U.S. patent application number 10/636396 was filed with the patent office on 2004-04-15 for sunflower anti-pathogenic proteins and genes and their uses.
This patent application is currently assigned to Pioneer Hi-Bred International, Inc.. Invention is credited to Bidney, Dennis L., Crasta, Oswald R., Duvick, Jon, Hu, Xu, Lu, Guihua.
Application Number | 20040073971 10/636396 |
Document ID | / |
Family ID | 27385529 |
Filed Date | 2004-04-15 |
United States Patent
Application |
20040073971 |
Kind Code |
A1 |
Bidney, Dennis L. ; et
al. |
April 15, 2004 |
Sunflower anti-pathogenic proteins and genes and their uses
Abstract
Compositions and methods to aid in protecting plants from
invading pathogenic organisms are provided. The compositions of the
invention comprise anti-pathogenic genes, including 5' regulatory
sequences in the promoter, and proteins encoded by the
anti-pathogenic genes. The compositions find use in methods for
reducing or eliminating damage to plants caused by plant pathogens.
Transformed plants, plant cells, tissues, and seed having enhanced
disease resistance are also provided.
Inventors: |
Bidney, Dennis L.;
(Urbandale, IA) ; Duvick, Jon; (Des Moines,
IA) ; Hu, Xu; (Urbandale, IA) ; Lu,
Guihua; (Urbandale, IA) ; Crasta, Oswald R.;
(Branford, CT) |
Correspondence
Address: |
ALSTON & BIRD LLP
PIONEER HI-BRED INTERNATIONAL, INC.
BANK OF AMERICA PLAZA
101 SOUTH TYRON STREET, SUITE 4000
CHARLOTTE
NC
28280-4000
US
|
Assignee: |
Pioneer Hi-Bred International,
Inc.
CuraGen Corporation
|
Family ID: |
27385529 |
Appl. No.: |
10/636396 |
Filed: |
August 7, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10636396 |
Aug 7, 2003 |
|
|
|
09589733 |
Jun 8, 2000 |
|
|
|
6677503 |
|
|
|
|
60140646 |
Jun 23, 1999 |
|
|
|
60162904 |
Nov 1, 1999 |
|
|
|
Current U.S.
Class: |
800/279 ;
435/320.1; 435/468; 435/69.1; 800/322 |
Current CPC
Class: |
C07K 14/415 20130101;
C12N 15/8282 20130101; C12N 9/0032 20130101 |
Class at
Publication: |
800/279 ;
435/069.1; 435/320.1; 435/468; 800/322 |
International
Class: |
A01H 001/00; C12N
015/82; A01H 005/00 |
Claims
That which is claimed:
1. An isolated nucleic acid molecule comprising a nucleotide
sequence selected from the group consisting of: a) the nucleotide
sequence set forth in SEQ ID NO:9; and, b) a nucleotide sequence
comprising the plant promoter sequence contained in the plasmid
deposited as Patent Deposit No. PTA-560.
2. The isolated nucleotide sequence of claim 1, wherein said
sequence regulates transcription of an operably linked nucleotide
sequence of interest.
3. A DNA construct comprising the nucleic acid molecule of claim 1
operably linked to a heterologous nucleotide sequence of
interest.
4. A vector comprising the DNA construct of claim 3.
5. A plant having stably incorporated into its genome a DNA
construct comprising a promoter operably linked to a heterologous
nucleotide sequence of interest, wherein said promoter comprises a
nucleotide sequence selected from the group consisting of: a) the
nucleotide sequence set forth in SEQ ID NO:9; and, b) a nucleotide
sequence comprising the plant promoter sequence contained in the
plasmid deposited as Patent Deposit No. PTA-560.
6. The plant of claim 5, wherein said plant is a monocot.
7. The plant of claim 5, wherein said plant is a dicot.
8. The plant of claim 7, wherein said dicot is sunflower.
9. The transformed seed of the plant of claim 5, wherein said seed
comprises said DNA construct.
10. A plant cell having stably incorporated into its genome a DNA
construct comprising a promoter operably linked to a heterologous
nucleotide sequence of interest, wherein said promoter comprises a
nucleotide sequence selected from the group consisting of: a) the
nucleotide sequence set forth in SEQ ID NO:9; and, b) a nucleotide
sequence comprising the plant promoter sequence contained in the
plasmid deposited as Patent Deposit No. PTA-560.
11. A method for regulating the expression of a nucleotide sequence
of interest in a plant cell, said method comprising: a) stably
integrating into the genome of said plant cell a DNA construct
comprising a promoter operably linked to said nucleotide sequence
of interest, wherein said promoter comprises a nucleotide sequence
selected from the group consisting of: i) the nucleotide sequence
set forth in SEQ ID NO:9; and, ii) a nucleotide sequence comprising
the plant promoter sequence contained in the plasmid deposited as
Patent Deposit No. PTA-560; and, b) contacting the plant cell with
a stimulus, wherein said stimulus induces transcription of the
nucleotide sequence of interest.
12. The method of claim 11, wherein said stimulus is selected from
the group consisting of wounding, a wound-responsive chemical, and
a pathogen.
13. The method of claim 11, wherein said nucleotide sequence of
interest encodes a defensin polypeptide.
14. The method of claim 11, wherein said nucleotide sequence of
interest is heterologous to the promoter sequence.
15. The method of claim 11, wherein expression of said nucleotide
sequence of interest enhances the disease resistance of the
plant.
16. The method of claim 11, wherein said nucleotide sequence of
interest is anti-pathogenic.
17. A method for regulating the expression of a nucleotide sequence
of interest in a plant, said method comprising: a) stably
integrating into the genome of a plant cell a DNA construct
comprising a promoter operably linked to said nucleotide sequence
of interest, wherein said promoter comprises a nucleotide sequence
selected from the group consisting of: i) the nucleotide sequence
set forth in SEQ ID NO:9; and, ii) a nucleotide sequence comprising
the plant promoter sequence contained in the plasmid deposited as
Patent Deposit No. PTA-560; b) regenerating said cell into a plant;
and, c) contacting the plant with a stimulus, wherein said stimulus
induces transcription of the nucleotide sequence of interest.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a divisional application of
copending U.S. application Ser. No. 09/589,733, filed Jun. 8, 2000,
entitled "Sunflower Anti-Pathogenic Proteins and Genes and Their
Uses", which claims the benefit of U.S. Provisional Application
Serial No. 60/140,646, filed Jun. 23, 1999, and U.S. Provisional
Application No. 60/162,904, filed Nov. 1, 1999, both entitled
"Sunflower Anti-Pathogenic Proteins and Genes and Their Uses," the
contents of which are herein incorporated by reference in their
entirety.
FIELD OF THE INVENTION
[0002] The invention relates to nucleotide sequences and proteins
for anti-pathogenic agents and their uses, particularly the genetic
manipulation of plant with genes that enhance disease resistance.
Promoter sequences are also provided.
BACKGROUND OF THE INVENTION
[0003] Plant diseases are often a serious limitation on
agricultural productivity and have therefore influenced the history
and development of agricultural practices. Only recently have
Mendelian genes controlling disease resistance been isolated, and
elucidation of their biochemical functions remains a major
challenge.
[0004] Plant disease outbreaks have resulted in catastrophic crop
failures that have triggered famines and caused major social
change. Generally, the best strategy for plant disease control is
to use resistant cultivars selected or developed by plant breeders
for this purpose. However, the potential for serious crop disease
epidemics persists today, as evidenced by outbreaks of the Victoria
blight of oats and southern corn leaf blight.
[0005] Mendelian genetics of resistance to disease in plants is
well known. Resistance is often controlled by a single gene, either
dominant, semidominant, or recessive. In some instances, multigenes
are involved. However, the biochemical mechanisms for gene products
involved in plant resistance are known in only a few model
cases.
[0006] Among the causal agents of infectious diseases of crop
plants, phytopathogenic fungi play the dominant role not only by
causing devastating epidemics, but also through the less
spectacular although persistent and significant annual crop yield
losses that have made fungal pathogens a serious economic factor.
All of the species of flowering plants are attacked by pathogenic
fingi. Generally, however, a single plant species can be host to
only a few fungal species, and similarly, most fungi have a limited
host range.
[0007] To colonize plants, fungal microorganisms have evolved
strategies to invade plant tissue, to optimize growth in the plant,
and to propagate. Bacteria and viruses, as well as some
opportunistic fungal parasites, often depend on natural openings or
wounds for invasion. In contrast, many true phytopathogenic fungi
have evolved mechanisms to actively traverse the plant's outer
structural barriers, the cuticle and the epidermal cell wall. To
gain entrance, fungi generally secrete a cocktail of hydrolytic
enzymes.
[0008] Despite the large number of microorganisms capable of
causing disease, most plants are resistant to any given pathogen.
The defense mechanisms utilized by plants can take many different
forms, ranging from passive mechanical or preformed chemical
barriers, which provide non-specific protection against a wide
range of organisms, to move more active host-specific responses
that provide host- or varietal-specific resistance. Resistance (R)
genes are effective against individual pathogen varieties. These
genes have been employed in breeding programs upon discovery.
[0009] A hypersensitive response (HR) that is elaborated in
response to invasion by all classes of pathogens is the most common
feature associated with active host resistance. In most cases,
activation of the HR leads to the death of cells at the infection
site, which results in the restriction of the pathogen to small
areas immediately surrounding the initially infected cells. At the
whole plant level, the HR is manifested as small necrotic lesions.
The number of cells affected by the HR is only a small fraction of
the total in the plant, so this response obviously contributes to
the survival of plants undergoing pathogen attack.
[0010] In plants, robust defense responses to invading
phytopathogens often conform to a gene-for-gene relationship.
Resistance to a pathogen is only observed when the pathogen carries
a specific avirulence (avr) gene and the plant carries a
corresponding resistance (R) gene. Because avr-R gene-for-gene
relationships are observed in many plant-pathogens systems and are
accompanied by a characteristic set of defense responses, a common
molecular mechanism avr-R gene mediated resistance has been
postulated. Thus, disease resistance results from the expression of
a resistance gene in the plant and a corresponding avirulence gene
in the pathogen and is often associated with the rapid, localized
cell death of the hypersensitive response. R genes that respond to
specific bacteria, fungal, or viral pathogens have been isolated
from a variety of plant species and several appear to encode
cytoplasmic proteins. It has been unclear how such proteins could
recognize an extracellular pathogen. Many strategies for plant
disease control have been attempted. Resistant cultivars has been
selected or developed by plant breeders for disease control.
Resistance is especially important for major crops such as the
cereals, sugar cane, potato, and soybean. The limitation in use of
disease resistance in modern agriculture is adaptability by
pathogens to overcome resistance.
[0011] The development of new strategies to control diseases is the
primary purpose of research on plant/pathogen interactions. These
include, for example, the identification of essential pathogen
virulence factors and the development of means to block them, or
the transfer of resistance genes into crop plants from unrelated
species. An additional benefit is a better understanding of the
physiology of the healthy plant through a study of the metabolic
disturbances caused by plant pathogens.
SUMMARY OF THE INVENTION
[0012] Anti-pathogenic compositions and methods for their use are
provided. The compositions comprise anti-pathogenic proteins and
their corresponding genes and regulatory regions. Particularly,
sunflower PR5-1, defensin, and berberine bridge enzyme (BBE)
homologues, and fragments and variants thereof, are provided.
[0013] The compositions are useful in protecting a plant from
invading pathogenic organisms. One method involves stably
transforming a plant with a nucleotide sequence of the invention to
engineer broad spectrum disease resistance in the plant. The
nucleotide sequences will be expressed from a promoter capable of
driving expression of a gene in a plant cell. A second method
involves controlling plant pathogens by applying an effective
amount of an anti-pathogenic protein or composition of the
invention to the environment of the pathogens. Additionally, the
nucleotide sequences of the invention are useful as genetic markers
in disease resistance breeding programs.
[0014] Promoters of the genes of the invention find use as disease
or pathogen-inducible promoters. Such promoters may be used to
express other coding regions, particularly other anti-pathogenic
genes, including disease and insect resistance genes.
[0015] The compositions of the invention additionally find use in
agricultural and pharmaceutical compositions as antifungal and
antimicrobial agents. For agricultural purposes, the compositions
may be used in sprays for control of plant disease. As
pharmaceutical compositions, the agents are useful for
antibacterial and antimicrobial treatments.
[0016] The methods of the invention find use in controlling pests,
including fungal pathogens, viruses, nematodes, insects, and the
like. Transformed plants, plant cells, plant tissues, and seeds, as
well as methods for making such transformed compositions are
additionally provided.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 depicts the cDNA cloning strategy. (I) Sunflower cDNA
libraries were directionally constructed into pBluescript phagemid
using a ZAP-cDNA synthesis kit from Stratagene; (II)
oligonucleotide primers (P1 and P3) were used to amplify the 5' end
of a target gene by a rapid amplification of cDNA ends (RACE)
method. PCR and the 3' end of the gene were amplified with P2 and
P4 primers; (III) P5 primer was designed at the putative start
codon (ATG) or upstream the start codon in order to clone
full-length cDNA; (IV) the full-length cDNA of the target gene were
amplified by PCR with P5 and P4 primers; and (V) the expected
full-length cDNA was inserted into TA vector (Invitrogen) for
sequencing. Shaded areas represent cloned regions.
[0018] FIG. 2 depicts an alignment of the amino acid sequence of
PR5-1 (SEQ ID NO:1) from sunflower with other PR5 or osmatin-like
proteins from grape, (Swiss-Prot Accession Nos. P93621, SEQ ID
NO:10; and O04708, SEQ ID NO:11); soybean, (Swiss-Prot Accession
No. P25096, SEQ ID NO:12); tomato, (Swiss-Prot Accession No.
Q01591, SEQ ID NO:14); and potato, (Swiss-Prot Accession No.
P50701, SEQ ID NO:15). A star indicates that the amino acid at that
position is conserved for all aligned sequences, and a dash denotes
gaps in alignment.
[0019] FIG. 3 depicts an alignment of the amino acid sequence of a
BBE (SEQ ID NO:20) from sunflower with other BBE homologues and two
possible sunflower carbohydrate oxidases. Sunflower-15 (SEQ ID
NO:17) and -19 (SEQ ID NO:16) sequences were reported in WO
98/13478. Other BBE homologues include a reticuline oxidase
precursor from California poppy, (Swiss-Prot Accession No. P30986,
SEQ ID NO:19) and a BBE from opium poppy, (Swiss-Prot Accession No.
P93479, SEQ ID NO:18).
[0020] FIG. 4 depicts an alignment of the amino acid sequence of a
sunflower defensin (SEQ ID NO:24) with other antifungal defensins
from garden pea (Swiss-Prot Accession No. Q01784, SEQ ID NO:25),
white mustard (Swiss-Prot Accession No. P30231, SEQ ID NO:22),
radish (Swiss-Prot Accession No. P30230, SEQ ID NO:21) and
Arabidopsis (Swiss-Prot Accession No. P30224, SEQ ID NO:23).
DETAILED DESCRIPTION OF THE INVENTION
[0021] Compositions and methods for controlling pathogenic agents
are provided. The anti-pathogenic compositions comprise sunflower
genes, including their promoters, and proteins. Particularly, the
sunflower genes and proteins are selected from PR5-1, defensin, and
berberine bridge enzyme (BBE). Accordingly, the methods are also
useful in protecting plants against fungal pathogens, viruses,
nematodes, insects and the like. Additionally, the compositions can
be used in formulation use for their antimicrobial activities.
[0022] Additionally, the present invention provides for isolated
nucleic acid molecules comprising nucleotide sequences for plant
promoters shown in SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9; for
nucleotide sequences encoding the amino acid sequences shown in SEQ
ID NO:1, SEQ ID NO:2, and SEQ ID NO:3; the nucleic acid molecules
deposited in a bacterial host as Patent Deposit Nos. PTA-67,
PTA-73, PTA-75, respectively; and the nucleic acid molecule
deposited as Patent Deposit No. PTA-560 which comprises the
nucleotide sequence shown in SEQ ID NO:9. Further provided are
polypeptides having an amino acid sequence encoded by a nucleic
acid molecule described herein, for example those set forth in SEQ
ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 those deposited as Patent
Deposit Nos. PTA-67, PTA-73, PTA-75, respectively, and fragments
and variants thereof.
[0023] Plasmids containing the promoter sequences and gene
nucleotide sequences of the invention were deposited with the
Patent Depository of the American Type Culture Collection,
Manassas, Va. The following plasmids were deposited: May 13, 1999,
pHp 15383 containing BBE cDNA; May 13, 1999, pHp 15384 containing
BBE promoter sequence; May 13, 1999, pHp 15385 containing defensin
cDNA; Aug. 31, 1999, pHp 16125 containing defensin promoter
sequence; May 13, 1999, pHp 15395 containing PR5-1 promoter
sequences; and May 14, 1999, pHp 15393 containing PR5-1 cDNA; and
assigned Patent Deposit Nos. PTA-73, PTA-74, PTA-75, PTA-560,
PTA-76, PTA-67, respectively. These deposits will be maintained
under the terms of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for the Purposes of
Patent Procedure. These deposits were made merely as a convenience
for those of skill in the art and are not an admission that a
deposit is required under 35 U.S.C. .sctn.112.
[0024] As indicated, the sequences of the invention find use as
antifungal agents. Thus, the genes can be used to engineer plants
for broad spectrum disease resistance. In this manner, the
sequences can be used alone or in combination with each other
and/or with other known disease resistance genes.
[0025] Additionally, the sequences can be used as markers in
studying defense signal pathways and in disease resistance breeding
programs. The sequences can also be used as baits to isolate other
signaling components in defense/resistance responsiveness and to
isolate the corresponding promoter. See, generally, Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (2d ed.), Cold Spring
Harbor Laboratory Press, Plainview, N.Y.
[0026] The invention encompasses isolated or substantially purified
nucleic acid or protein compositions. An "isolated" or "purified"
nucleic acid molecule or protein, or biologically active portion
thereof, is substantially free of other cellular material, or
culture medium when produced by recombinant techniques, or
substantially free of chemical precursors or other chemicals when
chemically synthesized. Preferably, an "isolated" nucleic acid is
free of sequences that naturally flank the nucleic acid (i.e.,
sequences located at the 5' and 3' ends of the nucleic acid) in the
genomic DNA of the organism from which the nucleic acid is derived.
For example, in various embodiments, the isolated nucleic acid
molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb,
0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the
nucleic acid molecule in genomic DNA of the cell from which the
nucleic acid is derived. A protein that is substantially free of
cellular material includes preparations of protein having less than
about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein.
When the protein of the invention or biologically active portion
thereof is recombinantly produced, preferably, culture medium
represents less than about 30%, 20%, 10%, or 5% (by dry weight) of
chemical precursors or non-protein of interest chemicals.
[0027] By "anti-pathogenic compositions" is intended that the
compositions of the invention are capable of suppressing,
controlling, and/or killing the invading pathogenic organism.
[0028] By "disease resistance" is intended that the plants avoid
the disease symptoms that are the outcome of plant-pathogen
interactions. That, is, pathogens are prevented from causing plant
diseases and the associated disease symptoms. The methods of the
invention can be utilized to protect plants from disease,
particularly those diseases that are caused by plant pathogens.
[0029] The compositions of the invention include isolated nucleic
acid molecules comprising the promoter nucleotide sequences set
forth in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9. By "promoter" is
intended a regulatory region of DNA usually comprising a TATA box
capable of directing RNA polymerase II to initiate RNA synthesis at
the appropriate transcription initiation site for a particular
coding sequence. A promoter may additionally comprise other
recognition sequences generally positioned upstream or 5' to the
TATA box, referred to as upstream promoter elements, which
influence the transcription initiation rate. It is recognized that
having identified the nucleotide sequences for the promoter regions
disclosed herein, it is within the state of the art to isolate and
identify further regulatory elements in the 5' untranslated region
upstream from the particular promoter regions identified herein.
Thus, for example, the promoter regions disclosed herein may
further comprise upstream regulatory elements that confer
tissue-preferred expression of any heterologous nucleotide sequence
operably linked to one of the disclosed promoter sequences. See
particularly Australian Patent No. AU-A-77751/94 and U.S. Pat. Nos.
5,466,785 and 5,635,618. Generally with the promoter sequences of
the invention, the pattern of expression will be inducible.
[0030] The inducible promoter sequences, of the present invention,
when assembled within a DNA construct such that the promoter is
operably linked to a nucleotide sequence of interest, enable
expression of the nucleotide sequences in the cells of a plant
stably transformed with this DNA construct. The nucleotide sequence
of interest encompasses both homologous and heterologous sequences.
By "heterologous nucleotide sequence" is intended a sequence that
is not naturally occurring with the promoter sequence. While this
nucleotide sequence is heterologous to the promoter sequence, it
may be homologous, or native, or heterologous, or foreign, to the
plant host. Choice of the promoter sequence will determine when and
where within the organism the heterologous nucleotide sequence is
expressed. Where gene expression in response to a stimulus is
desired, an inducible promoter of the invention is the regulatory
element of choice. When using an inducible promoter, expression of
the nucleotide sequence is initiated in cells in response to a
stimulus. By "stimulus" is intended a chemical, which may be
applied externally or may accumulate in response to another
external stimulus; a pathogen, which may, for example, induce
expression as a result of invading a plant cell; or other factor
such as environmental stresses, including but not limited to,
drought, temperature, and salinity.
[0031] Compositions of the invention also include the nucleotide
sequences for three sunflower genes: a sunflower PR5 homologue as
set forth in SEQ ID NO:4; a sunflower defensin homologue as set
forth in SEQ ID NO:6; and, a sunflower BBE homologue as set forth
in SEQ ID NO:5, and the corresponding amino acid sequences for the
proteins encoded thereby as set forth in SEQ ID NO:1, SEQ ID NO:3
and SEQ ID NO:2, respectively. These gene sequences may be
assembled into a DNA construct such that the gene is operably
linked to a promoter that drives expression of a coding sequence in
a plant cell. Plants stably transformed with this DNA construct
express, either in a constitutive or inducible manner, a protein of
the invention. Expression of this protein creates or enhances
disease resistance in the transformed plant.
[0032] BBE [9S0-reticuline:oxygen oxidoreductase
(methylene-bridge-forming- ), EC 1.5.3.9] is a covalently
flavinylated oxidase that is a key enzyme in benzophenanthridine
alkaloid biosynthesis in plants (Kutchan et al. (1995) J. Biol.
Chem. 270:24475-24481; Blechert et al. (1995) Proc. Natl. Acad.
Sci. USA 92:4099-4105; Dittrich et al. (1991) Proc. Natl. Acad.
Sci. USA 88:9969-9973; Chou et al. (1998) Plant J. 15:289-300).
Members of the alkaloid family are known to have potent
pharmacological activities. Berberine, for example, is currently
used as an antibacterial treatment for eye infections in Europe and
for intestinal infections in the far East. The benzophenanthridine
alkaloid, sanguimarine, is an antimicrobial used in the treatment
of peridontal disease in both the United States and Europe (Kutchan
et al. (1995) J. Biol. Chem. 270:24475-24481). In addition, BBE has
anti-Phytophthora and anti-Pythium activity, as well as
carbohydrate oxidase activity (WO 98/13478). The BBE-transgenic
plants of the invention have enhanced resistance to pathogens. BBE
and several other enzymes in the defense pathway are induced by
elicitors. See for example Blechert et al. (1995) Proc. Natl. Acad.
Sci. USA 92:4099-4105; Dittrich et al. (1991) Proc. Natl. Acad.
Sci. USA 88:9969-9973.
[0033] A sunflower BBE is disclosed that is regulated by oxalate
oxidase (oxox) expression and Sclerotinia infection. The cDNA (SEQ
ID NO:5) and promoter (SEQ ID NO:8) sequences of sunflower BBE are
provided. In addition, expression of this BBE in sunflower was
up-regulated by oxalic acid, H.sub.2O.sub.2, salicylic acid (SA)
and jasmonic acid (JA).
[0034] Pathogenesis-related protein-5 (PR5) is one of the 9 classes
of PR proteins. PR5 shares sequence similarity with osmotin,
thaumatin, and zeamatin proteins (Hu et al. (1997) Plant Mol. Biol.
34:949-959; Ryals et al. (1996) Plant Cell 8:1809-1819). PR5
proteins have been characterized from a wide range of plant species
in both dicotyledonous and monocotyledonous plants. Although the
biological function of PR5 proteins has yet to be established,
members of this group have been shown to have antifungal activities
against a broad range of fungal pathogens (Hu et al. (1997) Plant
Mol. Biol. 34:949-959; Ryals et al. (1996) Plant Cell 8:1809-1819);
Liu et al. (1994) Proc. Natl. Acad. Sci. USA 91:1888-1892; Liu et
al. (1995) Plant Mol. Biol. 29:1015-1026; Zhu et al. (1995) Plant
Physiol. 108:929-937). In Arabidospsis, the induction of PR5 is
SA-dependent. The sunflower PR5-1 gene disclosed herein was
regulated by oxox expression and Sclerotinia-infection. The
sunflower PR5-1 promoter contains potential pathogen-responsive
cis-elements, such as an MRE (MYB recognition element).
[0035] Defensins are one class among the numerous types of Cys-rich
antimicrobial polypeptides, which differ in length, number of
cysteine bonds, or folding pattern (Bomann, H. G. (1995) Annu. Rev.
Immunol. 13:61-92). Like cecropins, insect defensins are produced
in a pathogen-inducible manner by the insect fat body and secreted
in the hemolymph (Huffmann et al. (1992) Immunol. Today
13:411-415). Mammalian defensins are produced by various
specialized cells in the mammalian body (Lehrer et al. (1993) Annu.
Rev. Immunol. 11:105-128; Ganz et al. (1994) Curr. Opin. Immunol.
6:584-589). The structural and functional properties of plant
defensins resemble those of insect and mammalian defensins (Terras
et al. (1995) Plant Cell 7:573-588; Broekaer et al. (1995) Plant
Physiol. 108:1353-1358). Plant defensins inhibit the growth of a
broad range of fungi at micromolar concentrations by inhibiting
hyphal elongation or inhibiting hyphal extension (Broekaer et al.
(1995) Plant Physiol. 108:1353-1358).
[0036] Plant defensins are important components of the defense
system in plants. They are located at the periphery of different
organs and are induced by pathogens. A sunflower cDNA was isolated
that encodes a defensin peptide (SEQ ID NO:6). This defensin gene
was up regulated by Sclerotinia infection, oxox expression, oxalic
acid, H.sub.2O.sub.2 and SA as well as jasmonic acid. In general,
plant defensin genes such as Arabidopsis PDF1.2 and a radish
defensin are induced by pathogens via an SA-independent and
JA-dependent pathway (Thomma et al.) Proc. Natl. Acad. Sci. USA
95:15107-15111; Terras et al. (1995) Plant Cell 7:573-588; Terra et
al. (1988) Planta 206:117-124). The sunflower defensin gene appears
to be the only defensin that is regulated via a SA-dependent
pathway. The sunflower defensin promoter contains potential
pathogen responsive cis-elements, such as W-boxes and G-boxes.
[0037] The proteins of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and
insertions. Methods for such manipulations are generally known in
the art. For example, amino acid sequence variants of the proteins
can be prepared by mutations in the DNA. Methods for mutagenesis
and nucleotide sequence alterations are well-known in the art. See,
for example, Kunkel, T. (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker et al. (1983) (eds.) Techniques in
Molecular Biology, MacMillan Publishing Company, NY and the
references cited therein. Thus, the genes and nucleotide sequences
of the invention include both the naturally occurring sequences as
well as mutant forms. Likewise, the proteins of the invention
encompass both naturally occurring proteins as well as variations
and modified forms thereof. Such variants will continue to possess
the desired defense activation activity. Obviously, the mutations
that will be made in the DNA encoding the variant must not place
the sequence out of reading frame and preferably will not create
complementary regions that could produce secondary mRNA structure.
See, for example, EP Patent Application Publication No. 75,444.
[0038] Fragments and variants of these native nucleotide and amino
acid sequences are also encompassed by the present invention. By
"fragment" is intended a portion of the nucleotide or amino acid
sequence. Fragments of a promoter nucleotide sequence may retain
their regulatory activity. Thus, for example, less than the entire
promoter sequences disclosed herein may be utilized to drive
expression of an operably linked nucleotide sequence of interest,
such as a nucleotide sequence encoding a heterologous protein. It
is within skill in the art to determine whether such fragments
decrease expression levels or alter the nature of expression, i.e.,
and constitutive or inducible expression. Alternatively, fragments
of a promoter nucleotide sequence that are useful as hybridization
probes, such as described below, generally do not retain this
regulatory activity.
[0039] Nucleic acid molecules that are fragments of a promoter
nucleotide sequence comprise at least 15, 20, 25, 30, 35, 40, 45,
50, 75, 100, 325, 350, 375, 400, 425, 450, or 500 nucleotides, or
up to the number of nucleotides present in the full-length promoter
nucleotide sequence set forth in SEQ ID NO: 7, 8, and 9. Fragments
of a promoter sequence that retain their regulatory activity
comprise at least 30, 35, 40 contiguous nucleotides, preferably at
least 50 contiguous nucleotides, more preferably at least 75
contiguous nucleotides, still more preferably at least 100
contiguous nucleotides of the particular promoter nucleotide
sequence disclosed herein. Preferred fragment lengths depend upon
the objective and will also vary depending upon the particular
promoter sequence.
[0040] The nucleotides of such fragments will usually comprise the
TATA recognition sequence of the particular promoter sequence. Such
fragments may be obtained by use of restriction enzymes to cleave
the naturally occurring promoter nucleotide sequence disclosed
herein; by synthesizing a nucleotide sequence from the naturally
occurring sequence of the promoter DNA sequence; or may be obtained
through the use of PCR technology. See particularly, Mullis et al.
(1987) Methods Enzymol. 155:335-350, and Erlich, ed. (1989) PCR
Technology (Stockton Press, New York). Variants of these promoter
fragments, such as those resulting from site-directed mutagenesis,
are also encompassed by the compositions of the present
invention.
[0041] With respect to the antipathogenic nucleotide sequences,
fragments of a nucleotide sequence may encode protein fragments
that retain the biological activity of the native proteins, i.e.,
the sequences set forth in SEQ IDS 1, 2, and 3, and hence enhance
disease resistance when expressed in a plant. Alternatively,
fragments of a coding nucleotide sequence that is useful as
hybridization probes generally do not encode fragment proteins
retaining biological activity. Thus, fragments of a nucleotide
sequence may range from at least about 20 nucleotides, about 50
nucleotides, about 100 nucleotides, and up to the entire nucleotide
sequence encoding the proteins of the invention.
[0042] A fragment of an antipathogenic nucleotide sequence that
encodes a biologically active portion of a protein of the invention
will encode at least 15, 25, 30, 40, 50, 75, 100, or 150 contiguous
amino acids, or up to the total number of amino acids present in a
full-length protein of the invention. Fragments of a nucleotide
sequence of the invention that are useful as hybridization probes
for PCR primers generally need not encode a biologically active
portion of a protein.
[0043] A biologically active portion of a protein of the invention
can be prepared by isolating a portion of one of the nucleotide
sequences of the invention, expressing the encoded portion of the
protein (e.g., by recombinant expression in vitro), and assessing
the activity of the encoded portion of the protein of interest.
Nucleic acid molecules that are fragments of a nucleotide sequence
of the invention comprise at least 15, 20, 50, 75, 100, 325, 350,
375, 400, 425, 450, 500, 550, 600, 650, 700, or 800 nucleotides, or
up to the number of nucleotides present in a full-length sunflower
homologue nucleotide sequence disclosed herein.
[0044] By "variants" is intended substantially similar sequences.
For nucleotide sequences, conservative variants include those
sequences that, because of the degeneracy of the genetic code,
encode the amino acid sequence of one of the antipathogenic
polypeptides of the invention. Naturally occurring allelic variants
such as these can be identified with the use of well-known
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques as outlined
below. Variant nucleotide sequences also include synthetically
derived nucleotide sequences, such as those generated, for example,
by using site-directed mutagenesis but which still encode an
antipathogenic protein of the invention. Generally, variants of a
particular nucleotide sequence of the invention will have at least
40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, 87%,
preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, and more
preferably about 98%, 99% or more sequence identity to that
particular nucleotide sequence as determined by sequence alignment
programs described elsewhere herein using default parameters.
[0045] By "variant" protein is intended a protein derived from the
native protein by deletion (so-called truncation) or addition of
one or more amino acids to the N-terminal and/or C-terminal end of
the native protein; deletion or addition of one or more amino acids
at one or more sites in the native protein; or substitution of one
or more amino acids at one or more sites in the native protein.
Variant proteins encompassed by the present invention are
biologically active, that is they continue to possess the desired
biological activity of the native protein, that is, the defense
activation activity as described herein. Such variants may result
from, for example, genetic polymorphism or from human manipulation.
Biologically active variants of a native antipathogenic protein of
the invention will have at least 40%, 50%, 60%, 70%, generally at
least 75%, 80%, 85%, preferably about 90% to 95% or more, and more
preferably about 98% or more sequence identity to the amino acid
sequence for the native protein as determined by sequence alignment
programs described elsewhere herein using default parameters. A
biologically active variant of a protein of the invention may
differ from that protein by as few as 1-15 amino acid residues, as
few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even
1 amino acid residue.
[0046] The proteins of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and
insertions. Methods for such manipulations are generally known in
the art. For example, amino acid sequence variants of the
antipathogenic proteins can be prepared by mutations in the DNA.
Methods for mutagenesis and nucleotide sequence alterations are
well known in the art. See, for example, Kunkel (1985) Proc. Natl.
Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol.
154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra (eds.)
Techniques in Molecular Biology, MacMillan Publishing Company, NY
(1983) and the references cited therein.
[0047] Thus, the promoters and gene nucleotide sequences of the
invention include both the naturally occurring sequences as well as
mutant forms. Likewise, the proteins of the invention encompass
both naturally occurring proteins as well as variations and
modified forms thereof. Such variants will continue to possess the
desired promoter activity or antipathogenic defense protein
activity. Obviously, the mutations that will be made in the DNA
encoding a variant protein must not place the sequence out of
reading frame and preferably will not create complementary regions
that could produce secondary mRNA structure. See, for example, EP
Patent Application Publication No. 75,444.
[0048] In this manner, the present invention encompasses the
antipathogenic proteins as well as components and fragments
thereof. That is, it is recognized that component polypeptides or
fragments of the proteins may be produced which retain
antipathogenic protein activity that enhances disease resistance in
a plant. These fragments include truncated sequences, as well as
N-terminal, C-terminal, internal and internally deleted amino acid
sequences of the proteins.
[0049] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the antipathogenic proteins.
However, when it is difficult to predict the exact effect of the
substitution, deletion, or insertion in advance of doing so, one
skilled in the art will appreciate that the effect will be
evaluated by routine screening assays. That is, the activity of the
modified protein sequences can be evaluated by monitoring of the
plant defense system. See, for example U.S. Pat. No. 5,614,395,
herein incorporated by reference.
[0050] The nucleotide sequences of the invention can be used to
isolate corresponding sequences from other organisms, particularly
other plants, more particularly other monocots. In this manner,
methods such as PCR, hybridization, and the like can be used to
identify such sequences based on their sequence homology to the
sequences set forth herein. Sequences isolated based on their
sequence identity to the entire antipathogenic sequences set forth
herein or to fragments thereof are encompassed by the present
invention.
[0051] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any plant of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.). See also Innis et al., eds.
(1990) PCR Protocols: A Guide to Methods and Applications (Academic
Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies
(Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR
Methods Manual (Academic Press, New York). Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like.
[0052] In hybridization techniques, all or part of a known
nucleotide sequence is used as a probe that selectively hybridizes
to other corresponding nucleotide sequences present in a population
of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or
cDNA libraries) from a chosen organism. The hybridization probes
may be genomic DNA fragments, cDNA fragments, RNA fragments, or
other oligonucleotides, and may be labeled with a detectable group
such as .sup.32P, or any other detectable marker. Thus, for
example, probes for hybridization can be made by labeling synthetic
oligonucleotides based on the antipathogenic sequences of the
invention. Methods for preparation of probes for hybridization and
for construction of cDNA and genomic libraries are generally known
in the art and are disclosed in Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0053] For example, the entire antipathogenic sequence disclosed
herein, or one or more portions thereof, may be used as a probe
capable of specifically hybridizing to corresponding antipathogenic
sequence or messenger RNAs. Additionally, the promoter sequences
described herein, or one or more portions thereof, may be used a as
a probe capable of hybridizing to corresponding promoter
sequences.
[0054] To achieve specific hybridization under a variety of
conditions, such probes include sequences that are unique among
antipathogenic sequences or promoter sequence and are preferably at
least about 10 nucleotides in length, and most preferably at least
about 20 nucleotides in length. Such probes, may be used to amplify
corresponding antipathogenic sequences or promoter sequences from a
chosen plant by PCR. This technique may be used to isolate
additional coding sequences from a desired plant or as a diagnostic
assay to determine the presence of coding sequences in a plant.
Hybridization techniques include hybridization screening of plated
DNA libraries (either plaques or colonies; see, for example,
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
[0055] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences that are 100% complementary to the probe can be
identified (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Generally, a probe is less than about 1000 nucleotides in
length, preferably less than 500 nucleotides in length.
[0056] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours.
[0057] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with .gtoreq.90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution), it is preferred to increase the SSC concentration so
that a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, New York); and Ausubel et al., eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0058] Thus, isolated sequences that either have promoter activity
or encode for a antipathogenic protein and which hybridize under
stringent conditions to the sequences disclosed herein, or to
fragments thereof, are encompassed by the present invention. Such
sequences will be at least 40% to 50% homologous, about 60% to 70%
homologous, and even about 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97% to 98% homologous or more with the disclosed
sequences. That is, the sequence identity of sequences may range,
sharing at least 40% to 50%, about 60% to 70%, and even about 75%,
80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% to 98% or
more sequence identity.
[0059] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence", (b) "comparison window", (c) "sequence
identity", (d) "percentage of sequence identity", and (e)
"substantial identity".
[0060] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0061] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0062] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent sequence
identity between any two sequences can be accomplished using a
mathematical algorithm. Preferred, non-limiting examples of such
mathematical algorithms are the algorithm of Myers and Miller
(1988) CABIOS 4:11-17; the local homology algorithm of Smith et al.
(1981) Adv. Appl. Math. 2:482; the homology alignment algorithm of
Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453; the
search-for-similarity-method of Pearson and Lipman (1988) Proc.
Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and
Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
[0063] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters. The
CLUSTAL program is well described by Higgins et al. (1988) Gene
73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet
et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992)
CABIOS 8:155-65; and Pearson et al. (1994) Meth. Mol. Biol.
24:307-331. The ALIGN program is based on the algorithm of Myers
and Miller (1988) supra. A PAM120 weight residue table, a gap
length penalty of 12, and a gap penalty of 4 can be used with the
ALIGN program when comparing amino acid sequences. The BLAST
programs of Altschul et al (1990) J. Mol. Biol. 215:403 are based
on the algorithm of Karlin and Altschul (1990) supra. BLAST
nucleotide searches can be performed with the BLASTN program,
score=100, wordlength=12, to obtain nucleotide sequences homologous
to a nucleotide sequence encoding a protein of the invention. BLAST
protein searches can be performed with the BLASTX program,
score=50, wordlength=3, to obtain amino acid sequences homologous
to a protein or polypeptide of the invention. To obtain gapped
alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can
be utilized as described in Altschul et al. (1997) Nucleic Acids
Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used
to perform an iterated search that detects distant relationships
between molecules. See Altschul et al. (1997) supra. When utilizing
BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the
respective programs (e.g., BLASTN for nucleotide sequences, BLASTX
for proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may
also be performed manually by inspection.
[0064] For purposes of the present invention, comparison of
nucleotide or protein sequences for determination of percent
sequence identity to the promoter sequence or the anitpathogenic
sequences disclosed herein is preferably made using the Clustal W
program (Version 1.7 or later) with its default parameters or any
equivalent program. By "equivalent program" is intended any
sequence comparison program that, for any two sequences in
question, generates an alignment having identical nucleotide or
amino acid residue matches and an identical percent sequence
identity when compared to the corresponding alignment generated by
the preferred program.
[0065] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0066] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0067] (e)(i) The term "substantial identity" of polynucleotide
sequences means that a polynucleotide comprises a sequence that has
at least 70% sequence identity, preferably at least 80%, more
preferably at least 90%, and most preferably at least 95%, compared
to a reference sequence using one of the alignment programs
described using standard parameters. One of skill in the art will
recognize that these values can be appropriately adjusted to
determine corresponding identity of proteins encoded by two
nucleotide sequences by taking into account codon degeneracy, amino
acid similarity, reading frame positioning, and the like.
Substantial identity of amino acid sequences for these purposes
normally means sequence identity of at least 60%, more preferably
at least 70%, 80%, 90%, and most preferably at least 95%.
[0068] Another indication that nucleotide sequences are
substantially identical is if two molecules hybridize to each other
under stringent conditions. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence at a defined ionic
strength and pH. However, stringent conditions encompass
temperatures in the range of about 1.degree. C. to about 20.degree.
C. lower than the T.sub.m, depending upon the desired degree of
stringency as otherwise qualified herein. Nucleic acids that do not
hybridize to each other under stringent conditions are still
substantially identical if the polypeptides they encode are
substantially identical. This may occur, e.g., when a copy of a
nucleic acid is created using the maximum codon degeneracy
permitted by the genetic code. One indication that two nucleic acid
sequences are substantially identical is when the polypeptide
encoded by the first nucleic acid is immunologically cross reactive
with the polypeptide encoded by the second nucleic acid.
[0069] (e)(ii) The term "substantial identity" in the context of a
peptide indicates that a peptide comprises a sequence with at least
70% sequence identity to a reference sequence, preferably 80%, more
preferably 85%, most preferably at least 90% or 95% sequence
identity to the reference sequence over a specified comparison
window. Preferably, optimal alignment is conducted using the
homology alignment algorithm of Needleman and Wunsch (1970) J. Mol.
Biol. 48:443-453. An indication that two peptide sequences are
substantially identical is that one peptide is immunologically
reactive with antibodies raised against the second peptide. Thus, a
peptide is substantially identical to a second peptide, for
example, where the two peptides differ only by a conservative
substitution. Peptides that are "substantially similar" share
sequences as noted above except that residue positions that are not
identical may differ by conservative amino acid changes.
[0070] The anti-pathogenic genes and proteins as well as the
anti-pathogenic homologue genes and proteins of the invention can
also be used to control resistance to pathogens by enhancing the
defense mechanisms in a plant. While the exact function of the
antipathogenic homologues is not known, they are involved in
influencing the expression of defense-related proteins. It is
recognized that the present invention is not premised upon any
particular mechanism of action of the anti-pathogenic genes. It is
sufficient for purposes of the invention that the genes and
proteins are involved in the plant defense system and can be used
to increase resistance levels in the plant to pathogens.
[0071] The plant defense mechanisms described herein may be used
alone or in combination with other proteins or agents to protect
against plant diseases and pathogens. Other plant defense proteins
include those described in copending applications entitled "Methods
for Enhancing Disease Resistance in Plants", U.S. Application
Serial No. 60/076,151, filed Feb. 26, 1998, and U.S. Application
Serial No. 60/092,464, filed Jul. 11, 1998, and copending
application entitled "Genes for Activation of Plant Pathogen
Defense Systems ", U.S. Application Serial No. 60/076,083, filed
Feb. 26, 1998, all of which are herein incorporated by
reference.
[0072] The nucleotide sequences of the invention can be introduced
into any plant. The genes to be introduced can be conveniently used
in expression cassettes for introduction and expression in any
plant of interest.
[0073] Such expression cassettes will comprise a transcriptional
initiation region linked to the nucleotide sequence of interest.
Such an expression cassette is provided with a plurality of
restriction sites for insertion of the gene of interest to be under
the transcriptional regulation of the regulatory regions. The
expression cassette may additionally contain selectable marker
genes.
[0074] The transcriptional initiation region, the promoter, may be
native or analogous or foreign or heterologous to the plant host.
Additionally, the promoter may be the natural sequence or
alternatively a synthetic sequence. By foreign is intended that the
transcriptional initiation region is not found in the native plant
into which the transcriptional initiation region is introduced. As
used herein a chimeric gene comprises a coding sequence operably
linked to a transcription initiation region that is heterologous to
the coding sequence.
[0075] The transcriptional cassette will include in the 5'-3'
direction of transcription, a transcriptional and translational
initiation region, a DNA sequence of interest, and a
transcriptional and translational termination region functional in
plants. The termination region may be native with the
transcriptional initiation region, may be native with the DNA
sequence of interest, or may be derived from another source.
Convenient termination regions are available from the Ti-plasmid of
A. tumefaciens, such as the octopine synthase and nopaline synthase
termination regions. See also, Guerineau et al. (1991) Mol. Gen.
Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et
al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell
2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al.
1989) Nuc. Acids Res. 17:7891-7903; Joshi et al. (1987) Nuc. Acid
Res. 15:9627-9639.
[0076] A number of promoters can be used in the practice of the
invention. An inducible promoter can be used to drive the
expression of the genes of the invention. The inducible promoter
will be expressed in the presence of a pathogen to prevent
infection and disease symptoms. Such promoters include those from
pathogenesis-related proteins (PR proteins), which are induced
following infection by a pathogen; e.g., PR proteins, SAR proteins,
beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et
al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992)
Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol.
4:111-116. See, also the copending applications entitled "Inducible
Maize Promoters", U.S. Application Serial No. 60/076,100, filed
Feb. 26, 1998 and U.S. Application Serial No. 60/079,648, filed
Feb. 27, 1998, and herein incorporated by reference.
[0077] Of interest are promoters that are expressed locally at or
near the site of pathogen infection. See, for example, Marineau et
al. (1987) Plant Mol. Biol. 1:335-342; Matton et al. (1989)
Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al.
(1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al.
(1988) Molecular and General Genetics 2:93-98; and Yang (1996)
Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al.
(1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad.
Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201;
Siebertz et al. (1989) Plant Cell 1:961-968; and the references
cited therein. Of particular interest is the inducible promoter for
the maize PRms gene, whose expression is induced by the pathogen
Fusarium moniliforme (see, for example, Cordero et al. (1992)
Physiol. Mol. Plant Path. 41:189-200).
[0078] Additionally, as pathogens find entry into plants through
wounds or insect damage, a wound inducible promoter may be used in
the constructions of the invention. Such wound inducible promoters
include potato proteinase inhibitor (pin II) gene (Ryan et al. Ann.
Rev. Phytopath. 28:425-449; Duan et al. Nature Biotechnology
14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2
(Stanford et al. Mol. Gen Genet 215:200-208); system in (McGurl et
al. Science 225:1570-1573); WIPI (Rohmeier et al. Plant Mol. Biol.
22:783-792; Eckelkamp et al. FEBS Letters 323:73-76); MPI gene
(Corderok et al. Plant Journal 6(2): 141-150); and the like, herein
incorporated by reference.
[0079] Constitutive promoters include, for example, the Rsyn7
(copending U.S. application Ser. No. 08/661,601), the scp1 promoter
(copending U.S. application Ser. No. 09/028,819), the ucp promoter,
35S CaMV promoter, and the like. Other constitutive promoters
include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144;
5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142.
See also, copending application entitled "Constitutive Maize
Promoters", U.S. Application Serial No. 60/076,075, filed Feb. 26,
1998, and herein incorporated by reference.
[0080] Tissue-preferred promoters include Yamamoto et al. (1997)
Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol.
38(7):792-803; Hansen et al. (1997) Mol Gen Genet. 254(3):337-343;
Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al.
(1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996)
Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant
Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol.
35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196;
Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Matsuoka et
al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and
Guevara-Garcia et al. (1993) Plant J. 4(3):495-505.
[0081] The nucleotide sequences for the constitutive promoters
disclosed in the present invention, as well as variants and
fragments thereof, are useful in the genetic manipulation of any
plant when assembled within a DNA construct such that the promoter
sequence is operably linked with a heterologous nucleotide sequence
whose constitutive expression is to be controlled to achieve a
desired phenotypic response. By "operably linked" is intended the
transcription or translation of the heterologous nucleotide
sequence is under the influence of the promoter sequence. In this
manner, the nucleotide sequences for the promoters of the invention
are provided in expression cassettes along with heterologous
nucleotide sequences for expression in the plant of interest. It is
recognized that the promoter sequences of the invention may also be
used with their native coding sequences to increase or decrease
expression of the native coding sequence, thereby resulting in a
change in phenotype in the transformed plant.
[0082] The promoter nucleotide sequences and methods disclosed
herein are useful in regulating expression of any heterologous
nucleotide sequence in a host plant in order to vary the phenotype
of a plant. Various changes in phenotype are of interest including
modifying the fatty acid composition in a plant, altering the amino
acid content of a plant, altering a plant's pathogen defense
mechanism, and the like. These results can be achieved by providing
expression of heterologous products or increased expression of
endogenous products in plants. Alternatively, the results can be
achieved by providing for a reduction of expression of one or more
endogenous products, particularly enzymes or cofactors in the
plant. These changes result in a change in phenotype of the
transformed plant.
[0083] Genes of interest are reflective of the commercial markets
and interests of those involved in the development of the crop.
Crops and markets of interest change, and as developing nations
open up world markets, new crops and technologies will emerge also.
In addition, as our understanding of agronomic traits and
characteristics such as yield and heterosis increase, the choice of
genes for transformation will change accordingly. General
categories of genes of interest include for example, those genes
involved in information, such as zinc fingers, those involved in
communication, such as kinases, and those involved in housekeeping,
such as heat shock proteins. More specific categories of
transgenes, for example, include genes encoding important traits
for agronomics, insect resistance, disease resistance, herbicide
resistance, sterility, grain characteristics, and commercial
products. Genes of interest include, generally, those involved in
oil, starch, carbohydrate, or nutrient metabolism as well as those
affecting kernel size, sucrose loading, and the like.
[0084] Agronomically important traits such as oil, starch, and
protein content can be genetically altered in addition to using
traditional breeding methods. Modifications include increasing
content of oleic acid, saturated and unsaturated oils, increasing
levels of lysine and sulfur, providing essential amino acids, and
also modification of starch. Hordothionin protein modifications are
described in U.S. Pat. Nos. 5,703,049, 5,885,801, 5,885,802, and
5,990,389; herein incorporated by reference. Another example is
lysine and/or sulfur rich seed protein encoded by the soybean 2S
albumin described in U.S. Ser. No. 08/618,911, filed Mar. 20, 1996,
and the chymotrypsin inhibitor from barley, Williamson et al.
(1987) Eur. J. Biochem. 165:99-106, the disclosures of which are
herein incorporated by reference.
[0085] Derivatives of the coding sequences can be made by site
directed mutagenesis to increase the level of preselected amino
acids in the encoded polypeptide. For example, the gene encoding
the barley high lysine polypeptide (BHL) is derived from barley
chymotrypsin inhibitor, U.S. Ser. No. 08/740,682, filed Nov. 1,
1996, and PCT/US97/20441, filed Oct. 31, 1997, the disclosures of
each are incorporated herein by reference. Other proteins include
methionine-rich plant proteins such as from sunflower seed (Lilley
et al. (1989) Proceedings of the World Congress on Vegetable
Protein Utilization in Human Foods and Animal Feedstuffs, ed.
Applewhite (American Oil Chemists Society, Champaign, Ill.), pp.
497-502; herein incorporated by reference)); corn (Pedersen et al.
(1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359;
both of which are herein incorporated by reference); and rice
(Musumura et al. (1989) Plant Mol. Biol. 12:123, herein
incorporated by reference). Other agronomically important genes
encode latex, Floury 2, growth factors, seed storage factors, and
transcription factors.
[0086] Insect resistance genes may encode resistance to pests that
have great yield drag such as rootworm, cutworm, European Corn
Borer, and the like. Such genes include, for example Bacillus
thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881; Geiser et al. (1986)
Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol.
24:825); and the like.
[0087] Genes encoding disease resistance traits include
detoxification genes, such as against fumonosin (U.S. patent
application Ser. No. 08/484,815, filed Jun. 7, 1995); avirulence
(avr) and disease resistance (R) genes (Jones et al. (1994) Science
266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al.
(1994) Cell 78:1089); and the like.
[0088] Herbicide resistance traits may include genes coding for
resistance to herbicides that act to inhibit the action of
acetolactate synthase (ALS), in particular the sulfonylurea-type
herbicides (e.g., the acetolactate synthase (ALS) gene containing
mutations leading to such resistance, in particular the S4 and/or
Hra mutations), genes coding for resistance to herbicides that act
to inhibit action of glutamine synthase, such as phosphinothricin
or basta (e.g., the bar gene), or other such genes known in the
art. The bar gene encodes resistance to the herbicide basta, the
nptII gene encodes resistance to the antibiotics kanamycin and
geneticin, and the ALS gene encodes resistance to the herbicide
chlorsulfuron.
[0089] Sterility genes can also be encoded in an expression
cassette and provide an alternative to physical detasseling.
Examples of genes used in such ways include male tissue-preferred
genes and genes with male sterility phenotypes such as QM,
described in U.S. Pat. No. 5,583,210. Other genes include kinases
and those encoding compounds toxic to either male or female
gametophytic development.
[0090] The quality of grain is reflected in traits such as levels
and types of oils, saturated and unsaturated, quality and quantity
of essential amino acids, and levels of cellulose. In corn,
modified hordothionin proteins, described in U.S. Pat. Nos.
5,703,049, 5,885,801, 5,885,802, and 5,990,389, provide
descriptions of modifications of proteins for desired purposes.
[0091] Commercial traits can also be encoded on a gene or genes
that could increase for example, starch for ethanol production, or
provide expression of proteins. Another important commercial use of
transformed plants is the production of polymers and bioplastics
such as described in U.S. Pat. No. 5,602,321 issued Feb. 11, 1997.
Genes such as B-Ketothiolase, PHBase (polyhydroxyburyrate synthase)
and acetoacetyl-CoA reductase (see Schubert et al. (1988) J.
Bacteriol. 170:5837-5847) facilitate expression of
polyhyroxyalkanoates (PHAs).
[0092] Exogenous products include plant enzymes and products as
well as those from other sources including procaryotes and other
eucaryotes. Such products include enzymes, cofactors, hormones, and
the like. The level of proteins, particularly modified proteins
having improved amino acid distribution to improve the nutrient
value of the plant, can be increased. This is achieved by the
expression of such proteins having enhanced amino acid content.
[0093] Thus, the heterologous nucleotide sequence operably linked
to one of the constitutive promoters disclosed herein may be a
structural gene encoding a protein of interest. Examples of such
heterologous genes include, but are not limited to, genes encoding
proteins conferring resistance to abiotic stress, such as drought,
temperature, salinity, and toxins such as pesticides and
herbicides, or to biotic stress, such as attacks by fungi, viruses,
bacteria, insects, and nematodes, and development of diseases
associated with these organisms. More particularly, the
constitutive promoters disclosed herein and identified as weak
constitutive promoters are useful in transforming plants to
constitutively express an avirulence gene as disclosed in the
copending applications both entitled "Methods for Enhancing Disease
Resistance in Plants," U.S. Application Serial No. 60/075,151,
filed Feb. 26, 1998, and U.S. Application Serial No. 60/092,464,
filed Jul. 11, 1998, both of which are herein incorporated by
reference. Such weak promoters may cause activation of the plant
defense system short of hypersensitive cell death. Thus, there is
an activation of the plant defense system at levels sufficient to
protect from pathogen invasion. In this state, there is at least a
partial activation of the plant defense system wherein the plant
produces increased levels of antipathogenic factors such as PR
proteins, i.e., PR-1, cattiness, a-glucanases, etc.; secondary
metabolites; phytoalexins; reactive oxygen species; and the
like.
[0094] Alternatively, the heterologous nucleotide sequence operably
linked to one of the constitutive promoters disclosed herein may be
an antisense sequence for a targeted gene. By "antisense DNA
nucleotide sequence" is intended a sequence that is in inverse
orientation to the 5' to 3' normal orientation of that nucleotide
sequence. When delivered into a plant cell, expression of the
antisense DNA sequence prevents normal expression of the DNA
nucleotide sequence for the targeted gene. The antisense nucleotide
sequence encodes an RNA transcript that is complementary to and
capable of hybridizing to the endogenous messenger RNA (mRNA)
produced by transcription of the DNA nucleotide sequence for the
targeted gene. In this case, production of the native protein
encoded by the targeted gene is inhibited to achieve a desired
phenotypic response. Thus the promoter sequences disclosed herein
may be operably linked to antisense DNA sequences to reduce or
inhibit expression of a native protein in the plant.
[0095] The genes and promoters of the invention are provided in
expression cassettes for expression in the plant of interest. The
cassette will include 5' and 3' regulatory sequences operably
linked to the gene of interest. The cassette may additionally
contain at least one additional gene to be cotransformed into the
organism. Alternatively, the additional gene(s) can be provided on
another expression cassette. Where appropriate, the gene(s) may be
optimized for increased expression in the transformed plant. That
is, the genes can be synthesized using plant preferred codons for
improved expression. Methods are available in the art for
synthesizing plant preferred genes. See, for example, U.S. Pat.
Nos. 5,380,831, 5,436,391, and Murray et al. (1989) Nuc. Acids Res.
17:477498, herein incorporated by reference.
[0096] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences, which may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
[0097] The expression cassettes may additionally contain 5' leader
sequences in the expression cassette construct. Such leader
sequences can act to enhance translation. Translation leaders are
known in the art and include: picomavirus leaders, for example,
EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein
et al. (1989) PNAS USA 86:6126-6130); potyvirus leaders, for
example, TEV leader (Tobacco Etch Virus) (Allison et al. (1986);
MDMV leader (Maize Dwarf Mosaic Virus); Virology 154:9-20), and
human immunoglobulin heavy-chain binding protein (BiP), (Macejak et
al. (1991) Nature 353:90-94; untranslated leader from the coat
protein mRNA of alfalfa mosaic virus (AMV RNA 4), (Jobling et al.
(1987) Nature 325:622-625; tobacco mosaic virus leader (TMV),
(Gallie, D. R. (1989) Molecular Biology of RNA 237-256; and maize
chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology
81:382-385). See also, Della-Cioppa et al. (1987) Plant Physiology
84:965-968. Other methods known to enhance translation can also be
utilized, for example, introns, and the like.
[0098] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Towards this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g. transitions and transversions, may
be involved.
[0099] The genes of the present invention can be used to transform
any plant. In this manner, genetically modified plants, plant
cells, plant tissue, seed, and the like can be obtained.
Transformation protocols may vary depending on the type of plant or
plant cell, i.e. monocot or dicot, targeted for transformation.
Suitable methods of transforming plant cells include microinjection
(Crossway et al. (1986) Biotechniques 4:320-334), electroporation
(Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606,
Agrobacterium mediated transformation (Hinchee et al. (1988)
Biotechnology 6:915-921), direct gene transfer (Paszkowski et al.
(1984) EMBO J. 3:2717-2722), and ballistic particle acceleration
(see, for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes
et al. Direct DNA Transfer into Intact Plant Cells via
Microprojectile Bombardment; In Gamborg and Phillips (Eds.) Plant
Cell, Tissue and Organ Culture: Fundamental Methods,
Springer-Verlag, Berlin (1995); and McCabe et al. (1988)
Biotechnology 6:923-926). Also see, Weissinger et al. (1988) Ann.
Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science
and Technology 5:27-37 (onion); Christou et al. (1988) Plant
Physiol. 87:671-674(soybean); McCabe et al. (1988) Bio/Technology
6:923-926 (soybean); Datta et al. (1990) Biotechnology 8:736-740
(rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 5:4305-4309
(maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); Tomes
et al. Direct DNA Transfer into Intact Plant Cells via
Microprojectile Bombardment; In Gamborg and Phillips (eds.) Plant
Cell, Tissue and Organ Culture: Fundamental Methods,
Springer-Verlag, Berlin (1995) (maize); Klein et al. (1988) Plant
Physiol. 91:440-444(maize); Fromm et al. (1990) Biotechnology
8:833-839 (maize); Hooydaas-Van Slogteren et al. (1984) Nature
(London) 311:763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci.
USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) In The
Experimental Manipulation of Ovule Tissues ed. G. P. Chapman et
al., pp. 197-209. Longman, NY (pollen); Kaeppler et al. (1990)
Plant Cell Reports 9:415-418; and Kaeppler et al. (1992) Theor.
Appl. Genet. 84:560-566 (whisker-mediated transformation);
D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation);
Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and
Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al.
(1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); all of which are herein incorporated by
reference.
[0100] The cells, which have been transformed, may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having the
desired phenotypic characteristic identified. Two or more
generations may be grown to ensure that the subject phenotypic
characteristic is stably maintained and inherited and then seeds
harvested to ensure the desired phenotype or other property has
been achieved.
[0101] The methods of the invention can be used with other methods
available in the art for enhancing disease resistance in
plants.
[0102] Methods for increasing pathogen resistance in a plant are
provided. The methods involve stably transforming a plant with a
DNA construct comprising an anti-pathogenic nucleotide sequence of
the invention operably linked to promoter that drives expression in
a plant. Such methods find use in agriculture particularly in
limiting the impact of plant pathogens on crop plants. The
anti-pathogenic nucleotide sequences comprise sunflower genes.
Particularly, the sunflower genes are selected from the genes
encoding PR5, defensin and BBE. While the choice of promoter will
depend on the desired timing and location of expression of the
anti-pathogenic nucleotide sequences, preferred promoters include
constitutive and pathogen-inducible promoters.
[0103] Methods are provided for increasing the resistance of a
plant to a pathogen involving stably transforming a plant with a
DNA construct comprising a nucleotide sequence of an inducible
promoter of an antipathogenic gene of the invention operably linked
to a second nucleotide sequence. Preferably, the promoter is
selected from the promoters of genes encoding a PR5, a BBE
homologue or a defensin. More preferably, the promoter has a
nucleotide sequence selected from the sequences set forth in SEQ ID
NO:7, SEQ ID NO:8, and SEQ ID NO:9. Although any one of a variety
of second nucleotide sequences may be utilized, preferred
embodiments of the invention encompass those second nucleotide
sequences that, when expressed in a plant, help to increase the
resistance of a plant to pathogens. It is recognized that such
second nucleotide sequences may be used in either the sense or
antisense orientation depending on the desired outcome.
[0104] Antisense nucleotides are constructed to hybridize with the
corresponding mRNA. Modifications of the antisense sequences may be
made as long as the sequences hybridize to and interfere with
expression of the corresponding mRNA. In this manner, antisense
constructions having 70%, preferably 80%, more preferably 85%
sequence identity to the corresponding antisense sequences may be
used. Furthermore, portions of the antisense nucleotides may be
used to disrupt the expression of the target gene. Generally,
sequences of at least 50 nucleotides, 100 nucleotides, 200
nucleotides, or greater may be used. Examples of such second
nucleotide sequences include, but are not limited to, sequences
encoding PR1, different members of defensin, or BBE, PR5,
antifungal peptides such as tachyplesin, chitinases, glucanase,
etc.
[0105] Additionally provided are transformed plants, plant cells,
plant tissues and seeds thereof.
[0106] By "pathogenic agent" are intended pathogenic organisms such
as fungi, bacteria, viruses, and disease causing microorganisms.
Additionally included are nematodes, insects and the like.
Pathogens of the invention include, but are not limited to, viruses
or viroids, bacteria, insects, nematodes, fungi, and the like.
Viruses include tobacco or cucumber mosaic virus, ringspot virus,
necrosis virus, maize dwarf mosaic virus, etc.
[0107] Specific fungal and viral pathogens for the major crops
include: Soybeans: Phytophthora megasperma fsp. glycinea,
Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia
sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae
(Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium
rolfsii, Cercospora kikuchii, Cercospora sojina, Peronospora
manshurica, Colletotrichum dematium (Colletotichum truncatum),
Corynespora cassiicola, Septoria glycines, Phyllosticta sojicola,
Alternaria alternata, Pseudomonas syringae p.v. glycinea,
Xanthomonas campestris p.v. phaseoli, Microsphaera diffusa,
Fusarium semitectum, Phialophora gregata, Soybean mosaic virus,
Glomerella glycines, Tobacco Ring spot virus, Tobacco Streak virus,
Phakopsora pachyrhizi, Pythium aphanidermatum, Pythium ultimum,
Pythium debaryanum, Tomato spotted wilt virus, Heterodera glycines
Fusarium solani; Canola: Albugo candida, Alternaria brassicae,
Leptosphaeria maculans, Rhizoctonia solani, Sclerotinia
sclerotiorum, Mycosphaerella brassiccola, Pythium ultimum,
Peronospora parasitica, Fusarium roseum, Alternaria alternata;
Alfalfa: Clavibater michiganese subsp. insidiosum, Pythium ultimum,
Pythium irregulare, Pythium splendens, Pythium debaryanum, Pythium
aphanidermatum, Phytophthora megasperma, Peronospora trifoliorum,
Phoma medicaginis var. medicaginis, Cercospora medicaginis,
Pseudopeziza medicaginis, Leptotrochila medicaginis, Fusar-atrum,
Xanthomonas campestris p.v. alfalfae, Aphanomyces euteiches,
Stemphylium herbarum, Stemphylium alfalfae; Wheat: Pseudomonas
syringae p.v. atrofaciens, Urocystis agropyri, Xanthomonas
campestris p.v. translucens, Pseudomonas syringae p.v. syringae,
Alternaria alternata, Cladosporium herbarum, Fusarium graminearum,
Fusarium avenaceum, Fusarium culmorum, Ustilago tritici, Ascochyta
tritici, Cephalosporium gramineum, Collotetrichum graminicola,
Erysiphe graminis f.sp. tritici, Puccinia graminis f.sp. tritici,
Puccinia recondita f.sp. tritici, Puccinia striiformis, Pyrenophora
tritici-repentis, Septoria nodorum, Septoria tritici, Septoria
avenae, Pseudocercosporella herpotrichoides, Rhizoctonia solani,
Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici, Pythium
aphanidermatum, Pythium arrhenomanes, Pythium ultimum, Bipolaris
sorokiniana, Barley Yellow Dwarf Virus, Brome Mosaic Virus, Soil
Borne Wheat Mosaic Virus, Wheat Streak Mosaic Virus, Wheat Spindle
Streak Virus, American Wheat Striate Virus, Claviceps purpurea,
Tilletia tritici, Tilletia laevis, Ustilago tritici, Tilletia
indica, Rhizoctonia solani, Pythium arrhenomannes, Pythium
gramicola, Pythium aphanidermatum, High Plains Virus, European
wheat striate virus; Sunflower: Plasmophora halstedii, Sclerotinia
sclerotiorum, Aster Yellows, Septoria helianthi, Phomopsis
helianthi, Alternaria helianthi, Alternaria zinniae, Botrytis
cinerea, Phoma macdonaldii, Macrophomina phaseolina, Erysiphe
cichoracearum, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus
stolonifer, Puccinia helianthi, Verticillium dahliae, Erwinia
carotovorum pv. carotovora, Cephalosporium acremonium, Phytophthora
cryptogea, Albugo tragopogonis, Orobanche cumana; Corn: Fusarium
moniliforme var. subglutinans, Erwinia stewartii, Fusarium
moniliforme, Gibberella zeae (Fusarium graminearum), Stenocarpella
maydi (Diplodia maydis), Pythium irregulare, Pythium debaryanum,
Pythium graminicola, Pythium splendens, Pythium ultimum, Pythium
aphanidermatum, Aspergillus flavus, Bipolaris maydis O, T
(Cochliobolus heterostrophus), Helminthosporium carbonum I, II
& III (Cochliobolus carbonum), Exserohilum turcicum I, II &
III, Helminthosporium pedicellatum, Physoderma maydis, Phyllosticta
maydis, Kabatie-maydis, Cercospora sorghi, Ustilago maydis,
Puccinia sorghi, Puccinia polysora, Macrophomina phaseolina,
Penicillium oxalicum, Nigrospora oryzae, Cladosporium herbarum,
Curvularia lunata, Curvularia inaequalis, Curvularia pallescens,
Clavibacter michiganense subsp. nebraskense, Trichoderma viride,
Maize Dwarf Mosaic Virus A & B, Wheat Streak Mosaic Virus,
Maize Chlorotic Dwarf Virus, Claviceps sorghi, Pseudonomas avenae,
Erwinia chrysanthemi pv. zea, Erwinia corotovora, Cornstunt
spiroplasma, Diplodia macrospora, Sclerophthora macrospora,
Peronosclerospora sorghi, Peronosclerospora philippinensis,
Peronosclerospora maydis, Peronosclerospora sacchari, Spacelotheca
reiliana, Physopella zeae, Cephalosporium maydis, Caphalosporium
acremonium, Maize Chlorotic Mottle Virus, High Plains Virus, Maize
Mosaic Virus, Maize Rayado Fino Virus, Maize Streak Virus, Maize
Stripe Virus, Maize Rough Dwarf Virus; Sorghum: Exserohilum
turcicum, Colletotrichum graminicola (Glomerella graminicola),
Cercospora sorghi, Gloeocercospora sorghi, Ascochyta sorghina,
Pseudomonas syringae p.v. syringae, Xanthomonas campestris p.v.
holcicola, Pseudomonas andropogonis, Puccinia purpurea,
Macrophomina phaseolina, Perconia circinata, Fusarium moniliforme,
Alternaria alternate, Bipolaris sorghicola, Helminthosporium
sorghicola, Curvularia lunata, Phoma insidiosa, Pseudomonas avenae
(Pseudomonas alboprecipitans), Ramulispora sorghi, Ramulispora
sorghicola, Phyllachara sacchari, Sporisorium reilianum
(Sphacelotheca reiliana), Sphacelotheca cruenta, Sporisorium
sorghi, Sugarcane mosaic H, Maize Dwarf Mosaic Virus A & B,
Claviceps sorghi, Rhizoctonia solani, Acremonium strictum,
Sclerophthona macrospora, Peronosclerospora sorghi,
Peronosclerospora philippinensis, Sclerospora graminicola, Fusarium
graminearum, Fusarium oxysporum, Pythium arrhenomanes, Pythium
graminicola, etc.
[0108] Nematodes include parasitic nematodes such as root knot,
cyst, reniform and lesion nematodes, etc.
[0109] Insect pests include insects selected from the orders
Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga,
Homoptera, Hemiptera, Orthoptera, Thysanoptera, Dermaptera,
Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly
Coleoptera and Lepidoptera. Insect pests of the invention for the
major crops include: Maize: Ostrinia nubilalis, European corn
borer; Agrotis ipsilon, black cutworm; Helicoverpa zea, corn
earworm; Spodoptera frugiperda, fall armyworm; Diatraea
grandiosella, southwestern corn borer; Elasmopalpus lignosellus,
lesser cornstalk borer; Diatraea saccharalis, surgarcane borer;
Diabrotica virgifera, western corn rootworm; Diabrotica longicornis
barberi, northern corn rootworm; Diabrotica undecimpunctata
howardi, southern corn rootworm; Melanotus spp., wireworms;
Cyclocephala borealis, northern masked chafer (white grub);
Cyclocephala immaculata, southern masked chafer (white grub);
Popillia japonica, Japanese beetle; Chaetocnema pulicaria, corn
flea beetle; Sphenophorus maidis, maize billbug; Rhopalosiphum
maidis, corn leaf aphid; Anuraphis maidiradicis, corn root aphid;
Blissus leucopterus leucopterus, chinch bug; Melanoplus
femurrubrum, redlegged grasshopper; Melanoplus sanguinipes,
migratory grasshopper; Hylemya platura, seedcorn maggot; Agromyza
parvicornis, corn blot leafminer; Anaphothrips obscrurus, grass
thrips; Solenopsis milesta, thief ant; Tetranychus urticae,
twospotted spider mite; Sorghum: Chilo partellus, sorghum borer;
Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn
earworm; Elasmopalpus lignosellus, lesser cornstalk borer; Feltia
subterranea, granulate cutworm; Phyllophaga crinita, white grub;
Eleodes, Conoderus, and Aeolus spp., wireworms; Oulema melanopus,
cereal leaf beetle; Chaetocnema pulicaria, corn flea beetle;
Sphenophorus maidis, maize billbug; Rhopalosiphum maidis; corn leaf
aphid; Sipha flava, yellow sugarcane aphid; Blissus leucopterus
leucopterus, chinch bug; Contarinia sorghicola, sorghum midge;
Tetranychus cinnabarinus, carmine spider mite; Tetranychus urticae,
twospotted spider mite; Wheat: Pseudaletia unipunctata, army worm;
Spodoptera frugiperda, fall armyworm; Elasmopalpus lignosellus,
lesser cornstalk borer; Agrotis orthogonia, western cutworm;
Elasmopalpus lignosellus, lesser cornstalk borer; Oulema melanopus,
cereal leaf beetle; Hypera punctata, clover leaf weevil; Diabrotica
undecimpunctata howardi, southern corn rootworm; Russian wheat
aphid; Schizaphis graminum, greenbug; Macrosiphum avenae, English
grain aphid; Melanoplus femurrubrum, redlegged grasshopper;
Melanoplus differentialis, differential grasshopper; Melanoplus
sanguinipes, migratory grasshopper; Mayetiola destructor, Hessian
fly; Sitodiplosis mosellana, wheat midge; Meromyza americana, wheat
stem maggot; Hylemya coarctata, wheat bulb fly; Frankliniella
fusca, tobacco thrips; Cephus cinctus, wheat stem sawfly; Aceria
tulipae, wheat curl mite; Sunflower: Suleima helianthana, sunflower
bud moth; Homoeosoma electellum, sunflower moth; zygogramma
exclamationis, sunflower beetle; Bothyrus gibbosus, carrot beetle;
Neolasioptera murtfeldtiana, sunflower seed midge; Cotton:
Heliothis virescens, cotton budworm; Helicoverpa zea, cotton
bollworm; Spodoptera exigua, beet armyworm; Pectinophora
gossypiella, pink bollworm; Anthonomus grandis, boll weevil; Aphis
gossypii, cotton aphid; Pseudatomoscelis seriatus, cotton
fleahopper; Trialeurodes abutilonea, bandedwinged whitefly; Lygus
lineolaris, tarnished plant bug; Melanoplus femurrubrum, redlegged
grasshopper; Melanoplus differentialis, differential grasshopper;
Thrips tabaci, onion thrips; Franklinkiella fusca, tobacco thrips;
Tetranychus cinnabarinus, carmine spider mite; Tetranychus urticae,
twospotted spider mite; Rice: Diatraea saccharalis, sugarcane
borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn
earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus
oryzophilus, rice water weevil; Sitophilus oryzae, rice weevil;
Nephotettix nigropictus, rice leafhopper; Blissus leucopterus
leucopterus, chinch bug; Acrosternum hilare, green stink bug;
Soybean: Pseudoplusia includens, soybean looper; Anticarsia
gemmatalis, velvetbean caterpillar; Plathypena scabra, green
cloverworm; Ostrinia nubilalis, European corn borer; Agrotis
ipsilon, black cutworm; Spodoptera exigua, beet armyworm; Heliothis
virescens, cotton budworm; Helicoverpa zea, cotton bollworm;
Epilachna varivestis, Mexican bean beetle; Myzus persicae, green
peach aphid; Empoasca fabae, potato leafhopper; Acrosternum hilare,
green stink bug; Melanoplus femurrubrum, redlegged grasshopper;
Melanoplus differentialis, differential grasshopper; Hylemya
platura, seedcorn maggot; Sericothrips variabilis, soybean thrips;
Thrips tabaci, onion thrips; Tetranychus turkestani, strawberry
spider mite; Tetranychus urticae, twospotted spider mite; Barley:
Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black
cutworm; Schizaphis graminum, greenbug; Blissus leucopterus
leucopterus, chinch bug; Acrosternum hilare, green stink bug;
Euschistus servus, brown stink bug; Delia platura, seedcorn maggot;
Mayetiola destructor, Hessian fly; Petrobia latens, brown wheat
mite; Oil Seed Rape: Brevicoryne brassicae, cabbage aphid;
Phyllotreta cruciferae, Flea beetle; Mamestra configurata, Bertha
armyworm; Plutella xylostella, Diamond-back moth; Delia ssp., Root
maggots.
[0110] The present invention also provides isolated nucleic acids
comprising polynucleotides of sufficient length and complementarity
to a gene of the invention to use as probes or amplification
primers in the detection, quantitation, or isolation of gene
transcripts. For example, isolated nucleic acids of the present
invention can be used as probes in detecting deficiencies in the
level of mRNA in screenings for desired transgenic plants, for
detecting mutations in the gene (e.g., substitutions, deletions, or
additions), for monitoring upregulation of expression or changes in
enzyme activity in screening assays of compounds, for detection of
any number of allelic variants (polymorphisms) of the gene, or for
use as molecular markers in plant breeding programs. The isolated
nucleic acids of the present invention can also be used for
recombinant expression of polypeptides, or for use as immunogens in
the preparation and/or screening of antibodies. The isolated
nucleic acids of the present invention can also be employed for use
in sense or antisense suppression of one or more genes of the
invention in a host cell, tissue, or plant. Attachment of chemical
agents, which bind, intercalate, cleave and/or crosslink to the
isolated nucleic acids of the present invention can also be used to
modulate transcription or translation. Further, using a primer
specific to an insertion sequence (e.g., transposon) and a primer
which specifically hybridizes to an isolated nucleic acid of the
present invention, one can use nucleic acid amplification to
identity insertion sequence inactivated genes of the invention from
a cDNA library prepared from insertion sequence mutagenized plants.
Progeny seed from the plants comprising the desired inactivated
gene can be grown to a plant to study the phenotypic changes
characteristic of that inactivation. See, Tools to Determine the
Function of Genes, 1995 Proceedings of the Fiftieth Annual Corn and
Sorghum Industry Research Conference, American Seed Trade
Association, Washington, D.C., 1995. Additionally, non-translated
5' or 3' regions of the polynucleotides of the present invention
can be used to modulate turnover of heterologous mRNAs and/or
protein synthesis. Further, the codon preference characteristic of
the polynucleotides of the present invention can be employed in
heterologous sequences, or altered in homologous or heterologous
sequences, to modulate translational level and/or rates.
[0111] The present invention provides a method of genotyping a
plant comprising a polynucleotide of the present invention. The
plant may be a monocot, such as maize or sorghum, or alternatively,
a dicot, such as sunflower or soybean. Genotyping provides a means
of distinguishing homologues of a chromosome pair and can be used
to differentiate segregants in a plant population. Molecular marker
methods can be used for phylogenetic studies, characterizing
genetic relationships among crop varieties, identifying crosses or
somatic hybrids, localizing chromosomal segments affecting
monogenic traits, map based cloning, and the study of quantitative
inheritance. See, e.g., Plant Molecular Biology: A Laboratory
Manual, Chapter 7, Clark, Ed., Springer-Verlag, Berlin (1997). For
molecular marker methods, see generally, The DNA Revolution by
Andrew H. Paterson 1996 (Chapter 2) in: Genome Mapping in Plants
(ed. Andrew H. Paterson) by Academic Press/R. G. Landis Company,
Austin, Tex., pp. 7-21.
[0112] The particular method of genotyping in the present invention
may employ any number of molecular marker analytic techniques such
as, but not limited to, restriction fragment length polymorphisms
(RFLPs). Thus, the present invention further provides a means to
follow segregation of a gene or nucleic acid of the present
invention as well as chromosomal sequences genetically linked to
these genes or nucleic acids using such techniques as RFLP
analysis. Linked chromosomal sequences are within 50 centiMorgans
(cM), often within 40 or 30 cM, preferably within 20 or 10 cM, more
preferably within 5, 3, 2, or 1 cM of a gene of the invention.
[0113] In the present invention, the nucleic acid probes employed
for molecular marker mapping of plant nuclear genomes selectively
hybridize, under selective hybridization conditions, to a gene
encoding a polynucleotide of the present invention. In preferred
embodiments, the probes are selected from polynucleotides of the
present invention. Typically, these probes are cDNA probes or Pst I
genomic clones. The length of the probes is discussed in greater
detail, supra, but are typically at least 15 bases in length, more
preferably at least 20, 25, 30, 35, 40, or 50 bases in length.
Generally, however, the probes are less than about 1 kilobase in
length. Preferably, the probes are single copy probes that
hybridize to a unique locus in a haploid chromosome complement.
[0114] The present invention further provides a method of
genotyping comprising the steps of contacting, under stringent
hybridization conditions, a sample suspected of comprising a
polynucleotide of the present invention with a nucleic acid probe.
Generally, the sample is a plant sample; preferably, a sample
suspected of comprising a maize polynucleotide of the present
invention (e.g., gene, mRNA). The nucleic acid probe selectively
hybridizes, under stringent conditions, to a subsequence of a
polynucleotide of the present invention comprising a polymorphic
marker. Selective hybridization of the nucleic acid probe to the
polymorphic marker nucleic acid sequence yields a hybridization
complex. Detection of the hybridization complex indicates the
presence of that polymorphic marker in the sample. In preferred
embodiments, the nucleic acid probe comprises a polynucleotide of
the present invention.
[0115] Methods are provided for controlling plant pathogens
comprising applying an anti-pathogenic amount of a protein or
composition of the invention to the environment of the pathogens.
By "controlling plant pathogens" is intended killing the pathogen
or preventing or limiting disease formation on a plant. By
"anti-pathogenic amount" is intended an amount of a protein or
composition that controls a pathogen. The proteins and compositions
can be applied to the environment of the pathogen by methods known
to those of ordinary skill in the art.
[0116] The proteins of the invention can be formulated with an
acceptable carrier into a pesticidal composition(s) that is for
example, a suspension, a solution, an emulsion, a dusting powder, a
dispersible granule, a wettable powder, and an emulsifiable
concentrate, an aerosol, an impregnated granule, an adjuvant, a
coatable paste, and also encapsulations in, for example, polymer
substances.
[0117] Such compositions disclosed above may be obtained by the
addition of a surface-active agent, an inert carrier, a
preservative, a humectant, a feeding stimulant, an attractant, an
encapsulating agent, a binder, an emulsifier, a dye, a U.V.
protectant, a buffer, a flow agent or fertilizers, micronutrient
donors or other preparations that influence plant growth. One or
more agrochemicals including, but not limited to, herbicides,
insecticides, fungicides, bacteriocides, nematocides,
molluscicides, acaracides, plant growth regulators, harvest aids
and fertilizers, can be combined with carriers, surfactants or
adjuvants customarily employed in the art of formulation or other
components to facilitate product handling and application for
particular target pests. Suitable carriers and adjuvants can be
solid or liquid and correspond to the substances ordinarily
employed in formulation technology, e.g. natural or regenerated
mineral substances, solvents, dispersants, wetting agents,
tackifiers, binders or fertilizers. The active ingredients of the
present invention are normally applied in the form of compositions
and can be applied to the crop area or plant to be treated,
simultaneously or in succession, with other compounds. Preferred
methods of applying an active ingredient of the present invention
or an agrochemical composition of the present invention, which
contains at least one of the proteins of the present invention, are
foliar application, seed coating and soil application. The number
of applications and the rate of application depend on the intensity
of infestation by the corresponding pest.
[0118] Suitable surface-active agents include, but are not limited
to, anionic compounds such as a carboxylate of, for example, a
metal; carboxylate of a long chain fatty acid; an
N-acylsarcosinate; mono or di-esters of phosphoric acid with fatty
alcohol ethoxylates or salts of such esters; fatty alcohol sulfates
such as sodium dodecyl sulfate, sodium octadecyl sulfate or sodium
cetyl sulfate; ethoxylated fatty alcohol sulfates; ethoxylated
alkylphenol sulfates; lignin sulfonates; petroleum sulfonates;
alkyl aryl sulfonates such as alkyl-benzene sulfonates or lower
alkylnaphtalene sulfonates, e.g. butyl-naphthalene sulfonate; salts
of sulfonated naphthalene-formaldehyde condensates; salts of
sulfonated phenol-formaldehyde condensates; more complex sulfonates
such as the amide sulfonates, e.g. the sulfonated condensation
product of oleic acid and N-methyl taurine; or the dialkyl
sulfosuccinates, e.g. the sodium sulfonate or dioctyl succinate.
Non-ionic agents include condensation products of fatty acid
esters, fatty alcohols, fatty acid amides or fatty-alkyl- or
alkenyl-substituted phenols with ethylene oxide, fatty esters of
polyhydric alcohol ethers, e.g. sorbitan fatty acid esters,
condensation products of such esters with ethylene oxide, e.g.
polyoxyethylene sorbitar fatty acid esters, block copolymers of
ethylene oxide and propylene oxide, acetylenic glycols such as
2,4,7,9-tetraethyl-5-decyn-4,7-diol, or ethoxylated acetylenic
glycols. Examples of a cationic surface-active agent include, for
instance, an aliphatic mono-, di, or polyamine such as an acetate,
naphthenate or oleate; or oxygen-containing amine such as an amine
oxide of polyoxyethylene alkylamine; an amide-linked amine prepared
by the condensation of a carboxylic acid with a di- or polyamine;
or a quaternary ammonium salt.
[0119] Examples of inert materials include but are not limited to
inorganic minerals such as kaolin, phyllosilicates, carbonates,
sulfates, phosphates or botanical materials such as cork, powdered
corncobs, peanut hulls, rice hulls, and walnut shells.
[0120] The compositions of the present invention can be in a
suitable form for direct application or as concentrate of primary
composition, which requires dilution with a suitable quantity of
water or other diluent before application. The pesticidal
concentration will vary depending upon the nature of the particular
formulation, specifically, whether it is a concentrate or to be
used directly. The composition contains 1 to 98% of a solid or
liquid inert carrier, and 0 to 50%, preferably 0.1 to 50% of a
surfactant. These compositions will be administered at the labeled
rate for the commercial product, preferably about 0.01 lb-5.0 lb.
per acre when in dry form and at about 0.01 pts.-10 pts. per acre
when in liquid form.
[0121] In a further embodiment, the compositions, as well as the
proteins of the present invention can be treated prior to
formulation to prolong the activity when applied to the environment
of a target pest as long as the pretreatment is not deleterious to
the activity. Such treatment can be by chemical and/or physical
means as long as the treatment does not deleteriously affect the
properties of the composition(s). Examples of chemical reagents
include but are not limited to halogenating agents; aldehydes such
a formaldehyde and glutaraldehyde; anti-infectives, such as
zephiran chloride; alcohols, such as isopropanol and ethanol; and
histological fixatives, such as Bouin's fixative and Helly's
fixative (see, for example, Humason, Animal Tissue Techniques, W.
H. Freeman and Co., 1967).
[0122] The compositions can be applied to the environment of a pest
by, for example, spraying, atomizing, dusting, scattering, coating
or pouring, introducing into or on the soil, introducing into
irrigation water, by seed treatment or general application or
dusting at the time when the pest has begun to appear or before the
appearance of pests as a protective measure. It is generally
important to obtain good control of pests in the early stages of
plant growth, as this is the time when the plant can be most
severely damaged. The compositions of the invention can
conveniently contain another insecticide or pesticide if this is
thought necessary.
[0123] Plants to be protected within the scope of the present
invention include but are not limited to cereals (wheat, barley,
rye, oats, rice, sorghum and related crops), beets (sugar beet and
fodder beet), drupes, pomes and soft fruit (apples, pears, plums,
peaches, almonds, cherries, strawberries, raspberries, and
blackberries), leguminous plants (alfalfa, beans, peanuts, lentils,
peas, soybeans), oil plants (rape, mustard, poppy, olives,
safflowers, sunflowers, coconuts, castor oil plants, cocoa beans,
oil palms), cucumber plants (cucumber, marrows, melons), fiber
plants (cotton, flax, hemp, jute), citrus fruit (oranges, lemons,
limes, grapefruit, mandarins), vegetables (spinach, lettuce,
asparagus, cabbages and other Brassicae, carrots, onions, tomatoes,
potatoes, paprika), lauraceae (avocados, cinnamon, camphor),
deciduous trees and conifers (e.g. linden-trees, yew-trees,
oak-trees, alders, poplars, birch-trees, firs, larches, pines), or
plants such as maize, turf plants, tobacco, nuts, coffee, sugar
cane, tea, hops, bananas and natural rubber plants, as well as
ornamentals.
[0124] In a further embodiment, formulations of the present
invention for use as antimicrobial therapies comprise the
anti-pathogenic proteins in a physiologically or pharmaceutically
acceptable carrier, such as an aqueous carrier. Thus, formulations
for use in the present invention include, but are not limited to,
those suitable for parenteral administration, including
subcutaneous, intradermal, intramuscular, intravenous and
intraarterial administration, as well as topical administration.
The formulations may conveniently be presented in unit dosage form
and may be prepared by any of the methods well-known in the art.
Such formulations are described in, for example, Remington's
Pharmaceutical Sciences 19th ed., Osol, A. (ed.), Mack Easton Pa.
(1980).
[0125] In the manufacture of a medicament according to the
invention, the anti-pathogenic compositions are typically admixed
with, inter alia, an acceptable carrier. The carrier must, of
course, be acceptable in the sense of being compatible with any
other ingredients in the formulation and must not be deleterious or
harmful to the patient. The carrier may be a solid or a liquid. One
or more anti-pathogenic proteins may be incorporated in the
formulations of the invention, which may be prepared by any of the
well-known techniques of pharmacy consisting essentially of
admixing the components, optionally including one or more accessory
therapeutic ingredients.
[0126] Formulations of the present invention may comprise sterile
aqueous and non-aqueous injection solutions of the active compound,
which preparations are preferably isotonic with the blood of
intended recipient and essentially pyrogen free. These preparations
may contain anti-oxidants, buffers, bacteriostats and solutes that
render the formulation isotonic with the blood of the intended
recipient. Aqueous and non-aqueous sterile suspensions may include
suspending agents and thickening agents. The formulations may be
presented in unit dose or multi-dose containers, for example sealed
ampoules and vials, and may be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid carrier, for example, saline or water-for-injection
immediately prior to use.
[0127] In the formulation the anti-pathogenic protein may be
contained within a lipid particle or vesicle, such as a liposome or
microcrystal, which may be suitable for parenteral administration.
The particles may be of any suitable structure, such as unilamellar
or plurilamellar, so long as the targeted cassette is contained
therein. Positively charged lipids such as
N-[1-(2,3-dioleoyloxi)propyl]-N,N,N-trimethyl-amoniummethylsulfat-
e, or "DOTAP", are particularly preferred for such particles and
vesicles. The preparation of such lipid particles is well-known.
See, e.g., U.S. Pat. No. 4,880,635 to Janoff et al.; U.S. Pat. No.
4,906,477 to Kurono et al.; U.S. Pat. No. 4,911,928 to Wallach;
U.S. Pat. No. 4,917,951 to Wallach; U.S. Pat. No. 4,920,016 to
Allen et al.; U.S. Pat. No. 4,921,757 to Wheatley et al.; etc.
[0128] The dosage of the anti-pathogenic protein administered will
vary with the particular method of administration, the condition of
the subject, the weight, age, and sex of the subject, the
particular formulation, the route of administration, etc. In
general, the protein will be administered in a range of about 1
.mu.g/L to about 10 g/L.
[0129] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTAL
Materials and Methods
[0130] Plant Material
[0131] Sunflower plants were grown in the greenhouse and growth
chamber. The sunflower line SMF 3 and oxox-transgenic sunflower
(line 193870 and 610255) were used for RNA profiling study by
CuraGen using methods described in U.S. Pat. No. 5,871,697 to
Rothberg et al., and U.S. Pat. No. 5,972,693 to Rothberg et al.,
both incorporated herein by reference. Sunflower pathogen,
Sclerotinia sclerotiorum was maintained on plate at 20.degree. C.
in dark.
[0132] Preparation of Total RNAs for RNA Profiling Study and
Northern Analysis
[0133] Plant materials were ground in liquid nitrogen, and total
RNA was extracted by the Tri-Reagent Method (Sigma). For each RNA
profiling study, RNA samples from 6-week-old sunflower leaves and
stems of transgenic sunflower plants expressing a wheat oxalate
oxidase gene were compared with those from sunflower line SMF3.
Total RNA (20 .mu.g) was separated in a 1% agarose gel containing
formaldehye. Ethidium bromide was included to verify equal loading
of RNA. After transfer onto Hybond N+ membrane (Amersham), the
blots were hybridized with .sup.32P-labelled PR5, defensin or BBE
cDNA probes. A duplicate blot was hybridized with an 18S rRNA probe
as a control. Hybridization and washing conditions were performed
according to Church et al. (1984) Proc. Natl. Acad. Sci. USA
81:1991-1995.
[0134] RNA Profiling Technology
[0135] Total RNA was analyzed using the gene expression profiling
process (GeneCalling.RTM.) as described in U.S. Pat. No. 5,871,697,
herein incorporated by reference. A number of distinct transcripts
increased in abundance following the oxidative burst and cDNAs
corresponding to a portion of these transcripts were cloned and
sequenced.
[0136] Isolation of Full-Length or Flanking Sequences by PCR
Amplification of cDNA Ends
[0137] Three defense-related cDNAs were isolated by using RNA
profiling and PCR-based technologies. RNA profiling studies were
conducted through the collaboration with CuraGen Corporation. FIG.
1 illustrates the cloning strategy used. The sequence information
generated was used for designing gene-specific primers to amplify
both 3' and/or 5' end regions of the target genes using the
PCR-based, RACE method. Sclerotinia-infected and oxox-induced cDNA
libraries or cDNAs made using a Marathon cDNA Amplification Kit
(Clontech) were utilized as a source of templates for PCR
amplification. To facilitate cloning full-length cDNAs from the
initially cloned regions, we designed a pair of 28 bp vector
primers flanking cDNAs on the both ends (3' and 5') of the pBS
vector and directionally amplified either the 5' or 3' end of a
cDNA with one of vector primers (pBS-upper or pBS-lower) and a
gene-specific primer. Once the anticipated 5' end of a specific
gene with an intact ATG start codon was cloned and sequenced, the
full-length cDNA was amplified using a second gene-specific primer
containing corresponding to sequence upstream of the ATG and a
vector primer at 3' end. The PCR products were cloned and sequenced
by standard methods.
[0138] PCR reactions were performed in a total volume of 25 .mu.l
in 10 mM Tris-HCl, pH 8.3; 1.5 mM MgCl.sub.2; 50 mM KCl; 0.1 mM
dNTPs; 0.25 .mu.M of each primer with 0.5 units of advantage cDNA
polymerase mix (Clontech) or Pwo DNA polymerase (Boehringer).
Genomic DNA and/or cDNA library mixtures were used as a source of
templates for PCR amplification.
[0139] Isolation of Pathogen-Inducible Promoters
[0140] Promoter regions of PR5, defensin, and BBE were isolated
from sunflower genomic DNA using Universal GenomeWalker Kit
(Clontech) according to the manufacturer's instructions.
Restriction digested genomic DNAs were ligated with an adapter to
construct pools of genomic DNA fragments for walking by PCR
(Siebert et al. (1995) Nuc. Acids Res. 23:1087-1088).
[0141] Analysis of Amplified PCR Products
[0142] Amplified PCR fragments with the expected sizes were
individually sliced out of a gel for a second round of PCR
amplification with the same conditions as the initial PCR. Each
second-round PCR product yielding a single band of the expected
size was cloned into a TA vector (Clontech) according to the
manufacturer's instructions. Identified positive clones were
selected for DNA sequencing using an Applied BioSystems 373A (ABI)
automated sequencer at the Nucleic Acid Analysis Facility of
Pioneer Hi-Bred International, Incorporated. DNA sequence analysis
was carried out with the Sequencer (3.0). Multiple-sequence
alignments (Clustal W) of the DNA sequence were analyzed with the
Curatool (CuraGen).
[0143] Construction of the Sclerotinia-Infected and
Resistance-Enhanced (oxox-Induced) Sunflower cDNA Libraries
[0144] Six-week-old SMF3 sunflower plants were infected with
Sclerotinia sclerotrium by petiole inoculation with
Sclerotinia-infested carrot plugs. Six days after infection, leaf
and stem tissues were collected from infected plants for total RNA
isolation. Total RNA was also isolated from sunflower
oxox-transgenic plants (line 610255) expressing a wheat oxalate
oxidase gene at the six-week stage. Previous studies have shown
that elevated levels of H.sub.2O.sub.2, SA, and PR1 protein were
deducted in oxox-transgenic plants at six-week stage and the plants
showed more resistance to Sclerotinia infection (WO 99/04013). The
mRNAs were isolated using an mRNA purification kit (BRL) according
to manufacturer's instruction. cDNA libraries were constructed with
the ZAP-cDNA synthesis kit into pBluescrip phagemid (Stratagene). A
cDNA library mixture for PCR cloning was made of oxox transgenic
stem and Sclerotinia-infected leaf libraries (1:2 mix).
[0145] Fungal Infection and Chemical Treatments
[0146] Sunflower plants SMF3 were planted in 4-inch pots and grown
in the greenhouse for four weeks. After transfer to the growth
chamber, plants were maintained under 12 hour photoperiod at
22.degree. C. with a 80% relative humidity. Six-week-old plants
were inoculated with Sclerotinia-infested carrot plugs for sprayed
with one of four different chemical treatments. For each plant,
three petioles were inoculated and wrapped with 1.times.2 inch
parafilm. Plant tissue samples were collected at different time
points by immediately freezing in liquid nitrogen and then stored
at -80.degree. C.
Results
[0147] RNA Profiling Study of oxox-Transgenic Sunflower Plants
[0148] Resistance to the fungal pathogen Sclerotinia is a trait of
major importance for crops such as sunflower, canola, and soybean.
Sunflower Sclerotinia disease can be established at various
developmental stages with the main targets being head, stem, and
root tissues. This suggests that resistance genes need to be
constitutively expressed in multiple tissues. The major toxic and
pathogenic factor produced by Sclerotinia is oxalic acid that can
be converted into H.sub.2O.sub.2 and CO.sub.2 by oxalate oxidase. A
candidate gene for detoxifying oxalate is the wheat oxalate oxidase
(oxox) which have been used to transform a sunflower inbred line.
Expression of oxox by a constitutive promoter significantly
enhances resistance to Sclerotinia in sunflower. In a growth
chamber experiment, lesion size was six-fold lower in
oxox-transgenic sunflower plants upon infection with Sclerotinia
mycelia relative to untransformed plants. At the six-week-old
stage, the oxox-transgenic sunflower plants displayed a lesion
mimic in the mature leaves. The enhanced Sclerotinia resistance of
sunflower oxox transgenics is closely related to the observed
elevated levels of SA and PR proteins (WO 99/04013).
[0149] In the RNA profiling analysis, 30 bands were induced and 30
bands were repressed in the oxox-transgenic stem and leaf tissues
compared to non-transformed SMF3 plants. Three of the induced bands
were sequenced (Table 1), and the sequence information was used to
clone the full-length clones.
[0150] Cloning of Full-Length cDNAs Related to Sunflower Disease
Resistance
[0151] A PCR-based cloning method was developed to efficiently
isolate full-length cDNAs of the plant defense genes, from
sunflower cDNA libraries (FIG. 2). A cDNA library mixture
containing both oxox-transgenic cDNA library and
Sclerotinia-infected cDNA library (1:2 mix) was used as template
for PCR amplification. Using cDNA libraries as DNA template in PCR
amplification had two benefits: (1) the number of unexpected PCR
products was reduced as compared to genomic DNA as a source of
template, and (2) disease-induced cDNA libraries increased the
chance of isolating defense-related genes. To facilitate cloning
full-length cDNAs from the initial cloned regions, we designed a
pair of 28 bp vector primers (Table 1) flanking cDNAs on the both
ends (3' and 5') of the vector and directionally amplified either
the 5' or 3' end of a cDNA with one vector primer and a
gene-specific primer (FIG. 1 and Table 1). The anticipated 5' end
of specific gene with the intact ATG start codon was cloned and
sequenced. The full-length cDNA was amplified using a second
gene-specific primer containing sequence upstream of the ATG and a
vector primer at the 3' end. The PCR products were cloned and
submitted to sequence analysis.
[0152] Table 1 provides RNA profiling band sequences (PBS) and
oligonucleotide sequences used for PCR amplification of the cDNAs
and promoter regions. Oligonucleotide PBS-upper (P3) and PBS-lower
(P4) were two primers located at the ends of cDNA library vector,
as indicated in FIG. 2. For each targeted gene, two or three
gene-specific primers were made to complete the 5'-end RACE (P1),
the 3'-end RACE (P2), and the full-length RACE (P5). The additional
antisense primers were made for cloning promoter regions of PR5,
defensin, and BBE, using the GenomeWalker kit (Clontech) (Band
h0a0-231.3, PR5; band d010-113.9, defensin; and n0s0-162.7,
BBE).
1TABLE 1 Oligonucleotide sequences used for PCR amplification of
cDNAs and promoter regions: cDNA cloning: Library vector (pBS):
PBS-upper: GCGATTAAGTTGGGTAACGCCAGGGT (SEQ ID NO:26) PBS-lower:
TCCGGCTCGTATGTTGTGTGGAATTG (SEQ ID NO:27) PR5: h0a0-231.3:
TGATCAGTTTTGTACACGGTGCAAGGGTTATTGCACCCGCCAGAGCCC (SEQ ID NO:28)
GTAACTCNCCAGGACACTGGCCATTGATATCCGCAGTACATGAGATAC
CCCGGGTGCACCCATTAGAATTGGGTCTAAACACCATCGGCACATTGA
ATCCGTCCACAAGAGAAATGTCAAAGAAATCAAGATTGTTGAACTGGT
TCCAAGCGTACTCGGCCCATGTGTTTGGGTGGGGTACC Sense: CCGAGTACGCTTTAACCAGT
(SEQ ID NO:29) Antisense: TCCGCAGTACATGAGATACCC (SEQ ID NO: 30)
Full-RACE: ACAATGACAACCTCCACCCTTCCCACTTT (SEQ ID NO:31) (P5)
Defensin: d010-113.9: TCCGGACCATGTCTGGCTTGCCTTCTCACATAATTCT-
CCTTTCACCGAT (SEQ ID NO:32) CCGATTTCTGAGATAGCAAGAACAAAGAGAAGCAGAAG-
AAAAGCATT GAAAGCAACTGAAATT A-sense: GACCATGTCTGGCTTGCCTTCTCACA (SEQ
ID NO:33) full-RACE: GAGCTTGAGCTTAGTTCAGTAACTTAAAAATGGCC (SEQ ID
NO:34) (P5) BBE: n0s0-162.7: TGTACACATTTGGTGGGAAGATGGAGGAGTACTCAGA-
TACAGCAATTC (SEQ ID NO: 35) CGTATCCCCATAGAGCTGGGGTGTTGTACCAAGTGTTC-
AAGAGGGTGG ACTTCGTGGATCAGCCTTCGGACAAGACCTTGATATCACTCAGACGGT
TGGCTTGGCTCCGAAGCTT Sense: CCAACCGTCTGAGTGATATCAAGG (SEQ ID NO:36)
A-sense: GGGAAGATGGAGGAGTACTCAGAT (SEQ ID NO:37) Full-RACE:
CGGCACGAGTAACTCTCGTTCAGTGTTCC (SEQ ID NO:38) (P5) Promoter cloning:
AP Primer: GTAATACGACTCACTATAGGGC (SEQ ID NO:39) PR5 A-sense2:
CGAATAGTGAACACGGCTGCATTGGT (SEQ ID NO:40) BBE A-sense2:
GCTGCAGCTTGCCAAATGGGTATGTA (SEQ ID NO:41) *Oligonucleotide
PBS-upper (P3) and PBS-lower (P4) were two primers located at the
ends of cDNA library vector, as indicated in FIG. 2. For each
targeted gene, two or three gene specific primers were made to
complete the 5' end RACE (P1), the 3' end RACE (P2), and the
full-length RACE (PS). The additional antisense primers were made
for cloning promoter regions of PR5-1 and BBE, using the genome
walker kit from Clontech. Band h0a0-231.3, PR5-1; band d010-113.9,
defensin; and n0s0-162.7, BBE.
[0153] Cloning Sunflower PR5-1 cDNA and Its Promoter
[0154] A full-length cDNA encoding pathogenesis-related protein-5
(PR5-1) was isolated from sunflower. The nucleotide sequence of
PR5-1 is set forth in SEQ ID NO:4 and the amino acid sequence
encoded by this nucleotide sequence is set forth in SEQ ID NO:1.
The sunflower PR5-1 protein with its amino-terminal signal sequence
is 222 amino acids in length with a calculated molecular mass of 25
kDa and a pI of 6.71. Database searches with predicted amino acid
sequence revealed significant sequence similarity with previously
reported PR5 proteins from other plant species. The 5'-flanking
sequence of the PR5-1 gene contains two potential
pathogen-responsive MRE-like elements. These elements have the
sequences TGTAGG (nucleotides 23-28, SEQ ID NO:7) and AACAAAA
(nucleotides 247-253, SEQ ID NO:7). The PR5-1 promoter region also
contains a CAAT box (nucleotides 438-441, SEQ ID NO:7) and a TATA
box (nucleotides 485-490, SEQ ID NO:7). FIG. 2 shows the alignment
of amino acid sequence of PR5-1 from sunflower with other PR5 or
osmotin-like proteins from grape, soybean, tomato, and potato.
Sunflower PR5-1 shows the highest sequence similarity to P21
protein (78% amino acid identity; 80% similarity) from soybean
(Swiss-Prot P205096) followed by the osmotin-like protein from
grape (Swiss-Prot O04708; 72% amino acid identity; 77% similarity),
where sequence comparisons were performed with the GAP algorithm
described above using default parameters.
[0155] Berberine Bridge Enzyme (BBE) cDNA and Its Promoter
[0156] A full-length cDNA encoding a BBE homologue was isolated
from sunflower. The full-length cDNA set forth in SEQ ID NO:5 is
1809 nucleotides long with an open reading frame encoding a protein
of 542 amino acids (SEQ ID NO:2) and a calculated molecular mass at
61.41 kDa and a pI of 8.18 (FIG. 5). The BBE promoter region
contains a potential MRE-like element with the sequence TGTAGG
(nucleotides 139-144, SEQ ID NO:8). The BBE promoter also contains
a CAAT box (nucleotides 278-281, SEQ ID NO:8), and a TATA box
(nucleotides 299-304, SEQ ID NO:8). The isolated cDNA shares
homology with BBE cDNAs from California poppy and opium poppy (FIG.
3) and two published sunflower cDNA's encoding carbohydrate
oxidases (WO 98/13478), which have antifungal activity,
specifically against Phytophthora and Pythium species (FIG. 3). The
amino acid sequence alignment indicates 42% identity and 52%
similarity between the sunflower BBE and the previously patented
sequences (Sunflower-15 and Sunflower-17 from WO 98/13478), where
the comparison was performed with the GAP algorithm described above
using the default parameters.
[0157] Inducible Sunflower Defensin cDNA and Its Promoter
[0158] The sunflower defensin cDNA is 556 nucleotides long with an
open reading frame starting at nucleotide 36 and ending at
nucleotide position 362 (SEQ ID NO:6). The deduced polypeptide is
108 amino acids long and contains a putative signal peptide at the
amino-terminal end (SEQ ID NO:3). The cloned defensin promoter
contains two W-boxes with the nucleotide sequence TTGACC
(nucleotides 221-226, SEQ ID NO:9), and a G-box with sequence
CACGTG (nucleotides 564-569, SEQ ID NO:9). These cis-elements are
potentially related to plant defense response. The defensin
promoter also contains a TATA box (nucleotides 857-860, SEQ ID
NO:9). The protein has significant homology to other reported plant
defensins (FIG. 4). Eight important cysteine residues in this novel
defensin were highly conserved among all other known plant
defensins.
[0159] Accumulation of PR5-1, Defensin and BBE Transcripts in
Response to Fungal Pathogen Infection and Chemical Treatments
[0160] The expression of many of PR5 and defensin genes were
induced by biotic and abiotic stresses (Terra et al. (1988) Planta
206:117-124); Ward et al. (1991) Plant Cell 3:1085-1094). Oxalic
acid (OA), a compound produced by Sclerotinia and many other fungal
pathogens in planta, plays an important role in the disease
infection process (Noyes et al. (1981) Physiol. Plant Path.
18:123-132). Salicylic acid, jasmonic acid and H.sub.2O.sub.2 have
been implicated as having a central role in plant disease
resistance and systemic acquired resistance, and have been shown to
induce the accumulation of many PR proteins, including PR5 protein
and defensin in Arabidopsis (Blechert et al. (1995) Proc. Natl.
Acad. Sci. USA 92:4099-4105; Terra et al. (1988) Planta
206:117-124; Noyes et al. (1981) Physiol. Plant Path.
18:123-132).
[0161] Six-week-old sunflower plants were either inoculated with
Sclerotinia or treated with different chemicals. Plants inoculated
with Sclerotinia showed wilt symptoms on inoculated leaves 24 hours
after inoculation and lesions started to spread to the main stem 3
days after infection. For the infection experiment, plant tissues
were collected at 0, 6, 12, 24 hours, and 3, 6 and 10 days after
infection. Chemical-treated plants were collected at 0, 6, 12, and
24 hours after foliar application.
[0162] Northern blot analysis revealed that sunflower PR5-1 protein
was induced in leaf and stem tissues of the Sclerotinia-infected
and oxox transgenic plants. RNA profiling indicated that PR5-1
transcript level in the oxox transgenic plants was 9-fold higher
than in the untransformed line (SMF3). Northern results indicated
that the sunflower PR5-1 was up-regulated significantly by Jasmonic
acid (45 .mu.M) and oxalic acid (5 mM). Up-regulation was less
pronounced between control and salicylic acid, and H.sub.2O.sub.2
treated samples.
[0163] BBE transcripts were highly induced in oxox-transgenic and
Sclerotinia infected sunflower leaves. However, BBE transcripts
were not detected in either control or infected stem samples.
Northern blot analysis confirmed the RNA profiling result of
increased BBE transcripts in oxox transgenic plants. The chemical
induction experiment revealed that BBE expression was induced by
oxalic acid, H.sub.2O.sub.2, SA and JA at early time points and
returned to the normal level within 24 hours after application.
[0164] The expression of the isolated sunflower defensin gene
appeared to be different from other defensin genes. In general,
plant defensin genes such as Arabidopsis PDF1.2 and radish defensin
are induced by pathogens via an SA-independent and JA-dependent
pathway. Northern results indicated that the sunflower defensin was
up-regulated significantly by salicylic acid (5 mM), oxalic acid (5
mM) and H.sub.2O.sub.2 (5 mM). However, there was little difference
between control and Jasmonic acid treated samples.
[0165] Defensin transcript levels were significantly higher in
samples from oxox transgenic plants relative to levels in control
plants. Northern analysis revealed that sunflower defensin was
induced in leaf tissue of the Sclerotinia-infected and oxox
transgenic plants. A time course study showed that defensin, PR5-1
and BBE transcripts were highly induced in oxox-transgenic tissues
at the 6-week-old stage. These results indicate that the defense
pathways were activated in oxox transgenic sunflowers at that
stage.
[0166] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0167] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
41 1 222 PRT Helianthus annuus 1 Met Thr Thr Ser Thr Leu Pro Thr
Phe Leu Leu Leu Ala Ile Leu Phe 1 5 10 15 His Tyr Thr Asn Ala Ala
Val Phe Thr Ile Arg Asn Asn Cys Pro Tyr 20 25 30 Thr Val Trp Ala
Gly Ala Val Pro Gly Gly Gly Arg Gln Leu Asn Ser 35 40 45 Gly Gln
Thr Trp Ser Leu Thr Val Ala Ala Gly Thr Ala Gly Ala Arg 50 55 60
Ile Trp Pro Arg Thr Asn Cys Asn Phe Asp Gly Ser Gly Arg Gly Arg 65
70 75 80 Cys Gln Thr Gly Asp Cys Asn Gly Leu Leu Gln Cys Gln Asn
Tyr Gly 85 90 95 Thr Pro Pro Asn Thr Leu Ala Glu Tyr Ala Leu Asn
Gln Phe Asn Asn 100 105 110 Leu Asp Phe Phe Asp Ile Ser Leu Val Asp
Gly Phe Asn Val Pro Met 115 120 125 Val Phe Arg Pro Asn Ser Asn Gly
Cys Thr Arg Gly Ile Ser Cys Thr 130 135 140 Ala Asp Ile Asn Gly Gln
Cys Pro Gly Glu Leu Arg Ala Pro Gly Gly 145 150 155 160 Cys Asn Asn
Pro Cys Thr Val Tyr Lys Thr Asp Gln Tyr Cys Cys Asn 165 170 175 Ser
Gly Asn Cys Gly Pro Thr Asp Leu Ser Arg Phe Phe Lys Thr Arg 180 185
190 Cys Pro Asp Ala Tyr Ser Tyr Pro Lys Asp Asp Pro Thr Ser Thr Phe
195 200 205 Thr Cys Pro Gly Gly Thr Asn Tyr Asp Val Ile Phe Cys Pro
210 215 220 2 542 PRT Helianthus annuus 2 Met Asn Asn Ser Arg Ser
Val Phe Leu Leu Val Leu Ala Leu Ser Phe 1 5 10 15 Cys Val Ser Phe
Gly Ala Leu Ser Ser Ile Phe Asp Val Thr Ser Thr 20 25 30 Ser Glu
Asp Phe Ile Thr Cys Leu Gln Ser Asn Ser Asn Asn Val Thr 35 40 45
Thr Ile Ser Gln Leu Val Phe Thr Pro Ala Asn Thr Ser Tyr Ile Pro 50
55 60 Ile Trp Gln Ala Ala Ala Asp Pro Ile Arg Phe Asn Lys Ser Tyr
Ile 65 70 75 80 Pro Lys Pro Ser Val Ile Val Thr Pro Thr Asp Glu Thr
Gln Ile Gln 85 90 95 Thr Ala Leu Leu Cys Ala Lys Lys His Gly Tyr
Glu Phe Arg Ile Arg 100 105 110 Asp Gly Gly His Asp Phe Glu Gly Asn
Ser Tyr Thr Ala Asn Ala Pro 115 120 125 Phe Val Met Leu Asp Leu Val
Asn Met Arg Ala Ile Glu Ile Asn Val 130 135 140 Glu Asn Arg Thr Ala
Leu Val Gln Gly Gly Ala Leu Leu Gly Glu Leu 145 150 155 160 Tyr Tyr
Thr Ile Ser Gln Lys Thr Asp Thr Leu Tyr Phe Pro Ala Gly 165 170 175
Ile Trp Ala Gly Val Gly Val Ser Gly Phe Leu Ser Gly Gly Gly Tyr 180
185 190 Gly Asn Leu Leu Arg Lys Tyr Gly Leu Gly Ala Asp Asn Val Leu
Asp 195 200 205 Ile Arg Phe Met Asp Val Asn Gly Asn Ile Leu Asp Arg
Lys Ser Met 210 215 220 Gly Glu Asp Leu Phe Trp Ala Leu Arg Gly Gly
Gly Ala Ser Ser Phe 225 230 235 240 Gly Ile Val Leu Gln Trp Lys Leu
Asn Leu Val Pro Val Pro Glu Arg 245 250 255 Val Thr Leu Phe Ser Val
Ser Tyr Thr Leu Glu Gln Gly Ala Thr Asp 260 265 270 Ile Phe His Lys
Tyr Gln Tyr Val Leu Pro Lys Phe Asp Arg Asp Leu 275 280 285 Leu Ile
Arg Val Gln Leu Asn Thr Glu Tyr Ile Gly Asn Thr Thr Gln 290 295 300
Lys Thr Val Arg Ile Leu Phe His Gly Ile Tyr Gln Gly Asn Ile Asp 305
310 315 320 Thr Leu Leu Pro Leu Leu Asn Gln Ser Phe Pro Glu Leu Asn
Val Thr 325 330 335 Arg Glu Val Cys Gln Glu Val Arg Met Val Gln Thr
Thr Leu Glu Phe 340 345 350 Gly Gly Phe Asn Ile Ser Thr Pro Thr Ser
Val Leu Ala Asn Arg Ser 355 360 365 Ala Ile Pro Lys Leu Ser Phe Lys
Gly Lys Ser Asp Tyr Val Arg Thr 370 375 380 Pro Ile Pro Arg Ser Gly
Leu Arg Lys Leu Trp Arg Lys Met Phe Glu 385 390 395 400 Asn Asp Asn
Ser Gln Thr Leu Phe Met Tyr Thr Phe Gly Gly Lys Met 405 410 415 Glu
Glu Tyr Ser Asp Thr Ala Ile Pro Tyr Pro His Arg Ala Gly Val 420 425
430 Leu Tyr Gln Val Phe Lys Arg Val Asp Phe Val Asp Gln Pro Ser Asp
435 440 445 Lys Thr Leu Ile Ser Leu Arg Arg Leu Ala Trp Leu Arg Ser
Phe Asp 450 455 460 Lys Thr Leu Glu Pro Tyr Val Thr Ser Asn Pro Arg
Glu Ala Tyr Met 465 470 475 480 Asn Tyr Asn Asp Leu Asp Leu Gly Phe
Asp Ser Ala Ala Tyr Glu Glu 485 490 495 Ala Ser Glu Trp Gly Glu Arg
Tyr Trp Lys Arg Glu Asn Phe Lys Lys 500 505 510 Leu Ile Arg Ile Lys
Ala Lys Val Asp Pro Glu Asn Phe Phe Arg His 515 520 525 Pro Gln Ser
Ile Pro Val Phe Ser Arg Pro Leu Ser Asp Met 530 535 540 3 108 PRT
Helianthus annuus 3 Met Ala Lys Ile Ser Val Ala Phe Asn Ala Phe Leu
Leu Leu Leu Phe 1 5 10 15 Val Leu Ala Ile Ser Glu Ile Gly Ser Val
Lys Gly Glu Leu Cys Glu 20 25 30 Lys Ala Ser Gln Thr Trp Ser Gly
Thr Cys Gly Lys Thr Lys His Cys 35 40 45 Asp Asp Gln Cys Lys Ser
Trp Glu Gly Ala Ala His Gly Ala Cys His 50 55 60 Val Arg Asp Gly
Lys His Met Cys Phe Cys Tyr Phe Asn Cys Ser Lys 65 70 75 80 Ala Gln
Lys Leu Ala Gln Asp Lys Leu Arg Ala Glu Glu Leu Ala Lys 85 90 95
Glu Lys Ile Glu Pro Glu Lys Ala Thr Ala Lys Pro 100 105 4 875 DNA
Helianthus annuus 4 atgacaacct ccacccttcc cactttcctt ctcttggcta
ttctttttca ctataccaat 60 gcagccgtgt tcactattcg aaacaactgt
ccatacaccg tttgggctgg tgcggtgcct 120 ggtggcggcc gacaacttaa
ctcaggccaa acctggtctt taaccgtcgc agctggcaca 180 gcaggagccc
gtatatggcc ccgaaccaat tgcaactttg atggttctgg gcgaggcagg 240
tgtcagaccg gtgattgcaa cggtctcctc caatgccaaa actatggtac cccacccaac
300 acattggccg agtacgcttt gaaccagttc aacaatcttg atttctttga
catttctctt 360 gtggacggat tcaatgtgcc gatggtgttt agacccaatt
ctaatgggtg cacccggggt 420 atctcatgta ctgcggatat caatggccag
tgtcctggtg agttacgggc tcctggcggg 480 tgcaataacc cttgcaccgt
gtacaaaact gatcagtatt gttgcaactc tggaaattgt 540 ggaccaactg
atttatcaag gtttttcaag accagatgtc ctgatgcata tagttatccc 600
aaggatgatc caactagcac atttacgtgc cccggtggaa ccaactacga cgttatattc
660 tgcccttgat caaagccatt tgattatatg atcaaattaa aaggagttcg
aaatataaga 720 actgaaataa atggagtgaa taagtaatgg agatagtcta
attataaggc ttcttcctca 780 ttgtaataca ataatgttgt aatttgtcaa
aataaatgga tggatatata tgattaatta 840 ttaggaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaa 875 5 1809 DNA Helianthus annuus 5 aaaacatgaa
taactctcgt tcagtgttcc tcttagttct cgctctttca ttttgtgttt 60
catttggagc attgtcttcc attttcgatg ttacttcaac ttccgaagat ttcataacct
120 gtctccaatc caattccaac aatgtcacca ccatctctca actcgttttc
accccggcca 180 acacttctta catacccatt tggcaagctg cagccgaccc
tattcggttc aacaaatcct 240 acattccgaa accatcagtc atcgttactc
ccaccgatga aacacagatc caaaccgctc 300 ttttatgcgc caagaaacac
ggatatgagt ttaggatccg agacggtggt catgacttcg 360 agggcaactc
atacaccgcg aacgctccgt ttgtcatgct tgatctcgtc aacatgaggg 420
ctatagagat caacgttgaa aaccggaccg cgctggtcca gggtggcgct ttgcttggtg
480 agctctacta cactatttct cagaaaacgg acaccttgta ttttcctgct
ggtatttggg 540 ccggtgtggg tgttagcggg tttttgagcg gtggtgggta
tggaaacctg ttgaggaaat 600 acgggcttgg tgccgataat gttttggata
ttcgtttcat ggatgttaat ggaaacattc 660 ttgataggaa atcgatgggc
gaagatttgt tttgggcgct tcgtggcggt ggtgcttcca 720 gtttcggaat
tgttctccag tggaagctca atttggttcc ggtgcctgaa agagttactc 780
ttttcagtgt gagttatact ctggagcaag gggcgacgga cattttccat aaatatcaat
840 acgtgttacc gaaatttgat cgtgatttac tcatcagagt tcagcttaac
accgagtata 900 taggcaacac cactcagaaa accgtacgaa tattgtttca
cggtatttat caaggcaata 960 ttgacacact gcttccgttg ttgaaccaaa
gtttcccaga gctcaatgtg acacgagaag 1020 tctgccaaga agtacgaatg
gtccagacta cccttgagtt tggaggcttt aacatctcta 1080 ccccgacatc
ggttctagcg aaccgatcag caatccccaa gctgagcttc aaaggaaaat 1140
ctgactatgt ccgaactcca attcccagaa gcgggctaag aaagctctgg agaaagatgt
1200 ttgaaaacga caactcacag actctcttca tgtacacatt tggtgggaag
atggaggagt 1260 actcagatac agcaattccg tatccccata gagctggggt
gttgtaccaa gtgttcaaga 1320 gggtggactt cgtggatcag ccttcggaca
agaccttgat atcactcaga cggttagctt 1380 ggctccgaag ctttgataag
actttggagc cgtacgtgac gagtaacccg agggaggcgt 1440 atatgaacta
caatgatctt gatttgggtt ttgatagtgc tgcatatgaa gaagcaagtg 1500
aatggggaga aaggtattgg aaaagggaga actttaagaa gttgatccga atcaaggcta
1560 aagttgatcc ggaaaatttc tttagacacc cacaaagtat accggttttc
tcaagacctc 1620 tctcagatat gtgaagccaa cactttggat ggtgttcttt
ttcttgagta tattggtaat 1680 aattattaat taagagtcaa aagtcgatta
cttttgtgtt tggtgccttg tgtaccaatt 1740 atttaaactt ttttgttttc
ataaactttt aatcaaagct attatgtatt taaaaaaaaa 1800 aaaaaaaaa 1809 6
565 DNA Helianthus annuus 6 tcggcttgag cttgagctta gttcagtaac
ttaaaaatgg ccaaaatttc agttgctttc 60 aatgcttttc ttctgcttct
ctttgttctt gctatctcag aaatcggatc ggtgaaagga 120 gaattatgtg
agaaggcaag ccagacatgg tccggaacat gtggcaagac aaaacactgt 180
gatgaccagt gcaagtcttg ggagggtgca gcccatggag cttgtcacgt gcgcgatggg
240 aaacacatgt gcttctgcta cttcaactgt tccaaagccc agaagttggc
tcaggataaa 300 ctcagagcgg aagagctcgc caaggagaag attgaacccg
aaaaggcgac agccaaacct 360 tgagtatgta gcaaatgtca tacgattatg
aataaagaga aaatgctttc tacttggcat 420 attcagcatt ttcttgtgtg
taatgtttgt tgtatttgga aattggaatc agttgcttca 480 ttatgattcc
atgcaaaatg ttctaatgaa atgatattta aattaaaaaa aaaaaaaaaa 540
aaaaaaaaaa aaaaaaaaaa aaaaa 565 7 550 DNA Helianthus annuus 7
aaaactgcgt tttgaaaagg catgtaggta catgcttctc caaaactgcg ttttgaaggc
60 agataatcac ttttcatcca aacatttttt tagattattt atgttttaca
aacgcaatac 120 ttaaataacc acttcaaaac gtaatcccaa acaccctctt
agtgtataaa aaacctgaaa 180 ttagtttata cacacagaaa ataacaaatt
aaaagcataa acaaaaatga taattttata 240 aatgataaac aaaactaagt
ataagaataa gataatatat attttttata gagttactaa 300 atacaaagat
aaaataacaa aaaagagtaa actaaaataa gttataacaa atgtgttgtt 360
aactgtatag ttatgacttt gtctactaca gaacaattcc acgtaaccat tttgttcaat
420 gaatacattt gaaatttcaa tgaatgtata tctttctaaa tattgtacgt
atagcatgtt 480 cggcctatat aaaccatgtt tactctcact tccaattcac
ccaaaaccac aatgacaacc 540 tccacccttc 550 8 351 DNA Helianthus
annuus 8 tgttcaaaaa agcacgctga aagtgactaa tattcgaatc tagtcgtgac
cgctgcctag 60 tgccaaatta ctaaaggaga agaaaaaaaa aatatcaaga
agatacagaa aattatttgc 120 gcgttgtgac ttgtgttgtg taggcaacgg
gcatctagtc atacatttga tggctgtttc 180 ggtgtaaaca taagtcaaag
gctagatgtc tttttatcaa aaaggttgtt ttagtaattt 240 cccaaaaaaa
catcccactt tcccccttat ttcttcccaa tcgccttcgg gttcatctta 300
tataaatagg cgcattaagt gctaatagac tcaccaaacc aacaaaacat g 351 9 1346
DNA Helianthus annuus 9 gtacttcgca aaagggcctg tcgtaaatgt tagtgagatg
ggcaatcgtc tcaacgtcaa 60 tatttagcga ccataatttg tcagaaaatt
aacgacagga actaaattga ttgcaaattt 120 agcaaccaaa ataatcagtc
tgaaagtaat tagcaattaa acaaaattgg tggtaaattt 180 acaacgattt
tttttacaat gatttattgt tattttttac ttgacctgac tactgagttg 240
ttttaacctt aatcatttct atcagagtga ataaagcctc catggcacag aaaaaatgta
300 agaattatat gaatacagat aattacgata attttctgta taaataggtg
gtttaggaaa 360 actattaagc cctgttgttt tgcatctgaa tagaatcaat
cagaggttgg ctctgattca 420 atcagaactc aaaagttttg gtgtttggtt
cgacatctga atgacatcta aatggggatt 480 tcaagctctt aactattcag
ctttgaggag tcgctaaacc atttagagga tttctgatat 540 tacatgtaaa
aattaagcaa agtcacgtgc atgtgtatat gaatgaattt catcaaagtc 600
gcgtgcaagt gtatatgtta tgtgaatggt cctgtatcta atatacaaac atatgtttac
660 atgcaatttc aaaaatgccc taacccacgt agtgacacaa aaaaaaaaaa
aaaagtttgc 720 taacttatga aagttacttg gatgtataca atgcacgcac
cacaaaagtc aatttaagac 780 aaattttgtg gaaactttag ccattttgtg
tttattgttt attgtttatt ttcttgactt 840 tcaacatatt ttctcctata
aatacccctc attgtctcat cttctcttca caaaccttgc 900 aacaagtgtt
cttgagctta gttcagtaac taaaaaatgg ccaaaagtgc agttgctttc 960
tatgcttttc ttctgcttct ctttgttctt gctatctcag gttctcaatc aatcttattt
1020 acactcactt tgtgttcgta atattcagac ttttacacct taatgtcaca
tattttgacc 1080 cttcggatga caattagttt agttaagtag accgtgacat
taagctagca ctcatactta 1140 aataatgcag tgaaaagaag cattttataa
gtatataaaa gtgatttaat tagcttttat 1200 ttcgtgcaga aactaatcat
attcatcaca aaactgcatt cgttagacat tctagatttg 1260 tgtataacgt
acttaacaca gtttaacgtg tacagaaatc ggatcggtga aaggagaatt 1320
atgtgagaag gcaagccaga catgtc 1346 10 225 PRT Vitis vinifera 10 Met
Gly Leu Cys Lys Ile Leu Ser Ile Ser Ser Phe Leu Leu Thr Thr 1 5 10
15 Leu Phe Phe Thr Ser Ser Tyr Ala Ala Thr Phe Asn Ile Gln Asn His
20 25 30 Cys Ser Tyr Thr Val Trp Ala Ala Ala Val Pro Gly Gly Gly
Met Gln 35 40 45 Leu Gly Ser Gly Gln Ser Trp Ser Leu Asn Val Asn
Ala Gly Thr Thr 50 55 60 Gly Ala Arg Val Trp Gly Arg Thr Asn Cys
Asn Phe Asp Ala Ser Gly 65 70 75 80 Asn Gly Lys Cys Glu Thr Gly Asp
Cys Gly Gly Leu Leu Gln Cys Thr 85 90 95 Ala Tyr Gly Thr Pro Pro
Asn Thr Leu Ala Glu Phe Ala Leu Asn Gln 100 105 110 Phe Ser Asn Leu
Asp Phe Phe Asp Ile Ser Leu Val Asp Gly Phe Asn 115 120 125 Val Pro
Met Ala Phe Asn Pro Thr Ser Asn Gly Cys Thr Arg Gly Ile 130 135 140
Ser Cys Thr Ala Asp Ile Val Gly Glu Cys Pro Ala Ala Leu Lys Thr 145
150 155 160 Thr Gly Gly Cys Asn Asn Pro Cys Thr Val Phe Lys Thr Asp
Glu Tyr 165 170 175 Cys Cys Asn Ser Gly Ser Cys Asn Ala Thr Thr Tyr
Ser Glu Phe Phe 180 185 190 Lys Thr Arg Cys Pro Asp Ala Tyr Ser Tyr
Pro Lys Asp Asp Gln Thr 195 200 205 Ser Thr Phe Thr Cys Pro Ala Gly
Thr Asn Tyr Glu Val Ile Phe Cys 210 215 220 Pro 225 11 222 PRT
Vitis vinifera 11 Met Arg Phe Thr Thr Thr Leu Pro Ile Leu Ile Pro
Leu Leu Leu Ser 1 5 10 15 Leu Leu Phe Thr Ser Thr His Ala Ala Thr
Phe Asp Ile Leu Asn Lys 20 25 30 Cys Thr Tyr Thr Val Trp Ala Ala
Ala Ser Pro Gly Gly Gly Arg Arg 35 40 45 Leu Asp Ser Gly Gln Ser
Trp Thr Ile Thr Val Asn Pro Gly Thr Thr 50 55 60 Asn Ala Arg Ile
Trp Gly Arg Thr Ser Cys Thr Phe Asp Ala Asn Gly 65 70 75 80 Arg Gly
Lys Cys Glu Thr Gly Asp Cys Asn Gly Leu Leu Glu Cys Gln 85 90 95
Gly Tyr Gly Ser Pro Pro Asn Thr Leu Ala Glu Phe Ala Leu Asn Gln 100
105 110 Pro Asn Asn Leu Asp Tyr Ile Asp Ile Ser Leu Val Asp Gly Phe
Asn 115 120 125 Ile Pro Met Asp Phe Ser Gly Cys Arg Gly Ile Gln Cys
Ser Val Asp 130 135 140 Ile Asn Gly Gln Cys Pro Ser Glu Leu Lys Ala
Pro Gly Gly Cys Asn 145 150 155 160 Asn Pro Cys Thr Val Phe Lys Thr
Asn Glu Tyr Cys Cys Thr Asp Gly 165 170 175 Pro Gly Ser Cys Gly Pro
Thr Thr Tyr Ser Lys Phe Phe Lys Asp Arg 180 185 190 Cys Pro Asp Ala
Tyr Ser Tyr Pro Gln Asp Asp Lys Thr Ser Leu Phe 195 200 205 Thr Cys
Pro Ser Gly Thr Asn Tyr Lys Val Thr Phe Cys Pro 210 215 220 12 202
PRT Glycine Max 12 Ala Arg Phe Glu Ile Thr Asn Arg Cys Thr Tyr Thr
Val Trp Ala Ala 1 5 10 15 Ser Val Pro Val Gly Gly Gly Val Gln Leu
Asn Pro Gly Gln Ser Trp 20 25 30 Ser Val Asp Val Pro Ala Gly Thr
Lys Gly Ala Arg Val Trp Ala Arg 35 40 45 Thr Gly Cys Asn Phe Asp
Gly Ser Gly Arg Gly Gly Cys Gln Thr Gly 50 55 60 Asp Cys Gly Gly
Val Leu Asp Cys Lys Ala Tyr Gly Ala Pro Pro Asn 65 70 75 80 Thr Leu
Ala Glu Tyr Gly Leu Asn Gly Phe Asn Asn Leu Asp Phe Phe 85 90 95
Asp Ile Ser Leu Val Asp Gly Phe Asn Val Pro Met Asp Phe Ser Pro 100
105 110 Thr Ser Asn Gly Cys Thr Arg Gly Ile Ser Cys Thr Ala Asp Ile
Asn 115 120 125 Gly Gln Cys Pro Ser Glu Leu Lys Thr Gln Gly Gly Cys
Asn Asn Pro 130 135 140 Cys Thr Val Phe Lys Thr Asp Gln Tyr Cys Cys
Asn
Ser Gly Ser Cys 145 150 155 160 Gly Pro Thr Asp Tyr Ser Arg Phe Phe
Lys Gln Arg Cys Pro Asp Ala 165 170 175 Tyr Ser Tyr Pro Lys Asp Asp
Pro Pro Ser Thr Phe Thr Cys Asn Gly 180 185 190 Gly Thr Asp Tyr Arg
Val Val Phe Cys Pro 195 200 13 223 PRT Helainthus annuus 13 Met Thr
Thr Ser Thr Leu Pro Thr Phe Leu Leu Leu Ala Ile Leu Phe 1 5 10 15
His Tyr Thr Asn Ala Ala Val Phe Thr Ile Arg Asn Asn Cys Pro Tyr 20
25 30 Thr Val Trp Ala Gly Ala Val Pro Gly Gly Gly Arg Gln Leu Asn
Ser 35 40 45 Gly Gln Thr Trp Ser Leu Thr Val Ala Ala Gly Thr Ala
Gly Ala Arg 50 55 60 Ile Trp Pro Arg Thr Asn Cys Asn Phe Asp Gly
Ser Gly Arg Gly Arg 65 70 75 80 Cys Gln Thr Gly Asp Cys Asn Gly Leu
Leu Gln Cys Gln Asn Tyr Gly 85 90 95 Thr Pro Pro Asn Thr Phe Gly
Ser Glu Tyr Ala Leu Asn Gln Phe Asn 100 105 110 Asn Leu Asp Phe Phe
Asp Ile Ser Leu Val Asp Gly Phe Asn Val Pro 115 120 125 Met Val Phe
Arg Pro Asn Ser Asn Gly Cys Thr Arg Gly Ile Ser Cys 130 135 140 Thr
Ala Asp Ile Asn Gly Gln Cys Pro Gly Glu Leu Arg Ala Pro Gly 145 150
155 160 Gly Cys Asn Asn Pro Cys Thr Val Tyr Lys Thr Asp Gln Tyr Cys
Cys 165 170 175 Asn Ser Gly Asn Cys Gly Pro Thr Asp Leu Ser Arg Phe
Phe Lys Thr 180 185 190 Arg Cys Pro Asp Ala Tyr Ser Tyr Pro Lys Asp
Asp Pro Thr Ser Thr 195 200 205 Phe Thr Cys Pro Gly Gly Thr Asn Tyr
Asp Val Ile Phe Cys Pro 210 215 220 14 238 PRT Lycopersicon
esculentum 14 Phe Phe Phe Leu Leu Ala Phe Val Thr Tyr Thr Tyr Ala
Ala Thr Phe 1 5 10 15 Glu Val Arg Asn Asn Cys Pro Tyr Thr Val Trp
Ala Ala Ser Thr Pro 20 25 30 Ile Gly Gly Gly Arg Arg Leu Asp Arg
Gly Gln Thr Trp Val Ile Asn 35 40 45 Ala Pro Arg Gly Thr Lys Met
Ala Arg Ile Trp Gly Arg Thr Asn Cys 50 55 60 Asn Phe Asp Gly Asp
Gly Arg Gly Ser Cys Gln Thr Gly Asp Cys Gly 65 70 75 80 Gly Val Leu
Gln Cys Thr Gly Trp Gly Lys Pro Pro Asn Thr Leu Ala 85 90 95 Glu
Tyr Ala Leu Asp Gln Phe Ser Asn Leu Asp Phe Trp Asp Ile Ser 100 105
110 Leu Val Asp Gly Phe Asn Ile Pro Met Thr Phe Ala Pro Thr Asn Pro
115 120 125 Ser Gly Gly Lys Cys His Ala Ile His Cys Thr Ala Asn Ile
Asn Gly 130 135 140 Glu Cys Pro Gly Ser Leu Arg Val Pro Gly Gly Cys
Asn Asn Pro Cys 145 150 155 160 Thr Thr Phe Gly Gly Gln Gln Tyr Cys
Cys Thr Gln Gly Pro Cys Gly 165 170 175 Pro Thr Asp Leu Ser Arg Phe
Phe Lys Gln Arg Cys Pro Asp Ala Tyr 180 185 190 Ser Tyr Pro Gln Asp
Asp Pro Thr Ser Thr Phe Thr Cys Pro Ser Gly 195 200 205 Ser Thr Asn
Tyr Arg Val Val Phe Cys Pro Asn Gly Val Thr Ser Pro 210 215 220 Asn
Phe Pro Leu Glu Met Pro Ser Ser Asp Glu Glu Ala Lys 225 230 235 15
246 PRT Solanum commersonii 15 Met Ala Tyr Leu Arg Ser Ser Phe Val
Phe Phe Leu Leu Ala Phe Val 1 5 10 15 Thr Tyr Thr Tyr Ala Ala Thr
Ile Glu Val Arg Asn Asn Cys Pro Tyr 20 25 30 Thr Val Trp Ala Ala
Ser Thr Pro Ile Gly Gly Gly Arg Arg Leu Asp 35 40 45 Arg Gly Gln
Thr Trp Val Ile Asn Ala Pro Arg Gly Thr Lys Met Ala 50 55 60 Arg
Ile Trp Gly Arg Thr Asn Cys Asn Phe Asp Gly Ala Gly Arg Gly 65 70
75 80 Ser Cys Gln Thr Gly Asp Cys Gly Gly Val Leu Gln Cys Thr Gly
Trp 85 90 95 Gly Lys Pro Pro Asn Thr Leu Ala Glu Tyr Ala Leu Asp
Gln Phe Ser 100 105 110 Asn Leu Asp Phe Trp Asp Ile Ser Leu Val Asp
Gly Phe Asn Ile Pro 115 120 125 Met Thr Phe Ala Pro Thr Asn Pro Ser
Gly Gly Lys Cys His Ala Ile 130 135 140 His Cys Thr Ala Asn Ile Asn
Gly Glu Cys Pro Gly Ser Leu Arg Val 145 150 155 160 Pro Gly Gly Cys
Asn Asn Pro Cys Thr Thr Phe Gly Gly Gln Gln Tyr 165 170 175 Cys Cys
Thr Gln Gly Pro Cys Gly Pro Thr Asp Leu Ser Arg Phe Phe 180 185 190
Lys Gln Arg Cys Pro Asp Ala Tyr Ser Tyr Pro Gln Asp Asp Pro Thr 195
200 205 Ser Thr Phe Thr Cys Pro Ser Gly Ser Thr Asn Tyr Arg Val Val
Phe 210 215 220 Cys Pro Asn Gly Val Thr Ser Pro Asn Phe Pro Leu Glu
Met Pro Ala 225 230 235 240 Ser Asp Glu Glu Ala Lys 245 16 529 PRT
Helianthus annuus 16 Met Glu Thr Ser Ile Leu Thr Leu Leu Leu Leu
Leu Leu Ser Thr Gln 1 5 10 15 Ser Ser Ala Thr Ser Arg Ser Ile Thr
Asp Arg Phe Ile Gln Cys Leu 20 25 30 His Asp Arg Ala Asp Pro Ser
Phe Pro Ile Thr Gly Glu Val Tyr Thr 35 40 45 Pro Gly Asn Ser Ser
Phe Pro Thr Val Leu Gln Asn Tyr Ile Arg Asn 50 55 60 Leu Arg Phe
Asn Glu Thr Thr Thr Pro Lys Pro Phe Leu Ile Ile Thr 65 70 75 80 Ala
Glu His Val Ser His Ile Gln Ala Ala Val Val Cys Gly Lys Gln 85 90
95 Asn Arg Leu Leu Leu Lys Thr Arg Ser Gly Gly His Asp Tyr Glu Gly
100 105 110 Leu Ser Tyr Leu Thr Asn Thr Asn Gln Pro Phe Phe Ile Val
Asp Met 115 120 125 Phe Asn Leu Arg Ser Ile Asn Val Asp Ile Glu Gln
Glu Thr Ala Trp 130 135 140 Val Gln Ala Gly Ala Thr Leu Gly Glu Val
Tyr Tyr Arg Ile Ala Glu 145 150 155 160 Lys Ser Asn Lys His Gly Phe
Pro Ala Gly Val Cys Pro Thr Val Gly 165 170 175 Val Gly Gly His Phe
Ser Gly Gly Gly Tyr Gly Asn Leu Met Arg Lys 180 185 190 Tyr Gly Leu
Ser Val Asp Asn Ile Val Asp Ala Gln Ile Ile Asp Val 195 200 205 Asn
Gly Lys Leu Leu Asp Arg Lys Ser Met Gly Glu Asp Leu Phe Trp 210 215
220 Ala Tyr Thr Gly Gly Gly Gly Val Ser Phe Gly Val Val Leu Ala Tyr
225 230 235 240 Lys Ile Lys Leu Val Arg Val Pro Glu Val Val Thr Val
Phe Thr Ile 245 250 255 Glu Arg Arg Glu Glu Gln Asn Leu Ser Thr Ile
Ala Glu Arg Trp Val 260 265 270 Gln Val Ala Asp Lys Leu Asp Arg Asp
Leu Phe Leu Arg Met Thr Phe 275 280 285 Ser Val Ile Asn Asp Thr Asn
Gly Gly Lys Thr Val Arg Ala Ile Phe 290 295 300 Pro Thr Leu Tyr Leu
Gly Asn Ser Arg Asn Leu Val Thr Leu Leu Asn 305 310 315 320 Lys Asp
Phe Pro Glu Leu Gly Leu Gln Glu Ser Asp Cys Thr Glu Met 325 330 335
Ser Trp Val Glu Ser Val Leu Tyr Tyr Thr Gly Phe Pro Ser Gly Thr 340
345 350 Pro Thr Thr Ala Leu Leu Ser Arg Thr Pro Gln Arg Leu Asn Pro
Phe 355 360 365 Lys Ile Lys Ser Asp Tyr Val Gln Asn Pro Ile Ser Lys
Arg Gln Phe 370 375 380 Glu Phe Ile Phe Glu Arg Met Lys Glu Leu Glu
Asn Gln Met Leu Ala 385 390 395 400 Phe Asn Pro Tyr Gly Gly Arg Met
Ser Glu Ile Ser Glu Phe Ala Lys 405 410 415 Pro Phe Pro His Arg Ser
Gly Asn Ile Ala Lys Ile Gln Tyr Glu Val 420 425 430 Asn Trp Glu Asp
Leu Ser Asp Glu Ala Glu Asn Arg Tyr Leu Asn Phe 435 440 445 Thr Arg
Leu Met Tyr Asp Tyr Met Thr Pro Phe Val Ser Lys Asn Pro 450 455 460
Arg Glu Ala Phe Leu Asn Tyr Arg Asp Leu Asp Ile Gly Ile Asn Ser 465
470 475 480 His Gly Arg Asn Ala Tyr Thr Glu Gly Met Val Tyr Gly His
Lys Tyr 485 490 495 Phe Lys Glu Thr Asn Tyr Lys Arg Leu Val Ser Val
Lys Thr Lys Val 500 505 510 Asp Pro Asp Asn Phe Phe Arg Asn Glu Gln
Ser Ile Pro Thr Leu Ser 515 520 525 Ser 17 529 PRT Healianthus
annuus 17 Met Gln Thr Ser Ile Leu Thr Leu Leu Leu Leu Leu Leu Ser
Thr Gln 1 5 10 15 Ser Ser Ala Thr Ser Arg Ser Ile Thr Asp Arg Phe
Ile Gln Cys Leu 20 25 30 His Asp Arg Ala Asp Pro Ser Phe Pro Ile
Thr Gly Glu Val Tyr Thr 35 40 45 Pro Gly Asn Ser Ser Phe Pro Thr
Val Leu Gln Asn Tyr Ile Arg Asn 50 55 60 Leu Arg Phe Asn Glu Thr
Thr Thr Pro Lys Pro Phe Leu Ile Ile Thr 65 70 75 80 Ala Glu His Val
Ser His Ile Gln Ala Ala Val Val Cys Gly Lys Gln 85 90 95 Asn Arg
Leu Leu Leu Lys Thr Arg Ser Gly Gly His Asp Tyr Glu Gly 100 105 110
Leu Ser Tyr Leu Thr Asn Thr Asn Gln Pro Phe Phe Ile Val Asp Met 115
120 125 Phe Asn Leu Arg Ser Ile Asn Ile Asp Ile Glu Gln Glu Thr Ala
Trp 130 135 140 Val Gln Ala Gly Ala Thr Leu Gly Glu Val Tyr Tyr Arg
Ile Ala Glu 145 150 155 160 Lys Ser Asn Lys His Gly Phe Pro Ala Gly
Val Cys Pro Thr Val Gly 165 170 175 Val Gly Gly His Phe Ser Gly Gly
Gly Tyr Gly Asn Leu Met Arg Lys 180 185 190 Tyr Gly Leu Ser Val Asp
Asn Ile Val Asp Ala Gln Ile Ile Asp Val 195 200 205 Asn Gly Lys Leu
Leu Asp Arg Lys Ser Met Gly Glu Asp Leu Phe Trp 210 215 220 Ala Ile
Thr Gly Gly Gly Gly Val Ser Phe Gly Val Val Leu Ala Tyr 225 230 235
240 Lys Ile Lys Leu Val Arg Val Pro Glu Val Val Thr Val Phe Thr Ile
245 250 255 Glu Arg Arg Glu Glu Gln Asn Leu Ser Thr Ile Ala Glu Arg
Trp Val 260 265 270 Gln Val Ala Asp Lys Leu Asp Arg Asp Leu Phe Leu
Arg Met Thr Phe 275 280 285 Ser Val Ile Asn Asp Thr Asn Gly Gly Lys
Thr Val Arg Ala Ile Phe 290 295 300 Pro Thr Leu Tyr Leu Gly Asn Ser
Arg Asn Leu Val Thr Leu Leu Asn 305 310 315 320 Lys Asp Phe Pro Glu
Leu Gly Leu Gln Glu Ser Asp Cys Thr Glu Met 325 330 335 Ser Trp Val
Glu Ser Val Leu Tyr Tyr Thr Gly Phe Pro Ser Gly Thr 340 345 350 Pro
Thr Thr Ala Leu Leu Ser Arg Thr Pro Gln Arg Leu Asn Pro Phe 355 360
365 Lys Ile Lys Ser Asp Tyr Val Gln Asn Pro Ile Ser Lys Arg Gln Phe
370 375 380 Glu Phe Ile Phe Glu Arg Leu Lys Glu Leu Glu Asn Gln Met
Leu Ala 385 390 395 400 Phe Asn Pro Tyr Gly Gly Arg Met Ser Glu Ile
Ser Glu Phe Ala Lys 405 410 415 Pro Phe Pro His Arg Ser Gly Asn Ile
Ala Lys Ile Gln Tyr Glu Val 420 425 430 Asn Trp Glu Asp Leu Ser Asp
Glu Ala Glu Asn Arg Tyr Leu Asn Phe 435 440 445 Thr Arg Leu Met Tyr
Asp Tyr Met Thr Pro Phe Val Ser Lys Asn Pro 450 455 460 Arg Lys Ala
Phe Leu Asn Tyr Arg Asp Leu Asp Ile Gly Ile Asn Ser 465 470 475 480
His Gly Arg Asn Ala Tyr Thr Glu Gly Met Val Tyr Gly His Lys Tyr 485
490 495 Phe Lys Glu Thr Asn Tyr Lys Arg Leu Val Ser Val Lys Thr Lys
Val 500 505 510 Asp Pro Asp Asn Phe Phe Arg Asn Glu Gln Ser Ile Pro
Thr Leu Ser 515 520 525 Ser 18 535 PRT Papaver somniferum 18 Met
Met Cys Arg Ser Leu Thr Leu Arg Phe Phe Leu Phe Ile Val Leu 1 5 10
15 Leu Gln Thr Cys Val Arg Gly Gly Asp Val Asn Asp Asn Leu Leu Ser
20 25 30 Ser Cys Leu Asn Ser His Gly Val His Asn Phe Thr Thr Leu
Ser Thr 35 40 45 Asp Thr Asn Ser Asp Tyr Phe Lys Leu Leu His Ala
Ser Met Gln Asn 50 55 60 Pro Leu Phe Ala Lys Pro Thr Val Ser Lys
Pro Ser Phe Ile Val Met 65 70 75 80 Pro Gly Ser Lys Glu Glu Leu Ser
Ser Thr Val His Cys Cys Thr Arg 85 90 95 Glu Ser Trp Thr Ile Arg
Leu Arg Ser Gly Gly His Ser Tyr Glu Gly 100 105 110 Leu Ser Tyr Thr
Ala Asp Thr Pro Phe Val Ile Val Asp Met Met Asn 115 120 125 Leu Asn
Arg Ile Ser Ile Asp Val Leu Ser Glu Thr Ala Trp Val Glu 130 135 140
Ser Gly Ala Thr Leu Gly Glu Leu Tyr Tyr Ala Ile Ala Gln Ser Thr 145
150 155 160 Asp Thr Leu Gly Phe Thr Ala Gly Trp Cys Pro Thr Val Gly
Ser Gly 165 170 175 Gly His Ile Ser Gly Gly Gly Phe Gly Met Met Ser
Arg Lys Tyr Gly 180 185 190 Leu Ala Ala Asp Asn Val Val Asp Ala Ile
Leu Ile Asp Ser Asn Gly 195 200 205 Ala Ile Leu Asp Arg Glu Lys Met
Gly Asp Asp Val Phe Trp Ala Ile 210 215 220 Arg Gly Gly Gly Gly Gly
Val Trp Gly Ala Ile Tyr Ala Trp Lys Ile 225 230 235 240 Lys Leu Leu
Pro Val Pro Glu Lys Leu Thr Val Phe Arg Val Thr Lys 245 250 255 Asn
Val Gly Ile Glu Asp Ala Ser Ser Leu Leu His Lys Trp Gln Tyr 260 265
270 Val Ala Asp Glu Leu Asp Glu Asp Phe Thr Val Ser Val Leu Gly Gly
275 280 285 Val Asn Gly Asn Asp Ala Trp Leu Met Phe Leu Gly Leu His
Leu Gly 290 295 300 Arg Lys Asp Ala Ala Lys Thr Ile Ile Asp Glu Lys
Phe Pro Glu Leu 305 310 315 320 Gly Leu Val Asp Lys Glu Phe Gln Glu
Met Ser Trp Gly Glu Ser Met 325 330 335 Ala Phe Leu Ser Gly Leu Asp
Thr Ile Ser Glu Leu Asn Asn Arg Phe 340 345 350 Leu Lys Phe Asp Glu
Arg Ala Phe Lys Thr Lys Val Asp Phe Thr Lys 355 360 365 Val Ser Val
Pro Leu Asn Val Phe Arg His Ala Leu Glu Met Leu Ser 370 375 380 Glu
Gln Pro Gly Gly Phe Ile Ala Leu Asn Gly Phe Gly Gly Lys Met 385 390
395 400 Ser Glu Ile Ser Thr Asp Phe Thr Pro Phe Pro His Arg Lys Gly
Thr 405 410 415 Lys Leu Met Phe Glu Tyr Ile Ile Ala Trp Asn Gln Asp
Glu Glu Ser 420 425 430 Lys Ile Gly Glu Phe Ser Glu Trp Leu Ala Lys
Phe Tyr Asp Tyr Leu 435 440 445 Glu Pro Phe Val Ser Lys Glu Pro Arg
Val Gly Tyr Val Asn His Ile 450 455 460 Asp Leu Asp Ile Gly Gly Ile
Asp Trp Arg Asn Lys Ser Ser Thr Thr 465 470 475 480 Asn Ala Val Glu
Ile Ala Arg Asn Trp Gly Glu Arg Tyr Phe Ser Ser 485 490 495 Asn Tyr
Glu Arg Leu Val Lys Ala Lys Thr Leu Ile Asp Pro Asn Asn 500 505 510
Val Phe Asn His Pro Gln Ser Ile Pro Pro Met Met Lys Phe Glu Glu 515
520 525 Ile Tyr Met Leu Lys Glu Leu 530 535 19 538 PRT Eschscholzia
californica 19 Met Glu Asn Lys Thr Pro Ile Phe Phe Ser Leu Ser Ile
Phe Leu Ser 1 5 10 15 Leu Leu Asn Cys Ala Leu Gly Gly Asn Asp Leu
Leu Ser Cys Leu Thr 20 25 30 Phe Asn Gly Val Arg Asn His Thr Val
Phe Ser Ala Asp Ser Asp Ser 35 40 45 Asp Phe Asn Arg Phe Leu His
Leu Ser Ile Gln Asn Pro Leu Phe Gln 50 55 60 Asn Ser Leu Ile Ser
Lys Pro Ser Ala Ile Ile Leu Pro Gly Ser Lys
65 70 75 80 Glu Glu Leu Ser Asn Thr Ile Arg Cys Ile Arg Lys Gly Ser
Trp Thr 85 90 95 Ile Arg Leu Arg Ser Gly Gly His Ser Tyr Glu Gly
Leu Ser Tyr Thr 100 105 110 Ser Asp Thr Pro Phe Ile Leu Ile Asp Leu
Met Asn Leu Asn Arg Val 115 120 125 Ser Ile Asp Leu Glu Ser Glu Thr
Ala Trp Val Glu Ser Gly Ser Thr 130 135 140 Leu Gly Glu Leu Tyr Tyr
Ala Ile Thr Glu Ser Ser Ser Lys Leu Gly 145 150 155 160 Phe Thr Ala
Gly Trp Cys Pro Thr Val Gly Thr Gly Gly His Ile Ser 165 170 175 Gly
Gly Gly Phe Gly Met Met Ser Arg Lys Tyr Gly Leu Ala Ala Asp 180 185
190 Asn Val Val Asp Ala Ile Leu Ile Asp Ala Asn Gly Ala Ile Leu Asp
195 200 205 Arg Gln Ala Met Gly Glu Asp Val Phe Trp Ala Ile Arg Gly
Gly Gly 210 215 220 Gly Gly Val Trp Gly Ala Ile Tyr Ala Trp Lys Ile
Lys Leu Leu Pro 225 230 235 240 Val Pro Glu Lys Val Thr Val Phe Arg
Val Thr Lys Asn Val Ala Ile 245 250 255 Asp Glu Ala Thr Ser Leu Leu
His Lys Trp Gln Phe Val Ala Glu Glu 260 265 270 Leu Glu Glu Asp Phe
Thr Leu Ser Val Leu Gly Gly Ala Asp Glu Lys 275 280 285 Gln Val Trp
Leu Thr Met Leu Gly Phe His Phe Gly Leu Lys Thr Val 290 295 300 Ala
Lys Ser Thr Phe Asp Leu Leu Phe Pro Glu Leu Gly Leu Val Glu 305 310
315 320 Glu Asp Tyr Leu Glu Met Ser Trp Gly Glu Ser Phe Ala Tyr Leu
Ala 325 330 335 Gly Leu Glu Thr Val Ser Gln Leu Asn Asn Arg Phe Leu
Lys Phe Asp 340 345 350 Glu Arg Ala Phe Lys Thr Lys Val Asp Leu Thr
Lys Glu Pro Leu Pro 355 360 365 Ser Lys Ala Phe Tyr Gly Leu Leu Glu
Arg Leu Ser Lys Glu Pro Asn 370 375 380 Gly Phe Ile Ala Leu Asn Gly
Phe Gly Gly Gln Met Ser Lys Ile Ser 385 390 395 400 Ser Asp Phe Thr
Pro Phe Pro His Arg Ser Gly Thr Arg Leu Met Val 405 410 415 Glu Tyr
Ile Val Ala Trp Asn Gln Ser Glu Gln Lys Lys Lys Thr Glu 420 425 430
Phe Leu Asp Trp Leu Glu Lys Val Tyr Glu Phe Met Lys Pro Phe Val 435
440 445 Ser Lys Asn Pro Arg Leu Gly Tyr Val Asn His Ile Asp Leu Asp
Leu 450 455 460 Gly Gly Ile Asp Trp Gly Asn Lys Thr Val Val Asn Asn
Ala Ile Glu 465 470 475 480 Ile Ser Arg Ser Trp Gly Glu Ser Tyr Phe
Leu Ser Asn Tyr Glu Arg 485 490 495 Leu Ile Arg Ala Lys Thr Leu Ile
Asp Pro Asn Asn Val Phe Asn His 500 505 510 Pro Gln Ser Ile Pro Pro
Met Ala Asn Phe Asp Tyr Leu Glu Lys Thr 515 520 525 Leu Gly Ser Asp
Gly Gly Glu Val Val Ile 530 535 20 542 PRT Helianthus annuus 20 Met
Asn Asn Ser Arg Ser Val Phe Leu Leu Val Leu Ala Leu Ser Phe 1 5 10
15 Cys Val Ser Phe Gly Ala Leu Ser Ser Ile Phe Asp Val Thr Ser Thr
20 25 30 Ser Glu Asp Phe Ile Thr Cys Leu Gln Ser Asn Ser Asn Asn
Val Thr 35 40 45 Thr Ile Ser Gln Leu Val Phe Thr Pro Ala Asn Thr
Ser Tyr Ile Pro 50 55 60 Ile Trp Gln Ala Ala Ala Asp Pro Ile Arg
Phe Asn Lys Ser Tyr Ile 65 70 75 80 Pro Lys Pro Ser Val Ile Val Thr
Pro Thr Asp Glu Thr Gln Ile Gln 85 90 95 Thr Ala Leu Leu Cys Ala
Lys Lys His Gly Tyr Glu Phe Arg Ile Arg 100 105 110 Asp Gly Gly His
Asp Phe Glu Gly Asn Ser Tyr Thr Ala Asn Ala Pro 115 120 125 Phe Val
Met Leu Asp Leu Val Asn Met Arg Ala Ile Glu Ile Asn Val 130 135 140
Glu Asn Arg Thr Ala Leu Val Gln Gly Gly Ala Leu Leu Gly Glu Leu 145
150 155 160 Tyr Tyr Thr Ile Ser Gln Lys Thr Asp Thr Leu Tyr Phe Pro
Ala Gly 165 170 175 Ile Trp Ala Gly Val Gly Val Ser Gly Phe Leu Ser
Gly Gly Gly Tyr 180 185 190 Gly Asn Leu Leu Arg Lys Tyr Gly Leu Gly
Ala Asp Asn Val Leu Asp 195 200 205 Ile Arg Phe Met Asp Val Asn Gly
Asn Ile Leu Asp Arg Lys Ser Met 210 215 220 Gly Glu Asp Leu Phe Trp
Ala Leu Arg Gly Gly Gly Ala Ser Ser Phe 225 230 235 240 Gly Ile Val
Leu Gln Trp Lys Leu Asn Leu Val Pro Val Pro Glu Arg 245 250 255 Val
Thr Leu Phe Ser Val Ser Tyr Thr Leu Glu Gln Gly Ala Thr Asp 260 265
270 Ile Phe His Lys Tyr Gln Tyr Val Leu Pro Lys Phe Asp Arg Asp Leu
275 280 285 Leu Ile Arg Val Gln Leu Asn Thr Glu Tyr Ile Gly Asn Thr
Thr Gln 290 295 300 Lys Thr Val Arg Ile Leu Phe His Gly Ile Tyr Gln
Gly Asn Ile Asp 305 310 315 320 Thr Leu Leu Pro Leu Leu Asn Gln Ser
Phe Pro Glu Leu Asn Val Thr 325 330 335 Arg Glu Val Cys Gln Glu Val
Arg Met Val Gln Thr Thr Leu Glu Phe 340 345 350 Gly Gly Phe Asn Ile
Ser Thr Pro Thr Ser Val Leu Ala Asn Arg Ser 355 360 365 Ala Ile Pro
Lys Leu Ser Phe Lys Gly Lys Ser Asp Tyr Val Arg Thr 370 375 380 Pro
Ile Pro Arg Ser Gly Leu Arg Lys Leu Trp Arg Lys Met Phe Glu 385 390
395 400 Asn Asp Asn Ser Gln Thr Leu Phe Met Tyr Thr Phe Gly Gly Lys
Met 405 410 415 Glu Glu Tyr Ser Asp Thr Ala Ile Pro Tyr Pro His Arg
Ala Gly Val 420 425 430 Leu Tyr Gln Val Phe Lys Arg Val Asp Phe Val
Asp Gln Pro Ser Asp 435 440 445 Lys Thr Leu Ile Ser Leu Arg Arg Leu
Ala Trp Leu Arg Ser Phe Asp 450 455 460 Lys Thr Leu Glu Pro Tyr Val
Thr Ser Asn Pro Arg Glu Ala Tyr Met 465 470 475 480 Asn Tyr Asn Asp
Leu Asp Leu Gly Phe Asp Ser Ala Ala Tyr Glu Glu 485 490 495 Ala Ser
Glu Trp Gly Glu Arg Tyr Trp Lys Arg Glu Asn Phe Lys Lys 500 505 510
Leu Ile Arg Ile Lys Ala Lys Val Asp Pro Glu Asn Phe Phe Arg His 515
520 525 Pro Gln Ser Ile Pro Val Phe Ser Arg Pro Leu Ser Asp Met 530
535 540 21 80 PRT Raphanus sativus 21 Met Ala Lys Phe Ala Ser Ile
Ile Val Leu Leu Phe Val Ala Leu Val 1 5 10 15 Val Phe Ala Ala Phe
Glu Glu Pro Thr Met Val Glu Ala Gln Lys Leu 20 25 30 Cys Gln Arg
Pro Ser Gly Thr Trp Ser Gly Val Cys Gly Asn Asn Asn 35 40 45 Ala
Cys Lys Asn Gln Cys Ile Arg Leu Glu Lys Ala Arg His Gly Ser 50 55
60 Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile Cys Tyr Phe Pro Cys
65 70 75 80 22 51 PRT Sinapis alba 22 Gln Lys Leu Cys Glu Arg Pro
Ser Gly Thr Trp Ser Gly Val Cys Gly 1 5 10 15 Asn Asn Asn Ala Cys
Lys Asn Gln Cys Ile Asn Leu Glu Lys Ala Arg 20 25 30 His Gly Ser
Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile Cys Tyr 35 40 45 Phe
Pro Cys 50 23 80 PRT Arabidopsis thaliana 23 Met Ala Lys Ser Ala
Thr Ile Val Thr Leu Phe Phe Ala Ala Leu Val 1 5 10 15 Phe Phe Ala
Ala Leu Glu Ala Pro Met Val Val Glu Ala Gln Lys Leu 20 25 30 Cys
Glu Arg Pro Ser Gly Thr Trp Ser Gly Val Cys Gly Asn Ser Asn 35 40
45 Ala Cys Lys Asn Gln Cys Ile Asn Leu Glu Lys Ala Arg His Gly Ser
50 55 60 Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile Cys Tyr Phe
Pro Cys 65 70 75 80 24 108 PRT Helianthus annuus 24 Met Ala Lys Ile
Ser Val Ala Phe Asn Ala Phe Leu Leu Leu Leu Phe 1 5 10 15 Val Leu
Ala Ile Ser Glu Ile Gly Ser Val Lys Gly Glu Leu Cys Glu 20 25 30
Lys Ala Ser Gln Thr Trp Ser Gly Thr Cys Gly Lys Thr Lys His Cys 35
40 45 Asp Asp Gln Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys
His 50 55 60 Val Arg Asp Gly Lys His Met Cys Phe Cys Tyr Phe Asn
Cys Ser Lys 65 70 75 80 Ala Gln Lys Leu Ala Gln Asp Lys Leu Arg Ala
Glu Glu Leu Ala Lys 85 90 95 Glu Lys Ile Glu Pro Glu Lys Ala Thr
Ala Lys Pro 100 105 25 100 PRT Pisum Sativum 25 Met Glu Lys Lys Ser
Leu Ala Ala Leu Ser Phe Leu Leu Leu Leu Val 1 5 10 15 Leu Phe Val
Ala Gln Glu Ile Val Val Thr Glu Ala Asn Thr Cys Glu 20 25 30 His
Leu Ala Asp Thr Tyr Arg Gly Val Cys Phe Thr Asn Ala Ser Cys 35 40
45 Asp Asp His Cys Lys Asn Lys Ala His Leu Ile Ser Gly Thr Cys His
50 55 60 Asp Trp Lys Cys Phe Cys Thr Gln Asn Cys Glu Arg Arg Arg
Asn Lys 65 70 75 80 Asn Trp Asn Asp Cys Met Glu Asn Thr Pro Arg Pro
Glu Arg Thr Tyr 85 90 95 Asn Ala Met Glu 100 26 26 DNA Artificial
Sequence PCR primer corresponding to vector sequence 26 gcgattaagt
tgggtaacgc cagggt 26 27 26 DNA Artificial Sequence PCR primer
corresponding to vector sequence 27 tccggctcgt atgttgtgtg gaattg 26
28 230 DNA Helianthus annuus misc_feature (1)...(230) n = A,T,C or
G 28 tgatcagttt tgtacacggt gcaagggtta ttgcacccgc cagagcccgt
aactcnccag 60 gacactggcc attgatatcc gcagtacatg agataccccg
ggtgcaccca ttagaattgg 120 gtctaaacac catcggcaca ttgaatccgt
ccacaagaga aatgtcaaag aaatcaagat 180 tgttgaactg gttccaagcg
tactcggccc atgtgtttgg gtggggtacc 230 29 20 DNA Helianthus annuus 29
ccgagtacgc tttaaccagt 20 30 21 DNA Helainthus annuus 30 tccgcagtac
atgagatacc c 21 31 29 DNA Helianthus annuus 31 acaatgacaa
cctccaccct tcccacttt 29 32 112 DNA Helianthus annuus 32 tccggaccat
gtctggcttg ccttctcaca taattctcct ttcaccgatc cgatttctga 60
gatagcaaga acaaagagaa gcagaagaaa agcattgaaa gcaactgaaa tt 112 33 26
DNA Helianthus annuus 33 gaccatgtct ggcttgcctt ctcaca 26 34 35 DNA
Helianthus annuus 34 gagcttgagc ttagttcagt aacttaaaaa tggcc 35 35
163 DNA Helianthus annuus 35 tgtacacatt tggtgggaag atggaggagt
actcagatac agcaattccg tatccccata 60 gagctggggt gttgtaccaa
gtgttcaaga gggtggactt cgtggatcag ccttcggaca 120 agaccttgat
atcactcaga cggttggctt ggctccgaag ctt 163 36 24 DNA Helianthus
annuus 36 ccaaccgtct gagtgatatc aagg 24 37 24 DNA Helianthus annuus
37 gggaagatgg aggagtactc agat 24 38 29 DNA Helianthus annuus 38
cggcacgagt aactctcgtt cagtgttcc 29 39 22 DNA Artificial Sequence
PCR primer corresponding to vector sequence 39 gtaatacgac
tcactatagg gc 22 40 26 DNA Helianthus annuus 40 cgaatagtga
acacggctgc attggt 26 41 26 DNA Helianthus annuus 41 gctgcagctt
gccaaatggg tatgta 26
* * * * *
References