro 185 190 195 ctg att cac cga gcc ctg cag
ttg gcc cag cgt ccc gtt tca ctc ctt 678 Leu Ile His Arg Ala Leu Gln
Leu Ala Gln Arg Pro Val Ser Leu Leu 200 205 210 gcc agc ccc tgg aca
tca ccc act tgg ctc aag acc aat gga gcg gtg 726 Ala Ser Pro Trp Thr
Ser Pro Thr Trp Leu Lys Thr Asn Gly Ala Val 215 220 225 230 aat ggg
aag ggg tca ctc aag gga cag ccc gga gac atc tac cac cag 774 Asn Gly
Lys Gly Ser Leu Lys Gly Gln Pro Gly Asp Ile Tyr His Gln 235 240 245
acc tgg gcc aga tac ttt gtg aag ttc ctg gat gcc tat gct gag cac 822
Thr Trp Ala Arg Tyr Phe Val Lys Phe Leu Asp Ala Tyr Ala Glu His 250
255 260 aag tta cag ttc tgg gca gtg aca gct gaa aat gag cct tct gct
ggg 870 Lys Leu Gln Phe Trp Ala Val Thr Ala Glu Asn Glu Pro Ser Ala
Gly 265 270 275 ctg ttg agt gga tac ccc ttc cag tgc ctg ggc ttc acc
cct gaa cat 918 Leu Leu Ser Gly Tyr Pro Phe Gln Cys Leu Gly Phe Thr
Pro Glu His 280 285 290 cag cga gac tta att gcc cgt gac cta ggt cct
acc ctc gcc aac agt 966 Gln Arg Asp Leu Ile Ala Arg Asp Leu Gly Pro
Thr Leu Ala Asn Ser 295 300 305 310 act cac cac aat gtc cgc cta ctc
atg ctg gat gac caa cgc ttg ctg 1014 Thr His His Asn Val Arg Leu
Leu Met Leu Asp Asp Gln Arg Leu Leu 315 320 325 ctg ccc cac tgg gca
aag gtg gta ctg aca gac cca gaa gca gct aaa 1062 Leu Pro His Trp
Ala Lys Val Val Leu Thr Asp Pro Glu Ala Ala Lys 330 335 340 tat gtt
cat ggc att gct gta cat tgg tac ctg gac ttt ctg gct cca 1110 Tyr
Val His Gly Ile Ala Val His Trp Tyr Leu Asp Phe Leu Ala Pro 345 350
355 gcc aaa gcc acc cta ggg gag aca cac cgc ctg ttc ccc aac acc atg
1158 Ala Lys Ala Thr Leu Gly Glu Thr His Arg Leu Phe Pro Asn Thr
Met 360 365 370 ctc ttt gcc tca gag gcc tgt gtg ggc tcc aag ttc tgg
gag cag agt 1206 Leu Phe Ala Ser Glu Ala Cys Val Gly Ser Lys Phe
Trp Glu Gln Ser 375 380 385 390 gtg cgg cta ggc tcc tgg gat cga ggg
atg cag tac agc cac agc atc 1254 Val Arg Leu Gly Ser Trp Asp Arg
Gly Met Gln Tyr Ser His Ser Ile 395 400 405 atc acg aac ctc ctg tac
cat gtg gtc ggc tgg acc gac tgg aac ctt 1302 Ile Thr Asn Leu Leu
Tyr His Val Val Gly Trp Thr Asp Trp Asn Leu 410 415 420 gcc ctg aac
ccc gaa gga gga ccc aat tgg gtg cgt aac ttt gtc gac 1350 Ala Leu
Asn Pro Glu Gly Gly Pro Asn Trp Val Arg Asn Phe Val Asp 425 430 435
agt ccc atc att gta gac atc acc aag gac acg ttt tac aaa cag ccc
1398 Ser Pro Ile Ile Val Asp Ile Thr Lys Asp Thr Phe Tyr Lys Gln
Pro 440 445 450 atg ttc tac cac ctt ggc cat ttc agc aag ttc att cct
gag ggc tcc 1446 Met Phe Tyr His Leu Gly His Phe Ser Lys Phe Ile
Pro Glu Gly Ser 455 460 465 470 cag aga gtg ggg ctg gtt gcc agt cag
aag aac gac ctg gac gca gtg 1494 Gln Arg Val Gly Leu Val Ala Ser
Gln Lys Asn Asp Leu Asp Ala Val 475 480 485 gca ttg atg cat ccc gat
ggc tct gct gtt gtg gtc gtg cta aac cgc 1542 Ala Leu Met His Pro
Asp Gly Ser Ala Val Val Val Val Leu Asn Arg 490 495 500 tcc tct aag
gat gtg cct ctt acc atc aag gat cct gct gtg ggc ttc 1590 Ser Ser
Lys Asp Val Pro Leu Thr Ile Lys Asp Pro Ala Val Gly Phe 505 510 515
ctg gag aca atc tca cct ggc tac tcc att cac acc tac ctg tgg cat
1638 Leu Glu Thr Ile Ser Pro Gly Tyr Ser Ile His Thr Tyr Leu Trp
His 520 525 530 cgc cag tga tggagcagat actcaaggag gcactgggct
cagcctgggc 1687 Arg Gln 535 attaaaggga cagagtcagc gaattctgca
gatatccatc acactggcgg ccgc 1741 12 536 PRT Homo sapiens 12 Met Glu
Phe Ser Ser Pro Ser Arg Glu Glu Cys Pro Lys Pro Leu Ser 1 5 10 15
Arg Val Ser Ile Met Ala Gly Ser Leu Thr Gly Leu Leu Leu Leu Gln 20
25 30 Ala Val Ser Trp Ala Ser Gly Ala Arg Pro Cys Ile Pro Lys Ser
Phe 35 40 45 Gly Tyr Ser Ser Val Val Cys Val Cys Asn Ala Thr Tyr
Cys Asp Ser 50 55 60 Phe Asp Pro Pro Thr Phe Pro Ala Leu Gly Thr
Phe Ser Arg Tyr Glu 65 70 75 80 Ser Thr Arg Ser Gly Arg Arg Met Glu
Leu Ser Met Gly Pro Ile Gln 85 90 95 Ala Asn His Thr Gly Thr Gly
Leu Leu Leu Thr Leu Gln Pro Glu Gln 100 105 110 Lys Phe Gln Lys Val
Lys Gly Phe Gly Gly Ala Met Thr Asp Ala Ala 115 120 125 Ala Leu Asn
Ile Leu Ala Leu Ser Pro Pro Ala Gln Asn Leu Leu Leu 130 135 140 Lys
Ser Tyr Phe Ser Glu Glu Gly Ile Gly Tyr Asn Ile Ile Arg Val 145 150
155 160 Pro Met Ala Ser Cys Asp Phe Ser Ile Arg Thr Tyr Thr Tyr Ala
Asp 165 170 175 Thr Pro Asp Asp Phe Gln Leu His Asn Phe Ser Leu Pro
Glu Glu Asp 180 185 190 Thr Lys Leu Lys Ile Pro Leu Ile His Arg Ala
Leu Gln Leu Ala Gln 195 200 205 Arg Pro Val Ser Leu Leu Ala Ser Pro
Trp Thr Ser Pro Thr Trp Leu 210 215 220 Lys Thr Asn Gly Ala Val Asn
Gly Lys Gly Ser Leu Lys Gly Gln Pro 225 230 235 240 Gly Asp Ile Tyr
His Gln Thr Trp Ala Arg Tyr Phe Val Lys Phe Leu 245 250 255 Asp Ala
Tyr Ala Glu His Lys Leu Gln Phe Trp Ala Val Thr Ala Glu 260 265 270
Asn Glu Pro Ser Ala Gly Leu Leu Ser Gly Tyr Pro Phe Gln Cys Leu 275
280 285 Gly Phe Thr Pro Glu His Gln Arg Asp Leu Ile Ala Arg Asp Leu
Gly 290 295 300 Pro Thr Leu Ala Asn Ser Thr His His Asn Val Arg Leu
Leu Met Leu 305 310 315 320 Asp Asp Gln Arg Leu Leu Leu Pro His Trp
Ala Lys Val Val Leu Thr 325 330 335 Asp Pro Glu Ala Ala Lys Tyr Val
His Gly Ile Ala Val His Trp Tyr 340 345 350 Leu Asp Phe Leu Ala Pro
Ala Lys Ala Thr Leu Gly Glu Thr His Arg 355 360 365 Leu Phe Pro Asn
Thr Met Leu Phe Ala Ser Glu Ala Cys Val Gly Ser 370 375 380 Lys Phe
Trp Glu Gln Ser Val Arg Leu Gly Ser Trp Asp Arg Gly Met 385 390 395
400 Gln Tyr Ser His Ser Ile Ile Thr Asn Leu Leu Tyr His Val Val Gly
405 410 415 Trp Thr Asp Trp Asn Leu Ala Leu Asn Pro Glu Gly Gly Pro
Asn Trp 420 425 430 Val Arg Asn Phe Val Asp Ser Pro Ile Ile Val Asp
Ile Thr Lys Asp 435 440 445 Thr Phe Tyr Lys Gln Pro Met Phe Tyr His
Leu Gly His Phe Ser Lys 450 455 460 Phe Ile Pro Glu Gly Ser Gln Arg
Val Gly Leu Val Ala Ser Gln Lys 465 470 475 480 Asn Asp Leu Asp Ala
Val Ala Leu Met His Pro Asp Gly Ser Ala Val 485 490 495 Val Val Val
Leu Asn Arg Ser Ser Lys Asp Val Pro Leu Thr Ile Lys 500 505 510 Asp
Pro Ala Val Gly Phe Leu Glu Thr Ile Ser Pro Gly Tyr Ser Ile 515 520
525 His Thr Tyr Leu Trp His Arg Gln 530 535 13 1741 DNA Homo
sapiens CDS (37)..(1647) misc_difference n=1 n=any nucleotide 13
ngcggccgct tagcttgact taagaaggcc gacgcc atg gag ttt tca agt cct 54
Met Glu Phe Ser Ser Pro 1 5 tcc aga gag gaa tgt ccc aag cct ttg agt
aga gtc tcc atc atg gct 102 Ser Arg Glu Glu Cys Pro Lys Pro Leu Ser
Arg Val Ser Ile Met Ala 10 15 20 ggc agc ctc aca ggt ttg ctt cta
ctt cag gca gtg tcg tgg gca tca 150 Gly Ser Leu Thr Gly Leu Leu Leu
Leu Gln Ala Val Ser Trp Ala Ser 25 30 35 ggt gcc cgc ccc tgc atc
cct aaa agc ttc ggc tac agc tcg gtg gtg 198 Gly Ala Arg Pro Cys Ile
Pro Lys Ser Phe Gly Tyr Ser Ser Val Val 40 45 50 tgt gtc tgc aat
gcc aca tac tgt gac tcc ttt gac ccc ccg acc ttt 246 Cys Val Cys Asn
Ala Thr Tyr Cys Asp Ser Phe Asp Pro Pro Thr Phe 55 60 65 70 cct gcc
ctg gga aca ttt tcc cgc tat gag agt aca cgc agt ggg cga 294 Pro Ala
Leu Gly Thr Phe Ser Arg Tyr Glu Ser Thr Arg Ser Gly Arg 75 80 85
cgg atg gag ctg agt atg ggg ccc atc cag gct aat cac acg ggc aca 342
Arg Met Glu Leu Ser Met Gly Pro Ile Gln Ala Asn His Thr Gly Thr 90
95 100 ggc ctg cta ctg acc ctg cag cca gaa cag aag ttc cag aaa gtg
aag 390 Gly Leu Leu Leu Thr Leu Gln Pro Glu Gln Lys Phe Gln Lys Val
Lys 105 110 115 gga ttt gga ggg gcc atg aca gat gct gct gct ctc aac
atc ctt gcc 438 Gly Phe Gly Gly Ala Met Thr Asp Ala Ala Ala Leu Asn
Ile Leu Ala 120 125 130 ctg tca ccc cct gcc caa aat ttg cta ctt aaa
tcg tac ttc tct gaa 486 Leu Ser Pro Pro Ala Gln Asn Leu Leu Leu Lys
Ser Tyr Phe Ser Glu 135 140 145 150 gaa gga atc gga tat aac atc atc
cgg gta ccc atg gcc agc tgt gac 534 Glu Gly Ile Gly Tyr Asn Ile Ile
Arg Val Pro Met Ala Ser Cys Asp 155 160 165 ttc tcc atc cgc acc tac
acc tat gca gac acc cct gat gat ttc cag 582 Phe Ser Ile Arg Thr Tyr
Thr Tyr Ala Asp Thr Pro Asp Asp Phe Gln 170 175 180 ttg cac aac ttc
agc ctc cca gag gaa gat acc aag ctc aag ata ccc 630 Leu His Asn Phe
Ser Leu Pro Glu Glu Asp Thr Lys Leu Lys Ile Pro 185 190 195 ctg att
cac cga gcc ctg cag ttg gcc cag cgt ccc gtt tca ctc ctt 678 Leu Ile
His Arg Ala Leu Gln Leu Ala Gln Arg Pro Val Ser Leu Leu 200 205 210
gcc agc ccc tgg aca tca ccc act tgg ctc aag acc aat gga gcg gtg 726
Ala Ser Pro Trp Thr Ser Pro Thr Trp Leu Lys Thr Asn Gly Ala Val 215
220 225 230 aat ggg aag ggg tca ctc aag gga cag ccc gga gac atc tac
cac cag 774 Asn Gly Lys Gly Ser Leu Lys Gly Gln Pro Gly Asp Ile Tyr
His Gln 235 240 245 acc tgg gcc aga tac ttt gtg aag ttc ctg gat gcc
tat gct gag cac 822 Thr Trp Ala Arg Tyr Phe Val Lys Phe Leu Asp Ala
Tyr Ala Glu His 250 255 260 aag tta cag ttc tgg gca gtg aca gct gaa
aat gag cct tct gct ggg 870 Lys Leu Gln Phe Trp Ala Val Thr Ala Glu
Asn Glu Pro Ser Ala Gly 265 270 275 ctg ttg agt gga tac ccc ttc cag
tgc ctg ggc ttc acc cct gaa cat 918 Leu Leu Ser Gly Tyr Pro Phe Gln
Cys Leu Gly Phe Thr Pro Glu His 280 285 290 cag cga gac tta att gcc
cgt gac cta ggt cct acc ctc gcc aac agt 966 Gln Arg Asp Leu Ile Ala
Arg Asp Leu Gly Pro Thr Leu Ala Asn Ser 295 300 305 310 act cac cac
aat gtc cgc cta ctc atg ctg gat gac caa cgc ttg ctg 1014 Thr His
His Asn Val Arg Leu Leu Met Leu Asp Asp Gln Arg Leu Leu 315 320 325
ctg ccc cac tgg gca aag gtg gta ctg aca gac cca gaa gca gct aaa
1062 Leu Pro His Trp Ala Lys Val Val Leu Thr Asp Pro Glu Ala Ala
Lys 330 335 340 tat gtt cat ggc att gct gta cat tgg tac ctg gac ttt
ctg gct cca 1110 Tyr Val His Gly Ile Ala Val His Trp Tyr Leu Asp
Phe Leu Ala Pro 345 350 355 gcc aaa gcc acc cta ggg gag aca cac cgc
ctg ttc ccc aac acc atg 1158 Ala Lys Ala Thr Leu Gly Glu Thr His
Arg Leu Phe Pro Asn Thr Met 360 365 370 ctc ttt gcc tca gag gcc tgt
gtg ggc tcc aag ttc tgg gag cag agt 1206 Leu Phe Ala Ser Glu Ala
Cys Val Gly Ser Lys Phe Trp Glu Gln Ser 375 380 385 390 gtg cgg cta
ggc tcc tgg gat cga ggg atg cag tac agc cac agc atc 1254 Val Arg
Leu Gly Ser Trp Asp Arg Gly Met Gln Tyr Ser His Ser Ile 395 400 405
atc acg aac ctc ctg tac cat gtg gtc ggc tgg acc gac tgg aac ctt
1302 Ile Thr Asn Leu Leu Tyr His Val Val Gly Trp Thr Asp Trp Asn
Leu 410 415 420 gcc ctg aac ccc gaa gga gga ccc aat tgg gtg cgt aac
ttt gtc gac 1350 Ala Leu Asn Pro Glu Gly Gly Pro Asn Trp Val Arg
Asn Phe Val Asp 425 430 435 agt ccc atc att gta gac atc acc aag gac
acg ttt tac aaa cag ccc 1398 Ser Pro Ile Ile Val Asp Ile Thr Lys
Asp Thr Phe Tyr Lys Gln Pro 440 445 450 atg ttc tac cac ctt ggc cat
ttc agc aag ttc att cct gag ggc tcc 1446 Met Phe Tyr His Leu Gly
His Phe Ser Lys Phe Ile Pro Glu Gly Ser 455 460 465 470 cag aga gtg
ggg ctg gtt gcc agt cag aag aac gac ctg gac gca gtg 1494 Gln Arg
Val Gly Leu Val Ala Ser Gln Lys Asn Asp Leu Asp Ala Val 475 480 485
gca ttg atg cat ccc gat ggc tct gct gtt gtg gtc gtg cta aac cgc
1542 Ala Leu Met His Pro Asp Gly Ser Ala Val Val Val Val Leu Asn
Arg 490 495 500 tcc tct aag gat gtg cct ctt acc atc aag gat cct gct
gtg ggc ttc 1590 Ser Ser Lys Asp Val Pro Leu Thr Ile Lys Asp Pro
Ala Val Gly Phe 505
510 515 ctg gag aca atc tca cct ggc tac tcc att cac acc tac ctg tgg
cat 1638 Leu Glu Thr Ile Ser Pro Gly Tyr Ser Ile His Thr Tyr Leu
Trp His 520 525 530 cgc cag tga tggagcagat actcaaggag gcactgggct
cagcctgggc 1687 Arg Gln 535 attaaaggga cagagtcagc gaattctgca
gatatccatc acactggcgg ccgc 1741 14 536 PRT Homo sapiens 14 Met Glu
Phe Ser Ser Pro Ser Arg Glu Glu Cys Pro Lys Pro Leu Ser 1 5 10 15
Arg Val Ser Ile Met Ala Gly Ser Leu Thr Gly Leu Leu Leu Leu Gln 20
25 30 Ala Val Ser Trp Ala Ser Gly Ala Arg Pro Cys Ile Pro Lys Ser
Phe 35 40 45 Gly Tyr Ser Ser Val Val Cys Val Cys Asn Ala Thr Tyr
Cys Asp Ser 50 55 60 Phe Asp Pro Pro Thr Phe Pro Ala Leu Gly Thr
Phe Ser Arg Tyr Glu 65 70 75 80 Ser Thr Arg Ser Gly Arg Arg Met Glu
Leu Ser Met Gly Pro Ile Gln 85 90 95 Ala Asn His Thr Gly Thr Gly
Leu Leu Leu Thr Leu Gln Pro Glu Gln 100 105 110 Lys Phe Gln Lys Val
Lys Gly Phe Gly Gly Ala Met Thr Asp Ala Ala 115 120 125 Ala Leu Asn
Ile Leu Ala Leu Ser Pro Pro Ala Gln Asn Leu Leu Leu 130 135 140 Lys
Ser Tyr Phe Ser Glu Glu Gly Ile Gly Tyr Asn Ile Ile Arg Val 145 150
155 160 Pro Met Ala Ser Cys Asp Phe Ser Ile Arg Thr Tyr Thr Tyr Ala
Asp 165 170 175 Thr Pro Asp Asp Phe Gln Leu His Asn Phe Ser Leu Pro
Glu Glu Asp 180 185 190 Thr Lys Leu Lys Ile Pro Leu Ile His Arg Ala
Leu Gln Leu Ala Gln 195 200 205 Arg Pro Val Ser Leu Leu Ala Ser Pro
Trp Thr Ser Pro Thr Trp Leu 210 215 220 Lys Thr Asn Gly Ala Val Asn
Gly Lys Gly Ser Leu Lys Gly Gln Pro 225 230 235 240 Gly Asp Ile Tyr
His Gln Thr Trp Ala Arg Tyr Phe Val Lys Phe Leu 245 250 255 Asp Ala
Tyr Ala Glu His Lys Leu Gln Phe Trp Ala Val Thr Ala Glu 260 265 270
Asn Glu Pro Ser Ala Gly Leu Leu Ser Gly Tyr Pro Phe Gln Cys Leu 275
280 285 Gly Phe Thr Pro Glu His Gln Arg Asp Leu Ile Ala Arg Asp Leu
Gly 290 295 300 Pro Thr Leu Ala Asn Ser Thr His His Asn Val Arg Leu
Leu Met Leu 305 310 315 320 Asp Asp Gln Arg Leu Leu Leu Pro His Trp
Ala Lys Val Val Leu Thr 325 330 335 Asp Pro Glu Ala Ala Lys Tyr Val
His Gly Ile Ala Val His Trp Tyr 340 345 350 Leu Asp Phe Leu Ala Pro
Ala Lys Ala Thr Leu Gly Glu Thr His Arg 355 360 365 Leu Phe Pro Asn
Thr Met Leu Phe Ala Ser Glu Ala Cys Val Gly Ser 370 375 380 Lys Phe
Trp Glu Gln Ser Val Arg Leu Gly Ser Trp Asp Arg Gly Met 385 390 395
400 Gln Tyr Ser His Ser Ile Ile Thr Asn Leu Leu Tyr His Val Val Gly
405 410 415 Trp Thr Asp Trp Asn Leu Ala Leu Asn Pro Glu Gly Gly Pro
Asn Trp 420 425 430 Val Arg Asn Phe Val Asp Ser Pro Ile Ile Val Asp
Ile Thr Lys Asp 435 440 445 Thr Phe Tyr Lys Gln Pro Met Phe Tyr His
Leu Gly His Phe Ser Lys 450 455 460 Phe Ile Pro Glu Gly Ser Gln Arg
Val Gly Leu Val Ala Ser Gln Lys 465 470 475 480 Asn Asp Leu Asp Ala
Val Ala Leu Met His Pro Asp Gly Ser Ala Val 485 490 495 Val Val Val
Leu Asn Arg Ser Ser Lys Asp Val Pro Leu Thr Ile Lys 500 505 510 Asp
Pro Ala Val Gly Phe Leu Glu Thr Ile Ser Pro Gly Tyr Ser Ile 515 520
525 His Thr Tyr Leu Trp His Arg Gln 530 535 15 21 DNA Artificial
Sequence oligonucleotide 15 gccagtgtga tggatatctg c 21 16 23 DNA
Artificial Sequence oligonucleotide 16 gaccgatcca gcctccggac tct 23
17 22 DNA Artificial Sequence oligonucleotide 17 gccgcacact
ctgctcccag aa 22 18 51 DNA Artificial Sequence oligonucleotide 18
catccgtcgc ccactgcgtg tactctcata gcgggaaaat gtcagggcag g 51 19 30
DNA Artificial Sequence oligonucleotide 19 cctttgagta gagtctccat
catggctggc 30
* * * * *