U.S. patent application number 10/429176 was filed with the patent office on 2004-03-25 for tenasin-c nucleic acid ligands.
Invention is credited to Gold, Larry, Hicke, Brian, Parma, David, Warren, Stephen.
Application Number | 20040058884 10/429176 |
Document ID | / |
Family ID | 23436596 |
Filed Date | 2004-03-25 |
United States Patent
Application |
20040058884 |
Kind Code |
A1 |
Hicke, Brian ; et
al. |
March 25, 2004 |
Tenasin-C nucleic acid ligands
Abstract
Methods are described for the identification and preparation of
nucleic acid ligands to tenascin-C. Included in the invention are
specific RNA ligands to tenascin-C identified by the SELEX method.
Further included in the invention are methods for detecting the
presence of a disease condition in a biological tissue in which
tenascin-C is expressed.
Inventors: |
Hicke, Brian; (Boulder,
CO) ; Warren, Stephen; (Boulder, CO) ; Parma,
David; (Boulder, CO) ; Gold, Larry; (Boulder,
CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN L.L.C.
1745 SHEA CENTER DRIVE
SUITE 330
HIGHLANDS RANCH
CO
80129
US
|
Family ID: |
23436596 |
Appl. No.: |
10/429176 |
Filed: |
May 1, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10429176 |
May 1, 2003 |
|
|
|
09854662 |
May 14, 2001 |
|
|
|
6596491 |
|
|
|
|
09854662 |
May 14, 2001 |
|
|
|
09364902 |
Jul 29, 1999 |
|
|
|
6232071 |
|
|
|
|
09364902 |
Jul 29, 1999 |
|
|
|
08434425 |
May 3, 1995 |
|
|
|
5789157 |
|
|
|
|
08434425 |
May 3, 1995 |
|
|
|
07714131 |
Jun 10, 1991 |
|
|
|
5475096 |
|
|
|
|
07714131 |
Jun 10, 1991 |
|
|
|
07536428 |
Jun 11, 1990 |
|
|
|
10429176 |
May 1, 2003 |
|
|
|
08993765 |
Dec 18, 1997 |
|
|
|
6610841 |
|
|
|
|
Current U.S.
Class: |
514/44R ;
536/23.5 |
Current CPC
Class: |
C12N 2310/53 20130101;
G01N 33/535 20130101; G01N 2333/976 20130101; C12N 2310/317
20130101; C12N 2310/3517 20130101; A61P 9/00 20180101; A61K 47/547
20170801; C40B 40/00 20130101; G01N 33/531 20130101; C07H 19/06
20130101; G01N 2333/62 20130101; G01N 33/68 20130101; G01N 2333/966
20130101; C12N 9/1276 20130101; G01N 2333/575 20130101; A61P 17/06
20180101; C12N 2310/13 20130101; A61K 47/549 20170801; C12N 15/115
20130101; B82Y 5/00 20130101; A61K 47/54 20170801; A61K 2123/00
20130101; G01N 2333/16 20130101; C12Q 2600/158 20130101; G01N
2333/8125 20130101; G01N 2333/96433 20130101; G01N 2333/974
20130101; C12Q 1/37 20130101; A61P 17/00 20180101; C12N 2310/3183
20130101; G01N 2333/163 20130101; C07K 14/001 20130101; C12Q
2541/101 20130101; G01N 33/56988 20130101; A61P 9/10 20180101; F02B
2075/027 20130101; G01N 2333/503 20130101; A61P 35/00 20180101;
C07H 19/10 20130101; C12N 2310/321 20130101; C12N 15/1048 20130101;
C12N 2310/322 20130101; G01N 2333/9726 20130101; A61K 38/00
20130101; C12Q 1/6883 20130101; G01N 33/532 20130101; G01N
2333/96455 20130101; C07H 21/00 20130101; G01N 33/76 20130101; C12N
2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/044 ;
536/023.5 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
What is claimed is:
1. A method for delivering a therapeutic agent to a patient having
a disease in which tecnascin-C is expressed, comprising: covalently
attaching a tenascin-C nucleic acid ligand to a therapeutic agent
to form a complex, and administering said complex to said
patient.
2. The method of claim 1, wherein the disease in which tenascin-C
is expressed is selected from the group consisting of cancer,
hyperproliferative skin diseases, and arthrosclerosis.
3. The method of claim 2, wherein the cancer is selected from the
group consisting of lung cancer, breast cancer, prostate cancer,
colon cancer, astrocytomas, glioblastomas, melanomas, and
sarcomas.
4. The method of claim 1, wherein the disease in which tenascin-C
is expressed is a disease in which tenascin-C is overexpressed.
5. The method of claim 1, wherein the attachment of the tenascin-C
nucleic acid ligand to a therapeutic agent is accomplished through
the use of a linker.
6. The method of claim 5, wherein said linker has the structure:
1
7. The method of claim 6, wherein the tenascin-C nucleic acid
ligand is single stranded.
8. The method of claim 7, wherein the tenascin-C nucleic acid
ligand is RNA.
9. The method of claim 8, wherein the tenascin-C nucleic acid
ligand is comprised of 2'-fluoro (2'-F) modified nucleotides.
10. The method of claim 1, wherein the tenascin-C nucleic acid
ligand is selected from the group consisting of SEQ ID NO:4-65.
Description
RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. patent application
Ser. No. 09/854,662, filed May 14, 2001, which is a Divisional of
U.S. patent application Ser. No. 09/364,902, filed Jul. 29, 1999,
now U.S. Pat. No. 6,232,071, which is a Continuation-in-Part of
U.S. patent application Ser. No. 08/434,425, filed May 3, 1995,
entitled Systematic Evolution of Ligands by Exponential Enrichment:
Tissue SELEX," now U.S. Pat. No. 5,789,157, which is a
Continuation-in Part of U.S. patent application Ser. No.
07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid Ligands,"
now U.S. Pat. No. 5,475,096, which is a Continuation-in-Part of
U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990,
entitled "Systematic Evolution of Ligands by Exponential
Enrichment," now abandoned, and U.S. patent application Ser. No.
07/964,624, filed Oct. 21, 1992, entitled "Nucleic Acid Ligands to
HIV-RT and HIV-1 Rev", now U.S. Pat. No. 5,496,938. This
application is also a Continuation-in-Part of U.S. patent
application Ser. No. 08/993,765, filed Dec. 18, 1997, entitled
"Nucleotide Based Prodrugs." Each of the above described patents
and applications is specifically incorporated by reference herein
in their entirety.
FIELD OF THE INVENTION
[0002] Described herein are high affinity nucleic acid ligands to
tenascin-C. Also described herein are methods for identifying and
preparing high affinity nucleic acid ligands to tenascin-C. The
method used herein for identifying such nucleic acid ligands is
called SELEX, an acronym for Systematic Evolution of Ligands by
Exponential enrichment. Further disclosed are high affinity nucleic
acid ligands to tenascin-C. Further disclosed are RNA ligands to
tenascin-C. Also included are oligonucleotides containing
nucleotide derivatives chemically modified at the 2'-positions of
the purines and pyrimidines. Additionally disclosed are RNA ligands
to tenascin-C containing 2'-F and 2'OMe modifications. The
oligonucleotides of the present invention are useful as diagnostic
and/or therapeutic agents.
BACKGROUND OF THE INVENTION
[0003] Tenascin-C is a 1.1-1.5 million Da, hexameric glycoprotein
that is located primarily in the extracellular matrix. Tenascin-C
is expressed during embryogenesis, wound healing, and neoplasia,
suggesting a role for this protein in tissue remodeling (Erickson
& Bourdon, (1989) Ann Rev Cell Biol 5:71-92). Neoplastic
processes also involve tissue remodeling, and tenascin-C is
over-expressed in many tumor types including carcinomas of the
lung, breast, prostate, and colon, astrocytomas, glioblastomas,
melanomas, and sarcomas (Soini et al., (1993) Am J Clin Pathol
100(2):145-50; Koukoulis et al., (1991) Hum Pathol 22(7):636-43;
Borsi et al., (1992) Int J Cancer 52(5):688-92; Koukoulis et al.,
(1993) J Submicrosc Cytol Pathol 25(2):285-95; Ibrahim et al.,
(1993) Hum Pathol 24(9):982-9; Riedl et al., (1998) Dis Colon
Rectum 41(1):86-92; Tuominen & Kallioinen (1994) J Cutan Pathol
21(5):424-9; Natali et al., (1990) Int J Cancer 46(4):586-90;
Zagzag et al., (1995) Cancer Res 55(4):907-14; Hasegawa et al.,
(1997) Acta Neuropathol (Berl) 93(5):431-7; Saxon et al., (1997)
Pediatr Pathol Lab Med 17(2):259-66; Hasegawa et al., (1995) Hum
Pathol 26(8):838-45). In addition, tenascin-C is overexpressed in
hyperproliferative skin diseases, e.g. psoriasis (Schalkwijk et
al., (1991) Br J Dermatol 124(1):13-20), and in atherosclerotic
lesions (Fukumoto et al., (1998) J Atheroscler Thromb 5(1):29-35;
Wallner et al., (1999) Circulation 99(10):1284-9). Radiolabeled
antibodies that bind tenascin-C are used for imaging and therapy of
tumors in clinical settings (Paganelli et al., (1999) Eur J Nucl
Med 26(4):348-57; Paganelli et al., (1994) Eur J Nucl Med
21(4):314-21; Bigner et al., (1998) J Clin Oncol 16(6):2202-12;
Merlo et al., (1997) Int J Cancer 71(5):810-6).
[0004] Aptamers against tenascin-C have potential utility for
cancer diagnosis and therapy, as well as for diagnosis and therapy
of atheroslerosis and therapy of psoriasis. Relative to antibodies,
aptamers are small (7-20 kDa), clear very rapidly from blood, and
are chemically synthesized. Rapid blood clearance is important for
in vivo diagnostic imaging, where blood levels are a primary
determinant of background that obscures an image. Rapid blood
clearance may also be important in therapy, where blood levels may
contribute to toxicity. SELEX technology allows rapid aptamer
isolation, and chemical synthesis enables facile and site-specific
conjugation of aptamers to a variety of inert and bioactive
molecules. An aptamer to tenascin-C would therefore be useful for
tumor therapy or in vivo or ex vivo diagnostic imaging and/or for
delivering a variety of therapeutic agents complexed with the
tenascin-C nucleic acid ligand for treatment of disease conditions
in which tenascin-C is expressed.
[0005] The dogma for many years was that nucleic acids had
primarily an informational role. Through a method known as
Systematic Evolution of Ligands by EXponential enrichment, termed
the SELEX process, it has become clear that nucleic acids have
three dimensional structural diversity not unlike proteins. The
SELEX process is a method for the in vitro evolution of nucleic
acid molecules with highly specific binding to target molecules and
is described in U.S. patent application Ser. No. 07/536,428, filed
Jun. 11, 1990, entitled "Systematic Evolution of Ligands by
EXponential Enrichment," now abandoned, U.S. Pat. No. 5,475,096
entitled "Methods for Identifying Nucleic Acid Ligands", U.S. Pat.
No. 5,270,163 (see also WO 91/19813) entitled "Nucleic Acid
Ligands" each of which is specifically incorporated by reference
herein in its entirety. Each of these applications, collectively
referred to herein as the SELEX Patent Applications, describes a
fundamentally novel method for making a nucleic acid ligand to any
desired target molecule. The SELEX process provides a class of
products which are referred to as nucleic acid ligands or aptamers,
each having a unique sequence, and which have the property of
binding specifically to a desired target compound or molecule. Each
SELEX-identified nucleic acid ligand is a specific ligand of a
given target compound or molecule. The SELEX process is based on
the unique insight that nucleic acids have sufficient capacity for
forming a variety of two- and three-dimensional structures and
sufficient chemical versatility available within their monomers to
act as ligands (form specific binding pairs) with virtually any
chemical compound, whether monomeric or polymeric. Molecules of any
size or composition can serve as targets in the SELEX method. The
SELEX method applied to the application of high affinity binding
involves selection from a mixture of candidate oligonucleotides and
step-wise iterations of binding, partitioning and amplification,
using the same general selection scheme, to achieve virtually any
desired criterion of binding affinity and selectivity. Starting
from a mixture of nucleic acids, preferably comprising a segment of
randomized sequence, the SELEX method includes steps of contacting
the mixture with the target under conditions favorable for binding,
partitioning unbound nucleic acids from those nucleic acids which
have bound specifically to target molecules, dissociating the
nucleic acid-target complexes, amplifying the nucleic acids
dissociated from the nucleic acid-target complexes to yield a
ligand-enriched mixture of nucleic acids, then reiterating the
steps of binding, partitioning, dissociating and amplifying through
as many cycles as desired to yield highly specific high affinity
nucleic acid ligands to the target molecule.
[0006] It has been recognized by the present inventors that the
SELEX method demonstrates that nucleic acids as chemical compounds
can form a wide array of shapes, sizes and configurations, and are
capable of a far broader repertoire of binding and other functions
than those displayed by nucleic acids in biological systems.
[0007] The basic SELEX method has been modified to achieve a number
of specific objectives. For example, U.S. patent application Ser.
No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat.
No. 5,707,796, both entitled "Method for Selecting Nucleic Acids on
the Basis of Structure," describe the use of the SELEX process in
conjunction with gel electrophoresis to select nucleic acid
molecules with specific structural characteristics, such as bent
DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17,
1993, entitled "Photoselection of Nucleic Acid Ligands," now
abandoned, U.S. Pat. No. 5,763,177 entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Photoselection of Nucleic
Acid Ligands and Solution SELEX" and U.S. patent application Ser.
No. 09/093,293, filed Jun. 8 1998, entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Photoselection of Nucleic
Acid Ligands and Solution SELEX" describe a SELEX based method for
selecting nucleic acid ligands containing photoreactive groups
capable of binding and/or photocrosslinking to and/or
photoinactivating a target molecule. U.S. Pat. No. 5,580,737
entitled "High-Affinity Nucleic Acid Ligands That Discriminate
Between Theophylline and Caffeine," describes a method for
identifying highly specific nucleic acid ligands able to
discriminate between closely related molecules, which can be
non-peptidic, termed Counter-SELEX. U.S. Pat. No. 5,567,588
entitled "Systematic Evolution of Ligands by EXponential
Enrichment: Solution SELEX," describes a SELEX-based method which
achieves highly efficient partitioning between oligonucleotides
having high and low affinity for a target molecule.
[0008] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or improved delivery characteristics. Examples of
such modifications include chemical substitutions at the ribose
and/or phosphate and/or base positions. SELEX process-identified
nucleic acid ligands containing modified nucleotides are described
in U.S. Pat. No. 5,660,985 entitled "High Affinity Nucleic Acid
Ligands Containing Modified Nucleotides," that describes
oligonucleotides containing nucleotide derivatives chemically
modified at the 5- and 2'-positions of pyrimidines. U.S. Pat. No.
5,580,737, supra, describes highly specific nucleic acid ligands
containing one or more nucleotides modified with 2'-amino
(2'-NH.sub.2), 2'-fluoro (2'-F), and/or 2'-O-methyl (2'-OMe). U.S.
patent application Ser. No. 08/264,029, filed Jun. 22, 1994,
entitled "Novel Method of Preparation of Known and Novel 2'
Modified Nucleosides by Intramolecular Nucleophilic Displacement,"
now abandoned, oligonucleotides containing various 2'-modified
pyrimidines.
[0009] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S. Pat. No.
5,637,459 entitled "Systematic Evolution of Ligands by EXponential
Enrichment: Chimeric SELEX," and U.S. Pat. No. 5,683,867 entitled
"Systematic Evolution of Ligands by EXponential Enrichment: Blended
SELEX," respectively. These applications allow the combination of
the broad array of shapes and other properties, and the efficient
amplification and replication properties, of oligonucleotides with
the desirable properties of other molecules.
[0010] The SELEX method further encompasses combining selected
nucleic acid ligands with lipophilic compounds or non-immunogenic,
high molecular weight compounds in a diagnostic or therapeutic
complex as described in U.S. patent application Ser. No.
08/434,465, filed May 4, 1995, entitled "Nucleic Acid Ligand
Complexes". Each of the above described patents and applications
which describe modifications of the basic SELEX procedure are
specifically incorporated by reference herein in their
entirety.
SUMMARY OF THE INVENTION
[0011] The present invention describes a method for isolating
nucleic acid ligands that bind to tenascin-C with high specificity.
Further described herein are nucleic acid ligands to tenascin-C.
Also described herein are high affinity RNA ligands to tenascin-C.
Further described are 2'fluoro-modified pyrimidine and
2'OMe-modified purine RNA ligands to tenascin-C. The method
utilized herein for identifying such nucleic acid ligands is called
SELEX, an acronym for Systematic Evolution of Ligands by
Exponential enrichment. Included herein are the ligands that are
shown in Tables 3 and 4 and FIG. 2.
[0012] Further included in this invention is a method for detecting
the presence of a disease that is expressing tenascin-C in a
biological tissue that may contain the disease. Still further
included in this invention is a method for detecting the presence
of a tumor that is expressing tenascin-C in a biological tissue
that may contain the tumor. Further included in this invention is a
complex for use in in vivo or ex vivo diagnostics. Still further
included in this invention is a method for delivering therapeutic
agents for the treatment or prophylaxis of diseased tissues that
express tenascin-C. Still further included in this invention is a
complex for use in delivering therapeutic agents for treatment or
prophylaxis of diseased tissues that express tenascin-C.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 shows binding of Cell SELEX RNA pools to U251
cells.
[0014] FIG. 2 shows proposed secondary structure of aptamers TTA1
and TTA1.NB. Included in the figure is the conjugation of the
aptamers with Tc-99m. All A's are 2'OMe modified. All G's, except
as indicated, are 2'OMe modified. All C's and U's are 2'F
modified.
[0015] FIG. 3 shows images of U251 tumor xenografts in mice,
obtained using Tc-99m-labeled TTA1 and TTA1.NB, three hours
post-injection.
[0016] FIG. 4 shows fluorescence microscopy of a U251 glioblastoma
tumor section, taken three hours after i.v. injection of
Rhodamine-Red-X-labeled TTA1.
[0017] FIG. 5 shows the way in which the Tc-99m and linker is bound
through the 5'G of TTA1.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0018] The central method utilized herein for identifying nucleic
acid ligands to tenascin-C is called the SELEX process, an acronym
for Systematic Evolution of Ligands by Exponential enrichment and
involves (a) contacting the candidate mixture of nucleic acids with
tenascin-C (b) partitioning between members of said candidate
mixture on the basis of affinity to tenascin-C, and c) amplifying
the selected molecules to yield a mixture of nucleic acids enriched
for nucleic acid sequences with a relatively higher affinity for
binding to tenascin-C. The invention includes RNA ligands to
tenascin-C. This invention further includes the specific RNA
ligands to tenascin-C shown in Tables 3 and 4 and FIG. 2. More
specifically, this invention includes nucleic acid sequences that
are substantially homologous to and that have substantially the
same ability to bind tenascin-C as the specific nucleic acid
ligands shown in Tables 3 and 4 and FIG. 2. By substantially
homologous it is meant a degree of primary sequence homology in
excess of 70% , most preferably in excess of 80%, and even more
preferably in excess of 90%, 95%, or 99%. The percentage of
homology as described herein is calculated as the percentage of
nucleotides found in the smaller of the two sequences which align
with identical nucleotide residues in the sequence being compared
when 1 gap in a length of 10 nucleotides may be introduced to
assist in that alignment. Substantially the same ability to bind
tenascin-C means that the affinity is within one or two orders of
magnitude of the affinity of the ligands described herein. It is
well within the skill of those of ordinary skill in the art to
determine whether a given sequence--substantially homologous to
those specifically described herein--has the same ability to bind
tenascin-C.
[0019] A review of the sequence homologies of the nucleic acid
ligands of tenascin-C shown in Tables 3 and 4 and FIG. 2 shows that
sequences with little or no primary homology may have substantially
the same ability to bind tenascin-C. For these reasons, this
invention also includes Nucleic Acid Ligands that have
substantially the same postulated structure or structural motifs
and ability to bind tenascin-C as the nucleic acid ligands shown in
Tables 3 and 4 and FIG. 2. Substantially the same structure or
structural motifs can be postulated by sequence alignment using the
Zukerfold program (see Zuker (1989) Science 244:48-52). As would be
known in the art, other computer programs can be used for
predicting secondary structure and structural motifs. Substantially
the same structure or structural motif of Nucleic Acid Ligands in
solution or as a bound structure can also be postulated using NMR
or other techniques as would be known in the art.
[0020] Further included in this invention is a method for detecting
the presence of a disease that is expressing tenascin-C in a
biological tissue which may contain the disease by the method of
(a) identifying a nucleic acid ligand from a candidate mixture of
nucleic acids, the nucleic acid ligand being a ligand of
tenascin-C, by the method comprising (i) contacting a candidate
mixture of nucleic acids with tenascin-C, wherein nucleic acids
having an increased affinity to tenascin-C relative to the
candidate mixture may be partitioned from the remainder of the
candidate mixture; (ii) partitioning the increased affinity nucleic
acids from the remainder of the candidate mixture; (iii) amplifying
the increased affinity nucleic acids to yield a mixture of nucleic
acids with relatively higher affinity and specificity for binding
to tenascin-C, whereby a nucleic acid ligand of tenascin-C is
identified; (b) attaching a marker that can be used in in vivo or
ex vivo diagnostics to the nucleic acid ligand identified in step
(iii) to form a marker-nucleic acid ligand complex; (c) exposing a
tissue which may contain the disease to the marker-nucleic acid
ligand complex; and (d) detecting the presence of the
marker-nucleic acid ligand in the tissue, whereby a disease
expressing tenascin-C is identified.
[0021] It is a further object of the present invention to provide a
complex for use in in vivo or ex vivo diagnostics comprising one or
more tenascin-C nucleic acid ligands and one or more markers. Still
further included in this invention is a method for delivering
therapeutic agents for the treatment or prophylaxis of disease
conditions in which tenascin-C is expressed. Still further included
in this invention is a complex for use in delivering therapeutic
agents for treatment or prophylaxis of disease conditions in which
tenascin-C is expressed.
Definitions
[0022] Various terms are used herein to refer to aspects of the
present invention. To aid in the clarification of the description
of the components of this invention, the following definitions are
provided:
[0023] As used herein, "nucleic acid ligand" is a non-naturally
occurring nucleic acid having a desirable action on a target.
Nucleic acid ligands are often referred to as "aptamers." The
target of the present invention is tenascin-C, hence the term
tenascin-C nucleic acid ligand. A desirable action includes, but is
not limited to, binding of the target, catalytically changing the
target, reacting with the target in a way which modifies/alters the
target or the functional activity of the target, covalently
attaching to the target as in a suicide inhibitor, facilitating the
reaction between the target and another molecule. In the preferred
embodiment, the action is specific binding affinity for a target
molecule, such target molecule being a three dimensional chemical
structure other than a polynucleotide that binds to the nucleic
acid ligand through a mechanism which predominantly depends on
Watson/Crick base pairing or triple helix binding, wherein the
nucleic acid ligand is not a nucleic acid having the known
physiological function of being bound by the target molecule.
Nucleic acid ligands are identified from a candidate mixture of
nucleic acids, said nucleic acid ligand being a ligand of a
tenascin-C, by the method comprising: a) contacting the candidate
mixture with tenascin-C, wherein nucleic acids having an increased
affinity to tenascin-C relative to the candidate mixture may be
partitioned from the remainder of the candidate mixture; b)
partitioning the increased affinity nucleic acids from the
remainder of the candidate mixture; and c) amplifying the increased
affinity nucleic acids to yield a ligand-enriched mixture of
nucleic acids (see U.S. patent application Ser. No. 08/434,425,
filed May 3, 1995, now U.S. Pat. No. 5,789,157, which is hereby
incorporated herein by reference).
[0024] As used herein, "candidate mixture" is a mixture of nucleic
acids of differing sequence from which to select a desired ligand.
The source of a candidate mixture can be from naturally-occurring
nucleic acids or fragments thereof, chemically synthesized nucleic
acids, enzymatically synthesized nucleic acids or nucleic acids
made by a combination of the foregoing techniques. In a preferred
embodiment, each nucleic acid has fixed sequences surrounding a
randomized region to facilitate the amplification process.
[0025] As used herein, "nucleic acid" means either DNA, RNA,
single-stranded or double-stranded, and any chemical modifications
thereof. Modifications include, but are not limited to, those which
provide other chemical groups that incorporate additional charge,
polarizability, hydrogen bonding, electrostatic interaction, and
fluxionality to the nucleic acid ligand bases or to the nucleic
acid ligand as a whole. Such modifications include, but are not
limited to, 2'-position sugar modifications, 5-position pyrimidine
modifications, 8-position purine modifications, modifications at
exocyclic amines, substitution of 4-thiouridine, substitution of
5-bromo or 5-iodo-uracil; backbone modifications, methylations,
unusual base-pairing combinations such as the isobases isocytidine
and isoguanidine and the like. Modifications can also include 3'
and 5' modifications such as capping.
[0026] "SELEX" methodology involves the combination of selection of
nucleic acid ligands which interact with a target in a desirable
manner, for example binding to a protein, with amplification of
those selected nucleic acids. Optional iterative cycling of the
selection/amplification steps allows selection of one or a small
number of nucleic acids which interact most strongly with the
target from a pool which contains a very large number of nucleic
acids. Cycling of the selection/amplification procedure is
continued until a selected goal is achieved. In the present
invention, the SELEX methodology is employed to obtain nucleic acid
ligands to tenascin-C.
[0027] The SELEX methodology is described in the SELEX Patent
Applications.
[0028] "SELEX target" or "target" means any compound or molecule of
interest for which a ligand is desired. A target can be a protein,
peptide, carbohydrate, polysaccharide, glycoprotein, hormone,
receptor, antigen, antibody, virus, substrate, metabolite,
transition state analog, cofactor, inhibitor, drug, dye, nutrient,
growth factor, etc. without limitation. In this application, the
SELEX target is tenascin-C.
[0029] "Complex" as used herein means the molecular entity formed
by the covalent linking of one or more tenascin-C nucleic acid
ligands with one or more markers. In certain embodiments of the
present invention, the complex is depicted as A-B-Y, wherein A is a
marker; B is optional, and comprises a linker; and Y is a
tenascin-C nucleic acid ligand.
[0030] "Marker" as used herein is a molecular entity or entities
that when complexed with the tenascin-C nucleic acid ligand, either
directly or through a linker(s) or spacer(s), allows the detection
of the complex in an in vivo or ex vivo setting through visual or
chemical means. Examples of markers include, but are not limited to
radionuclides, including Tc-99m, Re-188, Cu-64, Cu-67, F-18,
.sup.125I, .sup.131I, .sup.32P, .sup.186Re; all fluorophores,
including fluorescein, rhodamine, Texas Red; derivatives of the
above fluorophores, including Rhodamine-Red-X; magnetic compounds;
and biotin.
[0031] As used herein, "linker" is a molecular entity that connects
two or more molecular entities through covalent bond or
non-covalent interactions, and can allow spatial separation of the
molecular entities in a manner that preserves the functional
properties of one or more of the molecular entities. A linker can
also be known as a spacer. Examples of a linker include, but are
not limited to, the (CH.sub.2CH.sub.2O).sub.- 6 and hexylamine
structures shown in FIG. 2.
[0032] "Therapeutic" as used herein, includes treatment and/or
prophylaxis. When used, therapeutic refers to humans and other
animals.
[0033] "Covalent Bond" is the chemical bond formed by the sharing
of electrons.
[0034] "Non-covalent interactions" are means by which molecular
entities are held together by interactions other than Covalent
Bonds including ionic interactions and hydrogen bonds.
[0035] In the preferred embodiment, the nucleic acid ligands of the
present invention are derived from the SELEX methodology. The SELEX
process is described in U.S. patent application Ser. No.
07/536,428, entitled Systematic Evolution of Ligands by Exponential
Enrichment, now abandoned, U.S. Pat. No. 5,475,096 entitled Nucleic
Acid Ligands and U.S. Pat. No. 5,270,163 (see also WO 91/19813)
entitled Methods for Identifying Nucleic Acid Ligands. These
applications, each specifically incorporated herein by reference,
are collectively called the SELEX Patent Applications.
[0036] The SELEX process provides a class of products which are
nucleic acid molecules, each having a unique sequence, and each of
which has the property of binding specifically to a desired target
compound or molecule. Target molecules are preferably proteins, but
can also include among others carbohydrates, peptidoglycans and a
variety of small molecules. SELEX methodology can also be used to
target biological structures, such as cell surfaces or viruses,
through specific interaction with a molecule that is an integral
part of that biological structure.
[0037] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0038] 1) A candidate mixture of nucleic acids of differing
sequence is prepared. The candidate mixture generally includes
regions of fixed sequences (i.e., each of the members of the
candidate mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: (a) to assist in the amplification steps described
below, (b) to mimic a sequence known to bind to the target, or (c)
to enhance the concentration of a given structural arrangement of
the nucleic acids in the candidate mixture. The randomized
sequences can be totally randomized (i.e., the probability of
finding a base at any position being one in four) or only partially
randomized (e.g., the probability of finding a base at any location
can be selected at any level between 0 and 100 percent).
[0039] 2) The candidate mixture is contacted with the selected
target under conditions favorable for binding between the target
and members of the candidate mixture. Under these circumstances,
the interaction between the target and the nucleic acids of the
candidate mixture can be considered as forming nucleic acid-target
pairs between the target and those nucleic acids having the
strongest affinity for the target.
[0040] 3) The nucleic acids with the highest affinity for the
target are partitioned from those nucleic acids with lesser
affinity to the target. Because only an extremely small number of
sequences (and possibly only one molecule of nucleic acid)
corresponding to the highest affinity nucleic acids exist in the
candidate mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the nucleic
acids in the candidate mixture (approximately 5-50%) are retained
during partitioning.
[0041] 4) Those nucleic acids selected during partitioning as
having the relatively higher affinity for the target are then
amplified to create a new candidate mixture that is enriched in
nucleic acids having a relatively higher affinity for the
target.
[0042] 5) By repeating the partitioning and amplifying steps above,
the newly formed candidate mixture contains fewer and fewer unique
sequences, and the average degree of affinity of the nucleic acids
to the target will generally increase. Taken to its extreme, the
SELEX process will yield a candidate mixture containing one or a
small number of unique nucleic acids representing those nucleic
acids from the original candidate mixture having the highest
affinity to the target molecule.
[0043] The basic SELEX method has been modified to achieve a number
of specific objectives. For example, U.S. patent application Ser.
No. 07/960,093, filed Oct. 14, 1992, now abandoned, and U.S. Pat.
No. 5,707,796 both entitled "Method for Selecting Nucleic Acids on
the Basis of Structure," describe the use of the SELEX process in
conjunction with gel electrophoresis to select nucleic acid
molecules with specific structural characteristics, such as bent
DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17,
1993, entitled "Photoselection of Nucleic Acid Ligands," now
abandoned, U.S. Pat. No. 5,763,177 entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Photoselection of Nucleic
Acid Ligands and Solution SELEX" and U.S. patent application Ser.
No. 09/093,293, filed Jun. 8 1998, entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Photoselection of Nucleic
Acid Ligands and Solution SELEX" all describe a SELEX based method
for selecting nucleic acid ligands containing photoreactive groups
capable of binding and/or photocrosslinking to and/or
photoinactivating a target molecule. U.S. Pat. No. 5,580,737
entitled "High-Affinity Nucleic Acid Ligands That Discriminate
Between Theophylline and Caffeine," describes a method for
identifying highly specific nucleic acid ligands able to
discriminate between closely related molecules, termed
Counter-SELEX. U.S. Pat. No. 5,567,588 entitled "Systematic
Evolution of Ligands by Exponential Enrichment: Solution SELEX,"
describes a SELEX-based method which achieves highly efficient
partitioning between oligonucleotides having high and low affinity
for a target molecule. U.S. Pat. No. 5,496,938 entitled "Nucleic
Acid Ligands to HIV-RT and HIV-1 Rev," describes methods for
obtaining improved nucleic acid ligands after SELEX has been
performed. U.S. Pat. No. 5,705,337 entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Chemi-SELEX," describes
methods for covalently linking a ligand to its target.
[0044] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or improved delivery characteristics. Examples of
such modifications include chemical substitutions at the ribose
and/or phosphate and/or base positions. SELEX-identified nucleic
acid ligands containing modified nucleotides are described in U.S.
Pat. No. 5,660,985 entitled "High Affinity Nucleic Acid Ligands
Containing Modified Nucleotides," that describes oligonucleotides
containing nucleotide derivatives chemically modified at the 5- and
2'-positions of pyrimidines. U.S. Pat. No. 5,637,459, supra,
describes highly specific nucleic acid ligands containing one or
more nucleotides modified with 2'-amino (2'-NH.sub.2), 2'-fluoro
(2'-F), and/or 2'-O-methyl (2'-OMe). U.S. patent application Ser.
No. 08/264,029, filed Jun. 22, 1994, entitled "Novel Method of
Preparation of Known and Novel 2' Modified Nucleosides by
Intramolecular Nucleophilic Displacement," describes
oligonucleotides containing various 2'-modified pyrimidines.
[0045] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S. Pat. No.
5,637,459 entitled "Systematic Evolution of Ligands by Exponential
Enrichment: Chimeric SELEX," and U.S. Pat. No. 5,683,867 entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX," respectively. These applications allow the combination of
the broad array of shapes and other properties, and the efficient
amplification and replication properties, of oligonucleotides with
the desirable properties of other molecules.
[0046] In U.S. Pat. No. 5,496,938 methods are described for
obtaining improved Nucleic Acid Ligands after the SELEX process has
been performed. This patent, entitled "Nucleic Acid Ligands to
HIV-RT and HIV-1 Rev," is specifically incorporated herein by
reference.
[0047] U.S. patent application Ser. No. 08/434,425, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Tissue
SELEX," filed May 3, 1995, now U.S. Pat. No. 5,789,157, describes
methods for identifying a nucleic acid ligands to a macromolecular
component of a tissue, including cancer cells, and the nucleic acid
ligands so identified. This patent is specifically incorporated
herein by reference.
[0048] One potential problem encountered in the diagnostic or
therapeutic use of nucleic acids is that oligonucleotides in their
phosphodiester form may be quickly degraded in body fluids by
intracellular and extracellular enzymes such as endonucleases and
exonucleases before the desired effect is manifest. Certain
chemical modifications of the nucleic acid ligand can be made to
increase the in vivo stability of the nucleic acid ligand or to
enhance or to mediate the delivery of the nucleic acid ligand. See,
e.g., U.S. patent application Ser. No. 08/117,991, filed Sep. 8,
1993, now abandoned, and U.S. Pat. No. 5,660,985, both entitled
"High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides", which is specifically incorporated herein by
reference. Modifications of the nucleic acid ligands contemplated
in this invention include, but are not limited to, those which
provide other chemical groups that incorporate additional charge,
polarizability, hydrophobicity, hydrogen bonding, electrostatic
interaction, and fluxionality to the nucleic acid ligand bases or
to the nucleic acid ligand as a whole. Such modifications include,
but are not limited to, 2'-position sugar modifications, 5-position
pyrimidine modifications, 8-position purine modifications,
modifications at exocyclic amines, substitution of 4-thiouridine,
substitution of 5-bromo or 5-iodo-uracil; backbone modifications,
phosphorothioate or alkyl phosphate modifications, methylations,
unusual base-pairing combinations such as the isobases isocytidine
and isoguanidine and the like. Modifications can also include 3'
and 5' modifications such as capping. In preferred embodiments of
the instant invention, the nucleic acid ligands are RNA molecules
that are 2'-fluoro (2'-F) modified on the sugar moiety of
pyrimidine residues.
[0049] The modifications can be pre- or post-SELEX process
modifications. Pre-SELEX process modifications yield nucleic acid
ligands with both specificity for their SELEX target and improved
in vivo stability. Post-SELEX process modifications made to 2'-OH
nucleic acid ligands can result in improved in vivo stability
without adversely affecting the binding capacity of the nucleic
acid ligand.
[0050] Other modifications are known to one of ordinary skill in
the art. Such modifications may be made post-SELEX process
(modification of previously identified unmodified ligands) or by
incorporation into the SELEX process.
[0051] The nucleic acid ligands of the invention are prepared
through the SELEX methodology that is outlined above and thoroughly
enabled in the SELEX applications incorporated herein by reference
in their entirety.
[0052] The tenascin-C aptamers of the invention bind to the heparin
binding site of the tenascin-C COOH terminus.
[0053] In certain embodiments of the present invention, the Nucleic
Acid ligands to tenascin-C described herein are useful for
diagnostic purposes and can be used to image pathological
conditions (such as human tumor imaging). In addition to diagnosis,
the tenascin-C nucleic acid ligands are useful in the prognosis and
monitoring of disease conditions in which tenascin-C is
expressed.
[0054] Diagnostic agents need only be able to allow the user to
identify the presence of a given target at a particular locale or
concentration. Simply the ability to form binding pairs with the
target may be sufficient to trigger a positive signal for
diagnostic purposes. Those skilled in the art would be able to
adapt any tenascin-C nucleic acid ligand by procedures known in the
art to incorporate a marker in order to track the presence of the
nucleic acid ligand. Such a marker could be used in a number of
diagnostic procedures, such as detection of primary and metastatic
tumors and athersclerotic lesions. The labeling marker exemplified
herein is technetium-99m; however, other markers such as additional
radionuclides, magnetic compounds, fluorophores, biotin, and the
like can be conjugated to the tenascin-C nucleic acid ligand for
imaging in an in vivo or ex vivo setting disease conditions in
which tenascin-C is expressed (e.g., cancer, atherosclerosis, and
psoriasis). The marker may be covalently bound to a variety of
positions on the tenascin-C nucleic acid ligand, such as to an
exocyclic amino group on the base, the 5-position of a pyrimidine
nucleotide, the 8-position of a purine nucleotide, the hydroxyl
group of the phosphate, or a hydroxyl group or other group at the
5' or 3' terminus of the tenascin-C nucleic acid ligand. In
embodiments where the marker is technetium-99m, preferably it is
bonded to the 5' or 3' hydroxyl of the phosphate group thereof or
to the 5 position of a modified pyrimidine. In the most preferred
embodiment, the marker is bonded to the 5' hydroxyl of the
phosphate group of the nucleic acid ligand with or without a
linker. In another embodiment, the marker is conjugated to the
nucleic acid ligand by incorporating a pyrimidine containing a
primary amine at the 5 position, and use of the amine for
conjugation to the marker. Attachment of the marker can be done
directly or with the utilization of a linker. In the embodiment
where technetium-99m is used as the marker, the preferred linker is
a hexylamine linker as shown in FIG. 2.
[0055] In other embodiments, the tenascin-C nucleic acid ligands
are useful for the delivery of therapeutic compounds (including,
but not limited to, cytotoxic compounds, immune enhancing
substances and therapeutic radionuclides) to tissues or organs
expressing tenascin-C. Disease conditions in which tenascin-C may
be expressed include, but are not limited to, cancer,
atherosclerosis, and psoriasis. Those skilled in the art would be
able to adapt any tenascin-C nucleic acid ligand by procedures
known in the art to incorporate a therapeutic compound in a
complex. The therapeutic compound may be covalently bound to a
variety of positions on the tenascin-C nucleic acid ligand, such as
to an exocyclic amino group on the base, the 5-position of a
pyrimidine nucleotide, the 8-position of a purine nucleotide, the
hydroxyl group of the phosphate, or a hydroxyl group or other group
at the 5' or 3' terminus of the tenascin-C nucleic acid ligand. In
the preferred embodiment, the therapeutic agent is bonded to the 5'
amine of the nucleic acid ligand. Attachment of the therapeutic
agent can be done directly or with the utilization of a linker. In
embodiments in which cancer is the targeted disease,
5-fluorodeoxyuracil or other nucleotide analogs known to be active
against tumors can be incorporated internally into existing U's
within the tenascin-C nucleic acid ligand or can be added
internally or conjugated to either terminus either directly or
through a linker. In addition, both pyrimidine analogues
2'2'-diFluorocytidine and purine analogues (deoxycoformycin) can be
incorporated. In addition, U.S. application Ser. No. 08/993,765,
filed Dec. 18, 1997, incorporated herein by reference in its
entirety, describes, inter alia, nucleotide-based prodrugs
comprising nucleic acid ligands directed to a tumor, for example
tenascin-C, for precisely localizing chemoradiosensitizers, and
radiosensitizers and radionuclides and other radiotherapeutic
agents to the tumor.
[0056] It is also contemplated that both the marker and therapeutic
agent may be associated with the tenascin-C nucleic acid ligand
such that detection of the disease condition and delivery of the
therapeutic agent is accomplished together in one aptamer or as a
mixture of two or more different modified versions of the same
aptamer. It is also contemplated that either or both the marker
and/or the therapeutic agent may be associated with a
non-immunogenic, high molecular weight compound or lipophilic
compound, such as a liposome. Methods for conjugating nucleic acid
ligands with lipophilic compounds or non-immunogenic compounds in a
diagnostic or therapeutic complex are described in U.S. patent
application Ser. No. 08/434,465, filed May 4, 1995, entitled
"Ligand Nucleic Acid Complexes," which is incorporated herein in
its entirety.
[0057] The therapeutic or diagnostic compositions described herein
may be administered parenterally by injection (e.g., intravenous,
subcutaneous, intradermal, intralesional), although other effective
administration forms, such as intraarticular injection, inhalant
mists, orally active formulations, transdermal iontophoresis or
suppositories, are also envisioned. They may also be applied
locally by direct injection, can be released from devices, such as
implanted stents or catheters, or delivered directly to the site by
an infusion pump. One preferred carrier is physiological saline
solution, but it is contemplated that other pharmaceutically
acceptable carriers may also be used. In one embodiment, it is
envisioned that the carrier and the tenascin-C nucleic acid ligand
complexed with a therapeutic compound constitute a
physiologically-compatible, slow release formulation. The primary
solvent in such a carrier may be either aqueous or non-aqueous in
nature. In addition, the carrier may contain other
pharmacologically acceptable excipients for modifying or
maintaining the pH, osmolarity, viscosity, clarity, color,
sterility, stability, rate of dissolution, or odor of the
formulation. Similarly, the carrier may contain still other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release, or
absorption of the tenascin-C nucleic acid ligand. Such excipients
are those substances usually and customarily employed to formulate
dosages for parental administration in either unit dose or
multi-dose form.
[0058] Once the therapeutic or diagnostic composition has been
formulated, it may be stored in sterile vials as a solution,
suspension, gel, emulsion, solid, or dehydrated or lyophilized
powder. Such formulations may be stored either in ready to use form
or requiring reconstitution immediately prior to administration.
The manner of administering formulations containing tenascin-C
nucleic acid ligands for systemic delivery may be via subcutaneous,
intramuscular, intravenous, intraarterial, intranasal or vaginal or
rectal suppository.
[0059] The following examples are provided to explain and
illustrate the present invention and are not to be taken as
limiting of the invention. Example 1 describes the materials and
experimental procedures used in Example 2 for the generation of RNA
ligands to tenascin-C. Example 2 describes the RNA ligands to
tenascin-C and the predicted secondary structure of a selected
nucleic acid ligand. Example 3 describes the determination of
minimal size necessary for high affinity binding of a selected
nucleic acid ligand, and substitution of 2'-OH purines with 2'-OMe
purines. Example 4 describes the biodistribution of Tc-99m labeled
tenascin-C nucleic acid ligands in tumor-bearing mice. Example 5
describes the use of a fluorescently labeled tenascin-C nucleic
acid ligand to localize tenascin-c within tumor tissue.
EXAMPLES
Example 1
Use of SELEX to Obtain Nucleic Acid Ligands to Tenascin-C and to
U251 Glioblastoma Cells
[0060] Materials and Methods
[0061] Tenascin-C was purchased from Chemicon (Temecula, Calif.).
Single-stranded DNA-primers and templates were synthesized by
Operon Technologies Inc. (Alameda, Calif.).
[0062] The SELEX-process has been described in detail in the SELEX
Patent Applications. In brief, double-stranded transcription
templates were prepared by Klenow fragment extension of 40N7a
ssDNA:
[0063] 5'-TCGCGCGAGTCGTCTG[40N]CCGCATCGTCCTCCC3' (SEQ ID NO:1)
[0064] using the 5N7 primer:
[0065] 5'-TAATACGACTCACTATAGGGAGGACGATGCGG-3' (SEQ ID NO:2)
[0066] which contains the T7 polymerase promoter (underlined). RNA
was prepared with T7 RNA polymerase as described previously in
Fitzwater, T., and Polisky, B. 1996. A SELEX primer. Methods
Enzymol. 267, 275-301, incorporated herein by reference in its
entirety. All transcription reactions were performed in the
presence of pyrimidine nucleotides that were 2'-fluoro (2'-F)
modified on the sugar moiety. This substitution confers enhanced
resistance to ribonucleases that utilize the 2'-hydroxyl moiety for
cleavage of the phosphodiester bond. Specifically, each
transcription mixture contained 3.3 mM 2'-F UTP and 3.3 mM 2'-F CTP
along with 1 mM GTP and ATP. The initial randomized RNA library
thus produced comprised 3.times.10.sup.14 molecules. The affinities
of individual ligands for tenascin-C were determined by standard
methods using nitrocellulose filter partitioning (Tuerk C, Gold L.
Science 1990 Aug. 3 ;249(4968):505-10).
[0067] For each round of SELEX, Lumino plates (Labsystems, Needham
Heights, Mass.) were coated for 2 hours at room temperature with
200 .mu.l Dulbecco's PBS containing tenascin-C concentrations as
shown in Table 1. After coating, wells were blocked using HBSMC+
buffer [20 mM Hepes, pH 7.4, 137 mM NaCl, 1 mM CaCl.sub.2, 1 mM
MgCl.sub.2 and 1 g/liter human serum albumin (Sigma, fraction V)
for rounds 1 to 6 while for rounds 7 and 8 wells were blocked
HBSMC+ buffer containing 1 g/liter casein (I-block; Tropix).
Binding and wash buffer consisted of HBSMC+ buffer containing 0.05%
Tween 20. For each SELEX round, RNA was diluted into 100 .mu.l of
binding buffer and allowed to incubate for 2 hours at 37.degree. C.
in the protein coated wells that were pre-washed with binding
buffer. After binding, six washes of 200 .mu.l each were performed.
Following the wash step, the dry well was placed on top of a
95.degree. C. heat block for 5 minutes. Standard AMV reverse
transcriptase reactions (50 .mu.l) were performed at 48.degree. C.
directly in the well and the reaction products utilized for
standard PCR and transcription reactions. Two synthetic primers 5N7
(see above) and 3N7a:
[0068] 5'-TCGCGCGAGTCGTCTG-3' (SEQ ID NO:3)
[0069] were used for these template amplification and reverse
transcription steps.
[0070] For cell SELEX, U251 human glioblastoma cells (Hum. Hered.,
1971, 21: 238) were grown to confluence in Dulbecco's Modified
Eagle's Medium supplemented with 10% fetal calf serum (GIBCO BRL,
Gaithersburg, Md.) on six-well tissue culture plates (Becton
Dickinson Labware, Lincoln Park, N.J.) and washed three times using
Dulbecco's PBS supplemented with CaCl.sub.2 (DPBS, GIBCO BRL)
buffer. RNA labeled internally by transcription (Fitzwater, 1996,
supra) was incubated with the cells at 37 degrees for one hour. The
labeled RNA was then removed, and the cells were washed six times
for ten minutes each at 37 degrees with DPBS. DPBS containing 5 mM
EDTA was then added and incubated with the cells for 30 minutes to
elute bound RNAs that remained after the washing steps. This RNA
was quantitated by a standard liquid scintillation counting
protocol and amplified using RT-PCR.
[0071] Binding assays for the U251 cells. Internally labeled RNA
was incubated at increasing concentrations with confluent U251
cells in six-well tissue culture plates (Becton Dickinson Labware,
Lincoln Park, N.J.) at 37 degrees for 60 min. Unbound RNA was
washed away using three 10 minute washes with DPBS+ CaCl.sub.2 at
37 degrees, and bound RNA was collected by disrupting the cells
using Trizol (Gibco BRL, Gaithersburg, Md.). Bound RNA was
quantitated by liquid scintillation counting.
[0072] Cloning and Sequencing. Amplified affinity enriched
oligonucleotide pools were purified on an 8% polyacrylamide gel,
reverse transcribed into ssDNA and the DNA amplified by the
polymerase chain reaction (PCR) using primers containing BamH1 and
HindIII restriction endonuclease sites. PCR fragments were cloned,
plasmids prepared and sequence analyses performed according to
standard techniques (Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual, 2.sup.nd Ed. 3 vols., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor).
Example 2
RNA Ligands to Tenascin-C
[0073] Nucleic Acid Ligands to U251 cells were obtained by the
SELEX process and are described in U.S. patent application Ser. No.
08/434,425, entitled "Systematic Evolution of Ligands by
Exponential Enrichment: Tissue SELEX," filed May 3, 1995, now U.S.
Pat. No. 5,789,157. Subsequently it was determined that the ligands
that were obtained were tenascin-C nucleic acid ligands.
[0074] To obtain oligonucleotide ligands against human tenascin-C,
eight rounds of SELEX were performed using the randomized
nucleotide library as described above in Materials and Methods. RNA
and protein input into each round is shown in Table 1. After 8
rounds of SELEX, the affinity of the oligonucleotide pool for
tenascin-C was 10 nM, and this affinity did not increase with
additional SELEX rounds.
[0075] To obtain ligands to U251 glioblastoma cells, nine rounds of
SELEX were performed using the randomized nucleotide library. After
nine rounds of binding to U251 cells and EDTA elution, rounds 3, 5
and 9 were tested for their ability to bind to U251 cells. FIG. 1
shows that as the number of SELEX rounds increases, the amount of
bound RNA also increases at a particular concentration. Because of
the complexity of the target tissue, it was not possible to
estimate the affinity of the oligonucleotide pools for the unknown
target molecules(s) on these cells.
[0076] The E9 pool (nine rounds of binding and EDTA elution from
U251 cells) was then used as a starting point for a SELEX against
purified tenascin-C. Two rounds of SELEX using purified tenascin-C
were performed as described above. Input protein and RNA
concentrations for two rounds of SELEX (E9P1 and E9P2) are
described in Table 2.
[0077] In summary, three different SELEX experiments were
performed: an experiment using purified tenascin-C as the target,
an experiment using U251 glioblastoma cells as the target, and an
experiment in which the SELEX pool from the U251 glioblastoma cells
was used to initiate a SELEX experiment using purified tenascin-C
as the target.
[0078] All three SELEX experiments were analyzed by cloning and
sequencing ligands from round 8 of the purified tenascin-C SELEX
("TN" sequences), from round 9 of the U251 cell SELEX ("E9"
sequences), and from round 2 of the U251/tenascin-C hybrid SELEX
("E9P2" sequences). The sequences of 34 unique clones are shown in
Table 3, and are divided into two major groups: tenascin-C ligands
("TN" and "E9P2" sequences) and U251 cell ligands ("E9" ligands).
Among the tenascin-C ligands, the majority of the clones (65 total)
represent one of two distinct sequence classes designated Family I
and Family II (FIG. 1). Examination of the variable region of the
12 clones in Family I revealed 7 unique sequences that are related
through the consensus sequence GACNYUUCCNGCYAC (SEQ ID NO: 12).
Examination of the variable region of the 18 clones in Family II
revealed sequences that share a consensus sequence CGUCGCC (Table
3;). The E9 sequences could be grouped into a related set by virtue
of conserved GAY and CAU sequences within the variable regions. The
remaining sequences did not appear related to other sequences and
were classified as orphans. Three sequences predominate, with
E9P2-1, E9P2-2, and TN9 represented 14, 16, and 10 times
respectively. In the "Orphan" category, one sequence, TN18, was
represented twice. Overall, these data represent a highly enriched
sequence pool.
[0079] Most individuals displayed low nanomolar dissociation
constants, with the three most prevalent sequences, TN9 and E9P2-1
and -2, having the highest affinities at 5 nM, 2 nM, and 8 nM.
(Table 3). These results indicate that the U251 cell SELEX is a
repository for aptamers against tenascin-C, and that only two
rounds of SELEX were required to isolate the tenascin-specific
ligands from the cell SELEX pool. Oligonucleotide ligands against
other proteins can be similarly isolated from the E9 pool using
purified protein targets.
Example 3
Determination of Minimal Size of TN9, and Substitution of 2'-OH
Purines with 2'-OMe Purines: Synthesis of Aptamer TTA1
[0080] Oligonucleotide synthesis procedures were standard for those
skilled in the art (Green L S, Jellinek D, Bell C, Beebe L A,
Feistner B D, Gill S C, Jucker F M, Janjic N. Chem Biol 1995
October; 2(10):683-95). 2'-fluoro pyrimidine phosphoramidite
monomers were obtained from JBL Scientific (San Luis Obispo,
Calif.); 2'-OMe purine, 2'-OH purine, hexyl amine, and
(CH.sub.2CH.sub.2O).sub.6 monomers, along with the dT polystyrene
solid support, were obtained from Glen Research (Sterling, Va.).
Aptamer affinities were determined using nitrocellulose filter
partitioning (Green et al., supra).
[0081] TN9 was chosen for further analysis based on its high
affinity for tenascin-C. We first searched for a minimal sequence
necessary for high affinity binding. Using standard techniques
(Green et al, supra), it was discovered that nucleotides 3' of
nucleotide 55 were required for binding to tenascin-C, while no
nucleotides could be removed from the 5' end without loss of
affinity. To further decrease the TN9's length from 55 nucleotides
and retain high affinity binding, we then attempted to define
internal deletions of TN9. The first 55 nucleotides of TN9, along
with the first 55 nucleotides of related family II ligands TN7,
TN21, and TN41, were input into a computer algorithm to determine
possible RNA secondary structure foldings (mfold 3.0, accessed at
http://www.ibc.wustl.edu/.about.zuker/. M. Zuker, D. H. Mathews
& D. H. Turner. Algorithms and Thermodynamics for RNA Secondary
Structure Prediction: A Practical Guide. In: RNA Biochemistry and
Biotechnology, J. Barciszewski & B. F. C. Clark, eds., NATO ASI
Series, Kluwer Academic Publishers, (1999)). Among many potential
RNA foldings predicted by the algorithm, a structure common to each
oligonucleotide was found. This structure, represented by
oligonucleotide TTA1 in FIG. 2, contains three stems that meet at a
single junction, a so-called 3-stem junction. This folding places
the most highly conserved nucleotides of family II oligonucleotides
at the junction area. In comparing TN9, TN7, TN21, and TN41, the
second stem was of variable length and sequence, suggesting that
extension of the second stem is not required for binding to
tenascin-C. Testing this hypothesis on TN9, we found that
nucleotides 10-26 could be replaced with an ethylene glycol linker,
(CH.sub.2CH.sub.2O).sub.6. The linker serves as a substitute loop
and decreases the size of the aptamer. Additionally,
four-nucleotide loops (CACU or GAGA) that replace nucleotides 10-26
produce sequences with high affinity for tenascin-C. It would be
well within one skilled in the art to determine other nucleotide
loops or other spacers that could replace nucleotides 10-26 to
produce sequences with high affinity for tenascin-C.
[0082] To increase protection against nuclease activity, purine
positions that could be substituted with the corresponding 2'-OMe
purines were located. The oligonucleotide was arbitrarily divided
into five sectors and all purines within each sector were
substituted by the corresponding 2'-OMe purine nucleotide, a total
of five oligonucleotides (Table 4, Phase I syntheses). The affinity
of each oligonucleotide for tenascin-C was determined, and it was
found that all purines within sectors 1, 3 and 5 could be
substituted without appreciable loss in affinity. Within sectors 2
and 4, individual purines were then substituted with 2'-OMe purines
and the effect of affinity was measured (Table 4, Phase III
syntheses). From these experiments, it was deduced that
substitution of nucleotides G9, G28, G31, and G34, with 2'-OMe G
causes loss in affinity for tenascin-C. Therefore these nucleotides
remain as 2'-OH purines in the aptamer TTA1.
[0083] The aptamer TTA1 (Table 4) was then synthesized with the
(CH.sub.2CH.sub.2O).sub.6 (Spacer 18) linker, a 3'-3' dT cap for
exonuclease protection, a 5' hexyl amine (Table 4), and all purines
as 2'-OMe except the 5 Gs indicated in Table 4. A non-binding
control aptamer, TTA1.NB, was generated by deleting 5 nucleotides
at the 3' end to produce TTA1.NB. TTA1 binds to tenascin-C with an
equilibrium dissociation constant (K.sub.d) of 5 nM, while TTA1.NB
has a K.sub.d of >5 .mu.M for tenascin-C.
[0084] Nucleotides 10-26 can be replaced by a non-nucleotide
ethylene glycol linker. It is therefore likely that TTA1 can be
synthesized in two separate pieces, where a break is introduced at
the position of the ethylene glycol linker and new 5' and 3' ends
are introduced. Subsequent to synthesis, the two molecules will
incubated together to allow hybrid formation. This method allows
introduction of additional amine groups as well as nucleotides at
the new 5' and 3 ends. The new functionalities could be used for
bioconjugation. In addition, two-piece synthesis results in
increased chemical synthetic yield due to shortening the length of
the molecules.
Example 4
Biodistribution of Tc-99m Labeled Aptamers in Tumor-Bearing
Mice
[0085] Aptamer biodistribution was tested by conjugating a Tc-99m
chelator (Hi.sub.15; Hilger, C. S., Willis, M. C., Wolters, M.
Pieken, W. A. 1998. Tet, Lett 39, 9403-9406) to the 5' end of the
oligonucleotide as shown in FIG. 2, and radiolabeling the aptamer
with Tc-99m. TTA1 and TTA1.NB were conjugated to Hi.sub.15 at 50
mg/ml aptamer in 30% dimethylformamide with 5 molar equivalents of
Hi.sub.15-N-hydoxysuccinimide, buffered in 100 mM Na Borate pH 9.3,
for 30 minutes at room temperature. Reversed phase HPLC
purification yielded Hi.sub.15-TTA1 and Hi.sub.15-TTA1.NB. The
oligonucleotides were then labeled with Tc-99m in the following
manner: to 1 nmole Hi15-aptamer was added 200 .mu.L of 100 mM NaPO4
buffer, pH 8.5, 23 mg/mL NaTartrate, and 50 .mu.L Tc-99m
pertechnetate (5.0 mCi) eluted from a Mo-99 column (Syncor, Denver)
within 12 hours of use. The labeling reaction was initiated by the
addition of 10 .mu.L 5 mg/mL SnCl.sub.2. The reaction mixture was
incubated for 15 minutes at 90.degree. C. The reaction was
separated from unreacted Tc-99m by spin dialysis through a 30,000
MW cut-off membrane (Centrex, Schleicher & Scheull) with two
300 .mu.L washes. This labeling protocol results in 30-50% of the
added 99mTc being incorporated with a specific activity of 2-3
mCi/nmole RNA. The Tc-99m is bound through the 5'G as shown in FIG.
5.
[0086] For biodistribution experiments, U251 xenograft tumors were
prepared as follows: U251 cells were cultured in Dulbeccos'
Modified Eagle's Medium supplemented with 10% v/v fetal calf serum
(Gibco BRL, Gaithersburg, Md.). Athymic mice (Harlan Sprague
Dawley, Indianapolis, Ind.) were injected subcutaneously with
1.times.10.sup.6 U251 cells. When the tumors reached a size of
200-300 mg (1-2 weeks), Tc-99m labeled aptamer was injected
intravenously at 3.25 mg/kg. At indicated times, animals were
anesthetized using isoflurane (Fort Dodge Animal Health, Fort
Dodge, Iowa), blood was collected by cardiac puncture, and the
animal was sacrificed and tissues were harvested. Tc-99m levels
were counted using a gamma counter (Wallac Oy, Turku, Finland).
Aptamer uptake into tissues was measured as the % of injected dose
per gram of tissue (% ID/g).
[0087] Images of mice were obtained using a gamma camera. Mice were
placed onto the camera (Siemens, LEM+) under anesthesia
(isoflurane). Data were collected (30 sec to 10 minutes) and
analyzed using Nuclear MAC software version 3.22.2 (Scientific
Imaging, CA) on a Power MAC G3 (Apple Computer, CA).
[0088] Biodistribution experiments, Table 5, indicated rapid and
specific uptake of the aptamer into tumor tissue; the non-binding
aptamer does not remain in the tumor. Blood levels of Tc-99m also
cleared rapidly. After three hours, Tc-99m levels brought into the
tumor using Hi.sub.15-TTA1 had a very long half life (>18 hrs).
This indicates that once the aptamer penetrates the tumor, the
radiolabel carried with it remains in the tumor for long periods of
time. Such data indicate that cytotoxic agents, including
radionuclides and non-radioactive agents, conjugated to the aptamer
will also remain in the tumor with long half lives.
[0089] Tc-99m radioactivity also appears in other tissues, notably
the small and large intestines. The hepatobiliary clearance pattern
seen here can be readily altered by those skilled in the art, for
example by altering the hydrophilicity of the Tc-99m chelator,
changing the chelator, or changing the radiometal/chelator pair
altogether.
[0090] Whole animal images were obtained using Tc-99m labeled
Hi.sub.15-TTA1 and at 3 hours post-injection. Images obtained from
mice injected with Hi.sub.15-TTA1, but not from mice injected with
Hi.sub.15-TTA1.NB, clearly show the tumor (FIG. 3). Additional
radioactivity is evident in gastrointestinal tract, as predicted by
the biodistribution experiments.
Example 5
Use of Fluorescently Labeled TTA1 to Localize Tenascin-C Within
Tumor Tissue
[0091] Materials and Methods.
[0092] TTA1 and TTA1.NB were synthesized as described above.
Succinimdyl Rhodamine-Red-X (Molecular Probes, Eugene, Oreg.) was
conjugated to the 5' amine of the aptamers as described above for
H.sub.15-NHS conjugation. The Rhodamine-Red-X-conjugated aptamers,
TTA1-Red and TTA1.NB-Red, were purified by reversed phase HPLC.
U251 cell culture and tumor growth in nude mice were as described
above. Five nmol of TTA1-Red or TTA1.NB-Red were injected
intravenously into nude mice and at the desired time the animal was
placed under anesthesia, perfused with 0.9% NaCl, and sacrificed.
The tumor was excised and placed in formalin. After 24 hr in
formalin, 10 .mu.M sections were cut and Rhodamine-Red-X was
detected using a fluorescence microscope (Eclipse E800, Nikon,
Japan).
[0093] Results: TTA1-Red has identical affinity for tenascin-C as
the unconjugated parent aptamer, TTA1, at 5 nM. We compared tumor
fluorescence levels of TTA1-Red and TTA1.NB-Red 10 min
post-injection. The binding aptamer, TTA1-Red, strongly stains the
tumor but not adjacent tissue (FIG. 4). In contrast, only tissue
auto-fluorescence is detected with TTA1.NB-Red. These results
demonstrate the utility of the aptamer in fluorescent detection of
tenascin-C in vivo, and the aptamer may be similarly used for
staining tissues sections ex vivo.
1TABLE 1 Tenascin-C SELEX RNA and protein input. Tenascin-C RNA
Round (pMol/well) (pMol/well) 1 12 200 2 12 200 3 12 200 4 12 200 5
2 33 6 2 33 7 2 33 8 0.2 3.3
[0094]
2TABLE 2 Cell SELEX/tenascin-C SELEX RNA and protein input
Tenascin-C RNA Round (pMol/well) (pMol/well) E9P1 2 33 E9P2 2
33
[0095]
3TABLE 3 Tenascin-C Sequences: purified protein SELEX (tenascin
sequences) and U251 cell SELEX + purified protein SELEX (E9P2
sequences) SEQ ID NO: Family I TN11 4 ggGAggAcGauGcgg
CAAUcAAAACUcACGUUA UUCCC UCAUUCUAUUAGCUUCCC cagacgacucgcccga 10 nM
TN45 5 qggaggacgaugcgg CAAUCUcCGAAAAAGACUCUUCCU GCAUCCUCUcACCCCC
cagacgacucgcccga 30 nM TN4 6 gggaggacgaugcgg CAACCUc GAAAGACUUUUCCC
GCAUCACUGUGUACUCCCC cagacgacucgcccga 40 nM TN22 7 gggaggacgaugcgg
CAACCUc GAUAGACUUUUCCC GCAUCACUGUGUACUCCCC cagacgacucgcccga 40 nM
TN32(2) 8 gggAggAcgauCcgg cAaCCUcAA UCUuGaCAUUUCCC GcACCUAAAUUUG
CCCC cagacgacucgcccga 15 nM TN14 9 gggaggacgaugcgg CAAACGAUC ACU
UACCUUUCCU GCAUCUGCUAGC CUCCCC cagacgacucgcccga 20 nM TN44(3) 10
gggaggacgaugcgg ACGCCAGCCAUUGACCCUCGCUUCCACUAUUCCAUCCCCC
cagacgacucgcccga 10 nM TN29(2) 11 gggaggacgaugcgg
CCAACCUCAUUUUGACACUUCGCCGCACCUAAUUGCCCC cagacgacucgcccga 25 nM
consensus: 12 GACNYUUCCN GCAYC Family II E922-4(5) 13
gggaggacgaugcgg AACCCAUA ACGCGA ACCGACCAACAUGCCUCCCGUGCCCC
cagacgacucgcccga E9P2-1(14) 14 gggAggacgaugcgg UGCCCAUAG AAGCGU
GCCGCUAAUGCUAACGCCCUCCCC cagacgacucgcccga 2 nM E9P2-2(16) 15
gggaggacgaugcgg UGCCCACU AUGCGU GCCGAAAAACAUUUCCCCCUCUACCC
cagacgacucgcccga 8 nM TN7 (3) 16 gggaggacgaugcgg
AACACUUUCCCAUGCGUCGCC AUACC GGAUAUAUUGCUCC cagacgacucgcccga 20 nM
TN21(4) 17 gggaggacgaugcgg ACUGGACCAAACCGUCGCCGAUACCCGGAUACUUUGCUCC
cagacgacucgcccga 10 nM TN9(10) 18 gggaggacgaugcgg
AACAAUGCACUCGUCGCCGUAAU GGAUGUUUUGCUCCCUG cagacgacucgcccga 5 nM
TN41 19 gggaggacgaugcgg UUAAGUCUCGGUUGAAU GCCCAUCCC AGAUCCCCCUGACC
cagacgacucgcccga 20 nM consensus: GCGUCGCCG Orphans E992-17 20
gggaggacgaugcgg AUGGCAAGUCGAACCAUCCCCCACGCUUCUCCUGUUCCCC
cagacgacucgcccga E992-48 21 gggaggacgaugcgg
GAAGUUUUcUCUGCCUUGGUUUCGAUU- GGCGCCUccCCCC cagacgacucgcccga1
E9P2-14 22 gggaggacgaugcgg UCGAGCGgUCGACCGUCAACAAGAAUAAAGCGUGUCCCUG
cagacgacucgcccga E9P2-17 23 gggaggacgaugcgg
AUGGCAAGUCGAACCAUCCCCCACGCUUCUCCUGUUCCCC cagacgacucgcccga E9P2-22
24 gggaggacgaugcgg ACUAGACcgCGAGUCCAUUCAACUUGCCCAAAAaAAAACcUCCCC
cagacgacucgcccga E9P2-40 25 gggaggacgaugcgg
GAGAUCAACAUUCCUCUAGUUUGGUUCCAACCUACACCCC cagacgacucgcccga E9P2-41
26 gggaggacgaugcgg ACGAGCGUCUCAUGAUCACACUAUUUCGUCUCAGUGUGCA
cagacgacucgcccga TNT8 27 gggaggacgaugcgg
UCGACCUCGAAUGACUCUCCACCUAUCUAACAUCCCCCCC cagacgacucgcccga 145 nM
TN20 28 gggaggacgaugcgg UCGACCUCGAAUGACUCUCCACCUAUCUAACAGCCUUCCC
cagacgacucgcccga TN5T 29 gggaggacgaugcgg
AGAACUCAUCCUAACCGCUCUAACAAAUCUUGUCCGACCG cagacgacucgcccga TN8 30
gggaggacgaugcgg AUAAUUcGACACCAACCAGGUCCCGGAAAUCAUCCCUCUG
cagacgacucgcccga >10 uM TN27 31 gggaggacgaugcgg
AAACCAACCGUUGACCAC CUUUUCGUUUCCGGAAAGUCCC cagacgacucgcccga 110 nM
TN39 32 gggaggacgaugcgg AAGCCAACCCUCUAGUCAGCCUUUCGUUUCCCACGCCACC
cagacgacucgcccga TN24 33 gggaggacgaugcGg
gACCAACUAAACUGUUCGAAAGCUGGaACAUGU- CCUGACGC cagacgacucgcccga 10 nM
TN5 34 gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUGGAACACGUCCUGACGC
cagacgacucgcccga TN3G 35 gggaggacgaugcgg
ACCAACUAAACUGUUCGAAAGCUAGAACACGUCCAGACGC cagacgacucgcccga TN36 36
gggaggacgaugcgg ACCAACUAAACUGUUCGAAAGCUGGAACACGUUCUGACGC
cagacgacucgcccga TN10 37 gggaggacgaugcgg
ACCAACUAAACUGUUCGAAAGCUGGAAUACGUCCUGACGC cagacgacucgcccga TN1 38
gggaggacgaugcgg AAGUUUA GuGCUCCAGUUCCGACACUCCUcUACUCAGCCC
cagacgacucgcccga >10 uM TN109 39 qggaggacgaugcgG
AgCCAGAGCCUcUcUcAGUUcUaCAGAACUuACCcACUGG cagacgacucgcccga TN110 40
gggaggacgaugcgg ACCUAACUCAAUCAGGAACCAAACCUAGCACUCUCAUGGC
cagacgacucgcccga U251 SELEX Aptamers, EDTA Elution (E9) E9-8(3) 41
gggaggacgaugcgg GAGAUCAACAUUCCUCUAGUUUGGUUCCCAACCUACACCCC
cagacgacucgcccga E9-15 42 gggaggacgaugcgg
AUCUCGAUCCUUCAGCACUUCAUUUCAUUCCUUUcUGCCC cagacgacucgcccga E9-6 43
gggaggacgaugcgg ACGAUCCUUUCCUUA CAUUUCAUCAUUUCUCUUGUGCCC
cagacgacucgcccga E9-5(2) 44 gggaggacgaugcgg UGACGACAACUCGACUG
CAUAUCUCACAACUCCUGUGCCC cagacgacucgcccga E9-3(6) 45 gggaggacgaugcgg
ACUAGACCGCGAGUC CAUUCAACUUGCCCAAAAACCUCCCC cagacgacucgcccga E9-9 46
gggaggacgaugcgg GCGCAUCGACCAACAUCCGAUUCGGAUUCCUCCACUCCC- C
cagacgacugcccga
[0096]
4TABLE 4 2'-OMe Substitutions, Internal Deletions, TTA1, and
TTA1.NB Sequence SEQ ID NO: Kd Phase I. 2'-OMe.Affinity. TN9.3 47
gggaggacgaugcggAACAAUGCACUCGUCGCCGUAAUG- GAUGUUUUGCU5 >10 uM
TN9.4 48 GGGAGGACGAUGCGGAACAAUGCAC- UCGUCGCCGUAAUGGAUGUUUUGCUCCCUG5
2 nM TN9.4M1 49
66676GACGAUGCGGAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCUCCCU65 6 nM
TN9.4M2 50 GGGAG67C67U6C6GAACAAUGCACUCGUCGCCGUAAUGGAUGUUUUGCUCCUG5
20 nM TN9.4M3 51 GGGAGGACGAUGCG677C77U6C7CUCGUCGCCGUAAUGGAUG-
UUUUGCUCCCUG5 7 nM TN9.4M4 52 GGGAGGACGAUGCGGAACAAUGCACUC-
6UC6CC6UAAUGGAUGUUUUGCUCCCUG5 nb TN9.4M5 53
GGGAGGACGAUGCGGAACAAUGCACUCGUCGCCGU77U667U6UUUU6CUCCCUG5 4 nM
TN9.4Me 54
16667667C67U6C6677C77U6C7CUC6UC6CC6U77U667U6UUUU6CUCCCU65 10 nM
Phase III. 2'-OMe.Affinity. TN9.4M1235 55
16667667C67U6C6677C77U6C7CUCGCUCGCCGU77U667U6UUUU6CUCCCU65 16.5 nM
TN9.4M135G6 56 1666766ACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6-
CUCCCU65 2.2 nM TN9.4M135A7 57 166676G7CGAUGCG677C77U6C7CU-
CGUCGCCGU77U667U6UUUU6CUCCCU65 1.7 nM TN9.4M135G9 58
166676GAC6AUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 7.7 nM
TN9.4M135A10 59 166676GACG7UGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6C-
UCCCU65 1.3 nM TN9.4M135G12c14 60 166676GACGAU6C6677C77U6C-
7CUCGUCGCCGU77U667U6UUUU6CUCCCU65 2.5 nM TN9.4M135G28 61
166676GACGAUGCG677C77U6C7CUC6UCGCCGU77U667U6UUUU6CUCCCU65 37 nM
TN9.4M135G31 62 166676GACGAUGCG677C77U6C7CUCGUCGCCGU77U667U6UUUU6C-
UCCCU65 55 nM TN9.4M135G34 63 166676GACGAUGCG677C77U6C7CUC-
GUCGCCGU77U667U6UUUU6CUCCCU65 7 nM TTA1: 64
5'-1G667667CG-(CH.sub.2CH.sub.2O).sub.6-CGUCGCCGU77U667U6UUUU6CUCCCU65
5 nM TTA1.NB: 65 5'-1G667667CG-(CH.sub.2CH.sub.2O).sub.6-CG-
UCGCCGU77U667U6UUUU6CU5 >5 uM 6 = mG; 7 = mA; 5 = 3'-3' Cap, 1 =
hexylamine
[0097]
5TABLE 5 Biodistribution of Tc-99m-TTA1 and -TTA1.NB min TTA1
TTA1.NB tumor 2 4.470 .+-. 0.410 4.510 .+-. 0.300 10 5.940 .+-.
0.590 3.020 .+-. 0.210 60 2.689 .+-. 0.310 0.147 .+-. 0.018 180
1.883 .+-. 0.100 0.043 .+-. 0.004 570 1.199 .+-. 0.066 0.018 .+-.
0.001 1020 1.150 .+-. 0.060 N/A blood 2 18.247 .+-. 1.138 15.013
.+-. 0.506 10 2.265 .+-. 0.245 2.047 .+-. 0.195 60 0.112 .+-. 0.003
0.102 .+-. 0.019 180 0.032 .+-. 0.001 0.034 .+-. 0.003 570 0.013
.+-. 0.001 0.011 .+-. 0.001 1020 0.006 .+-. 0.001 N/A lung 2 8.970
.+-. 1.210 8.130 .+-. 0.960 10 2.130 .+-. 0.080 1.940 .+-. 0.230 60
0.157 .+-. 0.011 0.120 .+-. 0.005 180 0.048 .+-. 0.006 0.041 .+-.
0.003 570 0.028 .+-. 0.006 0.017 .+-. 0.002 1020 0.007 .+-. 0.001
N/A liver 2 9.120 .+-. 0.530 7.900 .+-. 0.350 10 12.460 .+-. 1.250
9.100 .+-. 0.830 60 1.234 .+-. 0.091 0.423 .+-. 0.095 180 0.401
.+-. 0.084 0.211 .+-. 0.059 570 0.104 .+-. 0.017 0.058 .+-. 0.003
1020 0.075 .+-. 0.003 N/A spleen 2 5.100 .+-. 0.410 4.860 .+-.
0.130 10 2.460 .+-. 0.210 1.220 .+-. 0.120 60 0.643 .+-. 0.076
0.110 .+-. 0.015 180 0.198 .+-. 0.026 0.038 .+-. 0.005 570 0.062
.+-. 0.004 0.020 .+-. 0.001 1020 0.030 .+-. 0.003 N/A kidney 2
44.430 .+-. 4.280 54.470 .+-. 1.210 10 18.810 .+-. 0.940 14.320
.+-. 2.080 60 1.514 .+-. 0.040 0.637 .+-. 0.111 180 0.286 .+-.
0.028 0.221 .+-. 0.021 570 0.140 .+-. 0.006 0.100 .+-. 0.013 1020
0.081 .+-. 0.005 N/A sm. int. 2 3.690 .+-. 0.250 3.120 .+-. 0.100
10 7.010 .+-. 0.070 6.440 .+-. 0.250 60 15.716 .+-. 2.036 14.649
.+-. 0.532 180 1.479 .+-. 0.710 1.243 .+-. 0.405 570 0.219 .+-.
0.147 0.159 .+-. 0.067 1020 0.280 .+-. 0.243 N/A lg. int. 2 2.340
.+-. 0.240 2.280 .+-. 0.180 10 0.890 .+-. 0.040 0.770 .+-. 0.070 60
10.799 .+-. 5.381 21.655 .+-. 11.676 180 26.182 .+-. 7.839 18.023
.+-. 3.485 570 1.263 .+-. 0.706 0.716 .+-. 0.179 1020 0.298 .+-.
0.167 N/A muscle 2 1.270 .+-. 0.130 1.490 .+-. 0.050 10 0.870 .+-.
0.090 1.840 .+-. 1.000 60 0.064 .+-. 0.003 0.050 .+-. 0.004 180
0.016 .+-. 0.002 0.011 .+-. 0.001 570 0.011 .+-. 0.002 0.007 .+-.
0.001 1020 0.003 .+-. 0.0003
[0098]
Sequence CWU 1
1
65 1 71 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 1 tcgcgcgagt cgtctgnnnn nnnnnnnnnn nnnnnnnnnn
nnnnnnnnnn nnnnnnccgc 60 atcgtcctcc c 71 2 32 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 2
taatacgact cactataggg aggacgatgc gg 32 3 16 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Sequence 3 tcgcgcgagt
cgtctg 16 4 71 RNA Artificial Sequence Description of Artificial
Sequence Synthetic Sequence 4 gggaggacga ugcggcaauc aaaacucacg
uuauucccuc aucuauuagc uuccccagac 60 gacucgcccg a 71 5 71 RNA
Artificial Sequence Description of Artificial Sequence Synthetic
Sequence 5 gggaggacga ugcggcaauc uccgaaaaag acucuuccug cauccucuca
ccccccagac 60 gacucgcccg a 71 6 71 RNA Artificial Sequence
Description of Artificial Sequence Synthetic Sequence 6 gggaggacga
ugcggcaacc ucgaaagacu uuucccgcau cacuguguac ucccccagac 60
gacucgcccg a 71 7 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 7 gggaggacga ugcggcaacc
ucgauagacu uuucccgcau cacuguguac ucccccagac 60 gacucgcccg a 71 8 71
RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 8 gggaggacga ugcggcaacc ucaaucuuga cauuucccgc
accuaaauuu gcccccagac 60 gacucgcccg a 71 9 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 9
gggaggacga ugcggcaaac gaucacuuac cuuuccugca ucugcuagcc ucccccagac
60 gacucgcccg a 71 10 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 10 gggaggacga ugcggacgcc
agccauugac ccucgcuucc acuauuccau ccccccagac 60 gacucgcccg a 71 11
70 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 11 gggaggacga ugcggccaac cucauuuuga cacuucgccg
caccuaauug cccccagacg 60 acucgcccga 70 12 15 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 12
gacnyuuccn gcayc 15 13 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 13 gggaggacga ugcggaaccc
auaacgcgaa ccgaccaaca ugccucccgu gcccccagac 60 gacucgcccg a 71 14
70 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 14 gggaggacga ugcggugccc auagaagcgu gccgcuaaug
cuaacgcccu cccccagacg 60 acucgcccga 70 15 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 15
gggaggacga ugcggugccc acuaugcgug ccgaaaaaca uuucccccuc uaccccagac
60 gacucgcccg a 71 16 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 16 gggaggacga ugcggaacac
uuucccaugc gucgccauac cggauauauu gcucccagac 60 gacucgcccg a 71 17
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 17 gggaggacga ugcggacugg accaaaccgu cgccgauacc
cggauacuuu gcucccagac 60 gacucgcccg a 71 18 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 18
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccugcagac
60 gacucgcccg a 71 19 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 19 gggaggacga ugcgguuaag
ucucgguuga augcccaucc cagauccccc ugacccagac 60 gacucgcccg a 71 20
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 20 gggaggacga ugcggauggc aagucgaacc aucccccacg
cuucuccugu ucccccagac 60 gacucgcccg a 71 21 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 21
gggaggacga ugcgggaagu uuucucugcc uugguuucga uuggcgccuc ccccccagac
60 gacucgcccg a 71 22 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 22 gggaggacga ugcggucgag
cggucgaccg ucaacaagaa uaaagcgugu cccugcagac 60 gacucgcccg a 71 23
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 23 gggaggacga ugcggauggc aagucgaacc aucccccacg
cuucuccugu ucccccagac 60 gacucgcccg a 71 24 76 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 24
gggaggacga ugcggacuag accgcgaguc cauucaacuu gcccaaaaaa aaaccucccc
60 cagacgacuc gcccga 76 25 71 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Sequence 25 gggaggacga ugcgggagau
caacauuccu cuaguuuggu uccaaccuac acccccagac 60 gacucgcccg a 71 26
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 26 gggaggacga ugcggacgag cgucucauga ucacacuauu
ucgucucagu gugcacagac 60 gacucgcccg a 71 27 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 27
gggaggacga ugcggucgac cucgaaugac ucuccaccua ucuaacaucc ccccccagac
60 gacucgcccg a 71 28 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 28 gggaggacga ugcggucgac
cucgaaugac ucuccaccua ucuaacagcc uuccccagac 60 gacucgcccg a 71 29
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 29 gggaggacga ugcggagaac ucauccuaac cgcucuaaca
aaucuugucc gaccgcagac 60 gacucgcccg a 71 30 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 30
gggaggacga ugcggauaau ucgacaccaa ccaggucccg gaaaucaucc cucugcagac
60 gacucgcccg a 71 31 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 31 gggaggacga ugcggaaacc
aaccguugac caccuuuucg uuuccggaaa guccccagac 60 gacucgcccg a 71 32
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 32 gggaggacga ugcggaagcc aacccucuag ucagccuuuc
guuucccacg ccacccagac 60 gacucgcccg a 71 33 72 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 33
gggaggacga ugcgggacca acuaaacugu ucgaaagcug gaacaugucc ugacgccaga
60 cgacucgccc ga 72 34 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 34 gggaggacga ugcggaccaa
cuaaacuguu cgaaagcugg aacacguccu gacgccagac 60 gacucgcccg a 71 35
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 35 gggaggacga ugcggaccaa cuaaacuguu cgaaagcuag
aacacgucca gacgccagac 60 gacucgcccg a 71 36 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 36
gggaggacga ugcggaccaa cuaaacuguu cgaaagcugg aacacguucu gacgccagac
60 gacucgcccg a 71 37 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 37 gggaggacga ugcggaccaa
cuaaacuguu cgaaagcugg aauacguccu gacgccagac 60 gacucgcccg a 71 38
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 38 gggaggacga ugcggaaguu uagugcucca guuccgacac
uccucuacuc agccccagac 60 gacucgcccg a 71 39 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 39
gggaggacga ugcggagcca gagccucucu caguucuaca gaacuuaccc acuggcagac
60 gacucgcccg a 71 40 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 40 gggaggacga ugcggaccua
acucaaucag gaaccaaacc uagcacucuc auggccagac 60 gacucgcccg a 71 41
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 41 gggaggacga ugcgggagau caacauuccu cuaguuuggu
uccaaccuac acccccagac 60 gacucgcccg a 71 42 71 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 42
gggaggacga ugcggaucuc gauccuucag cacuucauuu cauuccuuuc ugccccagac
60 gacucgcccg a 71 43 71 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 43 gggaggacga ugcggacgau
ccuuuccuua acauuucauc auuucucuug ugccccagac 60 gacucgcccg a 71 44
71 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 44 gggaggacga ugcggugacg acaacucgac ugcauaucuc
acaacuccug ugccccagac 60 gacucgcccg a 71 45 72 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 45
gggaggacga ugcggacuag accgcgaguc cauucaacuu gcccaaaaac cucccccaga
60 cgacucgccc ga 72 46 70 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 46 gggaggacga ugcgggcgca
ucgagcaaca uccgauucgg auuccuccac ucccccagac 60 gacugcccga 70 47 50
RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 47 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu 50 48 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 48 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 49 55 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 49
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 50
55 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 50 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu cccug 55 51 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 51 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 52 55 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 52
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 53
55 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 53 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu cccug 55 54 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 54 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 55 55 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 55
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 56
55 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 56 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu cccug 55 57 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 57 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 58 55 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 58
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 59
55 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 59 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu cccug 55 60 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 60 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 61 55 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 61
gggaggacga ugcggaacaa ugcacucguc gccguaaugg auguuuugcu cccug 55 62
55 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Sequence 62 gggaggacga ugcggaacaa ugcacucguc gccguaaugg
auguuuugcu cccug 55 63 55 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Sequence 63 gggaggacga ugcggaacaa
ugcacucguc gccguaaugg auguuuugcu cccug 55 64 39 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 64
gggaggacgn cgucgccgua auggauguuu ugcucccug 39 65 34 RNA Artificial
Sequence Description of Artificial Sequence Synthetic Sequence 65
gggaggacgn cgucgccgua auggauguuu ugcu 34
* * * * *
References