U.S. patent application number 10/705430 was filed with the patent office on 2004-04-15 for expression of fructuse 1,6 bisphosphate aldolase in transgenic plants.
This patent application is currently assigned to Monsanto Technology LLC. Invention is credited to Barry, Gerard F., Cheikh, Nordine, Kishore, Ganesh M..
Application Number | 20040073976 10/705430 |
Document ID | / |
Family ID | 46277957 |
Filed Date | 2004-04-15 |
United States Patent
Application |
20040073976 |
Kind Code |
A1 |
Barry, Gerard F. ; et
al. |
April 15, 2004 |
Expression of fructuse 1,6 bisphosphate aldolase in transgenic
plants
Abstract
Fructose-1,6-bisphosphate aldolase (FDA) is an enzyme reversibly
catalyzing the reaction converting triosephosphate into
fructose-1,6-bisphosphate. In the leaf, this enzyme is located in
the chloroplast (starch synthesis) and the cytosol (sucrose
biosynthesis). Transgenic plants were generated that express the E.
coli fda gene in the chloroplast to improve plant yield by
increasing leaf starch biosynthetic ability in particular and
sucrose production in general. Leaves from plants expressing the
fda transgene showed a significantly higher starch accumulation, as
compared to control plants expressing the null vector, particularly
early in the photoperiod, but had lower leaf sucrose. Transgenic
plants also had a significantly higher root mass. Furthermore,
transgenic potatoes expressing fda exhibited improved uniformity of
solids.
Inventors: |
Barry, Gerard F.; (St.
Louis, MO) ; Cheikh, Nordine; (Manchester, MO)
; Kishore, Ganesh M.; (Creve Coeur, MO) |
Correspondence
Address: |
HOWREY SIMON ARNOLD & WHITE LLP
750 BERING DRIVE
HOUSTON
TX
77057
US
|
Assignee: |
Monsanto Technology LLC
|
Family ID: |
46277957 |
Appl. No.: |
10/705430 |
Filed: |
November 11, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10705430 |
Nov 11, 2003 |
|
|
|
10164204 |
Jun 6, 2002 |
|
|
|
6663906 |
|
|
|
|
10164204 |
Jun 6, 2002 |
|
|
|
09098219 |
Jun 16, 1998 |
|
|
|
6441277 |
|
|
|
|
60049955 |
Jun 17, 1997 |
|
|
|
Current U.S.
Class: |
800/284 ;
435/189; 435/320.1; 435/419; 536/23.2 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/8245 20130101; C12N 15/8261 20130101; C12N 9/88
20130101 |
Class at
Publication: |
800/284 ;
536/023.2; 435/189; 435/320.1; 435/419 |
International
Class: |
A01H 001/00; C12N
015/82; C07H 021/04; C12N 009/02; C12N 005/04 |
Claims
What is claimed is:
1. A recombinant, double-stranded DNA molecule containing a) a
promoter functional in plant cells, and b) a DNA sequence coding
for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase and operatively linked to the
promoter in sense orientation.
2. The DNA molecule according to claim 1, wherein the DNA sequence
coding for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase is derived from a prokaryotic
organism.
3. The DNA molecule according to claim 2, wherein the prokaryotic
organism is Escherichia coli.
4. The DNA molecule according to claim 1, wherein the DNA sequence
coding for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase has at least about 60% identity
with a prokaryotic DNA sequence coding for
fructose-1,6-bisphosphate aldolase class II.
5. The DNA molecule according to claim 1, wherein the DNA sequence
coding for the polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase is a sequence capable of
hybridizing with the coding region depicted as SEQ ID NO.1.
6. The DNA molecule according to claim 1, wherein the DNA sequence
coding for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase has at least about 60% identity
with the coding region depicted as SEQ ID NO.1.
7. The DNA molecule according to claim 1, wherein the DNA sequence
coding for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase has at least about 70% identity
with the coding region depicted as SEQ ID NO.1.
8. The DNA molecule according to claim 1, wherein the DNA sequence
coding for a polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase has at least about 80% identity
with the coding region depicted as SEQ ID NO.1.
9. The DNA molecule according to claim 1, wherein the DNA sequence
coding for the polypeptide having the enzymatic activity of a
fructose-1,6-bisphosphate aldolase has the coding region depicted
as SEQ ID NO.1, or encodes the same peptide as SEQ ID NO.1 in
accordance with the degeneracy of the genetic code.
10. A transgenic plant cell containing in its genome a recombinant
DNA molecule according to any of claims 1-9.
11. A transgenic plant containing plant cells according to claim
10.
12. The transgenic plant of claim 11, wherein the plant exhibits a
property selected from the group consisting of increased
photosynthesis rates, increased yields, increased growth rates and
improved solids uniformity compared with plants that do not contain
the recombinant DNA molecule.
13. The transgenic plant according to claim 11, which is a crop
plant.
14. The transgenic plant according to claim 11, selected from the
group consisting of corn, wheat, rice, tomato, potato, carrots,
sweet potato, yams, artichoke, alfalfa, peanut, barley, cotton,
soybean, canola, sunflower, sugarbeet, apple, pear, orange, peach,
sugarcane, strawberry, raspberry, banana, grape, plantain, tobacco,
lettuce, cassava, cruciferous vegetables, forestry species and
horticultural species.
15. The transgenic plant of claim 11, wherein the plant is a
potato.
16. A food product derived from the potato of claim 15.
17. The food product of claim 16, which is a french fry or a potato
chip.
18. Propagation material derived from the transgenic plant of claim
11.
19. A process for increasing the photosynthesis rate in plants
which comprises transforming plant cells with a DNA molecule
according to any one of claims 1 to 9, and regenerating the
transformed cells to produce a transgenic plant.
20. A process for increasing the yield in plants which comprises
transforming plant cells with a DNA molecule according to any one
of claims 1 to 9, and regenerating the transformed cells to produce
a transgenic plant.
21. A process for increasing the growth rate in plants which
comprises transforming plant cells with a DNA molecule according to
any one of claims 1 to 9, and regenerating the transformed cells to
produce a transgenic plant.
22. A process for improving the solids uniformity in plants which
comprises transforming plant cells with a DNA molecule according to
any one of claims 1 to 9, and regenerating the transformed cells to
produce a transgenic plant.
23. In a method for the processing of potatoes into fries or chips,
the improvement comprising, utilizing a potato that overexpresses
the fda transgene providing a higher solids uniformity in such
potato.
Description
[0001] This application is based on U.S. Provisional Application
Serial No. 60/049,995, filed Jun. 17, 1997.
FIELD OF THE INVENTION
[0002] This invention relates to the expression of fructose 1,6
bisphosphate aldolase (FDA) in transgenic plants to increase or
improve plant growth and development, yield, vigor, stress
tolerance, carbon allocation and storage into various storage
pools, and distribution of starch. Transgenic plants expressing FDA
have increased carbon assimilation, export and storage in plant
source and sink organs, which results in growth, yield and quality
improvements in crop plants.
BACKGROUND OF THE INVENTION
[0003] Recent advances in genetic engineering have provided the
prerequisite tools to transform plants to contain alien (often
referred to as "heterologous") or improved endogenous genes. These
genes can lead either to an improvement of an already existing
pathway in plant tissues or to an introduction of a novel pathway
to modify product levels, increase metabolic efficiency, and or
save on energy cost to the cell. It is presently possible to
produce plants with unique physiological and biochemical traits and
characteristics of high agronomic and crop processing importance.
Traits that play an essential role in plant growth and development,
crop yield potential and stability, and crop quality and
composition include enhanced carbon assimilation, efficient carbon
storage, and increased carbon export and partitioning.
[0004] Atmospheric carbon fixation (photosynthesis) by plants
represents the major source of energy to support processes in all
living organisms. The primary sites of photosynthetic activity,
generally referred to as "source organs", are mature leaves and, to
a lesser extent, green stems. The major carbon products of source
leaves are starch, which represents the transitory storage form of
carbohydrate in the chloroplast, and sucrose, which represents the
predominant form of carbon transport in higher plants. Other plant
parts named "sink organs" (e.g., roots, fruit, flowers, seeds,
tubers, and bulbs) are generally not autotrophic and depend on
import of sucrose or other major translocatable carbohydrates for
their growth and development. The storage sinks deposit the
imported metabolites as sucrose and other oligosaccharides, starch
and other polysaccharides, proteins, and triglycerides.
[0005] In leaves, the primary products of the Calvin Cycle (the
biochemical pathway leading to carbon assimilation) are
glyceraldehyde 3-phosphate (G3P) and dihydroxyacetone phosphate
(DHAP), also known as triose phosphates (triose-P). The
condensation of G3P and DHAP into fructose 1,6 bisphosphate (FBP)
is catalyzed reversibly by the enzyme fructose 1,6 bisphosphate
aldolase (FDA), and various isozymes are known. The acidic
isoenzyme appears to be chloroplastic and comprises about 85% of
the total leaf aldolase activity. The basic isoenzyme is cytosolic.
Both isoenzymes appear to be encoded by the nuclear genome and are
encoded by different genes (Lebherz et al., 1984).
[0006] In the leaf, the chloroplast FDA is an essential enzyme in
the Calvin Cycle, where its activity generates metabolites for
starch biosynthesis. Removal of more than 40% of the plastidic
aldolase enzymatic activity by antisense technology reduced leaf
starch accumulation as well as soluble proteins and chlorophyll
levels but also reduced plant growth and root formation (Sonnewald
et al., 1994). In contrast, the cytosolic FDA is part of the
sucrose biosynthetic pathway where it catalyzes the reaction of FBP
production. Moreover, cytosolic FDA is also a key enzyme in the
glycolytic and gluconeogenesis pathways in both source and sink
plant tissues.
[0007] In the potato industry, production of higher starch and
uniform solids tubers is highly desirable and valuable. The current
potato varieties that are used for french fry production, such as
Russet Burbank and Shepody, suffer from a non-uniform deposition of
solids between the tuber pith (inner core) and the cortex (outer
core). French fry strips that are taken from pith tissue are higher
in water content when compared to outer cortex french fry strips;
cortex tissue typically displays a solids level of twenty-four
percent whereas pith tissue typically displays a solids level of
seventeen percent. Consequently, in the french fry production
process, the pith strips need to be blanched, dried, and par-fried
for longer times to eliminate the excess water. Adequate processing
of the pith fries results in the over-cooking of fries from the
high solids cortex. The blanching, drying, and par frying times of
the french fry processor need to be adjusted accordingly to
accommodate the low solids pith strips and the high solids cortex
strips. A higher solids potato with a more uniform distribution of
starch from pith to cortex would allow for a more uniform finished
fry product, with higher plant throughput and cost savings due to
reduced blanch, dry and par-fry times.
[0008] Although various fructose 1,6 bisphosphate aldolases have
been previously characterized, it has been discovered that
overexpression of the enzyme in a transgenic plant provides
advantageous results in the plant such as increasing the
assimilation, export and storage of carbon, increasing the
production of oils and/or proteins in the plant and improving tuber
solids uniformity.
SUMMARY OF THE INVENTION
[0009] The present invention provides structural DNA constructs
that encode a fructose 1,6 bisphosphate aldolase (FDA) enzyme and
that are useful in increasing carbon assimilation, export, and
storage in plants.
[0010] In accomplishing the foregoing, there is provided, in
accordance with one aspect of the present invention, a method of
producing genetically transformed plants that have elevated carbon
assimilation, storage, export, and improved solids uniformity
comprising the steps of:
[0011] (a) Inserting into the genome of a plant a recombinant,
double-stranded DNA molecule comprising
[0012] (i) a promoter that functions in the cells of a target plant
tissue,
[0013] (ii) a structural DNA sequence that causes the production of
an RNA sequence that encodes a fructose 1,6 bisphosphate aldolase
enzyme,
[0014] (iii) a 3' non-translated DNA sequence that functions in
plant cells to cause transcriptional termination and the addition
of polyadenylated nucleotides to the 3' end of the RNA
sequence;
[0015] (b) obtaining transformed plant cells; and
[0016] (c) regenerating from transformed plant cells genetically
transformed plants that have elevated FDA activity.
[0017] In another aspect of the present invention there is provided
a recombinant, double-stranded DNA molecule comprising in
sequence
[0018] (i) a promoter that functions in the cells of a target plant
tissue,
[0019] (ii) a structural DNA sequence that causes the production of
an RNA sequence that encodes a fructose 1,6 bisphosphate aldolase
enzyme,
[0020] (iii) a 3' non-translated DNA sequence that functions in
plant cells to cause transcriptional termination and the addition
of polyadenylated nucleotides to the 3' end of the RNA
sequence.
[0021] In a further aspect of the present invention, the structural
DNA sequence that causes the production of an RNA sequence that
encodes a fructose 1,6 bisphosphate aldolase enzyme is coupled with
a chloroplast transit peptide to facilitate transport of the enzyme
to the plastid.
[0022] In accordance with the present invention, an improved means
for increasing carbon assimilation, storage and export in the
source tissues of various plants is provided. Further means of
improved carbon accumulation in sinks (such as roots, tubers,
seeds, stems, and bulbs) are provided, thus increasing the size of
various sinks (larger roots, tubers, etc.) and subsequently
increasing yield and crop productivity. The increased carbon
availability to these sinks would also improve composition and use
efficiency in the sink (oil, protein, starch and/or sucrose
production, and/or solids uniformity).
[0023] Various advantages may be achieved by the aims of the
present invention, including:
[0024] First, increasing the expression of the FDA enzyme in the
chloroplast would increase the flow of carbon through the Calvin
Cycle and increase atmospheric carbon assimilation during early
photoperiod. This would result in an increase in photosynthetic
efficiency and an increase in chloroplast starch production (a leaf
carbon storage form degraded during periods when photosynthesis is
low or absent). Both of these responses would lead to an increase
in sucrose production by the leaf and a net increase in carbon
export during a given photoperiod. This increase in source capacity
is a desirable trait in crop plants and would lead to increased
plant growth, storage ability, yield, vigor, and stress
tolerance.
[0025] Second, increasing FDA expression in the cytosol of
photosynthetic cells would lead to an increase in sucrose
production and export out of source leaves. This increase in source
capacity is a desirable trait in crop plants and would lead to
increased plant growth, storage ability, yield, vigor, and stress
tolerance.
[0026] Third, expression of FDA in sink tissues can show several
desirable traits, such as increased amino acid and/or fatty acid
pools via increases in carbon flux through glycolysis (and thus
pyruvate levels) in seeds or other sinks and increased starch
levels as result of increased production of glucose 6-phosphate in
seeds, roots, stems, and tubers where starch is a major storage
nonstructural carbohydrate (reverse glycolysis). This increase in
sink strength is a desirable trait in crop plants and would lead to
increased plant growth, storage ability, yield, vigor, and stress
tolerance.
[0027] Fourth, the invention is particularly desirable for use in
the commercial production of foods derived from potatoes. Potatoes
used for the production of french fries and other products suffer
from a non-uniform distribution of solids between the tuber pith
(inner core) and the cortex (outer core). Thus, french fry strips
from the pith regions of such tubers have a low solids content and
a high water content in comparison to cortex strips from the same
tubers. Therefore, the french fry processor attempts to adjust the
processing parameters so that the final inner strips are
sufficiently cooked while the outer cortex strips are not
overcooked. The results of such adjustments, however, are highly
variable and may lead to poor quality product. Transgenic potatoes
expressing fda will provide to the french-fry and potato chip
processor a raw product that consistently displays a higher tuber
solids uniformity with acceptable agronomic traits. In the french
fry plant production process, inner pith fry strips from higher
solids uniformity tubers will require less time to blanch, less
time to dry to a specific solids content, and less time to par-fry
before freezing and shipping to retail and institutional
end-users.
[0028] Therefore, with respect to potatoes, the present invention
provides 1) a higher quality, more uniform finish fry product in
which french fries from all tuber regions, when processed, are
nearly the same, 2) a higher through-put in the french fry
processing plant due to lower processing times, and 3) processor
cost savings due to lower energy input required for lower blanch,
dry, and par-fry times. A raw tuber product that displays a higher
solids uniformity will also produce a potato chip that has a
reduced saddle curl, and a reduced tendency for center bubble,
which are undesirable qualities in the potato chip industry.
Reduced fat content would also result; this would contribute to
improved consumer appeal and lower oil use (and costs) for the
processor. The increase in solids uniformity will also translate to
an increase in overall tuber solids. For both the french fry and
chipping industries, this overall tuber solids increase will also
result in higher through-put in the processing plant due to lower
processing times, and cost savings due to lower energy input for
blanching, drying, par-frying, and finish frying.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 shows the nucleotide sequence and deduced amino acid
sequence of a fructose 1,6 bisphosphate aldolase gene from E. coli
(SEQ ID No: 1).
[0030] FIG. 2 shows a plasmid map for plant transformation vector
pMON17524.
[0031] FIG. 3 shows a plasmid map for plant transformation vector
pMON17542.
[0032] FIG. 4 shows the change in diurnal fluctuations of sucrose,
glucose, and starch levels in tobacco leaves expressing the fda
transgene (pMON17524) and control (pMON17227). The light period is
from 7:00 to 19:00 hours. Only fully expanded and non-senescing
leaves were sampled.
[0033] FIG. 5 shows a plasmid map for plant transformation vector
pMON13925.
[0034] FIG. 6 shows a plasmid map for plant transformation vector
pMON17590.
[0035] FIG. 7 shows a plasmid map for plant transformation vector
pMON13936.
[0036] FIG. 8 shows a plasmid map for plant transformation vector
pMON17581.
[0037] FIG. 9 shows potato tuber cross-sections of improved solids
uniformity Segal Russet Burbank lines (top row) versus unimproved
nontransgenic Russet Burbank (bottom row).
DETAILED DESCRIPTION OF THE INVENTION
[0038] This invention is directed to a method for producing plant
cells and plants demonstrating an increased or improved growth and
development, yield, quality, starch storage uniformity, vigor,
and/or stress tolerance. The method utilizes a DNA sequence
encoding an fda (fructose 1,6 bisphosphate aldolase) gene
integrated in the cellular genome of a plant as the result of
genetic engineering and causes expression of the FDA enzyme in the
transgenic plant so produced. Plants that overexpress the FDA
enzyme exhibit increased carbon flow through the Calvin Cycle and
increased atmospheric carbon assimilation during early photoperiod
resulting in an increase in photosynthetic efficiency and an
increase in starch production. Thus, such plants exhibit higher
levels of sucrose production by the leaf and the ability to achieve
a net increase in carbon export during a given photoperiod. This
increase in source capacity leads to increased plant growth that in
turn generates greater biomass and/or increases the size of the
sink and ultimately providing greater yields of the transgenic
plant. This greater biomass or increased sink size may be evidenced
in different ways or plant parts depending on the particular plant
species or growing conditions of the plant overexpressing the FDA
enzyme. Thus, increased size resulting from overexpression of FDA
may be seen in the seed, fruit, stem, leaf, tuber, bulb or other
plant part depending upon the plant species and its dominant sink
during a particular growth phase and upon the environmental effects
caused by certain growing conditions, e.g. drought, temperature or
other stresses. Transgenic plants overexpressing FDA may therefore
have increased carbon assimilation, export and storage in plant
source and sink organs, which results in growth, yield, and
uniformity and quality improvements.
[0039] Plants overexpressing FDA may also exhibit desirable quality
traits such as increased production of starch, oils and/or proteins
depending upon the plant species overexpressing the FDA. Thus,
overexpression of FDA in a particular plant species may affect or
alter the direction of the carbon flux thereby directing metabolite
utilization and storage either to starch production, protein
production or oil production via the role of FDA in the glycolysis
and gluconeogenesis metabolic pathways.
[0040] The mechanism whereby the expression of exogenous FDA
modifies carbon relationships is believed to derive from
source-sink relationships. The leaf tissue is a sucrose source, and
if more sucrose resulting from the activity of increased FDA
expression is transported to a sink, it results in increased
storage carbon (sugars, starch, oil, protein, etc.) or nitrogen
(protein, etc.) per given weight of the sink tissue.
[0041] The expression in a plant of a gene that exists in
double-stranded DNA form involves transcription of messenger RNA
(mRNA) from one strand of the DNA by RNA polymerase enzyme, and the
subsequent processing of the mRNA primary transcript inside the
nucleus. This processing involves a 3' non-translated region, which
adds polyadenylate nucleotides to the 3' end of the RNA.
Transcription of DNA into mRNA is regulated by a region of DNA
usually referred to as the promoter. The promoter region contains a
sequence of bases that signals RNA polymerase to associate with the
DNA and to initiate the transcription of mRNA using one of the DNA
strands as a template to make a corresponding complimentary strand
of RNA. This RNA is then used as a template for the production of
the protein encoded therein by the cells protein biosynthetic
machinery.
[0042] A number of promoters that are active in plant cells have
been described in the literature. These include the nopaline
synthase (NOS) and octopine synthase (OCS) promoters (which are
carried on tumor-inducing plasmids of Agrobacterium tumefaciens),
the caulimovirus promoters such as the cauliflower mosaic virus
(CaMV) 19S and 35S and the figwort mosaic virus (FMV)
35S-promoters, the light-inducible promoter from the small subunit
of ribulose-1,5-bisphosphate carboxylase (ssRUBISCO), a very
abundant plant polypeptide, and the chlorophyll a/b binding protein
gene promoters, etc. All of these promoters have been used to
create various types of DNA constructs that have been expressed in
plants; see, e.g., PCT publication WO 84/02913.
[0043] Promoters that are known to or are found to cause
transcription of DNA in plant cells can be used in the present
invention. Such promoters may be obtained from a variety of sources
such as plants and plant viruses and include, but are not limited
to, the enhanced CaMV35S promoter and promoters isolated from plant
genes such as ssRUBISCO genes. As described below, it is preferred
that the particular promoter selected should be capable of causing
sufficient expression to result in the production of an effective
amount of fructose 1,6 bisphosphate aldolase enzyme to cause the
desired increase in carbon assimilation, export or storage.
Expression of the double-stranded DNA molecules of the present
invention can be driven by a constitutive promoter, expressing the
DNA molecule in all or most of the tissues of the plant.
Alternatively, it may be preferred to cause expression of the fda
gene in specific tissues of the plant, such as leaf, stem, root,
tuber, seed, fruit, etc. The promoter chosen will have the desired
tissue and developmental specificity. Those skilled in the art will
recognize that the amount of fructose 1,6 bisphosphate aldolase
needed to induce the desired increase in carbon assimilation,
export, or storage may vary with the type of plant. Therefore,
promoter function should be optimized by selecting a promoter with
the desired tissue expression capabilities and approximate promoter
strength and selecting a transformant that produces the desired
fructose 1,6 bisphosphate aldolase activity or the desired change
in metabolism of carbohydrates in the target tissues. This
selection approach from the pool of transformants is routinely
employed in expression of heterologous structural genes in plants
because there is variation between transformants containing the
same heterologous gene due to the site of gene insertion within the
plant genome (commonly referred to as "position effect"). In
addition to promoters that are known to cause transcription
(constitutively or tissue-specific) of DNA in plant cells, other
promoters may be identified for use in the current invention by
screening a plant cDNA library for genes that are selectively or
preferably expressed in the target tissues of interest and then
isolating the promoter regions by methods known in the art. In
particular, it may be desirable to use a bundle sheath cell
specific (or cell enhanced expression) promoter for use with C4
plants such as corn, sorghum, and sugarcane to obtain the yield
benefits of overexpression of FDA and not use a constitutive
promoter or a promoter with mesophyll cell enhanced expression
properties.
[0044] For the purpose of expressing the fda gene in source tissues
of the plant, such as the leaf or stem, it is preferred that the
promoters utilized in the double-stranded DNA molecules of the
present invention have relatively high expression in these specific
tissues. For this purpose, one may also choose from a number of
promoters for genes with leaf-specific or leaf-enhanced expression.
Examples of such genes known from the literature are the
chloroplast glutamine synthetase GS2 from pea (Edwards et al.,
1990), the chloroplast fructose-1,6-bisphosphatase (FBPase) from
wheat (Lloyd et al., 1991), the nuclear photosynthetic ST-LS1 from
potato (Stockhaus et al., 1989), and the phenylalanine
ammonia-lyase (PAL) and chalcone synthase (CHS) genes from
Arabidopsis thaliana (Leyva et al., 1995). Also shown to be active
in photosynthetically active tissues are the
ribulose-1,5-bisphosphate carboxylase (RUBISCO), isolated from
eastern larch (Larix laricina) (Campbell et al., 1994); the cab
gene, encoding the chlorophyll a/b-binding protein of PSII,
isolated from pine (cab6; Yamamoto et al., 1994), wheat (Cab-1;
Fejes et al., 1990), spinach (CAB-1; Luebberstedt et al., 1994),
and rice (cab1R: Luan et al., 1992); the pyruvate orthophosphate
dikinase (PPDK) from maize (Matsuoka et al., 1993); the tobacco
Lhcb1*2 gene (Cerdan et al., 1997); the Arabidopsis thaliana SUC2
sucrose-H+ symporter gene (Truernit et al., 1995); and the
thylacoid membrane proteins, isolated from spinach (psaD, psaF,
psaE, PC, FNR, atpC, atpD, cab, rbcS; Oelmueller et al., 1992).
Other chlorophyll a/b-binding proteins have been studied and
described in the literature, such as LhcB and PsbP from white
mustard (Sinapis alba; Kretsch et al., 1995). Homologous promoters
to those described here may also be isolated from and tested in the
target or related crop plant by standard molecular biology
procedures.
[0045] For the purpose of expressing the fda in sink tissues of the
plant, for example the tuber of the potato plant; the fruit of
tomato; or seed of maize, wheat, rice, or barley, it is preferred
that the promoters utilized in the double-stranded DNA molecules of
the present invention have relatively high expression in these
specific tissues. A number of genes with tuber-specific or
tuber-enhanced expression are known, including the class I patatin
promoter (Bevan et al., 1986; Jefferson et al., 1990); the potato
tuber ADPGPP genes, both the large and small subunits (Muller et
al., 1990); sucrose synthase (Salanoubat and Belliard, 1987, 1989);
the major tuber proteins including the 22 kDa protein complexes and
proteinase inhibitors (Hannapel, 1990); the granule bound starch
synthase gene (GBSS) (Rohde et al., 1990); and the other class I
and II patatins (Rocha-Sosa et al., 1989; Mignery et al., 1988).
Other promoters can also be used to express a fructose 1,6
bisphosphate aldolase gene in specific tissues, such as seeds or
fruits. The promoter for .beta.-conglycinin (Tierney, 1987) or
other seed-specific promoters, such as the napin and phaseolin
promoters, can be used to over-express an fda gene specifically in
seeds. The zeins are a group of storage proteins found in maize
endosperm. Genomic clones for zein genes have been isolated
(Pedersen et al., 1982), and the promoters from these clones,
including the 15 kDa, 16 kDa, 19 kDa, 22 kDa, 27 kDa, and gamma
genes, could also be used to express an fda gene in the seeds of
maize and other plants. Other promoters known to function in maize,
wheat, or rice include the promoters for the following genes: waxy,
Brittle, Shrunken 2, branching enzymes I and II, starch synthases,
debranching enzymes, oleosins, glutelins, and sucrose synthases.
Particularly preferred promoters for maize endosperm expression, as
well as in wheat and rice, of an fda gene is the promoter for a
glutelin gene from rice, more particularly the Osgt-1 promoter
(Zheng et al., 1993); the maize granule-bound starch synthase
(waxy) gene (zmGBS); the rice small subunit ADPGPP promoter
(osAGP); and the zein promoters, particularly the maize 27 kDa zein
gene promoter (zm27) (see, generally, Russell et al., 1997).
Examples of promoters suitable for expression of an fda gene in
wheat include those for the genes for the ADPglucose
pyrophosphorylase (ADPGPP) subunits, for the granule bound and
other starch synthases, for the branching and debranching enzymes,
for the embryogenesis-abundant proteins, for the gliadins, and for
the glutenins. Examples of such promoters in rice include those for
the genes for the ADPGPP subunits, for the granule bound and other
starch synthases, for the branching enzymes, for the debranching
enzymes, for sucrose synthases, and for the glutelins. A
particularly preferred promoter is the promoter for rice glutelin,
Osgt-1. Examples of such promoters for barley include those for the
genes for the ADPGPP subunits, for the granule bound and other
starch synthases, for the branching enzymes, for the debranching
enzymes, for sucrose synthases, for the hordeins, for the embryo
globulins, and for the aleurone-specific proteins.
[0046] The solids content of root tissue may be increased by
expressing an fda gene behind a root-specific promoter. An example
of such a promoter is the promoter from the acid chitinase gene
(Samac et al., 1990). Expression in root tissue could also be
accomplished by utilizing the root-specific subdomains of the
CaMV35S promoter that have been identified (Benfey et al.,
1989).
[0047] The RNA produced by a DNA construct of the present invention
may also contain a 5' non-translated leader sequence. This sequence
can be derived from the promoter selected to express the gene and
can be specifically modified so as to increase translation of the
mRNA. The 5' non-translated regions can also be obtained from viral
RNAs, from suitable eukaryotic genes, or from a synthetic gene
sequence. The present invention is not limited to constructs, as
presented in the following examples, wherein the non-translated
region is derived from the 5' non-translated sequence that
accompanies the promoter sequence. Rather, the non-translated
leader sequence can be derived from an unrelated promoter or coding
sequence.
[0048] In monocots, an intron is preferably included in the gene
construct to facilitate or enhance expression of the coding
sequence. Examples of suitable introns include the HSP70 intron and
the rice actin intron, both of which are known in the art. Another
suitable intron is the castor bean catalase intron (Suzuki et al.,
1994)
Polyadenylation Signal
[0049] The 3' non-translated region of the chimeric plant gene
contains a polyadenylation signal that functions in plants to cause
the addition of polyadenylate nucleotides to the 3' end of the RNA.
Examples of suitable 3' regions are (1) the 3' transcribed,
non-translated regions containing the polyadenylation signal of
Agrobacterium tumor-inducing (Ti) plasmid genes, such as the
nopaline synthase (NOS) gene, and (2) plant genes like the soybean
storage protein genes and the small subunit of the
ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene.
Plastid-directed Expression of Fructose-1,6-bisphosphate Aldolase
Activity
[0050] In one embodiment of the invention, the fda gene may be
fused to a chloroplast transit peptide, in order to target the FDA
protein to the plastid. As used hereinafter, chloroplast and
plastid are intended to include the various forms of plastids
including amyloplasts. Many plastid-localized proteins are
expressed from nuclear genes as precursors and are targeted to the
plastid by a chloroplast transit peptide (CTP), which is removed
during the import steps. Examples of such chloroplast proteins
include the small subunit of ribulose-1,5-biphosphate carboxylase
(ssRUBISCO, SSU), 5-enolpyruvateshikimate-3-phosphate synthase
(EPSPS), ferredoxin, ferredoxin oxidoreductase, the
light-harvesting-complex protein I and protein II, and thioredoxin
F. It has been demonstrated that non-plastid proteins may be
targeted to the chloroplast by use of protein fusions with a CTP
and that a CTP sequence is sufficient to target a protein to the
plastid. Those skilled in the art will also recognize that various
other chimeric constructs can be made that utilize the
functionality of a particular plastid transit peptide to import the
fructose-1,6-diphosphate aldolase enzyme into the plant cell
plastid. The fda gene could also be targeted to the plastid by
transformation of the gene into the chloroplast genome (Daniell et
al., 1998).
Fructose 1,6 Bisphosphate Aldolases
[0051] As used herein, the term "fructose 1,6-bisphophate aldolase"
means an enzyme (E.C. 4.1.2.13) that catalyzes the reversible
cleavage of fructose 1,6-bisphosphate to form glyceraldehyde
3-phosphate (G3P) and dihydroxyacetone phosphate (DHAP). Aldolase
enzymes are divided into two classes, designated class I and class
II (Witke and Gotz, 1993). Various fda genes encoding the enzyme
have been sequenced, as have numerous proteins, such as the
cytosolic enzyme from maize (GenBank Accession S07789;S10638),
cytosolic enzyme from rice (GenBank Accession JQ0543), cytosolic
enzyme from spinach (GenBank Accession S31091;S22093), from
Arabidopsis thaliana (GenBank Accession S 11958), from spinach
chloroplast (GenBank Accession S31090;A21815;S22092), from yeast
(S. cerevisiae) (GenBank Accession S07855; S37882; S12945; S39178;
S44523;X75781), from Rhodobacter sphaeroides (GenBank Accession
B40767;D41080), from B. subtilis (GenBank Accession S55426; D32354;
E32354; D41835), from garden pea (GenBank Accession S29048;
S34411), from garden pea chloroplast (GenBank Accession S29047;
S34410), from maize (GenBank Accession S05019), from Chlamydomonas
reinhardtii (GenBank Accession S48639; S58485; S58486; S34367),
from Corynebacterium glutamicum (GenBank Accession S09283; X17313),
from Campylobacter jejuni (GenBank Accession S52413), from
Haemophilus influenzae (strain Rd KW20) (GenBank Accession C64074),
from Streptococcus pneumonia (GenBank Accession AJ005697), from
rice (GenBank Accession X53130), and from the maize anaerobically
regulated gene (GenBank Accession X12872).
[0052] The class I enzymes may be isolated from higher eukaryotes,
such as animals and plants, and in some prokaryotes, including
Peptococcus aerogens, (Lebherz and Rutter, 1973), Lactobacillus
casei (London and Kline, 1973), Escherichia coli (Stribling and
Perham, 1973), Mycobacterium smegmatis (Bai et al., 1975), and most
staphylococcal species (Gotz et al., 1979). The gene for the FDA
enzyme may be obtained by known methods and has already been done
so for several organisms, such as rabbit (Lai et al., 1974), human
(Besmond et al., 1983), rat (Tsutsumi et al., 1984), Trypanosoma
brucei (Clayton, 1985), and Arabidopsis thaliana (Chopra et al.,
1990). These class I enzymes are invariably tetrameric proteins
with a total molecular weight of about 160 kDa and function by
imine formation between the substrate and a lysine residue in the
active site (Alfounder et al., 1989).
[0053] In animal, three class I isozymes, classified as A, B, and
C, are expressed in the cytosol of muscle, liver, and brain tissue
respectively, and they differ from plant aldolases in their
expression and compartmentation patterns (Joh et al., 1986). In the
leaves of higher plants, FDA is a class I enzyme, and two different
isoenzymes within the class have been documented. One is contained
in the chloroplast and the other in the cytosol (Lebherz et al.,
1984). The acidic plant isozyme appear to be chloroplastic and
comprises about 85% of the total leaf aldolase activity. The basic
plant isozyme is cytosolic, and both isozymes appear to be encoded
by the nuclear genome and are encoded by different genes (Lebherz
et al., 1984).
[0054] The class II type aldolases are normally dimeric with
molecular mass of approximately 80 kDa, and their activity depends
on divalent metal ions. The class II enzymes may be isolated from
prokaryotes, such as blue-green algae and bacteria, and eukaryotic
green algae and fungi (Baldwin et al., 1978). The gene for the FDA
class II enzyme may be obtained by known methods and has already
been done so from several organisms including Saccharomyces
cerevisiae (Jack and Harris, 1971), Bacillus stearothermophilus
(Jack, 1973), and Escherichia coli (Baldwin et al., 1978).
[0055] It is believed that highly homologous class II fructose
1,6-bisphophate aldolases with similar catalyzing activity will
also be found in other species of microorganism, such as
Saccharomyces (Saccharomyces cerevisiae); Bacillus (Bacillus
subtilis); Rhodobacter (Rhodobacter sphaeroides); Plasmodium
(Plasmodium falciparium, Plasmodium berghei); Trypanosoma
(Trypanosoma brucei); Chlamydomonas (Chlamydomas reinhardtii);
Candida (Candida albicans); Corynebacterium (Corynebacterium
glutamicum); Campylobacter (Campylobacter jejuni); and Haemophilus
(Haemophilus influenza).
[0056] Such sequences can be readily isolated by methods well known
in the art, for example by nucleic acid hybridization. The
hybridization properties of a given pair of nucleic acids are an
indication of their similarity or identity. Nucleic acid sequences
can be selected on the basis of their ability to hybridize with
known fda sequences. Low stringency conditions may be used to
select sequences with less homology or identity. One may wish to
employ conditions such as about 0.15 M to about 0.9 M sodium
chloride, at temperatures ranging from about 20.degree. C. to about
55.degree. C. High stringency conditions may be used to select for
nucleic acid sequences with higher degrees of identity to the
disclosed sequences. Conditions typically employed may include
about 0.02 M to about 0.15 M sodium chloride, about 0.5% to about
5% casein, about 0.02% SDS or about 0.1% N-laurylsarcosine, about
0.001 M to about 0.03 M sodium citrate, at hybridization
temperatures between about 50.degree. C. and about 70.degree. C.
More preferably, high stringency conditions are about 0.02 M sodium
chloride, about 0.5% casein, about 0.02% SDS, about 0.001 M sodium
citrate, at a temperature of about 50.degree. C. The skilled
individual will recognize that numerous variations are possible in
the conditions and means by which nucleic acid hybridization can be
performed to isolate fda sequences having similarity to fda
sequences known in the art and are not limited to those explicitly
disclosed herein. Preferably, such an approach is used to isolate
fda sequences having greater than about 60% identity with the
disclosed E.coli fda sequence, more preferably greater than about
70% identity, most preferably greater than about 80% identity.
[0057] Depending on growth conditions Euglena gracilis,
Chlamydomonas mundana, and Chlamydomomas rheinhardi produce either
a class I or a class II aldolase (Cremona, 1968; Russell and Gibbs,
1967; Guerrini et al., 1971).
[0058] The isolation of a class II fda gene from E. coli is
described in the following examples. Its DNA sequence is given as
SEQ ID NO:1 and shown in FIG. 1. The amino acid sequence is shown
in SEQ ID NO:2 and shown in FIG. 1. This gene can be used as
isolated by inserting it into plant expression vectors suitable for
the transformation method of choice as described. The E. coli FDA
enzyme has an apparent pH optimum range near pH 7-9 and retains
activity in the lower pH range of 5-7 (Baldwin et al., 1978;
Alfounder et al., 1989).
[0059] Thus, many different genes that encode a fructose 1,6
bisphosphate aldolase activity may be isolated and used in the
present invention.
Synthetic Gene Construction
[0060] A carbohydrate metabolizing enzyme considered in this
invention includes any sequence of amino acids, such as protein,
polypeptide, or peptide fragment, that demonstrates the ability to
catalyze a reaction involved in the synthesis or degradation of
starch or sucrose. These can be sequences obtained from a
heterologous source, such as algae, bacteria, fungi, and protozoa,
or endogenous plant sequences, by which is meant any sequence that
can be naturally found in a plant cell, including native
(indigenous) plant sequences as well as sequences from plant
viruses or plant pathogenic bacteria.
[0061] It will be recognized by one of ordinary skill in the art
that carbohydrate metabolizing enzyme gene sequences may also be
modified using standard techniques such as site-specific mutation
or PCR, or modification of the sequence may be accomplished by
producing a synthetic nucleic acid sequence and will still be
considered a carbohydrate biosynthesis enzyme nucleic acid sequence
of this invention. For example, "wobble" positions in codons may be
changed such that the nucleic acid sequence encodes the same amino
acid sequence, or alternatively, codons can be altered such that
conservative amino acid substitutions result. In either case, the
peptide or protein maintains the desired enzymatic activity and is
thus considered part of this invention.
[0062] A nucleic acid sequence to a carbohydrate metabolizing
enzyme may be a DNA or RNA sequence, derived from genomic DNA,
cDNA, mRNA, or may be synthesized in whole or in part. The
structural gene sequences may be cloned, for example, by isolating
genomic DNA from an appropriate source and amplifying and cloning
the sequence of interest using a polymerase chain reaction (PCR).
Alternatively, the gene sequences may be synthesized, either
completely or in part, especially where it is desirable to provide
plant-preferred sequences. Thus, all or a portion of the desired
structural gene may be synthesized using codons preferred by a
selected plant host. Plant-preferred codons may be determined, for
example, from the codons used most frequently in the proteins
expressed in a particular plant host species. Other modifications
of the gene sequences may result in mutants having slightly altered
activity.
[0063] If desired, the gene sequence of the fda gene can be changed
without changing the protein sequence in such a manner as may
increase expression and thus even more positively affect
carbohydrate content in transformed plants. A preferred manner for
making the changes in the gene sequence is set out in PCT
Publication WO 90/10076. A gene synthesized by following the
methodology set out therein may be introduced into plants as
described below and result in higher levels of expression of the
FDA enzyme. This may be particularly useful in monocots such as
maize, rice, wheat, sugarcane, and barley.
Combinations With Other Transgenes
[0064] The effect of fda in transgenic plants may be enhanced by
combining it with other genes that positively affect carbohydrate
assimilation or content, such as a gene encoding for a sucrose
phosphorylase as described in PCT Publication WO 96/24679, or
ADPGPP genes such as the E. coli glgC gene and its mutant glgC16.
PCT Publication WO 91/19806 discloses how to incorporate the latter
gene into many plant species in order to increase starch or solids.
Another gene that can be combined with fda to increase carbon
assimilation, export or storage is a gene encoding for sucrose
phosphate synthase (SPS). PCT Publication WO 92/16631 discloses one
such gene and its use in transgenic plants.
Plant Transformation/regeneration
[0065] In developing the nucleic acid constructs of this invention,
the various components of the construct or fragments thereof will
normally be inserted into a convenient cloning vector, e.g., a
plasmid that is capable of replication in a bacterial host, e.g.,
E. coli. Numerous vectors exist that have been described in the
literature, many of which are commercially available. After each
cloning, the cloning vector with the desired insert may be isolated
and subjected to further manipulation, such as restriction
digestion, insertion of new fragments or nucleotides, ligation,
deletion, mutation, resection, etc. so as to tailor the components
of the desired sequence. Once the construct has been completed, it
may then be transferred to an appropriate vector for further
manipulation in accordance with the manner of transformation of the
host cell.
[0066] A recombinant DNA molecule of the invention typically
includes a selectable marker so that transformed cells can be
easily identified and selected from non-transformed cells. Examples
of such include, but are not limited to, a neomycin
phosphotransferase (nptII) gene (Potrykus et al., 1985), which
confers kanamycin resistance. Cells expressing the nptII gene can
be selected using an appropriate antibiotic such as kanamycin or
G418. Other commonly used selectable markers include the bar gene,
which confers bialaphos resistance; a mutant EPSP synthase gene
(Hinchee et al., 1988), which confers glyphosate resistance; a
nitrilase gene, which confers resistance to bromoxynil (Stalker et
al., 1988); a mutant acetolactate synthase gene (ALS), which
confers imidazolinone or sulphonylurea resistance (European Patent
Application 154,204, 1985); and a methotrexate resistant DHFR gene
(Thillet et al., 1988).
[0067] Plants that can be made to have enhanced carbon
assimilation, increased carbon export and partitioning by practice
of the present invention include, but are not limited to, Acacia,
alfalfa, aneth, apple, apricot, artichoke, arugula, asparagus,
avocado, banana, barley, beans, beet, blackberry, blueberry,
broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot,
cassava, cauliflower, celery, cherry, cilantro, citrus,
clementines, coffee, corn, cotton, cucumber, Douglas fir, eggplant,
endive, escarole, eucalyptus, fennel, figs, gourd, grape,
grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon,
lime, Loblolly pine, mango, melon, mushroom, nut, oat, oil seed
rape, okra, onion, orange, an ornamental plant, papaya, parsley,
pea, peach, peanut, pear, pepper, persimmon, pine, pineapple,
plantain, plum, pomegranate, poplar, potato, pumpkin, quince,
radiata pine, radicchio, radish, raspberry, rice, rye, sorghum,
Southern pine, soybean, spinach, squash, strawberry, sugarbeet,
sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea,
tobacco, tomato, triticale, turf, a vine, watermelon, wheat, yams,
and zucchini.
[0068] A double-stranded DNA molecule of the present invention
containing an fda gene can be inserted into the genome of a plant
by any suitable method. Suitable plant transformation vectors
include those derived from a Ti plasmid of Agrobacterium
tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella
et al. (1983), Bevan (1984), Klee et al. (1985) and EPO publication
120,516. In addition to plant transformation vectors derived from
the Ti or root-inducing (Ri) plasmids of Agrobacterium, alternative
methods can be used to insert the DNA constructs of this invention
into plant cells. Such methods may involve, for example, the use of
liposomes, electroporation, chemicals that increase free DNA
uptake, free DNA delivery via microprojectile bombardment, and
transformation using viruses or pollen. DNA may also be inserted
into the chloroplast genome (Daniell et al., 1998).
[0069] A plasmid expression vector suitable for the introduction of
an fda gene in monocots using microprojectile bombardment is
composed of the following: a promoter that is specific or enhanced
for expression in the starch storage tissues in monocots, generally
the endosperm, such as promoters for the zein genes found in the
maize endosperm (Pedersen et al., 1982); an intron that provides a
splice site to facilitate expression of the gene, such as the Hsp70
intron (PCT Publication WO93/19189); and a 3' polyadenylation
sequence such as the nopaline synthase 3' sequence (NOS 3'; Fraley
et al., 1983). This expression cassette may be assembled on high
copy replicons suitable for the production of large quantities of
DNA.
[0070] A particularly useful Agrobacterium-based plant
transformation vector for use in transformation of dicotyledonous
plants is plasmid vector pMON530 (Rogers et al., 1987). Plasmid
pMON530 is a derivative of pMON505 prepared by transferring the 2.3
kb StuI-HindIII fragment of pMON316 (Rogers et al., 1987) into
pMON526. Plasmid pMON526 is a simple derivative of pMON505 in which
the SmaI site is removed by digestion with XmaI, treatment with
Klenow polymerase and ligation. Plasmid pMON530 retains all the
properties of pMON505 and the CaMV35S-NOS expression cassette and
now contains a unique cleavage site for SmaI between the promoter
and polyadenylation signal.
[0071] Binary vector pMON505 is a derivative of pMON200 (Rogers et
al., 1987) in which the Ti plasmid homology region, LIH, has been
replaced with a 3.8 kb HindIII to SmaI segment of the mini RK2
plasmid, pTJS75 (Schmidhauser and Helinski, 1985). This segment
contains the RK2 origin of replication, oriV, and the origin of
transfer, oriT, for conjugation into Agrobacterium using the
tri-parental mating procedure (Horsch and Klee, 1986). Plasmid
pMON505 retains all the important features of pMON200 including the
synthetic multi-linker for insertion of desired DNA fragments, the
chimeric NOS/NPTII'/NOS gene for kanamycin resistance in plant
cells, the spectinomycin/streptomycin resistance determinant for
selection in E. coli and A. tumefaciens, an intact nopaline
synthase gene for facile scoring of transformants and inheritance
in progeny, and a pBR322 origin of replication for ease in making
large amounts of the vector in E. coli. Plasmid pMON505 contains a
single T-DNA border derived from the right end of the pTiT37
nopaline-type T-DNA. Southern blot analyses have shown that plasmid
pMON505 and any DNA that it carries are integrated into the plant
genome, that is, the entire plasmid is the T-DNA that is inserted
into the plant genome. One end of the integrated DNA is located
between the right border sequence and the nopaline synthase gene
and the other end is between the border sequence and the pBR322
sequences.
[0072] Another particularly useful Ti plasmid cassette vector is
pMON17227. This vector is described in PCT Publication WO 92/04449
and contains a gene encoding an enzyme conferring glyphosate
resistance (denominated CP4), which is an excellent selection
marker gene for many plants, including potato and tomato. The gene
is fused to the Arabidopsis EPSPS chloroplast transit peptide
(CTP2) and expressed from the FMV promoter as described
therein.
[0073] When adequate numbers of cells (or protoplasts) containing
the fda gene or cDNA are obtained, the cells (or protoplasts) are
regenerated into whole plants. Choice of methodology for the
regeneration step is not critical, with suitable protocols being
available for hosts from Leguminosae (alfalfa, soybean, clover,
etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage,
radish, canola/rapeseed, etc.), Cucurbitaceae (melons and
cucumber), Gramineae (wheat, barley, rice, maize, etc.), Solanaceae
(potato, tobacco, tomato, peppers), various floral crops, such as
sunflower, and nut-bearing trees, such as almonds, cashews,
walnuts, and pecans. See, e.g., Ammirato et al. (1984); Shimamoto
et al. (1989); Fromm (1990); Vasil et al. (1990); Vasil et al.
(1992); Hayashimoto (1990); and Datta et al. (1990).
[0074] The following definitions are provided in order to aid those
skilled in the art in understanding the detailed description of the
present invention.
[0075] The term "promoter" or "promoter region" refers to a nucleic
acid sequence, usually found upstream (5') to a coding sequence,
that controls expression of the coding sequence by controlling
production of messenger RNA (mRNA) by providing the recognition
site for RNA polymerase or other factors necessary for start of
transcription at the correct site. As contemplated herein, a
promoter or promoter region includes variations of promoters
derived by means of ligation to various regulatory sequences,
random or controlled mutagenesis, and addition or duplication of
enhancer sequences. The promoter region disclosed herein, and
biologically functional equivalents thereof, are responsible for
driving the transcription of coding sequences under their control
when introduced into a host as part of a suitable recombinant
vector, as demonstrated by its ability to produce mRNA.
[0076] "Regeneration" refers to the process of growing a plant from
a plant cell (e.g., plant protoplast or explant).
[0077] "Transformation" refers to a process of introducing an
exogenous nucleic acid sequence (e.g., a vector, recombinant
nucleic acid molecule) into a cell or protoplast in which that
exogenous nucleic acid is incorporated into a chromosome or is
capable of autonomous replication.
[0078] A "transformed cell" is a cell whose DNA has been altered by
the introduction of an exogenous nucleic acid molecule into that
cell.
[0079] The term "gene" refers to chromosomal DNA, plasmid DNA,
cDNA, synthetic DNA, or other DNA that encodes a peptide,
polypeptide, protein, or RNA molecule, and regions flanking the
coding sequence involved in the regulation of expression.
[0080] "Identity" refers to the degree of similarity between two
nucleic acid or protein sequences. An alignment of the two
sequences is performed by a suitable computer program. A widely
used and accepted computer program for performing sequence
alignments is CLUSTALW v1.6 (Thompson et al., 1994). The number of
matching bases or amino acids is divided by the total number of
bases or amino acids and multiplied by 100 to obtain a percent
identity. For example, if two 580 base pair sequences had 145
matched bases, they would be 25 percent identical. If the two
compared sequences are of different lengths, the number of matches
is divided by the shorter of the two lengths. For example, if there
were 100 matched amino acids between 200 and a 400 amino acid
proteins, they are 50 percent identical with respect to the shorter
sequence. If the shorter sequence is less than 50 bases or amino
acids in length, the number of matches are divided by 50 and
multiplied by 100 to obtain a percent identity.
[0081] "C-terminal region" refers to the region of a peptide,
polypeptide, or protein chain from the middle thereof to the end
that carries the amino acid having a free carboxyl group.
[0082] The phrase "DNA segment heterologous to the promoter region"
means that the coding DNA segment does not exist in nature in the
same gene with the promoter to which it is now attached.
[0083] The term "encoding DNA" refers to chromosomal DNA, plasmid
DNA, cDNA, or synthetic DNA that encodes any of the enzymes
discussed herein.
[0084] The term "genome" as it applies to bacteria encompasses both
the chromosome and plasmids within a bacterial host cell. Encoding
DNAs of the present invention introduced into bacterial host cells
can therefore be either chromosomally integrated or
plasmid-localized. The term "genome" as it applies to plant cells
encompasses not only chromosomal DNA found within the nucleus, but
organelle DNA found within subcellular components of the cell. DNAs
of the present invention introduced into plant cells can therefore
be either chromosomally integrated or organelle-localized.
[0085] The terms "microbe" or "microorganism" refer to algae,
bacteria, fungi, and protozoa.
[0086] The term "mutein" refers to a mutant form of a peptide,
polypeptide, or protein.
[0087] "N-terminal region" refers to the region of a peptide,
polypeptide, or protein chain from the amino acid having a free
amino group to the middle of the chain.
[0088] "Overexpression" refers to the expression of a polypeptide
or protein encoded by a DNA introduced into a host cell, wherein
said polypeptide or protein is either not normally present in the
host cell, or wherein said polypeptide or protein is present in
said host cell at a higher level than that normally expressed from
the endogenous gene encoding said polypeptide or protein.
[0089] The term "plastid" refers to the class of plant cell
organelles that includes amyloplasts, chloroplasts, chromoplasts,
elaioplasts, eoplasts, etioplasts, leucoplasts, and proplastids.
These organelles are self-replicating and contain what is commonly
referred to as the "chloroplast genome," a circular DNA molecule
that ranges in size from about 120 kb to about 217 kb, depending
upon the plant species, and which usually contains an inverted
repeat region.
[0090] The phrase "simple carbohydrate substrate" means a
monosaccharide or an oligosaccharide but not a polysaccharide;
simple carbohydrate substrate includes glucose, fructose, sucrose,
lactose. More complex carbohydrate substrates commonly used in
media such as corn syrup, starch, and molasses can be broken down
to simple carbohydrate substrates.
[0091] The term "solids" refers to the nonaqueous component of a
tuber (such as in potato) or a fruit (such as in tomato) comprised
mostly of starch and other polysaccharides, simple carbohydrates,
nonstructural carbohydrated, amino acids, and other organic
molecules.
[0092] The following examples are provided to better elucidate the
practice of the present invention and should not be interpreted in
any way to limit the scope of the present invention. Those skilled
in the art will recognize that various modifications, truncations,
etc., can be made to the methods and genes described herein while
not departing from the spirit and scope of the present
invention.
EXAMPLES
Example 1
[0093] cDNA Cloning and Overexpression
[0094] Unless otherwise stated, basic DNA manipulations and genetic
techniques, such as PCR, agarose electrophoresis, restriction
digests, ligations, E. coli transformations, colony screens, and
Western blots were performed essentially by the protocols described
in Sambrook et al. (1989) or Maniatis et al. (1982).
[0095] The E. coli fda gene sequence (SEQ ID NO: 1) was obtained
from Genbank (Accession Number X14682) and nucleotide primers with
homology to the 5' and 3' end were designed for PCR amplification.
E. coli chromosomal DNA was extracted and the E. coli fda gene was
amplified by PCR using the 5' oligonucleotide
5'GGGGCCATGGCTAAGATT-TTGATTTCGTA3' (SEQ ID NO:3) and the 3'
oligonucleotide 5'CCCCGAGCTCTTACAGAACGTCGATCGCGTTCAG3- ' (SEQ ID
NO:4). The PCR cycling conditions were as follows: 94.degree. C., 5
min (1 cycle); addition of polymerase; 94.degree. C., 1 min.,
60.degree. C., 1 min., 72.degree. C., 2 min.30 sec. (35 cycles).
The 1.08 kb PCR purified and ligated into an E.coli expression
vector, pMON5723, to form a vector construct that was used for
transformation of frozen competent E.coli JM101 cells. The pMON5723
vector contains the E.coli recA promoter and the T7 gene10 leader
(G10L) sequences, which enable high level expression in E.coli
(Wong et al., 1988). After induction of the transformed cells, a
distinct protein band of about 40 kDa was apparent on an SDS PAGE
gel, which correlates with the size of the subunit polypeptide
chain of the dimeric aldolase II. It was shown that most of the
induced protein was present in the soluble phase. A gel slice
containing the highly induced protein was isolated and antibodies
were produced in a goat, which was injected with the homogenized
gel slice (emulsified in Freund's complete adjuvant).
[0096] The fda gene sequence was subsequently cloned into another
E.coli expression vector, under the control of the taq promoter.
Induction with IPTG of JM101 cells transformed with this vector
showed the same 40 kDa overexpressed protein band. This new clone
was used in an enzyme assay for FDA activity. Cells transformed
with this vector construct were grown in a liquid culture, induced
with IPTG, and grown for another 3 hours. Subsequently, a 3 mL cell
culture was spun down, dissolved in 100 mM Tris and sonicated. The
cell pellet was spun down, and the crude cell extract supernatant
was assayed for FDA activity, using a coupled enzymatic assay as
described by Baldwin et al. (1978). This assay was routinely
performed at 30.degree. C.
[0097] The reaction was performed in a 1 mL final volume in excess
presence of the enzymes triosephosphate isomerase (TIM) and
alpha-glycerophosphate dehydrogenase (GDH) in a reaction mixture
containing final concentrations of 100 mM Tris pH 8.0, 4.75 mM
fructose 1,6 bisphosphate, 0.15 mM NADH, 500 U/mL TIM, and 30 U/mL
GDH.
[0098] The decrease in absorbance at 340 nm, after addition of the
cell extract supernatant, was recorded using an HP diode array
spectrophotometer. One international unit (I.U.) of aldolase
activity is that causing the oxidation of 2 .mu.mol of NADH/min in
this assay system.
[0099] Cell extracts containing the vector with the fda sequence
showed a substantial increase in aldolase activity (13.1 I.U./mg
protein) as compared to cells transformed with the control vector
(0.15 I.U./mg protein). The activity was shown to be inhibited by
EDTA, known to specifically inhibit class II aldolases.
Example 2
[0100] Plant Transformation and fda Expression in Tobacco
[0101] Targeting of FDA Protein
[0102] E.coli fructose 1,6 bisphosphate aldolase was targeted to
the plastid in plants in order to assess its influence on
carbohydrate metabolism and starch biosynthesis in these plant
organelles. To accomplish the import of the E.coli aldolase into
the plastids, a vector was constructed in which the aldolase was
fused to the Arabidopsis small subunit transit peptide (CTP1)
(Stark et al., 1992) or the maize small subunit CTP (Russell et
al., 1993), creating constructs in which the CTP-fda fusion gene
was located between the 35S promoter from the figwort mosaic virus
(P-FMV35S; Gowda et al., 1989) and the 3'-nontranslated region of
the nopaline synthase gene (NOS 3'; Fraley et al., 1983) sequences.
The vector construct containing the expression cassette
[P-FMV/CTP1/fda/NOS3'] was subsequently used for tobacco protoplast
transformation, which was performed as described in Fromm et al.
(1987), with the following modifications. Tobacco cultivar Xanthi
line D (Txd) cell suspensions were grown in 250-mL flasks, at
25.degree. C. and 138 rpm in the dark. For maintenance, a
sub-culture volume of 9 mL was removed and added to 40 mL of fresh
Txd media containing MS salts, 3% sucrose, 0.2 g/L inositol, 0.13
g/L asparagine, 80 .mu.L of a 50 mg/mL stock of PCPA, 5 .mu.L of a
1 mg/mL stock of kinetin, and 1 mL of 1000.times.vitamins (1.3 g/L
nicotinic acid, 0.25 g/L thiamine, 0.25 g/L pyridoxine HCL, and
0.25 g/L calcium pantothenate) every 3 to 4 days. Protoplasts were
isolated from 1-day-old suspension cells that came from a 2-day-old
culture. Sixteen milliliters of cells were added to 40 mL of fresh
Txd media and allowed to grow 24 hours prior to digestion and
isolation of the protoplasts. The centrifugation stage for the
enzyme mix has been eliminated. The electroporation buffer and
protoplast isolation media were filter sterilized rather than
autoclaved. The electroporation buffer did not have 4 mM CaCl.sub.2
added. The suspension cells were digested in enzyme for 1 hour.
Protoplasts were counted on a hemacytometer, counting only the
protoplasts that look intact and circular. Bio-rad Gene Pulser
cuvettes (catalog # 165-2088) with a 0.4-cm gap and a maximum
volume of 0.8 mL were used for the electroporations. Fifty to 100
.mu.g of DNA containing the gene of interest along with 5 .mu.g of
internal control DNA containing the luciferase gene were added per
cuvette. The final protoplast density at electroporation was
2.times.10.sup.6/mL and electroporater settings were a 500
.mu.Farad capacitance and 140 volts on the Bio-rad Gene Pulser.
Protoplasts were put on ice after resuspension in electroporation
buffer and remained on ice in cuvettes until 10 minutes after
electroporation. Protoplasts were added to 7 mL of Txd media+0.4 M
mannitol and conditioning media after electroporation. At this
stage coconut water was no longer used. The protoplasts were grown
in 1-hour day/night photoperiod regime at 26.degree. C. and were
spun down and assayed or frozen 20-24 hours after
electroporation.
[0103] Western blot analysis performed on the protoplast extracts,
obtained after transformation, showed processing into the mature
FDA in the tobacco protoplasts. Expression was detected of a
protein migrating at approximately 40 kDa, which is the molecular
weight of the aldolase subunit and the size of the protein also
observed after overexpression of the aldolase in E. coli.
[0104] The expression cassette [P-FMV/CTP1/fda/NOS3'] was
subsequently cloned into the NotI site of pMON17227 (described in
PCT Publication WO 92/04449), in the same orientation as the
selectable marker expression cassette, to form the plant
transformation vector pMON17524, as shown in FIG. 2 (SEQ ID NO:
5).
[0105] An additional construct was made and used for tobacco
protoplast transformation, fusing the fda gene to the Arabidopsis
EPSPS transit peptide (CTP2), which is described in U.S. Pat. No.
5,463,175. The transit peptide was cloned (through the SphI site)
into the SphI site located immediately upstream from the N-terminus
of the fda gene sequence in the CTP1-fda fusion (described above).
This new CTP2-fda fusion gene was then cloned into a vector between
the FMV promoter and the NOS 3' sequences. When this construct
containing the CTP2/fda gene sequences was used for tobacco
protoplast transformation, expression was detected of a protein
migrating at approximately 40 kDa, which is the molecular weight of
the aldolase subunit and the size of the protein also observed
after overexpression of the aldolase in E. coli.
[0106] The NotI cassette [P-FMV/CTP2/fda/NOS3'] from this construct
was then cloned into the NotI site of pMON17227, in the same
orientation as the selectable marker expression cassette, to form
the plant transformation vector pMON17542, which is shown in FIG. 3
(SEQ ID NO:6).
[0107] For cytoplasmic expression of the FDA in tobacco
protoplasts, a construct was made in which the fda gene sequence
(without being coupled to a transit peptide) was cloned into a
vector backbone, between the FMV promoter and the NOS 3' sequences.
Using this construct for tobacco protoplast transformation also
showed expression of a protein of the same size, migrating at
approximately 40 kDa.
[0108] fda Expression in Tobacco Plants
[0109] Two constructs, containing the fda gene, fused to the
Arabidopsis small subunit CTP1 (pMON17524) (SEQ ID NO:5, FIG. 2)
and the Arabidopsis EPSPS (CTP2) transit peptide (pMON17542) (SEQ
ID NO:6, FIG. 3), were used for tobacco plant transformation, as
described in U.S. Pat. No. 5,463,175. A vector without the CTP-fda
sequences, pMON17227 (described in PCT Publication WO 92/04449),
was used as a negative control. The plant transformation vectors
were mobilized into the ABI Agrobacterium strain. Mating of the
plant vector into the ABI strain was done by the triparental
conjugation system using the helper plasmid pRK2013 (Ditta et al.,
1980).
[0110] Growth chamber-grown tobacco transformant lines were
generated and first screened by Western blot analysis to identify
expressors using goat antibody raised against E.coli-expressed fda.
Subsequently, for pMON17524-expressing tobacco lines, leaf
nonstructural carbohydrates were analyzed (sucrose, glucose, and
hydrolyzed starch into glucose) by means of a YSI Instrument, Model
2700 Select Biochemistry Analyzer. Starting at flowering stage,
leaf samples were also taken from these plants and analyzed for
diurnal changes in leaf nonstructural carbohydrates.
[0111] Five hundred milligrams to 1 g fresh tobacco leaf tissue
samples were harvested and extracted in 5 mL of hot Na-phosphate
buffer (40 g/L NaH.sub.2PO.sub.4 and 10 g/L Na.sub.2H.sub.2PO.sub.4
in double de-ionized water) by homogenization with a Polytron. Test
tubes were then placed in an 85.degree. C. water bath for 15
minutes. Tubes were centrifuged for 12 minutes at 3000 rpm and the
supernatants saved for soluble sugar analysis. The pellet was
resuspended in 5 mL of hot Na-phosphate buffer mixed with a Vortex
and centrifuged as described above. The supernatant was carefully
removed and added to the previous supernatant fraction for soluble
sugar (sucrose and glucose) analysis by YSI using appropriate
membranes.
[0112] The starch was extracted from the pellet using the Megazyme
Kit (Megazyme, Australia). To the pellet, 200 .mu.L of 50% ethanol
and 3 mL of thermostable alpha-amylase (300U) were added and the
mixture vortexed. Samples were then incubated in boiling water for
6 minutes and stirred after 2 and 4 minutes. Tubes were placed in
50.degree. C. water bath and 4 mL of 200 mM acetate buffer (pH 4.5)
were added followed by 0.1 mL amyloglucosidase (20 U). Incubation
occurred for 1 hour. Test tubes were then centrifuged for 15
minutes at 3000 rpm. Aliquots were taken from the supernatant and
analyzed for glucose by YSI. The free glucose was adjusted to
anhydrous glucose (as it occurs in starch by multiplying by the
ratio 162/182). The total volume per tube was 7.1 mL.
[0113] As seen in Table 1, expression of the fda gene in tobacco
correlated with a significant increase in leaf starch levels.
However, referring to FIG. 4, when a diurnal profile of starch
levels was established in the fda-expressing leaves, this increase
was apparent mainly early in the photoperiod, which is a phase when
leaves are known to have peak photosynthetic activity. This
increase in starch has no apparent negative effect on the plant
because the increased starch is turned over during the dark period.
There was no apparent increase in steady state levels of sucrose or
glucose in tobacco leaves expressing E.coli fda as compared to the
control.
1TABLE 1 Leaf Carbohydrate Levels of Plants Expressing the fda
Transgene.sup.1 (pMON17524) High Expressors Low Expressors
(>0.01% (<0.01%) Negative total protein) (mg/g fresh weight)
Control STARCH 35.08 .+-. 2.84 23.25 .+-. 3.20 16.69 .+-. 2.92
SUCROSE 0.97 .+-. 0.17 0.86 .+-. 0.25 0.66 .+-. 0.19 GLUCOSE 1.88
.+-. 0.17 1.58 .+-. 0.20 1.68 .+-. 0.26 .sup.1Leaf samples were
harvested at midday.
[0114] A second set of transgenic tobacco plants transformed with
the construct pMON17542 were grown in the greenhouse. Tobacco
plants containing a vector without the CTP-fda sequences,
pMON17227, were used as negative control. Of all the
pMON17542-lines screened for expression by Western blot analysis,
18 were high expressors (>0.01% of the total cellular protein)
and 15 lines were low expressors (<0.01%). Fifteen plants
containing the null vector, pMON17227, were used as control. Fully
expanded leaves from plants expressing the fda transgene and
negative controls were tested for sucrose export by collecting
phloem exudate from excised leaf systems. The phloem exudation
technique is described in Groussol et al. (1986). Leaves were
harvested at 11:30 AM and placed in an exudation medium, containing
5 mM EDTA at pH 6.0, and allowed to exude for a period of 4 hours
under full light and high humidity. The exudation solution was
immediately analyzed for sucrose level, as described above in the
carbohydrate analysis method. As seen in Table 2, a significant
increase in sucrose export out of source leaves was observed in
plants expressing the fda transgene.
[0115] This increase in sucrose export by fda-expressing leaves is
an illustration of an increase in source capacity, very likely due
to an increased carbon flow through the Calvin Cycle (in response
to increased triose-P utilization) and thus an increase in net
carbon utilization by the leaf. As seen in Table 2, the increase in
sucrose loading in the phloem correlates with the level of fda
expression.
2TABLE 2 Levels of Sucrose in Phloem Exudate from Excised Leaves of
fda Transgenic Tobacco Plants (pMON17542) Water uptake sucrose in
phloem exudate (.mu.l/g F .multidot. Wt./h) (ng/leaf) (ng/g F
.multidot. Wt.) fda high expressors 320 .+-. 20 330 .+-. 60 108
.+-. 22 fda low expressors 340 .+-. 10 210 .+-. 10 77 .+-. 3
Control 390 .+-. 30 160 .+-. 10 56 .+-. 3
[0116] Referring to Table 3, preliminary analysis of plant growth
and development revealed no significant differences in number of
leaves or pods per plant, plant height, stem diameter, or apparent
seed weight per plant, between plants expressing the fda gene and
the vector control under the specific growing and analysis
conditions. However, as seen in Table 4, the fda-transgenic plants
had a significantly higher root mass. This may be an indication
that, under these conditions, roots represented a more dominant
sink that attracted excess carbohydrate produced by the source
leaves. Furthermore, the present illustration shows that the
increase in root mass in the presence of the E.coli fda gene was
accomplished with no apparent negative effect on shoot growth,
inflorescence, or seed set. Therefore, this increase in root growth
and final root dry weight is a desirable plant trait because it
would lead to a rapid seedling establishment following germination
and greater plant ability to tolerate drought, cold stress, other
environmental challenges, and transplanting. In different plants
and under different growing conditions, other plant parts (such as
seed, fruit, stem, leaf, tuber, bulb, etc.) are expected to show
the weight increase observed in tobacco roots overexpressing the
fda transgene.
3TABLE 3 Assessment of Certain Plant Growth and Development
Parameters in Tobacco Expressing the fda Transgene.sup.1
(pMON17542) # pods/ # leaves/ Plant height Seed weight plant plant
(cm) (g/plant) high expressors 162 .+-. 40 25.4 .+-. 0.8 65.3 .+-.
3.1 18.8 .+-. 2.4 Control 156 .+-. 28 24.4 .+-. 0.5 65.8 .+-. 5.1
17.3 .+-. 2.6 .sup.1To achieve this analysis, 14 high-expressor
lines were compared to 15 control plants. Measurements were made
prior to seed harvest (most pods have reached maturity). The number
of leaves was confirmed by counting the number of nodes to account
for leaf drop.
[0117]
4TABLE 4 Tobacco Root Dry Weight of Plants Expressing the E. coli
fda Transgene.sup.1 (pMON17542) Root Dry Weight (g/plant) fda high
expressors 64.0 .+-. 3.9 fda low expressors 62.7 .+-. 5.4 Control
31.7 .+-. 1.6 .sup.1Roots from 5 high and 7 low expressing lines
and 6 control plants were excised and washed carefully then placed
in a 65.degree. C. drying oven for at least 48 hours. Roots were
removed from the oven and allowed to equilibrate in the laboratory
for 2 hours before dry weight determination.
Example 3
[0118] Plant Transformation and fda Expression in Corn Plants
[0119] Targeting of FDA Protein
[0120] Vectors containing the fda gene with and without the plastid
targeting peptide were made for transformation in corn and are also
suitable for other monocots, including rice, wheat, barley,
sugarcane, triticale, etc.
[0121] For the cytosolic expression of the fda gene in corn plants,
a construct was made in which the fda gene sequence was fused to
the backbone of a vector containing the enhanced CaMV 35S promoter
(e35S; Kay et al., 1987), the HSP70 intron (U.S. Pat. No.
5,593,874), and the NOS3' polyadenylation sequence (Fraley et al.,
1983). This created a NotI cassette [P-e35S/HSP70 intron/fda/NOS3']
that was cloned into the NotI site of pMON30460, a monocot
transformation vector, to form the plant transformation vector
pMON13925, as shown in FIG. 5. pMON30460 contains an expression
cassette for the selectable marker neomycin phosphotransferase
typeII gene (nptII) [P-35S/NPTII/NOS3'] and a unique NotI site for
cloning the gene of interest. The final vector (pMON13925) was
constructed so that the gene of interest and the selectable marker
gene were cloned in the same orientation. A vector fragment
containing the expression cassettes for these gene sequences could
be excised from the bacterial selector (Kan) and ori, gel purified,
and used for plant transformation.
[0122] For the chloroplast-targeted expression of the fda gene in
corn plants, a construct was made in which the fda gene sequence,
coupled to the maize RUBISCO small subunit CTP (Russell et al.,
1993), was fused to the backbone of a vector containing the
enhanced (CaMV) 35S promoter, the HSP70 intron, and the NOS3'
polyadenylation sequences. This created a NotI cassette
[P-e35S/HSP70 intron/mzSSuCTP/fda/NOS3'] that was cloned into the
NotI site (in the same orientation as the selectable marker
cassette [P-35S/NPTII/NOS3']) of the monocot transformation vector
pMON30460, to form the vector pMON17590, as shown in FIG. 6. From
this vector a fragment containing the fda gene expression cassette
and the selectable marker cassette could be excised from the
bacterial selector (Kan) and ori, gel purified, and used for plant
transformation.
[0123] For the cytosolic endosperm-specific expression of the
aldolase gene in corn, the fda gene sequence was cloned into a
vector (in the same orientation as the selectable marker
cassette[P-35S/NPTII/NOS3']) containing the glutelin gene promoter
P-osgt1 (Zheng et al., 1993), the HSP70 intron, and the NOS3'
polyadenylation sequences to form the vector pMON13936, as shown in
FIG. 7. From this vector a fragment containing the fda gene
expression cassette [P-osgt1/HSP70intron/fda/NOS3'] and the
selectable marker cassette could be excised from the bacterial
selector (Kan) and ori, gel purified, and used for plant
transformation.
[0124] Maize Plant Transformation
[0125] Transgenic maize plants transformed with the vectors
pMON13925 (described above) or pMON17590 (described above) were
produced using microprojectile bombardment, a procedure well-known
to the art (Fromm, 1990; Gordon-Kamm et al., 1990; Walters et al.,
1992). Embryogenic callus initiated from immature maize embryos was
used as a target tissue. Plasmid DNA at 1 mg/mL in TE buffer was
precipitated onto M10 tungsten particles using a calcium
chloride/spermidine procedure, essentially as described by Klein et
al. (1988). In addition to the gene of interest, the plasmids also
contained the neomycin phosphotransferase II gene (nptII) driven by
the 35S promoter from Cauliflower Mosaic Virus. The embryogenic
callus target tissue was pretreated on culture medium osmotically
buffered with 0.2M mannitol plus 0.2M sorbitol for approximately
four hours prior to bombardment (Vain et al., 1993). Tissue was
bombarded two times with the DNA-coated tungsten particles using
the gunpowder version of the BioRad Particle Delivery System (PDS)
1000 device. Approximately 16 hours following bombardment, the
tissue was subcultured onto a medium of the same composition except
that it contained no mannitol or sorbitol, and it contained an
appropriate aminoglycoside antibiotic, such as G418", to select for
those cells that contained and expressed the 35S/nptII gene.
Actively growing tissue sectors were transferred to fresh selective
medium approximately every 3 weeks. About 3 months after
bombardment, plants were regenerated from surviving embryogenic
callus essentially as described by Duncan and Widholm (1988).
[0126] Aldolase Activity From Transgenic Maize
[0127] In order to measure leaf aldolase activity, corn leaf
samples were taken and immediately frozen on dry ice. Aldolase
enzyme was extracted from the leaf tissue by grinding the leaf
tissue at 4.degree. C. in 1.2 mL of the extraction buffer (100 mM
Hepes, pH 8.0, 5 mM MgCl.sub.2, 5 mM MnCl.sub.2, 100 mM KCl, 10 mM
DTT, 1% BSA, 1 mM PMSF, 10 .mu.g/mL leupeptin, 10 .mu.g/mL
aprotinin). The extract was centrifuged at 15,000.times.g, at
4.degree. C. for 3 minutes, and the non-desalted supernatant was
assayed for enzyme activity. This extraction method gave about 60%
recovery of E. coli FDA activity.
[0128] Total aldolase activity was determined in 0.98 mL of
reaction mixture that consisted of 100 mM EPPS-NaOH, pH 8.5, 1 mM
fructose-bisphosphate, 0.1 mM NADH, 5 mM MgCl.sub.2, 4 units of
alpha-glycerophosphate dehydrogenase, and 15 units of
triosephosphate isomerase. The reaction was initiated by addition
of 20 .mu.L of leaf extract. The resulting data, generated from a
single experiment, are presented in Table 5.
5TABLE 5 Aldolase Activity from Transgenic Maize Leaves Lines
A340/min/20 .mu.L Activity % H99 (control) 0.113 100 pMON 17590
0.233 206 pMON13925 0.251 222
[0129] A phenotype was visible in the primary transformants (RO
plants) expressing the E. coli FDA when the protein was targeted to
the chloroplast. The leaves were chlorotic but seed set was normal.
R1 plants were grown in both field and in greenhouse experiments.
Starch was not detectable in the leaves using an iodine staining
and pollination was delayed. It is believed that the phenotype in
these corn plants may be the result of the promoter (e35S) used in
both the pMON17590 and pMON13925 vectors not being preferred for
causing FDA expression in corn. Because e35S is believed to cause
mesophyll enhanced expression and the Calvin Cycle in a C4 plant
such as corn occurs predominantly in the bundle sheath cells, the
use of a promoter directing enhanced expression in the bundle
sheath cells (such as the ssRUBISCO promoter) may be preferred.
Vectors containing such a promoter and driving expression of FDA
have been prepared and are being tested in maize.
[0130] In particular, the maize RuBISCO small subunit (PmzSSU, a
bundle sheath cell-specific promoter) has been used to construct
vectors for cell-specific fda expression in maize. A class I
aldolase (fdaI), an fda without an iron sulfur cluster and with
different properties from fdaII, was utilized to improve carbon
metabolism in C4 crops (e.g. maize). The gene for the class I
aldolase was amplified from the genome of Staphylococcus aureus and
activity was comfirmed. Transformation vectors were then
constructed to express both classes of aldolase (fdaI and fdaII) in
a cell-specific manner in maize. The following cassettes have been
made:
[0131] pMON13899: PmzSSU/hsp70/mzSSU CTP/fdaI
[0132] pMON13990PmzSSU/hsp70/mzSSU CTP/fdaII
[0133] pMON13988:P35S/hsp70/fdaI.
[0134] These vectors were used for corn transformation as described
generally above. The biochemical and physiological analysis of the
primary transformants should allow for the identification of
aldolase gene overexpression that will lead to increase growth and
development and yield in maize.
[0135] Also, two vectors were used for transformation of corn which
would target the expression of the E. coli fda II gene in the maize
endosperm. The vector pMON 13936 uses the rice gt1 promoter to
drive expression of aldolase in the cytoplasm of the endosperm
cells. Another vector (pMON 36416) uses the same promoter with the
maize RuBISCO small subunit transit peptide to localize the protein
in the amyloplasts. Homozygous lines of the cytosolic aldolase
transformants have been identified (Homozygosity of 37 plants was
confirmed using western blot analysis) and seed from these plants
were collected for grain composition analysis (moisture, protein,
starch, and oil). Of the 53 pMON 36416 primary transformants
screened for amylopast-targeted aldolase expression, 11 were
positive. These plants will be tested for homozygosity
selection/propagation and kernels from the homozygotes will be used
for composition analysis.
Example 4
[0136] Plant Transformation and fda Expression in Potato Plants
[0137] Targeting of fda Expression
[0138] The plant expression vector, pMON17542 (described earlier),
in which the fda gene is expressed behind the FMV promoter and the
aldolase enzyme is fused to the chloroplast transit peptide CTP2,
was used for Agrobacterium-mediated potato transformation.
[0139] A second potato transformation vector was constructed by
cloning the NotI cassette [P-FMV/CTP2/fda/NOS3'] (described
earlier) into the unique NotI site of pMON23616. pMON23616 is a
potato transformation vector containing the nopaline-type T-DNA
right border region (Fraley et al., 1985), an expression cassette
for the neomycin phosphotransferase typeII gene [P-35S/NPTII/NOS3']
(selectable marker), a unique NotI site for cloning the gene
expression cassette of interest, and the T-DNA left border region
(Barker et al., 1983). Cloning of the NotI cassette
[P-FMV/CTP2/fda/NOS3'] (described earlier) into the NotI site of
pMON23616 results in the potato transformation vector pMON17581, as
shown in FIG. 8. The vector pMON17581 was constructed such that the
gene of interest and the selectable marker gene were transcribed in
the same direction.
[0140] Potato Plant Transformation
[0141] The plant transformation vectors were mobilized into the ABI
Agrobacterium strain. Mating of the plant vector into the ABI
strain was done by the triparental conjugation system using the
helper plasmid pRK2013 (Ditta et al., 1980). The vector pMON17542
was used for potato transformation via Agrobacterium transformation
of Russet Burbank potato callus, following the method described in
PCT Publication WO 96/03513 for glyphosate selection of transformed
lines.
[0142] After transformation with the vector pMON17542, transgenic
potato plantlets that came through selection on glyphosate were
screened for expression of E. coli aldolase by leaf Western blot
analysis. Out of 112 independent lines assayed, 50 fda-expressing
lines (45%) were identified, with fda expression levels ranging
between 0.12% and 1.2% of total extractable protein.
[0143] The plant transformation vector pMON17581 was used for
Agrobacterium-mediated transformation of HS31-638 potato callus.
HS31-638 is a Russet Burbank potato line previously transformed
with the mutant ADPglucose pyrophosphorylase (glgC16) gene from
E.coli (U.S. Pat. No. 5,498,830). The potato callus was transformed
following the method described in PCT Publication WO 96/03513,
substituting kanamycin (administered at a concentration of 150-200
mg/L) for glyphosate as a selective agent.
[0144] The transgenic potato plants were screened for expression of
the fda gene by assaying leaf punches from tissue culture
plantlets. Western blot analysis (using antibodies raised against
the E. coli aldolase) of leaf tissue from the pMON17581-transformed
lines identified 12 expressing lines out of 56 lines screened.
Expression was detected of a protein migrating at approximately 40
kDa, which is the molecular weight of the E. coli (classII)
aldolase subunit and the size of the protein observed after
overexpression of the aldolase in E. coli.
[0145] Specific Gravity Measurements of Transgenic Potato
Plants
[0146] From the 50 fda-expressing potato lines obtained after
transformation with pMON17542, 7 of the highest expressing lines
were micropropagated in tissue culture, and 8 copies of each line
were planted in pots 14 inches in diameter and 12 inches deep,
containing a mixture of: 1/2 Metro 350 potting media, 1/4 fine
sand, 1/4 Ready Earth potting media. Wild-type Russet Burbank
plantlets from tissue culture were planted as controls. All plants
were cultivated for approximately 5 months in the greenhouse in
which daytime temperature was approximately 21-23.degree. C. while
nighttime temperature was approximately 13.degree. C. Plants were
watered every other day throughout their active growing period and
fertilized with Peter's 20-20-20 commercial fertilizer once a week,
at levels similar to commercial applications. Fertilization was
carried out only for the first 21/2 months, at which point
fertilization was stopped completely. Plants were allowed to
naturally senesce, and at approximately 50% senescence, tubers were
harvested.
[0147] For each line at harvest, all tubers from all 8 pots were
pooled and a total weight was obtained. Then for each line, tubers
30 g or greater were pooled and specific gravity was determined on
this group of tubers. Specific gravity is the weight of the tubers
in air divided by the weight in air minus the weight in water.
Results of these weight measurements are presented in Table 6.
6TABLE 6 Specific gravity measurements from transgenic potato
plants Combined Overall Weight % Increase in Combined Weight of
Total % Yield of Tubers Total Weight Tubers over 30 g Specific Line
# Weight Increase over 30 g (Tubers over 30 g) (% of Total Weight)
Gravity RB 6609 4477 67.70% 1.087 40652 5138 neg 1307 neg 25.40%
1.08 40611 7170 8.5% 4533 1.3% 63.20% 1.083 40608 7470 13.0% 1070
neg 14.30% 1.081 40632 7776 21.8% 5453 21.8% 70.10% 1.088 40614
8688 31.5% 5468 22.2% 62.90% 1.083 40631 8800 33.2% 6188 38.2%
70.30% 1.084 40610 9746 47.0% 7777 73.0% 80% 1.087
[0148] This table summarizes the tuber yield and specific gravity
for all seven lines grown in the greenhouse. The results indicate
that, in comparison to the control, all but one of the fda lines
show an increase in overall tuber yield, and that in four lines,
there is a corresponding increase in percentage of tubers that
weigh more than 30 g. For combined tubers over 30 g, the percent of
total weight is near that of the control, and for two lines is
greater than the control. This indicates that five out of the six
of the lines show higher overall yield and are not making smaller
tubers. In other words, with the increase in overall yield, there
is a corresponding increase in percentage of bigger tubers (over 30
g). However, there is no increase in specific gravity of the
tubers.
[0149] In conclusion, it appears that expression of fda in potato
produces greater numbers of tubers per plant without a sacrifice in
tuber size. This represents a yield benefit in that the farmer
could potentially be able to produce the same amount of tubers
using less acreage. Similar experiments will also be performed by
co-expression of fda with other carbohydrate metabolizing genes,
such as glgC16, in order to determine how such combinations will
affect tuber yield, tuber solids deposition and overall tuber
specific gravity.
[0150] Aldolase Activity From Transgenic Potato
[0151] After being cultivated for 3 months (post planting) in the
greenhouse, leaf samples were taken from 6 of the highest
fda-expressing potato lines, obtained after transformation with
pMON17542, and assayed for aldolase activity.
[0152] In order to measure potato leaf aldolase activity, duplicate
leaf samples from each line were taken and immediately frozen on
dry ice. Aldolase was extracted from 0.2 g of leaf tissue by
grinding at 4.degree. C. in 1.2 mL of the extraction buffer: 100 mM
Hepes, pH 8.0, 5 mM MgCl.sub.2, 5 mM MnCl.sub.2, 100 mM KCl, 10 mM
DTT, 1% BSA, 1 mM PMSF, 10 .mu.g/mL leupeptin, 10 .mu.g/mL
aprotinin. The extract was assayed for aldolase activity as
described earlier.
[0153] Six independent transgenic potato lines expressing fda were
tested for aldolase activity. The expression of fda in leaves is an
indicator of the expression in the whole plant because the FMV
promoter used to drive expression of the respective encoding DNAs
directs gene expression constitutively in most, if not all, tissues
of potato plants.
[0154] Table 7 summarizes the quantitative protein expression data
for each of the lines, and the percent activity for each individual
line.
7TABLE 7 Aldolase Activity from Transgenic Russet Burbank Potato
Leaves Exp. #1 Exp. #2 Average Lines Act (U/gFW) % Act Act (U/gFW)
% Act % Activity Control 4.461 100 4.732 100 100 40608 6.969 156
8.055 170 163 40610 8.489 190 7.326 155 173 40652 5.812 130 6.367
135 132 40632 5.257 118 4.244 90 104 40631 5.764 129 4.968 105 117
40611 5.715 128 5.836 123 126
[0155] Solids Uniformity in Transgenic Potato
[0156] Twenty-five Russet Burbank lines expressing fda (potato
lines designated "Maestro"), obtained after transformation with
pMON17542, and fifteen Russet Burbank Simple Solid lines, also
containing glgC16 (PCT Publication WO 91/19806 and U.S. Pat. No.
5,498,830), expressing fda (potato lines designated "Segal"),
obtained after transformation with pMON17581, were field tested at
two different sites. For each field site, 36 plants per line (three
repetitions of 12 plants per line) were evaluated for tuber solids
distribution. At harvest, tubers were pre-sorted at each field site
into a ten to twelve ounce category, and nine tubers from each
replicated plot were analyzed in groups of three.
[0157] For a typical 10-12 ounce tuber having a diameter of 7-8 cm,
starch distribution was evaluated by removing the center
longitudinal slice (13 mm) from each tuber. Slices were then peeled
and laid flat on a cutting board where the inner tuber region (pith
region) was removed by a 14-mm cork punch. The tissue from pith to
cortex (perimedullary region) was removed by an up-to-a 2-inch cork
punch. The remaining cortex tissue was approximately an 8-mm wide
ring from the outermost region of the slice.
[0158] Specific gravity was then determined by weighing both the
pooled pith punches and pooled cortex punches in air and then in
water:
[0159] Specific gravity=Air Wt./(Air Wt.-Water Wt.)
[0160] After calculating specific gravity, solids levels were
determined by the following equation:
[0161] -214.9206+(218.1852*Sp. Gravity)
[0162] The degree of solids uniformity (Solids Uniformity Index) is
determined by calculating the pith to cortex solids ratio (pith
solids divided by cortex solids). The three groups of three tubers
per plot were averaged, at which point the average of three plot
replications was calculated per field site.
[0163] Analyses of several previous solids uniformity field trials
(data not shown) have demonstrated nontransgenic, wild-type Russet
Burbank potato to have a typical pith to cortex tuber solids ratio
within the range of 68% to 72%, depending on growing region and
agricultural practices. Tables 8-11 provide the pith to cortex
solids ratios by plant line number, with a higher pith to cortex
solids ratio indicating a greater degree of solids uniformity.
[0164] Tables 8 and 9 represent the data from one field site (site
1) for Segal and Maestro, respectively, and illustrate that the
majority of Segal and Maestro lines have higher pith to cortex
solids ratios than that of 68.4% for the Russet Burbank control,
with some lines approaching an 82% pith to cortex solids ratio.
[0165] Tables 10 and 11 represent the data from another field site
(site 2) for Segal and Maestro, respectively, and also illustrate
that the majority of Maestro and Segal lines have higher pith to
cortex solids ratios than that of the Russet Burbank control, with
some lines approaching an 88% pith to cortex solids ratio. In the
site 2 field trial, the Russet Burbank control had an atypical,
abnormally high pith-to-cortex solids uniformity ratio of 79.3%,
which was most likely due to environmental growing conditions. The
site 2 results demonstrate that expression in Russet Burbank potato
of E. coli fda, alone or with co-expression of glgC16, increases
tuber solids uniformity even in a growing season when tuber solids
uniformity is already extremely high in nontransgenic Russet
Burbank. That is, the fda gene continues to perform when
agricultural conditions are already conducive to an abnormally high
solids uniformity level.
8TABLE 8 Solids Uniformity Index: Pith Solids to Cortex Solids
Ratio. Segal Russet Burbank Lines. Site 1 Line Ratio S-29 79.1 S-9
75.8 S-20 71.3 S-15 71.3 S-21 70.5 S-5 70.2 S-18 70.0 RB control
68.4 S-32 68.3 S-16 65.6
[0166]
9TABLE 9 Solids Uniformity Index: Pith Solids to Cortex Solids
Ratio. Maestro Russet Burbank Lines. Site 1 Line Ratio M-13 74.0
M-12 73.6 M-1 73.4 M-3 73.0 M-6 72.4 M-9 71.2 M-11 70.6 M-18 70.5
M-17 69.9 M-19 69.4 M-5 69.3 M-20 68.9 RB control 68.4 M-8 68.3
M-43 67.7 M-23 67.3 M-7 67.0 M-39 66.6 M-22 66.0 M-10 65.4 M-27
61.4
[0167]
10TABLE 10 Solids Uniformity Index: Pith Solids to Cortex Solids
Ratio Segal Russet Burbank Lines. Site 2 Line Ratio S-33 87.4 S-54
87.1 S-05 86.8 S-29 85.1 S-21 84.3 S-16 83.2 S-20 81.5 S-18 80.7
S-32 80.6 RB control 79.3 S-09 79.0
[0168]
11TABLE 11 Solids Uniformity Index: Pith Solids to Cortex Solids
Ratio Maestro Russet Burbank Lines. Site 2 Line Ratio M-04 87.7
M-18 83.9 M-17 83.8 M-03 83.7 M-09 83.4 M-15 83.2 M-29 82.9 M-44
82.3 M-08 82.2 M-43 81.6 M-22 81.1 M-05 80.8 M-01 80.5 M-20 80.2
M-45 79.6 M-39 79.5 M-27 79.5 RB control 79.3 M-13 78.9 M-22 78.8
M-19 78.7 M-07 78.2 M-12 77.9 M-23 77.3 M-06 76.5 M-10 75.0 M-11
74.1
[0169] The effect of aldolase on pith to cortex solids ratios in
the Segal lines is slightly more dramatic than in Maestro lines. We
believe this phenotype is due to expression of fda in a background
in which the Russet Burbank host expresses glgC16 at a relatively
low to moderate level, and that the combination of fda plus glgC16
provides improved benefits. Cross sectional tuber slices (FIG. 9)
of three Segal lines with improved solids uniformity illustrate a
greater deposition of starch within the inner regions of the tuber.
Specifically, an increase in cortex volume accompanied by
relocation of the xylem ring towards the center of the tuber, plus
a more opaque pith tissue due to an increase in starch density, are
evident in the transgenic lines. This physiological alteration may
be due to an increase in sucrose translocation from source to sink,
which may influence phloem element distribution during tuber
development or sucrose availability for starch biosynthesis across
the tuber.
Example 5
[0170] Plant Transformation and FDA Expression in Cotton Plants
[0171] The E. coli fda vectors pMON17524 [FMV/CTP1/fda] (FIG. 2)
and pMON17542 [FMV/CTP2/fda] (FIG. 3) were transformed into cotton
using Agrobacterium as described by Umbeck et al. (1987) and in
U.S. Pat. No. 5,004,863. The protein was targeted to the
chloroplast using either the Arabidopsis SSU CTP 1 (pMON17524) or
the Arabidopsis EPSPS (pMON17542) chloroplast transit peptide.
[0172] Aldolase Expression in Cotton
[0173] Five-week-old calli transformed with both vectors were
analyzed by Western blot analyses and by aldolase assays. Western
blot analysis indicated a large amount of protein at the position
of the full-length FDA standard and a lesser amount at the same
position in the control callus extracts. It appeared that the
protein was fully processed. To verify that FDA was expressed in
the tissue and for comparison of activity, calli transformed with
the two vectors were extracted in a buffer that would prevent loss
of activity of the transgene product. BSA was added to final
concentration of 1 mg/mL, which limited the analysis of processing
on import by Western blot. Aldolase assays were performed plus or
minus 25 mM EDTA, which inhibits the E. coli enzyme but not the
plant enzyme. The results of the assays are shown in Table 12.
12TABLE 12 Aldolase Activity in Cotton Calli and Cotton Leaf
.DELTA. A340 e.sup.-3/mg protein/5 min Colony # - EDTA + EDTA Fold
Increase Controls Cotton Leaf (Coker) 4.0 4.2 -- Uninoculated Calli
7.7 5.6 1.3X Inoculated Calli (E35S/GUS) #1 6.8 6.1 -- #2 3.5 4.0
-- FDA calli pMON 17542 #1 3.5 2.3 1.5X #3 5.5 2.6 2.1X #5 9.2 3.8
2.4X #4 19.8 3.6 5.5X pMON17524 #2 15.2 5.8 2.6X #3 12.5 4.0 3.1X
#5 14.4 2.9 4.9X #6 4.1 1.2 3.5X
[0174] The results indicate that there is good expression of the
fda gene in cotton callus. Almost all calli had at least twofold
higher aldolase activity, and the increase was sensitive to
inhibition by EDTA. Processing appeared complete by Western blot
analysis using these samples.
REFERENCES CITED
[0175] Alefounder et al. (1989) Biochem. J. 257:529-534
[0176] Ammirato et al. (1984) Handbook of Plant Cell Culture--Crop
Species. Macmillan Publ. Co.
[0177] Bai et al. (1975) Arch. Biochem. Biophys. 168: 230-234.
[0178] Baldwin et al. (1978) Biochem. J. 169: 633-641
[0179] Barker et al. (1983) Plant Mol Biol 2 (6): 335-350.
[0180] Benfey et al. (1989) EMBO J, 5: 2195-2202.
[0181] Besmond et al. (1983) Biochem. Biophys. Res. Commun. 117,
601-609.
[0182] Bevan (1984) Nucleic Acids Res. 12 (22): 8711-8721.
[0183] Bevan et al. (1986) Nucleic Acids Res. 14
(11):4625-4638.
[0184] Campbell et al. (1994) Canadian Journal of Forest Research
24 (8): 1689-1693.
[0185] Cerdan et al. (1997) Plant Molecular Biology 33 (2):
p245-255.
[0186] Chopra et al. (1990) Plant Molecular Biology 15:517-520.
[0187] Clayton (1985) EMBO J. 4, 2997-3003.
[0188] Cremona (1968) G. Bot. Ital. 102, 253-259.
[0189] Daniell et al. (1998) Nature Biotechnology 16:345-348.
[0190] Datta et al. (1990) Bio-technology 8:736-740.
[0191] Ditta et al. (1980) Proc Natl Acad Sci USA 77(12):
7347-7351.
[0192] Duncan and Widholm (1988) Plant Cell Reports 7: 452-455.
[0193] Edwards et al. (1990). Proc Natl Acad Sci USA 87 (9):
p3459-3463.
[0194] Fejes et al. (1990). Plant Mol Biol 15 (6): p921-932.
[0195] Fraley et al. (1983) Proc Natl Acad Sci USA 80:
4803-4807.
[0196] Fraley et al. (1985) Bio/Technology 3 (7): 629-635.
[0197] Fromm, M., (1990) UCLA Symposium on Molecular Strategies for
Crop Improvement, Apr. 16-22, 1990. Keystone, Colo.
[0198] Fromm et al. (1987) Methods in Enzymology. 153:351-366.
[0199] Gordon-Kamm et al. (1990) Plant Cell 2: 603-618.
[0200] Gotz et al. (1979) FEMS Microbiol. Lett. 5:253-257.
[0201] Gowda et al. (1989). Journal of Cellular Biochemistry
supplement 13D, 301 (Abstract).
[0202] Groussol et al. (1986) Physiologie Vegetale
24(1):123-134.
[0203] Guerrini et al. (1971) Arch. Biochem. Biophys. 146,
249-255.
[0204] Hannapel (1990) Plant Physiol. 94: 919-925.
[0205] Hayashimoto et al. (1990) Plant Physiol. 93:857-863.
[0206] Herrera-Estrella et al. (1983) Nature 303:209.
[0207] Hinchee et al., Bio/Technology 6:915-922 (1988).
[0208] Horsch and Klee. (1986) Proc. Natl. Acad. Sci. U.S.A.
83:4428-4432.
[0209] Jack (1973) Ph.D. Dissertation, University of Cambridge.
[0210] Jack and Harris (1971) Biochem. J. 124, 680-690.
[0211] Jefferson et al. (1990) Plant Mol. Biol. 14: 995-1006.
[0212] Joh et al. (1986) J. Mol. Biol. 190:401-410.
[0213] Kay et al. (1987) Science 236: 1299-1302.
[0214] Klee et al. (1985) Bio-Technology 3(7): 637-642.
[0215] Klein et al. (1988) Bio/Technology 6: 559-563.
[0216] Kretsch et al. (1995) Plant Journal 7 (5): p715-729.
[0217] Lai et al., (1974) Science 183, 1204-1206.
[0218] Lebherz and Rutter (1973) J. Biol. Chem. 248:1650-1659.
[0219] Lebherz et al (1984) J. Biol. Chem. 259 (2):1011-1017.
[0220] Leyva et al. (1995) Plant Physiology 108(1):39-46.
[0221] London and Kline (1973) Bacteriol. Rev. 37:453-478.
[0222] Lloyd et al. (1991). Mol. Gen. Genet. 225 (2):209-216.
[0223] Luan et al. (1992). Plant Cell 4 (8):971-981.
[0224] Luebberstedt et al. (1994) Plant Physiology 104
(3):997-1006.
[0225] Maniatis et al. (1982) Molecular Cloning: A laboratory
manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.
[0226] Matsuoka et al. (1993). Proc. Natl. Acad. Sci. U.S.A.
90(20):9586-9590.
[0227] Mignery et al (1988) Gene 62:27-44.
[0228] Muller et al (1990) Mol. Gen. Genet. 224:136-146.
[0229] Oelmueller et al. (1992). Res. Photosynth. Proc. Int. Congr.
Photosynth., 9th, Volume 3: p219-24. Editor(s): Murata, Norio.
Publisher: Kluwer, Dordrecht, Neth.
[0230] Pedersen et al. (1982) Cell 29:1015-1026.
[0231] Potrykus et al. (1985), Mol. Gen. Genet. 199:183-188.
[0232] Rocha-Sosa et al. (1989) EMBO J. 8 (1):23-29.
[0233] Rogers et al. (1987) Improved vectors for plant
transformation: expression cassette vectors and new selectable
markers. In Methods in Enzymology. Edited by R. Wu and L. Grossman.
p253-277. San Diego: Academic Press.
[0234] Rohde et al. (1990) J. Genet. & Breed. 44:311-315.
[0235] Russell et al. (1993) Plant Cell Reports 13:24-27.
[0236] Russell and Fromm (1997) Transgenic Research 6
(2):157-168.
[0237] Russel and Gibbs (1967) Biochim. Biophys. Acta 132,
145-154
[0238] Salanoubat and Belliard (1987) Gene 60:47-56.
[0239] Salanoubat and Belliard (1989) Gene 84:181-185.
[0240] Samac et al. (1990) Plant Physiol. 93:907-914.
[0241] Sambrook et al. (1989) Molecular cloning: A laboratory
manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.
[0242] Schmidhauser and Helinski. (1985) J. Bacteriol. 164-155.
[0243] Sonnewald et al. (1994) Plant Cell and Environment
17:649-658.
[0244] Stalker et al. (1988) J. Biol. Chem. 263:6310-6314.
[0245] Stark et al. (1992) Science 258: 287-292.
[0246] Stockhaus et al. (1989). EMBO Journal 8(9):2445-2451.
[0247] Stribling and Perham (1973) Biochem. J. 131:833-841.
[0248] Suzuki et al. (1994) Plant Mol. Biol. 25(3):507-516.
[0249] Thillet et al. (1988) J. Biol. Chem. 263:12500-12508.
[0250] Thompson et al. (1994) Nucl. Acids Res. 22:4673-4680.
[0251] Tierney et al. (1987) Planta 172:356-363.
[0252] Truernit et al. (1995) Planta 196 (3):564-570.
[0253] Tsutsumi et al. (1984) J. Biol. Chem. 259, 14572-14575.
[0254] Umbeck et al. (1987) Biotechnology. 5, 263-266.
[0255] Vain et al. (1993) Plant Cell Reports 12: 84-88.
[0256] Vasil et al. (1990) Bio/Technology 8:429-434.
[0257] Vasil et al. (1992) Bio/Technology 10:667-674.
[0258] Walters et al. (1992) Plant Molecular Biology 18:
189-200.
[0259] Witke and Goetz (1993) Journal of Bacteriology 175(22):
7495-7499
[0260] Wong et al. (1988) Gene 68: 193-203.
[0261] Yamamoto et al. (1994) Plant and Cell Physiology
35(5):773-778.
[0262] Zheng et al. (1993) Plant J. 4: 3357-3366.
Sequence CWU 1
1
6 1 1080 DNA E. coli 1 atgtctaaga tttttgattt cgtaaaacct ggcgtaatca
ctggtgatga cgtacagaaa 60 gttttccagg tagcaaaaga aaacaacttc
gcactgccag cagtaaactg cgtcggtact 120 gactccatca acgccgtact
ggaaaccgct gctaaagtta aagcgccggt tatcgttcag 180 ttctccaacg
gtggtgcttc ctttatcgct ggtaaaggcg tgaaatctga cgttccgcag 240
ggtgctgcta tcctgggcgc gatctctggt gcgcatcacg ttcaccagat ggctgaacat
300 tatggtgttc cggttatcct gcacactgac cactgcgcga agaaactgct
gccgtggatc 360 gacggtctgt tggacgcggg tgaaaaacac ttcgcagcta
ccggtaagcc gctgttctct 420 tctcacatga tcgacctgtc tgaagaatct
ctgcaagaga acatcgaaat ctgctctaaa 480 tacctggagc gcatgtccaa
aatcggcatg actctggaaa tcgaactggg ttgcaccggt 540 ggtgaagaag
acggcgtgga caacagccac atggacgctt ctgcactgta cacccagccg 600
gaagacgttg attacgcata caccgaactg agcaaaatca gcccgcgttt caccatcgca
660 gcgtccttcg gtaacgtaca cggtgtttac aagccgggta acgtggttct
gactccgacc 720 atcctgcgtg attctcagga atatgtttcc aagaaacaca
acctgccgca caacagcctg 780 aacttcgtat tccacggtgg ttccggttct
actgctcagg aaatcaaaga ctccgtaagc 840 tacggcgtag taaaaatgaa
catcgatacc gatacccaat gggcaacctg ggaaggcgtt 900 ctgaactact
acaaagcgaa cgaagcttat ctgcagggtc agctgggtaa cccgaaaggc 960
gaagatcagc cgaacaagaa atactacgat ccgcgcgtat ggctgcgtgc cggtcagact
1020 tcgatgatcg ctcgtctgga gaaagcattc caggaactga acgcgatcga
cgttctgtaa 1080 2 359 PRT E. coli 2 Met Ser Lys Ile Phe Asp Phe Val
Lys Pro Gly Val Ile Thr Gly Asp 1 5 10 15 Asp Val Gln Lys Val Phe
Gln Val Ala Lys Glu Asn Asn Phe Ala Leu 20 25 30 Pro Ala Val Asn
Cys Val Gly Thr Asp Ser Ile Asn Ala Val Leu Glu 35 40 45 Thr Ala
Ala Lys Val Lys Ala Pro Val Ile Val Gln Phe Ser Asn Gly 50 55 60
Gly Ala Ser Phe Ile Ala Gly Lys Gly Val Lys Ser Asp Val Pro Gln 65
70 75 80 Gly Ala Ala Ile Leu Gly Ala Ile Ser Gly Ala His His Val
His Gln 85 90 95 Met Ala Glu His Tyr Gly Val Pro Val Ile Leu His
Thr Asp His Cys 100 105 110 Ala Lys Lys Leu Leu Pro Trp Ile Asp Gly
Leu Leu Asp Ala Gly Glu 115 120 125 Lys His Phe Ala Ala Thr Gly Lys
Pro Leu Phe Ser Ser His Met Ile 130 135 140 Asp Leu Ser Glu Glu Ser
Leu Gln Glu Asn Ile Glu Ile Cys Ser Lys 145 150 155 160 Tyr Leu Glu
Arg Met Ser Lys Ile Gly Met Thr Leu Glu Ile Glu Leu 165 170 175 Gly
Cys Thr Gly Gly Glu Glu Asp Gly Val Asp Asn Ser His Met Asp 180 185
190 Ala Ser Ala Leu Tyr Thr Gln Pro Glu Asp Val Asp Tyr Ala Tyr Thr
195 200 205 Glu Leu Ser Lys Ile Ser Pro Arg Phe Thr Ile Ala Ala Ser
Phe Gly 210 215 220 Asn Val His Gly Val Tyr Lys Pro Gly Asn Val Val
Leu Thr Pro Thr 225 230 235 240 Ile Leu Arg Asp Ser Gln Glu Tyr Val
Ser Lys Lys His Asn Leu Pro 245 250 255 His Asn Ser Leu Asn Phe Val
Phe His Gly Gly Ser Gly Ser Thr Ala 260 265 270 Gln Glu Ile Lys Asp
Ser Val Ser Tyr Gly Val Val Lys Met Asn Ile 275 280 285 Asp Thr Asp
Thr Gln Trp Ala Thr Trp Glu Gly Val Leu Asn Tyr Tyr 290 295 300 Lys
Ala Asn Glu Ala Tyr Leu Gln Gly Gln Leu Gly Asn Pro Lys Gly 305 310
315 320 Glu Asp Gln Pro Asn Lys Lys Tyr Tyr Asp Pro Arg Val Trp Leu
Arg 325 330 335 Ala Gly Gln Thr Ser Met Ile Ala Arg Leu Glu Lys Ala
Phe Gln Glu 340 345 350 Leu Asn Ala Ile Asp Val Leu 355 3 30 DNA
Artificial Sequence Oligonucleotide 3 ggggccatgg ctaagatttt
tgatttcgta 30 4 34 DNA Artificial Sequence Oligonucleotide 4
ccccgagctc ttacagaacg tcgatcgcgt tcag 34 5 10846 DNA Artificial
Sequence P-FMV/CTP1/fda/NOS3' 5 cgataagctt gatgtaattg gaggaagatc
aaaattttca atccccattc ttcgattgct 60 tcaattgaag tttctccgat
ggcgcaagtt agcagaatct gcaatggtgt gcagaaccca 120 tctcttatct
ccaatctctc gaaatccagt caacgcaaat ctcccttatc ggtttctctg 180
aagacgcagc agcatccacg agcttatccg atttcgtcgt cgtggggatt gaagaagagt
240 gggatgacgt taattggctc tgagcttcgt cctcttaagg tcatgtcttc
tgtttccacg 300 gcgtgcatgc ttcacggtgc aagcagccgt ccagcaactg
ctcgtaagtc ctctggtctt 360 tctggaaccg tccgtattcc aggtgacaag
tctatctccc acaggtcctt catgtttgga 420 ggtctcgcta gcggtgaaac
tcgtatcacc ggtcttttgg aaggtgaaga tgttatcaac 480 actggtaagg
ctatgcaagc tatgggtgcc agaatccgta aggaaggtga tacttggatc 540
attgatggtg ttggtaacgg tggactcctt gctcctgagg ctcctctcga tttcggtaac
600 gctgcaactg gttgccgttt gactatgggt cttgttggtg tttacgattt
cgatagcact 660 ttcattggtg acgcttctct cactaagcgt ccaatgggtc
gtgtgttgaa cccacttcgc 720 gaaatgggtg tgcaggtgaa gtctgaagac
ggtgatcgtc ttccagttac cttgcgtgga 780 ccaaagactc caacgccaat
cacctacagg gtacctatgg cttccgctca agtgaagtcc 840 gctgttctgc
ttgctggtct caacacccca ggtatcacca ctgttatcga gccaatcatg 900
actcgtgacc acactgaaaa gatgcttcaa ggttttggtg ctaaccttac cgttgagact
960 gatgctgacg gtgtgcgtac catccgtctt gaaggtcgtg gtaagctcac
cggtcaagtg 1020 attgatgttc caggtgatcc atcctctact gctttcccat
tggttgctgc cttgcttgtt 1080 ccaggttccg acgtcaccat ccttaacgtt
ttgatgaacc caacccgtac tggtctcatc 1140 ttgactctgc aggaaatggg
tgccgacatc gaagtgatca acccacgtct tgctggtgga 1200 gaagacgtgg
ctgacttgcg tgttcgttct tctactttga agggtgttac tgttccagaa 1260
gaccgtgctc cttctatgat cgacgagtat ccaattctcg ctgttgcagc tgcattcgct
1320 gaaggtgcta ccgttatgaa cggtttggaa gaactccgtg ttaaggaaag
cgaccgtctt 1380 tctgctgtcg caaacggtct caagctcaac ggtgttgatt
gcgatgaagg tgagacttct 1440 ctcgtcgtgc gtggtcgtcc tgacggtaag
ggtctcggta acgcttctgg agcagctgtc 1500 gctacccacc tcgatcaccg
tatcgctatg agcttcctcg ttatgggtct cgtttctgaa 1560 aaccctgtta
ctgttgatga tgctactatg atcgctacta gcttcccaga gttcatggat 1620
ttgatggctg gtcttggagc taagatcgaa ctctccgaca ctaaggctgc ttgatgagct
1680 caagaattcg agctcggtac cggatccagc tttcgttcgt atcatcggtt
tcgacaacgt 1740 tcgtcaagtt caatgcatca gtttcattgc gcacacacca
gaatcctact gagttcgagt 1800 attatggcat tgggaaaact gtttttcttg
taccatttgt tgtgcttgta atttactgtg 1860 ttttttattc ggttttcgct
atcgaactgt gaaatggaaa tggatggaga agagttaatg 1920 aatgatatgg
tccttttgtt cattctcaaa ttaatattat ttgttttttc tcttatttgt 1980
tgtgtgttga atttgaaatt ataagagata tgcaaacatt ttgttttgag taaaaatgtg
2040 tcaaatcgtg gcctctaatg accgaagtta atatgaggag taaaacactt
gtagttgtac 2100 cattatgctt attcactagg caacaaatat attttcagac
ctagaaaagc tgcaaatgtt 2160 actgaataca agtatgtcct cttgtgtttt
agacatttat gaactttcct ttatgtaatt 2220 ttccagaatc cttgtcagat
tctaatcatt gctttataat tatagttata ctcatggatt 2280 tgtagttgag
tatgaaaata ttttttaatg cattttatga cttgccaatt gattgacaac 2340
atgcatcaat cgacctgcag ccactcgaag cggccgcgtt caagcttgag ctcaggattt
2400 agcagcattc cagattgggt tcaatcaaca aggtacgagc catatcactt
tattcaaatt 2460 ggtatcgcca aaaccaagaa ggaactccca tcctcaaagg
tttgtaagga agaattctca 2520 gtccaaagcc tcaacaaggt cagggtacag
agtctccaaa ccattagcca aaagctacag 2580 gagatcaatg aagaatcttc
aatcaaagta aactactgtt ccagcacatg catcatggtc 2640 agtaagtttc
agaaaaagac atccaccgaa gacttaaagt tagtgggcat ctttgaaagt 2700
aatcttgtca acatcgagca gctggcttgt ggggaccaga caaaaaagga atggtgcaga
2760 attgttaggc gcacctacca aaagcatctt tgcctttatt gcaaagataa
agcagattcc 2820 tctagtacaa gtggggaaca aaataacgtg gaaaagagct
gtcctgacag cccactcact 2880 aatgcgtatg acgaacgcag tgacgaccac
aaaagaattc cctctatata agaaggcatt 2940 cattcccatt tgaaggatca
tcagatactg aaccaatcct tctagaagat ctccacaatg 3000 gcttcctcta
tgctctcttc cgctactatg gttgcctctc cggctcaggc cactatggtc 3060
gctcctttca acggacttaa gtcctccgct gccttcccag ccacccgcaa ggctaacaac
3120 gacattactt ccatcacaag caacggcgga agagttaact gcatgcaggt
gtggcctccg 3180 attggaaaga agaagtttga gactctctct taccttcctg
accttaccga ttccggtggt 3240 cgcgtcaact gcatgcaggc catggctaag
atttttgatt tcgtaaaacc tggcgtaatc 3300 actggtgatg acgtacagaa
agttttccag gtagcaaaag aaaacaactt cgcactgcca 3360 gcagtaaact
gcgtcggtac tgactccatc aacgccgtac tggaaaccgc tgctaaagtt 3420
aaagcgccgg ttatcgttca gttctccaac ggtggtgctt cctttatcgc tggtaaaggc
3480 gtgaaatctg acgttccgca gggtgctgct atcctgggcg cgatctctgg
tgcgcatcac 3540 gttcaccaga tggctgaaca ttatggtgtt ccggttatcc
tgcacactga ccactgcgcg 3600 aagaaactgc tgccgtggat cgacggtctg
ttggacgcgg gtgaaaaaca cttcgcagct 3660 accggtaagc cgctgttctc
ttctcacatg atcgacctgt ctgaagaatc tctgcaagag 3720 aacatcgaaa
tctgctctaa atacctggag cgcatgtcca aaatcggcat gactctggaa 3780
atcgaactgg gttgcaccgg tggtgaagaa gacggcgtgg acaacagcca catggacgct
3840 tctgcactgt acacccagcc ggaagacgtt gattacgcat acaccgaact
gagcaaaatc 3900 agcccgcgtt tcaccatcgc agcgtccttc ggtaacgtac
acggtgttta caagccgggt 3960 aacgtggttc tgactccgac catcctgcgt
gattctcagg aatatgtttc caagaaacac 4020 aacctgccgc acaacagcct
gaacttcgta ttccacggtg gttccggttc tactgctcag 4080 gaaatcaaag
actccgtaag ctacggcgta gtaaaaatga acatcgatac cgatacccaa 4140
tgggcaacct gggaaggcgt tctgaactac tacaaagcga acgaagctta tctgcagggt
4200 cagctgggta acccgaaagg cgaagatcag ccgaacaaga aatactacga
tccgcgcgta 4260 tggctgcgtg ccggtcagac ttcgatgatc gctcgtctgg
agaaagcatt ccaggaactg 4320 aacgcgatcg acgttctgta agagctcggt
accggatcca attcccgatc gttcaaacat 4380 ttggcaataa agtttcttaa
gattgaatcc tgttgccggt cttgcgatga ttatcatata 4440 atttctgttg
aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat 4500
gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa
4560 aatatagcgc gcaaactagg ataaattatc gcgcgcggtg tcatctatgt
tactagatcg 4620 gggatcgatc cccgggcggc cgccactcga gtggtggccg
catcgatcgt gaagtttctc 4680 atctaagccc ccatttggac gtgaatgtag
acacgtcgaa ataaagattt ccgaattaga 4740 ataatttgtt tattgctttc
gcctataaat acgacggatc gtaatttgtc gttttatcaa 4800 aatgtacttt
cattttataa taacgctgcg gacatctaca tttttgaatt gaaaaaaaat 4860
tggtaattac tctttctttt tctccatatt gaccatcata ctcattgctg atccatgtag
4920 atttcccgga catgaagcca tttacaattg aatatatcct gccgccgctg
ccgctttgca 4980 cccggtggag cttgcatgtt ggtttctacg cagaactgag
ccggttaggc agataatttc 5040 cattgagaac tgagccatgt gcaccttccc
cccaacacgg tgagcgacgg ggcaacggag 5100 tgatccacat gggacttttc
ctagcttggc tgccattttt ggggtgaggc cgttcgcgcg 5160 gggcgccagc
tggggggatg ggaggcccgc gttaccggga gggttcgaga agggggggca 5220
ccccccttcg gcgtgcgcgg tcacgcgcca gggcgcagcc ctggttaaaa acaaggttta
5280 taaatattgg tttaaaagca ggttaaaaga caggttagcg gtggccgaaa
aacgggcgga 5340 aacccttgca aatgctggat tttctgcctg tggacagccc
ctcaaatgtc aataggtgcg 5400 cccctcatct gtcatcactc tgcccctcaa
gtgtcaagga tcgcgcccct catctgtcag 5460 tagtcgcgcc cctcaagtgt
caataccgca gggcacttat ccccaggctt gtccacatca 5520 tctgtgggaa
actcgcgtaa aatcaggcgt tttcgccgat ttgcgaggct ggccagctcc 5580
acgtcgccgg ccgaaatcga gcctgcccct catctgtcaa cgccgcgccg ggtgagtcgg
5640 cccctcaagt gtcaacgtcc gcccctcatc tgtcagtgag ggccaagttt
tccgcgtggt 5700 atccacaacg ccggcggccg gccgcggtgt ctcgcacacg
gcttcgacgg cgtttctggc 5760 gcgtttgcag ggccatagac ggccgccagc
ccagcggcga gggcaaccag cccggtgagc 5820 gtcggaaagg gtcgatcgac
cgatgccctt gagagccttc aacccagtca gctccttccg 5880 gtgggcgcgg
ggcatgacta tcgtcgccgc acttatgact gtcttcttta tcatgcaact 5940
cgtaggacag gtgccggcag cgctctgggt cattttcggc gaggaccgct ttcgctggag
6000 cgcgacgatg atcggcctgt cgcttgcggt attcggaatc ttgcacgccc
tcgctcaagc 6060 cttcgtcact ggtcccgcca ccaaacgttt cggcgagaag
caggccatta tcgccggcat 6120 ggcggccgac gcgctgggct acgtcttgct
ggcgttcgcg acgcgaggct ggatggcctt 6180 ccccattatg attcttctcg
cttccggcgg catcgggatg cccgcgttgc aggccatgct 6240 gtccaggcag
gtagatgacg accatcaggg acagcttcaa ggatcgctcg cggctcttac 6300
cagcctaact tcgatcactg gaccgctgat cgtcacggcg atttatgccg cctcggcgag
6360 cacatggaac gggttggcat ggattgtagg cgccgcccta taccttgtct
gcctccccgc 6420 gttgcgtcgc ggtgcatgga gccgggccac ctcgacctga
atggaagccg gcggcacctc 6480 gctaacggat tcaccactcc aagaattgga
gccaatcaat tcttgcggag aactgtgaat 6540 gcgcaaacca acccttggca
gaacatatcc atcgcgtccg ccatctccag cagccgcacg 6600 cggcgcatct
cgggcagcgt tgggtcctgg ccacgggtgc gcatgatcgt gctcctgtcg 6660
ttgaggaccc ggctaggctg gcggggttgc cttactggtt agcagaatga atcaccgata
6720 cgcgagcgaa cgtgaagcga ctgctgctgc aaaacgtctg cgacctgagc
aacaacatga 6780 atggtcttcg gtttccgtgt ttcgtaaagt ctggaaacgc
ggaagtcagc gccctgcacc 6840 attatgttcc ggatctgcat cgcaggatgc
tgctggctac cctgtggaac acctacatct 6900 gtattaacga agcgctggca
ttgaccctga gtgatttttc tctggtcccg ccgcatccat 6960 accgccagtt
gtttaccctc acaacgttcc agtaaccggg catgttcatc atcagtaacc 7020
cgtatcgtga gcatcctctc tcgtttcatc ggtatcatta cccccatgaa cagaaattcc
7080 cccttacacg gaggcatcaa gtgaccaaac aggaaaaaac cgcccttaac
atggcccgct 7140 ttatcagaag ccagacatta acgcttctgg agaaactcaa
cgagctggac gcggatgaac 7200 aggcagacat ctgtgaatcg cttcacgacc
acgctgatga gctttaccgc agctgcctcg 7260 cgcgtttcgg tgatgacggt
gaaaacctct gacacatgca gctcccggag acggtcacag 7320 cttgtctgta
agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg 7380
gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct
7440 taactatgcg gcatcagagc agattgtact gagagtgcac catatgcggt
gtgaaatacc 7500 gcacagatgc gtaaggagaa aataccgcat caggcgctct
tccgcttcct cgctcactga 7560 ctcgctgcgc tcggtcgttc ggctgcggcg
agcggtatca gctcactcaa aggcggtaat 7620 acggttatcc acagaatcag
gggataacgc aggaaagaac atgtgagcaa aaggccagca 7680 aaaggccagg
aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 7740
tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata
7800 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
cgaccctgcc 7860 gcttaccgga tacctgtccg cctttctccc ttcgggaagc
gtggcgcttt ctcatagctc 7920 acgctgtagg tatctcagtt cggtgtaggt
cgttcgctcc aagctgggct gtgtgcacga 7980 accccccgtt cagcccgacc
gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 8040 ggtaagacac
gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 8100
gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag
8160 gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
gagttggtag 8220 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt
ttttttgttt gcaagcagca 8280 gattacgcgc agaaaaaaag gatctcaaga
agatcctttg atcttttcta cggggtctga 8340 cgctcagtgg aacgaaaact
cacgttaagg gattttggtc atgagattat caaaaaggat 8400 cttcacctag
atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 8460
gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg
8520 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
cgatacggga 8580 gggcttacca tctggcccca gtgctgcaat gataccgcga
gacccacgct caccggctcc 8640 agatttatca gcaataaacc agccagccgg
aagggccgag cgcagaagtg gtcctgcaac 8700 tttatccgcc tccatccagt
ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 8760 agttaatagt
ttgcgcaacg ttgttgccat tgctgcaggt cgggagcaca ggatgacgcc 8820
taacaattca ttcaagccga caccgcttcg cggcgcggct taattcagga gttaaacatc
8880 atgagggaag cggtgatcgc cgaagtatcg actcaactat cagaggtagt
tggcgtcatc 8940 gagcgccatc tcgaaccgac gttgctggcc gtacatttgt
acggctccgc agtggatggc 9000 ggcctgaagc cacacagtga tattgatttg
ctggttacgg tgaccgtaag gcttgatgaa 9060 acaacgcggc gagctttgat
caacgacctt ttggaaactt cggcttcccc tggagagagc 9120 gagattctcc
gcgctgtaga agtcaccatt gttgtgcacg acgacatcat tccgtggcgt 9180
tatccagcta agcgcgaact gcaatttgga gaatggcagc gcaatgacat tcttgcaggt
9240 atcttcgagc cagccacgat cgacattgat ctggctatct tgctgacaaa
agcaagagaa 9300 catagcgttg ccttggtagg tccagcggcg gaggaactct
ttgatccggt tcctgaacag 9360 gatctatttg aggcgctaaa tgaaacctta
acgctatgga actcgccgcc cgactgggct 9420 ggcgatgagc gaaatgtagt
gcttacgttg tcccgcattt ggtacagcgc agtaaccggc 9480 aaaatcgcgc
cgaaggatgt cgctgccgac tgggcaatgg agcgcctgcc ggcccagtat 9540
cagcccgtca tacttgaagc taggcaggct tatcttggac aagaagatcg cttggcctcg
9600 cgcgcagatc agttggaaga atttgttcac tacgtgaaag gcgagatcac
caaggtagtc 9660 ggcaaataat gtctaacaat tcgttcaagc cgacgccgct
tcgcggcgcg gcttaactca 9720 agcgttagat gctgcaggca tcgtggtgtc
acgctcgtcg tttggtatgg cttcattcag 9780 ctccggttcc caacgatcaa
ggcgagttac atgatccccc atgttgtgca aaaaagcggt 9840 tagctccttc
ggtcctccga tcgaggattt ttcggcgctg cgctacgtcc gcaccgcgtt 9900
gagggatcaa gccacagcag cccactcgac ctctagccga cccagacgag ccaagggatc
9960 tttttggaat gctgctccgt cgtcaggctt tccgacgttt gggtggttga
acagaagtca 10020 ttatcgtacg gaatgccaag cactcccgag gggaaccctg
tggttggcat gcacatacaa 10080 atggacgaac ggataaacct tttcacgccc
ttttaaatat ccgttattct aataaacgct 10140 cttttctctt aggtttaccc
gccaatatat cctgtcaaac actgatagtt taaactgaag 10200 gcgggaaacg
acaatctgat ccccatcaag cttgagctca ggatttagca gcattccaga 10260
ttgggttcaa tcaacaaggt acgagccata tcactttatt caaattggta tcgccaaaac
10320 caagaaggaa ctcccatcct caaaggtttg taaggaagaa ttctcagtcc
aaagcctcaa 10380 caaggtcagg gtacagagtc tccaaaccat tagccaaaag
ctacaggaga tcaatgaaga 10440 atcttcaatc aaagtaaact actgttccag
cacatgcatc atggtcagta agtttcagaa 10500 aaagacatcc accgaagact
taaagttagt gggcatcttt gaaagtaatc ttgtcaacat 10560 cgagcagctg
gcttgtgggg accagacaaa aaaggaatgg tgcagaattg ttaggcgcac 10620
ctaccaaaag catctttgcc tttattgcaa agataaagca gattcctcta gtacaagtgg
10680 ggaacaaaat aacgtggaaa agagctgtcc tgacagccca ctcactaatg
cgtatgacga 10740 acgcagtgac gaccacaaaa gaattccctc tatataagaa
ggcattcatt cccatttgaa 10800 ggatcatcag atactgaacc aatccttcta
gaagatctaa gcttat 10846 6 10900 DNA Artificial Sequence
P-FMV/CTP2/fda/NO3' 6 cgataagctt gatgtaattg gaggaagatc aaaattttca
atccccattc ttcgattgct 60 tcaattgaag tttctccgat ggcgcaagtt
agcagaatct gcaatggtgt gcagaaccca 120 tctcttatct ccaatctctc
gaaatccagt caacgcaaat ctcccttatc ggtttctctg 180 aagacgcagc
agcatccacg agcttatccg atttcgtcgt cgtggggatt gaagaagagt 240
gggatgacgt taattggctc tgagcttcgt cctcttaagg tcatgtcttc tgtttccacg
300 gcgtgcatgc ttcacggtgc aagcagccgt ccagcaactg ctcgtaagtc
ctctggtctt 360 tctggaaccg tccgtattcc aggtgacaag tctatctccc
acaggtcctt catgtttgga 420 ggtctcgcta gcggtgaaac tcgtatcacc
ggtcttttgg aaggtgaaga tgttatcaac 480 actggtaagg ctatgcaagc
tatgggtgcc agaatccgta aggaaggtga tacttggatc 540 attgatggtg
ttggtaacgg tggactcctt gctcctgagg
ctcctctcga tttcggtaac 600 gctgcaactg gttgccgttt gactatgggt
cttgttggtg tttacgattt cgatagcact 660 ttcattggtg acgcttctct
cactaagcgt ccaatgggtc gtgtgttgaa cccacttcgc 720 gaaatgggtg
tgcaggtgaa gtctgaagac ggtgatcgtc ttccagttac cttgcgtgga 780
ccaaagactc caacgccaat cacctacagg gtacctatgg cttccgctca agtgaagtcc
840 gctgttctgc ttgctggtct caacacccca ggtatcacca ctgttatcga
gccaatcatg 900 actcgtgacc acactgaaaa gatgcttcaa ggttttggtg
ctaaccttac cgttgagact 960 gatgctgacg gtgtgcgtac catccgtctt
gaaggtcgtg gtaagctcac cggtcaagtg 1020 attgatgttc caggtgatcc
atcctctact gctttcccat tggttgctgc cttgcttgtt 1080 ccaggttccg
acgtcaccat ccttaacgtt ttgatgaacc caacccgtac tggtctcatc 1140
ttgactctgc aggaaatggg tgccgacatc gaagtgatca acccacgtct tgctggtgga
1200 gaagacgtgg ctgacttgcg tgttcgttct tctactttga agggtgttac
tgttccagaa 1260 gaccgtgctc cttctatgat cgacgagtat ccaattctcg
ctgttgcagc tgcattcgct 1320 gaaggtgcta ccgttatgaa cggtttggaa
gaactccgtg ttaaggaaag cgaccgtctt 1380 tctgctgtcg caaacggtct
caagctcaac ggtgttgatt gcgatgaagg tgagacttct 1440 ctcgtcgtgc
gtggtcgtcc tgacggtaag ggtctcggta acgcttctgg agcagctgtc 1500
gctacccacc tcgatcaccg tatcgctatg agcttcctcg ttatgggtct cgtttctgaa
1560 aaccctgtta ctgttgatga tgctactatg atcgctacta gcttcccaga
gttcatggat 1620 ttgatggctg gtcttggagc taagatcgaa ctctccgaca
ctaaggctgc ttgatgagct 1680 caagaattcg agctcggtac cggatccagc
tttcgttcgt atcatcggtt tcgacaacgt 1740 tcgtcaagtt caatgcatca
gtttcattgc gcacacacca gaatcctact gagttcgagt 1800 attatggcat
tgggaaaact gtttttcttg taccatttgt tgtgcttgta atttactgtg 1860
ttttttattc ggttttcgct atcgaactgt gaaatggaaa tggatggaga agagttaatg
1920 aatgatatgg tccttttgtt cattctcaaa ttaatattat ttgttttttc
tcttatttgt 1980 tgtgtgttga atttgaaatt ataagagata tgcaaacatt
ttgttttgag taaaaatgtg 2040 tcaaatcgtg gcctctaatg accgaagtta
atatgaggag taaaacactt gtagttgtac 2100 cattatgctt attcactagg
caacaaatat attttcagac ctagaaaagc tgcaaatgtt 2160 actgaataca
agtatgtcct cttgtgtttt agacatttat gaactttcct ttatgtaatt 2220
ttccagaatc cttgtcagat tctaatcatt gctttataat tatagttata ctcatggatt
2280 tgtagttgag tatgaaaata ttttttaatg cattttatga cttgccaatt
gattgacaac 2340 atgcatcaat cgacctgcag ccactcgaag cggccgcgtt
caagcttgag ctcaggattt 2400 agcagcattc cagattgggt tcaatcaaca
aggtacgagc catatcactt tattcaaatt 2460 ggtatcgcca aaaccaagaa
ggaactccca tcctcaaagg tttgtaagga agaattctca 2520 gtccaaagcc
tcaacaaggt cagggtacag agtctccaaa ccattagcca aaagctacag 2580
gagatcaatg aagaatcttc aatcaaagta aactactgtt ccagcacatg catcatggtc
2640 agtaagtttc agaaaaagac atccaccgaa gacttaaagt tagtgggcat
ctttgaaagt 2700 aatcttgtca acatcgagca gctggcttgt ggggaccaga
caaaaaagga atggtgcaga 2760 attgttaggc gcacctacca aaagcatctt
tgcctttatt gcaaagataa agcagattcc 2820 tctagtacaa gtggggaaca
aaataacgtg gaaaagagct gtcctgacag cccactcact 2880 aatgcgtatg
acgaacgcag tgacgaccac aaaagaattc cctctatata agaaggcatt 2940
cattcccatt tgaaggatca tcagatactg aaccaatcct tctagaagat ctaagcttat
3000 cgataagctt gatgtaattg gaggaagatc aaaattttca atccccattc
ttcgattgct 3060 tcaattgaag tttctccgat ggcgcaagtt agcagaatct
gcaatggtgt gcagaaccca 3120 tctcttatct ccaatctctc gaaatccagt
caacgcaaat ctcccttatc ggtttctctg 3180 aagacgcagc agcatccacg
agcttatccg atttcgtcgt cgtggggatt gaagaagagt 3240 gggatgacgt
taattggctc tgagcttcgt cctcttaagg tcatgtcttc tgtttccacg 3300
gcgtgcatgc aggccatggc taagattttt gatttcgtaa aacctggcgt aatcactggt
3360 gatgacgtac agaaagtttt ccaggtagca aaagaaaaca acttcgcact
gccagcagta 3420 aactgcgtcg gtactgactc catcaacgcc gtactggaaa
ccgctgctaa agttaaagcg 3480 ccggttatcg ttcagttctc caacggtggt
gcttccttta tcgctggtaa aggcgtgaaa 3540 tctgacgttc cgcagggtgc
tgctatcctg ggcgcgatct ctggtgcgca tcacgttcac 3600 cagatggctg
aacattatgg tgttccggtt atcctgcaca ctgaccactg cgcgaagaaa 3660
ctgctgccgt ggatcgacgg tctgttggac gcgggtgaaa aacacttcgc agctaccggt
3720 aagccgctgt tctcttctca catgatcgac ctgtctgaag aatctctgca
agagaacatc 3780 gaaatctgct ctaaatacct ggagcgcatg tccaaaatcg
gcatgactct ggaaatcgaa 3840 ctgggttgca ccggtggtga agaagacggc
gtggacaaca gccacatgga cgcttctgca 3900 ctgtacaccc agccggaaga
cgttgattac gcatacaccg aactgagcaa aatcagcccg 3960 cgtttcacca
tcgcagcgtc cttcggtaac gtacacggtg tttacaagcc gggtaacgtg 4020
gttctgactc cgaccatcct gcgtgattct caggaatatg tttccaagaa acacaacctg
4080 ccgcacaaca gcctgaactt cgtattccac ggtggttccg gttctactgc
tcaggaaatc 4140 aaagactccg taagctacgg cgtagtaaaa atgaacatcg
ataccgatac ccaatgggca 4200 acctgggaag gcgttctgaa ctactacaaa
gcgaacgaag cttatctgca gggtcagctg 4260 ggtaacccga aaggcgaaga
tcagccgaac aagaaatact acgatccgcg cgtatggctg 4320 cgtgccggtc
agacttcgat gatcgctcgt ctggagaaag cattccagga actgaacgcg 4380
atcgacgttc tgtaagagct cggtaccgga tccaattccc gatcgttcaa acatttggca
4440 ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca
tataatttct 4500 gttgaattac gttaagcatg taataattaa catgtaatgc
atgacgttat ttatgagatg 4560 ggtttttatg attagagtcc cgcaattata
catttaatac gcgatagaaa acaaaatata 4620 gcgcgcaaac taggataaat
tatcgcgcgc ggtgtcatct atgttactag atcggggatc 4680 gatccccggg
cggccgccac tcgagtggtg gccgcatcga tcgtgaagtt tctcatctaa 4740
gcccccattt ggacgtgaat gtagacacgt cgaaataaag atttccgaat tagaataatt
4800 tgtttattgc tttcgcctat aaatacgacg gatcgtaatt tgtcgtttta
tcaaaatgta 4860 ctttcatttt ataataacgc tgcggacatc tacatttttg
aattgaaaaa aaattggtaa 4920 ttactctttc tttttctcca tattgaccat
catactcatt gctgatccat gtagatttcc 4980 cggacatgaa gccatttaca
attgaatata tcctgccgcc gctgccgctt tgcacccggt 5040 ggagcttgca
tgttggtttc tacgcagaac tgagccggtt aggcagataa tttccattga 5100
gaactgagcc atgtgcacct tccccccaac acggtgagcg acggggcaac ggagtgatcc
5160 acatgggact tttcctagct tggctgccat ttttggggtg aggccgttcg
cgcggggcgc 5220 cagctggggg gatgggaggc ccgcgttacc gggagggttc
gagaaggggg ggcacccccc 5280 ttcggcgtgc gcggtcacgc gccagggcgc
agccctggtt aaaaacaagg tttataaata 5340 ttggtttaaa agcaggttaa
aagacaggtt agcggtggcc gaaaaacggg cggaaaccct 5400 tgcaaatgct
ggattttctg cctgtggaca gcccctcaaa tgtcaatagg tgcgcccctc 5460
atctgtcatc actctgcccc tcaagtgtca aggatcgcgc ccctcatctg tcagtagtcg
5520 cgcccctcaa gtgtcaatac cgcagggcac ttatccccag gcttgtccac
atcatctgtg 5580 ggaaactcgc gtaaaatcag gcgttttcgc cgatttgcga
ggctggccag ctccacgtcg 5640 ccggccgaaa tcgagcctgc ccctcatctg
tcaacgccgc gccgggtgag tcggcccctc 5700 aagtgtcaac gtccgcccct
catctgtcag tgagggccaa gttttccgcg tggtatccac 5760 aacgccggcg
gccggccgcg gtgtctcgca cacggcttcg acggcgtttc tggcgcgttt 5820
gcagggccat agacggccgc cagcccagcg gcgagggcaa ccagcccggt gagcgtcgga
5880 aagggtcgat cgaccgatgc ccttgagagc cttcaaccca gtcagctcct
tccggtgggc 5940 gcggggcatg actatcgtcg ccgcacttat gactgtcttc
tttatcatgc aactcgtagg 6000 acaggtgccg gcagcgctct gggtcatttt
cggcgaggac cgctttcgct ggagcgcgac 6060 gatgatcggc ctgtcgcttg
cggtattcgg aatcttgcac gccctcgctc aagccttcgt 6120 cactggtccc
gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc 6180
cgacgcgctg ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg ccttccccat
6240 tatgattctt ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca
tgctgtccag 6300 gcaggtagat gacgaccatc agggacagct tcaaggatcg
ctcgcggctc ttaccagcct 6360 aacttcgatc actggaccgc tgatcgtcac
ggcgatttat gccgcctcgg cgagcacatg 6420 gaacgggttg gcatggattg
taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg 6480 tcgcggtgca
tggagccggg ccacctcgac ctgaatggaa gccggcggca cctcgctaac 6540
ggattcacca ctccaagaat tggagccaat caattcttgc ggagaactgt gaatgcgcaa
6600 accaaccctt ggcagaacat atccatcgcg tccgccatct ccagcagccg
cacgcggcgc 6660 atctcgggca gcgttgggtc ctggccacgg gtgcgcatga
tcgtgctcct gtcgttgagg 6720 acccggctag gctggcgggg ttgccttact
ggttagcaga atgaatcacc gatacgcgag 6780 cgaacgtgaa gcgactgctg
ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc 6840 ttcggtttcc
gtgtttcgta aagtctggaa acgcggaagt cagcgccctg caccattatg 6900
ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac atctgtatta
6960 acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat
ccataccgcc 7020 agttgtttac cctcacaacg ttccagtaac cgggcatgtt
catcatcagt aacccgtatc 7080 gtgagcatcc tctctcgttt catcggtatc
attaccccca tgaacagaaa ttccccctta 7140 cacggaggca tcaagtgacc
aaacaggaaa aaaccgccct taacatggcc cgctttatca 7200 gaagccagac
attaacgctt ctggagaaac tcaacgagct ggacgcggat gaacaggcag 7260
acatctgtga atcgcttcac gaccacgctg atgagcttta ccgcagctgc ctcgcgcgtt
7320 tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc
acagcttgtc 7380 tgtaagcgga tgccgggagc agacaagccc gtcagggcgc
gtcagcgggt gttggcgggt 7440 gtcggggcgc agccatgacc cagtcacgta
gcgatagcgg agtgtatact ggcttaacta 7500 tgcggcatca gagcagattg
tactgagagt gcaccatatg cggtgtgaaa taccgcacag 7560 atgcgtaagg
agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct 7620
gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt
7680 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc
agcaaaaggc 7740 caggaaccgt aaaaaggccg cgttgctggc gtttttccat
aggctccgcc cccctgacga 7800 gcatcacaaa aatcgacgct caagtcagag
gtggcgaaac ccgacaggac tataaagata 7860 ccaggcgttt ccccctggaa
gctccctcgt gcgctctcct gttccgaccc tgccgcttac 7920 cggatacctg
tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 7980
taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc
8040 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca
acccggtaag 8100 acacgactta tcgccactgg cagcagccac tggtaacagg
attagcagag cgaggtatgt 8160 aggcggtgct acagagttct tgaagtggtg
gcctaactac ggctacacta gaaggacagt 8220 atttggtatc tgcgctctgc
tgaagccagt taccttcgga aaaagagttg gtagctcttg 8280 atccggcaaa
caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 8340
gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca
8400 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa
ggatcttcac 8460 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc
taaagtatat atgagtaaac 8520 ttggtctgac agttaccaat gcttaatcag
tgaggcacct atctcagcga tctgtctatt 8580 tcgttcatcc atagttgcct
gactccccgt cgtgtagata actacgatac gggagggctt 8640 accatctggc
cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 8700
atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc
8760 cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt
cgccagttaa 8820 tagtttgcgc aacgttgttg ccattgctgc aggtcgggag
cacaggatga cgcctaacaa 8880 ttcattcaag ccgacaccgc ttcgcggcgc
ggcttaattc aggagttaaa catcatgagg 8940 gaagcggtga tcgccgaagt
atcgactcaa ctatcagagg tagttggcgt catcgagcgc 9000 catctcgaac
cgacgttgct ggccgtacat ttgtacggct ccgcagtgga tggcggcctg 9060
aagccacaca gtgatattga tttgctggtt acggtgaccg taaggcttga tgaaacaacg
9120 cggcgagctt tgatcaacga ccttttggaa acttcggctt cccctggaga
gagcgagatt 9180 ctccgcgctg tagaagtcac cattgttgtg cacgacgaca
tcattccgtg gcgttatcca 9240 gctaagcgcg aactgcaatt tggagaatgg
cagcgcaatg acattcttgc aggtatcttc 9300 gagccagcca cgatcgacat
tgatctggct atcttgctga caaaagcaag agaacatagc 9360 gttgccttgg
taggtccagc ggcggaggaa ctctttgatc cggttcctga acaggatcta 9420
tttgaggcgc taaatgaaac cttaacgcta tggaactcgc cgcccgactg ggctggcgat
9480 gagcgaaatg tagtgcttac gttgtcccgc atttggtaca gcgcagtaac
cggcaaaatc 9540 gcgccgaagg atgtcgctgc cgactgggca atggagcgcc
tgccggccca gtatcagccc 9600 gtcatacttg aagctaggca ggcttatctt
ggacaagaag atcgcttggc ctcgcgcgca 9660 gatcagttgg aagaatttgt
tcactacgtg aaaggcgaga tcaccaaggt agtcggcaaa 9720 taatgtctaa
caattcgttc aagccgacgc cgcttcgcgg cgcggcttaa ctcaagcgtt 9780
agatgctgca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg
9840 ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag
cggttagctc 9900 cttcggtcct ccgatcgagg atttttcggc gctgcgctac
gtccgcaccg cgttgaggga 9960 tcaagccaca gcagcccact cgacctctag
ccgacccaga cgagccaagg gatctttttg 10020 gaatgctgct ccgtcgtcag
gctttccgac gtttgggtgg ttgaacagaa gtcattatcg 10080 tacggaatgc
caagcactcc cgaggggaac cctgtggttg gcatgcacat acaaatggac 10140
gaacggataa accttttcac gcccttttaa atatccgtta ttctaataaa cgctcttttc
10200 tcttaggttt acccgccaat atatcctgtc aaacactgat agtttaaact
gaaggcggga 10260 aacgacaatc tgatccccat caagcttgag ctcaggattt
agcagcattc cagattgggt 10320 tcaatcaaca aggtacgagc catatcactt
tattcaaatt ggtatcgcca aaaccaagaa 10380 ggaactccca tcctcaaagg
tttgtaagga agaattctca gtccaaagcc tcaacaaggt 10440 cagggtacag
agtctccaaa ccattagcca aaagctacag gagatcaatg aagaatcttc 10500
aatcaaagta aactactgtt ccagcacatg catcatggtc agtaagtttc agaaaaagac
10560 atccaccgaa gacttaaagt tagtgggcat ctttgaaagt aatcttgtca
acatcgagca 10620 gctggcttgt ggggaccaga caaaaaagga atggtgcaga
attgttaggc gcacctacca 10680 aaagcatctt tgcctttatt gcaaagataa
agcagattcc tctagtacaa gtggggaaca 10740 aaataacgtg gaaaagagct
gtcctgacag cccactcact aatgcgtatg acgaacgcag 10800 tgacgaccac
aaaagaattc cctctatata agaaggcatt cattcccatt tgaaggatca 10860
tcagatactg aaccaatcct tctagaagat ctaagcttat 10900
* * * * *