U.S. patent application number 10/674836 was filed with the patent office on 2004-04-15 for telomerase reverse transcriptase transcriptional regulatory sequences and methods of using.
This patent application is currently assigned to Geron Corporation. Invention is credited to Adams, Robert R., Andrews, William H., Lichtsteiner, Serge P., Morin, Gregg B., Vasserot, Alain P..
Application Number | 20040072787 10/674836 |
Document ID | / |
Family ID | 32853657 |
Filed Date | 2004-04-15 |
United States Patent
Application |
20040072787 |
Kind Code |
A1 |
Morin, Gregg B. ; et
al. |
April 15, 2004 |
Telomerase reverse transcriptase transcriptional regulatory
sequences and methods of using
Abstract
The present invention is related to novel nucleic acids
comprising telomerase reverse transcriptase (TERT) cis-acting
transcriptional control sequences, including TERT human and mouse
promoter sequences. The present invention is further directed to
methods of using these cis-acting transcriptional control
sequences, for example, to drive heterologous gene sequences; to
modulate the level of transcription of TERT or to isolate novel
trans-acting regulatory factors which bind to and modulate the
activity of a TERT promoter.
Inventors: |
Morin, Gregg B.; (Oakville,
CA) ; Lichtsteiner, Serge P.; (Encinitas, CA)
; Vasserot, Alain P.; (Carlsbad, CA) ; Adams,
Robert R.; (Redwood City, CA) ; Andrews, William
H.; (Reno, NV) |
Correspondence
Address: |
GERON CORPORATION
230 CONSTITUTION DRIVE
MENLO PARK
CA
94025
|
Assignee: |
Geron Corporation
Menlo Park
CA
|
Family ID: |
32853657 |
Appl. No.: |
10/674836 |
Filed: |
September 29, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10674836 |
Sep 29, 2003 |
|
|
|
09244438 |
Feb 4, 1999 |
|
|
|
09244438 |
Feb 4, 1999 |
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
08979742 |
Nov 26, 1997 |
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
08974549 |
Nov 19, 1997 |
|
|
|
6166178 |
|
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
08974584 |
Nov 19, 1997 |
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
PCT/US97/17618 |
Oct 1, 1997 |
|
|
|
09042460 |
Mar 16, 1998 |
|
|
|
PCT/US97/17885 |
Oct 1, 1997 |
|
|
|
PCT/US97/17618 |
|
|
|
|
08915503 |
Aug 14, 1997 |
|
|
|
PCT/US97/17618 |
|
|
|
|
08912951 |
Aug 14, 1997 |
|
|
|
6475789 |
|
|
|
|
PCT/US97/17618 |
|
|
|
|
08911312 |
Aug 14, 1997 |
|
|
|
PCT/US97/17885 |
|
|
|
|
08915503 |
Aug 14, 1997 |
|
|
|
PCT/US97/17885 |
|
|
|
|
08912951 |
Aug 14, 1997 |
|
|
|
6475789 |
|
|
|
|
PCT/US97/17885 |
|
|
|
|
08911312 |
Aug 14, 1997 |
|
|
|
08915503 |
|
|
|
|
08854050 |
May 9, 1997 |
|
|
|
6261836 |
|
|
|
|
08912951 |
|
|
|
|
08854050 |
May 9, 1997 |
|
|
|
6261836 |
|
|
|
|
08911312 |
|
|
|
|
08854050 |
May 9, 1997 |
|
|
|
6261836 |
|
|
|
|
08854050 |
May 9, 1997 |
|
|
|
08851843 |
May 6, 1997 |
|
|
|
6093809 |
|
|
|
|
08851843 |
May 6, 1997 |
|
|
|
08846017 |
Apr 25, 1997 |
|
|
|
08846017 |
Apr 25, 1997 |
|
|
|
08844419 |
Apr 18, 1997 |
|
|
|
08844419 |
Apr 18, 1997 |
|
|
|
08724643 |
Oct 1, 1996 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/456 |
Current CPC
Class: |
A01K 67/0271 20130101;
C12N 15/8509 20130101; C12N 9/1276 20130101; C07K 2319/00 20130101;
A61K 39/00 20130101; C12N 2795/10343 20130101; C12N 7/00 20130101;
C12N 2310/15 20130101; A01K 2227/105 20130101; A61K 48/00 20130101;
A01K 2267/0331 20130101; C12N 15/1137 20130101; A01K 2217/30
20130101; C12N 9/1241 20130101; C12N 2310/315 20130101; A01K
2217/05 20130101; C12Y 207/07049 20130101; A01K 2267/0393 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
514/044 ;
435/456 |
International
Class: |
A61K 048/00; C12N
015/86 |
Goverment Interests
[0002] This invention was made with United States Government
support under Grant Nos. HD.backslash.CA 34880, 5T32GM07491;
R01HD28317, R01EY09300, R01EY11267; all awarded by the National
Institute of Health. The United States Government has certain
rights in this invention.
Claims
The invention claimed is:
1. A method of killing a mammalian cell that expresses telomerase
reverse transcriptase (TERT), comprising contacting the cell with a
polynucleotide in which a promoter sequence controls transcription
of a transcribable sequence that is toxic to the cell or renders
the cell more susceptible to toxicity of a drug; wherein the
promoter has the property of causing the transcribable sequence to
be expressed in cells endogenously expressing TERT, and contains a
nucleotide sequence that is least 90% identical to the sequence
from position -117 to position -36 from the translation initiation
site (position 13545) of SEQ. ID NO:1.
2. A method of killing a mammalian cell that expresses telomerase
reverse transcriptase (TERT), comprising contacting the cell with a
polynucleotide in which a promoter sequence controls transcription
of a transcribable sequence that is toxic to the cell or renders
the cell more susceptible to toxicity of a drug; wherein the
promoter has the property of causing the transcribable sequence to
be expressed in cells endogenously expressing TERT, and is either;
a) contained in the APAI-FSPI fragment just upstream of the
encoding sequence for human telomerase reverse transcriptase
(hTERT) in lambda phage G.PHI.5 deposited as ATCC Accession No.
98505; or b) comprises a nucleotide sequence that hybridizes to DNA
complementary to said APAI-FSPI fragment at 5 to 10.degree. C.
below T.sub.m in aqueous solution at 1 M NaCl followed by wash in
0.2.times.SSC, wherein T.sub.m is the melting temperature of the
APAI-FSPI fragment in double-stranded form.
3. The method of claim 2, which hybridizes to lambda phage G.PHI.5
at 5.degree. C. below T.sub.m in aqueous solution at 1 M NaCl.
4. The method of claim 2, wherein the promoter contains a
nucleotide sequence that is at least 80% identical to the sequence
from position -239 to position -36 from the translation initiation
site of SEQ. ID NO:1.
5. The method of claim 1, wherein the promoter contains a
nucleotide sequence that is at least 95% identical to the sequence
from position -117 to position -36 from the translation initiation
site of SEQ. ID NO:1.
6. The method of claim 1, wherein the promoter contains the
sequence from position -117 to position -36 from the translation
initiation site of SEQ. ID NO:1.
7. The method of claim 1, wherein the promoter contains the
sequence from position -117 to position -36 from the translation
initiation site of SEQ. ID NO:1.
8. The method of claim 1, wherein the promoter is between about 400
to 900 nucleotides in length.
9. The method of claim 1, wherein the promoter is between about 200
to 400 nucleotides in length.
10. The method of claim 1, wherein the promoter is between about
100 to 200 nucleotides in length.
11. The method of claim 1, wherein the transcribable sequence
encodes a protein selected from the group consisting of ricin,
diphtheria toxin, other polypeptide toxins, thymidine kinase, and
an enzyme that induces apoptosis.
12. The method of claim 1, wherein the drug is ganciclovir.
13. The method of claim 1, wherein the polynucleotide is an
adenovirus vector.
14. The method of claim 1, wherein the cell is a cancer cell.
15. A method of treating cancer in a subject, comprising contacting
cancer cells in the subject with a polynucleotide in which a
promoter sequence controls transcription of a transcribable
sequence that is toxic to the cell or renders the cell more
susceptible to toxicity of a drug; wherein the promoter has the
property of causing the transcribable sequence to be expressed in
cells endogenously expressing TERT, and contains a nucleotide
sequence that is least 90% identical to the sequence from position
-117 to position -36 from the translation initiation site (position
13545) of SEQ. ID NO:1.
16. A method of expressing a transcribable nucleotide sequence in a
cell, comprising contacting the cell with a polynucleotide in which
the transcribable nucleotide sequence is operably linked to a
promoter sequence so as to cause it to be transcribed when the
polynucleotide is in cells endogenously expressing human telomerase
reverse transcriptase (hTERT); wherein the promoter has the
property of causing the transcribable sequence to be expressed in
cells endogenously expressing TERT, and contains a nucleotide
sequence that is least 90% identical to the sequence from position
-117 to position -36 from the translation initiation site (position
13545) of SEQ. ID NO:1.
17. A polynucleotide in which a promoter is operably linked to a
heterologous encoding region so as to cause it to be transcribed
when the polynucleotide is in cells endogenously expressing human
telomerase reverse transcriptase (hTERT), wherein the promoter
contains a nucleotide sequence that is least 90% identical to the
sequence from position -117 to position -36 from the translation
initiation site (position 13545) of SEQ. ID NO:1.
18. A polynucleotide in which a promoter is operably linked to a
heterologous sequence so as to cause the heterologous sequence to
be transcribed when the polynucleotide is in cells endogenously
expressing human telomerase reverse transcriptase (hTERT), wherein
the promoter is either a) contained in the APAI-FSPI fragment just
upstream of the encoding sequence for human telomerase reverse
transcriptase (hTERT) in lambda phage G.PHI.5 deposited as ATCC
Accession No. 98505; or b) comprises a nucleotide sequence that
hybridizes to DNA complementary to said APAI-FSPI fragment at 5 to
10.degree. C. below T.sub.m in aqueous solution at 1 M NaCl
followed by wash in 0.2.times.SSC, wherein T.sub.m is the melting
temperature of the APAI-FSPI fragment in double-stranded form.
19. The polynucleotide of claim 18, which hybridizes to lambda
phage G.PHI.5 at 5.degree. C. below T.sub.m in aqueous solution at
1 M NaCl.
20. The polynucleotide of claim 18, wherein the promoter contains a
nucleotide sequence that is at least 80% identical to the sequence
from position -239 to position -36 from the translation initiation
site of SEQ. ID NO:1.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application is a continuation-in-part
application ("CIP") of U.S. patent applications Ser. No. ("USSN")
09/042,460 filed on Mar. 16, 1998, which is a CIP of U.S. Ser. No,
08/979,742, filed on Nov. 26, 1997; and U.S. Ser. No. 08/974,549,
and U.S. Ser. No. 08/974,584, both filed on Nov. 19, 1997, and
Patent Convention Treaty (PCT) International Application Serial No:
PCT/US97/17618, for "Telomerase Reverse Transcriptase" (attorney
docket No.:015389-002940PC) and PCT Application Serial No.
PCT/US97/17885 for "Human Telomerase Catalytic Subunit" (attorney
docket no. 015389-002600PC), both filed in the U.S. receiving
office on Oct. 1, 1997, which are CIPs of U.S. Ser. No. 08/915,503,
filed Aug. 14, 1997, U.S. Ser. No. 08/912,951, filed Aug. 14, 1997,
and U.S. Ser. No. 08/911,312, filed Aug. 14, 1997; all three of
which are CIPs of U.S. Ser. No. 08/854,050, filed May 9, 1997,
which is CIP of U.S. Ser. No. 08/851,843, filed May 6, 1997, which
is a CIP application of U.S. Ser. No. 08/846,017, filed Apr. 25,
1997, which is a CIP of U.S. Ser. No. 08/844,419, filed Apr. 18,
1997, which is a CIP of U.S. Ser. No. 08/724,643, filed on Oct. 1,
1996. The afore-mentioned applications are explicitly incorporated
herein by reference in their entirety and for all purposes.
FIELD OF THE INVENTION
[0003] The present invention is related to novel nucleic acids
comprising telomerase reverse transcriptase (TERT, or TRT)
cis-acting transcriptional control sequences. The present invention
is further directed to methods of using these cis-acting
transcriptional control sequences, for example, to drive
heterologous gene sequences; to modulate the level of transcription
of TERT or to isolate novel trans-acting regulatory factors which
bind to and modulate the activity of a TERT promoter.
BACKGROUND OF THE INVENTION
[0004] The following discussion is intended to introduce the field
of the present invention to the reader. The citation of various
references in this section is not to be construed as an admission
of prior invention.
[0005] It has long been recognized that complete replication of the
ends of eukaryotic chromosomes requires specialized cell components
(Watson (1972) Nature New Biol. 239:197; Olovnikov (1973) J. Theor.
Biol. 41:181). Replication of a linear DNA strand by conventional
DNA polymerases requires an RNA primer, and can proceed only 5' to
3'. When the RNA primer bound at the extreme 5' ends of eukaryotic
chromosomal DNA strands is removed, a gap is introduced, leading to
a progressive shortening of daughter strands with each round of
replication. This shortening of telomeres, the protein-DNA
structures physically located on the ends of chromosomes, is
thought to account for the phenomenon of cellular senescence or
aging of normal human somatic cells in vitro and in vivo (see,
e.g., Goldstein (1990) Science 249:1129; Martin (1979) Lab. Invest.
23:86; Goldstein (1969) Proc. Natl. Acad. Sci. USA 64:155;
Schneider (1976) Proc. Natl. Acad. Sci. USA, 73:3584; Harley (1990)
Nature 345:458-460; Hastie (1990) Nature 346:866-868; Counter
(1992) EMBO J. 11:1921-1929; Bodnar (1998) Science 279:349-52).
[0006] The length and integrity of telomeres is thus related to
entry of a cell into a senescent stage (i.e., loss of proliferative
capacity). Moreover, the ability of a cell to maintain (or
increase) telomere length may allow a cell to escape senescence,
i.e., to become immortal.
[0007] The maintenance of telomeres is a function of a specific DNA
polymerase known as telomerase reverse transcriptase (TERT, or
TRT). Telomerase is a ribonucleoprotein (RNP) that uses a portion
of its RNA moiety as a template for telomere repeat DNA synthesis
(see, e.g., Morin (1997) Eur. J. Cancer 33:750). Consistent with
the relationship of telomeres and TERT to the proliferative
capacity of a cell (i.e., the ability of the cell to divide
indefinitely), telomerase activity is detected in immortal cell
lines and an extraordinarily diverse set of tumor tissues, but is
not detected (i.e., was absent or below the assay threshold) in
normal somatic cell cultures or normal tissues adjacent to a tumor
(see, U.S. Pat. Nos. 5,629,154; 5,489,508; 5,648,215; and
5,639,613; see also, Morin (1989) Cell 59:521; Shay (1997) Eur. J.
Cancer 33:787; Kim (1994) Science 266:2011). Moreover, a
correlation between the level of telomerase activity in a tumor and
the likely clinical outcome of the patient has been reported (see
e.g., U.S. Pat. No. 5,639,613; Langford (1997) Hum. Pathol.
28:416).
[0008] Telomerase activity has also been detected in human germ
cells, proliferating stem or progenitor cells, and activated
lymphocytes. In somatic stem or progenitor cells, and in activated
lymphocytes, telomerase activity is typically either very low or
only transiently expressed (see, e.g., Chiu (1996) Stem Cells
14:239; Bodnar (1996) Exp. Cell Res. 228:58; Taylor (1996) J.
Invest. Dermatol. 106:759).
[0009] Accordingly, human TERT (hTERT, hTRT) is an ideal target for
treating human diseases relating to cellular proliferation and
senescence, such as cancer. The cis-acting transcriptional control
elements of TERT provided herein also allow for the identification
of trans-acting transcription control factors. Moreover, the
discovery and characterization of the TERT cis-acting sequences
provide opportunities to develop useful disease therapies. The
present invention fulfills this and other needs.
SUMMARY OF THE INVENTION
[0010] The invention provides an isolated, synthetic, or
recombinant polynucleotide comprising a human telomerase reverse
transcriptase (hTERT) promoter sequence. In alternative
embodiments, the promoter sequence comprises at least 15, 50, 100,
150, 200, 250, 500, 1000, 2500 or at least 13,000 bases as set
forth in residues 44 to 13490 in SEQ ID NO:1 or SEQ ID NO:2. Other
embodiments include sequences starting within about one to 5
nucleotides of a translation start codon and ending at about 50,
100, 150, 200, 250, 500, 1000, 2500 or 13500 nucleotides upstream
of the translation start codon in SEQ ID NO:1 or SEQ ID NO:2. The
promoter sequence can comprise the sequence as set forth in
residues 44 to 13490 in SEQ ID NO:1.
[0011] The invention provides an isolated, synthetic, or
recombinant polynucleotide comprising a human telomerase reverse
transcriptase (hTERT) promoter or a mouse telomerase reverse
transcriptase (mTERT) sequence operably linked to a transcribable
sequence. The transcribable sequence can encode a protein other
than hTERT or mTERT. The protein can be a cellular toxin. In one
embodiment, the protein has activity that is not itself toxic to a
cell, but which renders the cell sensitive to an otherwise nontoxic
drug; e.g., the protein can be a Herpes virus thymidine kinase.
Alternatively, the transcribable sequence can encode a protein that
is detectable by fluorescence, phosphorescence, or by virtue of its
possessing an enzymatic activity. The detectable protein can be
firefly luciferase, alpha-glucuronidase, alpha-galactosidase,
chloramphenicol acetyl transferase, green fluorescent protein,
enhanced green fluorescent protein, and the human secreted alkaline
phosphatase.
[0012] The invention also provides a method for screening for a
compound that binds to TERT promoter, such as an hTERT or an mTERT
promoter, comprising the following steps: (i) providing an
isolated, synthetic, or recombinant polynucleotide comprising a
TERT promoter sequence and a test compound, (ii) contacting the
polynucleotide with the test compound, and (iii) measuring the
ability of the test compound to bind to the polynucleotide.
[0013] The invention also provides a method for a method for
screening for a compound that modulates a TERT promoter, such as
hTERT or mTERT promoter activity, comprising the following steps
(i) providing a first polynucleotide comprising an isolated,
synthetic, or recombinant TERT promoter sequence operably linked to
a transcribable second nucleotide, and a test compound, (ii)
contacting the polynucleotide with the test compound, and (iii)
measuring the ability of the test compound to modulate
transcription of the second nucleotide. The transcribable sequence
can encode a protein. The protein can be detectable by fluorescence
or phosphorescence or by virtue of its possessing an enzymatic
activity. The detectable protein can be firefly luciferase,
alpha-glucuronidase, alpha-galactosidase, chloramphenicol acetyl
transferase, green fluorescent protein, enhanced green fluorescent
protein, and the human secreted alkaline phosphatase.
[0014] The invention also provides a method for identifying a
cis-acting transcriptional regulatory sequence that modulates a
TERT promoter, such as hTERT or mTERT, promoter activity,
comprising the following steps (i) providing a first construct
comprising a first polynucleotide comprising an isolated,
synthetic, or recombinant TERT promoter sequence operably linked to
a transcribable second nucleotide, (ii) providing a second
construct comprising a modification in a subsequence of the first
polynucleotide of step 1 operably linked to a transcribable second
nucleotide, and (iii) measuring independently under the same
conditions the ability of the first construct and the second
construct to induce transcription of the transcribable second
nucleotide, wherein an increase or decrease in the ability of the
second modified construct to induce transcription of the
transcribable second nucleotide as compared to the first unmodified
construct identifies in the second modified construct a subsequence
acting functionally as a cis-acting transcriptional regulatory
sequence that modulates TERT promoter activity.
[0015] The invention also provides a method for generating a cell
that lacks a TERT promoter activity, comprising the following steps
(i) providing a polynucleotide comprising an isolated, synthetic,
or recombinant TERT promoter sequence; (ii) introducing into the
cell the polynucleotide of step (i), and (iii) measuring ability of
the cell to transcribe TERT message; wherein the inability of the
cell to transcribe TERT message indicates that a cell that lacks
TERT promoter activity has been generated.
[0016] The invention also provides a genetically engineered cell
lacking TERT, e.g., hTERT or mTERT, promoter activity, produced by
introducing into the cell a polynucleotide comprising an isolated,
synthetic, or recombinant TERT promoter sequence.
[0017] The invention also provides a composition comprising an
isolated nucleic acid molecule comprising a TERT promoter, wherein
the promoter comprises about 100 to about 200, 200 to about 400,
400 to about 900, or 900 to about 2500, or 2500 to about 5000
nucleotides upstream of a transcriptional start site in SEQ ID NO:1
or SEQ ID NO:2.
[0018] The invention also provides a vector comprising a TERT
promoter operably linked to a heterologous nucleic acid sequence,
wherein the promoter comprises about 100 to about 200, 200 to about
400, 400 to about 900, or 900 to about 2500, or 2500 to about 5000
nucleotides upstream of a transcriptional start site in SEQ ID NO:1
or SEQ ID NO:2.
[0019] The invention provides a transformed cell comprising a TERT
promoter operably linked to a heterologous nucleic acid sequence,
wherein the promoter comprises about 100 to about 200, 200 to about
400, 400 to about 900, or 900 to about 2500, or 2500 to about 5000
nucleotides upstream of a transcriptional start site in SEQ ID NO:1
or SEQ ID NO:2. The heterologous nucleic acid can code for a
cellular toxin. The cellular toxin can be a Herpes virus thymidine
kinase, ricin, abrin, diphtheria, gelonin, Pseudomonas exotoxin A,
tumor necrosis factor alpha (TNF-alpha), Crotalus durissus
terrificus toxin, Crotalus adamenteus toxin, Naja naja toxin, and
Naja mocambique toxin.
[0020] The invention also provides a method of expressing a
heterologous nucleic acid sequence in a cell comprising: (a)
transforming said cell with a vector or an expression cassette
comprising a TERT promoter, wherein the promoter consists of about
100 to about 200, 200 to about 400, 400 to about 900, or 900 to
about 2500, or 2500 to about 5000 nucleotides upstream of a
transcriptional start site in SEQ ID NO:1 or SEQ ID NO:2, and
wherein the promoter is operably linked to the heterologous nucleic
acid sequence; and (b) growing said cell under conditions where the
heterologous nucleic acid sequence is expressed in said cell.
[0021] The invention also provides an isolated nucleic acid
molecule which hybridizes to SEQ ID NO:1 or SEQ ID NO:2 under
stringent hybridization conditions. The nucleic acid can consist of
about 100 to about 200, 200 to about 400, 400 to about 900, or 900
to about 2500, or 2500 to about 5000 nucleotides upstream of a
transcriptional start site in SEQ ID NO:1 or SEQ ID NO:2. The
stringent hybridization conditions can comprise a hybridization
step comprising a salt concentration of about 0.02 molar at pH 7
and a temperature of about 60.degree. C. The stringent
hybridization conditions can also comprise a washing step at
65.degree. C. in 0.1.times.SSC, 0.1% SDS. In an alternative
embodiment, the stringent hybridization conditions are selected to
be about 5-10.degree. C. lower than the thermal melting point (Tm)
for the specific sequence at a defined ionic strength and pH.
[0022] The invention also provides transgenic non-human animals
comprising a TERT promoter sequence operably linked to
transcribable sequence, such as a reporter gene. In a preferred
embodiment, an hTERT promoter is operably linked to a reporter gene
in a transgenic mouse.
[0023] A further understanding of the nature and advantages of the
present invention may be realized by reference to the remaining
portions of the specification, the figures and claims.
[0024] All publications, GenBank deposited sequences, ATCC
deposits, patents and patent applications cited herein are hereby
expressly incorporated by reference for all purposes.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows a restriction map of lambda phage clone Gphi5,
discussed in detail in Example 1, below.
[0026] FIG. 2 shows the sequence of a NotI fragment (SEQ ID NO:1)
from the lambda Gphi5 insert containing the hTERT promoter
region.
[0027] FIG. 3 shows the construction of an hTERT promoter-reporter
plasmid, discussed in detail in Example 2, below.
[0028] FIG. 4A shows, in the upper panel, sequence alignment of the
murine and human TERT promoters. Also shown are-the positions of
conserved cis-acting transcriptional regulatory motifs, including
the motifs designated as the "E-box" or "Myc/Max binding site" and
SPI sites. E-boxes are indicated by shaded ("shaded") sequence. SPI
sites are indicated by underlines. FIG. 4A, lower panel,
illustrates the proximal sequences of the 2.5 kb hTERT and E-box
reporter constructs, including the region deleted in the E-box
reporter construct, as described below in Example 8. FIG. 4B shows
the alignment of human (residues -1106 to -1612) and mouse
(residues -916 to -1340) TERT promoter sequences. Alignments were
performed and identity calculated as described in Example 8.
Cis-acting transcriptional regulatory elements common to both TERT
promoters are indicated by shaded regions.
[0029] FIG. 5 shows the sequence of the mouse telomerase reverse
transcriptase promoter sequence (SEQ ID NO:2).
DETAILED DESCRIPTION OF THE INVENTION
[0030] The invention provides novel isolated polynucleotides
comprising cis-acting transcriptional control sequences of
telomerase reverse transcriptase genes. The polynucleotides of the
invention include those based on or derived from genomic sequences
of untranscribed, transcribed and intronic regions of TERT genes,
including the human TERT (hTERT) and mouse TERT (mTERT) genes.
Cis-acting TERT transcriptional control sequences, also referred to
as the "TERT promoter sequences," include all cis-acting TERT
transcriptional control elements and regulatory sequences,
including (without limitation) those that regulate and modulate
timing and rates of transcription of the TERT gene. Thus, the TERT
promoter sequences of the invention include cis-acting elements
such as, e.g., promoters, enhancers, transcription terminators,
origins of replication, chromosomal integration sequences, introns,
exons, and 5' and 3' untranslated regions, with which proteins or
other biomolecules interact to carry out and regulate transcription
of the TERT transcript.
Isolating and Characterizing Human TERT Promoter Sequences
[0031] As described in Example 1, the hTERT promoter (SEQ ID NO:1)
was obtained by sequencing an insert from a lambda phage isolated
from a human genomic library. This lambda clone is designated
"Gphi5" and has been deposited at the ATCC, with Accession No.
209024. Lambda Gphi5 contains a 15.3 kilobasepair (kbp) insert
including approximately 13,500 bases 5' (upstream) to the hTERT
coding sequence (i.e., 5' untranscribed promoter sequence). These
hTERT promoter sequences were further subcloned into plasmids. A
Not1 fragment (SEQ ID NO:1) from lambda Gphi5 containing the hTERT
promoter sequences was subcloned in opposite orientations into the
Not1 site of pUC derived plasmids (designated pGRN142 and pGRN143,
respectively, (see discussion below) and pGRN142 was sequenced.
[0032] In SEQ ID NO:1, the hTERT genomic insert begins at residue
44 and ends at residue 15375. The hTERT cDNA start site is at
residue 13490. The hTERT ATG codon starts at residue 13545. Thus,
untranscribed hTERT promoter sequences of the invention lie
downstream of residue 44 and upstream of residue 13489 of SEQ ID
NO:1. In immortal cells, a reporter gene driven by a sequence
upstream of the TERT coding sequence drove expression as
efficiently as the positive control (containing an SV40 early
promoter and enhancer).
[0033] TERT promoter sequences (i.e., TERT genomic sequences
capable of driving transcription in a telomerase activity positive
cell) of the invention also include intronic sequences.
Identification of Cis-Acting Transcriptional Regulatory Sequences
in the Human and Mouse TERT Promoter
[0034] To identify cis-acting transcriptional regulatory sequences
in human TERT (hTERT) and mouse TERT (mTERT) sequences 5' to their
respective TERT coding sequence, the human and mouse promoter
sequences were analyzed for sequence identity between themselves
and publicly accessible sequences (see Example 8, below). Alignment
of the first 300 bases upstream of the human and mouse coding
sequences indicated a number of conserved regions, i.e. putative
cis-acting transcriptional regulatory sequences (see FIG. 4A).
[0035] In particular, located at residues -34 to -29 upstream of
the human TERT translation start site (ATG, A at 13545 of SEQ ID
NO:1) and at residues -32 to -27 upstream of the mouse TERT
translation start site (ATG) are highly conserved motifs. They
correspond to a cis-acting motif known to interact with c-Myc, the
so-called "E-box" or "Myc/Max binding site." Specifically, they are
highly conserved with respect to the core nucleotides which
comprise the E-box, nucleotides flanking the E-box and position of
the E-box relative to the translation start site. A second E-box
was identified at residues -242 to -237 upstream of the human TERT
translation start site. This second E-box was not conserved in the
mouse promoter. These observations support the finding (see
discussion on E-box deletion construct experiments, below) that the
conserved Myc binding site, by interacting with c-Myc as a
trans-acting transcriptional regulatory factor, plays a major role
in TERT promoter regulation and telomerase expression.
[0036] Sequence alignment identified additional conserved
cis-acting transcriptional regulatory elements in the TERT gene
promoter. For example, two SPI binding sites, located at residue
-168 to -159 and residue -133 to -121 relative to the TERT
translation start site (FIG. 4A) were identified, which are highly
conserved between the mouse and human TERT promoters.
[0037] Binding sites (cis-acting sequences) for a number of other
transcription factors, including the sex determining region Y gene
product (SRY), hepatic nuclear factors 3-beta (HNF-3_) and 5
(HNF-5), TFIID-MBP, E2F and c-Myb were also found within this
region of both the mouse and human promoters.
TERT-Specific Promoter Motif Identified
[0038] Further analysis of the human and mouse TERT promoter
sequences indicated other regions of sequence conservation. In
particular, a region with a high degree of sequence identity
between human and mouse promoter was found between residue -1106
and residue -1602 upstream of the human TERT translation start site
and residue -916 and residue -1340 upstream of the mouse TERT
translation start site (FIG. 4B). Thus, the invention provides
cis-acting sequences specific for the modulation of TERT
transcription.
[0039] In a preferred embodiment, the methods of the invention use
these human and mouse TERT-specific transcriptional regulatory
motifs to identify and isolate TERT-specific, and other,
trans-acting transcriptional regulatory factors (as described in
detail, below).
Screening and Isolating Trans-Acting TERT Transcriptional
Modulators
[0040] The invention also provides the reagents and methods for
screening and isolating trans-acting TERT transcriptional
regulatory factors. Alternative embodiments include novel in vitro
and cell-based in vivo assay systems to screen for TERT promoter
binding agents (trans-acting TERT transcriptional regulatory
factors) using the nucleic acids of the invention.
[0041] Many assays are available that screen for nucleic acid
binding proteins and all are adapted and used with the novel TERT
sequences provided by the invention, as described below.
c-Myc Acts as a Potent Activator of TERT Gene Transcription
[0042] Use of recombinant constructs comprising TERT promoter
sequences of the invention has, for the first time, demonstrated
that c-Myc acts as a potent activator of telomerase activity by
direct interaction with cis-acting regulatory sequences in the TERT
promoter. c-Myc acts through the rapid upregulation of hTERT gene
expression (see Example 8, below). Significantly, the studies
demonstrate that transcriptional activation of the hTERT promoter
by c-Myc can be abrogated by deletion or mutation of a single
cis-acting regulatory sequence, the "Myc/Max binding site," within
the hTERT promoter. Furthermore, also as discussed below, the
ability of an inducible c-Myc to enhance expression of hTERT is
resistant to inhibition of protein synthesis.
Screening for Small Molecules and Biological Agents which are
Modulators of the TERT Promoter
[0043] The invention also provides constructs, cell lines and
methods for screening for small molecule modulators of TERT
promoter activity in vitro and in vivo. Many assays are available
that screen for small molecule modulators of TERT transcription,
including high throughput assays; all are adapted and used with the
novel TERT sequences provided by the invention.
[0044] As described in detail in Example 5, below, various
constructs containing hTERT promoter sequences driving a marker
gene (in this example, the human secreted alkaline phosphatase,
SEAP, gene) indicated that a fragment of approximately 2.5 kb of
hTERT promoter sequence contains sufficient sequence elements to
support both activation and repression of gene expression in
response to proliferation and/or growth arrest stimuli that control
telomerase activity in a model cell line, IDH4. Clones were
selected and expanded for high throughput screening of small
molecule activators of telomerase.
TERT Promoter used to Drive Heterologous Gene Sequences
[0045] The invention also provides constructs in which the TERT
promoter sequences of the invention are operably linked to a
heterologous gene (in a preferred embodiment, a structural gene).
In this way the heterologous gene is transcribed in the same cells
at the same time the natural TERT transcript would be expressed.
Thus, when the construct is expressed in a transformed cell or
transgenic (non-human) animal, the heterologous gene (and protein,
if the gene is a coding sequence) is expressed in the same temporal
pattern over the same cell range as the wild type, TERT
promoter-driven TERT gene.
[0046] These-constructs are useful for TERT promoter-based assays,
for example, to identify biological modulators of TERT and
telomerase activity. In alternative embodiments, the heterologous
coding sequence operably linked to a TERT promoter of the invention
is a marker gene (e.g., alkaline phosphatase, SEAP;
.beta.-galactosidase), a modified TERT structural gene or a TERT
antisense, a therapeutic gene (e.g., a "cancer cell cytotoxic gene"
as thymidine kinase).
[0047] In a further embodiment, cytopathic viruses are provided, in
particular human cytopathic viruses, such as modified adenovirus or
Herpes virus. Viruses, such as adenovirus or Herpes virus require
essential virally encoded genes to proliferate and lyse specific
cells. If any one of these essential viral genes were modified such
that expression of the essential element would be driven by the
TERT promoter, proliferation of the virus, and its cytopathic
effects, would be restricted to telomerase-expressing cells, in
particular tumor cells.
Definitions
[0048] The following terms are defined infra to provide additional
guidance to one of skill in the practice of the invention.
[0049] As used herein, the terms "allele" or "allelic sequence"
refer to an alternative form of a nucleic acid sequence (i.e., a
nucleic acid corresponding to a TERT promoter, particularly, an
hTERT promoter). Alleles result from mutations (i.e., changes in
the nucleic acid sequence), and can produce differently regulated
mRNAs. Common mutational changes that give rise to alleles are
generally ascribed to natural deletions, additions, or
substitutions of nucleotides. Each of these types of changes may
occur alone, in combination with the others, or one or more times
within a given gene, chromosome or other cellular nucleic acid.
Thus, the term "TERT promoter" includes allelic forms of TERT
promoter sequences, i.e., TERT cis-acting transcriptional control
elements, including, e.g., the exemplary human and mouse sequences
described herein.
[0050] The term "amplifying" as used herein incorporates its common
usage and refers to the use of any suitable amplification
methodology for generating or detecting recombinant or naturally
expressed nucleic acid, as described in detail, below. For example,
the invention provides methods and reagents (e.g., specific
oligonucleotide PCR primer pairs) for amplifying (e.g., by PCR)
naturally expressed or recombinant nucleic acids of the invention
(e.g., TERT promoter sequences of the invention) in vivo or in
vitro. An indication that two polynucleotides are "substantially
identical" can be obtained by amplifying one of the polynucleotides
with a pair of oligonucleotide primers or pool of degenerate
primers (e.g., fragments of an TERT promoter sequence) and then
using the product as a probe under stringent hybridization
conditions to isolate the second sequence (e.g., the TERT promoter
sequence) from a genomic library or to identify the second sequence
in, e.g., a Northern or Southern blot.
[0051] As used herein, the term "TERT promoter" includes any TERT
genomic sequences capable of driving transcription in a telomerase
activity positive cells. Thus, TERT promoters of the invention
include without limitation cis-acting transcriptional control
elements and regulatory sequences that are involved in regulating
or modulating the timing and/or rate of transcription of a TERT
gene. For example, the TERT promoter of the invention comprises
cis-acting transcriptional control elements, including enhancers,
promoters, transcription terminators, origins of replication,
chromosomal integration sequences, 5' and 3' untranslated regions,
exons and introns, which are involved in transcriptional
regulation. These cis-acting sequences typically interact with
proteins or other biomolecules to carry out (turn on/off, regulate,
modulate, etc.) transcription.
[0052] In alternative embodiments, the TERT promoter sequence
comprises TERT sequences 5' (upstream) of the translational start
site (ATG), for example, in one embodiment, the hTERT promoter
comprises residues 44 to 13545 of SEQ ID NO:1. Other embodiments
include sequences starting within about one to 5 nucleotides of a
translation start codon (for example in SEQ ID NO:1 or SEQ ID NO:2)
and ending at about 50, 100, 150, 200, 250, 500, 1000, 2500 or
13500 nucleotides upstream of the translation start codon. Such
embodiments can optionally include other regulatory sequences, such
as, exon and/or intron sequences. Another embodiment includes TERT
intronic sequences with regulatory activity, as described in
Example 2, below. hTERT promoters of the invention also include
sequences substantially identical (as defined herein) to an
exemplary hTERT promoter sequence of the invention, having the
sequence set forth by SEQ ID NO:1. Similarly, mTERT promoters of
the invention also include sequences substantially identical to an
exemplary mTERT promoter sequence of the invention, having the
sequence set forth by SEQ ID NO:2.
[0053] The term "heterologous" when used with reference to portions
of a nucleic acid, indicates that the nucleic acid comprises two or
more subsequences which are not found in the same relationship to
each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged in a manner not found in nature; e.g., a promoter
sequence of the invention operably linked to a polypeptide coding
sequence that, when operably linked, does not reform the naturally
occuring TERT gene. For example, the invention provides recombinant
constructs (expression cassettes, vectors, viruses, and the like)
comprising various combinations of promoters of the invention, or
subsequences thereof, and heterologous coding sequences, many
examples of which are described in detail below.
[0054] As used herein, "isolated," when referring to a molecule or
composition, such as, e.g., an hTERT promoter sequence, means that
the molecule or composition is separated from at least one other
compound, such as a protein, DNA, RNA, or other contaminants with
which it is associated in vivo or in its naturally occurring state.
Thus, a nucleic acid sequence is considered isolated when it has
been isolated from any other component with which it is naturally
associated. An isolated composition can, however, also be
substantially pure. An isolated composition can be in a homogeneous
state. It can be in a dry or an aqueous solution. Purity and
homogeneity can be determined, e.g., using analytical chemistry
techniques such as, e.g., polyacrylamide gel electrophoresis
(PAGE), agarose gel electrophoresis or high pressure liquid
chromatography (HPLC).
[0055] As used herein, the terms "nucleic acid" and
"polynucleotide" are used interchangeably, and include
oligonucleotides (i.e., short polynucleotides). They also refer to
synthetic and/or non-naturally occurring nucleic acids (i.e.,
comprising nucleic acid analogues or modified backbone residues or
linkages). The terms also refer to deoxyribonucleotide or
ribonucleotide oligonucleotides in either single-or double-stranded
form. The terms encompass nucleic acids containing known analogues
of natural nucleotides. The term also encompasses nucleic acid-like
structures with synthetic backbones. DNA backbone analogues
provided by the invention include phosphodiester, phosphorothioate,
phosphorodithioate, methyl-phosphonate, phosphoramidate, alkyl
phosphotriester, sulfamate, 3'-thioacetal, methylene (methylimino),
3'-N-carbamate, morpholino carbamate, and peptide nucleic acids
(PNAs); see Oligonucleotides and Analogues, a Practical Approach,
edited by F. Eckstein, IRL Press at Oxford University Press (1991);
Antisense Strategies, Annals of the New York Academy of Sciences,
Volume 600, Eds. Baserga and Denhardt (NTYAS 1992); Milligan (1993)
J. Med. Chem. 36:1923-1937; Antisense Research and Applications
(1993, CRC Press). PNAs contain non-ionic backbones, such as
N-(2-aminoethyl) glycine units. Phosphorothioate linkages are
described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol. Appl.
Pharmacol. 144:189-197. Other synthetic backbones encompassed by
the term include methyl-phosphonate linkages or alternating
methylphosphonate and phosphodiester linkages (Strauss-Soukup
(1997) Biochemistry 36:8692-8698), and benzyl-phosphonate linkages
(Samstag (1996) Antisense Nucleic Acid Drug Dev 6:153-156).
[0056] As used herein, the term "operably linked" refers to a
functional relationship between two or more nucleic acid (e.g.,
DNA) segments. Typically, it refers to the functional relationship
of a transcriptional regulatory sequence to a transcribed sequence.
For example, a TERT promoter sequence of the invention, including
any combination of cis-acting transcriptional control elements, is
operably linked to a coding sequence if it stimulates or modulates
the transcription of the coding sequence in an appropriate host
cell or other expression system. Generally, promoter
transcriptional regulatory sequences that are operably linked to a
transcribed sequence are physically contiguous to the transcribed
sequence, i.e., they are cis-acting. However, some transcriptional
regulatory sequences, such as enhancers, need not be physically
contiguous or located in close proximity to the coding sequences
whose transcription they enhance.
[0057] As used herein, "recombinant" refers to a polynucleotide
synthesized or otherwise manipulated in vitro (e.g., "recombinant
polynucleotide"), to methods of using recombinant polynucleotides
to produce gene products in cells or other biological systems, or
to a polypeptide ("recombinant protein") encoded by a recombinant
polynucleotide. "Recombinant means" also encompass the ligation of
nucleic acids having coding or promoter sequences from different
sources into an expression cassette or vector for expression of,
e.g., a fusion protein; or, inducible, constitutive expression of a
protein (i.e., a TERT promoter of the invention operably linked to
a heterologous nucleotide, such as a polypeptide coding
sequence).
[0058] As used herein, the "sequence" of a gene (unless
specifically stated otherwise) or nucleic acid refers to the order
of nucleotides in the polynucleotide, including either or both
strands of a double-stranded DNA molecule, e.g., the sequence of
both the coding strand and its complement, or of a single-stranded
nucleic acid molecule. For example, in alternative embodiments, the
promoter of the invention comprises untranscribed, untranslated,
and intronic TERT sequences, e.g., as set forth in the exemplary
SEQ ID NO:1 and SEQ ID NO:2.
[0059] As used herein, the term "transcribable sequence" refers to
any sequence which, when operably linked to a cis-acting
transcriptional control element, e.g., a promoter, such as the TERT
promoters of the invention, and when placed in the appropriate
conditions, is capable of being transcribed to generate RNA, e.g.,
messenger RNA (mRNA).
[0060] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of nucleotides (or amino acid residues) that
are the same, when compared and aligned for maximum correspondence
over a comparison window, as measured using one of the following
sequence comparison algorithms or by manual alignment and visual
inspection. This definition also refers to the complement of a
sequence. For example, in alternative embodiments, nucleic acids
within the scope of the invention include those with a nucleotide
sequence identity that is at least about 60%, at least about
75-80%, about 90%, and about 95% of the exemplary TERT promoter
sequence set forth in SEQ ID NO:1 (including residues 44 to 13544
of SEQ ID NO:1) or SEQ ID NO:2, and the intronic TERT sequences
capable of driving a reporter gene in telomerase positive cells, as
described below. Two sequences with these levels of identity are
"substantially identical." Thus, if a sequence has the requisite
sequence identity to a TERT promoter sequence or subsequence of the
invention, it also is a TERT promoter sequence within the scope of
the invention. Preferably, the percent identity exists over a
region of the sequence that is at least about 25 nucleotides in
length, more preferably over a region that is at least about 50-100
nucleotides in length.
[0061] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithms test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identity for the
test sequence(s) relative to the reference sequence, based on the
designated or default program parameters. A "comparison window", as
used herein, includes reference to a segment of any one of the
number of contiguous positions selected from the group consisting
of from 25 to 600, usually about 50 to about 200, more usually
about 100 to about 150 in which a sequence may be compared to a
reference sequence of the same number of contiguous positions after
the two sequences are optimally aligned. Methods of alignment of
sequences for comparison are well-known in the art. Optimal
alignment of sequences for comparison can be conducted, e.g., by
the local homology algorithm of Smith & Waterman, Adv. Appl.
Math. 2:482 (1981), by the homology alignment algorithm of
Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search
for similarity method of Pearson & Lipman, Proc. Natl. Acad.
Sci. USA 85:2444 (1988), by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Dr., Madison, Wis.), or by manual alignment and visual inspection
(see, e.g., Ausubel et al., supra).
[0062] One example of a useful algorithm is PILEUP. PILEUP creates
a multiple sequence alignment from a group of related sequences
using progressive, pairwise alignments to show relationship and
percent sequence identity. It also plots a tree or dendrogram
showing the clustering relationships used to create the alignment.
PILEUP uses a simplification of the progressive alignment method of
Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method
used is similar to the method described by Higgins & Sharp,
CABIOS 5:151-153 (1989). The program can align up to 300 sequences,
each of a maximum length of 5,000 nucleotides or amino acids. The
multiple alignment procedure begins with the pairwise alignment of
the two most similar sequences, producing a cluster of two aligned
sequences. This cluster is then aligned to the next most related
sequence or cluster of aligned sequences. Two clusters of sequences
are aligned by a simple extension of the pairwise alignment of two
individual sequences. The final alignment is achieved by a series
of progressive, pairwise alignments. The program is run by
designating specific sequences and their amino acid or nucleotide
coordinates for regions of sequence comparison and by designating
the program parameters. Using PILEUP, a reference sequence (e.g., a
TERT promoter sequence of the invention as set forth by. e.g., SEQ
ID NO:1 or SEQ ID NO:2) is compared to another sequence to
determine the percent sequence identity relationship (i.e., that
the second sequence is substantially identical and within the scope
of the invention) using the following parameters: default gap
weight (3.00), default gap length weight (0.10), and weighted end
gaps. PILEUP can be obtained from the GCG sequence analysis
software package, e.g., version 7.0 (Devereaux (1984) Nuc. Acids
Res. 12:387-395).
[0063] Another example of algorithm that is suitable for
determining percent sequence identity (i.e., substantial similarity
or identity) is the BLAST algorithm, which is described in Altschul
(1990) J. Mol. Biol. 215:403-410. Software for performing BLAST
analyses is publicly available through the National Center for
Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul (1990) supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always >0) and N (penalty score for
mismatching residues, always <0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. In one embodiment, to determine if a
nucleic acid sequence is within the scope of the invention, the
BLASTN program (for nucleotide sequences) is used incorporating as
defaults a wordlength (W) of 11, an expectation (E) of 10, M=5,
N=4, and a comparison of both strands. For amino acid sequences,
the BLASTP program uses as default parameters a wordlength (W) of
3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see,
e.g., Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
[0064] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin (1993)
Proc. Nat'l. Acad. Sci. USA 90:5873-5787). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. For example, a nucleic acid is considered
similar to a reference sequence if the smallest sum probability in
a comparison of the test nucleic acid to the reference nucleic acid
is less than about 0.1, more preferably less than about 0.01, and
most preferably less than about 0.001.
[0065] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule to a
particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture
(e.g., total cellular or library DNA or RNA), wherein the
particular nucleotide sequence is detected at least twice
background, preferably 10 times background. In one embodiment, a
nucleic acid can be determined to be within the scope of the
invention (e.g., is substantially identical to an hTERT promoter of
the invention, as exemplified by residues 44 to 13544 of SEQ ID
NO:1, or, SEQ ID NO:2, or, by an intronic promoter sequence, as
described below) by its ability to hybridize under stringent
conditions to another nucleic acid (such as the exemplary sequences
described herein).
[0066] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will primarily hybridize to its
target subsequence, typically in a complex mixture of nucleic acid,
but to no other sequences. Stringent conditions are
sequence-dependent and will be different in different
circumstances, e.g., depending on the length of the probe. Longer
sequences hybridize specifically at higher temperatures. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen, Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Probes, "Overview of principles
of hybridization and the strategy of nucleic acid assays" (1993).
Generally, stringent conditions are selected to be about
5-10.degree. C. lower than the thermal melting point (Tm) for the
specific sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at Tm, 50% of the probes
are occupied at equilibrium). Stringent conditions will be those in
which the salt concentration is less than about 1.0 M sodium ion,
typically about 0.01 to 1.0 M sodium ion concentration (or other
salts) at pH 7.0 to 8.3 and the temperature is at least about
30.degree. C. for short probes (e.g., 10 to about 50 nucleotides)
and at least about 60.degree. C. for long probes (e.g., greater
than about 50 nucleotides). Stringent conditions may also be
achieved with the addition of destabilizing agents such as
formamide. For selective or specific hybridization, a positive
signal (e.g., identification of a nucleic acid of the invention) is
about 5-10 times background hybridization. "Stringent"
hybridization conditions that are used to identify substantially
identical nucleic acids within the scope of the invention include
hybridization in a buffer comprising 50% formamide, 5.times.SSC,
and 1% SDS at 42.degree. C., or hybridization in a buffer
comprising 5.times.SSC and 1% SDS at 65.degree. C., both with a
wash of 0.2.times.SSC and 0.1% SDS at 65.degree. C., for long
probes. For short probes, stringent hybridization conditions
include hybridization in a buffer comprising 50% formamide,
5.times.SSC and 1% SDS at room temperature or hybridization in a
buffer comprising 5 .times.SSC and 1% SDS at 37.degree.
C.-42.degree. C., both with a wash of 0.2.times.SSC and 0.1% SDS at
37.degree. C.-42.degree. C. However, as is apparent to one of
ordinary skill in the art, hybridization conditions can be modified
depending on sequence composition. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, and 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency.
General Techniques
[0067] The TERT promoter sequences of the invention and nucleic
acids used to practice this invention, whether RNA, cDNA, genomic
DNA, or hybrids thereof, may be isolated from a variety of sources,
genetically engineered, amplified, and/or expressed recombinantly.
Any recombinant expression system can be used, including, e.g.,
bacterial, yeast, insect or mammalian systems. Alternatively, these
nucleic acids can be chemically synthesized in vitro. Techniques
for the manipulation of nucleic acids, such as, e.g., subcloning
into expression vectors, labeling probes, sequencing, and
hybridization are well described in the scientific and patent
literature, see e.g., ed., MOLECULAR CLONING: A LABORATORY MANUAL
(2ND ED.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989)
("Sambrook"); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, ed.
John Wiley & Sons, Inc., New York (1997) ("Ausubel");
LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY:
HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic
Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993) ("Tijssen").
Nucleic acids can be analyzed and quantified by any of a number of
general means well known to those of skill in the art. These
include, e.g., analytical biochemical methods such as NMR,
spectrophotometry, radiography, electrophoresis, capillary
electrophoresis, high pressure liquid chromatography (HPLC),.thin
layer chromatography (TLC), and hyperdiffusion chromatography,
various immunological methods, such as fluid or gel precipitin
reactions, immunodiffusion (single or double),
immunoelectrophoresis, radioimmunoassays (RIAs), enzyme-linked
immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern
analysis, Northern analysis, dot-blot analysis, gel electrophoresis
(e.g., SDS-PAGE), RT-PCR, quantitative PCR, other nucleic acid or
target or signal amplification methods, radiolabeling,
scintillation counting, and affinity chromatography.
Amplification of hTERT Promoter Sequences
[0068] The invention provides oligonucleotide primers that can
amplify all or any specific region within the TERT promoter
sequence of the invention, including, e.g., specific promoter and
enhancer subsequences. The nucleic acids of the invention can also
be generated or measured quantitatively using amplification
techniques. Using the TERT promoter sequences of the invention
(e.g., as in the exemplary hTERT SEQ ID NO:1 or mTERT SEQ ID NO:2),
the skilled artisan can select and design suitable oligonucleotide
amplification primers. Amplification methods are also well known in
the art, and include, e.g., polymerase chain reaction, PCR (PCR
PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic
Press, N.Y. (1990) and PCR STRATEGIES (1995), ed. Innis, Academic
Press, Inc., N.Y., ligase chain reaction (LCR) (Wu (1989) Genomics
4:560; Landegren (1988) Science 241:1077; Barringer (1990) Gene
89:117); transcription amplification (Kwoh (1989) Proc. Natl. Acad.
Sci. USA, 86:1173); and, self-sustained sequence replication
(Guatelli (1990) Proc. Natl. Acad. Sci. USA, 87:1874); Q Beta
replicase amplification (Smith (1997) J. Clin. Microbiol.
35:1477-1491, automated Q-beta replicase amplification assay; Burg
(1996) Mol. Cell. Probes 10:257-271) and other RNA polymerase
mediated techniques (e.g., NASBA, Cangene, Mississauga, Ontario);
see also Berger (1987) Methods Enzymol. 152:307-316, Sambrook,
Ausubel, Mullis (1987) U.S. Pat. Nos. 4,683,195, and 4,683,202;
Arnheim (1990) C&EN 36-47; Lomell J. Clin. Chem., 35:1826
(1989); Van Brunt (1990) Biotechnology, 8:291-294; Wu (1989) Gene
4:560; Sooknanan (1995) Biotechnology 13:563-564. Once amplified,
TERT genomic DNA, TERT promoter sequences, and the like, can be
cloned, if desired, into any of a variety of vectors using routine
molecular biological methods; methods for cloning in vitro
amplified nucleic acids are described, e.g., in Wallace, U.S. Pat.
No. 5,426,039.
Modified hTERT Promoter Sequences
[0069] The invention also provides for TERT promoter sequences that
have been modified in a site-specific manner to alter, add to, or
delete some or all of the promoter's functions. For example,
specific base pairs can be modified to alter, increase or decrease
the binding affinity to trans-acting transcriptional regulatory
factors, thus modifying the relative level of transcriptional
activation or repression. Modifications can also change secondary
structures of specific subsequences, such as those associated with
many cis-acting transcriptional elements. Site-specific mutations
can be introduced into nucleic acids by a variety of conventional
techniques, well described in the scientific and patent literature.
Illustrative examples include, e.g., site-directed mutagenesis by
overlap extension polymerase chain reaction (OE-PCR), as in Urban
(1997) Nucleic Acids Res. 25:2227-2228; Ke (1997) Nucleic Acids Res
25:3371-3372, and Chattopadhyay (1997) Biotechniques 22:1054-1056,
describing PCR-based site-directed mutagenesis "megaprimer" method;
Bohnsack (1997) Mol. Biotechnol. 7:181-188; Ailenberg (1997)
Biotechniques 22:624-626, describing site-directed mutagenesis
using a PCR-based staggered re-annealing method without restriction
enzymes; Nicolas (1997) Biotechniques 22:430-434, site-directed
mutagenesis using long primer-unique site elimination and
exonuclease III. See also Sambrook. and Ausubel. Modified TERT
promoter sequences of the invention can be further produced by
chemical modification methods, see, e.g., Belousov (1997) Nucleic
Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med.
19:373-380; Blommers (1994) Biochemistry 33:7886-7896. Designing
Antisense Oligonucleotides The invention also provides antisense
oligonucleotides capable of binding TERT promoter regions which, at
least in part, modulate TERT transcription and telomerase activity.
For example, antisense oligonucleotides that form triplexes with
promoter regions inhibit the activity of that promoter, see, e.g.,
Joseph (1997) Nucleic Acids Res. 25:2182-2188; Alunni-Fabbroni
(1996) Biochemistry 35:16361-16369; Olivas (1996) Nucleic Acids Res
24:1758-1764. Alternatively, antisense oligonucleotides that
hybridize to the promoter sequence can be used to inhibit promoter
activity. Means to design antisense oligonucleotides are well known
in the art.
[0070] For example, antisense polynucleotides of the invention can
comprise an antisense sequence of at least 7 to 10 to about 20 or
more nucleotides that specifically hybridize to a sequence
complementary to the TERT promoter sequences of the invention
(e.g., including part of the exemplary hTERT SEQ ID NO:1 or mTERT
SEQ ID NO:2, as discussed above). Alternatively, the antisense
polynucleotide of the invention can be from about 10 to about 50
nucleotides in length or from about 14 to about 35 nucleotides in
length. In other embodiments, they are less than about 100
nucleotides or less than about 200 nucleotides. In general, the
antisense polynucleotide should be long enough to form a stable
duplex (or triplex) but, if desired, short enough, depending on the
mode of delivery, to be administered in vivo. The minimum length of
a polynucleotide required for specific hybridization to a target
sequence depends on several factors, such as G/C content,
positioning of mismatched bases (if any), degree of uniqueness of
the sequence as compared to the population of target
polynucleotides, and chemical nature of the nucleotides used in the
antisense reagent (e.g., methylphosphonate backbone, peptide
nucleic acid, phosphorothioate), among other factors. Methods
relating to antisense polynucleotides, are also described, e.g., by
ANTISENSE RNA AND DNA, (1988), D. A. Melton, Ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.); Dagle (1991) Nucleic
Acids Research 19:1805; Kim (1998) J. Controlled Release
53:175-182; for antisense therapy, see, e.g., Uhlmann (1990) Chem.
Reviews 90:543-584; Poston (1998) J. Thorac. Cardiovasc. Surg.
116:386-396 (ex vivo gene therapy); Haller (1998) Kidney Int.
53:1550-1558; Nguyen (1998) Cancer Res 58:5673-7.
Identifying hTERT Genomic Sequences
[0071] The present invention provides TERT promoters comprising
genomic sequences, including, e.g., 5' (upstream) of an hTERT or
mTERT transcriptional start site, and intronic sequences, as
described below. The promoter of the invention contains cis-acting
transcriptional regulatory elements involved in TERT message
expression. It will be apparent that, in addition to the nucleic
acid sequences provided in hTERT SEQ ID NO:1 or mTERT SEQ ID NO:2,
additional TERT promoter sequences may be readily obtained using
routine molecular biological techniques. For example, additional
hTERT genomic (and promoter) sequence may be obtained by screening
a human genomic library using an hTERT nucleic acid probe having a
sequence or subsequence as set forth in SEQ ID NO:1 (a nucleic acid
sequence is within the scope of the invention if it hybridizes
under stringent conditions, as defined above, to an hTERT promoter
sequence of the invention). Additional hTERT or mTERT genomic
sequence can be readily identified by "chromosome walking"
techniques, as described by, e.g., Hauser (1998) Plant J
16:117-125; Min (1998) Biotechniques 24:398-400. Other useful
methods for further characterization of TERT promoter sequences;
e.g., sequences flanking SEQ ID NO:1 or mTERT SEQ ID NO:2, include
those general methods described by, e.g., Pang (1997) Biotechniques
22:1046-1048; Gobinda (1993) PCR Meth. Applic. 2:318; Triglia
(1988) Nucleic Acids Res. 16:8186; Lagerstrom (1991) PCR Methods
Applic. 1:111; Parker (1991) Nucleic Acids Res. 19:3055. As is
apparent to one of ordinary skill in the art, these techniques can
also be applied to any TERT promoter sequences in addition to the
human and mouse genomic sequences described herein.
Chemical Synthesis of TERT Promoter Sequences
[0072] The present invention also provides TERT polynucleotides
that are produced by direct chemical synthesis. Chemical synthesis
will typically be used to produce oligonucleotides and
polynucleotides containing nonstandard nucleotides (e.g., probes,
primers and antisense oligonucleotides) although nucleic acids
containing only standard nucleotides can also be prepared. Direct
chemical synthesis of nucleic acids can be accomplished by methods
known in the art, such as, e.g., the phosphotriester method of
Narang (1979) Meth. Enzymol. 68:90; the phosphodiester method of
Brown (1979) Meth. Enzymol. 68:109; the diethyl-phosphoramidite
method of Beaucage (1981) Tetra. Lett. 22:1859; and the solid
support method of U.S. Pat. No. 4,458,066. Chemical synthesis
typically produces a single stranded oligonucleotide, which may be
converted into double stranded DNA by hybridization with a
complementary sequence, or by polymerization with a DNA polymerase
and an oligonucleotide primer using the single strand as a
template. One of skill will recognize that while chemical synthesis
of DNA is often limited to sequences of less than about 100 or 150
bases, longer sequences may be obtained by the ligation of shorter
sequences or by more elaborate synthetic methods. It will be
appreciated that the polynucleotides and oligonucleotides of the
invention can be made using nonstandard bases (e.g., other than
adenine, cytidine, guanine, thymine, and uridine) or nonstandard
backbone structures to provide desirable properties (e.g.,
increased nuclease-resistance, tighter binding, stability or a
desired TM). Techniques for rendering oligonucleotides
nuclease-resistant include those described in PCT publication WO
94/12633. A wide variety of useful modified oligonucleotides may be
produced, including oligonucleotides having a peptide nucleic acid
(PNA) backbone (Nielsen (1991) Science 254:1497) or incorporating
2'-O-methyl ribonucleotides, phosphorothioate nucleotides, methyl
phosphonate nucleotides, phosphotriester nucleotides,
phosphorothioate nucleotides, and phosphoramidates. Still other
useful oligonucleotides may contain alkyl and halogen-substituted
sugar moieties comprising one of the following at the 2' position:
OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2 or
O(CH2)nCH3 where n is from 1 to about 10; C1 to C10 lower alkyl,
substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3 ; SO2CH3; ONO2;
NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl;
amino-alkylamino; polyalkylamino; substituted silyl; an RNA
cleaving group; a cholesteryl group; a folate group; a reporter
group; an intercalator; a group for improving the pharmacokinetic
properties of an oligonucleotide; or a group for improving the
pharmacodynamic properties of an oligonucleotide and other
substituents having similar properties. Folate, cholesterol or
other groups which facilitate oligonucleotide uptake, such as lipid
analogs, may be conjugated directly or via a linker at the 2'
position of any nucleoside or at the 3' or 5' position of the
3'-terminal or 5'-terminal nucleoside, respectively. One or more
such conjugates may be used. Oligonucleotides may also have sugar
mimetics such as cyclobutyls in place of the pentofuranosyl group.
Other embodiments may include at least one modified base form or
"universal base" such as inosine, or inclusion of other nonstandard
bases such as queosine and wybutosine as well as acetyl-, methyl-,
thio- and similarly modified forms of adenine, cytidine, guanine,
thymine, and uridine which are not as easily recognized by
endogenous endonucleases. The invention further provides
oligonucleotides having backbone analogues such as phosphodiester,
phosphorothioate, phosphorodithioate, methylphosphonate,
phosphor-amidate, alkyl phosphotriester, sulfamate, 3'-thioacetal,
methylene(methylimino), 3'-N-carbamate, morpholino carbamate,
chiral-methyl phosphonates, nucleotides with short chain alkyl or
cycloalkyl intersugar linkages, short chain heteroatomic or
heterocyclic intersugar ("backbone") linkages, or CH2--NH--O--CH2,
CH2--N(CH3)--OCH2, CH2--O--N(CH3)--CH2, CH2--N(CH3)--N(CH3)--CH2
and O--N(CH3)--CH2--CH2 backbones (where phosphodiester is
O--P--O--CH2), or mixtures of the same. Also useful are
oligonucleotides having morpholino backbone structures (see. e.g.,
U.S. Pat. No. 5,034,506).
Identifying Tert Promotor Subsequences Bound by Trans-Acting
Transcriptional Regulatory Factors
[0073] The invention provides means to identify and isolate
trans-acting transcriptional regulatory factors that are involved
in modulating the activity of the TERT promoter. Identification of
cis-acting motifs by, e.g., sequence identity comparison, as
discussed above, can be a useful initial means to identify promoter
sequences bound by trans-acting factors. For example, as discussed
above, the hTERT and mTERT promoters contain a variety of
cis-acting motifs. The hTERT promoter contains the motif known to
bind to c-Myc (the "E-box" or "Myc/Max binding site"). Two SPI
binding sites are located starting at residue -168 and starting at
residue -134 (FIG. 3A). Other identified motifs include the sex
determining region Y gene product (SRY), hepatic nuclear factors
3-beta (HNF-3_) and 5 (HNF-5), TFIID-MBP, E2F and c-Myb cis-acting
transcriptional regulatory elements. All other cis-acting
transcriptional regulatory elements known in the art (searchable
by, e.g., public data base, e.g.,
http://www.ncbi.nlm.nih.gov/PubMedl) present in the TERT promoter
sequences described herein are incorporated by the invention. To
identify these motifs, a variety of comparison algorithms can be
used. See, e.g., Karas (1996) Comput. Appl. Biosci. 12:441-6; Frech
(1997) Pac Symp Biocomput. 7:151-62; Brzma (1998) Genome Res
8:1202-1215; Tsunoda (1998) Pac Symp Biocomput :1998:252-63.
[0074] In addition to sequence identity analysis, TERT cis-acting
transcriptional regulatory elements can be identified or confirmed
by any means known in the art, including, e.g., promoter activity
assays, DNase assays, binding assays (e.g., mobility shift assays),
oligonucleotide affinity column chromatography, and the like.
[0075] After positive or tentative identification of a cis-acting
binding site in a TERT promoter, these sequences are used to
isolate the trans-acting transcriptional regulatory factor(s) by
any means known in the art. In a preferred embodiment, the
trans-acting factors are isolated using sequence-specific
oligonucleotide affinity chromatography, the oligonucleotides
comprising TERT sequences of the invention.
[0076] Another embodiment for identifying transcriptional
regulatory motifs involves modifying putative cis-acting regulatory
subsequences and assessing the change, if any, of the resultant
TERT promoter to modulate transcription. The modification can be,
e.g., one or more residue deletions, residue substitution(s),
chemical alteration(s) of nucleotides, and the like. The (modified)
promoter can be operably linked to TERT, or any transcribable
sequence (e.g., "reporter genes"). The relative increase or
decrease the modification has on transcriptional rates can be
determined, e.g., by measuring the ability of the unaltered TERT
promoter to transcriptionally activate the reporter coding sequence
under the same conditions as used to test the modified promoter. An
increase or decrease in the ability of the modified TERT promoter
to induce transcription as compared to the unmodified promoter
construct identifies a cis-acting transcriptional regulatory
sequence that is involved in the modulation of TERT promoter
activity.
[0077] The reporter gene can encode any detectable protein known in
the art, e.g., detectable by fluorescence or phosphorescence or by
virtue of its possessing an enzymatic activity. In alternative
embodiments, the detectable protein is firefly luciferase,
alpha-glucuronidase, alpha-galactosidase, chloramphenicol acetyl
transferase, green fluorescent protein, enhanced green fluorescent
protein, and the human secreted alkaline phosphatase.
[0078] Another embodiment tests the ability of these cis-acting
elements to bind soluble polypeptide trans-acting factors isolated
from different cellular compartments, particularly trans-acting
factors expressed in nuclei. For identification and isolation of
factors that stimulate transcription, cell (e.g. nuclear) extracts
from cells that express TERT are used. Means to conduct these
studies are well known in the art.
[0079] Furthermore, as discussed further below, once a cis-acting
motif, or element, is identified, it can be used to identify and
isolate trans-acting factors in a variety of cells and under
different conditions (e.g., cell proliferation versus cell
senescence). Accordingly, the invention provides a method for
screening for trans-acting factors that modulate TERT promoter
activity under a variety of conditions, developmental states, and
cell types (including, e.g., normal versus immortal versus
malignant phenotypes).
[0080] The cis-acting transcriptional regulatory sequences of the
invention that modulate TERT promoter activity can also be used as
oligonucleotides which, upon introduction into a cell, can bind
trans-acting regulatory factors to modulate TERT transcription in
vivo. This results in increased or decreased cell proliferative
capacity for the treatment of various diseases and conditions, as
discussed below.
High Throughput Screening of Small Molecule Modulators of Tert
Transcription
[0081] The invention provides constructs and methods for screening
modulators, in a preferred embodiment, small molecule modulators,
of TERT promoter activity in vitro and in vivo. The invention
incorporates all assays available to screen for small molecule
modulators of TERT transcription. In a preferred embodiment, high
throughput assays are adapted and used with the novel TERT promoter
sequences and constructs provided by the invention, e.g., the hTERT
and mTERT promoter sequences described herein. See, e.g., Schultz
(1998) Bioorg Med Chem Lett 8:2409-2414; Weller (1997) Mol Divers.
3:61-70; Fernandes (1998) Curr Opin Chem Biol 2:597-603;
Sittampalam (1997) Curr Opin Chem Biol 1:384-91.
[0082] In alternative embodiments, recombinant constructs contain
hTERT promoter sequences driving a marker, such as an alkaline
phosphatase marker gene (SEAP) or a .sctn.-galactosidase gene.
Using a SEAP expressing construct of the invention, it was
demonstrated that a TERT promoter fragment of approximately 2.5 kb
is sufficient to activate and repress TERT transcription in
response to proliferation and/or growth arrest stimuli in a model
cell line, IDH4. Two cell clones, ID245-1 and ID245-16 whose SEAP
profiles closely matched telomerase activity after TERT
upregulation by dexamethasone were selected and expanded for high
throughput screening of small molecule activators of
telomerase.
Treatment of Telomerase-Related Diseases
[0083] The present invention provides TERT promoter sequences
useful for the treatment of diseases and disease conditions. The
recombinant and synthetic nucleic acids comprising TERT promoter,
or TERT antisense complementary sequences, can be used to create or
elevate telomerase activity in a cell, as well as to inhibit
telomerase activity in cells in which it is not desired. In a
preferred embodiment, human TERT promoter sequences or antisense
sequences are used for the treatment of human diseases and disease
conditions.
[0084] Identification of cis-acting transcriptional regulatory
sequences by the invention further provides for the design of
targeted sequences that, as oligonucleotides, can modify TERT
promoter activity. In one embodiment, telomerase activity is
created or elevated by binding significant amounts of a
trans-acting transcriptional repressor or down-regulator with a
nucleic acid that binds specifically to the repressor. In another
embodiment, telomerase activity is down-regulated by antisense
oligonucleotides binding to promoter sequences (see discussion,
above). Similarly, telomerase activity can be inhibited by binding
significant amounts of a trans-acting transcriptional activator or
up-regulator with a nucleic acid that binds specifically to the
activator; or telomerase activity is up-regulated by antisense
oligonucleotides binding to promoter sequences involved in
telomerase repression. Thus, inhibiting, activating or otherwise
altering a telomerase activity (e.g., telomerase catalytic
activity, fidelity, processivity, telomere binding, etc.) in a cell
can be used to change the proliferative capacity of the cell.
[0085] For example, reduction of telomerase activity in an immortal
cell, such as a malignant tumor cell, can render the cell mortal.
Conversely, increasing the telomerase activity in a cell line or a
mortal cell (e.g., most human somatic cells) can increase the
proliferative capacity of the cell. For example, expression of
hTERT protein in dermal fibroblasts, thereby increasing telomere
length, will result in increased fibroblast proliferative capacity.
Such expression can slow or reverse age-related degenerative
processes, such as, e.g., the age-dependent slowing of wound
closure (see, e.g., West (1994) Arch. Derm. 130:87). Thus, in one
aspect, the present invention provides reagents and methods useful
for treating diseases and conditions characterized by the presence,
absence, or altered amount of human telomerase activity in a cell
(where the diseases and conditions are susceptible to treatment
using the compositions and methods disclosed herein). These
diseases include, e.g. cancers, other diseases of cell
proliferation (particularly, degenerative and aging processes and
diseases of aging), immunological disorders, infertility (or
fertility).
Treatment of Cancer
[0086] The present invention provides methods and compositions for
reducing TERT promoter activity (and hence telomerase activity) in
immortal cells and tumor cells for treating cancer. Cancer cells
(e.g., malignant tumor cells) that express telomerase activity
(telomerase-positive cells) can be mortalized by decreasing or
inhibiting TERT promoter activity. Moreover, because measurable
telomerase activity levels correlate with disease characteristics
such as metastatic potential (see, e.g., U.S. Pat. Nos. 5,639,613;
5,648,215; 5,489,508; and Pandita (1996) Proc. Am. Ass. Cancer Res.
37:559), any reduction in TERT promoter activity could reduce the
aggressive nature of a cancer to a more manageable disease state.
As noted above, immortal cells and cancer cells, as opposed to
non-cancerous, mortal cells, have high levels of TERT promoter
activity.
[0087] Taking advantage of this characteristic, in one embodiment
of the invention, a TERT promoter sequence is operably linked to a
gene encoding a toxin and introduced into a cell to kill the cell
(a number of protein toxins are well known in the art including,
e.g., ricin, diphtheria, gelonin, Pseudomonas toxin, abrin). If or
when TERT transcriptional activators are expressed or activated in
the cell, the toxin will be expressed, resulting in specific cell
killing.
[0088] Alternatively, the TERT promoter-linked gene can encode a
protein having activity that is not itself toxic to a cell, but
which renders the cell sensitive to an otherwise nontoxic drug
(such as, e.g., Herpes virus thymidine kinase).
[0089] In another embodiment, the invention takes advantage of the
fact that normal cytopathic viruses, in particular human cytopathic
viruses, such as adenovirus or Herpes virus, require essential
virally encoded genes to proliferate thereby lysing specific cells.
If any one of these essential viral genes was modified such that
expression of the essential element was driven by the TERT
promoter, proliferation of the virus and its cytopathic effects
would be restricted to tumor cells and other telomerase expressing
cells. Accordingly, the invention provides constructs and methods
for killing telomerase positive cells (e.g., cancer cells, germ
cells) wherein TERT promoter sequences of the invention are
operably linked to such viral "essential element" genes. For use in
human cells, human cytopathic viruses modified with hTERT promoter
sequences are preferred. Any one or more of the genes required for
the replication and packaging of the virus could be modified to be
driven by the TERT promoter. For instance, in one embodiment,
expression of the E1a gene of adenovirus, which is required for the
activation of expression of a cascade of adenoviral genes, is
placed under the control of the hTERT promoter.
[0090] Thus, expression of E1a, and hence downstream replication of
the virus, occurs only in those cells that express telomerase
(i.e., tumor cells). Likewise, a recombinant adenovirus of the
invention is designed so the adenoviral capsid genes are under the
control of a TERT promoter. While this construct replicates its DNA
in most cell types, it packages itself into active, infectious (and
cytotoxic) virus only in those cells that express telomerase. Thus,
when these constructs are used as cancer therapeutics, the
conditionally replicative virus only infects and yields a
productive infection in tumor cells (with no effect in "normal"
cells that do not express telomerase). Infection of normal cells
that do not express telomerase is expected to produce either no or
abortive production of the virus, depending on which gene is driven
by the TERT promoter. Thus, these recombinant viruses of the
invention allow the natural, yet tumor specific, amplification of
an oncolytic virus.
[0091] In alternative embodiments, many other elements are
incorporated into such an TERT promoter restricted oncolytic virus
or a TERT promoter restricted replicative but not lytic. Genes
encoding suicide genes, marker genes, apoptotic genes or cell cycle
regulators are incorporated in the TERT promoter restricted
conditionally replicative recombinant virus. Expression of these
elements in such a virus would assist the arrest of tumor growth.
In one embodiment, elements to be included within these
conditionally replicative viruses of the invention are structures
that inhibit telomerase activity. These telomerase inhibitors could
incorporate inhibitory oligonucleotides, dominant-negative
inhibitors of TERT, or the gene for any agent that would disrupt or
prevent TR/TERT assembly, interactions, or activity.
[0092] Other elements can also be included in the "TERT promoter
restricted" vectors of the invention (i.e., vectors expressing TERT
promoter driven genes which are only expressed in
telomerase-positive cells). For example, small inhibitory RNA
molecules, preferably targetting cancer cells, such as RNA
targeting telomerase activity can be synthesized in vivo using a
recombinant adenovirus vector. Exemplary sequences are provided in
U.S. Pat. No. 5,858,777 and GB 20890.4. RNA production from the
adenovirus can be achieved by a variety of expression cassettes.
For cell growth inhibition-purposes, RNA polymerase III expression
cassettes based on the structure of tRNA genes and other RNA
polymerase III transcripts, including the U6 snRNA gene, as well as
RNA polymerase II snRNP (U1, U2) transcripts are preferred due to
their ability to produce high levels of transcripts.
[0093] The hTERT promoter restricted viruses of the invention can
be designed to express inhibitory RNAs, as antisense molecules
complementary to several regions of the hTR molecule, including the
template region. The inhibitory RNAs can also mimic sequences
and/or structures present in the RNA component of telomerase (e.g.,
hTR), including potential binding site(s) for TERT or other
telomerase-associated proteins that might interact with the RNA
component. Other elements can also be designed to generate
inhibitory RNAs to target TERT mRNA by preventing its normal
processing, folding, modification, transport and/or
translation.
[0094] Other cytopathic viral vectors of the invention can be
designed to generate RNA molecules with sequences necessary for
cytoplasmic export and translation into peptides. The resulting
polypeptides or peptides can be designed to target telomerase
components or other molecules that are associated with telomerase
thereby influencing telomerase catalytic activity. The peptides
that inhibit telomerase will be produced at high level, paralleling
the amount of RNA. For example, peptides could be designed to mimic
the stretch of amino acids in hTERT involved in its binding to hTR,
thereby acting as competitors in the assembly of a functional
telomerase.
[0095] The TERT promoter restricted viral vectors of the invention
can also be designed to generate peptides or polypeptides for any
domain of TERT involved in interactions with other proteins and
disrupt contacts that are essential for telomerase function. Other
TERT promoter restricted viruses of the invention can be designed
to generate polypeptides to bind to telomere complexes and prevent
access and/or docking of telomerase or to generate immunogenic
peptides, in part TERT peptides.
[0096] Other TERT promoter restricted viral vectors of the
invention can be designed to generate polypeptides to mimic a
variety of apoptosis inducing agents observed during programmed
cell death and could result in the onset of apoptosis.
[0097] TERT promoter restricted viruses do not necessarily need to
be cytopathic. The TERT promoter conditionally restricted virus
could be used to amplify any sequences or any element in any TERT
expressing cell, e.g., a tumor cell.
[0098] Any of these embodiments can be provided with the
conditionally replicative viruses of the invention. The TERT
promoter constructs of the invention can also be used in gene
therapy vectors to prevent telomerase activation and result in
specific "mortalization" or death of telomerase-positive cells.
Similarly, these gene therapy methods may be used for "treating" a
genetic predilection for cancers.
Treatment of Other Conditions
[0099] The present invention also provides compositions and methods
useful for treatment of diseases and disease conditions (in
addition to cancers) characterized by under- or over-expression of
telomerase or TERT gene products. Examples include, e.g., diseases
of cell proliferation, diseases resulting from cell senescence
(particularly processes and diseases of aging), immunological
disorders, infertility, and diseases of immune dysfunction. Certain
diseases of aging are characterized by cell senescence-associated
changes due to reduced telomere length (compared to younger cells),
resulting from the absence (or much lower levels) of telomerase
activity in the cell. Decreased telomere length and decreased
replicative capacity contribute to these diseases. Telomerase
activity (resulting in increased telomere length) can be
upregulated by, e.g., increasing TERT promoter activity in the
cell.
[0100] The present invention, by providing methods and compositions
for modulating TERT promoter activity, also provides methods to
treat infertility. Human germline cells (e.g., spermatogonia cells,
their-progenitors or descendants) are capable of indefinite
proliferation and characterized by high telomerase activity.
Abnormal or diminished levels of TERT gene products can result,
e.g., in inadequate or abnormal production of spermatozoa, leading
to infertility or disorders of reproduction. Accordingly,
"telomerase-based" infertility can be treated using the methods and
compositions described herein to increase TERT promoter activity
levels. Similarly, because inhibition of telomerase may negatively
impact spermatogenesis, oogenesis, and sperm and egg viability, the
compositions of the invention capable of inhibiting hTERT promoter
activity can have contraceptive effects when used to reduce hTERT
levels in germline cells.
[0101] In a further embodiment, the invention provides methods and
composition useful for decreasing the proliferative potential of
telomerase-positive cells such as activated lymphocytes and
hematopoietic stem cells by reducing TERT promoter activity. Thus,
the invention provides means for effecting immunosuppression.
Conversely, the methods and reagents of the invention are useful in
immunostimulation by increasing TERT promoter activity (resulting
in increased proliferative potential) in immune cells, including
hematopoietic stem cells (that express a low level of telomerase or
no telomerase prior to therapeutic intervention).
Modulating Tert Promoter Activity
[0102] As is clear from the foregoing discussion, modulation of the
level of TERT promoter transcriptional activity (and thus, the
levels of telomerase or telomerase activity of a cell) can have a
profound effect on the proliferative potential of the cell, and so
has great utility in treatment of disease. This modulation can
either be a decrease or an increase in TERT promoter activity. The
promoter activity-modulatory nucleic acid molecules of the
invention can act through a number of mechanisms. However, the
invention is not limited to any particular mechanism of action.
[0103] For example, TERT promoter activity may be decreased or
increased by single stranded antisense sequences that directly bind
to TERT promoter sequences. This will result in decrease in
affinity or inhibition of trans-acting transcriptional regulatory
factors binding to critical TERT promoter sequences (e.g., TATA
boxes, CAAT boxes, and the like). When the cis-acting element bound
by a trans-acting factor has inhibitory activity, the binding of
the oligonucleotide would result in upregulation of TERT
transcription. Conversely, if the promoter subsequence, when bound
by a trans-acting factor, has upregulating activity, the binding of
the oligonucleotide would result in down-regulation of TERT
transcription. In another embodiment, double-stranded
oligonucleotides representing TERT promoter subsequences directly
bind trans-acting transcriptional modulatory elements, thus
preventing them from binding their corresponding cis-acting
elements. In summary, TERT promoter activity may be increased or
decreased through any of several mechanisms, or a combination of
mechanisms. These include any means apparent to those of skill upon
review of this disclosure.
Antisense Oligonucleotides Binding to TERT Promoter Control
Sequences
[0104] As discussed above, antisense oligonucleotides which
hybridize to TERT promoter sequences will inhibit the binding of
trans-acting transcriptional upregulatory agents to critical TERT
promoter sequences. Furthermore, the result will be activation or
repression of TERT transcriptional activity, depending on whether
the promoter subsequence is down-regulatory or up-regulatory,
respectively. Thus, the invention provides antisense
oligonucleotides directed to the TERT promoter (cis-acting) binding
sites for c-Myc (the "E-box" or "Myc/Max binding sites"), SP1, Y
gene product (SRY), hepatic nuclear factors 3-beta (HNF-3_), 5
(HNF-5), TFID-MBP, E2F, c-Myb, TATA boxes, CAAT boxes, and other,
as described herein.
[0105] While the invention is not limited by any particular
mechanism, oligonucleotides of the invention can also bind to
double-stranded or duplex TERT promoter sequences. They can bind in
a folded region, forming a triple helix, or "triplex" nucleic acid.
Triple helix formation results in inhibition of TERT promoter
activity by, e.g., disrupting the secondary structure of the
promoter sequence, resulting in a new conformation which the
trans-acting factor cannot bind with sufficient affinity to have a
transcriptional-modifying effect. Alternatively, triple helix
formation (induced by the binding of the antisense oligonucleotide
of the invention) compromises the ability of the double helix to
open sufficiently for the binding of polymerases, transcription
factors, or regulatory trans-acting molecules to occur. Triplex
oligo- and polynucleotides design construction (also discussed,
above) is well described in the art; see, e.g., Cheng (1988) J.
Biol. Chem. 263:15110; Ferrin (1991) Science 354:1494; Ramdas
(1989) J. Biol. Chem. 264:17395; Strobel (1991) Science 254:1639;
Rigas (1986) Proc. Natl. Acad. Sci. U.S.A. 83: 9591) Carr, 1994,
MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co, Mt
Kisco N.Y.; Rininsland (1997) Proc. Natl. Acad. Sci. USA 94:5854;
Perkins (1998) Biochemistry 37:11315-11322.
Double-Stranded Oligonucleotides Bind to Trans-Acting Molecules
[0106] The cis-acting transcriptional regulatory sequences of the
invention can also be used as oligonucleotides which, upon
introduction into a cell, can bind trans-acting regulatory factors
to modulate TERT transcription in vivo. These oligonucleotides can
be delivered to target cells through an appropriate delivery scheme
or they can be synthesized in vivo by recombinant expression
systems (vectors, viruses, and the like). Appropriate expression
systems, delivery mechanisms, formulations, and the like are well
known in the art (discussed in more detail, below).
Administration of Oligonucleotides In Vivo
[0107] The therapeutic nucleic acids and methods of the invention
involve the administration of oligonucleotides or polynucleotides
that function to inhibit or stimulate TERT promoter activity under
in vivo physiological conditions. In one embodiment, these nucleic
acids are, e.g., single stranded antisense sequences capable of
binding to promoter sequences. In an alternative embodiment, they
are double stranded nucleic acids capable of binding trans-acting
transcriptional regulatory factors. They should be sufficiently
stable under physiological conditions for a period of time to
obtain a therapeutic effect. As noted above, modified nucleic acids
may be useful in imparting such stability, as well as for targeting
delivery of the oligonucleotide to the desired tissue, organ, or
cell. Oligo- and poly-nucleotides can be delivered directly as a
drug in a suitable pharmaceutical formulation, or indirectly by
means of introducing a nucleic acid expression system (e.g.,
cassette, vector) which can recombinantly generate the hTERT
promoter modulating oligonucleotides into a cell, e.g., by "gene
therapy" (see below).
[0108] Oligonucleotides or expression vectors can be administered
by any means known in the art, including, e.g., liposomes,
immunoliposomes, ballistics, direct uptake into cells, and the
like. For treatment of disease (see discussion above), the
oligonucleotides of the invention will be administered to a patient
in a therapeutically effective amount. A therapeutically effective
amount is an amount sufficient to ameliorate the symptoms of the
disease or modulate hTERT promoter activity (thereby affecting
telomerase activity) in the target cell. Methods useful for
delivery of oligonucleotides for therapeutic purposes are well
known in the art and are described, e.g., in U.S. Pat. No.
5,272,065.
[0109] Telomerase activity can be measured by a variety of means,
e.g., by TRAP assay or other suitable assay of telomerase
biological function, as discussed in detail in related
applications.
Gene Therapy
[0110] The invention provides methods and reagents for affecting
TERT promoter activity in vivo by gene therapy. In one embodiment,
as discussed above, gene therapy is used to deliver
oligonucleotides that modulate TERT promoter activity by directly
binding to cis-acting sequences or, alternatively, that bind to
trans-acting regulatory factors. One embodiment exploits the fact
that the TERT promoter is only relatively active in a very limited
range of cell types, including, significantly, cancer cells.
TERT Promoter Operably Linked to Cellular Toxins
[0111] In one embodiment, the TERT promoter of the invention is
operably linked to a transcribable sequence which encodes a
cellular toxin. A number of polypeptide toxins that can be
recombinantly generated are well known in the art including, e.g.,
ricin, abrin (Hughes (1996) Hum. Exp. Toxicol. 15:443-451),
diphtheria, gelonin (Rosenblum (1996) Cancer Immunol. Immunother.
42:115-121), Pseudomonas exotoxin A, tumor necrosis factor alpha
(TNF-alpha), Crotalus durissus terrificus toxin, Crotalus
adamenteus toxin, Naja naja toxin, and Naja mocambique toxin, see,
e.g., Rodriguez (1998) Prostate 34:259-269; Mauceri (1996) Cancer
Res. 56:4311-4314.
[0112] The cellular toxin can also be capable of inducing
apoptosis, such as, e.g., a direct inducer of apoptosis, such as
the ICE-family of cysteine proteases, the Bcl-2 family of proteins,
bax, bclXs and caspases, see, e.g., Favrot (1998) Gene Ther.
5:728-739; McGill (1997) Front. Biosci. 2:D353-D379; McDonnell
(1995) Semin. Cancer Biol. 6:53-60.
[0113] Alternatively, the sequence under the control of the TERT
promoter can code for polypeptides having activity that is not
itself toxic to a cell, but which renders the cell sensitive to an
otherwise nontoxic drug, e.g., Herpes virus thymidine kinase
(GSV-TK). The HSV-TK is innocuous but converts the anti-herpetic
agent ganciclovir (GCV) to a toxic product that interferes with DNA
replication in proliferating cells (see, e.g., Delaney (1996) J.
Neurosci. 16:6908-6918; Heyman (1989) Proc. Natl. Acad. Sci. USA
86:2698-2702). The art describes numerous other suitable toxic or
potentially toxic proteins and systems that may be applied in this
embodiment.
[0114] The methods of the invention, in addition to enabling the
specific killing of telomerase-positive cells, can also be used to
prevent transformation of telomerase negative cells to a telomerase
positive state. As shown in Example 1, an hTERT promoter sequence
can be operably linked to a reporter gene such that activation of
the promoter results in expression of the protein encoded by the
reporter gene. If, instead of a reporter protein, the encoded
protein is toxic to the cell, activation of the promoter leads to
cell morbidity or death.
Modifying TERT Promoters by In vivo Homologous Recombination:
Generating TERT "Knockout" Cells
[0115] In another embodiment, the introduced TERT promoter sequence
(modified or wild type) can replace or disrupt an endogenous TERT
promoter sequence (e.g., gene replacement and "gene knockout,"
respectively). A newly introduced TERT promoter sequence can be
engineered to have greater or lesser transcriptional activity, be
responsive to new trans-acting transcriptional modulating agents,
and the like.
[0116] Disruption of an endogenous TERT promoter sequence typically
will decrease or abrogate ("knockout") the transcription of TERT.
Therapeutic indications for such TERT promoter activity
manipulations are discussed above. In one embodiment, the TERT
promoter "knockout" is prepared by deletion or disruption by
homologous recombination of the endogenous hTERT promoter.
Homologous recombination and other means to alter (and "knockout")
expression of endogenous sequences is well known in the art and is
described in, e.g., Moynahan (1996) Hum. Mol. Genet. 5:875;
Moynahan (1996) Hum. Mol. Genet. 5:875; Baudin (1993) Nucl. Acids
Res. 21:3329; Wach (1994) Yeast 10:1793; Rothstein (1991) Methods
Enzymol. 194:281; Anderson (1995) Methods Cell Biol. 48:31; Pettitt
(1996) Development 122:4149-4157; Ramirz-Solis (1993) Methods
Enzymol. 225:855; Thomas (1987) Cell 51:503; Couldrey (1998) Dev.
Dyn. 212:284-292). Holzschu (1997) Transgenic Res 6:97-106; U.S.
Pat. Nos. 5,464,764; 5,631,153; 5,487,992; 5,627,059, and
5,272,071; WO 91/09955; WO 93/09222; WO 96/29411; WO 95/31560; WO
91/12650.
[0117] Vectors useful in TERT gene therapy can be, e.g., viral or
nonviral. They may comprise other regulatory or processing
sequences. Gene therapy vectors are well known in the art, see,
e.g., Lyddiatt (1998) Curr Opin Biotechnol 9:177-85.
[0118] As the invention is also directed to methods and reagents
for gene replacement therapy (e.g., replacement by homologous
recombination of an endogenous TERT gene with a recombinant gene),
vectors specifically designed for integration by homologous
recombination comprising TERT promoter sequences are also provided
by the invention. Important factors for optimizing homologous
recombination include the degree of sequence identity and length of
homology to chromosomal sequences. The specific sequence mediating
homologous recombination is also important, because integration
occurs much more easily in transcriptionally active DNA. Methods
and materials for constructing homologous targeting constructs are
described by e.g., Mansour (1988) Nature 336: 348; Bradley (1992)
Bio/Technology 10:534; U.S. Pat. Nos. 5,627,059; 5,487,992;
5,631,153; and 5,464,764.
[0119] The invention provides delivery of the expression systems
(e.g., gene therapy vectors) of the invention into cells or tissues
in vitro or ex vivo. For ex vivo therapy, vectors may be introduced
into cells, e.g., stem cells, taken from the patient and clonally
propagated for autologous transplant back into the same patient;
see, e.g., U.S. Pat. Nos. 5,399,493 and 5,437,994. Cells that can
be targeted for TERT promoter gene therapy aimed at increasing the
telomerase activity of a target cell include, but are not limited
to, embryonic stem or germ cells, particularly primate or human
cells, hematopoietic stem cells (AIDS and post-chemotherapy),
vascular endothelial cells (cardiac and cerebral vascular disease),
skin fibroblasts and basal skin keratinocytes (wound healing and
burns), chondrocytes (arthritis), brain astrocytes and microglial
cells (Alzheimer's Disease), osteoblasts (osteoporosis), retinal
cells (eye diseases), and pancreatic islet cells (Type I
diabetes).
[0120] In one embodiment, the targeted cells are embryonic stem
cells used to generate the non-human transgenic animals (e.g.,
mice) of the invention, as described herein.
Pharmaceutical Compositions
[0121] The invention provides pharmaceutical compositions that
comprise TERT promoter-containing nucleic acids (e.g., oligo- and
poly-nucleotides, expression vectors, gene therapy constructs,
etc.) alone or in combination with at least one other agent, such
as, e.g., a stabilizing compound, diluent, carrier, cell targeting
agent, or another active ingredient or agent. The therapeutic
agents of the invention may be administered in any sterile,
biocompatible pharmaceutical carrier, including, but not limited
to, saline, buffered saline, dextrose, and water. Any of these
molecules can be administered to a patient alone, or in combination
with other agents, drugs or hormones, in pharmaceutical
compositions where it is mixed with suitable excipient(s),
adjuvants, and/or pharmaceutically acceptable carriers.
[0122] The pharmaceutical compositions of the invention can be
administered by any means, such as, e.g., oral, parenteral, and the
like. Methods of parenteral delivery include e.g., topical,
intra-arterial (e.g., directly to the tumor), intramuscular (IM),
subcutaneous (SC), intramedullary, intrathecal, intraventricular,
intravenous (IV), intraperitoneal (IP), or intranasal
administration. Further details on techniques for formulation and
administration may be found in the latest edition of "REMINGTON'S
PHARMACEUTICAL SCIENCES" (Maack Publishing Co, Easton Pa.). See
also, e.g., PCT publication WO 93/23572.
[0123] Pharmaceutical compositions of the invention include
TERT-containing nucleic acids in an effective amount to achieve the
intended purpose. "Therapeutically effective amount" or
"pharmacologically effective amount" are well recognized phrases
and refer to that amount of an agent effective to produce the
intended pharmacological result. For example, a therapeutically
effective amount is an amount sufficient to treat a disease or
condition or ameliorate the symptoms of the disease being treated.
Useful assays to ascertain an effective amount for a given
application (e.g., a therapeutically effective amount) includes,
e.g., to measure the effect on endogenous TERT promoter activity
and telomerase activity in a target cell (in the case of, e.g.,
inhibition therapy). The amount actually administered will be
dependent upon the individual to which treatment is to be applied,
and will preferably be an optimized amount such that the desired
effect is achieved without significant side effects. The
therapeutically effective dose can be estimated initially either in
cell culture assays or in any appropriate animal model. The animal
model is also used to estimate appropriate dosage ranges and routes
of administration in humans. Thus, the determination of a
therapeutically effective dose is well within the capability of
those skilled in the art.
Production of Immortalized Cells, Cell Lines, and Animals
[0124] As described above, as an extension of the various
embodiments providing TERT promoter-containing compositions and
methods to increase TERT promoter activity, and to thereby increase
telomerase expression, thus increasing the proliferative capacity
of the cell, the invention also provides immortalized cells, cell
lines and animals using the TERT promoter sequences of the
invention. As discussed above, most vertebrate cells senesce after
a finite number of divisions in culture (e.g., 50 to 100
divisions). Certain variant cells, however, are able to divide
indefinitely in culture (e.g., HeLa cells, 293 cells) and, for this
reason, are useful for research and industrial applications.
Usually these immortal cell lines are derived from spontaneously
arising tumors, or by transformation by exposure to, e.g., an
oncogene, radiation or a tumor-inducing virus or chemical.
Unfortunately, a limited selection of cell lines, especially human
cell lines representing differentiated cell function, is available.
Moreover, many immortal cell lines presently available are
characterized by chromosomal abnormalities (e.g., aneuploidy, gene
rearrangements, or mutations). Further, many long-established cell
lines are relatively undifferentiated (e.g., they do not produce
highly specialized products of the sort that uniquely characterize
particular tissues or organs). Thus, there is a need for the TERT
promoter activating compositions and methods of the invention to
generate new immortal cell lines, especially using cells of human
origin, where hTERT promoter activating compositions and methods
are preferred.
[0125] The "immortalized cells" of the invention are not limited to
those that proliferate indefinitely, but also include cells with
increased proliferative capacity compared to similar cells whose
TERT promoter has not been upregulated. Depending on the cell type,
increased proliferative capacity may mean proliferation for at
least about 50, about 100, about 150, about 200, or about 400 or
more generations, or for at least about 3, about 6, about 12, about
18, about 24 or about 36 or more months in in vitro culture.
[0126] Uses for cells with increased proliferative capacity
include, e.g., the production of natural proteins and recombinant
proteins (e.g., therapeutic polypeptides such as erythropoietin,
human growth hormone, insulin, and the like), or antibodies, for
which a stable, genetically normal cell line is preferred. Another
use is for replacement of diseased or damaged cells or tissue. For
example, autologous immune cells immortalized using an TERT
promoter sequence of the invention can be used for cell replacement
in a patient after aggressive cancer therapy, e.g., whole body
irradiation. Another use for immortalized cells is for ex vivo
production of "artificial" tissues or organs (e.g., skin) for
therapeutic use. Another use for such cells is for screening or
validation of drugs, such as telomerase-inhibiting drugs, or for
use in production of vaccines or biological reagents. Additional
uses of the cells of the invention will be apparent to those of
skill.
Karyotype Analysis: Deletions; Amplifications, and
Translocations
[0127] The present invention further provides methods and reagents
for karyotype analysis, gene amplification detection, or other
chromosomal analysis using probes comprising the TERT promoter
sequences of the invention. In various embodiments, amplifications
(e.g., change in copy number), deletions, insertions,
substitutions, or changes in the chromosomal location (e.g.,
translocations) of TERT promoter containing genes are detected.
These can be correlated with the presence of a pathological
condition or a predisposition to developing a pathological
condition (e.g., cancer). Thus, this information can be used in a
diagnostic or prognostic manner.
[0128] For instance, a translocation event could indicate that
activation of TERT expression occurs in some cases by replacing all
or part of the TERT promoter with another promoter element (e.g., a
non-TERT promoter or enhancer) which directs TERT transcription in
an inappropriate manner. Furthermore, the methods and reagents of
the invention can be used to inhibit this inappropriate TERT
activation.
[0129] Determining the chromosomal location of TERT promoter
sequence may also be useful for analysis of TERT gene repression in
normal somatic cells, for instance, whether the location is part of
non-expressing heterochromatin. Nuclease hypersensitivity assays
for distinguishing heterochromatin and euchromatin are described,
e.g., in Wu (1979) Cell 16:797; Groudine (1982) Cell 30:131; Gross
(1988) Ann. Rev. Biochem. 57:159. Methods for analyzing karyotype
are well known in the art, and are discussed in detail in related
applications See also, e.g., Pinkel (1988) Proc. Natl. Acad. Sci.
USA 85:9138; EPO Pub. No. 430,402; Choo, ed., METHODS IN MOLECULAR
BIOLOGY VOL. 33: IN SITU HYBRIDIZATION PROTOCOLS, Humana Press,
Totowa, N.J., 1994; Kallioniemi (1992) Science 258:818).
Screening and Isolating Tert Promoter Binding Proteins and Other
Trans-Acting Transcriptional Agents
[0130] In addition to the novel TERT promoter sequences and
identification of the cis-acting transcriptional regulatory
sequences contained therein, the invention provides for novel in
vitro and cell-based in vivo assay systems to screen for TERT
promoter binding proteins (trans-acting transcriptional regulatory
factors) using the nucleic acids of the invention. Many assays are
available that screen for nucleic acid binding proteins and all can
be adapted and used with the novel TERT sequences provided by the
invention. A few illustrative example are set forth below.
[0131] One embodiment of the invention provides a method of
screening and isolating a TERT promoter binding compound by
contacting a TERT promoter sequence of the invention (particularly,
an identified cis-acting regulatory sequence) with a test compound
and measuring the ability of the test compound to bind the selected
nucleic acid. The test compound, as discussed above, can be any
agent capable of specifically binding to a TERT promoter activity,
including compounds available in chemical (e.g., combinatorial)
libraries, a cell extract, a nuclear extract, a protein or peptide.
If a TERT transcriptional activating protein is the goal of the
search, a cell with telomerase activity is typically chosen.
[0132] A variety of well-known techniques can be used to identify
polypeptides which specifically bind to TERT promoter, e.g.,
mobility shift DNA-binding assays, methylation and uracil
interference assays, DNase and hydroxy radical footprinting
analysis, fluorescence polarization, and UV crosslinking or
chemical cross-linkers. For a general overview, see, e.g., Ausubel
(chapter 12, DNA-Protein Interactions). One technique for isolating
co-associating proteins, including nucleic acid and DNA/RNA binding
proteins, includes use of UV crosslinking or chemical
cross-linkers, including e.g., cleavable cross-linkers dithiobis
(succinimidylpropionate) and 3,3'-ditliiobis
(sulfosuccinimidyl-propionate); see, e.g., McLaughlin (1996) Am. J.
Hum. Genet. 59:561-569; Tang (1996) Biochemistry 35:8216-8225;
Lingner (1996) Proc. Natl. Acad. Sci. USA 93:10712; Chodosh (1986)
Mol. Cell. Biol 6:4723-4733. In many cases, there is a high
likelihood that a specific protein (or a related protein) may bind
to an hTERT promoter sequence, e.g., a Myc, NF-kappa B, EF2, Sp1,
AP-1 or CAAT box binding site. In these scenarios, where an
antibody may already be available or one can be easily generated,
co-immunoprecipitation analysis can be used to identify and isolate
TERT promoter-binding, trans-acting factors. The trans-acting
factor can be characterized by peptide sequence analysis. Once
identified, the function of the protein can be confirmed by methods
known in the art, for example, by competition experiments, factor
depletion experiments using an antibody specific for the factor, or
by competition with a mutant factor.
[0133] Alternatively, TERT promoter-affinity columns can be
generated to screen for potential TERT binding proteins. In a
variation of this assay, TERT promoter subsequences are
biotinylated, reacted with a solution suspected of containing a
binding protein, and then reacted with a strepavidin affinity
column to isolate the nucleic acid or binding protein complex (see,
e.g., Grabowski (1986) Science 233:1294-1299; Chodosh (1986)
supra). The promoter-binding protein can then be conventionally
eluted and isolated. Mobility shift DNA-protein binding assay using
nondenaturing polyacrylamide gel electrophoresis (PAGE) is an
extremely rapid and sensitive method for detecting specific
polypeptide binding to DNA (see, e.g., Chodosh (1986) supra,
Carthew (1985) Cell 43:439-448; Trejo (1997) J. Biol. Chem.
272:27411-27421; Bayliss (1997) Nucleic Acids Res.
25:3984-3990).
[0134] Interference assays and DNase and hydroxy radical
footprinting can be used to identify specific residues in the
nucleic acid protein -binding site, see, e.g., Bi (1997) J. Biol.
Chem. 272:26562-26572; Karaoglu (1991) Nucleic Acids Res.
19:5293-5300. Fluorescence polarization is a powerful technique for
characterizing macromolecular associations and can provide
equilibrium determinations of protein-DNA and protein-protein
interactions. This technique is particularly useful (and better
suited than electrophoretic methods) to study low affinity
protein-protein interactions, see, e.g., Lundblad (1996) Mol.
Endocrinol. 10:607-612.
[0135] Proteins identified by these techniques can be further
separated on the basis of their size, net surface charge,
hydrophobicity and affinity for ligands. In addition, antibodies
raised against such proteins can be conjugated to column matrices
and the proteins immunopurified. All of these general methods are
well known in the art. See,.e.g, Scopes, R. K., Protein
Purification: Principles and Practice, 2nd ed., Springer Verlag,
(1987).
Transgenic Non-Animals Incorporating TERT Genes
[0136] The invention also provides non-human transgenic animals
comprising heterologous TERT or recombinant constructs comprising
endogenous TERT promoter. In a preferred embodiment, the transgenic
animals of the invention comprise a TERT promoter driving a
heterologous gene, such as a reporter gene coding sequence. In a
preferred embodiment, an hTERT promoter of the invention is
operably linked to a reporter gene in a transgenic mouse.
Alternatively, an mTERT promoter is operably linked to a reporter
gene in a transgenic mouse. These transgenic animals are very
useful as in vivo animal models to screen for modulators of TERT
transcriptional activity. The introduction of hTERT, mTERT or other
TERT promoters into animals to generate transgenic models is also
used to assess the consequences of mutations or deletions to the
transcriptional regulatory regions.
[0137] In one embodiment, the endogenous TERT gene in these mice is
still functional and wild-type (native) telomerase activity can
still exist. A TERT promoter of the invention (e.g., hTERT or
mTERT) is used to drive a high level expression of an exogenous
TERT construct, the endogenously produced mTERT protein can be
competitively replaced with the introduced, exogenous TERT protein.
This transgenic animal (retaining a functional endogenous
telomerase activity) is preferred in situations where it is
desirable to retain "normal," endogenous telomerase function and
telomere structure. In other situations, where it is desirable that
all telomerase activity is by the introduced exogenous TERT
protein, use of an mTERT knockout line (described below) is
preferred.
[0138] Promoter function, and in a preferred embodiment, hTERT
promoter function, can be assessed with these transgenic animals.
Alterations of TERT promoters can be constructed that drive TERT or
a reporter gene to assess their function and expression pattern and
characteristics (the invention also provides constructs and animals
and methods for gene expression driven by a TERT promoter by
transient transfection).
[0139] In one embodiment, the TERT promoters and reagents of the
invention are used to create mouse cells and transgenic animals in
which the endogenous TERT promoter is deleted, modified,
supplemented or inhibited. For example, TERT promoter sequences can
be deleted, modified or inhibited on either one or both alleles.
The cells or animals can be reconstituted with a wild-type or
modified TERT promoter, or, in a preferred embodiment, an exogenous
TERT in the form of hTERT. Methods for the construction of
transgenic animals, particularly trangenic mice, and the selection
and preparation of recombinant constructs for generating
transformed cells are well known in the art.
[0140] Construction of a "knockout" cell and animal is based on the
premise that the level of expression of a particular gene in a
mammalian cell can be decreased or completely abrogated by
introducing into the genome a new DNA sequence (e.g., a TERT or
other nucleic acid construct of the invention) that serves to
interrupt some portion of the DNA sequence of the gene/promoter to
be suppressed. To prevent expression of endogenous promoter, simple
mutations that alter or disrupt the promoter can be suitable. To
upregulate expression, a native TERT promoter can be substituted
with a heterologous or mutated TERT promoter that induces higher
levels of transcription, or with multiple copies of trangene TERT
promoters. Also, "gene trap insertion" can be used to disrupt a
host gene, and mouse embryonic stem (ES) cells can be used to
produce knockout transgenic animals, as described herein and, e.g.,
in Holzschu (1997) Transgenic Res 6: 97-106.
[0141] In a preferred embodiment, cell and trangenic animal models
express TERT promoter (particularly, hTERT promoter) operably
linked to a reporter gene. The cell or animal can be a TERT
promoter "knockout" or it can retain endogenous TERT promoter
activity. The insertion of the TERT promoter-containing exogenous
sequence is typically by homologous recombination between
complementary nucleic acid sequences. Thus, the exogenous sequence,
which is typically an hTERT or mTERT promoter of this invention, is
some portion of the target (e.g., mTERT) gene to be modified, such
as exonic, intronic or transcriptional regulatory sequences, or any
genomic sequence which is able to affect the level of the target
gene's expression; or a combination thereof. The construct can also
be introduced into other (i.e., non-mTERT gene) locations in the
genome. Gene targeting via homologous recombination in
pluripotential embryonic stem cells allows one to modify precisely
the genomic sequence of interest.
[0142] The exogenous sequence is typically inserted in a construct,
usually also with a marker gene to aid in the detection of the
knockout construct and/or a selection gene. The construct can be
any of a variety of expression vectors, plasmids, and the like, as
described above. The knockout construct is inserted in a cell,
typically an embryonic stem (ES) cell, using a variety of
techniques, as described above. The insertion of the exogenous DNA
usually occurs by homologous recombination. The resultant
transformed cell can be a single gene knockout (i.e., only one of
the two copies of the endogenous TERT promoter has been modified)
or a double gene knockout. The knockout construct can be integrated
into one or several locations in the cell's genome due to the
random nature of homologous recombination events; however, the
recombination does occur between regions of sequence
complementarity. Typically, less than one to five percent of the ES
cells that take up the knockout construct will actually integrate
exogenous DNA in these regions of complementarity; thus,
identification and selection of cells with the desired phenotype is
usually necessary and a selection or marker sequence is usually
incorporated into the construct for this purpose. Cells which have
incorporated the construct are selected for prior to inserting the
genetically manipulated cell into a developing embryo; for example,
the cells are subjected to positive selection (using G418, for
example, to select for neomycin-resistance) and negative selection
(using, for example, FIAU to exclude cells lacking thymidine
kinase). A variety of selection and marker techniques are well
known in the art, e.g., antibiotic resistance selection or
beta-galactosidase marker expression can be used and are further
described herein.
[0143] After selection of manipulated cells with the desired
phenotype, i.e., complete or partial inability to express
endogenous TERT promoter, or, expression of the exogenous TERT
promoter (as hTERT promoter activity) the cells are inserted into a
mouse embryo. Insertion can be accomplished by a variety of
techniques, such as microinjection, in which about 10 to 30 cells
are collected into a micropipet and injected into embryos that are
at the proper stage of development to integrate the ES cell into
the developing embryonic blastocyst, at about the eight cell stage,
which for mice is about 3.5 days after fertilization. The embryos
are obtained by perfusing the uterus of pregnant females. After the
ES cell has been introduced into the embryo, it is implanted into
the uterus of a pseudopregnant foster mother, which is typically
prepared by mating with vascectomized males of the same species. In
mice, the optimal time to implant is about two to three days
pseudopregnant. Offspring are screened for integration of the TERT
nucleic acid sequences and the modified promoter activity
phenotype. Offspring that have the desired phenotype are crossed to
each other to generate a homozygous knockout. If it is unclear
whether germline cells of the offspring have modified promoter,
they can be crossed with a parental or other strain and the
offspring screened for heterozygosity of the desired trait. The
heterozygotes can be crossed with each other to produce mice
homozygous for modified TERT genomic sequence. While the above
described methodology describes a typical protocol, any technique
can be used to create, screen for, propagate, a knockout animal,
particularly, an mTERT knockout mice, e.g., see Bijvoet (1998) Hum.
Mol. Genet. 7:53-62; Moreadith (1997) J. Mol. Med. 75:208-216; Tojo
(1995) Cytotechnology 19:161-165; Mudgett (1995) Methods Mol. Biol.
48:167-184; Longo (1997) Transgenic Res. 6:321-328; U.S. Pat. Nos.
5,616,491 (Mak, et al.); 55,464,764; 5,631,153; 5,487,992;
5,627,059; 5,272,071; and, WO 91/09955, WO 93/09222, WO 96/29411,
WO 95/31560, and WO 91/12650. Thus, the invention provides for the
use of the TERT promoter sequence-containing reagents of the
invention to produce "knockout" mouse cells and animals, trangenic
animals, and their progeny. These cells and animals can be further
reconstituted with wild type or modified endogenous mTERT promoter
or exogenous TERT promoter, such as hTERT.
[0144] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended
claims.
EXAMPLES
Example 1
Cloning of Lambda Phage Gphi5 and Characterization of hTERT Genomic
Sequences
[0145] The following example details the cloning of the human hTERT
promoter. Lambda Phage Gphi5
[0146] A human genomic DNA library was screened by PCR and
hybridization to identify a genomic clone containing hTERT RNA
coding sequences. The library was a human fibroblast genomic
library made using DNA from WI38 lung fibroblast cells (Stratagene,
Cat # 946204). In this fibroblast library, partial Sau3AI fragments
were ligated into the XhoI site of a commercial phage cloning
vector, Lambda FIX(r)II Vector (Stratagene, San Diego, Calif.),
with insert sizes ranging from approximately 9 kilobases (kb) to 22
kb.
[0147] The genomic library was divided into pools of 150,000 phage
each. Each pool screened by nested PCR, with the outer primer pair
TCP1.52 & TCP1.57; inner pair TCP1.49 & TCP1.50, see Table
1. These primer pairs span a putative intron in the genomic DNA of
hTERT and ensured the PCR product was derived from a genomic source
and not from contamination by the hTERT cDNA clone. Positive pools
were further subdivided until a pool of 2000 phage was obtained.
This pool was plated at low density and screened via hybridization
with a DNA fragment encompassing a subset of hTERT cDNA, generated
by restriction digest with SphI and EcoRV.
[0148] Two positive clones were isolated and rescreened via nested
PCR as described above. At rescreening, both clones were positive
by PCR. One of the lambda phage clones (designated "Gphi5" or G (5)
was digested with NotI, revealing an insert size of approximately
20 kb. Subsequent mapping indicated the insert size was 15 kb and
that phage Gphi5 contains approximately 13 kb of DNA upstream from
the transcriptional start site (upstream from the cDNA sequence).
Phage Gphi5 was mapped by restriction enzyme digestion and DNA
sequencing. The-resulting map is shown in FIG. 1.
Isolating, Subcloning and Sequencing the Genomic hTERT Insert
[0149] The phage DNA was digested with NcoI. This fragment was
cloned into the plasmid pBBS167. The resulting subclones were
screened by PCR to identify those containing sequences
corresponding to the 5' region of the hTERT cDNA. A subclone
(plasmid "pGRN140") containing a 9 kb NcoI fragment (with hTERT
gene sequence and about 4 to 5 kb of lambda vector sequence) was
partially sequenced to determine the orientation of the insert.
pGRN140 was digested using SalI to remove lambda vector sequences,
the resulting plasmid (with removed lambda sequences) designated
pGRN144. The pGRN144 insert was then sequenced.
[0150] A NotI fragment (SEQ ID NO:1) from lambda Gphi5 (containing
the complete approximately 15 kbp genomic insert including the
hTERT gene promoter region) was inserted in the NotI site of
plasmid pBBS 185. Two plasmids were isolated with their respective
inserts oriented in opposite directions. One resulted in the insert
oriented with the hTERT open reading frame (ORF) in the same
orientation as the plasmid's Lac promoter, designated pGRN 142; the
second, pGRN 143. pGRN142 has been deposited in GenBank with the
Accession Number PGRN142.INS AF121948 (see National Center for
Biotechnology Information at http://www.ncbi.nlm.nih.-
gov/Web/Search/index.html).
[0151] The insert in pGRN 142 was sequenced; the results of which
are provided as SEQ ID NO:1. In SEQ ID NO:1, the genomic insert
begins at residue 44 and ends at residue 15375. The hTERT cDNA
start site is at residue 13490. The hTERT ATG codon is at residue
13545. As indicated in FIG. 1, Alu sequence elements are located
1700 base pairs upstream of the hTERT cDNA 5' end.
Example 2
TERT Promoter-Driven Reporter Constructs
[0152] This example describes the construction of plasmids in which
reporter genes are operably linked to hTERT promoter sequences of
the invention. This also illustrates how the TERT promoter sequence
of the invention can analogously be operatively linked to
heterologous sequences, such as polypeptide coding sequences, for
expression in cells and tissues in vitro and in vivo and transgenic
animals.
[0153] hTERT-linked reporter vectors of the invention have numerous
uses, including, e.g., identification of specific cis-acting
sequences and trans-acting transcriptional regulatory factors.
Importantly., these hTERT-containing reporter constructs can be
used for the screening of agents capable of modulating (e.g.,
activating or inhibiting) hTERT transcription (e.g., drug
screening). These studies can be in vitro and in vivo.
[0154] A number of reporter genes, e.g., firefly luciferase,
beta-glucuronidase, beta-galactosidase, chloramphenicol acetyl
transferase, and GFP and the like, are known in the art and can be
operably linked to hTERT promoter. In this example, the human
secreted alkaline phosphatase (SEAP; ClonTech) was used. The SEAP
reporter gene encodes a truncated form of the placental enzyme
which lacks the membrane anchoring domain, thereby allowing the
protein to be secreted efficiently from transfected cells. Levels
of SEAP activity detected in the culture medium have been shown to
be directly proportional to changes in intracellular concentrations
of SEAP mRNA and protein. The chemiluminescence-based SEAP assay is
about 10-fold more sensitive than similar assays using firefly
luciferase as the reporter enzyme. The SEAP activity can also be
assayed with a fluorescent substrate, which provides sensitivity
comparable to luciferase. See, e.g., Berger (1988) Gene 66:1;
Cullen (1992) Meth. Enzymol. 216:362; Yang (1997) Biotechniques
23:1110-1114.
hTERT5' Upstream and Intronic Sequences have "Promoter"
Activity
[0155] Experiments with reporter constructs comprising various
hTERT sequences of the invention identified cis-acting regions with
"promoter" transcriptional activating activity in both 5' upstream
and intronic sequences. In brief, four constructs, pGRN148,
pGRN150, "pSEAP2 basic" (no promoter sequences=negative control),
and "pSEAP2 control" (contains the SV40 early promoter and
enhancer) were constructed (see also details below) and transfected
in triplicate into mortal and immortal cells. Plasmid pGRN148 was
constructed as illustrated in FIG. 3. Briefly, a Bgl2-Eco47III
fragment from pGRN144 (described above) was digested and cloned
into the BglII-NruI site of pSeap2Basic (Clontech, San Diego,
Calif.).
[0156] A second reporter-promoter, plasmid pGRN1 50 was made by
inserting the BglII-FspI fragment from pGRN144 into the BglII-NruI
sites of pSEAP2. Plasmid pGRN173 was constructed by using the
EcoRV-StuI fragment from pGRN144. This makes a promoter reporter
plasmid that contains the promoter region of hTERT from
approximately 2.5 kb upstream from the start of the hTERT ORF to
just after the first intron in the coding region. The initiating
Met was mutated to Leu, so that the second ATG following the
promoter region would be the initiating ATG of the SEAP ORF.
[0157] Use of the intronic sequence allows identification of
regulatory sequences that may be present in the intron (the
invention provides transcriptional regulatory sequences from any
portion of the hTERT genomic sequence). In addition to the hTERT
derived pSEAP reporter constructs, a positive control vector and a
negative control vector were used. The negative control
(pSEAP2-Basic) is necessary to determine the background signal
associated with the DNA backbone of the vector. A positive control
is necessary to confirm transfection and expression of exogenous
DNA and to verify the presence of active SEAP in the culture media.
The positive control is the pSEAP2-Control vector (Clontech) which
contains the SEAP structural gene under transcriptional control of
the SV40 promoter and enhancer.
[0158] Three constructs, the control, pGRN148 (which include hTERT
5' promoter sequences) and pGRN150, were transfected into a mortal
cell line, BJ cells, a human foreskin fibroblast line; see, e.g.,
Feng (1995) Science 269:1236; and an immortal cell line, the human
embryonic kidney line 293; see, e.g., Graham (1977) J. Gen. Virol.
36:59. All transfections were done in parallel with the two control
plasmids.
[0159] In immortal cells, pGRN148 and pGRN150 constructs appear to
drive SEAP expression as efficiently as the pSEAP2 positive control
(containing the SV40 early promoter and enhancer). In contrast, in
mortal cells only the pSEAP2 control gave detectable activity.
Similar results were obtained using another normal cell line (RPE,
or retinal pigmental epithelial cells, see, e.g., Aronson (1983) In
vitro 19:642-650). In RPE cells transfected with pGRN150, the hTERT
promoter region was inactive while the pSEAP2 control plasmid was
active. These results indicate that, as expected, hTERT promoter
sequences are active in tumor cells but not in mortal cells.
Identification of the Tissue Specificity Elements of the hTERT
Promoter
[0160] The hTERT DNA promoter sequences were cloned into the
pSEAP2-Basic transcription reporter vector (Clontech) to generate
the plasmids pGRN 148, 150, 175, 176, 181,184, 261, 262, and 319.
Summarized below are details of the promoter plasmid construction
(nucleotide numbers refer to the number of nucleotides upstream of
the translation initiation site at 13545 of SEQ ID NO:1):
[0161] pEGFP-1. *Vector from Clontech containing the "Enhanced
Green Flourescent Protein".
[0162] pGRN140. *NCO1 fragment containing hTERT upstream sequences
and the first intron of hTERT from lambdaGPhi5 into the NCO1-site
of a pBBS167 (varient of pUC19 cloning vector with MCS, e.g.
1 (SEQ ID NO:3) ATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTC-
TAGAGTC GACCTGCAGGCATGCCCATGGCAGGCCTCGCGCGCGAGATCTCGGGCCC- A
ATCGATGCCGCGGCGATATCGCTCGAGGAAGCTTGGCACTGGCC,
[0163] and a chloramphenicol sensitive gene between the Flori and
the Amp gene in the opposite orientation from the Amp gene). The
fragment is oriented so that the hTERT sequences are in the same
direction as the Lac promoter.
[0164] pGRN144. described above; SalI deletion of pGRN140 to remove
phage (lambda) sequences.
[0165] pGRN148: *BGL2-ECO47III fragment from pGRN144 containing
hTERT upstream sequences (from position -51 to -2482) into the
BGL2-NRU1 sites of pSEAP2-Basic to make a hTERT promoter/reporter
plasmid.
[0166] pGRN150: *BGL2.-FSP1 fragment from pGRN144 containing 2447nt
of hTERT upstream sequences (from position -36 to -2482) into the
BGL2-NRU1 sites of pSEAP2 to make a hTERT promoter/reporter
plasmid.
[0167] pGRN175: *APAI(Klenow blunt)-SRF1 religation of pGRN150 to
delete most of the hTERT upstream sequences. This makes a
promoter/reporter plasmid that uses 82 nucleotides of hTERT
upstream sequences (from position -36 to -117).
[0168] pGRN176: *PML1-SRF1 religation of pGRN150 to delete most of
the hTERT upstream sequences. This makes a promoter/reporter
plasmid that uses 204 nucleotides of hTERT upstream sequences (from
position -36 to -239).
[0169] pGRN181: *APA1 digestion and religation of pGRN150 to delete
all APA1 sites but one. This makes a promoter/reporter plasmid that
comprises from -36 to -114 and -1076 to -2482 of the hTERT upstream
sequences.
[0170] pGRN184: *XBA1(partial, Klenow fill)-ECOR1 digest and
religation of pGRN150 to make a deletion of the hTERT promoter
sequences. This makes a promoter/reporter plasmid that expresses a
region from -1391 to -2484 of the hTERT upstream sequences.
[0171] pGRN213. *FSP1 fragment containing the CatS gene and the F1
ORI plus part of the AmpR gene into the FSP1 sites of pSEAP2-Basic
such that the orientation reconstructs the AmpR gene.
[0172] pGRN244: *SAL1-NOT1 fragment from pSEAP2-Basic containing
the SEAP region into the SAL1-NOT1 sites of pEGFP-1. This
modification adds a selectable marker to the vector.
[0173] pGRN245: *SAL1-NOT1 fragment from pGRN176 containing the
hTERT-promoter/SEAP region into the SAL1-NOT1 sites of pEGFP-1.
This modification adds a dominant selectable marker to the
vector.
[0174] pGRN246: *SAL1-NOT1 fragment from pGRN176 containing the
hTERT-promoter/SEAP region into the SAL1-NOT1 sites of pEGFP-1.
This modification adds a dominant selectable marker to the
vector.
[0175] pGRN248 *SAL1-NOT1 fragment from pGRN175 containing the
hTERT promoter/SEAP region into the SalI-NotI sites of pEGFP-1.
This modification adds a dominant selectable marker to the
vector.
[0176] pGRN259. *in vitro mutagenesis using RA94
(CCCGGCCACCCCCGCGAattCGCG- CGCTCCCCGCTGC) (SEQ ID NO:4) to
introduce an EcoRI site at the initiating met of hTERT in pGRN144.
This provides hTERT u=sequences from +1 to -2482 that can be cloned
into a vector using EcoRI and BglII.
[0177] pGRN260. *in vitro mutagenesis using RA91
(TTGTACTGAGAGTGCACCATATGC- GGTGTGcatgcTACGTAAGAGGTTCCAACT
TTCACCATAAT) (SEQ ID NO:5) to delete several sites from the
Chloramphenicol region of pGRN213 to create a variant, more useful,
MCS. This creates a Mutagenesis version of pSEAP2-Basic with more
unique cloning sites in it's MCS.
[0178] pGRN261: *BGL2-ECOR1 fragment from pGRN259 containing hTERT
upstream sequences into the BGL2-ECOR1 sites of pSEAP2-Basic. This
makes a promoter/reporter expression plasmid that contains from +1
to -2482 of the hTERT upstream sequences.
[0179] pGRN262: *BGL2-ECOR1 fragment from pGRN259 containing hTERT
upstream sequences into the BGL2-ECOR1 sites of pGRN260. This makes
a promoter/reporter expression and mutagenesis plasmid that
contains from +1 to -2482 of the hTERT upstream sequences.
[0180] pGRN294 *BbsI-XhoI fragment from pGRN142 containing hTERT
upstream sequences from -1667 to -3278 into the BbsI-XhoI sites of
pGRN259. This makes a vector containing the genomic upstream region
for hTERT from +1 to -3278 that can be cloned with EcoRI and
XhoI.
[0181] pGRN295: *ECOR1-XHO1 fragment from pGRN294 containing from
+1 to -3282 of hTERT upstream sequences into the ECOR1-XHO1 sites
of pGRN260. This makes a SEAP promoter/reporter/mutagenesis
plasmid:
[0182] pGRN296: *ECOR1-XHO1 fragment from pGRN294 containing from
+1 to -3282 of the hTERT upstream sequences into the ECOR1-XHO1
sites of pSEAP2-Basic. This makes a SEAP promoter/reporter
plasmid.
[0183] pGRN297. *RA96 (AATTGCGAAGCTTACG) (SEQ ID NO:6) and RA97
(AATTCGTAAGCTTCGC) (SEQ ID NO:7) annealed to make an oligo linker
into the ECOR1 sites of pGRN259 replacing the ECOR1 fragment of the
intron-exon region of pGRN259.
[0184] pGRN299: *XHO1-HIND3 fragment from pGRN298 containing from
+1 to -3282 of the hTERT upstream sequences into the XHO1-HIND3
sites of pGL2-Basic. This makes a Luciferase promoter/reporter
plasmid with about 3.3Kb of hTERT promoter sequences.
[0185] pGRN300: *XHO1-SAC1 fragment from pGRN142 containing hTERT
upstream sequences into the XHO1-SAC1 sites of pGRN299 such that
the resulting construct contains from +1 to -5124 of the hTERT
upstream sequences. This creates an hTERT promoter/reporter
construct using Luciferase as a reporter.
[0186] pGRN310: *SAC1 fragment from pGRN142 containing hTERT
upstream sequences into the SAC1 site of pGRN300 such that the
resulting construct contains +1 to -7984 of the hTERT upstream
sequences. This creates an hTERT promoter/reporter construct using
Luciferase as a reporter.
[0187] pGRN311. *SPE1 fragment from pGRN142 containing from -4773
to -13501 of the hTERT upstream sequences into the SPE1 site of
pGRN300 such that the orientation reconstructs the genomic region.
This makes a Luciferase promoter reporter plasmid that contains the
entire pGRN142 upstream genomic region of hTERT plus a 365bp region
of genomic DNA from the middle of the 13.5Kb genomic region
repeated upstream of the T7 promoter.
[0188] pGRN312: *BGL2-FSP1 fragment from pGRN144 into the
BGL2-HIND3 (Klenow filled) sites of pGL2-Basic. This makes a
Luciferase promoter/reporter version of pGRN150.
[0189] pGRN313: *KPN1-NOT1 digested pGRN311 blunted with T4
polymerase and religated. This makes a Luciferase promoter/reporter
plasmid using from +1 to -13501 of the hTERT upstream
sequences.
[0190] pGRN316: *oligo RA101 (5'-TAGGTACCGAGCTCTTACGCGTGC
TAGCCCCACGTGGCGGAGGGACTGGGGACCCGGGCA-3') (SEQ ID NO:8) used for in
vitro mutagenesis to delete the genomic sequence from pGRN262
between the SRF1 site and the first PML1 site. This makes a
promoter-reporter plasmid containing hTERT upstream sequences from
+1 to -239.
[0191] pGRN317: *oligo RA100 (5'-TAGGTACCGAGCTCTTACGCGTG
CTAGCCCCTCGCTGGCGTCCCTGCACCCTGGGAGCGC-3') (SEQ ID NO:9) used for in
vitro mutagenesis to delete the genomic sequence from pGRN262
between the SRF1 site and next to the last APAI site. This makes a
promoter-reporter plasmid containing hTERT upstream sequences from
+1 to -397.
[0192] pGRN319: *RA107 (5'-CGTCCTGCTGCGCACtcaGGAAGCCCTGGCCCC-3')
(SEQ ID NO:10) used for in vitro mutagenesis to inactivate the `B`
class E-box just proximal to the hTERT initiating met in pGRN262.
This changes the CACGTG (SEQ ID NO:11) to CACTCA (SEQ ID NO:12).
Also COD1941 (5'-GATGAATGCTCATGATTCCG TATGGCA-3') (SEQ ID NO:13)
was used to switch from CatR to CatS introducing a BSPH1 site and
COD2866 (5'-CAGCATCTTTTACTTTCACCAGCGTTTCTG
GGTGCGCAAAAACAGGAAGGCAAAATGCC-3') (SEQ ID NO:14) was used to select
from AmpS to AmpR introducing an FSP1 site. In summary, pGRN319
carries a mutation in the E-box.
[0193] pGRN350: *RA104 (5'-TAGGTACCGAGCTCTTACGCGTGC
TAGCCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGC-3') (SEQ ID NO:15) used for in
vitro mutagenesis to delete the genomic sequence from pGRN262
between the SRF1 site and the last APA1 site before the ATG of the
hTERT open reading frame (orf).
[0194] pGRN351: *SAC2 fragment from pGRN319 into the SAC2 sites of
pGRN350 such that the SEAP orf is recreated. This makes a
"deactivated E-box" version of pGRN350.
[0195] pGRN352: *RA122 (5'-GACCGCGCTTCCCACtcaGCGGAG GGACTGGGG-3')
(SEQ ID NO:16) used for in vitro mutagenesis to "deactivate" the
penultimate class "B" E-box before the translation start site of
hTERT.
[0196] The pSEAP2-Basic plasmid lacks eukaryotic promoter and
enhancer sequences. This vector contains the SV40 late
polyadenylation signal inserted downstream of the SEAP coding
sequences to ensure proper and efficient processing of the
transcript in eukaryotic cells. It also contains a synthetic
transcription blocker (TB), composed of adjacent polyadenylation
and transcription pause sites to reduce background transcription.
As noted above, the SEAP reporter gene encodes a truncated form of
the placental enzyme which lacks the membrane anchoring domain,
thereby allowing the protein to be efficiently secreted from
transfected cells.
[0197] Levels of SEAP activity detected in the culture medium have
been shown to be directly proportional to changes in intracellular
concentrations of SEAP mRNA. The chemiluminescent SEAP substrate
CSPDTM (Clontech) was used to detect secreted SEAP. Use of this
substrate enables monitoring of the expression of the SEAP reporter
gene through simple, sensitive, nonradioactive assays of secreted
phosphatase activity. This chemiluminescent assay can detect as
little as 10-13 g of SEAP protein. The assay is linear over a 104
fold range of enzyme concentrations. This makes the assay (and
these vectors) particularly well-suited for comparative
analyses.
[0198] As above, in addition to the hTERT derived pSEAP reporter
constructs, a positive control vector (pSEAP2-Control vector) and a
negative control vector (pSEAP2-Basic) were used. The promoter
constructs (PGRN 150, 175, 176) and the control vectors were
transfected into immortal (HEK 293) and mortal (BJ fibroblast, RPE,
HUVEC) cells 48-72 hours after transfection. The culture media was
collected and assayed for SEAP activity. The SEAP activity was
detected using the chemiluminescent assay from CLONTECH, Great
EscAPeTM SEAP Chemiluminescence Kit, according to the
manufacturer's protocol. The transfections were performed in
triplicate. The culture media from each transfection was collected
after 48-72 hours and assayed in triplicate. The background values
obtained by transfection of the negative control (pSEAP2-Basic)
vector was subtracted from the values obtained with the test
constructs. The average of nine measurements was used and plotted
for each of the constructs.
Experimental Results in Immortal and Mortal Cell Lines
[0199] The results of the assays show that while the hTERT promoter
constructs are capable of driving the expression of the reporter
SEAP gene in immortal cells, the same constructs are silent in all
mortal cells tested. The pSEAP2-Control vector however is active in
all cell types regardless of their mortal or immortal status and
the pSEAP2-Basic vector is silent in all cells assayed.
hTERT Promoter Driving Thymidine Kinase Expression In Vitro
[0200] The invention provides constructs comprising heterologous
coding sequences operably linked to hTERT promoter sequences. In
one embodiment, hTERT coding sequences are operably linked to
Herpes simplex virus thymidine kinase ("HSV-TK") coding sequences.
HSV-TK is an enzyme that is capable of converting innocuous
prodrugs, e.g. ganciclovir, into toxic metabolites that interfere
with the cellular replication of proliferating cells (e.g., cancer
cells, which have active hTERT promoter activity). Controlling
thymidine kinase (TK) expression by subordinating it to the hTERT
promoter restricts TK expression to cells where the hTERT promoter
is normally active, i.e., tumor cells and other proliferating
(e.g., immortalized) cells. This prevents TK expression in "normal"
cells, where the hTERT promoter is usually silent.
[0201] The ability of the hTERT promoter to specifically drive the
expression of the TK gene in tumor cells was tested using a variety
of constructs: One construct, designated pGRN266, contains an
EcoRI-FseI PCR fragment with the TK gene cloned into the EcoRI-FseI
sites of pGRN263. pGRN263, containing approximately 2.5 kb of hTERT
promoter sequence, is similar to pGRN150, described above, but
contains a neomycin gene as selection marker. pGRN267 contains an
EcoRI-FseI PCR fragment with the TK gene cloned into the EcoRI-FseI
sites of pGRN264. pGRN264, containing approximately 210 bp of hTERT
promoter sequence, is similar to pGRN176, described above, but
contains a neomycin gene as selection marker. pGRN268 contains an
EcoRI-XbaI PCR fragment with the TK gene cloned into the EcoRI-XbaI
(unmethylated) sites of pGRN265. pGRN265, containing approximately
90 bp of hTERT promoter sequence, is similar to pGRN175, described
above, but contains a neomycin gene as selection marker.
[0202] These hTERT promoter/TK constructs, pGRN266, pGRN267 and
pGRN268, were re-introduced into mammalian cells and TK/+ stable
clones (and/or mass populations) were selected. Ganciclovir
treatment in vitro of the TK/+ cells resulted in selective
destruction of all tumor lines tested, including 143B, 293, HT1080,
Bxpc-3, DAOY and NIH3T3. Significantly, ganciclovir treatment had
no effect on normal BJ cells. This clearly demonstrates the
tumor-specificity of all three hTERT promoter fragments used in
these experiments.
Example 3
Direct In Vivo hTERT Promoter Suicide Gene Therapy
[0203] The invention provides reagents and methods for treating
diseases involving unwanted cell proliferation by in vivo gene
therapy. To demonstrate the efficacy of this aspect of the
invention, the reagents of the invention were used to treat cancer
(of human origin) in an art-accepted animal model. A human cancer
cell, the osteosarcoma cell line 143B, which normally expresses the
telomerase gene, was transfected with a plasmid containing the TK
gene driven by the hTERT promoter.
[0204] Specifically, sequences -36 to -2482 upstream of the
translation start site of SEQ ID NO:1 were used to drive the TK
gene. The plasmid also contained the neomycin phosphotransferase
gene. After transfection of cells with the plasmid, G418 resistant
clones expressing TK were selected. Two hundred thousand of the
parental or TK expressing 143B cells were injected subcutaneously
in the flank of Balb/c nude (nu/nu) mice to establish tumors. Four
to 11 days after tumor implantation the mice were injected IP with
75 mg/kg ganciclovir (GCV) or saline twice daily. Tumor growth was
monitored every 3-4 days. When GCV was administered either at 4 or
at 11 days post tumor implantation to these tumor bearing animals,
TK mediated cell lysis and retarded tumor growth was observed. Such
inhibition of tumor cell growth is not observed when saline is
administered or if the parental 143B tumor (143BP) is treated with
either saline or GCV. Forty-five days after tumor implantation,
only the animals implanted with the TK+143B clone and treated with
GCV showed 100% survival. In the other groups all but one animal
died from massive tumor burden.
[0205] These data indicate that the hTERT promoter is sufficient to
drive TK gene expression both in vivo. It also shows that the
reagents and methods of the invention can be used to promote tumor
regression in vivo in animals carrying pre-established tumors;
i.e., the reagents of the invention can be used to treat cancer
patients with pre-existing tumors.
Example 4
Oncolytic Viruses Under Control of the hTERT Promoter
[0206] As discussed above, the invention provides "conditionally
replicating" oncolytic virus constructs (e.g., gene therapy
vectors) in which hTERT promoter sequences of the invention are
operably linked to essential virally encoded genes. Use of hTERT
promoter sequences of the invention ensures the virus will only be
productively expressed in cells with telomerase activity. Thus,
constructs can be used therapeutically to lyse only cells that
express telomerase, such as immortal or cancer cells. Proliferation
of the virus and its cytopathic effects is thus restricted to tumor
cells. Details of the construction of an exemplary hTERT promoter
driven, conditionally replicating oncolytic virus follows. In this
embodiment, the hTERT promoter replaces the normal E1a promoter to
create a virus which will only replicate in telomerase expressing
cells.
[0207] Plasmid pBR/ITR/549-ClaI containing nucleotides 1-356 (Ad2
ITR and packaging signals) and 549-920 (a portion of the E1a coding
sequence) of Adenovirus 2 (Ad2) linked using a polylinker was built
using standard molecular biology procedures in the bacterial
plasmid pBR322. In pBR/ITR/TB+phTERT176-E1A and
pBR/ITR/TB+phTERT316-E1A, the normal E1a promoter (Ad2 357-548) has
been replaced with the hTERT promoter. Ad2 sequences from 916-10680
are added to these plasmids to recreate the expression elements of
the 5' end of the virus.
[0208] These plasmids (pBR/ITR/TB+phTERT176-10680 and
pBR/ITR/TB+phTERT316-10680) are transfected into a telomerase
expressing human cell line along with an adenoviral DNA fragment
containing Ad2 sequences 10681-35937. Recombinant plaques are
scored and selected 7-21 days post transduction. The hTERT promoter
E1a containing Ad2 is propagated and produced for use employing
standard schemes for recombinant Ad2 amplification and
manufacturing. (Graham and Prevec, 1991, in Methods in Molecular
Biology, Chapter 11, Ed E. J. Murray, The Human Press Inc.,
Clifton, N.J.; Kanegae et al., Jpn J Med Sci Biol, 1994,
47(3):157-66). Because the E1a gene is driven by the hTERT
promoter, which is not normally expressed by most somatic cells,
recombinant Ad2 genome will only replicate and be packaged into
virus particles in cells expressing telomerase (i.e., immortal
cells, tumor cells).
Example 5
hTERT Promoter Sequences Driving an Alkaline Phosphatase Reporter
Gene for High Throughput Screening.
[0209] The invention provides constructs and promoter-based assays
to identify small molecule activators and/or repressors of hTERT
and telomerase activity. To this end, fragments of the hTERT
promoter were cloned into plasmids expressing a secreted form of
alkaline phosphatase and a selection marker. The SEAP constructs
described above (pGRN244, pGRN245, pGRN246 and pGRN248) were
re-introduced into normal human cells and into immortal cell lines.
After selection of stable clones having integrated the hTERT
promoter/SEAP constructs, RT-PCR was used to determine the levels
of SEAP mRNAs. In 293 cells, the levels of SEAP mRNA were elevated
and comparable to the levels of endogenous hTERT, whereas in BJ
cells, the levels of SEAP mRNA were virtually undetectable and
closely matched the levels of the endogenous hTERT in these
cells.
[0210] These results indicate that hTERT promoter/SEAP constructs
can be used to engineer cells suitable for promoter-based assays
and to screen for chemical and/or biological activators and/or
repressors of telomerase in normal and tumor cells. pGRN244,
pGRN245, pGRN246 and pGRN248 were re-introduced into BJ and 293
cells. SEAP activity and mRNA levels were determined in these cells
as criteria for clone selection. Several 293 and BJ lines were
selected and two BJ/pGRN245 clones were expanded for high
throughput screening. These constructs were also introduced into
IDH4 cells, which are immortal lung fibroblasts that express the
SV40 large T antigen under the control of the
dexamethasone-inducible MMTV promoter. IDH4 cells are telomerase
positive and proliferate in the presence of dexamethasone. However,
these cells can be induced into a senescent, telomerase negative
stage after dexamethasone removal. Upon re-addition of
dexamethasone, the cells return to an immortal phenotype and
re-activate telomerase.
[0211] pGRN244, pGRN245, pGRN246 and pGRN248 were transfected into
IDH4 cells. SEAP activity was shown to parallel telomerase activity
in the different clones, whereas no significant fluctuation of SEAP
activity was observed with the control plasmid. These results
indicate that a fragment of approximately 2.5 kb of hTERT promoter
sequence (pGRN245) contains sufficient sequence elements to support
both activation and repression in response to proliferation and/or
growth arrest stimuli that control telomerase activity in IDH4
cells. Two clones, ID245-1 and ID245-16 whose SEAP profile closely
matched telomerase activity during drug treatment, were selected
and expanded for high throughput screening of small molecule
activators of telomerase.
Example 6
hTERT Promoter Sequences Driving a .beta.-Galactosidase Reporter
Gene to Identify Biological Regulators of hTERT and Telomerase
activity.
[0212] The invention also provides constructs and promoter-based
assays to identify biological modulators of hTERT and telomerase
activity. An exemplary construct of this aspect of the invention is
pGRN353 containing a BglII-HindIII fragment from pGRN297 with
approximately 2.5 kb of hTERT promoter sequences cloned into the
BglII-HindIII sites of B-gal-Basic (Clontech). pGRN353 or similar
constructs are re-introduced into BJ cells by co-transfection with
a plasmid containing a hygromycin gene as selection marker. Clonal
cell lines and/or mass populations are established and used to
screen retroviral based cDNA libraries for genes or fragments of
genes that can activate the hTERT promoter. pGRN353 or similar
constructs are also re-introduced into 143B and 293 cells to screen
retroviral libraries to identify sequences that can repress the
hTERT promoter.
Example 7
Identifying Trans-Acting Transcriptional Regulatory Elements
[0213] The promoter-reporter (and other) vectors of the invention
are also used to identify trans-acting transcriptional regulatory
elements. As noted supra, plasmids in which reporter genes are
operably linked to hTERT promoter sequences are extremely useful
for identification of trans-acting transcriptional modulatory
agents and for the screening of potential hTERT promoter-modulating
drugs (including biological agents and small molecules, as
discussed above). Both transient and stable transfection techniques
can be used. In one embodiment, stable transformants of pGRN148 are
made in telomerase negative and telomerase positive cells by
cotransfection with a eukaryotic selectable marker (such as neo),
according to Ausubel, supra.
[0214] The resulting cell lines are used for screening of putative
telomerase trans-acting (e.g., promoter sequence binding)
transcriptional modulatory agents, e.g., by comparing
hTERT-promoter-driven expression in the presence and absence of the
test compound (the putative trans-acting transcriptional modulating
agent). Additional promoter-reporter vectors (including the
constructs described herein, as variations thereof) are similarly
used to identify and isolate trans-acting factors binding to
cis-acting transcriptional regulatory elements, such as, Myc, Sp1,
TATA box binding protein, AP-1, CREB, CAAT binding factor and
factors binding to hormone response elements (e.g., GRE). The
identification and isolation of such trans-acting regulatory
sequences provide for further methods and reagents for modulating
the transcription and translation of telomerase.
Example 8
c-Myc Acts as a Potent Activator of the TERT Promoter by Direct
Interaction with Cis-Acting Regulatory Sequences
[0215] Use of recombinant constructs comprising TERT promoter
sequences of the invention has, for the first time, demonstrated
that c-Myc acts as a potent activator of telomerase activity by
direct interaction with cis-acting regulatory sequences in the TERT
promoter. Significantly, the studies of the invention also show
that transcriptional activation of the hTERT promoter by c-Myc can
be abrogated by deletion or mutation of a single cis-acting
regulatory sequence, the "Myc/Max binding site."
[0216] To determine whether experimental induction of c-Myc can
lead to the de novo activation of telomerase in primary human
cells, pre-senescent IMR90 cultures engineered to express the mouse
ecotropic receptor (Serrano et al. (1997) Cell 88, 593-602) were
transduced with either the pBABE retroviral vector or one encoding
a hormone inducible c-Myc-Estrogen Receptor (cMycER) fusion protein
(Eilers et al., 1989 Nature 340, 66-68; Littlewood (1995) Nuc.
Acids Res: 23, 1686-1690). IMR90 cultures do not possess detectable
telomerase activity or TERT gene expression (Nakamura et al., 1997;
Meyerson et al., 1997).
[0217] Retroviral Infection The mouse ecotropic receptor was
transduced into IMR90 fibroblasts and all subsequent transductions
with ecotropic retrovirus were carried out according to Serrano et
al. (1997). pBABE-MycER and pBABE vector control viruses were
harvested from stable expressing 2 cell lines.
[0218] Cell Culture: IMR90 cells were grown in Dulbecco's Modified
Eagle Medium (DMEM) (Gibco/BRL) supplemented with 10% fetal bovine
serum (FBS), 0.29 mg/niL L-glutamine, 0.03% penicillin and
streptomycin, and 25 ug/mL gentamycin sulfate. For the Myc
induction studies in IMR90 cells, MycER transduced cells were
exposed to 2 uM 4-OHT for 24, 48 and 72 hours. For the promoter
studies NIH 3T3 cells were exposed to 1 uM 4-OHT for 24 and 72
hours. In all cases uninduced controls were treated with an
equivalent volume of ethanol, the solvent for 4-OHT.
[0219] Telomerase Assays: Telomerase activity was measured by a
modified telomerase repeat amplification protocol using the TRAPeze
telomerase detection kit (Oncor, Gaithersburg, Md.) (Kim et al.,
1994). Genomic DNA was obtained from vector control or MycER
transduced IMR90 fibroblasts. TRAP assays were performed on lysates
equivalent to 1000 cells for all samples, with 293 T cell lysates
serving as a positive control for telomerase activity. PCR internal
controls from each experiment were amplified equally. Inactivation
of lysate was for 5 minutes at 85.degree. C. prior to the TRAP
assay.
[0220] In the MycER system, the Myc moiety exists in a latent form
bound in a complex with HSP-90 through its ER fusion (Eilers et
al., 1989; Littlewood et al., 1995). Upon treatment with
4-hydroxy-tamoxifen (4-OHT), the MycER protein is liberated from
HSP-90, resulting in a Myc over-expression phenotype (Eilers et
al., 1989; Littlewood et al., 1995). Employing this cell culture
system, 4-OHT treatment of MycER-transduced IMR90 cultures resulted
in the marked and sustained activation of telomerase to a level at
or above that detected in lysates derived from an equivalent number
of telomerase-positive 293T tumor cells, as assayed by the
sensitive TRAP assay. In contrast, untreated MycER-transduced or
4-OHT-treated pBABE-transduced IR90 cultures remained telomerase
negative. Western blot analysis confirmed abundant MycER protein
levels in the MycER-transduced cultures in the presence or absence
of 4-OHT.
[0221] Notably, enforced expression of oncogenes such as H-Ras, and
cellular modulators of the Rb and p53 pathways (E7, cyclin D1,
Mdm2, dominant-negative p53) have not been found to be capable of
influencing telomerase activity in IMR90 cells (Wang et al.,
1998).
c-Myc Enhancement of hTERT Transcription Requires the Presence of a
Cis-Acting Promoter Element: the Proximal Myc-Binding "E-Box"
[0222] hTRT Reporter Construction: The pGRN150 (E box deleted),
pGRN261 (2.5 kbp hTRT reporter) are described above. NIH 3T3 cells
were grown in Dulbecco's Modified Eagle Medium (DMEM) (Gibco/BRL)
supplemented with 10% fetal bovine serum (FBS), 0.29 mg/mL
L-glutamine, 0.03% penicillin and streptomycin, and 25 ug/mL
gentamycin sulfate. NIH 3T3 cells were transfected using
LipoFectamine reagent (Life Sciences) with 100 ng of a promoter
reporter, and 200 ng of pCMX-.beta.-Galactosidase which served as
an internal control for transfection efficiency. Transfected cells
were allowed to recover for 6 hours in complete DMEM and then
treated with 1 uM 4-OHT or ethanol for 36 hours prior to analysis
of secreted alkaline phosphatase activity using the Great EscAPe
assay (Clontech). .beta.-galactosidase activity was assayed by
incubation of whole cell extracts with 400 ug/ml ONPG in buffer
containing 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl and 1 mM MgSO4
and relative transfection efficiencies determined by reading
absorbance at 415 nm.
[0223] Expression of endogenous hTRT following exposure to 4-OHT
(or solvent alone) was measured at various times in the presence of
1_M cyclohexamide in IMR90 fibroblasts transduced with MycER.
Reverse transcription of RNA derived from each sample followed by
PCR and Southern blotting of the amplified products was carried out
as described above. Glyceraldehyde-6-phosphate dehydrogenase
(GAPDH) was amplified from the same reverse transcription products
as an internal semi-quantitative control and visualized by ethidium
bromide staining. Low level expression of hTRT mRNA was detected in
uninduced samples after very long exposures; however, the level of
hTRT mRNA did not change over time in the uninduced samples.
[0224] The activity of the hTERT promoter was dramatically enhanced
by c-Myc-ER in NIH 3T3 cells. The ability of c-Myc-ER to enhance
hTERT promoter activity was dependent upon sequences in the hTERT
promoter that included an evolutionarily conserved Myc binding site
(E-box). To determine whether the increased telomerase activity
induced by activation of c-Myc-ER was a result of increased
transcription of the hTERT gene we initially examined the effect of
4-OHT induction of c-Myc-ER activity upon hTERT promoter sequences
placed upstream of the secreted alkaline phosphatase reporter gene.
The hTERT promoter contains two putative Myc-binding sites
positioned at -242 and -34 relative to the ATG initiation
codon.
[0225] NIH 3T3 cells engineered to express c-Myc-ER stably were
transfected with constructs containing a secreted alkaline
phosphatase reporter under the control of a 2.5 kb fragment of the
hTERT promoter, a 2.5 kb fragment of the hTERT promoter lacking the
proximal E-box, or a promoterless reporter construct. The basal
activity of the wild-type hTERT promoter and that of the hTERT
promoter lacking the proximal E-box were equivalent and
approximately 3 fold higher than the activity of the promoterless
reporter. Induction of c-Myc-ER activity with 1_M 4-OHT enhanced
the activity of the 2.5 kb hTERT promoter approximately 10 fold. By
contrast, the activity of the promoter lacking the proximal E-box
was not significantly affected by induction of c-Myc-ER. Similarly,
the promoterless reporter was not affected by induction of
c-Myc-ER. To further confirm the role of the proximal E-box in
regulating the hTERT promoter we tested the effect of changing the
E-box from CACGTG to CACTCA. The mutation in the E-box reduced the
promoter activity due to 4-OHT stimulation to the equivalent of the
E-box deletion and 10-fold below the wild-type promoter. This
demonstrates that c-Myc-ER is not able to significantly activate an
hTERT promoter with an attenuated E-box at -34 and that the E-box
at -242 is not able to significantly mediate c-Myc activation.
These results suggest that the ability of c-Myc to stimulate the
hTERT promoter is mediated via the -34 E-box.
hTERT is a Direct Target of c-Myc Regulated Transcription
[0226] To confirm the ability of c-Myc to stimulate transcription
of the hTERT gene directly, we assayed for hTERT gene expression in
MycER-transduced cultures of IM90 cells 0, 1, 3 and 9 hours
following the addition of 4-OHT. The cultures were treated with
cyclohexamide for 30 minutes prior to addition of 4-OHT to prevent
de novo protein synthesis. hTERT expression was undetectable at the
zero hour time point for the Myc transduced cultures. Pretreatment
of these cells with cyclohexamide alone had no effect on expression
of hTERT mRNA. Induction of the c-Myc-ER activity by treatment with
2 M 4-OHT in the presence of I cyclohexamide led to a rapid
increase in expression of hTERT message.
[0227] hTERT expression was detected by 1 hour post-induction, and
increased 3 and 9 hours post induction. By contrast, cells treated
with solvent alone were not induced to express hTERT. Furthermore,
the expression level of GAPDH was similar at all time points in
cells treated with 4-OHT or solvent alone. These observations
strongly suggest that Myc acts directly upon the hTERT promoter to
enhance transcription of the hTERT gene.
Lack of Equivalence of Myc and TERT in Cellular Transformation
[0228] To further explore the functional implications of Myc
induction of telomerase activity in primary cells, we examined
whether TERT could substitute for c-Myc as an immortalizing agent
in the rat embryonic fibroblast (REF) cooperation assay. In this
assay, co-transfection of Myc and activated RAS (H-RASG12V) effects
the malignant transformation of early passage REFs. This
cooperative activity can be quantified by monitoring the number of
transformed foci appearing in the monolayer 7 to 10 days
post-transfection. In two separate experiments, various
combinations of the expression constructs encoding c-myc,
H-RASG12V, TERT, or vector control were introduced into early
passage REFs. Strong cooperative activity was observed in the RAS
and Myc co-transfections as evidenced by an average of 34 foci per
10 cm plate; while Ras alone generated between 0 and 3 foci per
plate; consistent with previous findings that an immortalizing
agent and activated RAS are required for efficient transformation
of primary rodent cells (Land et al., 1983). By contrast,
co-transfection of TERT and RAS did not generate transformed foci
counts above that scored for the RAS alone controls. These results
indicate that expression of hTERT is insufficient to account for
the immortalizing function of Myc in a rat embryonic fibroblast
(REF) cooperation assay.
[0229] Effect of c-Myc-ER on the activity of the hTRT promoter in
NIH3T3 cells was determined by detection of secreted alkaline
phosphatase activity. Cells were treated with 4-OHT for 36 hours.
Uninduced cells were treated with solvent alone for 36 hours. The
detected secreted alkaline phosphatase activity was corrected for
transfection efficiency in each case using
.beta.-galactosidase.
Example 9
Cloning of Mouse TERT Promoter
[0230] The following example details the cloning of the mouse mTERT
promoter. mTERT Construction : A hybridization probe (nucleotides
1586-1970) of the mTERT cDNA (pGRN188) was used to identify a
recombinant phage (mTERT1) from a 129SV mouse genomic phage library
(Stratagene). An 8 kb HindIII fragment of mTERT 1 that hybridized
to the 1586-1970 probe was subcloned into pBluescript II
KS+(Stratagene) to generate clone B2.18. The regions encompassing
the initiator and promoter were sequenced. The sequence is provided
in FIG. 5. The sequence has been deposited as GenBank Accession No.
B2.18 AF121949.
[0231] The human and mouse promoter sequences were aligned using
the GAP program from the Wisconsin GCG package using a value of 48
for gap creation and a value of 3 for gap extension. Using a small
portion of the coding region (-450 bases) was found to improve the
initial alignment. See FIGS. 4A and 4B.
Conservation of Human and Mouse TERT Promoters
[0232] To determine whether the ability of c-Myc to enhance
telomerase activity was mediated through increased transcription of
the hTERT gene, we compared the sequences of the human and mouse
TERT promoters. Alignment of the first 300 bases of the human and
mouse promoters indicates a number of conserved regions (FIG. 4A).
In particular, the Myc/Max binding site (E-box) located at -34 of
the human promoter and at -32 of the mouse promoter, are highly
conserved, as discussed above. A second E-box was identified at
-242 of the human promoter; however, this site was not conserved in
the mouse promoter. These observations raised the possibility that
the conserved Myc binding site in particular might play a role in
the regulation of hTERT expression by c-Myc.
References
[0233] Bello-Femandez. (1993). Proc Natl Acad Sci U S A.
90,7804-8.
[0234] Bishop (1991). C.S.H. Symp. Quant. Biol. 56, 99-107.
[0235] Bodnar (1996). Expt. Cell Res. 228, 58-64.
[0236] Bodnar (1998). Science 279,349-52.
[0237] Counter (1992). EMBO J. 11, 1921-1929.
[0238] Eilers (1989). Nature 340, 66-68.
[0239] Eilers (1991). EMBO J. 10,133-41.
[0240] Fujimoto.(1997). Biochem. & Biophys. Res. Comm. 241,
775-781.
[0241] Galaktionov (1996). Nature 382, 511-7.
[0242] Grandori (1996). EMBO J. 15,4344-57.
[0243] Grandori (1997). TIBS 22, 177-181.
[0244] Greenberg, (1998) Oncogene 16,1723-30.
[0245] Harley (1990). Nature 345, 458-460.
[0246] Harrington. (1997). Genes Dev. 11, 3109-3115.
[0247] Hastie (1990) Nature 346, 866-868.
[0248] Hiyama (1995). Nature Med. 1, 249-255.
[0249] Kilian (1997). Hum. Mol. Genet. 6, 2011-2019.
[0250] Kim, (1994) Science 266,2011-2015.
[0251] Kiyono (1998). Nature 396, 84-88.
[0252] Klingelhutz (1996) Nature 380, 79-82.
[0253] Land (1983) Nature 304, 596-602.
[0254] Lee (1997) Proc Natl Acad Sci U S A 94,12886-91.
[0255] Marhin (1997) Oncogene 14, 2825-34.
[0256] Meyerson (1997) Cell 90, 785-795.
[0257] Nakamura (1997) Science 277, 955-959.
[0258] Nakayama (1998) Nature Genet. 18, 65-68.
[0259] Reed (1986) Proc. Natl. Acad. Sci USA 83, 3982-3986.
[0260] Schreiber-Agus (1995) Cell 80, 777-786.
[0261] Smith (1998) Science 282,1484-7.
[0262] van Steensel (1997) Nature 385,740-3.
[0263] Vaziri (1998) Curr. Biol. 8, 279-282.
[0264] Wagner. (1993) Cell Growth Differ. 4,879-83.
[0265] Wang. (1998) Genes Dev. 12, 1769-74.
[0266] Wright. (1995) Trends Cell Biol. 5, 293-297.
[0267] Xu (1997) Oncogene 15, 2589-2596.
Sequence CWU 1
1
23 1 15418 DNA Homo sapiens Human TERT promoter 1 gcggccgcga
gctctaatac gactcactat agggcgtcga ctcgatcaat ggaagatgag 60
gcattgccga agaaaagatt aatggatttg aacacacagc aacagaaact acatgaagtg
120 aaacacagga aaaaaaagat aaagaaacga aaagaaaagg gcatcagtga
gcttcagcag 180 aagttccatc ggccttacat atgtgtaagc agaggccctg
taggagcaga ggcaggggga 240 aaatacttta agaaataatg tctaaaagtt
tttcaaatat gaggaaaaac ataaaaccac 300 agatccaaga agctcaacaa
aacaaagcac aagaaacagg aagaaattaa aagttatatc 360 acagtcaaat
tgctgaaaac cagcaacaaa gagaatatct taagagtatc agaggaaaag 420
agattaatga caggccaaga aacaatgaaa acaatacaga tttcttgtag gaaacacaag
480 acaaaagaca ttttttaaaa ccaaaaggaa aaaaaatgct acattaaaat
gttttttacc 540 cactgaaagt atatttcaaa acatatttta ggccaggctt
ggtggctcac acctgtaatc 600 ccagcacttt gggaggccaa ggtgggtgga
tcgcttaagg tcaggagttc gagaccagcc 660 tggccaatat agcgaaaccc
catctgtact aaaaacacaa aaattagctg ggtgtggtga 720 cacatgcctg
taatcccagg tactcaggag gctaaggcag gagaattgct tgaactggga 780
ggcagaggtg gtgagccaag attgcaccag tgcactccag ccttggtgac agagtgaaac
840 tccatctcaa aaacaaacaa acaaaataca tatacataaa tatatatgca
catatatata 900 catatataaa tatatataca catatataaa tctatataca
tatatacata tatacacata 960 tataaatcta tatacatata tatacatata
taatatattt acatatataa atatatacat 1020 atataaatat acatatataa
atacatatat aaatatacat atataaatat acatatataa 1080 atatacatat
ataaatatat acatatataa atatacatat ataaatatat atacatatat 1140
aaatatataa atatacaagt atatacaaat atatacatat ataaatgtat atacgtatat
1200 acatatatat ataaatatat aaaaaaactt ttggctgggc acctttccaa
atctcatggc 1260 acatataagt ctcatggtaa cctcaaataa aaaaacatat
aacagataca ccaaaaataa 1320 aaaccaataa attaaatcat gccaccagaa
gaaattacct tcactaaaag gaacacagga 1380 aggaaagaaa gaaggaagag
aagaccatga aacaaccaga aaacaaacaa caaaacagca 1440 ggagtaattc
ctgacttatc aataataatg ctgggtgtaa atggactaaa ctctccaatc 1500
aaaagacata gagtggctga atggacgaaa aaaacaagac tcaataatct gttgcctaca
1560 agaatatact tcacctataa agggacacat agactgaaaa taaaaggaag
gaaaaatatt 1620 ctatgcaaat ggaaaccaaa aaaagaacag aactagctac
acttatatca gacaaaatag 1680 atttcaagac aaaaagtaca aaaagagaca
aagtaattat ataataataa agcaaaaaga 1740 tataacaatt gtgaatttat
atgcgcccaa cactgggaca cccagatata tacagcaaat 1800 attattagaa
ctaaggagag agagagatcc ccatacaata atagctggag acttcacccc 1860
gcttttagca ttggacagat catccagaca gaaaatcaac caaaaaattg gacttaatct
1920 ataatataga acaaatgtac ctaattgatg tttacaagac atttcatcca
gtagttgcag 1980 aatatgcatt ttttcctcag catatggatc attctcaagg
atagaccata tattaggcca 2040 cagaacaagc cattaaaaat tcaaaaaaat
tgagccaggc atgatggctt atgcttgtaa 2100 ttacagcact ttggggaggg
tgaggtggga ggatgtcttg agtacaggag tttgagacca 2160 gcctgggcaa
aatagtgaga ccctgtctct acaaactttt ttttttaatt agccaggcat 2220
agtggtgtgt gcctgtagtc ccagctactt aggaggctga agtgggagga tcacttgagc
2280 ccaagagttc aaggctacgg tgagccatga ttgcaacacc acacaccagc
cttggtgaca 2340 gaatgagacc ctgtctcaaa aaaaaaaaaa aaaattgaaa
taatataaag catcttctct 2400 ggccacagtg gaacaaaacc agaaatcaac
aacaagagga attttgaaaa ctatacaaac 2460 acatgaaaat taaacaatat
acttctgaat aaccagtgag tcaatgaaga aattaaaaag 2520 gaaattgaaa
aatttattta agcaaatgat aacggaaaca taacctctca aaacccacgg 2580
tatacagcaa aagcagtgct aagaaggaag tttatagcta taagcagcta catcaaaaaa
2640 gtagaaaagc caggcgcagt ggctcatgcc tgtaatccca gcactttggg
aggccaaggc 2700 gggcagatcg cctgaggtca ggagttcgag accagcctga
ccaacacaga gaaaccttgt 2760 cgctactaaa aatacaaaat tagctgggca
tggtggcaca tgcctgtaat cccagctact 2820 cgggaggctg aggcaggata
accgcttgaa cccaggaggt ggaggttgcg gtgagccggg 2880 attgcgccat
tggactccag cctgggtaac aagagtgaaa ccctgtctca agaaaaaaaa 2940
aaaagtagaa aaacttaaaa atacaaccta atgatgcacc ttaaagaact agaaaagcaa
3000 gagcaaacta aacctaaaat tggtaaaaga aaagaaataa taaagatcag
agcagaaata 3060 aatgaaactg aaagataaca atacaaaaga tcaacaaaat
taaaagttgg ttttttgaaa 3120 agataaacaa aattgacaaa cctttgccca
gactaagaaa aaaggaaaga agacctaaat 3180 aaataaagtc agagatgaaa
aaagagacat tacaactgat accacagaaa ttcaaaggat 3240 cactagaggc
tactatgagc aactgtacac taataaattg aaaaacctag aaaaaataga 3300
taaattccta gatgcataca acctaccaag attgaaccat gaagaaatcc aaagcccaaa
3360 cagaccaata acaataatgg gattaaagcc ataataaaaa gtctcctagc
aaagagaagc 3420 ccaggaccca atggcttccc tgctggattt taccaatcat
ttaaagaaga atgaattcca 3480 atcctactca aactattctg aaaaatagag
gaaagaatac ttccaaactc attctacatg 3540 gccagtatta ccctgattcc
aaaaccagac aaaaacacat caaaaacaaa caaacaaaaa 3600 aacagaaaga
aagaaaacta caggccaata tccctgatga atactgatac aaaaatcctc 3660
aacaaaacac tagcaaacca aattaaacaa caccttcgaa agatcattca ttgtgatcaa
3720 gtgggattta ttccagggat ggaaggatgg ttcaacatat gcaaatcaat
caatgtgata 3780 catcatccca acaaaatgaa gtacaaaaac tatatgatta
tttcacttta tgcagaaaaa 3840 gcatttgata aaattctgca cccttcatga
taaaaaccct caaaaaacca ggtatacaag 3900 aaacatacag gccaggcaca
gtggctcaca cctgcgatcc cagcactctg ggaggccaag 3960 gtgggatgat
tgcttgggcc caggagtttg agactagcct gggcaacaaa atgagacctg 4020
gtctacaaaa aactttttta aaaaattagc caggcatgat ggcatatgcc tgtagtccca
4080 gctagtctgg aggctgaggt gggagaatca cttaagccta ggaggtcgag
gctgcagtga 4140 gccatgaaca tgtcactgta ctccagccta gacaacagaa
caagacccca ctgaataaga 4200 agaaggagaa ggagaaggga gaaaggaggg
agaagggagg aggaggagaa ggaggaggtg 4260 gaggagaagt ggaaggggaa
ggggaaggga aagaggaaga agaagaaaca tatttcaaca 4320 taataaaagc
cctatatgac agaccgaggt agtattatga ggaaaaactg aaagcctttc 4380
ctctaagatc tggaaaatga caagggccca ctttcaccac tgtgattcaa catagtacta
4440 gaagtcctag ctagagcaat cagataagag aaagaaataa aaggcatcca
aactggaaag 4500 gaagaagtca aattatcctg tttgcagatg atatgatctt
atatctggaa aagacttaag 4560 acaccactaa aaaactatta gagctgaaat
ttggtacagc aggatacaaa atcaatgtac 4620 aaaaatcagt agtatttcta
tattccaaca gcaaacaatc tgaaaaagaa accaaaaaag 4680 cagctacaaa
taaaattaaa cagctaggaa ttaaccaaag aagtgaaaga tctctacaat 4740
gaaaactata aaatattgat aaaagaaatt gaagagggca caaaaaaaga aaagatattc
4800 catgttcata gattggaaga ataaatactg ttaaaatgtc catactaccc
aaagcaattt 4860 acaaattcaa tgcaatccct attaaaatac taatgacgtt
cttcacagaa atagaagaaa 4920 caattctaag atttgtacag aaccacaaaa
gacccagaat agccaaagct atcctgacca 4980 aaaagaacaa aactggaagc
atcacattac ctgacttcaa attatactac aaagctatag 5040 taacccaaac
tacatggtac tggcataaaa acagatgaga catggaccag aggaacagaa 5100
tagagaatcc agaaacaaat ccatgcatct acagtgaact catttttgac aaaggtgcca
5160 agaacatact ttggggaaaa gataatctct tcaataaatg gtgctggagg
aactggatat 5220 ccatatgcaa aataacaata ctagaactct gtctctcacc
atatacaaaa gcaaatcaaa 5280 atggatgaaa ggcttaaatc taaaacctca
aactttgcaa ctactaaaag aaaacaccgg 5340 agaaactctc caggacattg
gagtgggcaa agacttcttg agtaattccc tgcaggcaca 5400 ggcaaccaaa
gcaaaaacag acaaatggga tcatatcaag ttaaaaagct tctgcccagc 5460
aaaggaaaca atcaacaaag agaagagaca acccacagaa tgggagaata tatttgcaaa
5520 ctattcatct aacaaggaat taataaccag tatatataag gagctcaaac
tactctataa 5580 gaaaaacacc taataagctg attttcaaaa ataagcaaaa
gatctgggta gacatttctc 5640 aaaataagtc atacaaatgg caaacaggca
tctgaaaatg tgctcaacac cactgatcat 5700 cagagaaatg caaatcaaaa
ctactatgag agatcatctc accccagtta aaatggcttt 5760 tattcaaaag
acaggcaata acaaatgcca gtgaggatgt ggataaaagg aaacccttgg 5820
acactgttgg tgggaatgga aattgctacc actatggaga acagtttgaa agttcctcaa
5880 aaaactaaaa ataaagctac catacagcaa tcccattgct aggtatatac
tccaaaaaag 5940 ggaatcagtg tatcaacaag ctatctccac tcccacattt
actgcagcac tgttcatagc 6000 agccaaggtt tggaagcaac ctcagtgtcc
atcaacagac gaatggaaaa agaaaatgtg 6060 gtgcacatac acaatggagt
actacgcagc cataaaaaag aatgagatcc tgtcagttgc 6120 aacagcatgg
ggggcactgg tcagtatgtt aagtgaaata agccaggcac agaaagacaa 6180
acttttcatg ttctccctta cttgtgggag caaaaattaa aacaattgac atagaaatag
6240 aggagaatgg tggttctaga ggggtggggg acagggtgac tagagtcaac
aataatttat 6300 tgtatgtttt aaaataacta aaagagtata attgggttgt
ttgtaacaca aagaaaggat 6360 aaatgcttga aggtgacaga taccccattt
accctgatgt gattattaca cattgtatgc 6420 ctgtatcaaa atatctcatg
tatgctatag atataaaccc tactatatta aaaattaaaa 6480 ttttaatggc
caggcacggt ggctcatgtc cataatccca gcactttggg aggccgaggc 6540
ggtggatcac ctgaggtcag gagtttgaaa ccagtctggc caccatgatg aaaccctgtc
6600 tctactaaag atacaaaaat tagccaggcg tggtggcaca tacctgtagt
cccaactact 6660 caggaggctg agacaggaga attgcttgaa cctgggaggc
ggaggttgca gtgagccgag 6720 atcatgccac tgcactgcag cctgggtgac
agagcaagac tccatctcaa aacaaaaaca 6780 aaaaaaagaa gattaaaatt
gtaattttta tgtaccgtat aaatatatac tctactatat 6840 tagaagttaa
aaattaaaac aattataaaa ggtaattaac cacttaatct aaaataagaa 6900
caatgtatgt ggggtttcta gcttctgaag aagtaaaagt tatggccacg atggcagaaa
6960 tgtgaggagg gaacagtgga agttactgtt gttagacgct catactctct
gtaagtgact 7020 taattttaac caaagacagg ctgggagaag ttaaagaggc
attctataag ccctaaaaca 7080 actgctaata atggtgaaag gtaatctcta
ttaattacca ataattacag atatctctaa 7140 aatcgagctg cagaattggc
acgtctgatc acaccgtcct ctcattcacg gtgctttttt 7200 tcttgtgtgc
ttggagattt tcgattgtgt gttcgtgttt ggttaaactt aatctgtatg 7260
aatcctgaaa cgaaaaatgg tggtgatttc ctccagaaga attagagtac ctggcaggaa
7320 gcaggtggct ctgtggacct gagccacttc aatcttcaag ggtctctggc
caagacccag 7380 gtgcaaggca gaggcctgat gacccgagga caggaaagct
cggatgggaa ggggcgatga 7440 gaagcctgcc tcgttggtga gcagcgcatg
aagtgccctt atttacgctt tgcaaagatt 7500 gctctggata ccatctggaa
aaggcggcca gcgggaatgc aaggagtcag aagcctcctg 7560 ctcaaaccca
ggccagcagc tatggcgccc acccgggcgt gtgccagagg gagaggagtc 7620
aaggcacctc gaagtatggc ttaaatcttt ttttcacctg aagcagtgac caaggtgtat
7680 tctgagggaa gcttgagtta ggtgccttct ttaaaacaga aagtcatgga
agcacccttc 7740 tcaagggaaa accagacgcc cgctctgcgg tcatttacct
ctttcctctc tccctctctt 7800 gccctcgcgg tttctgatcg ggacagagtg
acccccgtgg agcttctccg agcccgtgct 7860 gaggaccctc ttgcaaaggg
ctccacagac ccccgccctg gagagaggag tctgagcctg 7920 gcttaataac
aaactgggat gtggctgggg gcggacagcg acggcgggat tcaaagactt 7980
aattccatga gtaaattcaa cctttccaca tccgaatgga tttggatttt atcttaatat
8040 tttcttaaat ttcatcaaat aacattcagg agtgcagaaa tccaaaggcg
taaaacagga 8100 actgagctat gtttgccaag gtccaaggac ttaataacca
tgttcagagg gatttttcgc 8160 cctaagtact ttttattggt tttcataagg
tggcttaggg tgcaagggaa agtacacgag 8220 gagaggactg ggcggcaggg
ctatgagcac ggcaaggcca ccggggagag agtccccggc 8280 ctgggaggct
gacagcagga ccactgaccg tcctccctgg gagctgccac attgggcaac 8340
gcgaaggcgg ccacgctgcg tgtgactcag gaccccatac cggcttcctg ggcccaccca
8400 cactaaccca ggaagtcacg gagctctgaa cccgtggaaa cgaacatgac
ccttgcctgc 8460 ctgcttccct gggtgggtca agggtaatga agtggtgtgc
aggaaatggc catgtaaatt 8520 acacgactct gctgatgggg accgttcctt
ccatcattat tcatcttcac ccccaaggac 8580 tgaatgattc cagcaacttc
ttcgggtgtg acaagccatg acaacactca gtacaaacac 8640 cactctttta
ctaggcccac agagcacggc ccacacccct gatatattaa gagtccagga 8700
gagatgaggc tgctttcagc caccaggctg gggtgacaac agcggctgaa cagtctgttc
8760 ctctagacta gtagaccctg gcaggcactc ccccagattc tagggcctgg
ttgctgcttc 8820 ccgagggcgc catctgccct ggagactcag cctggggtgc
cacactgagg ccagccctgt 8880 ctccacaccc tccgcctcca ggcctcagct
tctccagcag cttcctaaac cctgggtggg 8940 ccgtgttcca gcgctactgt
ctcacctgtc ccactgtgtc ttgtctcagc gacgtagctc 9000 gcacggttcc
tcctcacatg gggtgtctgt ctccttcccc aacactcaca tgcgttgaag 9060
ggaggagatt ctgcgcctcc cagactggct cctctgagcc tgaacctggc tcgtggcccc
9120 cgatgcaggt tcctggcgtc cggctgcacg ctgacctcca tttccaggcg
ctccccgtct 9180 cctgtcatct gccggggcct gccggtgtgt tcttctgttt
ctgtgctcct ttccacgtcc 9240 agctgcgtgt gtctctgtcc gctagggtct
cggggttttt ataggcatag gacgggggcg 9300 tggtgggcca gggcgctctt
gggaaatgca acatttgggt gtgaaagtag gagtgcctgt 9360 cctcacctag
gtccacgggc acaggcctgg ggatggagcc cccgccaggg acccgccctt 9420
ctctgcccag cacttttctg cccccctccc tctggaacac agagtggcag tttccacaag
9480 cactaagcat cctcttccca aaagacccag cattggcacc cctggacatt
tgccccacag 9540 ccctgggaat tcacgtgact acgcacatca tgtacacact
cccgtccacg accgaccccc 9600 gctgttttat tttaatagct acaaagcagg
gaaatccctg ctaaaatgtc ctttaacaaa 9660 ctggttaaac aaacgggtcc
atccgcacgg tggacagttc ctcacagtga agaggaacat 9720 gccgtttata
aagcctgcag gcatctcaag ggaattacgc tgagtcaaaa ctgccacctc 9780
catgggatac gtacgcaaca tgctcaaaaa gaaagaattt caccccatgg caggggagtg
9840 gttggggggt taaggacggt gggggcagca gctgggggct actgcacgca
ccttttacta 9900 aagccagttt cctggttctg atggtattgg ctcagttatg
ggagactaac cataggggag 9960 tggggatggg ggaacccgga ggctgtgcca
tctttgccat gcccgagtgt cctgggcagg 10020 ataatgctct agagatgccc
acgtcctgat tcccccaaac ctgtggacag aacccgcccg 10080 gccccagggc
ctttgcaggt gtgatctccg tgaggaccct gaggtctggg atccttcggg 10140
actacctgca ggcccgaaaa gtaatccagg ggttctggga agaggcgggc aggagggtca
10200 gaggggggca gcctcaggac gatggaggca gtcagtctga ggctgaaaag
ggagggaggg 10260 cctcgagccc aggcctgcaa gcgcctccag aagctggaaa
aagcggggaa gggaccctcc 10320 acggagcctg cagcaggaag gcacggctgg
cccttagccc accagggccc atcgtggacc 10380 tccggcctcc gtgccatagg
agggcactcg cgctgccctt ctagcatgaa gtgtgtgggg 10440 atttgcagaa
gcaacaggaa acccatgcac tgtgaatcta ggattatttc aaaacaaagg 10500
tttacagaaa catccaagga cagggctgaa gtgcctccgg gcaagggcag ggcaggcacg
10560 agtgatttta tttagctatt ttattttatt tacttacttt ctgagacaga
gttatgctct 10620 tgttgcccag gctggagtgc agcggcatga tcttggctca
ctgcaacctc cgtctcctgg 10680 gttcaagcaa ttctcgtgcc tcagcctccc
aagtagctgg gatttcaggc gtgcaccacc 10740 acacccggct aattttgtat
ttttagtaga gatgggcttt caccatgttg gtcaggctga 10800 tctcaaaatc
ctgacctcag gtgatccgcc cacctcagcc tcccaaagtg ctgggattac 10860
aggcatgagc cactgcacct ggcctattta accattttaa aacttccctg ggctcaagtc
10920 acacccactg gtaaggagtt catggagttc aatttcccct ttactcagga
gttaccctcc 10980 tttgatattt tctgtaattc ttcgtagact ggggatacac
cgtctcttga catattcaca 11040 gtttctgtga ccacctgtta tcccatggga
cccactgcag gggcagctgg gaggctgcag 11100 gcttcaggtc ccagtggggt
tgccatctgc cagtagaaac ctgatgtaga atcagggcgc 11160 gagtgtggac
actgtcctga atctcaatgt ctcagtgtgt gctgaaacat gtagaaatta 11220
aagtccatcc ctcctactct actgggattg agccccttcc ctatcccccc ccaggggcag
11280 aggagttcct ctcactcctg tggaggaagg aatgatactt tgttattttt
cactgctggt 11340 actgaatcca ctgtttcatt tgttggtttg tttgttttgt
tttgagaggc ggtttcactc 11400 ttgttgctca ggctggaggg agtgcaatgg
cgcgatcttg gcttactgca gcctctgcct 11460 cccaggttca agtgattctc
ctgcttccgc ctcccatttg gctgggatta caggcacccg 11520 ccaccatgcc
cagctaattt tttgtatttt tagtagagac gggggtgggg gtggggttca 11580
ccatgttggc caggctggtc tcgaacttct gacctcagat gatccacctg cctctgcctc
11640 ctaaagtgct gggattacag gtgtgagcca ccatgcccag ctcagaattt
actctgttta 11700 gaaacatctg ggtctgaggt aggaagctca ccccactcaa
gtgttgtggt gttttaagcc 11760 aatgatagaa tttttttatt gttgttagaa
cactcttgat gttttacact gtgatgacta 11820 agacatcatc agcttttcaa
agacacacta actgcaccca taatactggg gtgtcttctg 11880 ggtatcagcg
atcttcattg aatgccggga ggcgtttcct cgccatgcac atggtgttaa 11940
ttactccagc ataatcttct gcttccattt cttctcttcc ctcttttaaa attgtgtttt
12000 ctatgttggc ttctctgcag agaaccagtg taagctacaa cttaactttt
gttggaacaa 12060 attttccaaa ccgccccttt gccctagtgg cagagacaat
tcacaaacac agccctttaa 12120 aaaggcttag ggatcactaa ggggatttct
agaagagcga cccgtaatcc taagtattta 12180 caagacgagg ctaacctcca
gcgagcgtga cagcccaggg agggtgcgag gcctgttcaa 12240 atgctagctc
cataaataaa gcaatttcct ccggcagttt ctgaaagtag gaaaggttac 12300
atttaaggtt gcgtttgtta gcatttcagt gtttgccgac ctcagctaca gcatccctgc
12360 aaggcctcgg gagacccaga agtttctcgc cccttagatc caaacttgag
caacccggag 12420 tctggattcc tgggaagtcc tcagctgtcc tgcggttgtg
ccggggcccc aggtctggag 12480 gggaccagtg gccgtgtggc ttctactgct
gggctggaag tcgggcctcc tagctctgca 12540 gtccgaggct tggagccagg
tgcctggacc ccgaggctgc cctccaccct gtgcgggcgg 12600 gatgtgacca
gatgttggcc tcatctgcca gacagagtgc cggggcccag ggtcaaggcc 12660
gttgtggctg gtgtgaggcg cccggtgcgc ggccagcagg agcgcctggc tccatttccc
12720 accctttctc gacgggaccg ccccggtggg tgattaacag atttggggtg
gtttgctcat 12780 ggtggggacc cctcgccgcc tgagaacctg caaagagaaa
tgacgggcct gtgtcaagga 12840 gcccaagtcg cggggaagtg ttgcagggag
gcactccggg aggtcccgcg tgcccgtcca 12900 gggagcaatg cgtcctcggg
ttcgtcccca gccgcgtcta cgcgcctccg tcctcccctt 12960 cacgtccggc
attcgtggtg cccggagccc gacgccccgc gtccggacct ggaggcagcc 13020
ctgggtctcc ggatcaggcc agcggccaaa gggtcgccgc acgcacctgt tcccagggcc
13080 tccacatcat ggcccctccc tcgggttacc ccacagccta ggccgattcg
acctctctcc 13140 gctggggccc tcgctggcgt ccctgcaccc tgggagcgcg
agcggcgcgc gggcggggaa 13200 gcgcggccca gacccccggg tccgcccgga
gcagctgcgc tgtcggggcc aggccgggct 13260 cccagtggat tcgcgggcac
agacgcccag gaccgcgctt cccacgtggc ggagggactg 13320 gggacccggg
cacccgtcct gccccttcac cttccagctc cgcctcctcc gcgcggaccc 13380
cgccccgtcc cgacccctcc cgggtccccg gcccagcccc ctccgggccc tcccagcccc
13440 tccccttcct ttccgcggcc ccgccctctc ctcgcggcgc gagtttcagg
cagcgctgcg 13500 tcctgctgcg cacgtgggaa gccctggccc cggccacccc
cgcgatgccg cgcgctcccc 13560 gctgccgagc cgtgcgctcc ctgctgcgca
gccactaccg cgaggtgctg ccgctggcca 13620 cgttcgtgcg gcgcctgggg
ccccagggct ggcggctggt gcagcgcggg gacccggcgg 13680 ctttccgcgc
gctggtggcc cagtgcctgg tgtgcgtgcc ctgggacgca cggccgcccc 13740
ccgccgcccc ctccttccgc caggtgggcc tccccggggt cggcgtccgg ctggggttga
13800 gggcggccgg ggggaaccag cgacatgcgg agagcagcgc aggcgactca
gggcgcttcc 13860 cccgcaggtg tcctgcctga aggagctggt ggcccgagtg
ctgcagaggc tgtgcgagcg 13920 cggcgcgaag aacgtgctgg ccttcggctt
cgcgctgctg gacggggccc gcgggggccc 13980 ccccgaggcc ttcaccacca
gcgtgcgcag ctacctgccc aacacggtga ccgacgcact 14040 gcgggggagc
ggggcgtggg ggctgctgct gcgccgcgtg ggcgacgacg tgctggttca 14100
cctgctggca cgctgcgcgc tctttgtgct ggtggctccc agctgcgcct accaggtgtg
14160 cgggccgccg ctgtaccagc tcggcgctgc cactcaggcc cggcccccgc
cacacgctag 14220 tggaccccga aggcgtctgg gatgcgaacg ggcctggaac
catagcgtca gggaggccgg 14280 ggtccccctg ggcctgccag ccccgggtgc
gaggaggcgc gggggcagtg ccagccgaag 14340 tctgccgttg cccaagaggc
ccaggcgtgg cgctgcccct gagccggagc ggacgcccgt 14400 tgggcagggg
tcctgggccc acccgggcag gacgcgtgga ccgagtgacc gtggtttctg 14460
tgtggtgtca cctgccagac ccgccgaaga agccacctct ttggagggtg cgctctctgg
14520 cacgcgccac tcccacccat ccgtgggccg ccagcaccac gcgggccccc
catccacatc 14580 gcggccacca cgtccctggg acacgccttg tcccccggtg
tacgccgaga ccaagcactt 14640 cctctactcc tcaggcgaca aggagcagct
gcggccctcc ttcctactca gctctctgag 14700 gcccagcctg actggcgctc
ggaggctcgt ggagaccatc tttctgggtt ccaggccctg 14760 gatgccaggg
actccccgca ggttgccccg cctgccccag cgctactggc aaatgcggcc 14820
cctgtttctg gagctgcttg ggaaccacgc gcagtgcccc tacggggtgc tcctcaagac
14880 gcactgcccg ctgcgagctg cggtcacccc agcagccggt gtctgtgccc
gggagaagcc 14940 ccagggctct gtggcggccc ccgaggagga ggacacagac
ccccgtcgcc tggtgcagct 15000 gctccgccag cacagcagcc
cctggcaggt gtacggcttc gtgcgggcct gcctgcgccg 15060 gctggtgccc
ccaggcctct ggggctccag gcacaacgaa cgccgcttcc tcaggaacac 15120
caagaagttc atctccctgg ggaagcatgc caagctctcg ctgcaggagc tgacgtggaa
15180 gatgagcgtg cgggactgcg cttggctgcg caggagccca ggtgaggagg
tggtggccgt 15240 cgagggccca ggccccagag ctgaatgcag taggggctca
gaaaaggggg caggcagagc 15300 cctggtcctc ctgtctccat cgtcacgtgg
gcacacgtgg cttttcgctc aggacgtcga 15360 gtggacacgg tgatcgagtc
gactcccttt agtgagggtt aattgagctc gcggccgc 15418 2 7498 DNA Mus sp.
Mouse TERT promoter 2 aagcttccag caaaccagtt agagctgagt tgatgctctg
aagaagagaa aatgtagaga 60 cggtactgaa caaataatgt ctgggcaaac
ctcagacatg aaaatggaag acgtggaaat 120 ccagagaact ctgagggaaa
ataaaacaca actccaggtc atcacgggac tcatcaaact 180 gctgaggtgc
agccacagag aaaaatctta aaatagccta gaacgatgca tgacacataa 240
agcacagaga agacgaagct gagtctgtct tgtaggaaca acttgagaag acctaaacca
300 ctgcaatgag tgcattctgc taacttagaa tttgctaccc agttcagatc
caaaaagggt 360 ttcacaaagt tcaacacaaa acagtagcag gagtggctaa
gggggacaca ctgataggaa 420 ttcagagaag tagggaatgc tcatatgggg
acattacaaa atgtactttc atgttgctta 480 aatcatttta attgtcaacc
acatcaagct aaataatgct ttgaggttca taacatttgg 540 agattatgtc
tacactagca gagaaggcac caataacatc ccaattgcta gattctcata 600
gaatcatgag tcacaatggc agagacaggt tctgagagtg tgtccttgtt gtaaacagta
660 tgctctacaa actaagttgg ctgcaatatc actaggcagt gttgtcccat
aagacaacta 720 tcacatatgt ggtccagtga tgaccaaagc atcttttagc
attttgcaaa tgaagctcaa 780 atcgaatatg actaagctca tgcagtacaa
atcaaaggta cactgggata gtttaaaaga 840 tacatacttg tactggttag
ttttgtgtca gcttgacaca gctggagtta tcacagagaa 900 aagagcttca
gttgaggaaa ttcctccatg agatccagct atagggcatt ttctcaatta 960
gtgatcaagg ggggaaggcc ccttgtgggt gggaccatct ctgggctggt agtcttggtt
1020 ctataagaga gcaggctgag caagccagga gaagcaagcc agtaaagaac
atccctccat 1080 ggcttctgca tcagctcctg ctccctgacc tgcttgagtt
ccagttctaa cttctttcag 1140 tgatgaacag caatgtggaa atgaaagctg
aataaaccct ttcctcccca ttttgcttct 1200 tggtcatgat gtttgtgcag
gaatagaaac cctgactaag acaatactat aaaccctaaa 1260 agttgtaaac
caaacacatg tgtttccatt aagccatcgt agaacaataa gtactcaacc 1320
ccaagtcaca taactataat cccagccttt gaaaaccggg atcaggaatt caaggctagc
1380 ctcatctata tgtaagatta aagcctgttt gggctgcatg agactttgtt
tcaaaaaaaa 1440 aaaaaaaaaa gcaaacaggc aaaaacaaac acaagacaag
acagatgtaa aatgaaggag 1500 gggtagatgg gtcaagtaga aaatagcata
ggaaacgagt caagtataga agaggtggta 1560 gtaaccagat catgcagaag
gactcaaggc catctcctca cagtggctta ggtaggcctt 1620 cctctgctct
tgagcagggg cagagttgcc gctttaagga ggggatcagt cacctttaag 1680
aactgaaaag ctgaacagtc ttctcaagtc agaagccagt ggcttcatct tacacctctc
1740 ttccttccct tgctactcat attggatctg atgatttgcc caacttggaa
gaaacatctc 1800 ttctgaaggg tttcacagac accccatctt tccgagaaag
gaccgcatag gctggccatc 1860 cctgtgctta caaaaggaat aattaagaaa
cttaattcca taagcaaata caacctttcc 1920 aagccccaag tggatgattt
tatcttactg tttttttata tctcatcaaa taacttccaa 1980 gggctcaaaa
atccaaagat gtaaaaaagg aactgagctc tgtttgccaa gccatgagga 2040
ttaaataatg acattcaaag agatttttgt gccctaagta ctttttattg gttttcatag
2100 atggtttaat gtgcaagatg aagcaaacag agatgggagt ggtatcagca
tggattaagg 2160 tggcagttgt gagggagggg tactgagaga acaggacaag
gtaacctatc taaggagagg 2220 ccaagttggc aagtgccagg gacttctaag
cccagaacta gtacacattc cttaggtgct 2280 gtttgggaag tcagggagtc
accagccttg ggatctataa aagtgcatgg tggcattcac 2340 tcacatactt
cctgagctgt tcgatgttga tgaagtcgtg ggtatgagac tgttgtgtca 2400
gtgacaaact atgtaaatga gaatgattgt ttccatcttg accactaaga cgtaaaccgg
2460 ttccagtgat ctccaaacat ggcaagctac agcagagcag cagccccatc
cagagccttg 2520 ccctggttct gaatggggga gaatccagtg ggagtcggtt
gctgccagca tgttggggta 2580 gaaggctgga gcatgacagg tccccgagga
tttcctgctt cctatatggg tagggatact 2640 tgaggtcctc tcttctacct
ccttccctgc agggtttata acctctacca ctgtctgtct 2700 ctgggatagc
tcctagggtg cagcccctcc ccaaaaaggc ctctccctgg cctcatgtct 2760
ctaagaacag ctttctaaag caggcctgtt acacaaaggc tcccttttcc tggcttcatc
2820 gttgctggta gacaacttcc actcgttttc cacttcagtt tcttctactc
tgttgttatt 2880 tgattctgat gcttgaaccc agggttgtgt agtcagcaag
tgctaccccc tccctcctct 2940 tctttgtttt tttgaggcag ggtctcattt
tgcccaagtg gacctaaatt tcagcatgta 3000 gctggcctgg ttttgaatgc
cttctcatcc tgcctctact tcccaagagt agcttacaag 3060 tgtgcaccac
catgccccgc gatattctta tttttgagac tgttttctat gctggtttct 3120
ttggggaact acactaaggt agcttacaag tgtgcaccac catgccccgc gatattctta
3180 tttttgagac tgttttctat gctggtttct ttggggaact acactaaggt
agcttcattg 3240 ttggcataaa tttctcagtt caggcccata tctcctaagt
agcagaacta agcaaatctc 3300 aaacaaaccc ctcaaaaaga ctgatgtcca
ctaaacggac ttctaaaata gctcctgtaa 3360 tcctgagcat ttacaaggcg
gcagacctcc tataagggag taaatatgaa aacgcgcctg 3420 ttcaaatgct
aggtcggtgg atagaagcaa tttcctcaga aagctgaagg caccaaaggt 3480
tatatttgtt agcatttcag tgtttgccaa actcagctac agtagagatc acagattccc
3540 tatttcccag agattcaaaa ttcagcagcc cctctctaac tatggctcag
agtcgtgtca 3600 ttacatatgc cccaacaaca acccccaccc ctatcctacc
cccgcctcac acgtgcaagt 3660 actatcacag ttgccaacct agcagagctg
ccatcctaag gtcgaggtcg ccgctttggc 3720 tgtgtgcaca ggcaagcgcc
ctcacccaat ggccctggcc ttgctatggg tgcgtgagtt 3780 gagatgatgc
tctggactct gaggtgaagg ccactggaac agtgaaaaaa gctaacgcag 3840
ggcttttacc tagtcccctt cctttggtgg tgggtgttta cggaacatat ttgggatctg
3900 agtgtatggt cgcaccacaa taaagcctta acctatatag tagaatttca
gctgtaatca 3960 ttaagaactg agattgccac cacccacctc actgtctgtg
tcaaccacag caggctggag 4020 cagtcagctc aggaacaggc aaaaccttag
gtccctccgc ctacctaacc ttcaatacat 4080 caaggatagg cttctttgct
tgcccaaacc tcgccccagt ctagaccacc tggggattcc 4140 cagctcaggg
cgaaaaggaa gcccgagaag cattctgtag agggaaatcc tgcatgagtg 4200
cgcccccttt cgttactcca acacatccag caaccactga acttggccgg ggaacacacc
4260 tggtcctcat gcaccagcat tgtgaccatc aacggaaaag tactattgct
gcgaccccgc 4320 cccttccgct acaacgcttg gtccgcctga atcccgcccc
ttcctccgtt cccagcctca 4380 tctttttcgt cgtggactct cagtggcctg
ggtcctggct gttttctaag cacacccttg 4440 catcttggtt cccgcacgtg
ggaggcccat cccggccttg agcacaatga cccgcgctcc 4500 tcgttgcccc
gcggtgcgct ctctgctgcg cagccgatac cgggaggtgt ggccgctggc 4560
aacctttgtg cggcgcctgg ggcccgaggg caggcggctt gtgcaacccg gggacccgaa
4620 gatctaccgc actttggttg cccaatgcct agtgtgcatg cactggggct
cacagcctcc 4680 acctgccgac ctttccttcc accaggtggg cctccaggcg
ggatccccat gggtcagggg 4740 cggaaagccg ggaggacgtg ggatagtgcg
tctagctcat gtgtcaagac cctcttctcc 4800 ttaccaggtg tcatccctga
aagagctggt ggccagggtt gtgcagagac tctgcgagcg 4860 caacgagaga
aacgtgctgg cttttggctt tgagctgctt aacgaggcca gaggcgggcc 4920
tcccatggcc ttcactagta gcgtgcgtag ctacttgccc aacactgtta ttgagaccct
4980 gcgtgtcagt ggtgcatgga tgctactgtt gagccgagtg ggcgacgacc
tgctggtcta 5040 cctgctggca cactgtgctc tttatcttct ggtgcccccc
agctgtgcct accaggtgtg 5100 tgggtctccc ctgtaccaaa tttgtgccac
cacggatatc tggccctctg tgtccgctag 5160 ttacaggccc acccgacccg
tgggcaggaa tttcactaac cttaggttct tacaacagat 5220 caagagcagt
agtcgccagg aagcaccgaa acccctggcc ttgccatctc gaggtacaaa 5280
gaggcatctg agtctcacca gtacaagtgt gccttcagct aagaaggcca gatgctatcc
5340 tgtcccgaga gtggaggagg gaccccacag gcaggtgcta ccaaccccat
caggcaaatc 5400 atgggtgcca agtcctgctc ggtcccccga ggtgcctact
gcagagaaag atttgtcttc 5460 taaaggaaag gtgtctgacc tgagtctctc
tgggtcggtg tgctgtaaac acaagcccag 5520 ctccacatct ctgctgtcac
caccccgcca aaatgccttt cagctcaggc catttattga 5580 gaccagacat
ttcctttact ccaggggaga tggccaagag cgtctaaacc cctcattcct 5640
actcagcaac ctccagccta acttgactgg ggccaggaga ctggtggaga tcatctttct
5700 gggctcaagg cctaggacat caggaccact ctgcaggaca caccgtctat
cgcgtcgata 5760 ctggcagatg cggcccctgt tccaacagct gctggtgaac
catgcagagt gccaatatgt 5820 cagactcctc aggtcacatt gcaggtttcg
aacagcaaac caacaggtga cagatgcctt 5880 gaacaccagc ccaccgcacc
tcatggattt gctccgcctg cacagcagtc cctggcaggt 5940 atatggtttt
cttcgggcct gtctctgcaa ggtggtgtct gctagtctct ggggtaccag 6000
gcacaatgag cgccgcttct ttaagaactt aaagaagttc atctcgttgg ggaaatacgg
6060 caagctatca ctgcaggaac tgatgtggaa gatgaaagta gaggattgcc
actggctccg 6120 cagcagcccg ggtgagcatg gctggtctcc agctgaatgc
attaggggcc cagaaaaggg 6180 agacaatggg tggcagtaac ccaggtcccc
agtggtgtgg tggctttatg cagtccgtgg 6240 ttggatgagt tccatcttat
ggtctctgac tccaagctcc ctccagctcg ccttgcacaa 6300 actaagattc
ttgtccaagc cctgggcagg ttctcagggc tggggacatt gtggtgaaca 6360
gataagcaga cggggagcat ggtggatagg agttctggca cagtgcacca gagagagtct
6420 ggaagcgcta gtgagagcta atgtaagggc ccgtggttcg ccaaagaatg
ataaccccgg 6480 actcaaatag tatgccaaag caaggagcat ttcattctgc
agaaatcaag catgcaggtg 6540 gggggggggg gttgctctca ttccaagatg
gagagacaac caagtataga ttttaagggg 6600 atcgggggcc tttatcttac
tccatctcta ggggcattcc attactgggg catggggttg 6660 gaggttggaa
actgttaatg gggaggtctg gaaacttgct gccccattgt ccttgcttca 6720
ggctaggtag ctgagtagct tctaatggca ggatagtttc tgactagctg tctaaagtct
6780 ggggtgtttg tttttttgtt ttttctagta acttacttgc ctgaacttgc
tcagttttta 6840 ggcctggtct cctggactgc caatttgaag cctattaagg
agtcagcctg tctcactact 6900 ccaggttatc tataatcccc ctgtagaacg
gtacctcact gataacaatg acagaccaac 6960 ataggaaccc actatccttg
tggtgcatga gtttcaaagg ttcttctggt cctcccagtg 7020 tgcagatcca
tgcttaagct atggtcctcc cagtgtgcag atccgtgctt aagctatggt 7080
cttgcagctg ctcgatctac aaagggtagg gtgaacgaag gaaagataaa tgaaaaaaaa
7140 aaaactgttt cctacagtga agatcgctgc cccatcttag ctatgagaag
ggactgggga 7200 gtggagcctg gtgcataaaa gaggattgtg ttacttggaa
ggctgcagag cctggactcc 7260 tgtgccctcc ttgcctggtt ttctgggttt
aatgttgagg ttggccctct gtagtcacta 7320 cctgacccct tccctttcag
ccaaccctcc ggttacaccc tgtgcatgta tggaaggggc 7380 caaacgccct
atcctgctct cccttcccca aaattcttag gatattaaca acttatgggg 7440
aaaagatggt agagctatgt ttacccacca tgtacttggg aagctccgaa gtaagctt
7498 3 144 DNA Artificial Sequence NCO1 fragment containing hTERT
upstream sequences and the first intron of hTERT from lambdaGPhi5
into the NCO1 site of a pBBS167 (variant of pUC cloning vector with
MCS) 3 atgaccatga ttacgaattc gagctcggta cccggggatc ctctagagtc
gacctgcagg 60 catgcccatg gcaggcctcg cgcgcgagat ctcgggccca
atcgatgccg cggcgatatc 120 gctcgaggaa gcttggcact ggcc 144 4 37 DNA
Artificial Sequence Description of Artificial Sequence RA94 4
cccggccacc cccgcgaatt cgcgcgctcc ccgctgc 37 5 65 DNA Artificial
Sequence Description of Artificial Sequence RA91 5 ttgtactgag
agtgcaccat atgcggtgtg catgctacgt aagaggttcc aactttcacc 60 ataat 65
6 16 DNA Artificial Sequence Description of Artificial Sequence
RA96 6 aattgcgaag cttacg 16 7 16 DNA Artificial Sequence
Description of Artificial Sequence RA97 7 aattcgtaag cttcgc 16 8 60
DNA Artificial Sequence Description of Artificial Sequence oligo
RA101 8 taggtaccga gctcttacgc gtgctagccc cacgtggcgg agggactggg
gacccgggca 60 9 58 DNA Artificial Sequence Description of
Artificial Sequence oligo RA100 9 taggtaccga gctcttacgc gtgctagccc
ctcgctggcg tccctgcacc ctgggagc 58 10 33 DNA Artificial Sequence
Description of Artificial Sequence RA107 10 cgtcctgctg cgcactcagg
aagccctggc ccc 33 11 6 DNA Artificial Sequence Description of
Artificial Sequence 'B' class E-Box just proximal to the hTERT
initiating Met in pGRN262 11 cacgtg 6 12 6 DNA Artificial Sequence
Description of Artificial Sequence changed 'B' class E-Box just
proximal to the hTERT initiating Met in pGRN262 12 cactca 6 13 25
DNA Artificial Sequence Description of Artificial Sequence COD1941
13 gatgaatgct catgattccg tatgg 25 14 57 DNA Artificial Sequence
Description of Artificial Sequence COD2866 14 cagcatcttt tactttcacc
agcgtttctg ggtgcgcaaa aacaggaagg caaaatg 57 15 58 DNA Artificial
Sequence Description of Artificial Sequence RA104 15 taggtaccga
gctcttacgc gtgctagccc ctcccagccc ctccccttcc tttccgcg 58 16 33 DNA
Artificial Sequence Description of Artificial Sequence RA122 16
gaccgcgctt cccactcagc ggagggactg ggg 33 17 298 DNA Homo sapiens
Human TERT promoter 17 caggccgggc tcccagtgga ttcgcgggca cagacgccca
ggaccgcgct tcccacgtgg 60 cggagggact ggggacccgg gcacccgtcc
tgccccttca ccttccagct ccgcctcctc 120 cgcgcggacc ccgccccgtc
ccgacccctc ccgggtcccc ggcccagccc cctccgggcc 180 ctcccagccc
ctccccttcc tttccgcggc cccgccctct cctcgcggcg cgagtttcag 240
gcagcgctgc gtcctgctgc gcacgtggga agccctggcc ccggccaccc ccgcgatg 298
18 262 DNA Mus sp. Mouse TERT promoter 18 cagcaaccac tgaacttggc
cggggaacac acctggtcct catgcaccag cattgtgacc 60 atcaacggaa
aagtactatt gctgcgaccc cgccccttcc gctacaacgc ttggtccgcc 120
tgaatcccgc cccttcctcc gttcccagcc tcatcttttt cgtcgtggac tctcagtggc
180 ctgggtcctg gctgttttct aagcacaccc ttgcatcttg gttcccgcac
gtgggaggcc 240 catcccggcc ttgagcacaa tg 262 19 77 DNA Homo sapiens
Human TERT promoter 19 ctcgcggcgc gagtttcagg cagcgctgcg tcctgctgcg
cacgtgggaa gccctggccc 60 cggccacccc cgcgatg 77 20 89 DNA Artificial
Sequence Description of Artificial Sequence E-box reporter
construct 20 ctcgcggcgc gagtttcagg cagcgctgcg tcctgctgcg cacgtgggaa
gccctggccc 60 cggccacccc cgcgaattcg cccaccatg 89 21 56 DNA
Artificial Sequence Description of Artificial Sequence E-box
reporter construct (with portion deleted) 21 ctcgcggcgc gagtttcagg
cagcgctgcg tcctgctgcc gaattcgccc accatg 56 22 497 DNA Homo sapiens
Human TERT promoter 22 actccagcat aatcttctgc ttccatttct tctcttccct
cttttaaaat tgtgttttct 60 atgttggctt ctctgcagag aaccagtgta
agctacaact taacttttgt tggaacaaat 120 tttccaaacc gcccctttgc
cctagtggca gagacaattc acaaacacag ccctttaaaa 180 aggcttaggg
atcactaagg ggatttctag aagagcgacc cgtaatccta agtatttaca 240
agacgaggct aacctccagc gagcgtgaca gcccagggag ggtgcgaggc ctgttcaaat
300 gctagctcca taaataaagc aatttcctcc ggcagtttct gaaagtagga
aaggttacat 360 ttaaggttgc gtttgttagc atttcagtgt ttgccgacct
cagctacagc atccctgcaa 420 ggcctcggga gacccagaag tttctcgccc
cttagatcca aacttgagca acccggagtc 480 tggattcctg ggaagtc 497 23 425
DNA Mus sp. Mouse TERT promoter 23 caagtgtgca ccaccatgcc ccgcgatatt
cttatttttg agactgtttt ctatgctggt 60 ttctttgggg aactacacta
aggtagcttc attgttggca taaatttctc agttcaggcc 120 catatctcct
aagtagcaga actaagcaaa tctcaaacaa acccctcaaa aagactgatg 180
tccactaaac ggacttctaa aatagctcct gtaatcctga gcatttacaa ggcggcagac
240 ctcctataag ggagtaaata tgaaaacgcg cctgttcaaa tgctaggtcg
gtggatagaa 300 gcaatttcct cagaaagctg aaggcaccaa aggttatatt
tgttagcatt tcagtgtttg 360 ccaaactcag ctacagtaga gatcacagat
tccctatttc ccagagattc aaaattcagc 420 agccc 425
* * * * *
References