U.S. patent application number 10/712525 was filed with the patent office on 2004-04-22 for kit for enhancing the association rates of polynucleotides.
Invention is credited to Becker, Michael M..
Application Number | 20040077014 10/712525 |
Document ID | / |
Family ID | 22968766 |
Filed Date | 2004-04-22 |
United States Patent
Application |
20040077014 |
Kind Code |
A1 |
Becker, Michael M. |
April 22, 2004 |
Kit for enhancing the association rates of polynucleotides
Abstract
Kit for increasing the association rate between a polynucleotide
probe and a target nucleic acid, where the kit includes a
polynucleotide probe, a synthetic polycationic polymer for
increasing the association rate of the probe and a target nucleic
acid, and a dissociating reagent for dissociating the polymer from
the probe and the target nucleic acid.
Inventors: |
Becker, Michael M.; (San
Diego, CA) |
Correspondence
Address: |
GEN PROBE INCORPORATED
10210 GENETIC CENTER DRIVE
SAN DIEGO
CA
92121
|
Family ID: |
22968766 |
Appl. No.: |
10/712525 |
Filed: |
November 12, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10712525 |
Nov 12, 2003 |
|
|
|
10020596 |
Dec 7, 2001 |
|
|
|
60255535 |
Dec 14, 2000 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12 |
Current CPC
Class: |
C12Q 1/6839 20130101;
C12Q 2527/125 20130101; C12Q 2527/125 20130101; C12Q 1/70 20130101;
Y10T 436/143333 20150115; C12Q 1/6832 20130101; C12Q 1/6832
20130101; C12Q 1/6832 20130101; C12Q 1/6818 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
What I claim is:
1. A kit comprising: a polynucleotide probe which preferentially
hybridizes to a target nucleic acid present in a test sample under
a first set of hybridization conditions; a synthetic polycationic
polymer in an amount sufficient to increase the association rate of
said probe and said target nucleic acid in said sample under said
first set of hybridization conditions; and a dissociating reagent
for dissociating said polymer from said probe and said target
nucleic acid in said sample.
2. The kit of claim 1, wherein the cationic monomers comprising
said polymer are in molar excess of the phosphate groups of said
probe.
3. The kit of claim 1, wherein said polymer is copolymer.
4. The kit of claim 1, wherein said polymer is a graft
copolymer.
5. The kit of claim 1, wherein said polymer has a delocalized
charge.
6. The kit of claim 1, wherein said polymer has a weight average
molecular weight of less than about 300,000 Da.
7. The kit of claim 1, wherein said probe includes multiple
interacting labels and comprises first and second base regions
which hybridize to each other under said first set of hybridization
conditions in the absence of said target sequence, wherein said
labels interact with each other to produce a first detectable
signal when said probe is not hybridized to said target sequence
and a second detectable signal when said probe is hybridized to
said target sequence, and wherein said first and second signals are
detectably different from each other.
8. The kit of claim 7, wherein said probe includes a third base
region which hybridizes to said target sequence under said first
set of hybridization conditions, and wherein said third base region
is distinct from said first and second base regions or said third
base region partially or fully overlaps at least one of said first
and second base regions of said probe.
9. The kit of claim 1, wherein said probe is a polyanion.
10. The kit of claim 9, wherein said probe further includes at
least one of a cationic group and a nonionic group.
11. The kit of claim 9, wherein the distance between adjacent
cationic monomers of said polymer approximates the distance between
adjacent phosphate groups of said probe.
12. The kit of claims 1, where said target sequence comprises
RNA.
13. The kit of claim 12, wherein said RNA is ribosomal RNA.
14. The kit of claim 12, wherein said RNA is messenger RNA.
15. The kit of claim 1, wherein said dissociating reagent is at
least one of a polyanion or an anionic detergent.
16. The kit of claim 1 further comprising written instructions for
performing an assay to determine the presence or absence of said
target sequence in said sample as an indication of the presence or
absence of a virus or organism or members of a group of viruses or
organisms in said sample.
17. The kit of claim 16, wherein said written instructions specify
hybridization conditions which include a temperature of at least
about 40.degree. C. and a salt concentration of at least about 5 mM
monovalent cations or an equivalent salt concentration containing
multivalent cations.
18. The kit of claim 17, wherein the temperature specified by said
written instruction is up to about 60.degree. C.
19. The kit of claim 16, wherein said written instructions specifiy
hybridization conditions which include a temperature of at least
about 40.degree. C. and a salt concentration of at least about 150
mM monovalent cations or an equivalent salt concentration
containing multivalent cations.
20. The kit of claim 19, wherein the temperature specified by said
written instructions is up to about 60.degree. C.
21. The kit of claim 16, wherein said probe includes a label.
22. The kit of claim 1 further comprising a capture probe having a
base region which stably hybridizes to a base region present in
said target nucleic acid under a second set of hybridization
conditions, wherein said first and second hybridization conditions
may be the same or different, and wherein said capture probe stably
hybridizes to said target nucleic acid under said first set of
hybridization conditions.
23. The kit of claim 1 further comprising one or more amplification
primers.
Description
[0001] This application is a divisional of application Ser. No.
10/020,596, filed Dec. 7, 2001, now pending, the contents of which
are hereby incorporated by reference herein, which claims the
benefit of U.S. Provisional Application No. 60/255,535, filed Dec.
14, 2000.
FIELD OF THE INVENTION
[0002] The present invention relates to a method and kit for use in
forming duplexes from single-stranded, complementary regions of
polynucleotides which include one or more synthetic, water soluble
polycationic polymers which enhance the association rates of the
polynucleotides under assay conditions.
INCORPORATION BY REFERENCE
[0003] All references referred to herein are hereby incorporated by
reference in their entirety. The incorporation of these references,
standing alone, should not be construed as an assertion or
admission by the inventors that any portion of the contents of all
of these references, or any particular reference, is considered to
be essential material for satisfying any national or regional
statutory disclosure requirement for patent applications.
Notwithstanding, the inventors reserve the right to rely upon any
of such references, where appropriate, for providing material
deemed essential to the claimed invention by an examining authority
or court. No reference referred to herein is admitted to be prior
art to the claimed invention.
BACKGROUND OF THE INVENTION
[0004] Nucleic acid association concerns techniques by which
complementary base regions of two separate strands of nucleic acid,
or distinct base regions of the same nucleic acid strand, anneal to
each other through Watson-Crick base pairing, thus forming at least
partially double-stranded nucleic acids. Examples of such pairing
include two complementary DNA sequences, a single-stranded DNA
sequence and a complementary RNA sequence, and two complementary
RNA sequences, as well as modified forms of these nucleic acids,
such as peptide nucleic acids or locked nucleic acids. See Nielsen
et al, "Peptide Nucleic Acids," U.S. Pat. No. 5,773,571; see also
Imanishi et al., "Bicyclonucleoside and Oligonucleotide Analogues,"
U.S. Pat. No. 6,268,490. For base pairing to take place, it is
necessary to incubate the single-stranded nucleic acids under
conditions which facilitate the formation of stable duplexes
between nucleic acids or within a nucleic acid having complementary
base regions. The formation of duplexes under stringent assay
conditions can provide useful information about at least one member
of each duplex, including the source from which that particular
member was derived (e.g., a specific virus, microorganism, plant or
animal), whether directly or by nucleic acid amplification, the
presence of a disease-associated gene, the level of gene
expression, the identification of genetic variability, including
the detection of mutations and polymorphisms, and nucleic acid
sequence information.
[0005] The rate at which nucleic acids having complementary base
regions associate to form duplexes follows second-order kinetics.
Thus, as the concentration of single-stranded nucleic acids is
increased, the reaction rate (i.e., the rate at which duplexes are
formed) is also increased. Conversely, as the concentration of
single-stranded nucleic acids is decreased, the reaction rate is
likewise decreased and, as a result, more time is required for the
formation of double-stranded nucleic acids.
[0006] It is also well known that the temperature a reaction
mixture affects the rate at which complementary nucleic acids
associate. For example, as the temperature of a reaction mixture
falls below the melting temperature or T.sub.m (the temperature at
which 50% of the duplexed molecules are rendered single-stranded),
a maximum rate of reaction will be reached at temperatures
approximately 15.degree. to 30.degree. C. below the T.sub.m.
Decreasing the temperature still further will lower the reaction
rate below this maximum rate.
[0007] The reaction rate between nucleic acids having complementary
base regions is also very dependent upon the ionic strength of a
reaction mixture. Deoxynucleic acids, for instance, show a marked
increase in reaction rates up to about 1.2 M NaCl, at which point
the rate of association becomes essentially constant. See Wetmur et
al. J. Mol. Biol. (1968) 31:349-379. And hybridizations between DNA
and RNA molecules show a 5-6 fold increase in the rate of
association when the ionic strength is increased from 0.2 to 1.5 M
NaCl. The effect of changes in salt concentration on the rate of
DNA:DNA reactions is greater than it ifor RNA:DNA reactions.
[0008] A major limitation on the utility of many known nucleic acid
association techniques is the basic rate of the reaction. Reaction
times can be on the order of several hours to tens of hours, and
even days in certain instances. Increasing the reaction rate by
increasing the amount of single-stranded nucleic acid molecules in
a reaction, in order to take advantage of second-order kinetics, is
an undesirable solution for several reasons. First, in many
applications the targeted nucleic acid in a reaction mixture has
been extracted from a physiological sample, thereby imposing
inherent limits on the amount of the targeted nucleic acid
available in the reaction mixture, at least in the absence of an
amplification procedure such as the polymerase chain reaction. See,
e.g., Mullis, "Process for Amplifying Nucleic Acid Sequences," U.S.
Pat. No. 4,683,202. Second, there are considerable expenses
associated with the use of nucleic acid reactants, and even greater
expenses associated with a nucleic acid amplification procedure
(e.g., enzymes and amplification primers), thus affecting the
practicality of using more of these reactants or adding
amplification reactants. Third, increasing the quantity of labeled,
single-stranded nucleic acid probe molecules in a reaction mixture
will cause a decrease in the sensitivity of a reaction, since the
additional single-stranded nucleic acid probe molecules will
elevate the background noise.
[0009] Accordingly, it is a principal object of the present
invention to provide a method for forming a duplex from
single-stranded regions of separate polynucleotides which enhances
the association rate of the polynucleotides, whether reassociation
or hybridization, and which enhancement can be demonstrated using
reference conditions, including those conditions set forth herein.
It is a further object of the present invention to provide a method
for enhancing association rates that would be applicable to
DNA:DNA, RNA:DNA and RNA:RNA reaction systems. Additionally, it is
an object of the present invention to provide a method for
promoting polynucleotide association rates that is applicable to
reaction mixtures having a range of temperature and ionic strength
conditions.
SUMMARY OF THE INVENTION
[0010] In satisfaction of these objectives, the present invention
features a method for forming a duplex from a polynucleotide probe
and a target nucleic acid, where the method comprises the steps of:
(i) providing the probe to a test sample under conditions
permitting the probe to preferentially hybridize to the target
nucleic acid, if any, present in the sample; and (ii) providing a
synthetic polycationic polymer to the test sample in an amount
sufficient to increase the association rate of the probe and the
target nucleic acid in the sample under the conditions permitting
the probe to preferentially hybridize to the target nucleic acid.
To facilitate detecting the formation of probe:target nucleic acid
hybrids, this method may further comprise providing to the test
sample a reagent to dissociate the polymer from the probe in some
detection systems. Additionally, this method may be used in an
assay to determine the presence or absence of a target nucleic acid
sequence derived from a target virus or organism or a target group
of viruses or organisms as an indication of the presence or absence
of the target virus or organism or members of the target group of
viruses or organisms in the test sample. Alternative uses of this
method include detecting the presence of a disease-associated gene,
determining the state of a disease, measuring levels of gene
expression, and detecting mutations or polymorphisms in a test
sample.
[0011] In addition to anionic groups, polynucleotide probes
featured in the present invention may further include cationic
and/or nonionic groups, provided the probes have a net positive
charge. The polynucleotide may consist of deoxyribonucleic acid
(DNA), ribonucleic acid (RNA), a combination of DNA and RNA, or it
may include a nucleic acid analog (e.g., a peptide nucleic acid) or
contain one or more modified nucleosides (e.g., a ribonucleoside
having a 2'-O-methyl substitution to the ribofuranosyl moiety).
Non-nucleotide groups, such as polysaccharides or polyethyelene
glycol, may also be included in the probes, provided they do not
prevent or substantially interfere with hybridization of the probe
to the target nucleic acid. Probes of the present invention are up
to 100 bases or more in length (preferably from 12 to 50 bases, and
more preferably from 18 to 35 bases in length) and contain a base
region which is complementary to a target sequence contained in the
target nucleic acid (the base region is preferably perfectly
complementary to the target sequence).
[0012] The probes preferably include a detectable label or group of
interacting labels. The label may be any suitable labeling
substance, including but not limited to a radioisotope, an enzyme,
an enzyme cofactor, an enzyme substrate, a dye, a hapten, a
chemiluminescent molecule, a fluorescent molecule, a phosphorescent
molecule, an electrochemiluminescent molecule, a chromophore, a
base sequence region that is unable to stably bind to the target
nucleic acid under the stated conditions, and mixtures of these. In
one particularly preferred embodiment, the label is an acridinium
ester (AE), preferably 4-(2-succinimidyloxycarbonyl
ethyl)-phenyl-10-methylacridinium-9-carboxyl- ate fluorosulfonate
(hereinafter referred to as "standard AE"). Groups of interacting
labels include, but are not limited to, enzyme/substrate,
enzyme/cofactor, luminescent/quencher, luminescent/adduct, dye
dimers and Forrester energy transfer pairs. When provided with a
group of interacting labels, the probes preferably have regions of
self-complementarity such that the group of interacting labels
produce a first signal when an associated probe is self-hybridized
and a second signal when the probe is hybridized to the target
nucleic acid, where the first and second signals are differentially
detectable. In some embodiments, these regions of
self-complementarity may overlap or include the portion or portions
of the probe which hybridize to the target nucleic acid.
[0013] To isolate the target nucleic acid in a test sample prior to
detection, the present invention further contemplates probes having
a base sequence region distinct from the target binding region of
the probe which constitutes an immobilized probe binding region of
a capture probe. The immobilized probe binding region may be
comprised of, for example, a 3' poly dA (adenine) region which
hybridizes under stringent conditions to a 5' poly dT (thymine)
region of a polynucleotide bound directly or indirectly to a solid
support provided to the test sample. Any known solid support may be
used, such as matrices and particles free in solution. The solid
support may be, for example, nitrocellulose, nylon, glass,
polyacrylate, mixed polymers, polystyrene, silane polypropylene
and, preferably, particles having a magnetic charge to facilitate
recovering sample and/or removing unbound nucleic acids or other
sample components. Particularly preferred supports are magnetic
spheres that are monodisperse (i.e., uniform in size.+-.5%),
allowing for consistent results, which is particularly advantageous
for use in an automated procedure.
[0014] The target nucleic acid may be RNA or DNA, a nucleic acid
analog or a chimeric containing different types of nucleic acid
and/or nucleic acid analogs. A preferred target nucleic acid of the
present invention is RNA, especially ribosomal RNA (rRNA) and
messenger RNA (mRNA). Ribosomal RNA is a preferred target nucleic
acid for detecting groups of organisms in test samples because of
its relative abundance in cells and because of its conserved nature
which allows for differentiating between defined groups of
organisms. See, e.g., Kohne, "Method for Detecting, Identifying,
and Quantitating Organisms and Viruses," U.S. Pat. No. 5,288,611,
and Hogan et al., "Nucleic Acid Probes for Detection and/or
Quantitation of Non-Viral Organisms," U.S. Pat. No. 5,840,488. For
measuring gene expression, determining the presence of a particular
cell-type, or detecting the presence of a target group of viruses,
assaying for specific mRNAs may be preferred. See, e.g., Gentalen
et al., "Methods of Using an Array of Pooled Probes in Genetic
Analysis," U.S. Pat. No. 6,306,643; Kohne, "Method for Detecting
the Presence of RNA Belonging to an Organ or Tissue Cell-Type,"
U.S. Pat. No. 5,932,416; and Kohne, "Method for Detecting the
Presence of Group-Specific Viral mRNA in a Sample," U.S. Pat. No.
5,955,261.
[0015] The sensitivity of an assay is limited by the amount of
target nucleic acid present in the test sample. To increase the
sensitivity of a detection assay, the present invention further
contemplates an amplification step to increase the quantity of the
target nucleic acid in the test sample prior to detection with a
polynucleotide probe. Thus, the target nucleic acid may be directly
obtained from the test sample or it may be a nucleic acid derived
from an amplification procedure (i.e., amplicon). Numerous
amplification procedures are well known in the art, the most common
of which is the polymerase chain reaction. See, e.g., Mullis in
U.S. Pat. No. 4,683,202. Amplification may be performed in the
presence of non-target nucleic acid or the target nucleic acid may
be isolated and purified prior to amplification in order to remove
inhibitors of amplification and to limit non-specific
amplification.
[0016] The polycationic polymers and polynucleotide probes of the
present invention may be provided to the test sample in any order.
The polymers are synthetically produced and water soluble. They
include a plurality of cationic charges and may be homopolymers
and/or copolymers, including block and graft copolymers. While the
polymers may include ionic and/or anionic monomers, the positively
charged monomers are present in molar excess to the negatively
charged monomers. The cationic charges of the polymers may be
localized or delocalized or they may include both localized and
delocalized cationic charges.
[0017] In a preferred embodiment, the polycationic polymers of the
present invention form complexes of nanoparticle size in the test
sample under hybridization assay conditions. These complexes may
include a plurality of covalently linked polymers, and may further
include covalently linked polymers and polynucleotides. To prevent
their precipitation out of solution, these complexes are preferably
water soluble. Thus, the cationic monomers present in the polymers
are preferably present in molar excess of the phosphate groups of
the probes provided to a test sample, and even more preferably
present in molar excess of the phosphate groups of all nucleic
acids predicted to be present in a test sample.
[0018] In certain embodiments of the present invention, it is
desirable to dissociate polymers and polynucleotides prior to
detection of the target nucleic acid, if present, and after
complementary polynucleotides have had sufficient time to stably
associate in the test sample. Dissociation can be achieved by
providing one or more dissociating agents to the test sample, such
as an anionic detergent (e.g., lithium lauryl sulfate) and/or a
polyanion (e.g., exogenous nucleic acid). The dissociating agents
should be provided to the test sample in an amount sufficient to
weaken the bonds between polymers and polynucleotides.
[0019] The association rate of complementary polynucleotides in the
presence of the polycationic polymers of the present invention is
preferably at least about 2-fold greater than the association rate
of the same complementary polynucleotides in the absence of the
polymer under identical incubation periods and conditions. More
preferably, the association rate is at least about 5-fold greater,
at least about 10-fold greater, at least about 100-fold greater or
at least about 1000-fold greater in the presence of the
polycationic polymers. Such conditions preferably include a
temperature of at least about 40.degree. C. and a salt
concentration of at least about 5 mM monovalent cations (or an
equivalent salt concentration including multivalent cations, such
as divalent magnesium present in magnesium chloride or magnesium
sulfate). More preferably, such conditions include a temperature of
at least about 40.degree. C. and a salt concentration of at least
about 150 mM monovalent cations (or an equivalent salt
concentration including multivalent cations). An equivalent salt
concentration is one which will result in approximately the same
rate enhancement as a salt concentration which does not include any
multivalent cations under otherwise identical conditions. The
temperature of the reaction mixture will generally be in the range
of room temperature to about 90.degree. C., and is preferably in
the range of about 40.degree. C. to about 70.degree. C., more
preferably in the range of about 50.degree. C. to about 60.degree.
C., and is most preferably about 60.degree. C.
[0020] In a further embodiment of the present invention, a kit is
featured which comprises: (i) a polynucleotide probe which
preferentially hybridizes to a target nucleic acid sequence in a
test sample under hybridization assay conditions; and (ii) a
synthetic polycationic polymer in an amount sufficient to increase
the association rate of the probe and the target sequence in the
test sample under the hybridization assay conditions. The probe and
polymer may be provided in the same or separate containers. Kits
according to the present invention may further comprise at least
one of the following: (i) a reagent to dissociate the polymer from
the probe; (ii) one or more amplification primers for amplifying a
target sequence contained in or derived from the target nucleic
acid; (iii) a capture probe for isolating and purifying target
nucleic acid present in a test sample; and (iv) if a capture probe
is included, a solid support material (e.g., magnetically
responsive particles) for immobilizing the capture probe, either
directly or indirectly, in a test sample. Where the target nucleic
acid is a structured nucleic acid having regions of
self-complementarity, such as rRNA, the kits of the present
invention may further include helper probes. See Hogan et al.,
"Means and Method for Enhancing Nucleic Acid Hybridization," U.S.
Pat. No. 5,030,557. Additionally, the kits may comprise written
instructions for performing an assay to determine the presence or
absence of a target nucleic acid sequence in the test sample as an
indication of the presence or absence of a target virus or organism
or members of a target group of viruses or organisms in the test
sample. The assay described in the written instructions may include
steps for isolating and purifying the target nucleic acid prior to
detection with the polynucleotide probe and/or amplifying a target
sequence contained in the target nucleic acid. Alternatively, the
kit may include written instructions for performing, for example,
an assay to detect the presence of a disease-associated gene, to
determine the state of a disease, to measure levels of gene
expression, or to detect mutations or polymorphisms in a test
sample.
[0021] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 is a plot of percent hybridization versus log of
C.sub.ot for a range of target concentrations used to determine the
rate of a reaction having a three minute incubation period, where
each (.circle-solid.) represents a data point derived from
experimental data.
[0023] FIG. 2 is a plot of percent hybridization versus log of
C.sub.ot for a range of target concentrations used to determine the
rate of a reaction having an eight minute incubation period, where
each (.circle-solid.) represents a data point derived from
experimental data.
[0024] FIG. 3 is a plot of the predicted percent hybridization
versus log of C.sub.ot curve (where the estimated association rate
constant (k.sub.1)=16,000 M.sup.-1 and the estimated dissociation
rate constant (k.sub.2)=0) superimposed over the plotted data
points (.circle-solid.) derived from experimental data and depicted
in FIG. 1.
[0025] FIG. 4 is a plot of the predicted percent hybridization
versus log of C.sub.ot curve (where the estimated k.sub.1=16,000
M.sup.-1 and the estimated k.sub.2=0) superimposed over the plotted
data points (.circle-solid.) derived from experimental data and
depicted in FIG. 2.
[0026] FIG. 5 graphically represents an adjustment to k.sub.1 and
k.sub.2 (k.sub.1=14,500 M.sup.-1s.sup.-1 and
k.sub.2=8.33.times.10.sup.-4s.sup.-1- ), such that the predicted
curve of FIG. 3 and the data points (.circle-solid.) of FIG. 1 are
coincident. Adjusted k.sub.1 and k.sub.2 should provide a closer
approximation of the actual rate of this reaction.
[0027] FIG. 6 graphically represents an adjustment to k.sub.1 and
k.sub.2 (k.sub.1=14,500 M.sup.-1s.sup.-1 and
k.sub.2=8.33.times.10.sup.-4s.sup.-1- ), such that the predicted
curve of FIG. 4 and the data points (.circle-solid.) of FIG. 2 are
coincident. Adjusted k.sub.1 and k.sub.2 should provide a closer
approximation of the actual rate of this reaction.
[0028] FIG. 7 is a plot of percent hybridization versus log of
C.sub.ot for a range of target concentrations with polymer
(.diamond-solid.) and without polymer (.DELTA.), where each
(.diamond-solid.) and (.DELTA.) represents a data point derived
from experimental data.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
A. Definitions
[0029] The following terms have the indicated meanings in the
specification unless expressly indicated to have a different
meaning.
[0030] By "target nucleic acid," "target polynucleotide" or
"target" is meant a nucleic acid containing a target nucleic acid
sequence.
[0031] By "target nucleic acid sequence," "target sequence" or
"target region" is meant a specific deoxyribonucleotide or
ribonucleotide sequence comprising all or part of the nucleotide
sequence of a single-stranded nucleic acid molecule. Target nucleic
acid sequences of the present invention contain a mixture of
nucleotides, i.e., more than one type of nucleotide (e.g., adenine
(A), cytosine (T), guanine (G), inosine (I), thymine (T) or uracil
(U)).
[0032] By "polynucleotide" is meant a polymer having two or more
nucleoside subunits or nucleobase subunits coupled together. The
polynucleotides include DNA and/or RNA or analogs thereof and may
further include non-nucleotide groups such as, for example, abasic
nucleotides, universal bases (e.g., 3-nitropyrrole and
5-nitroindole), polysaccharides, peptides, polypeptides and/or
polyethylene glycol. See, e.g., Becker et al., "Molecular Torches,"
U.S. Pat. No. 6,361,945; Bergstrom et al., "3-Nitropyrrole
Nucleoside," U.S. Pat. No. 5,681,947; Loakes et al. Nucleic Acids
Research (1995) 23(13):2361-2366; and Arnold et al., "Linking
Reagents for Nucleotide Probes," U.S. Pat. No. 5,585,481. The sugar
groups of the nucleoside subunits may be ribose, deoxyribose and
analogs thereof, including, for example, ribonucleosides having a
2'-O-methyl substitution to the ribofuranosyl moiety.
(Polynucleotides including nucleoside subunits having 2'
substitutions which are useful as polynucleotide probes are
disclosed by Becker et al., "Method for Amplifying Target Nucleic
Acid Using Modified Primers," U.S. Pat. No. 6,130,038.) The
nucleoside subunits may by joined by linkages such as
phosphodiester linkages, modified linkages or by non-nucleotide
moieties which do not prevent hybridization of the polynucleotide
to its complementary target nucleic acid sequence. Modified
linkages include those linkages in which a standard phosphodiester
linkage is replaced with a different linkage, such as a
phosphorothioate linkage or a methylphosphonate linkage. The
nucleobase subunits may be joined, for example, by replacing at
least a portion of the natural deoxyribose phosphate backbone of
DNA with a pseuodo peptide backbone, such as a 2-aminoethylglycine
backbone which couples the nucleobase subunits by means of a
carboxymethyl linker to the central secondary amine. (DNA analogs
having a pseudo peptide backbone are commonly referred to as
"peptide nucleic acids" or "PNA" and are disclosed by Nielsen et
al. in U.S. Pat. No. 5,773,571.) Other non-limiting examples of
polynucleotides contemplated by the present invention include
nucleic acid analogs containing bicyclic and tricyclic nucleoside
and nucleotide analogs referred to as "Locked Nucleic Acids,"
"Locked Nucleoside Analogues" or "LNA." (Locked Nucleic Acids are
disclosed by Wang, "Conformationally Locked Nucleosides and
Oligonucleotides," U.S. Pat. No. 6,083,482; U.S. Pat. No.
6,268,490; and Wengel et al., "Oligonucleotide Analogues,"
International Publication No. WO 99/14226.) Any nucleic acid analog
is contemplated by the present invention provided the modified
polynucleotide can form a stable hybrid with a target nucleic acid
under hybridization assay conditions and at least a portion of the
modified polynucleotide is anionic. In the case of polynucleotide
probes, the modified polynucleotide must be capable of
preferentially hybridizing to the target nucleic acid under
hybridization assay conditions. Unless indicated to be a "probe," a
polynucleotide, as used herein, may be a nucleic acid molecule
obtained from a natural source which is at least partially
single-stranded or which may be rendered partially or fully
single-stranded by human intervention.
[0033] By "polynucleotide probe" or "probe" is meant a
polynucleotide having a base sequence sufficiently complementary to
its target nucleic acid sequence to form a probe:target hybrid
stable for detection under hybridization assay conditions. As would
be understood by someone having ordinary skill in the art, a probe
is an isolated nucleic acid molecule, or an analog thereof, in a
form not found in nature without human intervention (e.g.,
recombined with foreign nucleic acid, isolated, or purified to some
extent). Probes may have additional nucleosides or nucleobases
outside of the targeted region so long as such nucleosides or
nucleobases do not prevent hybridization under hybridization assay
conditions and, where indicated, do not prevent preferential
hybridization to the target nucleic acid. A non-complementary
sequence may also be included, such as a target capture sequence
(generally a homopolymer tract, such as a poly-A, poly-T or poly-U
tail) or sequences which will confer a desired secondary or
tertiary structure, such as a hairpin structure, which can be used
to facilitate detection. Examples of probes having a target capture
sequence ("capture probes") are disclosed by Ranki et al.,
"Detection of Microbial Nucleic Acids by a One-Step Sandwich
Hybridization Test," U.S. Pat. No. 4,486,539; Stabinsky, "Methods
and Kits for Performing Nucleic Acid Hybridization Assays," U.S.
Pat. No. 4,751,177; and Weisburg et al., "Two Step Hybridization
and Capture of a Polynucleotide," U.S. Pat. No. 6,110,678.
Self-hybridizing probes are disclosed by, for example, Bagwell,
"Fluorescent Imperfect Nucleic Acid Probes," U.S. Pat. No.
5,607,834; Tyagi et al., "Detectably Labeled Dual Conformation
Oligonucleotide Probes, Assays and Kits," U.S. Pat. No. 5,925,517;
and Becker et al. in U.S. Pat. No. 6,361,945.
[0034] Polynucleotide probes of the present invention are
preferably no more than about 100 bases in length, more preferably
no more than about 50 bases in length, and most preferably no more
than about 35 bases in length. Probes of a defined sequence may be
produced by techniques known to those of ordinary skill in the art,
such as by chemical or biochemical synthesis, and by in vitro or in
vivo expression from recombinant nucleic acid molecules, e.g.,
bacterial or retroviral vectors.
[0035] By "complementary" is meant polynucleotides having base
sequence regions able to form stable hydrogen bonds under
hybridization assay conditions. Perfect complementarity between
base regions of polynucleotides is not required, provided the two
regions are sufficiently complementary to permit the stable
formation of a double-stranded, hydrogen-bonded region under
hybridization assay conditions.
[0036] By "stably," "stable" or "stable for detection" is meant
that the temperature of a reaction mixture is at least 2.degree. C.
below the melting temperature of a polynucleotide duplex. The
temperature of the reaction mixture is more preferably at least
5.degree. C. below the melting temperature of the polynucleotide
duplex, and even more preferably at least 10.degree. C. below the
melting temperature of the reaction mixture.
[0037] By "hybridization" is meant the ability of two completely or
partially complementary polynucleotides to come together under
specified hybridization assay conditions in an orientation
permitting the formation of a stable structure having a
double-stranded region. The two constituent strands of this
double-stranded structure, sometimes called a hybrid, are held
together by hydrogen bonds. Although these hydrogen bonds most
commonly form between the bases of adenine and thymine or uracil (A
and T or U) or cytosine and guanine (C and G) on single nucleic
acid strands, base pairing can also form between bases which are
not members of these "canonical" pairs. Non-canonical base pairing
is well-known in the art. (See, e.g., ROGER L. P. ADAMS ET AL., THE
BIOCHEMISTRY OF THE NUCLEIC ACIDS (11.sup.th ed. 1992).)
[0038] By "preferentially hybridize" is meant that under the
specified hybridization assay conditions, polynucleotide probes can
hybridize to their target nucleic acids to form stable probe:target
hybrids indicating the presence of a specific target nucleic acid
sequence, and there is not formed a sufficient number of stable
probe:non-target hybrids to indicate the presence of non-target
nucleic acids. Thus, the probe hybridizes to target nucleic acid to
a sufficiently greater extent than to non-target nucleic acid to
enable one having ordinary skill in the art to accurately detect
the presence (or absence) of the target nucleic acid sequence in a
test sample which may also contain non-target nucleic acid. Probes
which preferentially hybridize to target nucleic acid are
particularly useful in diagnostic assays intended to specifically
detect the presence or absence of a particular virus or organism or
members of a group of viruses or organisms in a test sample which
may also contain phylogenetically closely related non-target
viruses or organisms. Such diagnostic assays are well known in the
art and are disclosed by, for example, Kohne in U.S. Pat. No.
5,288,611.
[0039] In general, reducing the degree of complementarity between a
polynucleotide sequence and its target sequence will decrease the
degree or rate of hybridization of the polynucleotide to its target
region. However, the inclusion of one or more non-complementary
bases may facilitate the ability of a polynucleotide to
discriminate against non-target polynucleotides.
[0040] Preferential hybridization can be measured using techniques
well known to those having ordinary skill in the art, including
those described in the Examples section infra. Preferably, there is
at least a 10-fold difference between target and non-target
hybridization signals in a test sample, more preferably at least a
100-fold difference, and most preferably at least a 1,000-fold
difference. Preferably, non-target hybridization signals in a test
sample are no more than the background signal level.
[0041] By "phylogenetically closely related" is meant that the
organisms or viruses are closely related to each other in an
evolutionary sense and therefore would have a higher total nucleic
acid sequence homology than organisms or viruses that are more
distantly related. Organisms or viruses occupying adjacent and next
to adjacent positions on the phylogenetic tree are closely related.
Organisms or viruses occupying positions farther away than adjacent
or next to adjacent positions on the phylogenetic tree will still
be closely related if they have significant total nucleic acid
sequence homology.
[0042] By "test sample" is meant a substance known or suspected to
contain target nucleic acid extracted or removed from any source,
including bodily fluids, tissues, secretions and excretions,
plants, water, food and the environment, for assaying in vitro or
ex vivo. The substance may be processed to isolate and purify
nucleic acid contained therein, such that use of the term "test
sample" herein may refer to either the substance in its unaltered,
extracted state or to target nucleic acid which has been isolated
from the substance and then purified.
[0043] By "capture probe" is meant a polynucleotide or a set of at
least two polynucleotides linked together which are capable of
hybridizing to a target nucleic acid and to an immobilized probe,
thereby providing means for immobilizing and isolating the target
nucleic acid in a test sample. That portion of the capture probe
which hybridizes to the target nucleic acid is referred to as the
"target binding region," and that portion of the capture probe
which hybridizes to the immobilized probe is referred to as the
"immobilized probe binding region." While the capture probe
hybridizes to both the target nucleic acid and the immobilized
probe under hybridization assay conditions, the target binding
region and the immobilized probe binding region may be designed to
hybridize to their respective target sequences under different
hybridization assay conditions. In this way, the capture probe may
be designed so that it first hybridizes to the target nucleic acid
under more favorable in solution kinetics before adjusting the
conditions to permit hybridization of the immobilized probe binding
region to the immobilized probe. The target binding and immobilized
probe binding regions may be directly adjoining each other on the
same polynucleotide, they may be separated from each other by one
or more optionally modified nucleotides, and/or they may be joined
to each other by means of a non-nucleotide linker.
[0044] By "target binding region" is meant that portion of a
polynucleotide which stably binds to a target sequence present in a
target nucleic acid, a DNA or RNA equivalent of the target sequence
or a complement of the target sequence under hybridization assay
conditions. The hybridization assay conditions may be stringent
hybridization assay conditions or amplification conditions.
[0045] By "immobilized probe binding region" is meant that portion
of a polynucleotide which hybridizes to an immobilized probe under
hybridization assay conditions.
[0046] By "immobilized probe" is meant a polynucleotide for joining
a capture probe to an immobilized support. The immobilized probe is
joined either directly or indirectly to the solid support by a
linkage or interaction which remains stable under the conditions
employed to hybridize the capture probe to the target nucleic acid
and to the immobilized probe, whether those conditions are the same
or different. The immobilized probe facilitates separation of the
bound target nucleic acid from unbound materials in a sample.
[0047] By "isolate," "isolated" or "isolating" is meant that at
least a portion of the target nucleic acid present in a test sample
is concentrated in a reaction receptacle or on a reaction device or
solid carrier (e.g., test tube, cuvette, microtiter plate well,
nitrocellulose filter, slide or pipette tip) in a fixed or
releasable manner so that the target nucleic acid can be purified
without significant loss of the target nucleic acid from the
receptacle, device or carrier.
[0048] By "purify," "purified" or "purifying" is meant that one or
more components of a sample present in a reaction receptacle or on
a reaction device or solid carrier are physically removed from one
or more other sample components present in the reaction receptacle
or on the reaction device or solid carrier. Sample components which
may be removed during a separating or purifying step include
proteins, carbohydrates, lipids, inhibitors, non-target nucleic
acids and unbound probe. Preferably retained in a sample during a
purifying step are target nucleic acids bound to immobilized
capture probes.
[0049] By "reaction mixture" is meant a test sample containing a
polynucleotide probe having a base region which is complementary to
a target sequence contained in a target nucleic acid known or
suspected to be present in the test sample. The reaction mixture is
subjected to conditions which facilitate hybridization of the probe
to the target sequence.
[0050] By "hybridization conditions" or "hybridization assay
conditions" is meant conditions permitting a polynucleotide probe
to stably hybridize to a target nucleic acid. Hybridization assay
conditions may vary depending upon factors including the GC
(guanine/cytosine) content and length of the probe, the degree of
similarity between the probe sequence and sequences of non-target
nucleic acids which may be present in the test sample, and the
target sequence. Hybridization assay conditions include the
temperature and composition of the hybridization reagents or
solutions. While the Examples section infra provides preferred
hybridization assay conditions for detecting target nucleic acids,
other acceptable conditions could be easily ascertained by someone
having ordinary skill in the art.
[0051] By "reaction rate," "rate of reaction," "association rate"
or "rate of association" is meant the rate at which polynucleotides
having regions of complementarity reassociate or hybridize to form
duplexes under hybridization assay conditions.
[0052] By "reassociation," "reassociate," "renaturation" or
"renaturate" is meant the reformation of double-stranded
polynucleotides from single-stranded polynucleotides which were
base-paired to each other before being separated through a
denaturation process.
[0053] By "hybridization" or "hybridize" is meant the formation of
double-stranded polynucleotides from single-stranded
polynucleotides of individual origin with respect to each other
(e.g., DNA from different species or a mixture of RNA and DNA). As
used herein, the term "hybridization" is used interchangeably to
refer to hybridization or reassociation.
[0054] By "solution hybridization" or "in solution" is meant that
the reactants present in a reaction mixture (i.e., polynucleotides
having complementary, single-stranded regions) are diffusible in
the reaction mixture when they are exposed to hybridization assay
conditions.
[0055] By "label" is meant a reporter moiety associated with a
polynucleotide which can be detected by means well known in the art
and used to indicate the presence or absence of a particular
polynucleotide sequence in a test sample. Examples of labels which
are well known in the art include chemiluminescent,
electrochemiluminescent and fluorescent compounds, radioisotopes,
dyes, polynucleotides, enzymes, enzyme substrates, chromophores and
haptens. When multiple interacting labels are associated with a
polynucleotide, interacting labels may include, for example, the
following: luminescent and quencher labels, luminescent and adduct
labels, dye dimer labels, enzyme and substrate labels, enzyme and
cofactor labels, and Forrester energy transfer pairs. Examples of
polynucleotides having multiple interacting labels are disclosed
by, for example, Bagwell in U.S. Pat. No. 5,607,834; Tyagi et al.
in U.S. Pat. No. 5,925,517; and Becker et al. in U.S. Pat. No.
6,361,945.
[0056] By "nucleic acid duplex," "duplex," "nucleic acid hybrid" or
"hybrid" is meant a stable nucleic acid structure comprising a
double-stranded, hydrogen-bonded region. Such hybrids include
RNA:RNA, RNA:DNA and DNA:DNA duplex molecules and analogs thereof.
The structure is sufficiently stable to be detectable by any known
means, including means which do not require a probe associated
label. For instance, the detection method may include a probe
coated substrate which is optically active and sensitive to changes
in mass at its surface. Mass changes result in different reflective
and transmissive properties of the optically active substrate in
response to light and serve to indicate the presence or amount of
immobilized target nucleic acid. This exemplary form of optical
detection is disclosed by Nygren et al., "Devices and Methods for
Optical Detection of Nucleic Acid Hybridization," U.S. Pat. No.
6,060,237. Other detection methods include those based on detecting
probe associated changes in conductivity or turbidity in the test
sample.
[0057] By "helper probe" is meant a polynucleotide designed to
hybridize to a target nucleic acid at a different locus than that
of a polynucleotide probe, thereby either increasing the rate of
hybridization of the probe to the target nucleic acid, increasing
the melting temperature of the probe:target hybrid, or both.
[0058] By "amplification primer" or "primer" is meant a
polynucleotide capable of hybridizing to a target nucleic acid and
acting as a primer and/or a promoter template (e.g., for synthesis
of a complementary strand, thereby forming a functional promoter
sequence) for the initiation of nucleic acid synthesis. If the
amplification primer is designed to initiate RNA synthesis, the
primer may contain a base sequence which is non-complementary to
the target sequence but which is recognized by an RNA polymerase,
such as a T7, T3 or SP6 RNA polymerase. An amplification primer may
contain a 3' terminus which is modified to prevent or lessen the
rate or amount of primer extension. (McDonough et al. disclose
primers and promoter-primers having modified or blocked 3'-ends in
U.S. Pat. No. 5,766,849, entitled "Methods of Amplifying Nucleic
Acids Using Promoter-Containing Primer Sequences.") While the
amplification primers of the present invention may be chemically
synthesized or derived from a vector, they are not
naturally-occurring nucleic acid molecules.
[0059] By "nucleic acid amplification," "target amplification" or
"amplification" is meant increasing the number of nucleic acid
molecules having at least one target nucleic acid sequence. Target
amplification according to the present invention may be either
linear or exponential, although exponential amplification is
preferred.
[0060] By "amplicon" is meant a nucleic acid molecule generated in
a nucleic acid amplification reaction and which is derived from a
target nucleic acid. An amplicon contains a target nucleic acid
sequence which may be of the same or opposite sense as the target
nucleic acid.
[0061] By "derived" is meant that the referred to nucleic acid is
obtained directly from a target organism or indirectly as the
product of a nucleic acid amplification, which product may be, for
instance, an antisense RNA molecule which does not exist in the
target organism.
[0062] By "polymer" is meant a macromolecule comprising one or more
repeated monomer types of low relative molecular mass covalently
joined together.
[0063] By "polycationic polymer" is meant a polymer having a net
positive charge, whether the charges of the polymer are localized
or delocalized. A polycationic polymer is comprised of at least one
cationic monomer type and may also include anionic and/or nonionic
monomer types, provided the polymer has a net positive charge.
[0064] By "monomer" is meant a molecule which can undergo
polymerization, thereby contributing constitutional units to the
essential structure of a polymer.
[0065] By "constitutional units" is meant an atom or group of atoms
(including pendant atoms or groups, if any) comprising a part of
the essential structure of a polymer.
[0066] By "block copolymer" is meant a polymer composed of blocks
in linear sequence.
[0067] By "block" is meant a portion of a polymer, comprising many
constitutional units, which has at least one feature that is not
present in adjacent portions of the polymer.
[0068] By "graft copolymer" is meant a polymer having one or more
species of block connected to the main chain of the polymer as side
chains. These side chains have constitutional or configurational
features that differ from those of the main chain.
[0069] By "synthetic" is meant that the polymerization of the
polymer did not occur exclusively in nature without human
intervention.
[0070] By "complex" is meant a composition comprising a plurality
of polycationic polymers. Complexes of the present invention are
generally nanoparticles.
[0071] By "degree of polymerization" or "DP" is meant the number of
repeating units in a polymer chain.
[0072] By "number-average molecular weight" or "M.sub.n" is meant a
value equal to the weight of a polymer mixture divided by the
number of molecules in the mixture. The number-average molecular
weight can be determined by various well known methods, including
colligative properties, osmotic pressure and freezing point
depression methods.
[0073] By "weight-average molecular weight" or "M.sub.w" is meant
the average molecular weight of the molecules in a polymer mixture.
The weight-average molecular weight can be determined by a number
of different well known methods, including light-scattering and
ultracentrifuge methods. While the M.sub.w value and the M.sub.n
value may be the same if all of the molecules in a mixture have
essentially the same weight, the M.sub.w value will be higher than
the M.sub.n value if some of the molecules in the mixture are
heavier than others.
[0074] By "polydispersity" is meant the ratio of the weight-average
molecular weight and number-average molecular weight
(M.sub.w/M.sub.n) in a polymer mixture. The polydispersity value
indicates how wide the range of molecular weights is in a
mixture.
[0075] The following abbreviations have the indicated meanings:
"Da"=daltons; "M"=moles/liter; "s"=seconds; and "m"=minutes.
B. Hybridization Conditions and Probe Design
[0076] Hybridization reaction conditions, most importantly the
temperature of hybridization and the concentration of salt in the
hybridization solution, can be selected to allow a polynucleotide
probe to preferentially hybridize to a target nucleic acid and not
to non-target nucleic acid known or suspected of being present in a
test sample. At decreased salt concentrations and/or increased
temperatures (conditions of increased stringency) the extent of
hybridization decreases as hydrogen bonding between paired
nucleotide bases in the double-stranded hybrid molecule is
disrupted. This process is known as "melting."
[0077] Generally speaking, the most stable hybrids are those having
the largest number of contiguous, perfectly matched (i.e.,
hydrogen-bonded) nucleotide base pairs. Such hybrids would usually
be expected to be the last to melt as the stringency of the
hybridization conditions increases. However, a double-stranded
nucleic acid region containing one or more mismatched,
"non-canonical," or imperfect base pairs (resulting in weaker or
non-existent base pairing at that position in the nucleotide
sequence of a nucleic acid) may still be sufficiently stable under
conditions of relatively high stringency to allow the nucleic acid
hybrid to be formed and detected in a hybridization assay without
cross-reacting with other, non-selected nucleic acids which may be
present in a test sample.
[0078] Hence, depending on the degree of similarity between the
nucleotide sequences of the target nucleic acid and those of
non-target nucleic acids present in the test sample on one hand,
and the degree of complementarity between the base sequence of a
particular probe and the nucleotide sequences of the target and
non-target nucleic acids on the other, one or more mismatches will
not necessarily defeat the ability of a probe to hybridize to the
target nucleic acid and not to non-target nucleic acids present in
the test sample.
[0079] Polynucleotide probes useful in the present invention are
preferably chosen, selected, and/or designed to maximize the
difference between the melting temperatures T.sub.m of the
probe:target hybrid and the T.sub.m of a mismatched hybrid formed
between the probe and non-target nucleic acid present in the test
sample (e.g., nucleic acid, such as ribosomal RNA (rRNA), from a
phylogenetically closely-related organism).
[0080] Where the target nucleic acid is rRNA, it is important to
note that within the rRNA molecule there is a close relationship
between secondary structure (caused in part by intra-molecular
hydrogen bonding) and function. This fact imposes restrictions on
evolutionary changes in the primary nucleotide sequence causing the
secondary structure to be maintained. For example, if a base is
changed in one "strand" of a double helix (due to intra-molecular
hydrogen bonding, both "strands" are part of the same rRNA
molecule), a compensating substitution usually occurs in the
primary sequence of the other "strand" in order to preserve
complementarity (this is referred to as co-variance), and thus the
necessary secondary structure. This allows two very different rRNA
sequences to be aligned based both on the conserved primary
sequence and also on the conserved secondary structure elements.
Potential target sequences for the polynucleotide probes can be
identified by noting variations in the homology of the aligned
sequences.
[0081] Merely identifying a putatively unique potential target
nucleotide sequence does not guarantee that a functionally specific
polynucleotide probe may be made to hybridize to nucleic acid
comprising that sequence. Various other factors will determine the
suitability of a nucleic acid locus as a target site for a specific
probe. Because the extent and specificity of hybridization
reactions, such as those described herein, are affected by a number
of factors, manipulation of one or more of those factors will
determine the exact sensitivity and specificity of a particular
polynucleotide, whether perfectly complementary to its target or
not. The importance and effect of various hybridization assay
conditions are known to those skilled in the art and are disclosed
by, for example, Kohne, "Method for Detection, Identification and
Quantitation of Non-Viral Organisms," U.S. Pat. No. 4,851,330;
Hogan et al., "Nucleic Acid Probes to Mycobacterium gordonae," U.S.
Pat. No. 5,216,143; and Hogan, "Nucleic Acid Probes for Detection
and/or Quantitation of Non-Viral Organisms," U.S. Pat. No.
5,840,488.
[0082] The desired temperature of hybridization and the
hybridization solution composition (such as salt concentration,
detergents and other solutes) can also greatly affect the stability
of double-stranded hybrids. Conditions such as ionic strength and
the temperature at which a probe will be allowed to hybridize to a
target must be taken into account in constructing a probe. As noted
above, the thermal stability of hybrid polynuceotides generally
increases with the ionic strength of the reaction mixture. On the
other hand, chemical reagents which disrupt hydrogen bonds, such as
formamide, urea, dimethyl sulfoxide and alcohols, can greatly
reduce the thermal stability of the hybrids.
[0083] To maximize the specificity of a probe for its target,
probes should be designed to hybridize to their targets under
conditions of high stringency. Under such conditions only
polynucleotides (or regions) having a high degree of
complementarity will hybridize to each other. Polynucleotides
without such a high degree of complementarity will not form
hybrids. Accordingly, the stringency of the hybridization assay
conditions determines the amount of complementarity which should
exist between two polynucleotides in order to form a hybrid.
Stringency is chosen to maximize the difference in stability
between the hybrid formed between the probe and the target nucleic
acid and potential hybrids between the probe and any non-target
nucleic acids present in a test sample.
[0084] While probes having extensive self-complementarity are
generally avoided, there are some applications in which probes
exhibiting at least some degree of self-complementarity are
desirable to facilitate detection of probe:target duplexes in the
presence of unhybridized probe. By way of example, structures
referred to as "Molecular Torches" are designed to include distinct
regions of self-complementarity (coined the "target binding domain"
and the "target closing domain") which are connected by a
polynucleotide and/or non-nucleotide joining region and hybridize
to one another under predetermined hybridization assay conditions.
When exposed to denaturing conditions, the two complementary
regions (which may be fully or partially complementary) of the
Molecular Torch melt, leaving the target binding domain available
for hybridization to a target sequence when the predetermined
hybridization assay conditions are restored. Molecular Torches are
designed so that the target binding domain favors hybridization to
the target sequence over the target closing domain. The target
binding domain and the target closing domain of a Molecular Torch
include interacting labels (e.g., luminescent/quencher) positioned
so that a different signal is produced when the Molecular Torch is
self-hybridized than when the Molecular Torch is hybridized to a
target nucleic acid, thereby permitting detection of probe:target
duplexes in a test sample in the presence of unhybridized probe
having viable labels associated therewith. (Molecular Torches are
disclosed by Becker et al. in U.S. Pat. No. 6,361,945.) In
accordance with the teachings of Becker, probes of the present
invention may be designed and constructed to include, in addition
to a "target binding domain" able to distinguish target nucleic
acid from non-target nucleic acid, a "target closing domain," a
"joining region" and interacting labels characteristic of a
Molecular Torch.
[0085] Another example of a self-complementary probe is a structure
known as a "Molecular Beacon." Molecular Beacons include nucleic
acid molecules having a target complement sequence, an affinity
pair (or nucleic acid arms) holding the probe in a closed
conformation in the absence of a target nucleic acid sequence, and
a label pair that interacts when the probe is in a closed
conformation. Hybridization of the target nucleic acid and the
target complement sequence separates the members of the affinity
pair, thereby shifting the probe to an open conformation. The shift
to the open conformation is detectable due to reduced interaction
of the label pair, which may be, for example, a fluorophore and a
quencher (e.g., DABCYL and EDANS). (Molecular Beacons are disclosed
by Tyagi et al. in U.S. Pat. No. 5,925,517.) In accordance with the
teachings of Tyagi, probes of the present invention may be designed
and constructed to include, in addition to a "target complement
sequence" able to distinguish target nucleic acid from non-target
nucleic acid, an "affinity pair" and dual labels characteristic of
a Molecular Beacon.
[0086] Specificity may be achieved by limiting that portion of the
polynucleotide probe having perfect complementarity to non-target
sequences, by avoiding G and C rich regions of complementarity to
non-target nucleic acids, and by constructing the probe to contain
as many destabilizing mismatches to non-target sequences as
possible. Whether a probe is appropriate for detecting a specific
target nucleic acid depends largely on the thermal stability
difference between probe:target hybrids versus probe:non-target
hybrids. In designing probes, the differences in these T.sub.m
values should be as large as possible (preferably 2.degree. to
5.degree. C. or more). Manipulation of the T.sub.m can be
accomplished by changes to probe length and probe composition, such
as GC content versus AT content or the inclusion of nucleotide
analogs (e.g., ribonucleotides having a 2'-O-methyl substitution to
the ribofuranosyl moiety).
[0087] In general, the optimal hybridization temperature for
polynucleotide probes is approximately 5.degree. C. below the
melting temperature for a given duplex. Incubation at temperatures
below the optimum temperature may allow mismatched base sequences
to hybridize and can therefore decrease specificity. The longer the
probe, the more hydrogen bonding between base pairs and, in
general, the higher the T.sub.m. Increasing the percentage of G and
C also increases the T.sub.m because G-C base pairs exhibit
additional hydrogen bonding and therefore greater thermal stability
than A-T base pairs. Such considerations are well known in the art.
See, e.g., J. SAMBROOK ET AL., MOLECULAR CLONING: A LABORATORY
MANUAL, ch. 11 (2d ed. 1989).
[0088] A preferred method for determining T.sub.m measures
hybridization using the Hybridization Protection Assay (HPA)
disclosed by Arnold et al., "Homogenous Protection Assay," U.S.
Pat. No. 5,283,174. The T.sub.m can be measured using HPA in the
following manner. Probe molecules are labeled with an acridinium
ester and permitted to form probe:target hybrids in a lithium
succinate buffer (0.1 M lithium succinate buffer, pH 4.7, 20 mM
EDTA, 15 mM aldrithiol-2, 1.2 M LiCl, 3% (v/v) ethanol absolute, 2%
(w/v) lithium lauryl sulfate) using an excess amount of target.
Aliquots of the solution containing the probe:target hybrids are
then diluted in the lithium succinate buffered solution and
incubated for five minutes at various temperatures starting below
that of the anticipated T.sub.m (typically 55.degree. C.) and
increasing in 2-5.degree. C. increments. This solution is then
diluted with a mild alkaline borate buffer (600 mM boric acid, 240
mM NaOH, 1% (v/v) TRITON.RTM. X-100, pH 8.5) and incubated at an
equal or lower temperature (for example 50.degree. C.) for ten
minutes.
[0089] Under these conditions the acridinium ester attached to the
single-stranded probe is hydrolyzed, while the acridinium ester
attached to hybridized probe is relatively protected from
hydrolysis. Thus, the amount of acridinium ester remaining after
hydrolysis treatment is proportional to the number of hybrid
molecules. The remaining acridinium ester can be measured by
monitoring the chemiluminescence produced from the remaining
acridinium ester by adding hydrogen peroxide and alkali to the
solution. Chemiluminescence can be measured in a luminometer, such
as a LEADER.RTM. 450i luminometer (Gen-Probe Incorporated, San
Diego, Calif.; Cat. No. 3200i). The resulting data is plotted as
percent of maximum signal (usually from the lowest temperature)
versus temperature. The T.sub.m is defined as the temperature at
which 50% of the maximum signal remains. In addition to the method
above, T.sub.m may be determined by isotopic methods known to those
skilled in the art, such as those disclosed by Hogan in U.S. Pat.
No. 5,840,488.
[0090] To ensure specificity of a probe for its target, it is
preferable to design probes which hybridize only to target nucleic
acid under conditions of high stringency. Only highly complementary
sequences will form hybrids under conditions of high stringency.
Accordingly, the stringency of the hybridization assay conditions
determines the amount of complementarity needed between two
sequences in order for a stable hybrid to form. Stringency should
be chosen to maximize the difference in stability between the
probe:target hybrid and potential probe:non-target hybrids. See
SAMBROOK ET AL., supra, ch. 11.
[0091] The length of the target nucleic acid sequence region and,
accordingly, the length of the probe sequence can also be
important. In some cases, there may be several sequences from a
particular region, varying in location and length, which may be
used to design probes with the desired hybridization
characteristics. In other cases, one probe may be significantly
better with regard to specificity than another which differs from
it merely by a single base. While it is possible for
polynucleotides that are not perfectly complementary to hybridize,
the longest stretch of perfectly complementary bases, as well as
the base compositions, will generally determine hybrid
stability.
[0092] If a target nucleic acid is wholly or partially involved in
an intra-molecular or inter-molecular hybrid, it will be less able
to participate in the formation of a new inter-molecular
probe:target hybrid without a change in the reaction conditions.
Ribosomal RNA molecules are known to form very stable
intra-molecular helices and secondary structures by hydrogen
bonding. By designing a probe to a region of the target nucleic
acid which remains substantially single-stranded under
hybridization assay conditions, the rate and extent of
hybridization between probe and target may be increased. However,
if the preferred target region is contained in region of an rRNA
molecule which is at least partially double-stranded, then helper
probes may used to facilitate access to the target region. A helper
probe is a polynucleotide which is designed to hybridize to the
target nucleic acid at a different locus than that of a
polynucleotide probe, thereby increasing the rate of hybridization
of the polynucleotide probe to the target nucleic acid, increasing
the melting temperature of the probe:target hybrid, or both. Hogan
et al. disclose helper probes in U.S. Pat. No. 5,030,557.
[0093] A genomic target occurs naturally in a double-stranded form,
as does a product of the polymerase chain reaction (PCR) method of
amplification. These double-stranded targets are naturally
inhibitory to hybridization with a probe and require denaturation
prior to hybridization. Appropriate denaturation and hybridization
conditions are known in the art. See, e.g., Southern J. Mol. Biol.
(1975) 98:503.
[0094] A number of formulae are available which will provide an
estimate of the melting temperature for perfectly matched
polynucleotides to their target nucleic acids. One such formula is
the following:
T.sub.m=81.5+16.6(log.sub.10[Na.sup.+])+0.41(fraction
G+C)-(600/N)
[0095] (where N=the length of the polynucleotide in number of
nucleotides) provides a good estimate of the T.sub.m for
polynucleotides between 14 and 60 to 70 nucleotides in length. From
such calculations, subsequent empirical verification or "fine
tuning" of the T.sub.m may be made using screening techniques well
known in the art. For further information on hybridization and
polynucleotide probes, reference may be made to SAMBROOK ET AL.,
supra, ch. 11. This reference, among others well known in the art,
also provides estimates of the effect of mismatches on the T.sub.m
of a hybrid. Thus, from known nucleotide sequences, polynucleotides
may be designed which can distinguish between these sequences.
[0096] C. Preparation of Polynucleotide Probes
[0097] The polynucleotide probes used in the present invention can
be readily prepared by methods known in the art. Preferably, the
probes are synthesized using solid phase methods. For example,
Caruthers describes using standard phosphoramidite solid-phase
chemistry to join nucleotides by phosphodiester linkages. See
Caruthers et al. Methods Enzymol. (1987) 154:287. Automated
solid-phase chemical synthesis using cyanoethyl phosphoramidite
precursors has been described by Barone. See Barone et al. Nucleic
Acids Res. (1984) 12(10):4051. Likewise, a procedure for
synthesizing polynucleotides containing phosphorothioate linkages
is disclosed by Batt, "Method and Reagent for Sulfurization of
Organophosphorous Compounds," U.S. Pat. No. 5,449,769. In addition,
the synthesis of polynucleotides having different linkages
including methylphosphonate linkages are disclosed by Riley et al.,
"Process for the Purification of Oligomers," U.S. Pat. No.
5,811,538. Moreover, methods for the organic synthesis of
polynucleotides are known to those of skill in the art and are
disclosed by, for example, SAMBROOK ET AL., supra, ch. 11.
[0098] Following synthesis and purification of a particular
polynucleotide, several different procedures may be utilized to
purify and control the quality of the polynucleotide. Suitable
procedures include polyacrylamide gel electrophoresis or high
pressure liquid chromatography. Both of these procedures are well
known to those skilled in the art.
[0099] Polynucleotides which can be used in the present invention
may be modified with chemical groups to enhance their performance,
provided those polynucleotides being used as probes carry a net
positive charge. For example, backbone-modified polynucleotides,
such as those having phosphorothioate, methylphosphonate,
2'-O-alkyl or peptide groups which render the polynucleotides
resistant to the nucleolytic activity of certain polymerases or to
nuclease enzymes may allow the use of such enzymes in an
amplification or other reaction. Another example of a modification
involves using non-nucleotide linkers incorporated between
nucleotides in the nucleic acid chain of a polynucleotide, and
which do not prevent hybridization of a probe. See Arnold et al.,
"Non-Nucleotide Linking Reagents for Nucleotide Probes," U.S. Pat.
No. 6,031,091. The polynucleotides of the present invention may
also contain mixtures of the desired modified and natural
nucleotides.
[0100] Once synthesized, a selected polynucleotide may be labeled
by any of several well known methods (see, e.g., SAMBROOK ET AL.,
supra, ch. 10). Useful labels include radioisotopes as well as
non-radioactive reporting groups. Isotopic labels include .sup.3H,
.sup.35S, .sup.32P, 125i, .sup.57Co and .sup.14C. Isotopic labels
can be introduced into the polynucleotide by techniques known in
the art such as nick translation, end labeling, second strand
synthesis, the use of reverse transcription, and by chemical
methods. When using radiolabeled probes, hybridization can be
detected by autoradiography, scintillation counting or gamma
counting. The detection method selected will depend upon the
particular radioisotope used for labeling.
[0101] Non-isotopic materials can also be used for labeling and may
be introduced internally into the nucleic acid sequence or at the
end of the nucleic acid sequence. Modified nucleotides may be
incorporated enzymatically or chemically. Chemical modifications of
the probe may be performed during or after synthesis of the probe,
for example, through the use of non-nucleotide linker groups, as
disclosed by Arnold et al. in U.S. Pat. No. 6,031,091. Non-isotopic
labels include fluorescent molecules (individual labels or
combinations of interacting labels, such as the fluorescence
resonance energy transfer (FRET) pairs disclosed by Tyagi et al. in
U.S. Pat. No. 5,925,517), chemiluminescent molecules, enzymes,
cofactors, enzyme substrates, haptens or other ligands. The probes
of the present invention are preferably labeled by means of a
non-nucleotide linker with an acridinium ester (AE). Acridinium
ester labeling may be performed as disclosed by Arnold et al.,
"Acridinium Ester Labelling and Purification of Nucleotide Probes,"
U.S. Pat. No. 5,185,439.
D. Polycationic Polymers
[0102] Polymers of the present invention have a net cationic charge
and include polymers of one repetitive monomer type (i.e.,
homopolymers) as well as polymers of multiple repetitive monomer
types (i.e., copolymers). Polymers of the present invention further
include block and graft copolymers. Those polymers having multiple
monomer types may include, in addition to cationic monomers,
monomers which are ionic or anionic or both, provided the cationic
charges of the polymers are in excess of the anionic charges. The
cationic charges of the polymers may be localized or delocalized
(i.e., localized to a particular monomer or spread over two or more
contiguous monomers). In one preferred embodiment, the distance
between adjacent cationic monomers of the polymers approximates the
distance between adjacent phosphate groups of a polynucleotide,
which is in the range of about 5 to about 7 angstroms. The polymers
of the present invention are synthetic and water soluble.
[0103] The polycationic polymers of the present invention promote
the reassociation or hybridization (collectively referred to herein
as "association") of complementary polynucleotides by greatly
increasing the rate at which polynucleotides associate in solution,
even in reaction mixtures containing medium to high salt
concentrations (i.e., salt concentrations greater than about 150 mM
for monovalent cations, such as lithium (Li+), potassium (K+) and
sodium (Na+)). Reaction mixtures having salt concentrations greater
than about 5 to about 10 mM for monovalent cations are preferred in
the present invention. The rate enhancement due to the presence of
polycationic polymers in a reaction mixture may be as great as
2-fold, 5-fold, 10-fold, 100-fold, 1000-fold or greater.
Determining the effect that any particular polycationic polymer or
group of polycationic polymers has on the rate of association of
complementary polynucleotides can be evaluated using reference
conditions that differ only by the presence or absence of the
polycationic polymer or group of polycationic polymers. The
reference conditions used herein included either a high salt
hybridization buffer (100 mM lithium succinate, pH 5.1, 0.35 M LiCl
and 0.1% (v/v) TRITON.RTM. X-100) or a low salt hybridization
buffer (100 mM lithium succinate, pH 5.1, 50 mM LiCl and 0.1% (v/v)
TRITON.RTM. X-100) and an incubation temperature of 40.degree. C.
or 60.degree. C. The reference conditions may be any conditions
which facilitate stable hybridization between complementary
polynucleotides. Other conditions of stringency could serve as
reference conditions for determining the effect of a polycationic
polymer or a group of polycationic polymers on the rate of
association between complementary polynucleotides, including the
standard reaction conditions of 0.18 M Na.sup.+ (0.12 M sodium
phosphate buffer, pH 6.8) at 60.degree. C. See Britten et al.
Methods Enzymol. (1974) 29:363-418.
[0104] Polycationic polymers are known to significantly increase
the T.sub.m of nucleic acid duplexes, and large increases in
T.sub.m are often associated with a loss in discrimination. See,
e.g., Maruyama et al. Bioconjugate Chem. (1998) 9:292-299 and
Majlessi et al. Nucleic Acids Research (1998) 26:2224-2229. For
detection assays, in which polynucleotide probes are intended to
preferentially hybridize to target nucleic acid in the presence of
non-target nucleic acid, the probes must be specific for the target
nucleic acid in order for the assay to be of diagnostic or
probative value. A loss in discrimination cannot be tolerated.
Thus, the applicant's discovery that polycationic polymers of the
present invention can be used in an assay employing generally
practiced salt and temperature conditions to significantly increase
the T.sub.m of hybrids, without a loss in specificity for the
target nucleic acid, was unexpected. The polycationic polymers of
the present invention appear to function by further stabilizing the
small duplex formed during nucleation, but not to such an extent
that the probe loses its specificity for the target nucleic acid.
(Nucleation sites have been described as spanning as few as three
adjacent base pairs, and may be as long as six to eight adjacent
base pairs. See Porschke et al. J. Mol. Biol. (1971) 62:361-381.)
As a result, the applicant surprisingly found that the polycationic
polymers of the present invention can be used to increase the
reaction rate of assays in which the probe preferentially
hybridizes to a target nucleic acid in the presence of non-target
nucleic acid, even nucleic acid from a closely related non-target
organism or virus.
[0105] Through routine screening, the applicant also discovered
that polycationic polymers can be selected which allow for some
mismatch tolerance so that closely related strains of an organism
or virus, for example, can be detected in an assay. These polymers
would allow practitioners to design probes which are less sensitive
to sequence variation so that multiple strains of an organism or
virus could be detected with a single probe, while still having
sufficient specificity to distinguish over non-target nucleic acid
present in a test sample. Assays employing these selected for
polymers would be particularly useful in detecting organisms or
viruses exhibiting high genotypic diversity, such as the HIV-1 and
HIV-2 viruses. See, e.g., Chee et al., "Array of Nucleic Acid
Probes on Biological Chips for Diagnosis of HIV and Methods of
Using the Same," U.S. Pat. No. 5,861,242. By adjusting the
conditions of stringency (e.g., salt and temperature conditions),
it is expected that these same polymers could be used in assays
requiring single base mismatch discrimination.
[0106] While not wishing to be bound by theory, the applicant
currently believes that the polycationic polymers of the present
invention assemble in solution to form complexes of nanometer
dimensions (i.e., nanoparticles) which create a charge environment
that attracts negatively charged polynucleotides (e.g.,
polynucleotide probes and target nucleic acids) present in the
solution. Once localized by these complexes, polynucleotides having
sufficiently complementary sequences are able to more readily
associate, thereby enhancing the association kinetics of
complementary polynucleotides. Alternatively, the applicant
theorizes that the polycationic polymers of the present invention
assemble in solution as they bind polynucleotides, such that the
polynucleotides are being localized as the nanoparticles are
forming rather than after the nanoparticles have already largely
formed. Microscopy methods well known to those skilled in the art
could be used to screen for the formation of nanoparticles
comprising polycationic polymers.
[0107] Based upon the applicant's theory that the formation of
complexes attracts and concentrates polynucleotides present in a
reaction mixture, it is preferable that the molar concentration of
cationic monomers which are present in the polycationic polymers of
the reaction mixture exceed the molar concentration of anionic
phosphate groups (i.e., nucleotides) which are present in the
polynucleotides of the reaction mixture. Providing a molar excess
of cationic monomers to a reaction mixture should also prevent
complexes of polycationic polymers from precipitating out of
solution, as may occur when approximately equal numbers of cationic
monomers and phosphate groups are provided to the reaction mixture.
Precipitation is undesirable since nucleic acids are removed from
solution, thereby impeding hybridization between complementary
polynucleotides. While even small amounts of the polycationic
polymers should enhance the rate of association in a reaction
mixture, preferred concentrations of the polycationic polymers are
in the range of about 1 .mu.M to about 1000 .mu.M, and more
preferably in the range of about 10 .mu.M to about 100 .mu.M.
[0108] The weight average molecular weights (M.sub.w) of
polycationic polymers of the present invention are preferably less
than about 300,000 Da, as polymers having a M.sub.w greater than
about 300,000 Da are often too viscous or polydisperse to
adequately facilitate the association of complementary
polynucleotides. While the lowest acceptable M.sub.w will depend
greatly upon the polymer used, polymers having a M.sub.w of at
least 10,000 Da are generally preferred. Polymers having optimal
M.sub.w values for enhancing the association kinetics of
complementary polynucleotides can be determined through routine
screening procedures for any given set of reaction conditions.
[0109] Although the polycationic polymers of the present invention
may be polydisperse, it is generally preferred that the polymers of
a mixture have a polydispersity value of about one. Since
polydispersity is a measure of the ratio of the weight-average
molecular weight and number-average molecular weight
(M.sub.w/M.sub.n) in a polymer mixture, the closer this ratio is to
one, the greater the size uniformity of the polymers making up the
mixture.
[0110] Polycationic polymers contemplated by the present invention
include, but are not limited to, poly-L-lysine (an example of which
is poly-L-lysine hydrobromide available from Fluka AG of Buchs,
Switzerland as Cat. Nos. 81333 and 81355), poly(lys, tyr) 4:1 (an
example of which is poly(lys, tyr) 4:1 hydrobromide available from
Sigma Chemical Company of St. Louis, Mo. as Product No. P 4659),
poly-L-histidine (an example of which is poly-L-histidine
hydrochloride available from Sigma Chemical Company as Product No.
P 2534), poly-L-arginine (an example of which is poly-L-arginine
hydrochloride available from Sigma Chemical Company as Product No.
P 4663), hexadimethrine bromide (1,5-dimethyl-1,5-diazaundeca-
-methylene polymethobromide) (an example of which is available from
Sigma Chemical Company as Product No. H 9268), poly(allylamine
hydrochloride) (an example of which is available from Aldrich
Chemical Company of Milwaukee, Wis. as Cat. No. 28,321-5),
poly(diallyldimethylammonium chloride) (an example of which is
available from Aldrich Chemical Company as Cat. No.40,901-4),
poly[bis(2-chloroethyl)ether-alt-1,3 bis[3-(dimethyl amino) propyl]
urea], polyethylenimine (an example of which is available from
Aldrich Chemical Company as Cat. No. 40,872-7) and poly-L-lysine
dextran. While not specifically enumerated, other polycationic
polymers are envisaged by the present invention which function to
enhance the association kinetics of complementary polynucleotides.
Such polycationic polymers can be easily screened for by skilled
artisans following the guidance provided herein without having to
engage in anything more than routine experimentation.
[0111] The polycationic polymers of the present invention may be
used in conjunction with other techniques for increasing reaction
rates, including techniques which depend upon volume exclusion to
enhance the rate of association between complementary
polynucleotides. By adding synthetic polymers such as polyetheylene
glycol, dextran or dextran sulfate, the volume of a reaction
mixture which remains available to the polynucleotide reactants is
reduced, thereby increasing the effective concentration of these
reactants. Volume exclusion techniques are well known in the art
and are described in, for example, Renz et al. Nucleic Acids Res.
(1984) 12:3435-3444 and Wahl et al. Proc. Natl. Acad. Sci. USA
(1979) 75:3683-3687. Other techniques for increasing the rate of
association between polynucleotides which may be used in
combination with the polymers of the present invention could
include techniques which enhance reaction rates by including a
precipitating agent. See, e.g., Kohne et al., "Accelerated Nucleic
Acid Reassociation Method," U.S. Pat. No. 5,132,207.
E. Association Kinetics
[0112] The term "association rate," as used herein, refers to the
rate at which two polynucleotides reassociate or hybridize to form
a duplex in solution. A number of factors affect the association
rate, including the size and concentration of the polynucleotides,
the incubation temperature and the salt concentration of the
reaction mixture. Conventionally, association rates have been
quantified using the C.sub.ot analysis developed by Britten and
Kohne. Science (1968) 161:529-540. Following this analysis, the
fraction of single-stranded polynucleotides remaining at any time
during an isothermal reaction is given by the formula:
C/C.sub.o=1/(1+kC.sub.ot), where C.sub.o is the starting
concentration of the polynucleotides in nucleotides per liter, C is
the concentration of the polynucleotides in nucleotides per liter
remaining at any given time, t is the time of the reaction (s), and
k is the rate constant for a second-order reaction
(M.sup.-1s.sup.-1). When a reaction is half complete
(time=t.sub.1/2), C/C.sub.o=1/2 and C.sub.ot.sub.1/2=1/k. Thus,
C.sub.ot.sub.1/2 is inversely proportional to the rate constant and
is a measure of the association rate.
[0113] A shortcoming of the C.sub.ot analysis method for measuring
association rates is that it does not account for the simultaneous
dissociation of polynucleotides during a reaction. The amount of
dissociation that takes place during a reaction will depend on such
factors as the temperature of the reaction, as it relates to the
melting temperature of the duplex formed between polynucleotides,
and the time of the reaction. As the reaction temperature
approaches the melting temperature of the duplex or as the reaction
period increases, the amount of dissociation is expected to rise.
Therefore, to accurately calculate the rate of association, it is
necessary to factor in both the association rate constant and the
dissociation rate constant of the reaction.
[0114] To make this determination, the applicant devised a novel
equation and method for calculating a rate constant for measuring
the rate of a reaction which accounts for both association and
dissociation of the involved polynucleotides. The first step in
this procedure is to plot percent hybridization versus log of
C.sub.ot data points on a graph for each of the polynucleotide
concentrations tested. Examples of such plots are depicted in FIGS.
1 and 2, which plot data points (.circle-solid.) calculated from
the experimental data of Example 1 infra. These graphs plot data
points for hybridizations of both 3 and 8 minutes. Two incubation
periods are used to ensure that the association of polynucleotides
is increasing with time so that it can be established that the rate
being calculated is a kinetic determination and not an equilibrium
measurement. An increase in the percentage of hybridization can be
demonstrated by showing that the percentage of hybridization is
increasing with both concentration and time.
[0115] Next, predicted curves are plotted based on percent
hybridization values calculated from the following novel equation:
% hybridization=100(1-K)(1-exp-(k.sub.1C.sub.o+k.sub.2)t), where
K=k.sub.2/(C.sub.ok.sub.1+k.sub.2), t=time (s), C.sub.o=initial
concentration of polynucleotides in nucleotides (M), k.sub.1=the
association rate constant (M.sup.-1s.sup.-1), and k.sub.2=the
dissociation rate constant (s.sup.-1). Both k.sub.1 and k.sub.2 are
unknowns in this equation and are estimated by the practitioner. To
begin the analysis, k.sub.1 is assigned a rate constant value
derived from a conventional C.sub.ot analysis and k.sub.2 is
assigned a rate constant value of zero, which presupposes that
there was no dissociation during the reaction. (When k.sub.2=0,
this equation reduces to the C.sub.ot equation.) Plugging the
actual t values and estimated k.sub.1 and k.sub.2 values into the
new equation, curve plotting software, such as KaleidaGraph 3.0
(Synergy Software; Reading, Pa.), can be used to generate a curve
which relates percent hybridization and C.sub.o across a range of
concentrations tested. Examples of such curves are depicted in
FIGS. 3 and 4, which superimpose the curves generated using the
curve plotting software over the plotted data points
(.circle-solid.) derived from the C.sub.ot analysis and depicted in
FIGS. 1 and 2. (For FIGS. 3 and 4, a k.sub.1 rate constant of
16,000 M.sup.-1s.sup.-1 and a k.sub.2 rate constant of 0 were
fitted into the equation.) As can be seen from FIGS. 3 and 4, the
curves and plotted data points in each of these graphs are not
entirely coincident.
[0116] Finally, k, and k.sub.2 are adjusted until the plotted data
points from the experimental data are coincident with the curves
plotted from the new equation using the curve plotting software.
FIGS. 5 and 6 show the graphs of FIGS. 3 and 4 after k.sub.1 and
k.sub.2 have been adjusted, resulting in a curve and plotted data
points (.circle-solid.) which coincide in each graph. (To obtain a
coincident curve and plotted data points for each of these graphs,
k.sub.1 was adjusted to 14,500 M.sup.-1s.sup.-1 and k.sub.2 was
adjusted to 8.33.times.10.sup.-4s.sup.-1- .) When two incubation
periods are used, as in the example represented in FIGS. 1-6,
k.sub.1 and k.sub.2 must be the same for both reactions to ensure
that the amount of dissociation is being accurately accounted for
in arriving at a final association rate constant (k.sub.1). As
stated above, one reason for testing two association periods is
that the association and dissociation of polynucleotides tend to
increase over time of reaction. Thus, data for two distinct
reaction times results in a more accurate determination of the rate
of association.
[0117] Either the conventional C.sub.ot analysis or the new
equation and curve plotting procedure described above may be used
to determine the extent to which any particular polycationic
polymer or group of polycationic polymers enhance the rate of
association for a set of polynucleotides. While the latter is
preferred for quantitative reasons, both methods will provide a
qualitative measure of whether a polycationic polymer or group of
polycationic polymers positively affect the kinetics of an
association reaction. This is demonstrated in FIG. 7, which
directly compares percent of hybridization versus log of C.sub.ot
for poly-L-histidine hydrochloride (.diamond-solid.) and no polymer
(.DELTA.) under identical hybridization conditions based on data
from Example 1 infra. It will be understood, however, that both
equations are estimates of actual association rates, which become
more difficult to calculate with accuracy as association rates
increase.
F. Detection Systems
[0118] Before a target nucleic acid can be detected in a test
sample, it must be made available in the reaction mixture for
hybridization to a polynucleotide probe. Many cellular disruption
methods for releasing nucleic acid into a reaction mixture are well
known in the art, and include both chemical and enzymatic methods,
as well as mechanical means such as ultrasonication, agitation with
glass beads, grinding with abrasives and the French pressure cell.
Other methods involve weakening the cell wall by one or more rounds
of freezing and thawing or by treatment with a lysing enzyme such
as lysozyme, followed by dissolution of the cell membrane by
treatment with a strong detergent or a chaotropic reagent (i.e., a
reagent that disrupts hydrophobic interactions). The lysate of
these methods include organelles, proteins (including enzymes such
as proteases and nucleases), carbohydrates, and lipids as well as
nucleic acids, which may require further purification of the
nucleic acids.
[0119] An extraction method requiring only a single reagent to
release nucleic acids from a wide range of cellular types in a form
suitable for nucleic acid hybridization without the need for
subsequent purification steps is disclosed by Clark et al., "Method
for Extracting Nucleic Acids from a Wide Range of Organisms," U.S.
Pat. No. 5,786,208. This extraction method combines a test sample
with a reagent which includes a non-ionic detergent, an optional
anionic detergent and a metal chelating agent and heats the
resulting mixture at a temperature between 80.degree. and
100.degree. C. until nucleic acids are released from the cells.
Because anionic detergents such as lithium lauryl sulfate are
believed to disrupt or denature nucleases (e.g., ribonucleases)
present in the test sample, inclusion of an anionic detergent is
particularly desirable when the target nucleic acid is RNA. (In
this and other extraction methods employing an anionic detergent,
the target nucleic acid is preferably separated from the anionic
detergent prior to contacting the target nucleic acid with the
polycationic polymers of the present invention.) Nucleic acids are
released in this method without observable destruction to cell
walls, so that the liberated nucleic acids are suitable for
hybridization, amplification or other genetic manipulations without
further purification.
[0120] Following sample preparation, the polycationic polymers of
the present invention may be used in a variety of detection
systems, including both heterogenous and homogenous systems used to
determine the presence or amount of target nucleic acids in a
sample. In a heterogenous assay, a step is required to isolate or
separate probe:target hybrids from excess probe sequences before
single-stranded probes and probe:target hybrids can be
distinguished from each other. Examples of heterogenous assay
systems are disclosed by, for example, Ranki et al. in U.S. Pat.
No. 4,486,539 and Stabinsky in U.S. Pat. No. 4,751,177. Homogenous
assays on the other hand require no separation step, thereby
permitting the in solution detection of probe:target hybrids in the
presence of excess probe sequences. Examples of detection systems
which can be used in either the heterogenous or homogenous systems
are the Hybridization Protection Assay and the Adduct Protection
Assay disclosed by Arnold et al. in U.S. Pat. No. 5,283,174, and
Becker et al., "Adduct Protection Assay," U.S. Pat. No. 5,731,148,
respectively. Other well known detection systems employ
self-hybridizing probes which incorporate interacting labels that
emit differentially detectable signals, depending upon whether the
probes are bound to target nucleic acid or remain self-hybridized
in the reaction mixture. See, e.g., Bagwell in U.S. Pat. No.
5,607,834; Tyagi et al. in U.S. Pat. No. 5,925,517; and Becker et
al. in U.S. Pat. No. 6,361,945.
[0121] The Hybridization Protection Assay is a particularly
preferred homogenous detection system based on differential
hydrolysis. See Arnold et al. in U.S. Pat. No. 5,283,174; see also
Arnold et al. Clinical Chemistry (1989) 35:1588-1594. In this
detection system, an excess of probe labeled with a
chemiluminescent acridinium ester is provided to a test sample for
a period of time and under conditions permitting the probe to
stably hybridize to a target nucleic acid suspected of being
present in the test sample. Following hybridization, acridinium
ester label associated with unhybridized probe is selectively
degraded by providing an alkaline reagent to the test sample which
hydrolyzes of the phenyl ester of the acridinium ester. Label
associated with hybridized probe is protected from hydrolysis by
intercalation of the label in the duplexed molecule. Thus, the
amount of acridinium ester remaining in the test sample is
proportional to the amount of hybrid and can be measured by the
chemiluminescence produced from acridinium ester labels associated
with hybridized probe upon the addition of hydrogen peroxide
followed by alkali. Chemiluminescence can be measured in a
luminometer, including the LEADER.RTM. 450i luminometer. Useful HPA
conditions and reagents are exemplified in Example 1 below.
[0122] The adduct protection assay, which is preferred when
measuring hybridization kinetics, can facilitate the detection of a
target polynucleotide by exploiting adduct formation to
preferentially alter signal production from a label present on a
polynucleotide probe not bound to the target polynucleotide. The
assay involves the formation of a protective micro-environment when
a labeled polynucleotide probe forms a duplex with the target
polynucleotide. Label associated with probe bound to target
polynucleotide is preferentially protected from forming an adduct
with a signal altering ligand, such as sodium sulfite. Label
associated with free probe, however, can be selectively altered in
the presence of the signal altering ligand, thereby affecting its
ability to produce a detectable signal. Examples of signal altering
ligands useful in an adduct protection assay include
tetrahydrothiopene, propanethiol, benzylmercaptan, sulfite, glycol
sulfite, hydrosulfite, metabisulfite, thiosulfate, thiophosphate,
metaarsenite, tellurite, arsenite and thiocyanate. By introducing a
signal triggering reagent which causes label to produce a
detectable signal, the presence or amount of a probe:target duplex
in a sample can be determined. The preferred label is a
chemiluminescent reagent, such as an acridinium ester, and the
preferred signal triggering reagent is sodium hydroxide or hydrogen
peroxide. Acridinium ester labels and means for their detection are
disclosed by Arnold et al. in U.S. Pat. No. 5,185,439.
[0123] Before signal triggering reagent is introduced into the
sample, polycationic polymers and polynucleotides are first
dissociated from each other in the preferred adduct protection
assay. (A dissociation step is not required for all embodiments of
the present invention.) Dissociation of polycationic polymers from
polynucleotides can be effected with anionic detergents and
polyanions which weaken the binding of polycations to nucleic acids
(e.g., polyglutamic acid, polyaspartic acid, sodium dodecyl sulfate
and polynucleotides). For this reason, where a dissociation step is
to be included, the sample should exclude appreciable amounts of
anionic detergents and polyanions capable of dissociating
polycationic polymers from polynucleotides prior to the
dissociation step so that the enhanced association of complementary
polynucleotides in the presence of polycationic polymers can
proceed unimpeded. More particularly, the total anionic charge in
the reaction mixture should be less than the total cationic charge.
A preferred dissociating reagent is lithium lauryl sulfate (LLS) at
a final concentration of about 1% (w/v) in the reaction
mixture.
[0124] Prior to detection, it may be desirable to increase the
quantity of target nucleic acid present, and thus the sensitivity
of the assay, by exposing the reaction mixture to nucleic acid
amplification conditions. Under amplification conditions,
polynucleotide chains containing the target sequence or its
complement are synthesized in a template-dependent manner from
ribonucleoside or deoxynucleoside triphosphates using
nucleotidyltransferases known as polymerases. There are many
amplification procedures in common use today, including the
polymerase chain reaction (PCR), Q-beta replicase, self-sustained
sequence replication (3SR), transcription-mediated amplification
(TMA), nucleic acid sequence-based amplification (NASBA), ligase
chain reaction (LCR), strand displacement amplification (SDA) and
loop-mediated isothermal amplification (LAMP), each of which is
well known in the art. See, e.g., Mullis, "Process for Amplifying
Nucleic Acid Sequences," U.S. Pat. No. 4,683,202; Erlich et al.,
"Kits for Amplifying and Detecting Nucleic Acid Sequences," U.S.
Pat. No. 6,197,563; Walker et al. Nucleic Acids Res. (1992)
20:1691-1696; Fahy et al. PCR Methods and Applications (1991)
1:25-33; Kacian et al., U.S. Pat. No. 5,399,491; Kacian et al.,
"Nucleic Acid Sequence Amplification Methods," U.S. Pat. No.
5,480,784; Davey et al., "Nucleic Acid Amplification Process," U.S.
Pat. No. 5,554,517; Birkenmeyer et al., "Amplification of Target
Nucleic Acids Using Gap Filling Ligase Chain Reaction," U.S. Pat.
No. 5,427,930; Marshall et al., "Amplification of RNA Sequences
Using the Ligase Chain Reaction," U.S. Pat. No. 5,686,272; Walker,
"Strand Displacement Amplification," U.S. Pat. No. 5,712,124;
Notomi et al., "Process for Synthesizing Nucleic Acid," European
Patent Application No. 1 020 534 A1; Dattagupta et al., "Isothermal
Strand Displacement Amplification," U.S. Pat. No. 6,214,587; and
HELEN H. LEE ET AL., NUCLEIC ACID AMPLIFICATION TECHNOLOGIES:
APPLICATION TO DISEASE DIAGNOSIS (1997).
[0125] A preferred method for amplifying a target sequence is
transcription-mediated amplification (TMA). See, e.g., Kacian et
al. in U.S. Pat. Nos. 5,399,491 and 5,480,784 and LEE ET AL.,
supra, ch. 8. TMA is an isothermal amplification procedure which
allows for a greater than one billion-fold increase in copy number
of the target sequence using reverse transcriptase and RNA
polymerase. The target sequence in a TMA amplification may be any
type of nucleic acid, including rRNA, mRNA or DNA. TMA reaction
involves converting a single-stranded target sequence to a
double-stranded DNA intermediate by reverse transcriptase in the
presence of a sense primer and an antisense primer having a 5' RNA
polymerase-specific promoter sequence (i.e., promoter-primer).
Reverse transcriptase creates a DNA copy of the target sequence by
extension from the 3' end of the promoter-primer in the presence of
nucleoside triphosphate substrates. Where the target sequence is
RNA, the RNA in the resulting DNA:RNA duplex is degraded by RNase H
activities of reverse transcriptase. The sense primer then binds to
the DNA copy, and a new strand of DNA is synthesized from the 3'
end of the sense primer by reverse transcriptase, thereby creating
a double-stranded DNA intermediate molecule. Included in this DNA
intermediate is a double-stranded promoter sequence which is
recognized by RNA polymerase and transcribed into hundreds of
copies of RNA. Each of these transcribed RNA molecules, in turn,
can be converted to a double-stranded DNA intermediate which is
used for producing additional RNA. Thus, TMA reactions proceed
exponentially. Particular parameters of a TMA reaction, including
concentrations of enzymes, primers and nucleoside triphosphates, as
well as reaction times and temperatures, can be determined and
adapted from what is well known in the art about TMA reactions
without having to engage in undue experimentation.
[0126] If the detection step is preceded by an amplification step,
the target nucleic acid is preferably isolated and purified before
amplifying the target sequence. A wide variety of procedures for
isolating and purifying a target nucleic acid are well known in the
art.
[0127] A particularly preferred method for isolating and purifying
a target nucleic acid prior to amplification is disclosed by
Weisberg et al. in U.S. Pat. No. 6,280,952. In this system, the
capture probe hybridizes to the target nucleic acid and an
immobilized probe hybridizes to the capture probe:target complex
under different hybridization conditions. Under a first set of
hybridization conditions, hybridization of the capture probe to the
target nucleic acid is favored over hybridization of the capture
probe to the immobilized probe. Thus, under this first set of
conditions, the capture probe is in solution rather than bound to a
solid support, thereby maximizing the concentration of the free
capture probe and utilizing favorable liquid phase kinetics for
hybridization to the target nucleic acid. Polycationic polymers of
the present invention may be provided to the reaction mixture under
this first set of conditions to promote rapid hybridization of the
capture probe to the target nucleic acid. After the capture probe
has had sufficient time to hybridize to the target nucleic acid, a
second set of hybridization conditions is imposed permitting in the
capture probe:target complex to hybridize to the immobilized probe,
thereby isolating the target nucleic acid in the sample solution.
The immobilized target nucleic acid may then be purified, and a
target sequence present in the target nucleic acid may be amplified
and detected. A purification procedure which includes one or more
wash steps is generally desirable when working with crude samples
(e.g., clinical, environmental, industrial, food, water, etc.) to
prevent enzyme inhibition and/or nucleic acid degradation due to
substances present in the sample.
[0128] Instrument systems for performing detection assays are well
known in the art and may be used to perform manual, semi-automated
or fully automated assays. Some of these instrument systems are
limited to direct detection (no prior amplification step), while
others have the capability of performing both amplification and
detection. These instrument systems may detect the formation of
polynucleotide hybrids using any of a variety of techniques known
in the art including, but not limited to, those based on light
emission, mass changes, changes in conductivity or turbidity.
Examples of instrument systems which could be readily adapted to
perform assays incorporating the polycationic polymers of the
present invention in order to enhance reaction rates include those
sold under the trade names of DTS 400 (detection only) and DTS 1600
(amplification and detection) by Gen-Probe Incorporated of San
Diego, Calif., which represent embodiments of instrument systems
disclosed by Acosta et al., "Assay Work Station," U.S. Pat. No.
6,254,826, and by Ammann et al., "Automated Process for Isolating
and Amplifying a Target Nucleic Acid Sequence," U.S. application
Ser. No. 09/303,030, and International Publication No. WO 99/57561,
"Automated Diagnostic Analyzer and Method," each of which enjoys
common ownership herewith.
G. Kits
[0129] The present invention also contemplates detection systems in
kit form. Kits of the present invention include, in an amount
sufficient for at least one assay, a polynucleotide probe which
preferentially hybridizes to a target nucleic acid sequence in a
test sample under hybridization assay conditions and a synthetic
polycationic polymer in an amount sufficient to increase the
association rate of the probe and the target sequence in the test
sample under the hybridization assay conditions. The probe and the
polymer may be combined in the same or separate containers. Kits
containing multiple probes are also contemplated by the present
invention where the multiple probes are designed to target
different nucleic acid sequences and may include distinct labels
which permit the probes to be differentially detected in a test
sample. Kits according to the present invention may further
comprise at least one of the following: (i) a reagent in an amount
sufficient to dissociate the polymer from the probe in the test
sample; (ii) one or more amplification primers for amplifying a
target sequence contained in or derived from the target nucleic
acid; (iii) a capture probe for isolating and purifying target
nucleic acid present in a test sample; and (iv) if a capture probe
is included, a solid support material (e.g., magnetically
responsive particles) for immobilizing the capture probe, either
directly or indirectly, in a test sample. Kits of the present
invention may further include one or more helper probes.
[0130] Typically, the kits will also include instructions recorded
in a tangible form (e.g., contained on paper or an electronic
medium) for using the packaged probe and polymer in a detection
assay for determining the presence or amount of a target nucleic
acid sequence in a test sample. The assay described in the written
instructions may include steps for isolating and purifying the
target nucleic acid prior to detection with the polynucleotide
probe, amplifying a target sequence contained in the target nucleic
acid, and/or dissociating the probe from the polymer using a
dissociating reagent. The detection assay may be diagnostic for the
presence of a particular virus or organism or group of viruses or
organisms, disease or condition, or it may be useful for
determining a disease state or level of gene expression or for
detecting the presence of a mutation or polymorphism.
[0131] The various components of the detection systems may be
provided in a variety of forms. For example, the probe and/or
polycationic polymer may be provided as lyophilized reagents. The
lyophilized reagents may be pre-mixed before lyophilization so that
when reconstituted they form a complete mixture with the proper
ratio of each of the components ready for use in the assay. In
addition, the detection systems of the present invention may
contain a reconstitution reagent for reconstituting the lyophilized
reagents of the kit. Preferred kits contain lyophilized probe
reagents.
[0132] Typical packaging materials include solid matrices, such as
glass, plastic, paper, foil, micro-particles and the like, which
are capable of holding within fixed limits the probe, polycationic
polymer and other optional reagents of the present invention. Thus,
for example, the packaging materials can include glass vials used
to contain sub-milligram quantities of a contemplated probe or
polycationic polymer, or they can be microtiter plate wells to
which probes of the present invention have been operatively
affixed, i.e., linked so as to be capable of participating in a
procedure for detecting a target nucleic acid sequence.
[0133] The instructions will typically indicate the reagents and/or
concentrations of reagents and at least one assay method parameter
which might be, for example, the relative amounts of reagents to
use per amount of sample. In addition, such specifics as
maintenance, time periods, temperature and buffer conditions may
also be included.
H. EXAMPLES
[0134] Examples are provided below illustrating different aspects
and embodiments of the invention. Skilled artisans will appreciate
that these examples are not intended to limit the invention to the
specific embodiments described therein.
Example 1
Effect of Polycationic Polymers on Hybridization Kinetics Between
Perfectly Complementary Probe and Target Sequences
[0135] This example shows the effect that various polycationic
polymers had on the rate at which a polynucleotide probe and a
perfectly complementary synthetic target sequence associated under
different combinations of salt and temperature conditions. For this
example, the probe had the nucleotide base sequence of SEQ ID NO:1
gctcgttgcgggactt(*)aacccaacat, which was synthesized to include a
non-nucleotide linker (the asterik indicates the location of the
non-nucleotide linker), as disclosed by Arnold et al. in U.S. Pat.
No. 6,031,091. The probe was labeled with a chemiluminescent
acridinium ester (standard AE), as disclosed by Arnold et al. in
U.S. Pat. No. 5,185,439, and measured in relative light units
(RLU).
[0136] The following five polymers were tested in this example, and
each polymer was indicated to have the noted properties by the
supplier:
[0137] (i) Poly-L-lysine hydrobromide. This polymer was purchased
from Fluka AG (Cat. No. 81333; Lot No. 307943/1 497) and was
indicated to have a M.sub.w of between 20,000 and 30,000 Da ("Low
M.sub.w Poly-L-lysine");
[0138] (ii) Poly-L-lysine hydrobromide. This polymer was purchased
from Fluka AG (Cat. No. 81355; Lot No. 299299/1 1093) and was
indicated to have a M.sub.w of between 150,000 and 300,000 Da
("High M.sub.w Poly-L-lysine");
[0139] (iii) Poly (lys, tyr) 4:1. This polymer was purchased from
Sigma Chemical Company (Product No. P 4659; Lot No. 81H5520) and
was indicated to have a M.sub.w of 24,600 Da (visible) and a degree
of polymerization of 123 (visible);
[0140] (iv) Poly-L-histidine hydrochloride. This polymer was
purchased from Sigma Chemical Company (Product No. P 2534; Lot No.
118H5905) and was indicated to have a M.sub.w of 15,800 Da (using
low angle laser light scattering) and a degree of polymerization of
91 (using low angle laser light scattering);
[0141] (v) Poly-L-arginine hydrochloride. This polymer was
purchased from Sigma Chemical Company (Product No. P 4663; Lot No.
87H5903) and was indicated to have a M.sub.w of 11,800 Da (visible)
and 8,400 Da (using low angle laser light scattering), a degree of
polymerization of 43 (using low angle laser light scattering), and
a M.sub.w/M.sub.n of 1.25 (using low angle laser light scattering
with size exclusion chromatography); and
[0142] (vi) Hexadimethrine bromide. This polymer
(1,5-dimethyl-1,5-diazaun- decamethylene polymethobrornide) was
purchased from Sigma Chemical Company (Product No. H 9268; Lot No.
50K3672).
[0143] For each polymer tested, a total of 40 12.times.75 mm
polypropylene tubes (Gen-Probe Incorporated; Cat. No. 2440) were
set up, and each tube received 0.5 fmol probe and 20 .mu.M polymer
dissolved in 40 .mu.l hybridization buffer. A no polymer control
set was also tested in 40 12.times.75 mm polypropylene tubes
(Gen-Probe Incorporated; Cat. No. 2440) which received only 0.5
fmol probe dissolved in 40 .mu.l hybridization buffer. The
hybridization buffer was either a high salt hybridization buffer
made up of 200 mM lithium succinate, pH 5.1, 0.70 M LiCl and 0.2%
(v/v) TRITON.RTM. X-100 or a low salt hybridization buffer made up
of 200 mM lithium succinate, pH 5.1, 100 mM LiCl and 0.2% (v/v)
TRITON.RTM. X-100. The tubes were divided into two groups of 20
tubes each and all tubes were pre-heated to 40.degree. C. or
60.degree. C. (consistent with the hybridization temperature
indicated below) for two minutes in a circulating water bath (Lauda
Dr. R. Wobser GmbH & Co. KG, Lauda-Koenigshofen, Germany; Model
No. E100). With the exception of 4 control tubes for determining
background RLU values in each group, 40 .mu.l filtered water
(Millipore Corporation; Bedford, Mass.; Milli-Q UF Plus; Cat. No.
ZD5311595) containing synthetic RNA target sequence was added to
the tubes of both groups and the tubes were mixed briefly by hand.
The amount of target sequence in the 16 target-containing tubes of
each group ranged (in increasing concentrations) from as low as
0.05 fmol to as high as 100,000 fmol. Precise target sequence
concentrations for individual tubes are indicated in Tables 1 and 2
below. The target sequence used in this example was the RNA
complement of the probe (SEQ ID NO:2
auguuggguuaagucccgcaacgagc).
[0144] After adding the target sequence, the tubes of groups one
and two were heated to 40.degree. C. or 60.degree. C. in a
circulating water bath (Lauda Dr. R. Wobser GmbH & Co. KG;
Model No. E100) to allow hybridization of the probe to the target
sequence. The incubation time was three minutes for the tubes of
group one and eight minutes for the tubes of group two. Following
hybridization, lithium lauryl sulfate (LLS) was added to all of the
tubes to dissociate polymer from probe. The final concentration of
the LLS was 1% (w/v) for all tubes. The tubes were then placed in
an ice water bath for approximately five minutes to arrest the
hybridization reaction. All tubes were then analyzed in a
LEADER.RTM. 50 luminometer (Gen-Probe Incorporated; Cat. No. 3100)
equipped with automatic injection of detection reagents comprised
of Detect Reagent I, which contained 0.14 M sodium sulfite and
0.042 M sodium borate, and Detect Reagent II, which contained 1.5 M
sodium hydroxide and 0.12% (v/v) sodium peroxide. A 12 second pause
was introduced between injections of the two Detect Reagents.
[0145] To determine the rate of association for no polymer and each
polymer tested, the novel equation and method for calculating rate
constants described in the Association Kinetics section supra were
followed. Following this approach, the first step was to determine
the C.sub.ot value and the percent hybridization for each
concentration of target tested for each incubation period. Percent
hybridizations were determined by dividing the net RLU for each
target concentration by the RLU observed at high target
concentrations where hybridization was complete. The net RLU for
each target concentration was determined by subtracting the average
background RLU observed in the four blank tubes for each test
performed from the raw RLU for each target concentration. Each of
these values is set forth in Tables 1 and 2 below for the no
polymer 3 and 8 minute incubations tested in the low salt
hybridization buffer at 40.degree. C. (The values determined for
each of the polymers tested, as well as no polymer tested in the
high salt hybridization buffer at 60.degree. C., are not shown in
Tables 1 and 2.) The percent hybridization versus the log of
C.sub.ot data points ( ) were then plotted on the graphs, which are
shown in FIGS. 1 and 2 for the no polymer 3 and 8 minute
incubations.
[0146] Predicted graphs of percent hybridization versus the log of
C.sub.ot were then determined based on percent hybridization values
calculated using the following equation: %
hybridization=100(1-K)(1-exp-(- k.sub.1C.sub.o+k.sub.2)t), where
K=k.sub.2/(C.sub.ok.sub.1+k.sub.2), t=time (s), C.sub.o=initial
concentration of polynucleotides in nucleotides (M), k.sub.1=the
association rate constant (M.sup.-1s.sup.-1), and k.sub.2=the
dissociation rate constant (s.sup.-1). Being unknowns, k.sub.1 and
k.sub.2 were initially assigned estimated values. The estimated k,
values were determined using the conventional C.sub.ot analysis
discussed in the Association Kinetics section supra (e.g., k, was
determined to be 16,000 M.sup.-1s.sup.-1 by conventional C.sub.ot
analysis for the no polymer tests illustrated) and the estimated
value of k.sub.2 was always zero. After plugging the actual t
values and the estimated k.sub.1 and k.sub.2 values for each test
performed into the equation above, KaleidaGraph 3.0 software was
used to generate curves which related percent hybridization and
C.sub.o across the range of target concentrations tested. The
curves generated in this manner for the no polymer 3 and 8 minute
incubations are depicted in FIGS. 3 and 4, where the predicted
curves are shown superimposed over the graphs plotted from the
experimental data and shown in FIGS. 1 and 2. The greater
discrepancy between the predicted curve and the plotted data points
observed at 8 minutes versus 3 minutes for each test indicated a
k.sub.2 that was greater than zero.
[0147] For this reason, the k.sub.1 and k.sub.2 values were
adjusted for each test until the data points plotted from the
experimental data were coincident with the curves plotted from the
above new equation using the curve plotting software, as shown in
FIGS. 5 and 6. Thus, the final k.sub.1 and k.sub.2 values for each
test were the same for both incubation times, thereby ensuring that
the concomitant dissociation of polynucleotides over time was being
accounted for in the k, determination. Rate constants determined in
this manner are set forth in Table 3 below for no polymer and each
of the polymers tested.
1TABLE 1 C.sub.ot Values and Percent Hybridization for Various
Concentrations of Target After a Three Minute Incubation in a Low
Salt Hybridization Buffer at 40.degree. C. in the Absence of
Polymer Target C.sub.ot Percent (fmol) (M.sup.-1s.sup.-1) Raw RLU
Net RLU Hybridization 0 0 1526 0 0 1 5.85 .times. 10.sup.-8 1607 81
0.15 2 1.17 .times. 10.sup.-7 2727 1201 2.26 5 2.93 .times.
10.sup.-7 1791 265 0.50 10 5.85 .times. 10.sup.-7 2026 500 0.94 20
1.17 .times. 10.sup.-6 2289 763 1.44 50 2.93 .times. 10.sup.-6 3526
2000 3.77 100 5.85 .times. 10.sup.-6 5730 4204 7.93 200 1.17
.times. 10.sup.-5 9850 8324 15.69 500 2.93 .times. 10.sup.-5 19,545
18,019 33.97 1000 5.85 .times. 10.sup.-5 31,340 29,814 56.21 2000
1.17 .times. 10.sup.-4 42,403 40,877 77.07 5000 2.93 .times.
10.sup.-4 51,067 49,541 93.40 20,000 1.17 .times. 10.sup.-3 53,460
51,934 97.92 50,000 2.93 .times. 10.sup.-3 55,629 54,103 102.01
100,000 5.85 .times. 10.sup.-3 54,607 53,081 100.08
[0148]
2TABLE 2 C.sub.ot Values and Percent Hybridization for Various
Concentrations of Target After An Eight Minute Incubation in a Low
Salt Hybridization Buffer at 40.degree. C. in the Absence of
Polymer Target C.sub.ot Percent (fmol) (M.sup.-1s.sup.-1) Raw RLU
Net RLU Hybridization 0 0 1641 0 0 1 1.56 .times. 10.sup.-7 1605
-36 -0.07 2 3.12 .times. 10.sup.-7 1705 64 0.13 5 7.8 .times.
10.sup.-7 1871 230 0.47 10 1.56 .times. 10.sup.-6 2484 843 1.73 20
3.12 .times. 10.sup.-6 2963 1322 2.71 50 7.8 .times. 10.sup.-6 5123
3482 7.13 100 1.56 .times. 10.sup.-5 8240 6599 13.51 200 3.12
.times. 10.sup.-5 13,901 12,260 25.11 500 7.8 .times. 10.sup.-5
27,400 25,759 52.75 1000 1.56 .times. 10.sup.-4 37,532 35,891 73.50
2000 3.12 .times. 10.sup.-4 46,501 44,860 91.87 5000 7.8 .times.
10.sup.-4 50,159 48,518 99.36 10,000 1.56 .times. 10.sup.-3 49,613
47,972 98.24 50,000 7.8 .times. 10.sup.-3 50,739 40,098 100.54
100,000 1.56 .times. 10.sup.-2 50,434 48,793 99.92
[0149]
3TABLE 3 Rate Constant of Probe in the Presence of Various Polymers
and No Polymer Under Different Temperature and Salt Concentration
Conditions Salt Rate Temperature Concentration Constant Polymer
(.degree. C.) (M) (M.sup.-1s.sup.-1) No Polymer 60 0.45 5.7 .times.
10.sup.4 No Polymer 40 0.15 1.45 .times. 10.sup.4
Poly-.sub.L-lysine hydrobromide 60 0.45 1 .times. 10.sup.5 (Low
M.sub.w Poly-.sub.L-lysine) Poly-.sub.L-lysine hydrobromide 60 0.45
5.7 .times. 10.sup.4 (High M.sub.w Poly-.sub.L-lysine)
Poly-.sub.L-lysine hydrobromide 40 0.15 .sup. .gtoreq.2 .times.
10.sup.7 (High M.sub.w Poly-.sub.L-lysine) Poly (lys, tyr) 4:1 60
0.45 6 .times. 10.sup.5 Poly-.sub.L-histidine hydro- 60 0.45 5
.times. 10.sup.6 chloride Poly-.sub.L-arginine hydro- 60 0.45 5
.times. 10.sup.6 chloride Poly-.sub.L-arginine hydro- 40 0.15 .sup.
.gtoreq.2 .times. 10.sup.7 chloride Hexadimethrine bromide 60 0.15
3 .times. 10.sup.6
[0150] The results of this experiment demonstrate that the presence
of polycationic polymers in a reaction mixture can significantly
enhance the rate of hybridization between a polynucleotide probe
and a perfectly complementary target sequence. The results of this
experiment further show that this enhanced rate of hybridization
can be achieved using polycationic polymers under conditions
promoting hybridization (e.g., high salt conditions).
Example 2
Effect of Polycationic Polymers on Hybridization Kinetics Between
Probe and Mutant Target Sequences
[0151] This example shows the effect that various polycationic
polymers had on the rate at which a polynucleotide probe and a
mutant target sequence associated under different combinations of
salt and temperature conditions. The reagents, concentrations,
times, conditions, tubes and instruments used in this example were
identical to those of Example 1 above, except that a single base
mismatch between the probe and the synthetic RNA target sequence
was introduced at the fourth nucleotide position reading from the
5' end of the probe sequence. This was achieved by using the same
target sequence as Example 1 and altering the probe to have the
nucleotide base sequence of SEQ ID NO:3 gctgttgcgggactt(*)aaccca-
acat (the asterik indicates the location of a non-nucleotide
linker). The rates listed below were determined in the same manner
detailed above in Example 1.
4TABLE 4 Rate Constant of Probe Containing a Single-Base Mismatch
in the Presence of Various Polymers and No Polymer Under Identical
Temperature and Salt Concentration Conditions Salt Temperature
Concentration Rate Polymer (.degree. C.) (M) (M.sup.-1s.sup.-1) No
Polymer 60 0.45 6 .times. 10.sup.3 Poly-.sub.L-lysine hydrobromide
60 0.45 1.5 .times. 10.sup.4 (Low M.sub.w Poly-.sub.L-lysine) Poly
(lys, tyr) 4:1 60 0.45 1 .times. 10.sup.5 Poly-.sub.L-histidine
hydro- 60 0.45 1.5 .times. 10.sup.6 chloride Poly-.sub.L-arginine
hydro- 60 0.45 6 .times. 10.sup.6 chloride Poly-.sub.L-arginine
hydro- 40 0.15 6 .times. 10.sup.6 chloride Hexadimethrine bromide
60 0.15 6 .times. 10.sup.6
[0152] This experiment demonstrated that the presence of some
polycationic polymers in a reaction mixture can enhance the rate of
hybridization between a polynucleotide probe and a mutant target
sequence having a single base mismatch to a sufficient degree to
allow for the detection of different subtypes in a reaction
mixture. Here, the results indicate that the poly-L-arginine
hydrochloride (high salt concentration) and hexadimethrine bromide
(low salt concentration) polymers tolerated the mismatch, whereas
the remainder of the polymers tested were sensitive to the
mismatch. The sensitivity of these remaining polymers suggests that
they would enhance the rate of association between a probe and its
complementary sequence while at the same time allowing for single
base mismatch discrimination.
[0153] While the present invention has been described and shown in
considerable detail with reference to certain preferred
embodiments, those skilled in the art will readily appreciate other
embodiments of the present invention. Accordingly, the present
invention is deemed to include all modifications and variations
encompassed within the spirit and scope of the following appended
claims.
Sequence CWU 1
1
3 1 26 DNA Artificial Sequence Synthetic Construct 1 gctcgttgcg
ggacttaacc caacat 26 2 26 RNA Artificial Sequence Synthetic
Construct 2 auguuggguu aagucccgca acgagc 26 3 25 DNA Artificial
Sequence Synthetic Construct 3 gctgttgcgg gacttaaccc aacat 25
* * * * *