U.S. patent application number 10/182936 was filed with the patent office on 2004-02-26 for reagents and methods for modulating dkk-mediated interactions.
Invention is credited to Allen, Kristina M., Anisowicz, Anthony, Damagnez, Veronique.
Application Number | 20040038860 10/182936 |
Document ID | / |
Family ID | 31886500 |
Filed Date | 2004-02-26 |
United States Patent
Application |
20040038860 |
Kind Code |
A1 |
Allen, Kristina M. ; et
al. |
February 26, 2004 |
Reagents and methods for modulating dkk-mediated interactions
Abstract
The present invention provides reagents, compounds,
compositions, and methods relating to novel interactions of the
extracellular domain of LRP5, HBM (a variant of LRP5), and/or LRP6
with Dkk, including Dkk-1. The various nucleic acids, polypeptides,
antibodies, assay methods, diagnostic methods, and methods of
treatment of the present invention are related to and impact on
Dkk, LRP5, LRP6, HBM, and Wnt signaling. Dkk, LRP5, LRP6, HBM, and
Wnt are implicated in bone and lipid cellular signaling. Thus, the
present invention provides reagents and methods for modulating
lipid levels and/or bone mass and is useful in the treatment and
diagnosis of abnormal lipid levels and bone mass disorders, such as
osteoporosis.
Inventors: |
Allen, Kristina M.;
(Hopkinton, MA) ; Anisowicz, Anthony; (West
Newton, MA) ; Damagnez, Veronique; (Framingham,
MA) |
Correspondence
Address: |
BURNS DOANE SWECKER & MATHIS L L P
POST OFFICE BOX 1404
ALEXANDRIA
VA
22313-1404
US
|
Family ID: |
31886500 |
Appl. No.: |
10/182936 |
Filed: |
August 2, 2002 |
PCT Filed: |
May 17, 2002 |
PCT NO: |
PCT/US02/15982 |
Current U.S.
Class: |
435/69.1 ;
514/1.1; 514/16.7; 514/16.9 |
Current CPC
Class: |
G01N 33/5041 20130101;
C07K 16/30 20130101; G01N 2333/4715 20130101; G01N 33/6887
20130101; C07K 16/2863 20130101; C07K 2317/34 20130101; C07K 16/18
20130101; G01N 2500/02 20130101; C07K 16/28 20130101 |
Class at
Publication: |
514/2 |
International
Class: |
A61K 038/45 |
Claims
We claim:
1. A method of regulating LRP5, LRP6, or HBM activity in a subject
comprising administering a composition which modulates a Dkk
activity in an amount effective to regulate LRP5, LRP6, or HBM
activity.
2. The method of any of claims 1, 24, 28, 33, 36, 37, 48, 64, 65,
93, 98, 101, 105, 107, 111, or 112, wherein the Dkk is Dkk-1.
3. The method of any of claims 1, 24, 28, or 33, wherein the Dkk is
Dkk-1 and the Dkk activity is inhibited.
4. The method of claims 1 or 24, wherein the Dkk activity modulates
bone mass and/or lipid levels.
5. The method of claim 4, wherein bone mass is increased and/or
lipid levels are decreased.
6. The method of claim 5, wherein the increase in bone mass is
determined via one or more of a decrease in fracture rate, an
increase in bone strength, an increase in bone density, an increase
in bone mineral density, an increase in trabecular connectivity, an
increase in trabecular density, an increase in cortical density, an
increase in bone diameter, and an increase in inorganic bone
content.
7. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises one or more compounds selected from the group
consisting of Dkk interacting proteins, or a Dkk-binding fragment
thereof.
8. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises an antisense, a siRNA, or shRNA molecule
which recognizes and binds to a nucleic acid encoding one or more
Dkk interacting proteins.
9. The method of any of claims 1, 24, 28, or 33, and wherein said
composition comprises a Dkk peptide aptamer.
10. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises a mimetic of a Dkk peptide aptamer.
11. The method of any of claims 1, 24, 28, or 33, wherein said
composition inhibits Dkk binding to LRP5, LRP6, or HBM.
12. The method of any of claims 1, 24, 28, or 33, wherein said
composition enhances binding of Dkk to LRP5, LRP6, or HBM.
13. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises a Dkk interacting protein peptide
aptamer.
14. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises a mimetic of a Dkk interacting protein
peptide aptamer.
15. The method of any of claims 1, 24, 28 or 33, wherein said
composition inhibits Dkk interacting protein or Dkk-binding
fragment thereof binding to Dkk.
16. The method of any of claims 1, 24, 28, or 33, wherein said
composition enhances binding of Dkk interacting protein or
Dkk-binding fragment thereof to Dkk.
17. The method of any of claims 1, 24, 28, or 33, wherein said
subject is a vertebrate or an invertebrate organism.
18. The method of any of claims 1, 24, 28, or 33, wherein said
subject is a mammal.
19. The method of any of claims 1, 24, 28, or 33, wherein said
subject is a canine, a feline, an ovine, a primate, an equine, a
porcine, a caprine, a camelid, an avian, a bovine, or a rodent.
20. The method of claim 19, wherein said primate is a human.
21. The method of any of claims 1, 24, 28, or 33, wherein said
composition comprises an LRP5 peptide aptamer.
22. The method of claim 21, wherein said peptide aptamer is OST262
(SEQ ID NO:208).
23. The method of any of claims 1, 24, 28 or 33, wherein the
composition comprises an LRP5 antibody or an immunologically active
fragment thereof.
24. A method of regulating Dkk-Wnt pathway activity in a subject
comprising administering a composition which modulates Dkk activity
in an amount effective to regulate Dkk-Wnt pathway activity.
25. The method of claims 24, 101, or 107, wherein the Wnt is one or
more of Wnt1-Wnt19.
26. The method of claim 25, wherein the Wnt is Wnt1, Wnt3, Wnt3a,
or Wnt10b.
27. The method of claim 24 wherein said composition which modulates
Dkk activity or modulates Dkk interaction with LRP5/LRP6/HBM is
administered in an amount effective to modulate Wnt signaling.
28. A method of modulating bone mass in a subject comprising
administering to the subject a composition which modulates Dkk
activity or Dkk interaction with LRP5, LRP6, or HBM in an amount
effective to modulate bone mass in the subject.
29. The method of claim 28, wherein bone mass is increased.
30. The method of the previous claim, wherein the increase in bone
mass is determined via one or more of a decrease in fracture rate,
an increase in bone strength, an increase in bone density, an
increase in bone mineral density, an increase in trabecular
connectivity, an increase in trabecular density, an increase in
cortical density, an increase in bone diameter, and an increase in
inorganic bone content.
31. The method of claims 28 or 36, wherein said subject has a bone
mass disorder selected from the group consisting of a bone
development disorder, a bone fracture, age-related loss of bone,
chrondrodystrophy, drug-induced bone disorder, high bone turnover,
hypercalcemia, hyperostosis, osteogenesis imperfecta, osteomalacia,
osteomyelitis, osteoporosis, Paget's disease, osteoarthritis, and
rickets.
32. The method of claim 28, wherein the composition which modulates
Dkk activity or Dkk interaction with LRP5, LRP6, or HBM is
administered in an amount effective to modulate the amount of
trabecular and/or cortical tissue.
33. A method of modulating lipid levels in a subject comprising
administering to the subject a composition which modulates Dkk
activity or Dkk interaction with LRP5, LRP6, or HBM in an amount
effective to modulate lipid levels in the subject.
34. The method of claim 33, wherein lipid levels are decreased.
35. The method of claim 33 or 36, wherein the subject has a
lipid-modulated disorder and wherein the lipid-modulated disorder
is selected from the group consisting of a cardiac condition,
atherosclerosis, familial lipoprotein lipase deficiency, familial
apoprotein CII deficiency, familial type 3 hyperlipoproteinemia,
familial hypercholesterolemia, familial hypertriglyceridemia,
multiple lipoprotein-type hyperlipidemia, elevated lipid levels due
to dialysis and/or diabetes, and elevated lipid levels of unknown
etiology.
36. A method of diagnosing low or high bone mass and/or high or low
lipid levels in a subject comprising examining expression of Dkk,
LRP5, LRP6, HBM, or and HBM-like variant in the subject and
determining whether Dkk, LRP5, LRP6, HBM, or an HBM-like variant is
over- or under-expressed to determine whether subject has (a) high
or low bone mass and/or (b) has high or low lipid levels.
37. A method of screening for a compound which modulates the
interaction of Dkk with LRP5, LRP6, HBM, or a Dkk-binding fragment
of LRP5, LRP6, or HBM comprising: (a) exposing Dkk and a LRP5,
LRP6, and/or HBM binding fragment thereof to a compound; and (b)
determining whether said compound modulates Dkk interaction with
the LRP5/LRP6/HBM binding fragment.
38. The method of claim 37, wherein said modulation is determined
by whether said compound binds to Dkk or the LRP5, LRP6, or HBM
binding fragment thereof.
39. The method of claim 37, wherein Dkk or a LRP-binding fragment
thereof is attached to a substrate.
40. The method of claim 37, wherein said compound comprises one or
more compounds selected from the group consisting of Dkk
interacting proteins, or a Dkk-binding fragment thereof.
41. The method of claim 37 or 48, wherein said compound comprises a
Dkk peptide aptamer.
42. The method of claim 37 or 48, wherein said compound comprises a
mimetic of a Dkk peptide aptamer.
43. The method of claim 37 or 48, wherein said compound comprises a
Dkk interacting protein peptide aptamer.
44. The method of claim 37 or 48, wherein the compound comprises an
LRP5 peptide aptamer.
45. The method of claim 44, wherein the peptide aptamer is OST262
(SEQ ID NO:208).
46. The method of claim 37 or 48, wherein the compound comprises an
LRP5 antibody.
47. The method of claim 37 or 48, wherein said compound is a
mimetic of a Dkk interacting protein peptide aptamer.
48. A method of screening for a compound which modulates the
interaction of Dkk with a Dkk interacting protein comprising: (a)
exposing a Dkk interacting protein or a Dkk-binding fragment
thereof to a compound; and (b) determining whether said compound
bound to a Dkk interacting protein or the Dkk-binding fragment
thereof; and (c) further determining whether said compound
modulates the interaction of Dkk interacting protein and Dkk.
49. The method of claim 48, wherein the Dkk interacting protein or
a Dkk-binding fragment thereof is attached to a substrate.
50. A composition comprising a LRP5, LRP6, or HBM
activity-modulating compound and a pharmaceutically acceptable
carrier therefor.
51. The composition of claim 50, wherein said LRP5, LRP6, or HBM
activity-modulating compound comprises a compound which binds to
Dkk thereby modulating the interaction of Dkk with LRP5, LRP6, or
HBM.
52. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises one or more Dkk interacting proteins
and Dkk-binding fragments thereof.
53. The composition of claim 50, wherein said LRP5, or LRP6, or HBM
modulating compound is a monoclonal antibody or an immunologically
active fragment thereof which binds to a Dkk interacting protein,
or a Dkk-binding fragment thereof.
54. The composition of claim 53, wherein the monoclonal antibody is
human, chimeric, humanized, primatized.RTM., or bispecific.
55. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises an antisense, a siRNA, or shRNA
molecule which recognizes and binds to a nucleic acid encoding one
or more Dkk interacting proteins.
56. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises a Dkk peptide aptamer.
57. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises a mimetic of a Dkk peptide
aptamer.
58. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises a Dkk interacting protein peptide
aptamer.
59. The composition of claim 50, wherein said LRP5, LRP6, or HBM
modulating compound comprises a mimetic of a Dkk interacting
protein peptide aptamer.
60. The composition of claim 50, wherein the compound comprises an
LRP5 peptide aptamer.
61. The composition of claim 60, wherein the peptide aptamer is
OST262.
62. The composition of claim 50, wherein the compound comprises an
LRP5 antibody.
63. A pharmaceutical composition comprising a compound which
modulates Dkk activity and a pharmaceutically acceptable carrier
therefor.
64. A method for identifying compounds which modulate Dkk and
LRP5/LRP6/HBM interactions comprising: (a) creating an LRP5, LRP6,
or HBM fluorescent fusion protein using a first fluorescent tag;
and (b) creating a Dkk fusion protein comprising a second
fluorescent tag; (c) adding a test compound; and (d) assessing
changes in the ratio of fluorescent tag emissions using
Fluorescence Resonance Energy Transfer (FRET) or Bioluminescence
Resonance Energy Transfer (BRET) to determine whether the compound
modulates Dkk and LRP5/LRP6/HBM interactions.
65. A method of identifying binding partners for a Dkk protein
comprising the steps of: (a) exposing the Dkk protein(s) or a
LRP5/LRP6 binding fragment thereof to a potential binding partner;
and (b) determining if the potential binding partner binds to a Dkk
protein or the LRP5/LRP6 binding fragment thereof.
66. A nucleic acid encoding a Dkk interacting protein peptide
aptamer comprising a nucleic acid encoding a scaffold protein
in-frame with the activation domain of Gal4 or LexA that is
in-frame with a nucleic acid that encodes a Dkk interacting protein
amino acid sequence.
67. A vector comprising the nucleic acid of claim 66.
68. The nucleic acid of claim 66, wherein the scaffold protein is
trxA.
69. A method of detecting a modulatory activity of a compound on
the binding interaction of a first peptide and a second peptide of
a peptide binding pair that bind through extracellular interaction
in their natural environment, comprising: (i) culturing at least
one eukaryotic cell comprising: a) a nucleotide sequence encoding a
first heterologous fusion protein comprising the first peptide or a
segment thereof joined to a transcriptional activation protein DNA
binding domain; b) a nucleotide sequence encoding a second
heterologous fusion protein comprising the second peptide or a
segment thereof joined to a transcriptional activation protein
transcriptional activation domain; wherein binding of the first
peptide or segment thereof and the second peptide or segment
thereof reconstitutes a transcriptional activation protein; and c)
a reporter element activated under positive transcriptional control
of the reconstituted transcriptional activation protein, wherein
expression of the reporter element produces a selected phenotype;
(ii) incubating the eukaryotic cell in the presence of a compound
under conditions suitable to detect the selected phenotype; and
(iii) detecting the ability of the compound to affect the binding
interaction of the peptide binding pair by determining whether the
compound affects the expression of the reporter element which
produces the selected phenotype; wherein (1) said first peptide is
a Dkk peptide and the second peptide is a peptide selected from
LRP5, HBM, LRP6 and the Dkk-binding portion of LRP5/LRP6/HBM or (2)
said first peptide is a Dkk interacting protein or the Dkk-binding
fragment thereof and said second peptide is a Dkk peptide.
70. The method of claim 69, wherein the eukaryotic cell is a yeast
cell.
71. The method of claim 70, wherein the yeast cell is
Saccharomyces.
72. The method of claim 71, wherein the Saccharomyces cell is
Saccharomyces cerevisiae.
73. The method of claim 69, wherein the Dkk is Dkk-1 and wherein
the compound comprises one or more Dkk interacting proteins or a
Dkk-binding fragment thereof.
74. The method of claim 73, wherein the compound is directly added
to assay.
75. The method of claim 73, wherein the compound is recombinantly
expressed by said eukaryotic cell in addition to said first and
second peptides.
76. The method of claim 69, wherein the compound comprises a Dkk
peptide aptamer.
77. The method of claim 69, wherein the compound comprises a
mimetic of a Dkk peptide aptamer.
78. The method of claim 69, wherein the compound comprises a Dkk
interacting protein peptide aptamer.
79. The method of claim 69, wherein the compound comprises a
mimetic of a Dkk interacting protein peptide aptamer.
80. The method of claim 69, wherein the eukaryotic cell further
comprises at least one endogenous nucleotide sequence selected from
the group consisting of a nucleotide sequence encoding the DNA
binding domain of a transcriptional activation protein, a
nucleotide sequence encoding the transcriptional activation domain
of a transcriptional activation protein, and a nucleotide sequence
encoding the reporter element, wherein at least one of the
endogenous nucleotide sequences is inactivated by mutation or
deletion.
81. The method of claim 69, wherein the peptide binding pair
comprises a ligand and a receptor to which the ligand binds.
82. The method of claim 69, wherein the transcriptional activation
protein is Gal4, Gcn4, Hap1, Adr1, Swi5, Ste12, Mcm1, Yap1, Ace1,
Ppr1, Arg81, Lac9, QalF, VP16, or a mammalian nuclear receptor.
83. The method of claim 69, wherein at least one of the
heterologous fusion proteins is expressed from an
autonomously-replicating plasmid.
84. The method of claim 69, wherein the DNA binding domain is a
heterologous DNA-binding domain of a transcriptional activation
protein.
85. The method of claim 84, wherein the DNA binding protein is
selected from the group consisting of a mammalian steroid receptor
and bacterial LexA protein.
86. The method of claim 69, wherein the reporter element is
selected from the group consisting of lacZ, a polynucleotide
encoding luciferase, a polynucleotide encoding green fluorescent
protein (GFP), and a polynucleotide encoding chloramphenicol
acetyltransferase.
87. The method of claim 86, wherein the reporter element is
LacZ.
88. The method of claim 69, wherein the test sample comprises an
LRP5 peptide aptamer.
89. The method of claim 88, wherein the peptide aptamer is OST262
(SEQ ID NO:208).
90. The method of claim 69, wherein the test sample comprises an
LRP5 antibody.
91. A transgenic animal wherein Dkk-1 is knocked out in a
tissue-specific fashion.
92. The transgenic animal of claim 91, wherein the tissue
specificity is bone tissue, cancer tissue, or liver tissue.
93. A method for identifying potential compounds which modulate Dkk
activity comprising: a) measuring the effect on binding of one or
more Dkk interacting proteins, or a Dkk-binding fragment thereof,
with Dkk or a fragment thereof in the presence and absence of a
compound; and b) identifying as a potential Dkk modulatory compound
a compound which modulates the binding between one or more Dkk
interacting proteins or Dkk-binding fragment thereof and Dkk or
fragment thereof.
94. A peptide aptamer of FIG. 3 (SEQ ID NOs:171-188) or FIG. 4 (SEQ
ID NOs:189-192).
95. An antibody or antibody fragment which recognizes and binds to
one or more peptides of amino acid sequences GNKYQTIDNYQPYPC (SEQ
ID NO:118), LDGYSRRTTLSSKMYHTKGQEG (SEQ ID NO:119),
RIQKDHHQASNSSRLHTCQRH (SEQ ID NO:120), RGEIEETITESFGND (SEQ ID
NO:121), EIFQRCYCGEGLSCRIQKD (SEQ ID NO:122), MYWTDWVETPRIE (SEQ ID
NO:123), MYWTDWGETPRIE (SEQ ID NO:124), KRTGGKRKEILSA (SEQ ID
NO:125), ERVEKTTGDKRTRIQGR (SEQ ID NO:126), KQQCDSFPDCIDGSDE (SEQ
ID NO:127), or a Dkk-1 amino acid sequence selected from the group
consisting Asn34-His266 (SEQ ID NO:110), Asn34-Cys245 (SEQ ID
NO:111), Asn34-Lys182 (SEQ ID NO:112), Cys97-His266 (SEQ ID
NO:113), Val139-His266 (SEQ ID NO:114), Gly183-His266 (SEQ ID
NO:115), Cys97-Cys245 (SEQ ID NO:116), or Val139-Cys245 (SEQ ID
NO:117).
96. The antibody or antibody fragment of claim 95, wherein the
antibody is a monoclonal antibody.
97. The antibody or antibody fragment of claim 95, wherein the
antibody is a polyclonal antibody
98. A method of identifying Dkk interacting proteins which modulate
the interaction of Dkk with the Wnt signaling pathway comprising:
(a) injecting Dkk and potential Dkk interacting protein mRNA into a
Xenopus blastomere; and (b) assessing axis duplication or analyzing
marker gene expression; and (c) identifying compositions which
elicit changes in axis duplication or marker gene expression as Dkk
interacting proteins which modulate the interaction of Dkk with the
Wnt signaling pathway.
99. The method of claim 98, wherein the mRNA of HBM, LRP5/6, any
Wnt, Wnt antagonist, Wnt pathway modulator, or combination of these
is co-injected into the Xenopus blastomere.
100. The method of claim 98, wherein the marker gene analyzed is
Siamois, Xnr3, slug, Xbra, HNK-1, endodermin, Xlhbox8, BMP2, BMP4,
XLRP6, EF-1, or ODC.
101. A method for identifying Dkk interacting proteins which
modulate the interaction of Dkk with the Wnt signaling pathway
comprising: (a) transfecting cells with constructs containing Dkk
and potential Dkk interacting proteins; and (b) assessing changes
in expression of a reporter gene linked to a Wnt-responsive
promoter; and (c) identifying as a Dkk interacting protein any
protein which alters reporter gene expression compared with cells
transfected with a Dkk construct alone.
102. The method of claim 101, wherein the cells are HOB-03-CE6,
HEK293, or U2OS cells.
103. The method of claim 101, wherein the Wnt-responsive promoter
is TCF or LEF.
104. The method of claim 101, wherein the cells are co-transfected
with CMV -galactosidase.
105. A method for identifying compounds which modulate Dkk and
LRP5/LRP6/HBM interactions comprising: (a) immobilizing
LRP5/LRP6/HBM to a solid surface; and (b) treating the solid
surface with a secreted Dkk protein or a secreted epitope-tagged
Dkk and a test compound; and (c) determining whether the compound
regulates binding between Dkk and LRP5/LRP6/HBM using antibodies to
Dkk or the epitope tag or by directly measuring activity of an
epitope tag.
106. The method of claim 105, wherein the epitope tag is alkaline
phosphatase, histidine, or a V5 tag.
107. A method for identifying compounds which modulate the
interaction of Dkk with the Wnt signaling pathway comprising: (a)
transfecting cells with constructs containing Dkk and Wnt proteins;
(b) assessing changes in expression of a reporter element linked to
a Wnt- responsive promoter; and (c) identifying as a Dkk/Wnt
interaction modulating compound any compound which alters reporter
gene expression compared with cells transfected with a Dkk
construct alone.
108. The method according to claim 107, wherein Wnt3a and Wnt1
constructs are co-transfected into the cells.
109. The method according to claim 107, wherein the cells are
U2-OS, HOB-03-CE6, or HEK293 cells.
110. The method according to claim 107, wherein the reporter
element used is TCF-luciferase, tk-Renilla, or a combination
thereof.
111. A method of testing compounds that modulate Dkk-mediated
activity in a mammal comprising (a) providing a group of transgenic
animals having (1) a regulatable one or more Dkk genes, (2) a
knock-out of Dkk genes, or (3) a knock-in of one or more Dkk genes;
(b) providing a second group of control animals respectively for
the group of transgenic animals in step (a); and (c) exposing the
transgenic animal group and control animal group to a potential
Dkk-modulating compound which modulates bone mass or lipid levels;
and (d) comparing the transgenic animals and the control group of
animals and determining the effect of the compound on bone mass or
lipid levels in the transgenic animals as compared to the control
animals.
112. A method of screening for compounds or compositions which
modulate the interaction of Dkk and a Dkk interacting protein
comprising: (a) exposing a Dkk interacting proteins or a
Dkk-binding fragment thereof to a compound; and (b) determining
whether said compound binds to a Dkk interacting proteins or the
Dkk-binding fragment thereof.
113. The method of claim 112, wherein said modulation is determined
by whether said compound binds to the Dkk interacting protein or
the Dkk-binding fragment thereof.
114. An antibody or antibody fragment which recognizes and binds to
a sequence depicted in FIG. 3 (SEQ ID NOs:171-188) or FIG. 4 (SEQ
ID NOs: 189-192).
Description
FIELD OF THE INVENTION
[0001] The present invention relates to signal transduction, bone
development, bone loss disorders, modulation of lipid-related
conditions, research reagents, methods of screening drug leads,
drug development, treatments for bone and/or lipid disorders,
screening and development of therapies, molecular, cellular, and
animal models of bone and/or lipid development and maintenance,
which are mediated by Dkk, including Dkk-1, and/or LRP5, LRP6, HBM
or other members of the Wnt pathway.
BACKGROUND OF THE INVENTION
[0002] Two of the most common types of osteoporosis are
postmenopausal and senile osteoporosis. Osteoporosis affects both
men and women, and, taken with other abnormalities of bone,
presents an ever-increasing health risk for an aging population.
The most common type of osteoporosis is that associated with
menopause. Most women lose between 20-60% of the bone mass in the
trabecular compartment of the bone within 3-6 years after the
cessation of menses. This rapid bone loss is generally associated
with an increase of bone resorption and formation. However, the
resorptive cycle is more dominant and the result is a net loss of
bone mass. Osteoporosis is a common and serious disease among
postmenopausal women. There are an estimated 25 million women in
the United States alone who are afflicted with this disease. The
results of osteoporosis are personally harmful, and also account
for a large economic loss due to its chronicity and the need for
extensive and long-term support (e.g., hospitalization and nursing
home care) from disease sequelae. This is especially true in
elderly patients. Additionally, while osteoporosis is generally not
thought of as a life-threatening condition, a 20-30% mortality rate
is related to hip fractures in elderly women. A large percentage of
this mortality rate can be directly associated with postmenopausal
osteoporosis.
[0003] The most vulnerable tissue in the bone to the effects of
postmenopausal osteoporosis is the trabecular bone. This tissue is
often referred to as spongy bone and is particularly concentrated
near the ends of the bone, near the joints, and in the vertebrae of
the spine. The trabecular tissue is characterized by small
structures which inter-connect with each other as well as the more
solid and dense cortical tissue which makes up the outer surface
and central shaft of the bone. This cris-cross network of
trabeculae gives lateral support to the outer cortical structure
and is critical to the biomechanical strength of the overall
structure. In postmenopausal osteoporosis, it is primarily the net
resorption and loss of the trabeculae which lead to the failure and
fracture of the bone. In light of the loss of the trabeculae in
postmenopausal women, it is not surprising that the most common
fractures are those associated with bones which are highly
dependent on trabecular support, e.g., the vertebrae, the neck of
the femur, and the forearm. Indeed, hip fracture, Colle's
fractures, and vertebral crush fractures are indicative of
postmenopausal osteoporosis. Osteoporosis affects cortical as well
as trabecular bone. Alterations in endosteal bone resorption and
Haversian remodeling with age affect cortical thickness and
structural integrity contributing the increased risk for
fracture.
[0004] One of the earliest generally accepted methods for treatment
of postmenopausal osteoporosis was estrogen replacement therapy.
Although this therapy frequently is successful, patient compliance
is low, primarily due to the undesirable side-effects of chronic
estrogen treatment. Frequently cited side-effects of estrogen
replacement therapy include reinitiation of menses, bloating,
depression, and, potentially, increased risk of breast or uterine
cancer. In order to limit the known threat of uterine cancer in
women who have not had a hysterectomy, a protocol of estrogen and
progestin cyclic therapy is often employed. This protocol is
similar to that used in birth control regimens, and often is not
tolerated by women because of the side-effects characteristic of
progestin. More recently, certain antiestrogens, originally
developed for the treatment of breast cancer, have been shown in
experimental models of postmenopausal osteoporosis to be
efficacious. Among these agents is raloxifene (See, U.S. Pat. No.
5,393,763; Black et al., J. Clin. Invest, 93:63-69 (1994); and
Ettinger et al., JAMA 282:637-45 (1999)). In addition, tamoxifen, a
widely used clinical agent for treating breast cancer, has been
shown to increase bone mineral density in post menopausal women
suffering from breast cancer (Love et al., N. Engl. J. Med.,
326:852-856 (1992)).
[0005] Another therapy for the treatment of postmenopausal
osteoporosis is the use of calcitonin. Calcitonin is a naturally
occurring peptide which inhibits bone resorption and has been
approved for this use in many countries (Overgaard et al., Br. Med.
J., 305:556-561 (1992)). The use of calcitonin has been somewhat
limited, however. Its effects are very modest in increasing bone
mineral density, and the treatment is very expensive. Another
therapy for the treatment of postmenopausal osteoporosis is the use
of bisphosphonates. These compounds were originally developed for
treating Paget's disease and malignant hypercalcemia. They have
been shown to inhibit bone resorption. Alendronate, a
bisphosphonate, has been approved for the treatment of
postmenopausal osteoporosis. These agents may be helpful in the
treatment of osteoporosis, but these agents also have potential
liabilities which include osteomalacia, extremely long half-life in
bone (greater than 2 years), and possible "frozen bone syndrome,"
e.g., the cessation of normal bone remodeling.
[0006] Senile osteoporosis is similar to postmenopausal
osteoporosis in that it is marked by the loss of bone mineral
density and resulting increase in fracture rate, morbidity, and
associated mortality. Generally, it occurs in later life, i.e.,
after 70 years of age. Historically, senile osteoporosis has been
more common in females, but with the advent of a more elderly male
population, this disease is becoming a major factor in the health
of both sexes. It is not clear what, if any, role hormones such as
testosterone or estrogen have in this disease, and its etiology
remains obscure. Treatment of this disease has not been very
satisfactory. Hormone therapy, estrogen in women and testosterone
in men, has shown equivocal results; calcitonin and bisphosphonates
may be of some utility.
[0007] The peak mass of the skeleton at maturity is largely under
genetic control. Twin studies have shown that the variance in bone
mass between adult monozygotic twins is smaller than between
dizygotic twins (Slemenda et al., J. Bone Miner. Res., 6: 561-567
(1991); Young et al, J. Bone Miner. Res., 6:561-567 (1995); Pocock
et al., J. Clin. Invest., 80:706-710 (1987); Kelly et al., J. Bone
Miner. Res., 8:11-17 (1993)). It has been estimated that up to 60%
or more of the variance in skeletal mass is inherited (Krall et
al., J. Bone Miner. Res., 10:S367 (1993)). Peak skeletal mass is
the most powerful determinant of bone mass in elderly years (Hui et
al., Ann. Int Med., 111:355-361 (1989)), even though the rate of
age-related bone loss in adult and later life is also a strong
determinant (Hui et al., Osteoporosis Int., 1:30-34 (1995)). Since
bone mass is the principal measurable determinant of fracture risk,
the inherited peak skeletal mass achieved at maturity is an
important determinant of an individual's risk of fracture later in
life. Thus, study of the genetic basis of bone mass is of
considerable interest in the etiology of fractures due to
osteoporosis.
[0008] Recently, a strong interest in the genetic control of peak
bone mass has developed in the field of osteoporosis. The interest
has focused mainly on candidate genes with suitable polymorphisms
to test for association with variation in bone mass within the
normal range, or has focused on examination of genes and gene loci
associated with low bone mass in the range found in patients with
osteoporosis. The vitamin D receptor locus (VDR) (Morrison et al.,
Nature, 367:284-287 (1994)), PTH gene (Howard et al., J. Clin.
Endocrinol. Metab., 80:2800-2805 (1995); Johnson et al., J. Bone
Miner. Res., 8:11-17 (1995); Gong et al., J. Bone Miner. Res.,
10:S462 (1995)) and the estrogen receptor gene (Hosoi et al., J.
Bone Miner. Res., 10:S170 (1995); Morrison et al., Nature,
367:284-287 (1994)) have figured most prominently in this work.
These studies are difficult because bone mass (i.e, the phenotype)
is a continuous, quantitative, polygenic trait, and is confounded
by environmental factors such as nutrition, co-morbid disease, age,
physical activity, and other factors. Also, this type of study
design requires large numbers of subjects. In particular, the
results of VDR studies to date have been confusing and
contradictory (Garnero et al., J. Bone Miner. Res., 10:1283-1288
(1995); Eisman et al., J. Bone. Miner. Res., 10:1289-1293 (1995);
Peacock, J. Bone Miner. Res., 10: 1294-1297 (1995)). Furthermore,
thus far, the art has not determined the mechanism(s) whereby the
genetic influences exert their effect on bone mass.
[0009] While it is well known that peak bone mass is largely
determined by genetic rather than environmental factors, studies to
determine the gene loci (and ultimately the genes) linked to
variation in bone mass are difficult and expensive. Study designs
which utilize the power of linkage analysis, e.g., sib-pair or
extended family, are generally more informative than simple
association studies, although the latter do have value. However,
genetic linkage studies involving bone mass are hampered by two
major problems. The first problem is the phenotype, as discussed
briefly above. Bone mass is a continuous, quantitative trait, and
establishing a discrete phenotype is difficult. Each anatomical
site for measurement may be influenced by several genes, many of
which may be different from site to site. The second problem is the
age component of the phenotype. By the time an individual can be
identified as having low bone mass, there is a high probability
that their parents or other members of prior generations will be
deceased and therefore unavailable for study, and younger
generations may not have even reached peak bone mass, making their
phenotyping uncertain for genetic analysis.
[0010] Thus, there is a need in the art for additional research
tools for the elucidation of the molecular mechanism of bone
modulation, for the screening and development of candidate drugs,
and for treatments of bone development and bone loss disorders. The
present invention is directed to these, as well as other, important
ends.
[0011] In addition to bone modulation, the present invention
relates to modulation of lipid levels. Cardiovascular disease is
the most common cause of mortality in the United States, and
atherosclerosis is the major cause of heart disease and stroke. It
is widely appreciated that cholesterol plays an important role in
atherogenesis. Normally, most cholesterol serves as a structural
element in the walls of cells, whereas much of the rest is in
transit through the blood or functions as the starting material for
the synthesis of bile acids in the liver, steroid hormones in
endocrine cells and vitamin D in skin. The transport of cholesterol
and other lipids through the circulatory system is facilitated by
their packaging into lipoprotein carriers. These spherical
particles comprise protein and phospholipid shells surrounding a
core of neutral lipid, including unesterified ("free") or
esterified cholesterol and triglycerides. Risk for atherosclerosis
increases with increasing concentrations of low density lipoprotein
(LDL) cholesterol, whereas risk is inversely proportional to levels
of high-density lipoprotein (HDL) cholesterol. The
receptor-mediated control of plasma LDL levels has been
well-defined, and recent studies have now provided new insights
into HDL metabolism.
[0012] The elucidation of LDL metabolism began in 1974 by Michael
Brown and Joseph Goldstein. In brief, the liver synthesizes a
precursor lipoprotein (very low density lipoprotein, VLDL) that is
converted during circulation to intermediate density lipoprotein
(IDL) and then to LDL. The majority of the LDL receptors expressed
in the body are on the surfaces of liver cells, although virtually
all other tissues ("peripheral tissues") express some LDL
receptors. After binding, the receptor-lipoprotein complex is
internalized by the cells via coated pits and vesicles, and the
entire LDL particle is delivered to lysosomes, wherein it is
dissembled by enzymatic hydrolysis, releasing cholesterol for
subsequent cellular metabolism. This whole-particle uptake pathway
is called "receptor-mediated endocytosis." Cholesterol-mediated
feedback regulation of both the levels of LDL receptors and
cellular cholesterol biosynthesis help ensure cellular cholesterol
homeostasis. Genetic defects in the LDL receptor in humans results
in familial hypercholesterolemia, a disease characterized by
elevated plasma LDL cholesterol and premature atherosclerosis and
heart attacks. One hypothesis for the deleterious effects of excess
plasma LDL cholesterol is that LDL enters the artery wall, is
chemically modified, and then is recognized by a special class of
receptors called macrophage scavenger receptors, that mediate the
cellular accumulation of the LDL cholesterol in the artery,
eventually leading to the formation of an atherosclerotic
lesion.
[0013] The major lipoprotein classes include intestinally derived
chylomicrons that transport dietary fats and cholesterol,
hepatic-derived VLDL, IDL, and LDL that can be atherogenic, and
hepatic- and intestinally-derived HDL that are antiatherogenic.
Apoprotein B (ApoB) is necessary for the secretion of chylomicrons
(ApoB48) and VLDL, IDL, and LDL (ApoB100). Plasma levels of VLDL
triglycerides are determined mainly by the rates of secretion in
LDL lipolytic activity. Plasma levels of LDL cholesterol are
determined mainly by the secretion of ApoB100 into plasma, the
efficacy with which VLDL are converted to LDL and by LDL
receptor-mediated clearance. Regulation of HDL cholesterol levels
is complex and is affected by rates of synthesis of its Apo
proteins, rates of esterification of free cholesterol to
cholesterol ester by LCAT, levels of triglyceride-rich lipoproteins
and CETP-mediated transfer of cholesterol esters from HDL, and
clearance from plasma of HDL lipids and Apo proteins.
[0014] Normal lipoprotein transport is associated with low levels
of triglycerides and LDL cholesterol and high levels of HDL
cholesterol. When lipoprotein transport is abnormal, lipoprotein
levels can change in ways that predispose individuals to
atherosclerosis and arteriosclerosis (see Ginsburg, Endocrinol.
Metab. Clin. North Am., 27:503-19 (1998)).
[0015] Several lipoprotein receptors may be involved in cellular
lipid uptake. These receptors include: scavenger receptors; LDL
receptor-related protein/a2-macroglobulin receptor (LRP); LDL
receptor; and VLDL receptor. With the exception of the LDL
receptor, all of these receptors are expressed in atherosclerotic
lesions while scavenger receptors are mostly expressed in
macrophages, the LRP and VLDL receptors may play an important role
in mediating lipid uptake in smooth muscle cells (Hiltunen et al.,
Atherosclerosis, 137 suppl.:S81-8 (1998)).
[0016] A major breakthrough in the pharmacologic treatment of
hypercholesterolemia has been the development of the "statin" class
of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG CoA reductase)
inhibitory drugs. 3-hydroxy-3-methylglutaryl-CoA reductase is the
rate controlling enzyme in cholesterol biosynthesis, and its
inhibition in the liver stimulates LDL receptor expression. As a
consequence, both plasma LDL cholesterol levels and the risk for
atherosclerosis decrease. The discovery and analysis of the LDL
receptor system has had a profound impact on cell biology,
physiology, and medicine.
[0017] HDL is thought to remove unesterified, or "free" cholesterol
(FC) from peripheral tissues, after which most of the cholesterol
is converted to cholesterol ester (CE) by enzymes in the plasma.
Subsequently, HDL cholesterol is efficiently delivered directly to
the liver and steroidogenic tissues via a selective uptake pathway
and the HDL receptor, SR-BI (class B type I scavenger receptor) or,
in some species, transferred to other lipoproteins for additional
transport in metabolism (see Krieger, Proc. Natl. Acad. Sci. USA,
95:4077-4080 (1998)).
[0018] These issues illustrate a need in the art for additional
research tools for the elucidation of the molecular mechanism of
lipid modulation, for the screening and development of candidate
drugs, and for treatments of lipid levels and lipid level
modulation disorders. The present invention is directed to these,
as well as other, important ends.
SUMMARY OF THE INVENTION
[0019] The present invention provides reagents, compounds,
compositions and methods relating to novel interactions of the
extracellular domain of LRP5, HBM (a variant of LRP5), and/or LRP6
with Dkk proteins. LRP5 is also referred to as Zmax1 or Zmax. Thus,
when discussing methods, reagents, compounds, and compositions of
the invention which relate to the interaction between Dkk and LRP5
(or Zmax1), the invention is also to be understood to encompass
embodiments relating to interactions between Dkk and LRP6 and Dkk
and HBM. Moreover, where Dkk is discussed herein, it is to be
understood that the methods, reagents, compounds, and compositions
of the present invention include the Dkk family members, including
but not limited to Dkk-1, Dkk-2, Dkk-3, Dkk-4 and Soggy.
Furthermore, the invention encompasses novel fragments of Dkk-1
which demonstrate a binding interaction between the ligand binding
domain (LBD) of LRP5 and additional proteins and/or which can
modulate an interaction between LRP5, or a variant or fragment
thereof, and a Dkk protein. The invention provides assays, methods,
compositions, and compounds relating to Dkk-Wnt signaling. Numerous
Wnt proteins are compatible with the present invention, including
Wnt1-Wnt19, and particularly, Wnt1, Wnt3, Wnt3a, and Wnt10b. The
present invention further provides reagents, compounds,
compositions and methods modulating interactions between one or
more other proteins and Dkk-1. The present invention also provides
a series of peptide aptamers which bind to Dkk-1 or to LRP5 (or HBM
and/or LRP6).
[0020] The polypeptides of the invention, for example in the form
of peptide oligomers, aptamers, proteins, and protein fragments as
well as the nucleic acids of the invention, for example in the form
of nucleic acids which encode the polypeptides of the invention as
well as antisense, or complimentary nucleic acids, are useful as
reagents for the study of bone mass and lipid level modulation. The
polypeptides and nucleic acids of the invention are also useful as
therapeutic and diagnostic agents.
[0021] The present invention provides useful reagents for the
modulation of Dkk proteins with LRP5, LRP6, and/or HBM, the
modulation Dkk-1 and/or Dkk-1 interacting protein activity, and
modulation of LRP5/Dkk-1, LRP6/Dkk1 and HBM/Dkk-1 interactions and
Dkk-1/Dkk-1 interacting protein interactions. The present invention
provides a series of peptide aptamers which bind Dkk-1 or LRP5,
LRP6, and/or HBM.
[0022] An object of the invention is to provide for a method of
regulating LRP5/LRP6/HBM/HBM-like activity in a subject comprising
administering a therapeutically effective amount of a composition
which modulates Dkk activity. The subject can be a vertebrate or an
invertebrate organism, but more preferably the organism is a
canine, a feline, an ovine, a primate, an equine, a porcine, a
caprine, a camelid, an avian, a bovine, or a rodent organism. A
more preferred organism is a human. In a preferred embodiment, the
Dkk protein is Dkk-1. In a particularly preferred embodiment, Dkk-1
activity is decreased. In another embodiment, Dkk activity
modulates bone mass and/or lipid levels. In a preferred embodiment,
bone mass is increased and/or lipid levels are decreased. In
another preferred embodiment, the modulation in bone mass is an
increase in bone strength determined via one or more of a decrease
in fracture rate, an increase in areal bone density, an increase in
volumetric mineral bone density, an increase in trabecular
connectivity, an increase in trabecular density, an increase in
cortical density or thickness, an increase in bone diameter, and an
increase in inorganic bone content. The invention further provides
such a method wherein the composition comprises a Dkk, Dkk-1 or a
LRP5/LRP6/HBM binding fragment thereof, such as those depicted in
FIG. 6 or a mimetic of those fragments depicted in FIG. 6. The
invention further provides such a method wherein the composition
comprises one or more of the proteins which interact with Dkk,
including Dkk-1, such as those depicted in FIG. 5, or a Dkk-binding
fragment thereof, or an antisense, siRNA, or shRNA molecule which
recognizes and binds to a nucleic acid encoding one or more Dkk
interacting or Dkk-1 interacting proteins. The invention further
provides such a method wherein the composition comprises an
LRP5/LRP6/Zmax1 antibody, Dkk antibody, a Dkk-1 antibody or an
antibody to a Dkk-1 interacting protein. The invention further
provides such a method wherein the compositions comprise an aptamer
of Dkk or Dkk-1, such as those depicted in FIG. 3 (SEQ ID
NOs:171-188), or a mimetic of such an aptamer. The method further
provides that invention further provides such a method wherein the
compositions comprise an aptamer of a Dkk interacting or Dkk-1
interacting protein, or a mimetic of such an aptamer.
[0023] A composition of the present invention may modulate activity
either by enhancing or inhibiting the binding of Dkk to
LRP5/LRP6/Zmax1, particularly Dkk-1, or the binding of Dkk-1 to a
Dkk-1 interacting protein, such as those shown in FIG. 5. A
composition of the present invention may comprise an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIGS. 4 (SEQ ID
NOs:189-192) (particularly, peptide (SEQ ID NO:191) and 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Preferred compositions of the present invention also comprise LRP5
antibodies.
[0024] Another aspect of the invention is to provide for a method
of regulating Dkk-Wnt pathway activity in a subject comprising
administering a therapeutically effective amount of a composition
which modulates Dkk-Wnt pathway activity. In a preferred
embodiment, the Dkk protein is Dkk-1. In a particularly preferred
embodiment, Dkk-1 activity is decreased. In another embodiment, Dkk
activity modulates bone mass and/or lipid levels. In a preferred
embodiment, bone mass is increased and/or lipid levels are
decreased. In another preferred embodiment, the modulation in bone
mass is an increase in bone strength determined via one or more of
a decrease in fracture rate, an increase in areal bone density, an
increase in volumetric mineral bone density, an increase in
trabecular connectivity, an increase in trabecular density, an
increase in cortical density or thickness, an increase in bone
diameter, and an increase in inorganic bone content. In another
preferred embodiment, the Wnt is Wnt1-Wnt19. In a particularly
preferred embodiment, the Wnt is Wnt1, Wn3, Wnt3a, or Wnt10b.
Preferred compositions comprise Dkk-modulating or Dkk-1-modulating
compounds or one or more Dkk interacting or Dkk-1 interacting
proteins, or a Dkk-binding fragment thereof. Other preferred Dkk
modulating compositions comprise a Dkk or Dkk-1 antibody or an
antibody to a Dkk interacting or Dkk-1 interacting protein. Also
contemplated are antisense, siRNA, and shRNA molecules which
recognize and bind to a nucleic acid encoding one or more Dkk-1
interacting proteins. The invention further provides such a method
wherein the composition comprises a biologically active or
LRP5/LRP6/HBM binding fragment of Dkk, including Dkk-1, such as
those depicted in FIG. 6 or a mimetic of those fragments depicted
in FIG. 6. The Dkk modulating composition may also comprise a
peptide aptamer of a Dkk interacting or Dkk-1 interacting protein,
or a mimetic of such an aptamer. A composition of the present
invention may modulate activity either by enhancing or inhibiting
the binding of Dkk, including Dkk-1, to LRP5, LRP6, or HBM or the
binding of Dkk, including Dkk-1, to a Dkk interacting protein, such
as those shown in FIG. 5. The invention further provides such a
method wherein the composition comprises an aptamer of Dkk or
Dkk-1, such as those depicted. A composition of the present
invention may comprise an LRP5 peptide aptamer, such as OST262 (SEQ
ID NO:208). Preferred compositions of the present invention also
comprise LRP5 antibodies.
[0025] A further aspect of the invention is to provide for a method
of modulating Wnt signaling in a subject comprising administering a
therapeutically effective amount of a composition which modulates
Dkk activity or modulates Dkk interaction with LRP5 (or LRP6 or
HBM). In a preferred embodiment, the Dkk protein is Dkk-1. In a
particularly preferred embodiment, Dkk-1 activity is decreased. In
another embodiment, Dkk activity modulates bone mass and/or lipid
levels. In a preferred embodiment, bone mass is increased and/or
lipid levels are decreased. In another preferred embodiment, the
modulation in bone mass is an increase in bone strength determined
via one or more of a decrease in fracture rate, an increase in
areal bone density, an increase in volumetric mineral bone density,
an increase in trabecular connectivity, an increase in trabecular
density, an increase in cortical density or thickness, an increase
in bone diameter, and an increase in inorganic bone content. In
another preferred embodiment, the Wnt is Wnt1-Wnt19. In a
particularly preferred embodiment, the Wnt is Wnt1, Wnt3, Wnt3a, or
Wnt10b. Preferred Wnt modulating compositions comprise one or more
Dkk interacting or Dkk-1 interacting proteins, or a biologically
active or LRP5/LRP6/HBM binding fragment thereof. Also contemplated
are antisense, siRNA, and shRNA molecules which recognize and bind
to a nucleic acid encoding one or more Dkk interacting or Dkk-1
interacting proteins. The invention further provides such a method
wherein the composition comprises a biologically active or
LRP5/LRP6/HBM binding fragment of Dkk or Dkk-1, such as those
depicted in FIG. 6 or a mimetic of those fragments depicted in FIG.
6. The Dkk modulating composition may also comprise a peptide
aptamer of a Dkk interacting or Dkk-1 interacting protein, or a
mimetic of such an aptamer. A composition of the present invention
may modulate activity either by enhancing or blocking the binding
of Dkk, including Dkk-1, to LRP5, LRP6, or HBM or the binding of
Dkk or Dkk-1 to a Dkk interacting or Dkk-1 interacting protein,
such as those shown in FIG. 5. The invention further provides such
a method wherein compositions comprising an aptamer of Dkk or
Dkk-1, such as those depicted in FIG. 3 (SEQ ID NOs:171-188), or a
mimetic of such an aptamer. The invention further provides such a
method wherein the composition comprises a Dkk or Dkk-1 antibody or
an antibody to a Dkk interacting or Dkk-1 interacting protein. The
invention further provides such a method wherein compositions of an
LRP5 peptide aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ
ID NO:189-192 (particularly peptide (SEQ ID NO:191) and FIG. 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Additional preferred compositions of the present invention also
comprise LRP5 antibodies.
[0026] Additionally, the invention provides for a method of
modulating bone mass and/or lipid levels in a subject comprising
administering to the subject a composition which modulates Dkk
activity or Dkk interaction with LRP5 in an amount effective to
modulate bone mass and/or lipid levels, wherein bone mass and/or
lipid levels are in need of modulation. In a preferred embodiment,
the Dkk protein is Dkk-1. In a particularly preferred embodiment,
Dkk-1 activity is decreased. In another embodiment, Dkk activity
modulates bone mass and/or lipid levels. In a preferred embodiment,
bone mass is increased and/or lipid levels are decreased. In
another preferred embodiment, the modulation in bone mass is an
increase in bone strength determined via one or more of a decrease
in fracture rate, an increase in areal bone density, an increase in
volumetric mineral bone density, an increase in trabecular
connectivity, an increase in trabecular density, an increase in
cortical density or thickness, an increase in bone diameter, and an
increase in inorganic bone content. Preferred bone mass and/or
lipid modulating compositions comprise one or more Dkk interacting
or Dkk-1 interacting proteins, or a biologically active or
LRP5/LRP6/HBM binding fragment thereof. Also contemplated are
antisense, siRNA, and shRNA molecules which recognize and bind to a
nucleic acid encoding one or more Dkk interacting or Dkk-1
interacting proteins. The invention further provides such a method
wherein the composition comprises a biologically active or
LRP5/LRP6/HBM binding fragment of Dkk, including Dkk-1, such as
those depicted in FIG. 6 or a mimetic of those fragments depicted
in FIG. 6. The Dkk modulating composition may also comprise a
peptide aptamer of a Dkk interacting or Dkk-1 interacting protein,
or a mimetic of such an aptamer. The invention further provides
such a method wherein the composition comprises an aptamer of Dkk
or Dkk-1, such as those depicted in FIG. 3 (SEQ ID NOs:171-188), or
a mimetic of such an aptamer. A composition of the present
invention may modulate activity either by enhancing or inhibiting
the binding of Dkk, including Dkk-1, to LRP5, LRP6, or HBM or the
binding of Dkk, including Dkk-1, to a Dkk interacting protein, such
as those shown in FIG. 5. The invention further provides such a
method wherein the composition comprises a Dkk or Dkk-1 antibody or
an antibody to a Dkk interacting or Dkk-1 interacting protein. A
composition of the present invention may comprise an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIGS. 4 (SEQ ID
NOs:189-192 (particularly peptide 13 (SEQ ID NO:191)) and 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Preferred compositions of the present invention also comprise LRP5
antibodies. It is a further aspect of the invention that such
lipid-modulated diseases include a cardiac condition,
atherosclerosis, familial lipoprotein lipase deficiency, familial
apoprotein CII deficiency, familial type 3 hyperlipoproteinemia,
familial hypercholesterolemia, familial hypertriglyceridemia,
multiple lipoprotein-type hyperlipidemia, elevated lipid levels due
to dialysis and/or diabetes, and an elevated lipid level of unknown
etiology.
[0027] Bone disorders contemplated for treatment and/or diagnosis
by the methods and compositions disclosed herein include a bone
development disorder, a bone fracture, age related loss of bone, a
chondrodystrophy, a drug-induced bone disorder, high bone turnover,
hypercalcemia, hyperostosis, osteogenesis imperfecta, osteomalacia,
osteomyelitis, osteoporosis, Paget's disease, osteoarthritis, and
rickets.
[0028] It is a further object of the invention to provide a method
of screening for compounds or compositions which modulates the
interaction of Dkk with LRP5, LRP6, HBM, or a Dkk-binding fragment
of LRP5, LRP6, or HBM comprising:
[0029] (a) exposing Dkk or a LRP5/LRP6/HBM binding fragment thereof
to a compound; and
[0030] (b) determining whether said compound binds to Dkk or the
LRP5/LRP6/HBM binding fragment thereof.
[0031] In a preferred embodiment, the Dkk is Dkk-1. In a
particularly preferred embodiment, the binding of Dkk-1 to
LRP5/LRP6/HBM is decreased.
[0032] It is a further object of the invention to provide a method
of screening compounds or compositions which modulate the
interaction of DKK with LRP5, LRP6, HBM, or a DKK-finding fragment
thereof comprising:
[0033] (a) exposing DKK or a LRP5/LRP6/HBM binding fragment thereof
to a compound; and,
[0034] (b) determining whether said compound modulates the
interaction of Dkk with LRP5, LRP6, or HBM, or the Dkk-binding
fragment of LRP5/LRP6/HBM.
[0035] In a preferred embodiment, the Dkk is Dkk-1. In a
particularly preferred embodiment, the interaction of Dkk-1 with
LRP5/LRP6/HBM is decreased.
[0036] It is a further object of the invention to provide a method
of screening for compounds or compositions which modulates the
interaction of Dkk with LRP5, LRP6, HBM, or a Dkk-binding fragment
of LRP5, LRP6, or HBM comprising:
[0037] (a) exposing Dkk or a LRP5/LRP6/HBM binding fragment thereof
to a compound;
[0038] (b) determining whether said compound binds to Dkk or the
LRP5/LRP6/HBM binding fragment thereof; and,
[0039] (c) further determining whether said compound modulates the
interaction of Dkk with LRP5, LRP6, or HBM, or the Dkk-binding
fragment of LRP5/LRP6/HBM.
[0040] In preferred embodiments of such methods, Dkk or a
biologically active fragment thereof is attached to a solid
substrate. In an alternative embodiment of the invention,
LRP5/LRP6/HBM, or a biologically active fragment thereof (such as
the ligand binding domain), is exposed to the compound. Another
aspect of the invention provides for compounds and compositions
identified by the disclosed methods. A preferred embodiment of the
invention provides that the compound screened in an afore-mentioned
method is one or more proteins which interact with Dkk,
particularly Dkk-1, as depicted in FIG. 5, or a
LRP5/LRP6/HBM-binding fragment thereof. Another preferred
embodiment provides that the compound comprises a Dkk or Dkk-1
peptide aptamer, such as those depicted in FIG. 3 (SEQ ID
NOs:171-188), or a mimetic of such aptamers. The compound may also
comprise a peptide aptamer of a Dkk interacting or Dkk-1
interacting protein, or a mimetic of such an aptamer. The method
further provides that the compound comprises a Dkk or Dkk-1
antibody or an antibody to a Dkk-1 interacting protein. The
invention further provides that the compound may comprise an LRP5
peptide aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID
NOs:189-192) (particularly peptide 13 (SEQ ID NO:191)) and FIG. 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Preferred compounds of the present invention also comprise LRP5
antibodies.
[0041] It is a further object of the invention to provide a method
of screening for compounds or compositions which modulate the
interaction of Dkk and a Dkk interacting protein comprising:
[0042] (a) exposing a Dkk interacting proteins or a Dkk-binding
fragment thereof to a compound; and,
[0043] (b) determining whether said compound binds to a Dkk
interacting proteins or the Dkk-binding fragment thereof.
[0044] In a preferred embodiment, the Dkk is Dkk-1.
[0045] It is a further object of the invention to provide a method
of screening for compounds or compositions which modulate the
interaction of Dkk and a Dkk interacting protein comprising:
[0046] (a) exposing Dkk interacting protein(s) or a Dkk-binding
fragment thereof to a compounds; and,
[0047] (b) determining whether said compound modulates the
interaction of Dkk and Dkk interacting proteins.
[0048] It is a further object of the invention to provide a method
of screening for compounds or compositions which modulate the
interaction of Dkk and a Dkk interacting protein comprising:
[0049] (a) exposing a Dkk interacting proteins or a Dkk-binding
fragment thereof to a compound;
[0050] (b) determining whether said compound binds to a Dkk
interacting proteins or the Dkk-binding fragment thereof; and,
[0051] (c) further determining whether said compound modulates the
interaction of Dkk and Dkk interacting proteins.
[0052] In a preferred embodiment, Dkk is Dkk-1.
[0053] In preferred embodiments of such methods, the Dkk
interacting proteins, particularly Dkk-1 interacting proteins, or a
Dkk-binding fragment thereof are attached to a solid substrate.
Another aspect of the invention provides for compounds and
compositions identified by the disclosed methods. A preferred
embodiment provides that the compound comprises a Dkk or Dkk-1
peptide aptamer, such as those depicted in FIG. 3 (SEQ ID
NOs:171-188), or a mimetic of such aptamers. The compound may also
comprise a peptide aptamer of a Dkk interacting or Dkk-1
interacting protein, or a mimetic of such an aptamer. The compound
may also comprise an antibody to a Dkk interacting or Dkk-1
interacting protein.
[0054] It is another object of the invention to provide for a
composition for treating bone mass disorders comprising a
LRP5/LRP6/HBM modulating compound and a pharmaceutically acceptable
excipient and/or carrier therefor. Preferred LRP5 (or LRP6 or HBM)
modulating compounds include Dkk or Dkk-1 or a LRP5/LRP6/HBM
binding fragment thereof. Also contemplated are compounds which
comprise monoclonal or polyclonal antibodies or immunologically
active fragments thereof which bind to Dkk, including Dkk-1, and a
pharmaceutically acceptable excipient and/or carrier. Another
preferred embodiment provides that the modulating compound
comprises one or more Dkk interacting or Dkk-1 interacting
proteins, or a biologically active fragment thereof. Also
contemplated are compounds which comprise monoclonal or polyclonal
antibodies or immunologically active fragments thereof which bind
to Dkk interacting or Dkk-1 interacting proteins, or a biologically
active fragment thereof, and a pharmaceutically acceptable
excipient and/or carrier. Another preferred embodiment provides
that the modulating compound comprises an antisense, siRNA, and
shRNA molecule which recognizes and binds to a nucleic acid
encoding a Dkk interacting or Dkk-1 interacting protein. Another
preferred embodiment provides that the modulating compound
comprises a Dkk or Dkk-1 peptide aptamer, a mimetic of a Dkk or
Dkk-1 peptide aptamer, a peptide aptamer of a Dkk interacting or
Dkk-1 interacting protein, or a mimetic of such an aptamer. Another
embodiment provides that the compound comprises an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID
NOs:189-192) (particularly peptide) and FIG. 13 (including SEQ ID
NOs:204-214), or a mimetic of such an aptamer. Preferred compounds
of the present invention also comprise LRP5 antibodies.
[0055] It is a further object of the invention to provide a
pharmaceutical composition for treating a Dkk-mediated disease or
condition comprising a compound which modulates Dkk activity and a
carrier therefor, including pharmaceutically acceptable excipients.
Such compositions include those wherein the compound comprises an
antisense, siRNA, and shRNA molecule or an antibody which binds to
Dkk, including Dkk-1, and thereby prevents it from interacting with
LRP5, LRP6, or HBM. Other such compositions include one or more of
Dkk interacting or Dkk-1 interacting proteins, such as those
depicted in FIG. 5, or a Dkk-binding fragment thereof, or a
monoclonal or polyclonal antibody, or immunologically active
fragment thereof, which binds to a Dkk interacting or Dkk-1
interacting protein or Dkk-binding fragment thereof. Other
contemplated compositions include antisense, siRNA, and shRNA
molecules which recognize and bind to a nucleic acid encoding a Dkk
interacting or Dkk-1 interacting protein. Further contemplated
compositions include Dkk and Dkk-1 peptide aptamers, such as those
depicted in FIG. 3 (SEQ ID NOs;171-188), mimetics of such aptamers,
a peptide aptamer of a Dkk interacting or Dkk-1 interacting
protein, or a mimetic of such an aptamer. Other contemplated
compositions comprise an LRP5 peptide aptamer, such as OST262 (SEQ
ID NO:208), FIG. 4 (SEQ ID NOs:189-192) (particularly peptide 13
(SEQ ID NO:191)) and FIG. 13 (including SEQ ID NO:204-214), or a
mimetic of such an aptamer. Other preferred compositions of the
present invention comprise LRP5 antibodies.
[0056] A further object of the invention to provide for a method of
modulating the expression of a nucleic acid encoding a Dkk
interacting or Dkk-1 interacting protein in an organism, such as
those shown in FIG. 5, comprising the step of administering to the
organism an effective amount of composition which modulates the
expression of a nucleic acid encoding a Dkk-1 interacting protein.
In a preferred embodiment, said composition comprises an antisense,
siRNA, or shRNA molecule which recognizes and binds to a nucleic
acid encoding a Dkk interacting or Dkk-1 interacting protein.
[0057] One aspect of the invention provides for a method of
modulating at least one activity of Dkk or a Dkk-1 interacting
protein comprising administering an effective amount of a
composition which modulates at least one activity of Dkk or a Dkk-1
interacting protein. The invention provides for a composition
comprising a Dkk interacting or Dkk-1 interacting protein, such as
those shown in FIG. 5, or a biologically active fragment thereof.
Other agents contemplated for this method are antisense, siRNA, or
shRNA molecules which recognize and bind to a nucleic acid encoding
a Dkk interacting or Dkk-1 interacting protein. The method further
provides that the composition comprises a Dkk or Dkk-1 antibody or
an antibody to a Dkk interacing or Dkk-1 interacting protein. In
another preferred embodiment, the composition comprises a Dkk or
Dkk-1 peptide aptamer, a mimetic of a Dkk or Dkk-1 peptide aptamer,
a peptide aptamer of a Dkk interacting or Dkk-1 interacting
protein, or a mimetic of such an aptamer. The method provides that
a composition of the present invention may comprise an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID NO:189-192)
(particularly peptide including (SEQ ID NO:191)) and Figure
including (SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Preferred compositions of the present invention also comprise LRP5
antibodies. In a further preferred embodiment, the modulated Dkk
activity is lipid modulation or bone mass modulation.
[0058] In all of the testing/screening embodiments of the present
invention discussed below to obtain compounds or compositions which
ultimately impact LRP5/LRP6/HBM signaling, one skilled in the art
will recognize that HBM can be used as a control in the absence of
a test sample or compound. Further, the effect of a test sample of
compound on Wnt signaling through the interaction of Dkk with
LRP5/LRP6/HBM does not necessarily require a direct measurement of
an association or interaction of Dkk and LRP5/LRP6/HBM. Other
positive phenotypes/activities established by the High Bone Mass
phenotype or by using HBM as a control.
[0059] One aspect of the invention provides for a method of
identifying binding partners for a Dkk protein comprising the steps
of:
[0060] (a) exposing the Dkk protein(s) or a LRP5/LRP6 binding
fragment thereof to a potential binding partner; and
[0061] (b) determining if the potential binding partner binds to a
Dkk protein or the LRP5/LRP6 binding fragment thereof.
[0062] In a preferred embodiment, the Dkk is Dkk-1.
[0063] Another aspect of the invention is to provide for a method
of identifying a compound that effects Dkk-mediated activity
comprising
[0064] (a) providing a group of transgenic animals having (1) a
regulatable one or more Dkk interacting protein genes, (2) a
knock-out of one or more Dkk interacting protein genes, or (3) a
knock-in of one or more Dkk interacting protein genes;
[0065] (b) providing a second group of control animals respectively
for the group of transgenic animals in step (a); and
[0066] (c) exposing the transgenic animal group and the control
animal group to a potential Dkk-modulating compound which modulates
bone mass or lipid levels; and
[0067] (d) comparing the transgenic animal group and the control
animal group and determining the effect of the compound on bone
mass or lipid levels in the transgenic animals as compared to the
control animals.
[0068] In a preferred embodiment, the Dkk is Dkk-1.
[0069] It is another aspect of the invention to provide for a
method for determining whether a compound modulates a Dkk
interacting protein, said method comprising the steps of:
[0070] (a) mixing the Dkk interacting protein or a Dkk-binding
fragment thereof with the ligand binding domain of Dkk in the
presence of said at least one compound;
[0071] (b) measuring the amount of said binding domain of Dkk bound
to said Dkk interacting protein or the Dkk-binding fragment thereof
as compared to a control without said at least one compound;
and
[0072] (c) determining whether the compound reduces the amount of
said binding domain of Dkk binding to said Dkk interacting protein
or Dkk-binding fragment thereof.
[0073] In a preferred embodiment, the Dkk is Dkk-1.
[0074] In a preferred embodiment, the binding domain is attached to
a solid substrate. The invention further provides for compounds
identified by this method. In a preferred embodiment, the invention
provides that the Dkk interacting or Dkk-1 interacting protein is
detected by antibodies. In another preferred embodiment, the solid
substrate is a microarray. Another preferred embodiment provides
that the ligand binding domain of Dkk and/or Dkk interacting
protein is fused or conjugated to a peptide or protein. The
invention also provides that the compounds include Dkk and Dkk-1
peptide aptamers, mimetics of Dkk and Dkk-1 peptide aptamers, Dkk
and Dkk-1 interacting proteins peptide aptamers, or mimetics of
such aptamers.
[0075] An aspect of the invention provides a composition comprising
one or more polypeptide sequences of one or more Dkk-1 interacting
proteins, or a biologically active fragment thereof, one or more
Dkk proteins, or a biologically active fragment thereof, or
LRP5/LRP6/HBM polypeptide sequences or a biologically active
fragment thereof (for example, the ligand binding domain) and a
pharmaceutically acceptable excipient and/or carrier. Another
aspect of the invention provides that the composition comprises a
Dkk or Dkk-1 antibody or an antibody to a Dkk interacting or Dkk-1
interacting protein and a pharmaceutically acceptable excipient. A
composition of the present invention may comprise an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID
NOs:189-192) (particularly peptide 13 (SEQ ID NO:191)) and FIG. 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer. A
composition of the present invention may comprise a Dkk peptide
aptamer, for example as shown in FIG. 3 (SEQ ID NOs:171-188).
Preferred compositions of the present invention also comprise LRP5
antibodies.
[0076] Another aspect of the invention is to provide an antibody or
immunologically active antibody fragment which recognizes and binds
to a Dkk-1 amino acid sequence selected from the group consisting
of: Asn34-His266 (SEQ ID NO:1 10), Asn34-Cys245 (SEQ ID NO:111),
Asn34-Lys182 (SEQ ID NO:112), Cys97-His266 (SEQ ID NO:113),
Val139-His266 (SEQ ID NO:114), Gly183-His266 (SEQ ID NO:115),
Cys97-Cys245 (SEQ ID NO:116), or Val139-Cys245 (SEQ ID NO:117) of
human Dkk-1. Additional antibodies may bind to any of the sequences
depicted in FIG. 3 (SEQ ID NOs:171-188) and FIG. 4 (SEQ ID
NOs:189-192). Another aspect of the invention is to provide for
polyclonal antibodies to one or more amino acid sequences: Peptide
1--GNKYQTIDNYQPYPC (SEQ ID NO:118), Peptide
2--LDGYSRRTTLSSKMYHTKGQEG (SEQ ID NO:119), Peptide
3--RIQKDHHQASNSSRLHTCQRH (SEQ ID NO:120), Peptide
4--RGEIEETITESFGND (SEQ ID NO:121), and Peptide
5--EIFQRCYCGEGLSCRIQKD (SEQ ID NO: 122).
[0077] It is a further object of the invention to provide a nucleic
acid encoding a Dkk protein, e.g. Dkk-1, a Dkk interacting or Dkk-1
interacting protein aptamer, or an LRP5 aptamer comprising a
nucleic acid encoding a scaffold protein in-frame with the
activation domain of Gal4 or LexA that is in-frame with a nucleic
acid which encodes for a Dkk or Dkk-1 or Dkk interacting or Dkk-1
interacting protein amino acid sequence. Preferably the scaffold
protein is thioredoxin (trxA), S1 nuclease from Staphylococcus or
M13. Other preferable embodiments include Dkk-1 amino acid
sequences selected from FIG. 6.
[0078] It is yet a further object of the invention to provide a
composition comprising a polypeptide sequence of FIG. 3 (SEQ ID
NOs:171-188), FIG. 4 (SEQ ID NO:189-192), or of Dkk-1 interacting
proteins identified in FIG. 5 and a pharmaceutically acceptable
excipient and/or carrier.
[0079] Another aspect of the invention includes a method of
detecting the modulatory activity of a compound on the binding
interaction of a first peptide and a second peptide of a peptide
binding pair that bind through extracellular interaction in their
natural environment, comprising:
[0080] (i) culturing at least one eukaryotic cell, wherein the
eukaryotic cell comprises;
[0081] a) a nucleotide sequence encoding a first heterologous
fusion protein comprising the first peptide or a segment thereof
joined to a DNA binding domain of a transcriptional activation
protein;
[0082] b) a nucleotide sequence encoding a second heterologous
fusion protein comprising the second peptide or a segment thereof
joined to a transcriptional activation domain of a transcriptional
activation protein;
[0083] wherein binding of the first peptide or segment thereof and
the second peptide or segment thereof reconstitutes a
transcriptional activation protein; and
[0084] c) a reporter element activated under positive
transcriptional control of the reconstituted transcriptional
activation protein, wherein expression of the reporter element
produces a selected phenotype;
[0085] (ii) incubating a compound with the eukaryotic cell under
conditions suitable to detect the selected phenotype; and
[0086] (iii) detecting the ability of the compound to affect the
binding interaction of the peptide binding pair by determining
whether the compound affects the expression of the reporter element
which produces the selected phenotype;
[0087] wherein (1) said first peptide is a Dkk peptide and said
second peptide is a peptide selected from LRP5, HBM, LRP6, and the
Dkk-binding portion of LRP5/LRP6/HBM or (2) said first peptide is a
Dkk-interacting protein or the Dkk-binding fragment thereof, and
said second peptide is a Dkk peptide.
[0088] In one embodiment, the eukaryotic cell is a yeast cell. In a
preferred embodiment, the yeast cell is Saccharomyces. In a
particularly preferred embodiment, the Saccharomyces cell is
Saccharomyces cerevisiae. The invention further provides that the
compound may comprise a Dkk interacting or Dkk-1 interacting
protein, or a biologically active fragment thereof. In one
embodiment, the Dkk interacting or Dkk-1 interacting protein, or a
Dkk-binding fragment thereof, is added directly to the assay. In
another embodiment, the Dkk interacting or Dkk-1 interacting
protein, or a Dkk-binding fragment thereof, is recombinantly
expressed by the eukaryotic cell in addition to the first and
second peptides. In a preferred embodiment the compound comprises a
Dkk or Dkk-1 aptamer, a mimetic of a Dkk or Dkk-1 peptide aptamer,
a Dkk interacting or Dkk-1 interacting protein aptamer, or a
mimetic of a Dkk-1 interacting protein aptamer. Other preferred
embodiments provide that the compound comprises an LRP5 peptide
aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID
NOs:189-192) (particularly peptide 13 (SEQ ID NO:191) and FIG. 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Alternatively, the present invention also provides that the
compound may comprise LRP5 antibodies or Dkk antibodies. In another
embodiment, the yeast cell further comprises at least one
endogenous nucleotide sequence selected from the group consisting
of a nucleotide sequence encoding the DNA binding domain of a
transcriptional activation protein, a nucleotide sequence encoding
the transcriptional activation domain of a transcriptional
activation protein, and a nucleotide sequence encoding the reporter
element, wherein at least one of the endogenous nucleotide
sequences is inactivated by mutation or deletion. In another
embodiment, the peptide binding pair comprises a ligand and a
receptor to which the ligand binds. In one embodiment, the
transcriptional activation protein is Gal4, Gcn4, Hap1, Adr1, Swi5,
Ste12, Mcm1, Yap1, Ace1, Ppr1, Arg81, Lac9, Qa1F, VP16, or a
mammalian nuclear receptor. In another embodiment, at least one of
the heterologous fusion proteins is expressed from an
autonomously-replicating plasmid. In one embodiment, the DNA
binding domain comprises a heterologous DNA-binding domain of a
transcriptional activation protein. In a preferred embodiment, the
DNA binding protein is selected from the group consisting of a
mammalian steroid receptor and bacterial LexA protein. In another
embodiment, the reporter element is selected from the group
consisting of lacZ, a polynucleotide encoding luciferase, a
polynucleotide encoding green fluorescent protein (GFP), and a
polynucleotide encoding chloramphenicol acetyltransferase. In a
particularly preferred embodiment, the reporter element is lacZ
[0089] The invention further provides for a rescue screen for
detecting the activity of a compound for modulating the binding
interaction of a first peptide and a second peptide of a peptide
binding pair, comprising:
[0090] (i) culturing at least one yeast cell, wherein the yeast
cell comprises;
[0091] a) a nucleotide sequence encoding a first heterologous
fusion protein comprising the first peptide or a segment thereof
joined to a DNA binding domain of a transcriptional activation
protein;
[0092] b) a nucleotide sequence encoding a second heterologous
fusion protein comprising the second peptide or a segment thereof
joined to a transcriptional activation domain of a transcriptional
activation protein;
[0093] wherein binding of the first peptide or segment thereof and
the second peptide or segment thereof reconstitutes a
transcriptional activation protein; and
[0094] c) a reporter element activated under positive
transcriptional control of the reconstituted transcriptional
activation protein, wherein expression of the reporter gene
prevents exhibition of a selected phenotype;
[0095] (ii) incubating a compound with the yeast cell under
conditions suitable to detect the selected phenotype; and
[0096] (iii) detecting the ability of the compound to affect the
binding interaction of the peptide binding pair by determining
whether the compound affects the expression of the reporter element
which prevents exhibition of the selected phenotype,
[0097] wherein said first peptide is a Dkk peptide and said second
peptide is a peptide selected from LRP5, HBM, LRP6 and a
Dkk-binding fragment of LRP5/LRP6/HBM.
[0098] In a preferred embodiment, the invention provides that the
yeast cell is Saccharomyces. In a particularly preferred
embodiment, the Saccharomyces cell is Saccharomyces cerevisiae. In
one embodiment, the compound comprises one or more Dkk interacting
or Dkk-1 interacting proteins, or a Dkk-binding fragment thereof.
Compounds used in the present invention may comprise an LRP5
peptide aptamer, such as OST262 (SEQ ID NO:208), FIG. 4 (SEQ ID
NOs:189-192) (particularly peptide 13 (SEQ ID NO:191)) and FIG. 13
(including SEQ ID NOs:204-214), or a mimetic of such an aptamer.
Alternatively, the compound may comprise LRP5 antibodies or Dkk
antibodies. In another embodiment, the yeast cell further comprises
at least one endogenous nucleotide sequence selected from the group
consisting of a nucleotide sequence encoding the DNA binding domain
of a transcriptional activation protein, a nucleotide sequence
encoding the transcriptional activation domain of a transcriptional
activation protein, and a nucleotide sequence encoding the reporter
gene, wherein at least one of the endogenous nucleotide sequences
is inactivated by mutation or deletion. In another embodiment, the
transcriptional activation protein is Gal4, Gcn4, Hap1, Adr1, Swi5,
Ste12, Mcm1, Yap1, Ace1, Ppr1, Arg81, Lac9, Qa1F, VP16, or a
mammalian nuclear receptor. In one embodiment, at least one of the
heterologous fusion proteins is expressed from an
autonomously-replicating plasmid. In another embodiment, the DNA
binding domain is a heterologous DNA-binding domain of a
transcriptional activation protein.
[0099] The invention also provides for a rescue screen for
detecting the modulatory activity of a compound on the binding
interaction of a first peptide and a second peptide of a peptide
binding pair, comprising:
[0100] (i) culturing at least one yeast cell, wherein the yeast
cell comprises;
[0101] a) a nucleotide sequence encoding a first heterologous
fusion protein comprising the first peptide or a segment thereof
joined to a DNA binding domain of a transcriptional activation
protein;
[0102] b) a nucleotide sequence encoding a second heterologous
fusion protein comprising the second peptide or a segment thereof
joined to a transcriptional activation domain of a transcriptional
activation protein;
[0103] wherein binding of the first peptide or segment thereof and
the second peptide or segment thereof reconstitutes a
transcriptional activation protein; and
[0104] c) a reporter element activated under positive
transcriptional control of the reconstituted transcriptional
activation protein, wherein expression of the reporter element
prevents exhibition of a selected phenotype;
[0105] (ii) incubating a compound with the yeast cell under
conditions suitable to detect the selected phenotype; and
[0106] (iii) detecting the ability of the compound to affect the
binding interaction of the peptide binding pair by determining
whether the compound affects the expression of the reporter element
which prevents exhibition of the selected phenotype,
[0107] wherein said first peptide is a Dkk interacting or Dkk-1
interacting protein peptide and said second peptide is a Dkk or
Dkk-1 peptide.
[0108] In a preferred embodiment of the rescue screen, the yeast
cell is Saccharomyces. In a particularly preferred embodiment, the
Saccharomyces cell is Saccharomyces cerevisiae. In another
embodiment, the yeast cell further comprises at least one
endogenous nucleotide sequence selected from the group consisting
of a nucleotide sequence encoding the DNA binding domain of a
transcriptional activation protein, a nucleotide sequence encoding
the transcriptional activation domain of a transcriptional
activation protein, and a nucleotide sequence encoding the reporter
gene, wherein at least one of the endogenous nucleotide sequences
is inactivated by mutation or deletion. In one embodiment, the
transcriptional activation protein is Gal4, Gcn4, Hap1, Adr1, Swi5,
Ste12, Mcm1, Yap1, Ace1, Ppr1, Arg81, Lac9, Qa1F, VP16, or a
mammalian nuclear receptor. In another embodiment of the rescue
screen, at least one of the heterologous fusion proteins is
expressed from an autonomously-replicating plasmid. In another
embodiment, the DNA binding domain is a heterologous DNA-binding
domain of a transcriptional activation protein.
[0109] The invention also provides for a method for identifying
potential compounds which modulate Dkk activity comprising:
[0110] a) measuring the effect on binding of one or more Dkk
interacting protein, or a Dkk-binding fragment thereof, with Dkk or
a LRP5/LRP6/HBM binding fragment thereof in the presence and
absence of a compound; and
[0111] b) identifying as a potential Dkk modulatory compound a
compound which modulates the binding between one or more Dkk
interacting proteins or Dkk-binding fragment thereof and Dkk or
LRP5/LRP6/HBM fragment thereof.
[0112] In a preferred embodiment, the Dkk is Dkk-1.
[0113] The invention further provides for any of the Dkk peptide
aptamers of FIG. 3 (SEQ ID NOs:171-188). The invention also
provides for any of the LRP peptide aptamers of FIG. 4 (SEQ ID
NOs:189-192).
[0114] Another aspect of the invention provides for a method of
identifying agents which modulate the interaction of Dkk with the
Wnt signaling pathway comprising:
[0115] (a) injecting mRNA encoding Dkk and an agent into a Xenopus
blastomere;
[0116] (b) assessing axis duplication or analyzing marker gene
expression; and
[0117] (c) identifying agents which elicit changes in axis
duplication or marker gene expression as agents which modulate the
interaction of Dkk with the Wnt signaling pathway. Wherein the
agent may be chosen from among mRNA encoding Dkk interacting
proteins, fragments thereof, siRNA, shRNA, antisense nucleotides,
and antibodies. In a preferred embodiment, Dkk is Dkk-1. In a
further embodiment, mRNA of HBM, LRP5/6, any Wnt (including
Wnt1-Wnt19, particularly Wnt1, Wnt3, Wnt3a, and Wnt10b), Wnt
antagonist, or combination of these is co-injected into the Xenopus
blastomere. In another embodiment, the marker gene analyzed could
include Siamois, Xnr3, slug, Xbra, HNK-1, endodermin, Xlhbox8,
BMP2, BMP4, XLRP6, EF-1, or ODC.
[0118] The present invention provides for a method for identifying
agents which modulate the interaction of Dkk with the Wnt signaling
pathway comprising:
[0119] (a) transfecting cells with constructs encoding Dkk and
potential Dkk interacting proteins, mRNA fragments thereof, siRNA,
shRNA, or antisense, antibodies to
LRP5/HBM/LRP6/Dkk/Dkk-interacting protein;
[0120] (b) assessing changes in expression of a reporter gene
linked to a Wnt-responsive promoter; and,
[0121] (c) identifying as a Dkk interacting protein any protein
which alters reporter gene expression compared with cells
transfected with a Dkk construct alone. In a further preferred
embodiment, the cells may be HOB-03-CE6, HEK293, or U2OS cells.
[0122] In alternative embodiments, the Wnt-responsive promoter is
TCF or LEF. In other preferred embodiments, the cells are
co-transfected with CMV beta-galactosidase or tk-Renilla.
[0123] The present invention further provides for a LRP5/HBM
monoclonal or polyclonal antibody to one or more peptides of amino
acid sequences
1 MYWTDWVETPRIE, (SEQ ID NO:123) MYWTDWGETPRIE, (SEQ ID NO:124)
KRTGGKRKEILSA, (SEQ ID NO:125) ERVEKTTGDKRTRIQGR, (SEQ ID NO:126)
or KQQCDSFPDCIDGSDE. (SEQ ID NO:127)
[0124] Additionally, the present invention provides a method for
identifying compounds which modulate Dkk and LRP5/LRP6/HBM
interactions comprising:
[0125] (a) immobilizing LRP5/LRP6/HBM to a solid surface; and
[0126] (b) treating the solid surface with a secreted Dkk protein
or a secreted epitope-tagged Dkk and a test compound; and
[0127] (c) determining whether the compound regulates binding
between Dkk and LRP5/LRP6/HMB using antibodies to Dkk or the
epitope tag or by directly measuring activity of an epitope
tag.
[0128] In one embodiment, the Dkk is Dkk-1. In a preferred
embodiment, the epitope tag is alkaline phosphatase, histidine,
myc, or a V5 tag.
[0129] Another embodiment of the present invention provides for a
method for identifying compounds which modulate Dkk and
LRP5/LRP6/HBM interactions comprising:
[0130] (a) creating an LRP5, LRP6, or HBM fluorescent fusion
protein using a first fluorescent tag;
[0131] (b) creating a Dkk fusion protein comprising a second
fluorescent tag;
[0132] (c) adding a test compound; and,
[0133] (d) assessing changes in the ratio of fluorescent tag
emissions using Fluorescence Resonance Energy Transfer (FRET) or
Bioluminescent Resonance Energy Transfer (BRET) to determine
whether the compound modulates Dkk and LRP5/LRP6/HBM
interactions.
[0134] In a preferred embodiment, the Dkk is Dkk-1.
[0135] The present invention also provides for a method of
diagnosing low or high bone mass and/or low or high lipid levels in
a subject comprising examining expression of Dkk, LRP5, LRP6, HBM
or HBM-like variant in the subject and determining whether Dkk,
LRP5, LRP6, or HBM or a HBM-like variant is over- or
under-expressed to determine whether subject has (a) high or low
bone mass and/or (b) high or low lipid levels.
[0136] The invention further provides for a transgenic animal
wherein Dkk is knocked out in a tissue-specific fashion. In a
preferred embodiment, the Dkk is Dkk-1. In one preferred
embodiment, the tissue specificity is bone tissue. In another
preferred embodiment, the tissue specificity is liver or other
tissues or cells involved in regulating lipid metabolism or cancer
tissue.
[0137] The present invention further provides a method of screening
for compounds which modulate the interaction of Dkk with LRP5,
LRP6, or HBM comprising:
[0138] (a) exposing LRP5, LRP6, or HBM, or a Dkk-binding fragment
of LRP5, LRP6, or HBM to a compound; and
[0139] (b) determining whether said compound bound to LRP5, LRP6,
or HBM or the Dkk-binding fragment of LRP5, LRP6, or HBM and
further determining whether said compound modulates the interaction
of Dkk and LRP5, LRP6, or HBM.
[0140] In one embodiment, the Dkk is Dkk-1. In a preferred
embodiment, the compound comprises an LRP5 peptide aptamer. Other
preferred compositions include the peptide aptamer, OST262 (SEQ ID
NO:208), FIG. 4 (SEQ ID NOs:189-192) (particularly peptide 13 (SEQ
ID NO:191) and FIG. 13 (including SEQ ID NOs:204-214), or a mimetic
of such an aptamer, and an LRP5 antibody.
[0141] The present invention also provides a method for identifying
compounds which modulate Dkk and LRP5/LRP6/HBM interactions
comprising:
[0142] (a) immobilizing LRP5/LRP6/HBM to a solid surface; and
[0143] (b) treating the solid surface with a secreted Dkk protein
or a secreted epitope-tagged Dkk and a test compound; and
[0144] (c) determining whether the compound regulates binding
between Dkk and LRP5/LRP6/HBM using antibodies to Dkk or the
epitope tag or by directly measuring activity of an epitope tag. In
a preferred embodiment, the epitope tag is alkaline phosphatase,
histidine, myc or a V5 tag.
[0145] In a preferred embodiment, the Dkk is Dkk-1.
[0146] The invention also provides for a method for identifying
compounds which modulate the interaction of Dkk with the Wnt
signaling pathway comprising:
[0147] (a) transfecting cells with constructs containing Dkk and
Wnt proteins;
[0148] (b) assessing changes in expression of a reporter element
linked to a Wnt-responsive promoter; and
[0149] (c) identifying as a Dkk/Wnt interaction modulating compound
any compound which alters reporter gene expression compared with
cells transfected with a Dkk construct alone.
[0150] In one embodiment, the Dkk is Dkk-1. In another embodiment,
the Wnt is any of Wnt1-Wnt19. In a preferred embodiment, the Wnt is
Wnt1, Wnt3, Wnt3a, or Wnt10b. In a particularly preferred
embodiment, the Wnt construct contains Wnt3a. In another
particularly preferred embodiment, the Wnt construct contains Wnt1.
In another preferred embodiment, the Wnt construct encodes for a
Wnt that signals through the canonical Wnt pathway. In a
particularly preferred embodiment, both Wnt3a and Wnt1 constructs
are co-transfected into the cells. In another embodiment, the cells
may be U2-OS, HOB-03-CE6, or HEK293 cells. In another embodiment,
the reporter element used is TCF-luciferase, tk-Renilla, or a
combination thereof.
[0151] The invention also provides for a method of testing
compounds that modulate Dkk-mediated activity in a mammal
comprising:
[0152] (a) providing a group of transgenic animals having (1) a
regulatable one or more Dkk genes, (2) a knock-out of Dkk genes, or
(3) a knock-in of one or more Dkk genes;
[0153] (b) providing a second group of control animals respectively
for the group of transgenic animals in step (a); and
[0154] (c) exposing the transgenic animal group and control animal
group to a potential Dkk-modulating compound which modulates bone
mass or lipid levels; and
[0155] (d) comparing the transgenic animals and the control group
of animals and determining the effect of the compound on bone mass
or lipid levels in the transgenic animals as compared to the
control animals.
[0156] In a preferred embodiment, the Dkk is Dkk-1.
[0157] The invention further provides variants of LRP5 which
demonstrate HBM biological activity, i.e., that are "HBM-like." In
preferred embodiments, variants G171F, M282V, G171K, G171Q, A65V,
G171V, G171I, and A214V of LRP5 are provided. The invention further
provides for the use any of these variants in the forgoing
methods.
BRIEF DESCRIPTION OF THE FIGURES
[0158] FIG. 1 shows a schematic of the components of the Wnt signal
transduction pathway. Schematic obtained from:
http://www.stanford.edu/.a- bout.rnusse/pathways/cell2.html
[0159] FIG. 2 (A-C) show bait sequences (SEQ ID NOs:168-170)
utilized in yeast two hybrid (Y2H) screens for protein-protein
interactions.
[0160] FIG. 3 shows a table of peptide aptamer insert sequences
(SEQ ID NOs: 171-192) identified in Y2H screen with a Dkk-1 bait
sequence.
[0161] FIG. 4 shows a table of peptide aptamer insert sequences
identified in a Y2H screen using a LRP5 ligand binding domain bait
sequence.
[0162] FIG. 5 shows a table of proteins identified in a Y2H screen
using a Dkk-1 bait sequence. These proteins are identified by both
their nucleic acid and amino acid accession numbers.
[0163] FIG. 6 shows the results of a minimum interaction domain
mapping screen of Dkk-1 with LRP5. At the top, a map of Dkk-1
showing the location of the signal sequence, and cysteine rich
domains 1 and 2. Below, the extent of domains examined using LRP5
LBD baits, LBD1 and LBD4, of FIG. 2. To the right, scoring of the
binding results observed in the experiment.
[0164] FIG. 7 shows a diagram of the Xenopus Embryo Assay for Wnt
activity.
[0165] FIG. 8 shows the effects of Zmax/LRP5 and HBM on Wnt
signaling in the Xenopus embryo assay.
[0166] FIG. 9 shows the effects of Zmax/LRP5 and HBM on induction
of secondary axis formation in the Xenopus embryo assay.
[0167] FIG. 10 shows the effects of human Dkk-1 on the repression
of the canonical Wnt pathway.
[0168] FIG. 11 shows the effects of human Dkk-1 on Zmax/LRP5 and
HBM-mediated Wnt signaling.
[0169] FIG. 12 shows pcDNA3.1 construct names with nucleotide
sequences (including SEQ ID NOs:193-203) for LRP5-binding peptide
aptamers, Dkk-1 peptides and control constructs.
[0170] FIG. 13 shows the amino acid sequences (including SEQ ID
NOs:204-214) for the corresponding LRP5-binding peptides, Dkk-1
peptide aptamers and control constructs in FIG. 12.
[0171] FIG. 14 shows the effects of Dkk-1 and Dkk-2 on Wnt1
signaling with coreceptors LRP5, HBM, and LRP6 in HOB03CE6
cells.
[0172] FIG. 15 shows the effects of Dkk-1 and Dkk-2 on Wnt3a
signaling with coreceptors LRP5, HBM, and LRP6 in HOB03CE6
cells.
[0173] FIG. 16 demonstrates that the LRP5-LBD peptide aptamer 262
activates Wnt signaling in the presence of Wnt3a in U2OS cells.
[0174] FIG. 17 shows the differential binding of an antibody
generated to a sequence (a.a. 165-177) containing the HBM mutation
in LRP5 in LRP5 and HBM virus-infected cells.
[0175] FIG. 18 shows data generated from a Y2H interaction trap
where a mutant Dkk-1 (C220A) is unable to bind to LRP5 and
demonstrating the window of capability of detecting small molecule
effects on LRP and Dkk interactions.
[0176] FIG. 19 shows that Dkk-1 represses Wnt3a-mediated Wnt
signaling in U2OS bone cells using the cell-based reporter gene
assay for high throughput screening.
[0177] FIG. 20 demonstrates that Wnt1-HBM generated signaling is
not efficiently inhibited by Dkk-1 in U2OS bone cells while LRP5
and LRP6-mediated signaling are using the cell-based reporter gene
assay for high throughput screening.
[0178] FIG. 21 shows that the TCF signal in the cell-based reporter
gene assay for high throughput screening can be modulated by Dkk-1
and Dkk-1-AP without Wnt DNA transfection.
[0179] FIG. 22 shows the morphological results in the Xenopus assay
using aptamers 261 and 262 from the LRP5-LBD to activate Wnt
signaling.
[0180] FIG. 23 demonstrates that LRP5-LBD aptamers 261 and 262
induce Wnt signaling over other LRP5 aptamers.
[0181] FIG. 24 shows that the mutation G171 F in LRP5 produces a
greater activation of the Wnt pathway than LRP5 which is consistent
with HBM activity.
[0182] FIG. 25 shows that the mutation M282V in LRP5 produces an
activation of the Wnt pathway which is consistent with HBM activity
in U2OS cells.
[0183] FIG. 26 shows the amino acid sequence of the various
peptides of dkk-1 selected to generate polyclonal antibodies, their
relationship to the Dkk-1 amino acid sequence and identities of
polyclonal antibodies generated.
[0184] FIG. 27 shows a Western blot demonstrating that polyclonal
antibody #5521 to amino acids 165-186 of Dkk-1 was able to detect
Dkk1 -V5 and Dkk1-AP from conditioned medium.
[0185] FIG. 28 shows a Western blot demonstrating that polyclonal
antibody #74397 to amino acids 147-161 was able to detect Dkk1-V5
in both conditioned medium and immunoprecipitated conditioned
medium.
DETAILED DESCRIPTION OF THE INVENTION
[0186] 1. Definitions
[0187] In general, terms in the present application are used
consistent with the manner in which those terms are understood in
the art. To aid in the understanding of the specification and
claims, the following definitions are provided.
[0188] "Gene" refers to a DNA sequence that encodes through its
template or messenger RNA a sequence of amino acids characteristic
of a specific peptide. The term "gene" includes intervening,
non-coding regions, as well as regulatory regions, and can include
5' and 3' ends.
[0189] By "nucleic acid" is meant to include single stranded and
double stranded nucleic acids including, but not limited to DNAs,
RNAs (e.g., mRNA, tRNAs, siRNAs), cDNAs, recombinant DNA (rDNA),
rRNAs, antisense nucleic acids, oligonucleotides, and oligomers,
and polynucleotides. The term may also include hybrids such as
triple stranded regions of RNA and/or DNA or double stranded
RNA:DNA hybrids. The term also is contemplated to include modified
nucleic acids such as, but not limited to biotinylated nucleic
acids, tritylated nucleic acids, fluorophor labeled nucleic acids,
inosine, and the like.
[0190] "Gene sequence" refers to a nucleic acid molecule, including
DNA which contains a non-transcribed or non-translated sequence,
which comprises a gene. The term is also intended to include any
combination of gene(s), gene fragment(s), non-transcribed
sequence(s) or non-translated sequence(s) which are present on the
same DNA molecule.
[0191] The nucleic acid sequences of the present invention may be
derived from a variety of sources including DNA, cDNA, synthetic
DNA, synthetic RNA or combinations thereof. Such sequences may
comprise genomic DNA which may or may not include naturally
occurring introns. Moreover, such genomic DNA may be obtained in
association with promoter regions and/or poly (A) sequences. The
sequences, genomic DNA or cDNA may be obtained in any of several
ways. Genomic DNA can be extracted and purified from suitable cells
by means well known in the art. Alternatively, mRNA can be isolated
from a cell and used to produce cDNA by reverse transcription or
other means.
[0192] "cDNA" refers to complementary or copy DNA produced from an
RNA template by the action of RNA-dependent DNA polymerase (reverse
transcriptase). Thus, a "cDNA clone" means a duplex DNA sequence
for which one strand is complementary to an RNA molecule of
interest, carried in a cloning vector or PCR amplified. cDNA can
also be single stranded after first strand synthesis by reverse
transcriptase. In this form, it is a useful PCR template and does
not need to be carried in a cloning vector. This term includes
genes from which the intervening sequences have been removed. Thus,
the term "gene", as sometimes used generically, can also include
nucleic acid molecules comprising cDNA and cDNA clones.
[0193] "Recombinant DNA" means a molecule that has been engineered
by splicing in vitro a cDNA or genomic DNA sequence or altering a
sequence by methods such as PCR mutagenesis.
[0194] "Cloning" refers to the use of in vitro recombination
techniques to insert a particular gene or other DNA sequence into a
vector molecule. In order to successfully clone a desired gene, it
is necessary to use methods for generating DNA fragments, for
joining the fragments to vector molecules, for introducing the
composite DNA molecule into a host cell in which it can replicate,
and for selecting the clone having the target gene from amongst the
recipient host cells.
[0195] "cDNA library" refers to a collection of recombinant DNA
molecules containing cDNA inserts which together comprise the
entire or a partial repertoire of genes expressed in a particular
tissue or cell source. Such a cDNA library can be prepared by
methods known to one skilled in the art and described by, for
example, Cowell and Austin, "cDNA Library Protocols," Methods in
Molecular Biology (1997).
[0196] "Cloning vehicle" refers to a plasmid or phage DNA or other
DNA sequence which is able to replicate in a host cell. This term
can also include artificial chromosomes such as BACs and YACs. The
cloning vehicle is characterized by one or more endonuclease
recognition sites at which such DNA sequences may be cut in a
determinable fashion without loss of an essential biological
function of the DNA, which may contain a marker suitable for use in
the identification of transformed cells.
[0197] "Expression" refers to the process comprising transcription
of a gene sequence and subsequent processing steps, such as
translation of a resultant mRNA to produce the final end product of
a gene. The end product may be a protein (such as an enzyme or
receptor) or a nucleic acid (such as a tRNA, antisense RNA, or
other regulatory factor). The term "expression control sequence"
refers to a sequence of nucleotides that control or regulate
expression of structural genes when operably linked to those genes.
These include, for example, the lac systems, the trp system, major
operator and promoter regions of the phage lambda, the control
region of fd coat protein and other sequences known to control the
expression of genes in prokaryotic or eukaryotic cells. Expression
control sequences will vary depending on whether the vector is
designed to express the operably linked gene in a prokaryotic or
eukaryotic host, and may contain transcriptional elements such as
enhancer elements, termination sequences, tissue-specificity
elements and/or translational initiation and termination sites.
[0198] "Expression vehicle" refers to a vehicle or vector similar
to a cloning vehicle but which is capable of expressing a gene
which has been cloned into it, after transformation into a host.
The cloned gene is usually placed under the control of (i.e.,
operably linked to) an expression control sequence.
[0199] "Operator" refers to a DNA sequence capable of interacting
with the specific repressor, thereby controlling the transcription
of adjacent gene(s).
[0200] "Promoter" refers to a DNA sequence that can be recognized
by an RNA polymerase. The presence of such a sequence permits the
RNA polymerase to bind and initiate transcription of operably
linked gene sequences.
[0201] "Promoter region" is intended to include the promoter as
well as other gene sequences which may be necessary for the
initiation of transcription. The presence of a promoter region is
sufficient to cause the expression of an operably linked gene
sequence. The term "promoter" is sometimes used in the art to
generically indicate a promoter region. Many different promoters
are known in the art which direct expression of a gene in a certain
cell types. Tissue-specific promoters can comprise nucleic acid
sequences which cause a greater (or decreased) level of expression
in cells of a certain tissue type.
[0202] "Operably linked" means that the promoter controls the
initiation of expression of the gene. A promoter is operably linked
to a sequence of proximal DNA if upon introduction into a host cell
the promoter determines the transcription of the proximal DNA
sequence(s) into one or more species of RNA. A promoter is operably
linked to a DNA sequence if the promoter is capable of initiating
transcription of that DNA sequence.
[0203] "Prokaryote" refers to all organisms without a true nucleus,
including bacteria.
[0204] "Eukaryote" refers to organisms and cells that have a true
nucleus, including mammalian cells.
[0205] "Host" includes prokaryotes and eukaryotes, such as yeast
and filamentous fungi, as well as plant and animal cells. The term
includes an organism or cell that is the recipient of a replicable
expression vehicle.
[0206] The term "animal" is used herein to include all vertebrate
animals, except humans. It also includes an individual animal in
all stages of development, including embryonic and fetal stages.
Preferred animals include higher eukaryotes such as avians, rodents
(e.g., mice, rabbits, rats, chinchillas, guinea pigs, hamsters and
the like), and mammals. Preferred mammals include bovine, equine,
feline, canine, ovine, caprine, porcine, buffalo, humans, and
primates.
[0207] A "transgenic animal" is an animal containing one or more
cells bearing genetic information received, directly or indirectly,
by deliberate genetic manipulation or by inheritance from a
manipulated progenitor at a subcellular level, such as by
microinjection or infection with a recombinant viral vector (e.g.,
adenovirus, retrovirus, herpes virus, adeno-associated virus,
lentivirus). This introduced DNA molecule may be integrated within
a chromosome, or it may be extra-chromosomally replicating DNA.
[0208] "Embryonic stem cells" or "ES cells" as used herein are
cells or cell lines usually derived from embryos which are
pluripotent meaning that they are undifferentiated cells. These
cells are also capable of incorporating exogenous DNA by homologous
recombination and subsequently developing into any tissue in the
body when incorporated into a host embryo. It is possible to
isolate pluripotent cells from sources other than embryonic tissue
by methods which are well understood in the art.
[0209] Embryonic stem cells in mice have enabled researchers to
select for transgenic cells and perform gene targeting. This allows
more genetic engineering than is possible with other transgenic
techniques. For example, mouse ES cells are relatively easy to grow
as colonies in vitro. The cells can be transfected by standard
procedures and transgenic cells clonally selected by antibiotic
resistance. See, for example, Doetschman et al., 1994, Gene
transfer in embryonic stem cells. In Pinkert (Ed.) Transgenic
Animal Technology: A Laboratory Handbook. Academic Press Inc., New
York, pp.115-146. Furthermore, the efficiency of this process is
such that sufficient transgenic colonies (hundreds to thousands)
can be produced to allow a second selection for homologous
recombinants. Mouse ES cells can then be combined with a normal
host embryo and, because they retain their potency, can develop
into all the tissues in the resulting chimeric animal, including
the germ cells. The transgenic modification can then be transmitted
to subsequent generations.
[0210] Methods for deriving embryonic stem (ES) cell lines in vitro
from early preimplantation mouse embryos are well known. See for
example, Evans et al., 1981 Nature 29:154-6 and Martin, 1981, Proc.
Nat. Acad. Sci. USA, 78: 7634-8. ES cells can be passaged in an
undifferentiated state, provided that a feeder layer of fibroblast
cells or a differentiation inhibiting source is present.
[0211] The term "somatic cell" indicates any animal or human cell
which is not a sperm or egg cell or is capable of becoming a sperm
or egg cell. The term "germ cell" or "germ-line cell" refers to any
cell which is either a sperm or egg cell or is capable of
developing into a sperm or egg cell and can therefore pass its
genetic information to offspring. The term "germ cell-line
transgenic animal" refers to a transgenic animal in which the
genetic information was incorporated in a germ line cell, thereby
conferring the ability to transfer the information to offspring. If
such offspring in fact possess some or all of that information,
then they, too, are transgenic animals.
[0212] The genetic alteration of genetic information may be foreign
to the species of animal to which the recipient belongs, or foreign
only to the particular individual recipient. In the last case, the
altered or introduced gene may be expressed differently than the
native gene.
[0213] "Fragment" of a gene refers to any portion of a gene
sequence. A "biologically active fragment" refers to any portion of
the gene that retains at least one biological activity of that
gene. For example, the fragment can perhaps hybridize to its
cognate sequence or is capable of being translated into a
polypeptide fragment encoded by the gene from which it is
derived.
[0214] "Variant" refers to a gene that is substantially similar in
structure and biological activity or immunological characteristics
to either the entire gene or to a fragment of the gene. Provided
that the two genes possess a similar activity, they are considered
variant as that term is used herein even if the sequence of encoded
amino acid residues is not identical. Preferentially, as used
herein (unless otherwise defined) the variant is one of LRP5, HBM
or LRP6. The variant preferably is one that yields an HBM-like
phenotype (i.e., enhances bones mass and/or modulates lipid
levels). These variants include missense mutations, single
nucleotide polymorphisms (SNPs), mutations which result in changes
in the amino acid sequence of the protein encoded by the gene or
nucleic acid, and combinations thereof, as well as corn in the exon
domains of the HBM gene and mutations in LRP5 or LRP6 which result
in an HBM like phenotype.
[0215] "Amplification of nucleic acids" refers to methods such as
polymerase chain reaction (PCR), ligation amplification (or ligase
chain reaction, LCR) and amplification methods based on the use of
Q-beta replicase. These methods are well known in the art and
described, for example, in U.S. Pat. Nos. 4,683,195 and 4,683,202.
Reagents and hardware for conducting PCR are commercially
available. Primers useful for amplifying sequences from the HBM
region are preferably complementary to, and hybridize specifically
to sequences in the HBM region or in regions that flank a target
region therein. HBM sequences generated by amplification may be
sequenced directly. Alternatively, the amplified sequence(s) may be
cloned prior to sequence analysis.
[0216] "Antibodies" may refer to polyclonal and/or monoclonal
antibodies and fragments thereof, and immunologic binding
equivalents thereof, that can bind to the HBM proteins and
fragments thereof or to nucleic acid sequences from the HBM region,
particularly from the HBM locus or a portion thereof. Preferred
antibodies also include those capable of binding to LRP5, LRP6 and
HBM variants. The term antibody is used both to refer to a
homogeneous molecular entity, or a mixture such as a serum product
made up of a plurality of different molecular entities. Proteins
may be prepared synthetically in a protein synthesizer and coupled
to a carrier molecule and injected over several months into
rabbits. Rabbit sera is tested for immunoreactivity to the HBM
protein or fragment. Monoclonal antibodies may be made by injecting
mice with the proteins, or fragments thereof. Monoclonal antibodies
will be screened by ELISA and tested for specific immunoreactivity
with HBM protein or fragments thereof. Harlow et al., Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y. (1988) and Using Antibodies: A Laboratory Manual,
Harlow, Ed and Lane, David (Cold Spring Harbor Press, 1999). These
antibodies will be useful in assays as well as pharmaceuticals. By
"antibody" is meant to include but not limited to polyclonal,
monoclonal, chimeric-, human, humanized, bispecific, multispecific,
primatized.TM. antibodies.
[0217] "HBM protein" refers to a protein that is identical to a
Zmax1 (LRP5) protein except that it contains an alteration of
glycine 171 to a valine. An HBM protein is defined for any organism
that encodes a Zmax1 (LRP5) true homolog. For example, a mouse HBM
protein refers to the mouse Zmax1 (LRP5) protein having the glycine
170 to valine substitution.
[0218] By "HBM-like" is meant a variant of LRP5, LRP6 or HBM which
when expressed in a cell is capable of modulating bone mass, lipid
levels, Dkk activity, and/or Wnt activity.
[0219] In one embodiment of the present invention, "HBM gene"
refers to the genomic DNA sequence found in individuals showing the
HBM characteristic or phenotype, where the sequence encodes the
protein indicated by SEQ ID NO: 4. The HBM gene and the Zmax1
(LRP5) gene are allelic. The protein encoded by the HBM gene has
the property of causing elevated bone mass, while the protein
encoded by the Zmax1 (LRP5) gene does not. The HBM gene and the
Zmax1 (LRP5) gene differ in that the HBM gene has a thymine at
position 582, while the Zmax1 gene has a guanine at position 582.
The HBM gene comprises the nucleic acid sequence shown as SEQ ID
NO: 2. The HBM gene may also be referred to as an "HBM
polymorphism." Other HBM genes may further have silent mutations,
such as those discussed in Section 3 below.
[0220] In alternative embodiments of the present invention, "HBM
gene" may also refer to any allelic variant of Zmax1 (LRP5) or LRP6
which results in the HBM phenotype. Such variants may include
alteration from the wild-type protein coding sequence as described
herein and/or alteration in expression control sequences of Zmax1
(LRP5) or contains an amino acid mutation in LRP5 or LRP6, such
that the resulting protein produces a phenotype which enhances bone
mass and/or modulates lipid levels. A preferred example of such a
variant is an alteration of the endogenous Zmax1 (LRP5) promoter
region resulting in increased expression of the Zmax1 (LRP5)
protein.
[0221] "Normal," "wild-type," "unaffected", "Zmax1", "Zmax", "LR3"
and "LRP5" all refer to the genomic DNA sequence that encodes the
protein indicated by SEQ ID NO: 3. LRP5 has also been referred to
LRP7 in mouse. Zmax1, LRP5 and Zmax may be used interchangeably
throughout the specification and are meant to be the same gene,
perhaps only relating to the gene in a different organism. The
Zmax1 gene has a guanine at position 582 in the human sequence. The
Zmax1 gene of human comprises the nucleic acid sequence shown as
SEQ ID NO: 1. "Normal," "wild-type," "unaffected", "Zmax1" and
"LRP5" also refer to allelic variants of the genomic sequence that
encodes proteins that do not contribute to elevated bone mass. The
Zmax1 (LRP5) gene is common in the human population, while the HBM
gene is rare.
[0222] "Bone development" generally refers to any process involved
in the change of bone over time, including, for example, normal
development, changes that occur during disease states, and changes
that occur during aging. This may refer to structural changes and
dynamic rate changes such as growth rates, resorption rates, bone
repair rates, and etc. "Bone development disorder" particularly
refers to any disorders in bone development including, for example,
changes that occur during disease states and changes that occur
during aging. Bone development may be progressive or cyclical in
nature. Aspects of bone that may change during development include,
for example, mineralization, formation of specific anatomical
features, and relative or absolute numbers of various cell
types.
[0223] "Bone modulation" or "modulation of bone formation" refers
to the ability to affect any of the physiological processes
involved in bone remodeling, as will be appreciated by one skilled
in the art, including, for example, bone resorption and
appositional bone growth, by, inter alia, osteoclastic and
osteoblastic activity, and may comprise some or all of bone
formation and development as used herein.
[0224] Bone is a dynamic tissue that is continually adapting and
renewing itself through the renewal of old or unnecessary bone by
osteoclasts and the rebuilding of new bone by osteoblasts. The
nature of the coupling between these processes is responsible for
both the modeling of bone during growth as well as the maintenance
of adult skeletal integrity through remodeling and repair to meet
the everyday needs of mechanical usage. There are a number of
diseases that result from an uncoupling of the balance between bone
resorption and formation. With aging there is a gradual
"physiologic" imbalance in bone turnover, which is particularly
exacerbated in women due to menopausal loss of estrogen support,
that leads to a progressive loss of bone. As bone mineral density
falls below population norms there is a consequent increase in bone
fragility and susceptibility to spontaneous fractures. For every 10
percent of bone that is lost, the risk of fracture doubles.
Individuals with bone mineral density (BMD) in the spine or
proximal femur 2.5 or more standard deviations below normal peak
bone mass are classified as osteoporotic. However, osteopenic
individuals with BMD between 1 and 2.5 standard deviations below
the norm are clearly at risk.
[0225] Bone is measured by several different forms of X-ray
absorptiometry. All of the instruments measure the inorganic or
bone mineral content of the bone. Standard DXA measurements give a
value that is an areal density, not a true density measurement by
the classical definition of density (mass/unit volume).
Nevertheless, this is the type of measurement used clinically to
diagnose osteoporosis. However, while BMD is a major contributing
factor to bone strength, as much as 40% of bone strength stems from
other factors including: 1) bone size (i.e., larger diameters
increase organ-level stiffness, even in the face of lower density);
2) the connectivity of trabecular structures; 3) the level of
remodeling (remodeling loci are local concentrators of strain); and
4) the intrinsic strength of the bony material itself, which in
turn is a function of loading history (i.e., through accumulated
fatigue damage) and the extent of collagen cross-linking and level
of mineralization. There is good evidence that all of these
strength/fragility factors play some role in osteoporotic
fractures, as do a host of extraskeletal influences as well (such
as fall patterns, soft tissue padding, and central nervous system
reflex responsiveness).
[0226] Additional analytical instruments can be used to address
these features of bone. For example, the PQCT allows measurement of
separate trabecular and cortical compartments for size and density
and the .mu.CT provides quantitative information on architectural
features such as trabecular connectivity. The .mu.CT also gives a
true bone density measurement. With these tools, the important
non-BMD parameters can be measured for diagnosing the extent of
disease and the efficacy of treatments. Current treatments for
osteoporosis are based on the ability of drugs to prevent or retard
bone resorption. Although newer anti-resorptive agents are proving
to be useful in the therapy of osteoporosis, they are viewed as
short-term solutions to the more definitive challenge to develop
treatments that will increase bone mass and/or the bone quality
parameters mentioned above.
[0227] Thus, bone modulation may be assessed by measuring
parameters such as bone mineral density (BMD) and bone mineral
content (BMC) by pDXA X-ray methods, bone size, thickness or volume
as measured by X-ray, bone formation rates as measured for example
by calcien labeling, total, trabecular, and mid-shaft density as
measured by pQCT and/or .mu.CT methods, connectivity and other
histological parameters as measured by .mu.CT methods, mechanical
bending and compressive strengths as preferably measured in femur
and vertebrae respectively. Due to the nature of these
measurements, each may be more or less appropriate for a given
situation as the skilled practitioner will appreciate. Furthermore,
parameters and methodologies such as a clinical history of freedom
from fracture, bone shape, bone morphology, connectivity, normal
histology, fracture repair rates, and other bone quality parameters
are known and used in the art. Most preferably, bone quality may be
assessed by the compressive strength of vertebra when such a
measurement is appropriate. Bone modulation may also be assessed by
rates of change in the various parameters. Most preferably, bone
modulation is assessed at more than one age.
[0228] "Normal bone density" refers to a bone density within two
standard deviations of a Z score of 0 in the context of the HBM
linkage study. In a general context, the range of normal bone
density parameters is determined by routine statistical methods. A
normal parameter is within about 1 or 2 standard deviations of the
age and sex normalized parameter, preferably about 2 standard
deviations. A statistical measure of meaningfulness is the P value
which can represent the likelihood that the associated measurement
is significantly different from the mean. Significant P values are
P<0.05, 0.01, 0.005, and 0.001, preferably at least
P<0.01.
[0229] "HBM" refers to "high bone mass" although this term may also
be expressed in terms of bone density, mineral content, and
size.
[0230] The "HBM phenotype" and "HBM-like phenotype" may be
characterized by an increase of about 2 or more standard
deviations, preferably 2, 2.5, 3, or more standard deviations in 1,
2, 3, 4, 5, or more quantitative parameters of bone modulation,
preferably bone density and mineral content and bone strength
parameters, above the age and sex norm for that parameter. The HBM
phenotype and HBM-like phenotype are characterized by statistically
significant increases in at least one parameter, preferably at
least 2 parameters, and more preferably at least 3 or more
parameters. The HBM phenotype and the HBM-like phenotype may also
be characterized by an increase in one or more bone quality
parameters and most preferably increasing parameters are not
accompanied by a decrease in any bone quality parameters. Most
preferably, an increase in bone modulation parameters and/or bone
quality measurements is observed at more than one age. The HBM
phenotype and HBM-like phenotype also includes changes of lipid
levels, Wnt activity and/or Dkk activity.
[0231] The terms "isolated" and "purified" refer to a substance
altered by hand of man from the natural environment. An isolated
peptide may be for example in a substantially pure form or
otherwise displaced from its native environment such as by
expression in an isolated cell line or transgenic animal. An
isolated sequence may for example be a molecule in substantially
pure form or displaced from its native environment such that at
least one end of said isolated sequence is not contiguous with the
sequence it would be contiguous with in nature.
[0232] "Biologically active" refers to those forms of proteins and
polypeptides, including conservatively substituted variants,
alleles of genes encoding a protein or polypeptide fragments of
proteins which retain a biological and/or immunological activity of
the wild-type protein or polypeptide. Preferably the activity is
one which induces a change in Dkk activity, such as inhibiting the
interaction of Dkk with a ligand binding partner (e.g., LRP5 or
LRP6 or Dkk-1 with a Dkk-1 interacting protein such as those shown
in FIG. 5). By biologically active is also meant to include any
form which modulates Wnt signaling.
[0233] By "modulate" and "regulate" is meant methods, conditions,
or agents which increase or decrease the wild-type activity of an
enzyme, inhibitor, signal transducer, receptor, transcription
activator, co-factor, and the like. This change in activity can be
an increase or decrease of mRNA translation, mRNA or DNA
transcription, and/or mRNA or protein degradation, which may in
turn correspond to an increase or decrease in biological
activity.
[0234] By "modulated activity" is meant any activity, condition,
disease or phenotype which is modulated by a biologically active
form of a protein. Modulation may be effected by affecting the
concentration or subcellular localization of biologically active
protein, i.e., by regulating expression or degradation, or by
direct agonistic or antagonistic effect as, for example, through
inhibition, activation, binding, or release of substrate,
modification either chemically or structurally, or by direct or
indirect interaction which may involve additional factors.
[0235] By "effective amount" or "dose effective amount" or
"therapeutically effective amount" is meant an amount of an agent
which modulates a biological activity of the polypeptide of the
invention.
[0236] By "immunologically active" is meant any immunoglobulin
protein or fragment thereof which recognizes and binds to an
antigen.
[0237] By "Dkk" is meant to refer to the nucleic acids and proteins
of members of the Dkk (Dickkopf) family. This includes, but is not
limited to, Dkk-1, Dkk-2, Dkk-3, Dkk-4, Soggy, and related Dkk
proteins. Dkk-1 is a preferred embodiment of the present invention.
However, the Dkk proteins have substantial homology and one skilled
in the art will appreciate that all of the embodiments of the
present invention utilizing Dkk-1 may also be utilized with the
other Dkk proteins.
[0238] By "Dkk-1" is meant to refer to the Dkk-1 protein and
nucleic acids which encode the Dkk-1 protein. Dkk-1 refers to
Dickkopf-1, and in Xenopus it is related to at least Dkk-2, Dkk-3,
and Dkk-4 (see Krupnik et al., Gene 238:301-313 (1999)). Dkk-1 was
first identified in Xenopus (Glinka et al., Nature 391:357-62
(1998)). It was recognized as a factor capable of inducing ectopic
head formation in the presence of inhibition of the BMP pathway. It
was then also found to inhibit the axis-inducing activity of
several Xenopus Wnt molecules by acting as an extracellular
antagonist of Wnt signaling. Mammalian homologs have been found
including Dkk-1, Dkk-2, Dkk-3, Dkk-4 and soggy (Fedi et al., 1999
and Krupnick et al. 1999). Human Dkk-1 was also referred to as sk
(Fedi et al. 1999). As used herein, Dkk-1 is meant to include
proteins from any species having a Wnt pathway in which Dkk-1
interacts. Particularly preferred are mammalian species (e.g.,
murine, caprine, canine, bovine, feline, equine, primate, ovine,
porcine and the like), with particularly preferred mammals being
humans. Nucleic acid sequences encoding Dkk-1 include, but are not
limited to human Dkk-1 (GenBank Accession Nos. AH009834,
XM.sub.--005730, AF261158, AF261157, AF177394, AF127563 and
NM.sub.--012242), Mus musculus dickkopf homolog 1 (GenBank
Accession No. NM.sub.--010051), and Danio rerio dickkopf-1 (GenBank
Accession Nos. AF116852 and AB023488). The genomic sequences with
exon annotation are GenBank Accession Nos. AF261157 and AF261158.
Also contemplated are homologs of these sequences which have Dkk-1
activity in the Wnt pathway. Dkk-1 amino acid sequences include,
but are not limited to human dickkopf homolog 1 (GenBank Accession
Nos. AAG15544, BAA34651, NP.sub.--036374, MF02674, AAD21087, and
XP.sub.--005730), Danio rerio (zebrafish) dickkopf1 (GenBank
Accession Nos. BAA82135 and AAD22461) and murine dickkopf-1
(GenBank Accession Nos. O54908 and NP.sub.--034181). Variants and
homologs of these sequences which possess Dkk-1 activity are also
included when referring to Dkk-1.
[0239] By "Dkk mediated" disorder, condition or disease is any
abnormal state that involves Dkk activity. The abnormal state can
be induced by environmental exposure or drug administration.
Alternatively, the disease or disorder can be due to a genetic
defect. Dkk mediated diseases, disorders and conditions include but
are not limited to bone mass disorders or conditions and lipid
disorders and conditions. For example, bone mass
disorders/conditions/diseases, which may be mediated by Dkk,
include but are not limited to age related loss of bone, bone
fractures (e.g., hip fracture, Colle's fracture, vertebral crush
fractures), chondrodystrophies, drug-induced disorders (e.g.,
osteoporosis due to administration of glucocorticoids or heparin
and osteomalacia due to administration of aluminum hydroxide,
anticonvulsants, or glutethimide), high bone turnover,
hypercalcemia, hyperostosis, osteogenesis imperfecta, osteomalacia,
osteomyelitis, osteoporosis, Paget's disease, osteoarthritis, and
rickets.
[0240] Lipid disorders/diseases/conditions, which may be mediated
by Dkk, include but are not limited to familial lipoprotein lipase
deficiency, familial apoprotein CII deficiency, familial type 3
hyperlipoproteinemia, familial hypercholesterolemia, familial
hypertriglyceridemia, multiple lipoprotein-type hyperlipidemia,
elevated lipid levels due to dialysis and/or diabetes, and elevated
lipid levels of unknown etiologies
[0241] The term "recognizes and binds," when used to define
interactions of antisense nucleotides, siRNAs (small inhibitory
RNA), or shRNA (short hairpin RNA) with a target sequence, means
that a particular antisense, siRNA, or shRNA sequence is
substantially complementary to the target sequence, and thus will
specifically bind to a portion of an mRNA encoding polypeptide. As
such, typically the sequences will be highly complementary to the
mRNA target sequence, and will have no more than 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10 base mismatches throughout the sequence. In many
instances, it may be desirable for the sequences to be exact
matches, i.e. be completely complementary to the sequence to which
the oligonucleotide specifically binds, and therefore have zero
mismatches along the complementary stretch. As such, highly
complementary sequences will typically bind quite specifically to
the target sequence region of the mRNA and will therefore be highly
efficient in reducing, and/or even inhibiting the translation of
the target mRNA sequence into polypeptide product.
[0242] Substantially complementary oligonucleotide sequences will
be greater than about 80 percent complementary (or `% exact-match`)
to the corresponding mRNA target sequence to which the
oligonucleotide specifically binds, and will, more preferably be
greater than about 85 percent complementary to the corresponding
mRNA target sequence to which the oligonucleotide specifically
binds. In certain aspects, as described above, it will be desirable
to have even more substantially complementary oligonucleotide
sequences for use in the practice of the invention, and in such
instances, the oligonucleotide sequences will be greater than about
90 percent complementary to the corresponding mRNA target sequence
to which the oligonucleotide specifically binds, and may in certain
embodiments be greater than about 95 percent complementary to the
corresponding mRNA target sequence to which the oligonucleotide
specifically binds, and even up to and including 96%, 97%, 98%,
99%, and even 100% exact match complementary to the target mRNA to
which the designed oligonucleotide specifically binds.
[0243] Percent similarity or percent complementary of any of the
disclosed sequences may be determined, for example, by comparing
sequence information using the GAP computer program, version 6.0,
available from the University of Wisconsin Genetics Computer Group
(UWGCG). The GAP program utilizes the alignment method of Needleman
and Wunsch (1970). Briefly, the GAP program defines similarity as
the number of aligned symbols (i.e., nucleotides or amino acids)
which are similar, divided by the total number of symbols in the
shorter of the two sequences. The preferred default parameters for
the GAP program include: (1) a unary comparison matrix (containing
a value of 1 for identities and 0 for non-identities) for
nucleotides, and the weighted comparison matrix of Gribskov and
Burgess (1986), (2) a penalty of 3.0 for each gap and an additional
0.10 penalty for each symbol in each gap; and (3) no penalty for
end gaps.
[0244] By "mimetic" is meant a compound or molecule that performs
the same function or behaves similarly to the compound
mimicked.
[0245] By "reporter element" is meant a polynucleotide that encodes
a poplypeptide capable of being detected in a screening assays.
Examples of polypeptides encoded by reporter elements include, but
are not limited to, lacZ, GFP, luciferase, and chloramphenicol
acetyltransferase.
[0246] 2. Introduction
[0247] A polymorphism in LRP5 (Zmax), G171V, designated as HBM, has
been identified as conferring a high bone mass phenotype in a
population of related subjects as described in co-pending
applications International Patent Application PCT/US 00/16951, and
U.S. patent application Ser. Nos. 09/543,771 and 09/544,398, which
are hereby incorporated by reference in their entirety (Little et
al., Am J Hum Genet. 70:11-19 (2002)). LRP5 is also described in
International Patent Application WO 98/46743, which is incorporated
by reference in its entirety. Loss of LRP5 function has been shown
to have a deleterious effect on bone (Gong et al., Cell 107:513-523
(2001)). Additionally, the HBM polymorphism and LRP5 may also be
important in cardiac health and lipid-mediated disorders. Thus,
methods of regulating their activity can serve as methods of
treating and/or preventing cardiac and lipid-mediated
disorders.
[0248] Recent studies have indicated that LRP5 participates in the
Wnt signal transduction pathway. The Wnt pathway is critical in
limb early embryological development. A recently published sketch
of the components of Wnt signaling is shown in FIG. 1 (Nusse, 2001
http://www.stanford.edu/- .about.rnusse/pathways/cell2.html) (see
also, Nusse, Nature 411:255-6 (2001); and Mao et al., Nature
411:321-5 (2001)). Briefly summarized, Wnt proteins are secreted
proteins which interact with the transmembrane protein Frizzled
(Fz). LRP proteins, such as LRP5 and LRP6, are believed to modulate
the Wnt signal in a complex with Fz (Tamai et al., Nature 407:530-5
(2000)). The Wnt pathway acts intracellularly through the
Disheveled protein (Dsh) which in turn inhibits glycogen synthetase
kinase-3 (GSK3) from phosphorylating .beta.-catenin. Phosphorylated
.beta.-catenin is rapidly degraded following ubiquitination.
However, the stabilized .beta.-catenin accumulates and translocates
to the nucleus where it acts as a cofactor of the T-cell factor
(TCF) transcription activator complex.
[0249] The protein dickkopf-1 (Dkk-1) is reported to be an
antagonist of Wnt pathway. Dkk-1 is required for head formation in
early development. Dkk-1 and its function in the Wnt pathway are
described in e.g., Krupnik, et al., Gene 238:301-13 (1999); Fedi et
al., J. Biol. Chem. 274:19465-72 (1999); see also for Dkk-1 and the
Wnt pathway, Wu et al., Curr. Biol. 10:1611-4 (2000), Shinya et
al., Mech. Dev. 98:3-17 (2000), Mukhopadhyay et al., Dev Cell
1:423-434 (2001) and in PCT Patent Application No. WO 00/52047, and
in references cited in each. It has been known that Dkk-1 acts
upstream of Dsh, however the nature of the mechanism of inhibition
by Dkk-1 is just beginning to be elucidated. Dkk-1 is expressed in
the mouse embryonic limb bud and its disruption results in abnormal
limb morphogensis, among other developmental defects (Gotewold et
al., Mech. Dev. 89:151-3 (1999); and, Mukhopadhyay et al., Dev Cell
1:423-434 (2001)).
[0250] Related U.S. provisional application 60/291,311 disclosed a
novel interaction between Dkk-1 (GenBank Accession No. XM 005730)
and LRP5. The interaction between Dkk-1 and LRP5 was discovered by
a yeast two hybrid (Y2H) screen for proteins which interact with
the ligand binding domain of LRP5, as described in Example 1. The
two-hybrid screen is a common procedure in the art, which is
described, for example, by Gietz et al., Mol. Cell. Biochem.
172:67-79 (1997); Young, Biol. Reprod. 58:302-11 (1998); Brent and
Finley, Ann. Rev. Genet. 31:663-704 (1997); and Lu and Hannon,
eds., Yeast Hybrid Technologies, Eaton Publishing, Natick Mass.,
(2000). More recently, other studies confirm that Dkk-1 is a
binding partner for LRP and modulates the Wnt pathway via direct
binding with LRP (R. Nusse, Nature 411:255-256 (2001); A. Bafico et
al., Nat. Cell Biol. 3:683-686 (2001); M. Semnov, Curr. Biol.
11:951-961 (2001); B. Mao, Nature 411:321-325 (2001), Zorn, Curr.
Biol. 11:R592-5 (2001)); and, L. Li et al., J. Biol Chem.
277:5977-81 (2002)).
[0251] Mao and colleagues (2001) identified Dkk-1 as a ligand for
LRP6. Mao et al. suggest that Dkk-1 and LRP6 interact
antagonistically where Dkk proteins inhibit the Wnt coreceptor
functions of LRP6. Using co-immunoprecipitation, the group verified
that the Dkk-1/LRP6 interaction was direct. Dkk-2 was also found to
directly bind LRP6. Contrary to data contained in provisional
application 60/291,311, Mao et al. report that no interaction was
detected between any Dkk protein and LRP5, as well as no
interaction with LDLR, VLDLR, ApoER, or LRP). Additionally, Mao et
al. demonstrated that LRP6 can titrate Dkk-1's effects of
inhibiting Wnt signaling using the commercial TCF-luciferase
reporter gene assay (TOPFLASH). A similar conclusion was drawn from
analogous studies in Xenopus embryos. Deletion analyses of LRP6
functional domains revealed that EGF repeats (beta-propellers) 3
and 4 were necessary for Dkk-1 binding and that the ligand binding
domains of LRP6 had no effect on Dkk-1 binding. The findings of Mao
et al. contrast with data obtained by the present inventors
indication that the ligand binding domains of LRP5 were necessary
and sufficient for Dkk-1 binding in yeast. Using classical
biochemical ligand-receptor studies, Mao et al. determined a
Kd=0.34 nM for Dkk-1/LRP6 and a Kd=0.73 nM for Dkk-2/LRP6.
[0252] Semenov et al. (2001) verified the Mao group's results and
confirmed by coimmunoprecipitation that Dkk-1 does not directly
bind to Wnt or Frizzled but rather interacts with LRP6. Their
Scatchard analyses found a Kd=0.5 nM for Dkk-1/LRP6. Semenov et a/.
also demonstrated that Dkk-1 could abolish an LRP5/Frizzled8
complex implying that Dkk-1 can also repress Wnt signaling via
interactions with LRP5. A Dkk-1 mutant where cysteine 220 was
changed to alanine abolished LRP6 binding and was unable to repress
Wnt signaling. Studies in Xenopus embryos confirmed the results and
revealed a functional consequence of Dkk-1/LRP6: repression of Wnt
signaling. Their Xenopus work also suggested that LRP6/Dkk-1 may be
specific for the canonical, -catenin-mediated, Wnt pathways as
opposed to the Wnt Planar Cell Polarity pathway.
[0253] Bafico et al. (2001) employed a .sup.125I-labeled Dkk-1
molecule to identify LRP6 as its sole membrane receptor with a
Kd=0.39 nM. Again, the functional consequences of the Dkk-1/LRP6
interaction was a repression of the canonical Wnt signaling even
when Dkk-1 was added at extremely low concentrations (30 pM).
[0254] Not wishing to be bound by theory, it is believed that the
present invention provides an explanation for the mechanism of
Dkk-1 inhibition of the Wnt pathway and provides a mechanism
whereby the Wnt pathway may be modulated. The present application
and related provisional application 60/291,311 describe Dkk-1/LRP5
interactions and demonstrate that the interaction between
LRP5/LRP6/HBM and Dkk can be used in a method as an intervention
point in the Wnt pathway for an anabolic bone therapeutic or a
modulator of lipid metabolism.
[0255] As detailed below, in the section "Methods to Identify
Binding Partners" and Examples 6 and 7, Dkk-1 is able to repress
LRP5-mediated Wnt signaling but not HBM-mediated Wnt signaling.
This observation is of particular interest because the HBM mutation
in LRP5 is a gain of function or activation mutation. That is, Wnt
signaling, via the canonical pathway, is enhanced with HBM versus
LRP5. The present data suggest the mechanism of this functional
activation: the inability of Dkk-1 to repress HBM-mediated Wnt
signaling. Further investigations of other Wnt or Dkk family
members show differential activities in the canonical Wnt pathway
that demonstrate the complexity and variability in Wnt signaling
that can be achieved depending on the LRP/Dkk/Wnt/Frizzled
repertoire that is expressed in a particular cell or tissue. This
may attest to the apparent bone specificity of the HBM phenotype in
humans and in the HBM transgenic animals.
[0256] Furthermore, the present data reveal the importance and
functional consequence for the potential structural perturbation of
the first beta-propeller domain of LRP5. Our data identified the
ligand binding domain of LRP5 as the interacting region with Dkk-1
while the Mao et al. publication demonstrated the functional role
of propellers 3 and 4 in their LRP6/Dkk-1 studies. In the present
invention, we implicate the first beta propeller domain, via the
HBM mutation at residue 171, as having a functional consequence in
the Dkk-1 -mediated Wnt pathway. The involvement of position 171 of
propeller 1 may be direct or indirect with Dkk-1. Direct
involvement could arise from perturbations of the 3-dimensional
structure of the HBM extracellular domain that render Dkk-1 unable
to bind. Alternatively, residue 171 of propeller 1 may directly
interact with Dkk-1; however, by itself, it is insufficient to bind
and requires other LRP5 domains. Potential indirect candidate
molecules may be among the proteins identified the Dkk-1
yeast-two-hybrid experiments.
[0257] It may be that the disruption of Dkk activity is not
necessarily mediated by enhancing or preventing the binding of Dkk
to LRP5/LRP6/HBM. More than one mechanism may be involved. Indeed,
the inventors have observed that Dkk-1 binds LRP5, LRP6, and HBM.
It is able to effectively inhibit LRP6, and to a slightly lesser
extent, LRP5 activity. Further, has been observed that different
members of the Dkk family differentially affect LRP5/LRP6/HBM
activity. For example, Dkk-1 inhibits LRP5/LRP6/HBM activity while
another Dkk may enhance LRP5/LRP6/HBM activity. An endpoint to
consider is the modulation of the LRP5/LRP6/HBM activity, not
simply binding.
[0258] The present disclosure shows that targeting the disruption
of the Dkk-1/LRP5 interaction is a therapeutic intervention point
for an HBM mimetic agent. A therapeutic agent of the invention may
be a small molecule, peptide or nucleic acid aptamer, antibody, or
other peptide/protein, etc. Methods of reducing Dkk-1 expression
may also be therapeutic using methodologies such as: RNA
interference, antisense oligonucleotides, morpholino
oligonucleotides, PNAs, antibodies to Dkk-1 or Dkk-1 interacting
proteins, decoy or scavenger LRP5 or LRP6 receptors, and knockdown
of Dkk-1 or Dkk-1 interactor transcription.
[0259] In an embodiment of the present invention, the activity of
Dkk-1 or the activity of a Dkk-1 interacting protein may be
modulated for example by binding with a peptide aptamer of the
present invention. In another embodiment, LRP5 activity may be
modulated by a reagent provided by the present invention (e.g., a
peptide aptamer). In another embodiment, the Dkk-1/LRP5 interaction
may be modulated by a reagent of the present invention (e.g., a
Dkk-1 interacting protein such as those identified in FIG. 5). In
another embodiment, the Wnt signal transduction pathway may be
modulated by use of one or more of the above methods. In a
preferred embodiment of the present invention, the Dkk-1 mediated
activity of the Wnt pathway may be specifically modulated by one or
more of the above methods. In another preferred embodiment of the
present invention, the Wnt signal transduction pathway may be
stimulated by down-regulating Dkk-1 interacting protein activity;
such down-regulation could, for example, yield greater LRP5
activity. In a more preferred embodiment, by stimulating LRP5
activity, bone mass regulation may be stimulated to restore or
maintain a more optimal level. In another preferred embodiment, by
stimulating LRP5 activity, lipid metabolism may be stimulated to
restore or maintain a more optimal level. Alternative embodiments
provide methods for screening candidate drugs and therapies
directed to correction of bone mass disorders or lipid metabolism
disorders. And, preferred embodiments of the present invention
provide drugs and therapies developed by the use of the reagents
and/or methods of the present invention. One skilled in the art
will understand that the present invention provides important
research tools to develop an effective model of osteoporosis, to
increase understanding of bone mass and lipid modulation, and to
modulate bone mass and lipid metabolism.
[0260] Previous investigation of a large family in which high bone
mass is inherited as a single gene (autosomal dominant) trait
(HBM-1) has provided important insight into the mechanism by which
bone density might be modulated. Members of this family have
significantly increased spinal and hip BMD (>3 standard
deviations above the norm) which affects young adults as well as
elderly family members into the ninth decade. The bones of affected
members, while appearing very dense radiographically, have normal
external shape and outer dimensions. Cortical bone is thickened on
endosteal surfaces and "affected" individuals are asymptomatic
without any other phenotypic abnormalities. Assays of biochemical
markers that reflect skeletal turnover suggest that the disorder is
associated with a normal rate of bone remodeling. Affected
individuals have achieved a balance in bone turnover at a density
that is significantly greater than necessary for normal skeletal
stresses. Importantly, the bones most affected are load-bearing
bones which are subjected to the greatest mechanical and
gravitational stresses (spine and hip). These are the most
important bones to target fir therapeutic interventions in
osteoporosis. The gene identified as being responsible for this
phenotype, Zmax or LRP5, was not previously associated with bone
physiology. The fact that modification of this gene, such as that
produced by the polymorphism leading to the autosomal dominant
inheritance of the HBM family phenotype, identifies Zmax/LRP5 and
the pathway by which it is regulated, including DkkNVnt pathways
discussed above, as an important target for developing modulators
of bone density. Modulation of Zmax/LRP5 to mimic the gain in
function provided by the HBM polymorphism would be expected to
provide an important therapy for bone wasting conditions.
Additionally, such modulation in young adults could enhance peak
bone mass and prevent or delay fracture risk later in life.
Alternatively, modulation to reduce function could be employed to
treat conditions where bone is being inappropriately produced.
[0261] 3. Polypeptides
[0262] Polypeptides contemplated for use in this invention include
those which modulate Dkk and Dkk interacting protein activities.
Preferred polypeptides and peptides include those which modulate
the Wnt pathway. Examples of preferred sequences include the Y2H
baits exemplified in FIG. 2, peptide aptamers of FIG. 3 (SEQ ID
NOs:171-188) and FIG. 4 (SEQ ID NOs:189-192), the polypeptides of
the Dkk-1 interacting proteins identified in FIG. 5, those
polypeptides shown in FIG. 6, the LRP binding domain of Dkk (amino
acids 138-266 of hDkk1), the cysteine-rich domain 2 (a.a. 183-245
of hDkk-1), the cysteine-rich domain 1 (a.a. 97-138 of hDkk), and
LRP5 binding aptamers of FIG. 13 (including SEQ ID NOs:204-213).
Although Dkk-1 is exemplified, the other Dkk proteins contain
substantially similar regions and may also be used according to the
present invention.
[0263] For example, the baits depicted in FIG. 2 were used in a
yeast two hybrid (Y2H) screen. The Y2H screen was performed as
described in Example 2 to determine the minimum required binding
domain for Dkk-1 to bind LRP5. The minimum binding domain
constructs (i.e., residues 139-266 in bold below and residues
97-245 which are underlined, of Dkk-1) include the second cysteine
rich domain which has sequence homology to a colipase fold.
2 (SEQ ID NO: 128) mmalgaagat rvfvamvaaa lgghpllgvs atlnsvlnsn
aiknlppplg gaaghpgsav 60 .fwdarw. saapgilypg gnkyqtidny qpypcaedee
cgtdeycasp trggdagvgqi clacrkrrkr 120 cmrhamccpg nyckngic____ 180
_____ 240 (GenBank Accession No. XP_005730).
[0264] This homology suggests a lipid-binding function and may
facilitate Dkk-1 interactions at the plasma membrane (van
Tilbeurgh, H., Biochim. Biophys. Acta. 1441:173-84 (1999)). An
interaction domain of Dkk-1 that is able to interact with the
ligand binding domain (LBD) of LRP5 is a useful reagent in the
modulation of LRP5 activity and modulation of Dkk-1/LRP5 complex
formation. Similar screens can be prepared for Dkk-1 and Dkk-1
interacting proteins or polypeptides.
[0265] A set of peptide aptamers was identified from a library of
random peptides constrained and presented in a thioredoxin A (trxA)
scaffold as described in Example 3. Peptide aptamers are powerful
new tools for molecular medicine as reviewed by Hoppe-Seyler &
Butz, J. Mol. Med., 78:426-430 (2000); Brody and Gold, Rev. Mol.
Biotech., 74:5-13 (2000); and Colas, Curr. Opin. in Chem. Biol.
4:54-9 (2000) and the references cited therein. Briefly, peptide
aptamers have been shown to be highly specific reagents capable of
binding in vivo. As such, peptide aptamers provide a method of
modulating the function of a protein and may serve as a substitute
for conventional knock-out methods, knock-down or complete loss of
function. Peptide aptamers are also useful reagents for the
validation of targets for drug development and may be used as
therapeutic compounds directly or provide the necessary foundation
for drug design. Once identified, the peptide insert may be
synthesized and used directly or incorporated into another carrier
molecule. References reviewed and cited by Brody and Gold (2000,
supra) describe demonstrated therapeutic and diagnostic
applications of peptide aptamers and would be known to the skilled
artisan.
[0266] The peptide aptamers of the present invention are useful
reagents in the binding of Dkk-1 to its ligands and thereby
modulation of the Wnt pathway and may be used to prevent Dkk-1 from
inhibiting LRP5 modulation or Dkk-1 interacting protein modulation
of the Wnt pathway. The sequence of these peptide aptamers is shown
in FIG. 3 (SEQ ID NOs:171-188). The peptide aptamers refers to the
peptide constrained by the thioredoxin scaffold. The aptamers are
also contemplated as therapeutic agents to treat Dkk-1 mediated
diseases and conditions. Such aptamers are useful structural guides
to chemists, for the design of mimetic compounds of the
aptamers.
[0267] Peptide aptamers were likewise developed to the LRP5 ligand
binding domain (LBD) bait sequences. The sequences of these peptide
aptamers is shown in FIG. 4 (SEQ ID NOs:189-192). These are useful
reagents which may be used to disrupt the Dkk-1/LRP5 binding
interface while leaving Dkk-1 undisturbed. These can be used as
comparative controls for Wnt signaling, thus, a control is provided
for the specificity of any drug or therapy screened. The aptamers
are also useful therapeutic agents to treat LRP mediated diseases
and conditions. Such aptamers may also be used as structural guides
to chemists, for the design of mimetic compounds of the
aptamers.
[0268] Thirty proteins were identified which interact with Dkk-1,
Dkk-1 interacting proteins, were identified in a yeast-two-hybrid
screen using the Dkk-1 bait and are shown in FIG. 5. It was noted
that these results suggest an interaction of Dkk-1 with Notch-2. It
has been suggested that cross-talk exists between the Wnt and Notch
signaling pathways. For instance, Presenilin1 (Ps1) is required for
Notch processing and inhibits the downstream Wnt pathway. The
extracellular domain of Notch is thought to interact with Wnt.
Furthermore, the Notch intracellular domain is thought to interact
with disheveled and in signal induced processing, the intracellular
domain is thought to interact with presenilin. (Soriano et a., J.
Cell Biol. 152:785-94 (2001)). For additional information regarding
the relationships between Notch and Wnt signaling, see Wesley, Mol.
Cell. Biol. 19:5743-58 (1999) and Axelrod et al., Science
271:1826-32 (1996).
[0269] An interaction between Dkk-1 and chordin has also been
noted; suggesting that cross-talk exists between the Wnt and
TGF-beta/BMP signaling pathways (Letamendia et al., J. Bone Joint
Surg. Am. 83A:S31 (2001); Labbe et al., Proc. Natl. Acad. Sci. USA
97:8358-63 (2000); Nishita et al., Nature 403:781-5 (2000);
DeRobertis et al., Int. J. Dev. Biol.. 45:1389-97 (2001); and
Saint-Jeannet et a., Proc. Natl. Acad. Sci. USA 94:13713-8 (1997)).
The BMP signaling pathway has an established role in bone and
connective tissue development, repair and homeostasis (review in
Rosen and Wozney "Bone Morphogenetic Proteins" In: Principles of
Bone Biology, 2.sup.nd Edition, Eds. J. Bilezikian, L. Raisz and G.
Rodan, Academic Press, pp. 919-28 (2002)). Chordin is an important
molecule during development which also modulates BMP signaling in
adults by sequestering BMPs in latent complexes (Piccolo et al.,
Cell 86:589-98 (1996) reviewed in Reddi, Arthritis Res. 3:1-5
(2001); DeRobertis et al., Int. J. Dev. Biol. 45:189-97 (2001)). It
may be that Dkk effects bone mass modulation through both the Wnt
signaling pathway via LRP and the BMP pathway via chordin.
[0270] Moreover, a number of putative growth factors, growth factor
related proteins, and extracellular matrix proteins have been
identified as Dkk-1 interacting proteins. Additional information
regarding Dkk-1 interacting proteins identified in the Y2H assay
may be obtained from publicly available databases such as PubMed
via the use of the accession numbers provided in the present
application. In a preferred embodiment of the invention, the amino
acid sequences of these Dkk-1 interacting proteins or biologically
active fragments thereof be used to modulate Dkk, Dkk-1, LRP5,
LRP6, HBM, or Wnt activity. Although these proteins were identified
as interacting with Dkk-1, due to the substantial homology between
the various Dkk proteins, such interacting proteins are
contemplated to interact with the other Dkk family members.
[0271] 4. Aptamer Mimetics
[0272] The present invention further provides for mimetics of Dkk,
particularly Dkk-1, and LRP5 peptide aptamers. Such aptamers may
serve as structural guides to chemists for the design of mimetic
compounds of the aptamers. The aptamers and their mimetics are
useful as therapeutic agents to treat LRP- or Dkk-mediated diseases
and conditions.
[0273] 5. Nucleic Acid Molecules
[0274] The present invention further provides nucleic acid
molecules that encode polypeptides and proteins which interact with
Dkk and Dkk interacting proteins, and/or LRP5 (also LRP6 and HBM)
to modulate biological activities of these proteins. Preferred
embodiments provide nucleic acids encoding for fragments of Dkk-1
protein, including the nucleic acids of FIG. 7, the Dkk-1
interacting proteins listed in FIG. 5, polypeptide aptamers of
Dkk-1 (FIG. 3--SEQ ID NOs:171-188), LRP5 (FIG. 4--SEQ ID
NOs:189-192), FIG. 13 peptide aptamers (including SEQ ID
NO:204-214) encoded by FIG. 12 polynucleotides (including SEQ ID
NO:193-203), LRP6 and HBM and the related fusion proteins herein
described, preferably in isolated or purified form. As used herein,
"nucleic acid" is defined as RNA, DNA, or cDNA that encodes a
peptide as defined above, or is complementary to a nucleic acid
sequence encoding such peptides, or hybridizes to either the sense
or antisense strands of the nucleic acid and remains stably bound
to it under appropriate stringency conditions. The nucleic acid may
encode a polypeptide sharing at least about 75% sequence identity,
preferably at least about 80%, and more preferably at least about
85%, with the peptide sequences; at least about 90%, 95%, 96%, 97%,
98%, and 99% or greater are also contemplated. Specifically
contemplated are genomic DNA, cDNA, mRNA, antisense molecules,
enzymatically active nucleic acids (e.g., ribozymes), as well as
nucleic acids based on an alternative backbone or including
alternative bases, whether derived from natural sources or
synthesized. Such hybridizing or complementary nucleic acids,
however, are defined further as being novel and nonobvious over any
prior art nucleic acid including that which encodes, hybridizes
under appropriate stringency conditions, or is complementary to a
nucleic acid encoding a protein according to the present
invention.
[0275] As used herein, the terms "hybridization" (hybridizing) and
"specificity" (specific for) in the context of nucleotide sequences
are used interchangeably. The ability of two nucleotide sequences
to hybridize to each other is based upon the degree of
complementarity of the two nucleotide sequences, which in turn is
based on the fraction of matched complementary nucleotide pairs.
The more nucleotides in a given sequence that are complementary to
another sequence, the greater the degree of hybridization of one to
the other. The degree of hybridization also depends on the
conditions of stringency which include temperature, solvent ratios,
salt concentrations, and the like. In particular, "selective
hybridization" pertains to conditions in which the degree of
hybridization of a polynucleotide of the invention to its target
would require complete or nearly complete complementarity. The
complementarity must be sufficiently high so as to assure that the
polynucleotide of the invention will bind specifically to the
target nucleotide sequence relative to the binding of other nucleic
acids present in the hybridization medium. With selective
hybridization, complementarity will be about 90-100%, preferably
about 95-100%, more preferably about 100%.
[0276] "Stringent conditions" are those that (1) employ low ionic
strength and high temperature for washing, for example: 0.015 M
NaCl, 0.0015 M sodium titrate, 0.1% SDS at 50.degree. C.; or (2)
employ during hybridization a denaturing agent such as formamide,
for example, 50% (vol/vol) formamide with 0.1% bovine serum
albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium
phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate
at 42.degree. C. Another example is use of 50% formamide, 5.times.
SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate
(pH 6.8), 0.1% sodium pyrophosphate, 5.times. Denhardt's solution,
sonicated salmon sperm DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran
sulfate at 42.degree. C., with washes at 42.degree. C. in
0.2.times. SSC and 0.1% SDS. A skilled artisan can readily
determine and vary the stringency conditions appropriately to
obtain a clear and detectable hybridization signal.
[0277] As used herein, a nucleic acid molecule is said to be
"isolated" or "purified" when the nucleic acid molecule is
substantially separated from contaminant nucleic acid encoding
other polypeptides from the source of nucleic acid. Isolated or
purified is also meant to include nucleic acids which encode Dkk or
fragments thereof which lack surrounding genomic sequences that
flank the Dkk gene. Isolated or purified is further intended to
include nucleic acids which encode Dkk interacting proteins or
biologically active fragments thereof which lack surrounding
genomic sequences that flank the Dkk interacting protein genes.
[0278] The present invention further provides fragments of the
encoding nucleic acid molecule. As used herein, a fragment of an
encoding nucleic acid molecule refers to a small portion of the
entire protein encoding sequence. The size of the fragment will be
determined by the intended use. For example, if the fragment is
chosen so as to encode an active portion of the protein, the
fragment will need to be large enough to encode the functional
region(s) of the protein. If the fragment is to be used as a
nucleic acid probe or PCR primer, then the fragment length is
chosen so as to obtain a relatively small number of false positives
during probing/priming.
[0279] Fragments of the encoding nucleic acid molecules of the
present invention (i.e., synthetic oligonucleotides) that are used
as probes or specific primers for the polymerase chain reaction
(PCR), or to synthesize gene sequences encoding proteins of the
invention can easily be synthesized by chemical techniques, for
example, the phosphotriester method of Matteucci et al. (J. Am.
Chem. Soc. 103:3185-3191 (1981)) or using automated synthesis
methods. In addition, larger DNA segments can readily be prepared
by well known methods, such as synthesis of a group of
oligonucleotides that define various modular segments of the gene,
followed by ligation of oligonucleotides to build the complete
modified gene.
[0280] The polypeptide encoding nucleic acid molecules of the
present invention may further be modified to contain a detectable
label for diagnostic and probe purposes. A variety of such labels
are known in the art and can readily be employed with the encoding
molecules herein described. Suitable labels include, but are not
limited to, biotin, radiolabeled nucleotides and the like. A
skilled artisan can employ any of the art known labels to obtain a
labeled encoding nucleic acid molecule.
[0281] Modifications to the primary structure itself by deletion,
addition, or alteration of the amino acids incorporated into the
protein sequence during translation can be made without destroying
the activity of the protein. Such substitutions or other
alterations result in proteins having an amino acid sequence
encoded by a nucleic acid falling within the contemplated scope of
the present invention.
[0282] Antisense molecules corresponding to the polypeptide coding
or complementary sequence may be prepared. Methods of making
antisense molecules which bind to mRNA, form triple helices or are
enzymatically active and cleave TSG RNA and single stranded DNA
(ssDNA) are known in the art. See, e.g., Antisense and Ribozyme
Methodology:Laboratory Companion (Ian Gibson, ed., Chapman &
Hall, 1997) and Ribozyme Protocols: Methods in Molecular Biology
(Phillip C. Turner, ed., Humana Press, Clifton, N.J., 1997).
[0283] Also contemplated is the use of compounds which mediate
postranscriptional gene silencing (PTGS), quelling and RNA
interference (RNAi). These compounds typically are about 21 to
about 25 nucleotides and are also known as short interfering RNAs
or short inhibitory RNAs (siRNAs). The siRNAs are produced from an
initiating double stranded RNA (dsRNA). Although the full mechanism
by which the siRNAs function is not fully elucidated, it is known
that these siRNAs transform the target mRNA into dsRNA, which is
then degraded. Preferred forms are 5' phosphorylated siRNAs,
however, hydroxylated forms may also be utilized. For additional
background regarding the preparation and mechanism of siRNAs
generally, see, e.g., Lipardi et al., Cell 107(3): 297-307 (2001);
Boutla et al., Curr. Biol. 11 (22): 1776-80 (2001); Djikeng et al.,
RNA 7(11): 1522-30 (2001); Elbashir et al., EMBO J. 20(23): 6877-88
(2001); Harborth et al., J. Cell. Sci. 114(Pt. 24): 4557-65 (2001);
Hutvagner et al., Science 293(5531): 811-3 (2001); and Elbashir et
al., Nature 411:494-98 (2001).
[0284] Also contemplated are short hairpin RNAs (shRNAs). shRNAs
are a modification of the siRNA method described above. Instead of
transfecting exogenously synthesized dsRNA into a cell,
sequence-specific silencing can be achieved by stabling expressing
siRNA from a DNA template as a fold-back stem-loop, or hairpin.
This approach is known as shRNA. This method permits the analysis
of loss of function phenotypes due to sequence-specific gene
silencing in mammalian cells by avoiding many of the problems
associated with siRNAs, such as RNase degradation of the reagents,
expensive chemical synthesis, etc. For additional background
regarding the preparation and mechanism of shRNAs generally, see,
e.g., Yu et al., PNAS 99:6047-6052 (2002); Paddison et al., Genes
and Devel. 16:948-58 (2002); and Brummelkamp et al., Science
296:550-553 (2002). For additional background on the use of this
method in mammalian gene knockdown methodologies, see Tuschl,
Nature Biotech. 20:446-448 (2002) (and references therein).
[0285] In one preferred embodiment, the siRNA or shRNA is directed
to a Dkk encoding mRNA, wherein a preferred Dkk is Dkk-1. In
another embodiment, the siRNA or shRNA is directed towards a
protein which binds to and modulates the activity of or is
modulated by a Dkk; these proteins include LRP5, LRP6 and HBM as
well as other members of the Wnt pathway.
[0286] 6. Isolation of Other Related Nucleic Acid Molecules
[0287] The identification of the nucleic acid molecule of Dkk
allows a skilled artisan to isolate nucleic acid molecules that
encode other members of the Dkk family (see, Krupnik et al., 1999).
Further, the presently disclosed nucleic acid molecules allow a
skilled artisan to isolate nucleic acid molecules that encode Dkk-1
-like proteins, in addition to Dkk-1. The presently disclosed Dkk-1
interacting proteins and their corresponding nucleic acid molecules
allows a skilled artisan to further isolate other related protein
family members which interact with Dkk-1.
[0288] A skilled artisan can readily use the amino acid sequence of
Dkk and Dkk interacting proteins to generate antibody probes to
screen expression libraries prepared from appropriate cells.
Typically, polyclonal antiserum from mammals such as rabbits
immunized with the purified protein (as described below) or
monoclonal antibodies can be used to probe a mammalian cDNA or
genomic expression library, such as a human macrophage library, to
obtain the appropriate coding sequence for other members of the
protein family. The cloned cDNA sequence can be expressed as a
fusion protein, expressed directly using its own control sequences,
or expressed by constructions using control sequences appropriate
to the particular host used for expression of the desired
protein.
[0289] Alternatively, a portion of the coding sequence herein
described can be synthesized and used as a probe to retrieve DNA
encoding a member of the protein family from any mammalian
organism. Oligomers containing approximately 18-20 nucleotides
(encoding about a 6-7 amino acid stretch) are prepared and used to
screen genomic DNA or cDNA libraries to obtain hybridization under
stringent conditions or conditions of sufficient stringency to
eliminate an undue level of false positives.
[0290] Additionally, pairs of oligonucleotide primers can be
prepared for use in a polymerase chain reaction (PCR) to
selectively clone an encoding nucleic acid molecule. A PCR
denature/anneal/extend cycle for using such PCR primers is well
known in the art and can readily be adapted for use in isolating
other encoding nucleic acid molecules. For example, degenerate
primers can be utilized to obtain sequences related to Dkk-1 or
Dkk-1 interacting proteins. Primers can be designed that are not
perfectly complementary and can still hybridize to a portion of a
target sequence or flanking sequence and thereby provide for
amplification of all or a portion of a target sequence. Primers of
about 20 nucleotides or less, preferably have about one to three
mismatches located at the 5' and/or 3' ends. Primers of about 20 to
30 nucleotides have up to about 30% mismatches and can still
hybridize to a target sequence. Hybridization conditions for
primers with mismatch can be determined by the method described in
Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982) or by
reference to known methods. The ability of the primer to hybridize
to a sequence of either Dkk-1, a Dkk-1 interacting protein, or a
related sequence under varying conditions can be determined using
this method. Because a target sequence is known, the effect of
mismatches can be determined by methods known to those of skill in
the art. Degenerate primers would be based on putative conserved
amino acid sequences of the Dkk-1 and Dkk-1 interacting protein
genes.
[0291] 7. rDNA Molecules for Polypeptide Expression
[0292] The present invention further provides recombinant DNA
molecules (rDNAs) that contain a polypeptide coding sequence. As
used herein, a rDNA molecule is a DNA molecule that has been
subjected to molecular manipulation in situ. Methods for generating
rDNA molecules are well known in the art, for example, see Sambrook
et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989). In the preferred rDNA
molecules, a coding DNA sequence is operably linked to expression
control sequences and/or vector sequences.
[0293] The choice of vector and/or expression control sequences to
which one of the protein family encoding sequences of the present
invention is operably linked depends directly, as is well known in
the art, on the functional properties desired, e.g., protein
expression, and the host cell to be transformed. A vector
contemplated by the present invention is at least capable of
directing the replication and/or insertion into the host
chromosome, and preferably also expression, of the structural gene
included in the rDNA molecule.
[0294] Expression control elements that are used for regulating the
expression of an operably linked protein encoding sequence are
known in the art and include, but are not limited to, inducible
promoters, constitutive promoters, secretion signals, and other
regulatory elements. Preferably, the inducible promoter is readily
controlled, such as being responsive to a nutrient in the host
cell's medium. Preferred promoters include yeast promoters, which
include promoter regions for metallothionein, 3-phosphoglycerate
kinase or other glycolytic enzymes such as enolase or
glyceraldehyde-3-phosphate dehydrogenase, enzymes responsible for
maltose and galactose utilization, and others. Vectors and
promoters suitable for use in yeast expression are further
described in EP 73,675A. Appropriate non-native mammalian promoters
might include the early and late promoters from SV40 (Fiers et al,
Nature, 273:113 (1978)) or promoters derived from Moloney murine
leukemia virus, mouse tumor virus, avian sarcoma viruses,
adenovirus 11, bovine papilloma virus or polyoma. In addition, the
construct may be joined to an amplifiable gene (e.g., DHFR) so that
multiple copies of the gene may be made. For appropriate enhancer
and other expression control sequences, see also Enhancers and
Eukaryotic Gene Expression (Cold Spring Harbor Press, Cold Spring
Harbor, N.Y., 1983). Preferred bone related promoters include
CMVbActin or type I collagen promoters to drive expression of the
human HBM, Zmax1/LRP5 or LRP6 cDNA. Other preferred promoters for
mammalian expression are from cytomegalovirus (CMV), Rous sarcoma
virus (RSV), Simian virus 40 (SV40), and EF-1a (human elongation
factor 1a-subunit).
[0295] In one embodiment, the vector containing a coding nucleic
acid molecule will include a prokaryotic replicon, i.e., a DNA
sequence having the ability to direct autonomous replication and
maintenance of the recombinant DNA molecule extrachromosomally in a
prokaryotic host cell, such as a bacterial host cell, transformed
therewith. Such replicons are well known in the art. In addition,
vectors with a prokaryotic replicon may also include a gene whose
expression confers a detectable marker such as a drug resistance.
Typical bacterial drug resistance genes are those that confer
resistance to ampicillin or tetracycline.
[0296] Vectors that include a prokaryotic replicon can further
include a prokaryotic or bacteriophage promoter capable of
directing the expression (transcription and translation) of the
coding gene sequences in a bacterial host cell, such as E. coli. A
promoter is an expression control element formed by a DNA sequence
that permits binding of RNA polymerase and transcription to occur.
Promoter sequences compatible with bacterial hosts are typically
provided in plasmid vectors containing convenient restriction sites
for insertion of a DNA segment of the present invention. Typical of
such vector plasmids are pUC8, pUC9, pBR322 and pBR329 available
from Biorad Laboratories, (Richmond, Calif.), and pPL and pKK223
available from Pharmacia (Piscataway, N.J.).
[0297] Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells, can also be used
to form a rDNA molecule that contains a coding sequence. Eukaryotic
cell expression vectors are well known in the art and are available
from several commercial sources. Typically, such vectors are
provided containing convenient restriction sites for insertion of a
desired DNA segment. Typical of such vectors are pSVL and pKSV-10
(Pharmacia), pBPV-1/pML2d (International Biotechnologies, Inc.),
vector systems that include Histidine Tags and periplasmic
secretion, or other vectors described in the art.
[0298] Eukaryotic cell expression vectors used to construct the
rDNA molecules of the present invention may further include a
selectable marker that is effective in an eukaryotic cell,
preferably a drug resistance selection marker. A preferred drug
resistance marker is the gene whose expression results in neomycin
resistance, i.e., the neomycin phosphotransferase (neo) gene
(Southern et al., J. Mol. Anal. Genet. 1:327-341 (1982)).
Alternatively, the selectable marker can be present on a separate
plasmid, and the two vectors introduced by co-transfection of the
host cell, and selected by culturing in the appropriate drug for
the selectable marker.
[0299] 8. Host Cells Containing an Exogenously Supplied rDNA
Nucleic Acid Molecule
[0300] The present invention further provides host cells
transformed with a nucleic acid molecule that encodes a polypeptide
or protein of the present invention. The host cell can be either
prokaryotic or eukaryotic. Eukaryotic cells useful for expression
of a protein of the invention are not limited, so long as the cell
line is compatible with cell culture methods and compatible with
the propagation of the expression vector and expression of the gene
product. Preferred eukaryotic host cells include, but are not
limited to, yeast, insect and mammalian cells, preferably
vertebrate cells such as those from a mouse, rat, monkey or human
cell line but also can include invertebrates with, for example,
cartilage. Preferred eukaryotic host cells include but are not
limited to Chinese hamster ovary (CHO) cells (ATCC No. CCL61), NIH
Swiss mouse embryo cells NIH/3T3 (ATCC No. CRL 1658), baby hamster
kidney cells (BHK), HOB-03-CE6 osteoblast cells, and other like
eukaryotic tissue culture cell lines.
[0301] Any prokaryotic host can be used to express a rDNA molecule
encoding a protein of the invention. A preferred prokaryotic host
is E coli.
[0302] Transformation of appropriate cell hosts with a recombinant
DNA (rDNA) molecule of the present invention is accomplished by
well known methods that typically depend on the type of vector used
and host system employed. With regard to transformation of
prokaryotic host cells, electroporation and salt treatment methods
are typically employed; see, for example, Cohen et al., Proc. Natl.
Acad. Sc. USA 69: 2110 (1972); Maniatis et al. (1982); and Sambrook
et al. (1989). With regard to transformation of vertebrate cells
with vectors containing rDNAs, electroporation, cationic lipid or
salt treatment methods are typically employed; see, for example,
Graham et al., Virol. 52: 456 (1973); Wigler et al., Proc. Natl.
Acad. Sci. USA 76: 1373-76 (1979).
[0303] Successfully transformed cells, i.e., cells that contain a
rDNA molecule of the present invention, can be identified by well
known techniques including the selection for a selectable marker.
For example, cells resulting from the introduction of an rDNA of
the present invention can be cloned to produce single colonies.
Cells from those colonies can be harvested, lysed and their DNA
content examined for the presence of the rDNA using a method such
as that described by Southern, J. Mol. Biol. 98: 503 (1975), or
Berent et al., Biotech. 3: 208 (1985). Alternatively, the cells can
be cultured to produce the proteins encoded by the rDNA and the
proteins harvested and assayed, using for example, any suitable
immunological method. See, e.g., Harlow et al., (1988).
[0304] Recombinant DNA can also be utilized to analyze the function
of coding and non-coding sequences. Sequences that modulate the
translation of the mRNA can be utilized in an affinity matrix
system to purify proteins obtained from cell lysates that associate
with the Dkk-1 or Dkk-1 interacting protein or expression control
sequence. Synthetic oligonucleotides would be coupled to the beads
and probed with the lysates, as is commonly known in the art.
Associated proteins could then be separated using, for example, a
two dimensional SDS-PAGE system. Proteins thus isolated could be
further identified using mass spectroscopy or protein sequencing.
Additional methods would be apparent to the skilled artisan.
[0305] 9. Production of Recombinant Peptides and Proteins using a
cDNA or Other Recombinant Nucleic Acids
[0306] The invention also relates to nucleic acid molecules which
encode a Dkk protein and polypeptide fragments thereof, and
proteins and polypeptides which bind to Dkk -(e.g., LRP5, LRP6 and
HBM, Dkk interacting proteins such as the proteins of FIG. 5) and
molecular analogues. The polypeptides of the present invention
include the full length Dkk and polypeptide fragments thereof, Dkk
binding proteins and polypeptides thereof. Preferably these
proteins are mammalian proteins, and most preferably human proteins
and biologically active fragments thereof. Alternative embodiments
include nucleic acid molecules encoding polypeptide fragments
having a consecutive amino acid sequence of at least about 3, 5, 7,
8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150,
175, or 200 amino acid residues from a common polypeptide sequence;
amino acid sequence variants of a common polypeptide sequence
wherein an amino acid residue has been inserted N- or C-terminal
to, or within, the polypeptide sequence or its fragments; and amino
acid sequence variants of the common polypeptide sequence or its
fragments, which have been substituted by another conserved
residue. Recombinant nucleic acid molecules which encode
polypeptides include those containing predetermined mutations by,
e.g., homologous recombination, site-directed or PCR mutagenesis,
and recombinant Dkk proteins or polypeptide fragments of other
animal species, including but not limited to vertebrates (e.g.,
rabbit, rat, murine, porcine, camelid, reptilian, caprine, avian,
fish, bovine, ovine, equine and non-human primate species) as well
as invertebrates, and alleles or other naturally occurring variants
and homologs of Dkk binding proteins of the foregoing species and
of human sequences. Also contemplated herein are derivatives of the
commonly known Dkk, Dkk interacting proteins, or fragments thereof,
wherein Dkk, Dkk interacting proteins, or their fragments have been
covalently modified by substitution, chemical, enzymatic, or other
appropriate means with a moiety other than a naturally occurring
amino acid (for example a detectable moiety such as an enzyme or
radioisotope) and soluble forms of Dkk. It is further contemplated
that the present invention also includes nucleic acids with silent
mutations which will hybridize to the endogenous sequence and which
will still encode the same polypeptide.
[0307] The nucleic acid molecules encoding Dkk binding proteins,
the LRP5 binding domain fragment of Dkk, or other polypeptides of
the present invention are preferably those which share a common
biological activity (e.g., mediate Dkk activity such as its
interaction with LRP5, HBM or LRP6). The polypeptides of the
present invention include those encoded by a nucleic acid molecule
with silent mutations, as well as those nucleic acids encoding a
biologically active protein with conservative amino acid
substitutions, allelic variants, and other variants of the
disclosed polypeptides which maintain at least one Dkk
activity.
[0308] The amino acid compounds of the invention are polypeptides
which are partially defined in terms of amino acid residues of
designated classes. Polypeptide homologs would include conservative
amino acid substitutions within the amino acid classes described
below. Amino acid residues can be generally sub-classified into
four major subclasses as follows:
[0309] Acidic: The residue has a negative charge due to loss of
H.sup.+ ion at physiological pH, and the residue is attracted by
aqueous solution so as to seek the surface positions in the
conformation of a peptide in which it is contained when the peptide
is in aqueous medium, at physiological pH.
[0310] Basic: The residue has a positive charge due to association
with H.sup.+ ion at physiological pH, and the residue is attracted
by aqueous solution so as to seek the surface positions in the
conformation of a peptide in which it is contained when the peptide
is in aqueous medium at physiological pH.
[0311] Neutral/non-polar: The residues are not charged at
physiological pH, but the residue is repelled by aqueous solution
so as to seek the inner positions in the conformation of a peptide
in which it is contained when the peptide is in aqueous medium.
These residues are also designated "hydrophobic."
[0312] Neutral/polar: The residues are not charged at physiological
pH, but the residue is attracted by aqueous solution so as to seek
the outer positions in the conformation of a peptide in which it is
contained when the peptide is in aqueous medium.
[0313] It is understood, of course, that in a statistical
collection of individual residue molecules some molecules will be
charged, and some not, and there will be an attraction for or
repulsion from an aqueous medium to a greater or lesser extent. To
fit the definition of "charged", a significant percentage (at least
approximately 25%) of the individual molecules are charged at
physiological pH. The degree of attraction or repulsion required
for classification as polar or nonpolar is arbitrary and,
therefore, amino acids specifically contemplated by the invention
have been classified as one or the other. Most amino acids not
specifically named can be classified on the basis of known
behavior.
[0314] Amino acid residues can be further subclassified as cyclic
or noncyclic, and aromatic or non-aromatic, self-explanatory
classifications with respect to the side chain substituent groups
of the residues, and as small or large. The residue is considered
small if it contains a total of 4 carbon atoms or less, inclusive
of the carboxyl carbon. Small residues are, of course, always
nonaromatic.
[0315] The gene-encoded secondary amino acid proline, although
technically within the group neutral/nonpolar/large/cyclic and
nonaromatic, is a special case due to its known effects on the
secondary conformation of peptide chains, and is not, therefore,
included in this defined group.
[0316] Other amino acid substitutions of those encoded in the gene
can also be included in peptide compounds within the scope of the
invention and can be classified within this general scheme
according to their structure.
[0317] All of the compounds of the invention may be in the form of
the pharmaceutically acceptable salts or esters. Salts may be, for
example, Na.sup.+, K.sup.+, Ca.sup.+2, Mg.sup.+2 and the like; the
esters are generally those of alcohols of 1-6 carbons.
[0318] The present invention further provides methods for producing
a protein of the invention using nucleic acid molecules herein
described. In general terms, the production of a recombinant form
of a protein typically involves the following steps.
[0319] First, a nucleic acid molecule is obtained that encodes Dkk,
such as a nucleic acid molecule encoding human Dkk or any other Dkk
sequence, or that encodes a Dkk binding protein, a Dkk aptamer or a
biologically active fragment thereof. Particularly for Dkk binding
peptides, the nucleotides encoding the peptide are incorporated
into a nucleic acid in the form of an in-frame fusion, insertion
into or appended to a thioredoxin coding sequence. The coding
sequence (ORF) is directly suitable for expression in any host, as
it is not interrupted by introns.
[0320] These DNAs can be transfected into host cells such as
eukaryotic cells or prokaryotic cells. Eukaryotic hosts include
mammalian cells and vertebrate (e.g., osteoblasts, osteosarcoma
cell lines, Drosophila S2 cells, hepatocytes, tumor cell lines and
other bone cells of any mammal, as well as insect cells, such as
Sf9 cells using recombinant baculovirus). For example, a DNA
expressing an open reading frame (ORF) under control of a type I
collagen promoter, or such osteoblast promoters as osteocalcin
histone, type I collagen, TGF.beta.1, MSX2, cfos/cJun and Cbfal,
can be used to regulate the Dkk in animal cells. Alternatively, the
nucleic acid can be placed downstream from an inducible promoter,
which can then be placed into vertebrate or invertebrate cells or
be used in creating a transgenic animal model.
[0321] Alternatively, proteins and polypeptides of the present
invention can be expressed in an heterologous system. The human
cell line GM637, SV40 transformed human fibroblasts, can be
transfected, with a plasmid containing a Dkk ligand binding domain
coding sequence under the control of the chicken actin promoter
(Reis et al., EMBO J. 11: 185-193 (1992)). Such transfected cells
could be used as a source of Dkk binding domain in functional
assays. Alternatively, polypeptides encoding only a portion of Dkk
or any of the disclosed Dkk binding peptides Dkk aptamers or a
polypeptide encoding a Dkk interacting protein can be expressed
alone or in the form of a fusion protein. For example, Dkk derived
peptides can be expressed in bacteria (e.g., E. coli) as GST- or
His-Tag fusion proteins. These fusion proteins are then purified
and can be used to generate polyclonal antibodies or can be used to
identify other Dkk ligands.
[0322] The nucleic acid coding sequence is preferably placed in
operable linkage with suitable control sequences, as described
above, to form an expression unit containing the protein encoding
open reading frame. The expression unit is used to transform a
suitable host and the transformed host is cultured under conditions
that allow the production of the recombinant protein. Optionally
the recombinant protein is isolated from the medium or from the
cells; recovery and purification of the protein may not be
necessary in some instances where some impurities may be
tolerated.
[0323] Each of the foregoing steps can be done in a variety of
ways. For example, the desired coding sequences may be obtained
from genomic fragments and used directly in appropriate hosts. The
construction of expression vectors that are operable in a variety
of hosts is accomplished using appropriate replicons and control
sequences, as set forth above. The control sequences, expression
vectors, and transformation methods are dependent on the type of
host cell used to express the gene and were discussed in detail
earlier. Suitable restriction sites can, if not normally available,
be added to the ends of the coding sequence so as to provide an
excisable gene to insert into these vectors. A skilled artisan can
readily adapt any host/expression system known in the art for use
with the nucleic acid molecules of the invention to produce
recombinant protein.
[0324] 10. Methods to Identify Binding Partners
[0325] Another embodiment of the present invention provides methods
for use in isolating and identifying binding partners of Dkk or Dkk
interacting proteins. Dkk or a Dkk interacting protein or a
polypeptide fragment thereof can be mixed with a potential binding
partner or an extract or fraction of a cell under conditions that
allow the association of potential binding partners with Dkk or
with Dkk interacting proteins. After mixing, the peptides,
polypeptides, proteins or other molecules that have become
associated with Dkk or a Dkk interacting protein are separated from
the mixture. The binding partner that bound to the polypeptide then
can be purified and further analyzed. Determination of binding
partners of Dkk and Dkk interacting proteins as well as agents
which prevent the interaction of Dkk with one of its interacting
proteins (e.g., LRP5, LRP6, HBM, or those proteins listed in FIG.
5) can be performed using a variety of different competition assays
as are known in the art. For example, the minimal sequence of Dkk,
as described herein, can be used to identify antibodies which
compete with LRP5 (or LRP6, HBM or other ligand binding partners)
for binding to Dkk-1 and vice versa. The minimal Dkk sequence can
be bound to the bottom of a 96-well plate (or other solid
substrate), and antibodies or other potential binding agents (e.g.,
polypeptides, mimetics, homologs, antibody fragments and the like)
can be screened in a competition assay to identify agents with
binding affinities, for example, greater than the natural ligand
binding partner of Dkk.
[0326] In the present invention, suitable cells are used for
preparing assays, for the expression of a LRP and/or Dkk or
proteins that interact therewith. The cells may be made or derived
from mammals, yeast, fungi, or viruses. A suitable cell for the
purposes of this invention is one that includes but is not limited
to a cell that can exhibit a detectable Dkk-LRP (or HBM)
interaction, and preferably, the differential interaction between
Dkk-1-LRP5 and Dkk-1-HBM. For the desired assay, the cell type may
vary. In several embodiments, bone cells are preferred, for
example, a human osteoblast cell (e.g. hOB-03-CE6) or osteosarcoma
cell (e.g. U2OS). Additional hOB cells are hOB-03-C5, hOB-02-02
and, an immortalized pre-osteocytic cell line referred to as
hOB-01-C1-PS-09 cells (which are deposited with American Type
Culture Collection in Manassas, Va. with the designation PTA-785),
Examples of osteosarcoma cells would include SaoS2, MG63 and HOS
TE85 Immortalized refers to a substantially continuous and
permanently established cell culture with substantially unlimited
cell division potential. That is, the cells can be cultured
substantially indefinitely, i.e., for at least about 6 months under
rapid conditions of growth, preferably much longer under slower
growth conditions, and can be propagated rapidly and continually
using routine cell culture techniques. Alternatively stated,
preferred cells can be cultured for at least about 100, 150 or 200
population doublings. These cells produce a complement of proteins
characteristic of normal human osteoblastic cells and are capable
of osteoblastic differentiation. They can be used in cell culture
studies of osteoblastic cell sensitivity to various agents, such as
hormones, cytokines, and growth factors, or in tissue therapy.
Certain non bone cells such as HEK 293 cells that exhibit
detectable Dkk-LRP (or HBM) interaction are also be useful for the
assays of this invention.
[0327] To identify and isolate a binding partner, the entire Dkk
protein (e.g., human Dkk-1, GenBank Accession No. BM34651) or a Dkk
interacting protein (Genbank Accession Nos. for some Dkk-1
interacting proteins are given in FIG. 5) can be used.
Alternatively, a polypeptide fragment of the protein can be used.
Suitable fragments of the protein include at least about 5, 6, 7,
8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100, 110, 120, 130, 140, 150 or more contiguous amino
acid residues of any Dkk or Dkk interactor sequence. Preferable
sequences of Dkk include portions or all of one or both of the
cysteine rich domains (e.g., Cys-1 and Cys-2 of Dkk-1) or the
conserved sequences at the amino terminus of Dkk-1 (See Krupnik et
al., Gene 238: 301-313 (1999)). Alternatively, portions of LRP5,
LRP6, HBM and other Dkk interacting proteins such as those in FIG.
5 that interact with Dkk-1 can be used to identify and isolate
agents which modulate Dkk activity. Alternatively, peptide aptamers
of LRP5, LRP6, HBM, Dkk and other Dkk interacting proteins such as
those in FIG. 5 that interact with Dkk-1 can be used to identify
and isolate agents which modulate Dkk activity.
[0328] As used herein, a cellular extract refers to a preparation
or fraction which is made from a lysed or disrupted cell. A variety
of methods can be used to obtain cell extracts. Cells can be
disrupted using either physical or chemical disruption methods.
Examples of physical disruption methods include, but are not
limited to, sonication and mechanical shearing. Examples of
chemical lysis methods include, but are not limited to, detergent
lysis and enzyme lysis. A skilled artisan can readily adapt methods
for preparing cellular extracts in order to obtain extracts for use
in the present methods.
[0329] Once an extract of a cell is prepared, the extract is mixed
with the protein of the invention under conditions in which
association of the protein with the binding partner can occur. A
variety of conditions can be used, the most preferred being
conditions that closely resemble conditions found in the cytoplasm
of a human cell. Features such as osmolarity, pH, temperature, and
the concentration of cellular extract used, can be varied to
optimize the association of the protein with the binding
partner.
[0330] After mixing under appropriate conditions, the bound complex
is separated from the mixture. A variety of techniques can be
utilized to separate the mixture. For example, antibodies specific
to a protein of the invention can be used to immunoprecipitate the
binding partner complex. Alternatively, standard chemical
separation techniques such as chromatography and density/sediment
centrifugation can be used. For example, a protein of the invention
is expressed with an affinity tag such as a His tag. The His
labeled protein and any bound molecule may be retained and
selectively eluted from a Ni-NTA column.
[0331] After removal of non-associated cellular constituents found
in the extract, the binding partner can be dissociated from the
complex using conventional methods. For example, dissociation can
be accomplished by altering the salt concentration or pH of the
mixture.
[0332] To aid in separating associated binding partner pairs from
the mixed extract, the protein of the invention can be immobilized
on a solid support. For example, the protein can be attached to a
nitrocellulose matrix or acrylic beads. Attachment of the protein
to a solid support aids in separating peptide/binding partner pairs
from other constituents found in the extract. The identified
binding partners can be either a single protein or a complex made
up of two or more proteins.
[0333] Alternatively, the nucleic acid molecules of the invention
can be used in a Y2H system. The Y2H system has been used to
identify other protein partner pairs and can readily be adapted to
employ the nucleic acid molecules herein described. Methods of
performing and using Y2H systems are known. See, e.g., Finley et
al., "Two-Hybrid Analysis of Genetic Regulatory Networks," in The
Yeast Two-Hybrid System (Paul L. Bartel et al., eds., Oxford,
1997); Meijia Yang, "Use of a Combinatorial Peptide Library in the
Two-Hybrid Assay," in The Yeast Two-Hybrid System (Paul L. Bartel
et al., eds., Oxford, 1997); Gietz et al., "Identification of
proteins that interact with a protein of interest: Applications of
the yeast two-hybrid system," Mol. & Cell. Biochem. 172: 67-9
(1997); K. H. Young, "Yeast Two-Hybrid: So Many Interactions,(in)
so Little Time," Biol. Reprod. 58: 302-311 (1998); R. Brent et al.,
"Understanding Gene and Allele Function with Two-Hybrid Methods,"
Annu. Rev. Genet 31:663-704 (1997) and U.S. Pat. No. 5,989,808. The
Dkk-1 interacting proteins identified in FIG. 5 were identified
using the Y2H interacting system using Dkk-1 as bait.
[0334] One preferred in vitro binding assay for Dkk modulators
would comprise a mixture of a LRP binding domain of Dkk and one or
more candidate binding targets or substrates. After incubating the
mixture under appropriate conditions, one would determine whether
Dkk or a fragment thereof bound with the candidate modulator
present. For cell-free binding assays, one or more of the
components usually comprises or is coupled to a label. The label
may provide for direct detection, such as radioactivity,
luminescence, optical or electron density, etc., or indirect
detection such as an epitope tag, an enzyme, etc. A variety of
methods may be employed to detect the label depending on the nature
of the label and other assay components. For example, the label may
be detected bound to the solid substrate or a portion of the bound
complex containing the label may be separated from the solid
substrate, and the label thereafter detected. Fluorescence
resonance energy transfer may be utilized to monitor the
interaction of two labeled molecules. For example, a fluorescence
label on Dkk and another label on LRP5 or a soluble fragment
thereof such as the extracellular domain will exchange fluorescence
resonance energy when in close proximity indicating that the two
molecules are bound. A preferred binding partner for Dkk will
increase or decrease the affinity between Dkk and LRP5 which will
be readily observable in a fluorescence spectrometer.
Alternatively, an instrument, such as a surface plasmon resonance
detector manufactured by BlAcore (Uppsala, Sweden), may be used to
observe interactions with a fixed target. One skilled in the art
knows of many other methods which may be employed for this
purpose.
[0335] Thereby, the present invention provides methods for
screening candidates including polypeptides of the present
invention for activity which identifies these candidates as
valuable drug leads. Other suitable methods are also known in the
art and are suitable for use herein, including Xenopus oocyte
injection studies and TCF luciferase assays.
[0336] Additional assays can be used to identify the activity of
Dkk and Dkk interacting proteins in the Wnt pathway, as well as the
impact of modulators of Dkk and Dkk interacting proteins on the Wnt
pathway. These include, for example, a Xenopus embryo assay and a
TCF-luciferase reporter gene assay to monitor Wnt signaling
modulation.
[0337] Xenopus embryos are an informative in vivo assay system to
evaluate the modulation of Wnt signaling. Ectopic expression of
certain Wnts or other activators of the Wnt signaling pathway
results in a bifurcation of the anterior neural plate. This
bifurcation results in a duplicated body axis, which suggests a
role for Wnt signaling during embryonic development (McMahon et
al., Cell 58: 1075-84 (1989); Sokol et al., Cell 67: 741-52
(1991)). Since these original observations, the Xenopus embryo
assay has been extensively used as an assay system for evaluating
modulation of the Wnt signaling pathway. One preferred embodiment
of the present invention is demonstrated in Example 6.
[0338] Constructs for Xenopus expression can be prepared as would
be known in the art. For example, a variety of cDNAs have been
engineered into the vector pCS2+ (Turner et al., Genes Devel. 8:
1434-1447 (1994)) to facilitate the in vitro generation of mRNA for
use in Xenopus embryo injection experiments. DNA inserts are
subcloned in the sense orientation with respect to the vector SP6
promoter. Downstream of the insert, the vector provides an SV40
virus polyadenlylation signal and a T3 promoter sequence (i.e., for
the generation of antisense mRNA). Constructs can be generated for
various Dkk family members, LRP5, LRP6, HBM, Dkk-1 interactors,
etc. Constructs could be generated in pCS2.sup.+ that contain the
nucleic acid sequence encoding for the peptide aptamers that were
identified in yeast screens. These sequences would be fused to a 5'
synthetic translation initiation sequence followed by a canonical
signal sequence to ensure that the peptide aptamer would be
translated and secreted from the cell.
[0339] Once these constructs are made then mRNA can be synthesized
and injected into Xenopus oocytes. mRNA for microinjection into
Xenopus embryos is generated by in vitro transcription using the
cDNA constructs in the pCS2.sup.+ vector described above as
template. Various amounts of RNA can be injected into the ventral
blastomere of the 4- or 8-cell Xenopus embryo substantially as
described in Moon et al., Technique-J. of Methods in Cell and Mol.
Biol. 1: 76-89 (1989), and Peng, Meth. Cell. Biol. 36: 657-62
(1991).
[0340] Previous data has shown that expression of LRP5, in the
presence of Wnt5a, results in a Wnt-induced duplicated axis
formation in Xenopus embryos (Tamai et a., Nature 407: 530-535
(2000)). The roles of Dkk-1 and Dkk-2, and Dkk-1 interacting
proteins, in modulating the LRP5-mediated Wnt response in vivo can
be analyzed using, for example, the Xenopus embryo. In addition,
the peptide aptamers, Dkk interacting proteins, or combinations of
the above can be evaluated in a similar manner.
[0341] Experiments can also be conducted wherein RNA is injected
into the dorsal blastomere to ensure the specificity of the
observed phenotypes. Lineage tracing experiments can be performed
where a marker gene such as green fluorescent protein (GFP) or LacZ
is co-injected with the experimental RNAs. Detecting marker gene
expression would identify the targeted cells of the microinjection
and aid in elucidating the mechanism of action. In addition to the
Wnt signaling components listed above, the point at which HBM acts
upon the Wnt pathway can also be analyzed. This can be done by
co-injections of various dominant-negative constructs. For example,
a dominant negative TCF-3 construct would be useful to demonstrate
that the observed axis duplication (and Wnt activation) is mediated
via the .beta.-catenin-TCF response. If so, such a construct would
be expected to abolish the observed duplicated axis phenotype.
Another example would include a dominant negative Dsh construct.
Since Dsh is far upstream in the Wnt signaling pathway, a dominant
negative construct should abolish the activation of the Wnt
response and the observed axis duplication. If it does not, this
would suggest that axis duplication is being induced via a
different signaling pathway.
[0342] The marker genes of the injected Xenopus embryos can be
analyzed as follows. Representative embryos are collected at stage
10.5 (11 hours post fertilization) for marker gene analysis. RNA is
extracted and purified from the embryos following standard
protocols (Sambrook et al., 1989 at 7.16). Marker genes could
include the following: Siamois (i.e., Wnt responsive gene), Xnr3
(i.e., Wnt responsive gene), slug (i.e., neural crest marker), Xbra
(i.e., early mesoderm marker), HNK-1 (i.e., ectodermal/neural
marker), endodermin (Le., endoderm), Xlhbox8 (i.e., pancreatic),
BMP2 and BMP4 (i.e., early mesoderm), XLRP6 (i.e., maternal and
zygotic expression, it is also the LRP6 homolog in the frog), EF-1
(i.e., control) and ODC (i.e., control). Induction of marker genes
is analyzed and quantitated by RT-PCR/TaqMan.RTM..
[0343] This type of marker analysis is excellent to monitor changes
in gene expression that result very early in the embryo as a direct
result of signaling perturbation. Other experiments could be
designed that would monitor changes in gene expression in a more
tissue or spatially-restricted fashion. Examples would include the
generation of a transgenic Xenopus model. For example, Zmax/LRP5
and HBM expression could be under the control of the brachyury or
cardiac-actin promoters directing gene expression transiently in
the mesoderm or in the somites, respectively. Phenotype analyses of
these transgenic Xenopus animals would include marker gene
analysis/transcriptional profiling (from a restricted tissue
source) and histologic examination of the tissue.
[0344] A TCF-luciferase assay system such as that described in
Example 7 can also be used to monitor Wnt signaling activity, Dkk
activity and Dkk interacting protein activity. Constructs for the
TCF-luciferase assays can be prepared as would be known in the art.
For example, Dkk and Dkk interacting protein peptides, LRP5/LRP6,
among others, can be expressed in pcDNA3.1, using Kozak and signal
sequences to target peptides for secretion.
[0345] Once constructs have been prepared, cells such as
osteoblasts and HEK293 cells are seeded in well plates and
transfected with construct DNA, CMV beta-galactosidase plasmid DNA,
and TCF-luciferase reporter DNA. The cells are then lysed and
assayed for beta-galactosidase and luciferase activity to determine
whether Dkk, Dkk interacting proteins, or other molecules such as
antibodies affect Wnt signaling.
[0346] Additional assays for monitoring Wnt signaling activity, Dkk
activity, and Dkk interacting protein activity include:
[0347] Modulation of another Wnt-responsive transcription factor,
LEF, as visualized by a reporter gene activity. One example
includes the activation of the LEF1 promoter region fused to the
luciferase reporter gene (Hsu et al., Mol. Cell. Biol. 18: 4807-18
(1999)).
[0348] Alterations in cell proliferation, cell cycle or apoptosis.
There are numerous examples describing Wnt-mediated cellular
transformations including Shimizu et al., Cell. Growth Differ. 8:
1349-58 (1997).
[0349] Stabilization and cellular localization of de-phosphorylated
.beta.-catenin as an indicator of Wnt activation (Shimizu et al.,
1997).
[0350] Additional methods of assaying Wnt signaling, through either
the canonical or non-canonical pathways, would be apparent to the
artisan of ordinary skill.
[0351] 11. Methods to Identify Agents that Modulate the Expression
of a Nucleic Acid Encoding the Dkk and/or LRP5 Proteins and/or Dkk
Interacting Proteins
[0352] Another embodiment of the present invention provides methods
for identifying agents that modulate the expression of a nucleic
acid encoding Dkk. Such assays may utilize any available means of
monitoring for changes in the expression level of the nucleic acids
of the invention. As used herein, an agent is said to modulate the
expression of Dkk, if it is capable of up- or down-regulating
expression of the nucleic acid in a cell (e.g., mRNA).
[0353] In one assay format, cell lines that contain reporter gene
fusions between the nucleic acid encoding Dkk (or proteins which
modulate the activity of Dkk) and any assayable fusion partner may
be prepared. Numerous assayable fusion partners are known and
readily available, including but not limited to the firefly
luciferase gene and the gene encoding chloramphenicol
acetyltransferase (Alam et al., Anal. Biochem. 188: 245-254
(1990)). Cell lines containing the reporter gene fusions are then
exposed to the agent to be tested under appropriate conditions and
time. Differential expression of the reporter gene between samples
exposed to the agent and control samples identifies agents which
modulate the expression of a nucleic acid encoding Dkk or other
protein which modulates Dkk activity. Such assays can similarly be
used to determine whether LRP5 and even LRP6 activity is modulated
by regulating Dkk activity.
[0354] Additional assay formats may be used to monitor the ability
of the agent(s) to modulate the expression of a nucleic acid
encoding Dkk, alone or Dkk and LRP5, and/or Dkk interacting
proteins such as those identified in FIG. 5. For instance, mRNA
expression may be monitored directly by hybridization to the
nucleic acids of the invention. Cell lines are exposed to the agent
to be tested under appropriate conditions and time and total RNA or
mRNA is isolated by standard procedures such those disclosed in
Sambrook et al. (1989); Ausubel et al., Current Protocols in
Molecular Biology (Greene Publishing Co., NY, 1995); Maniatis et
al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1982); and Short Protocols in
Molecular Biology: A Compendium of Methods from Current Protocols
in Molecular Biology (Frederick M. Ausubel et al., April 1999).
[0355] Probes to detect differences in RNA expression levels
between cells exposed to the agent and control cells may be
prepared from the nucleic acids of the invention. It is preferable,
but not necessary, to design probes which hybridize only with
target nucleic acids under conditions of high stringency. Only
highly complementary nucleic acid hybrids form under conditions of
high stringency. Accordingly, the stringency of the assay
conditions determines the amount of complementarity which should
exist between two nucleic acid strands in order to form a hybrid.
Stringency should be chosen to maximize the difference in stability
between the probe:target hybrid and potential probe:non-target
hybrids.
[0356] Probes may be designed from the nucleic acids of the
invention through methods known in the art. For instance, the G+C
content of the probe and the probe length can affect probe binding
to its target sequence. Methods to optimize probe specificity are
commonly available. See for example, Sambrook et al. (1989) or
Ausubel et al. (Current Protocols in Molecular Biology, Greene
Publishing Co., NY, 1995).
[0357] Hybridization conditions are modified using known methods,
such as those described by Sambrook et al. (1989) and Ausubel et
al. (1995), as suitable for each probe. Hybridization of total
cellular RNA or RNA enriched for polyA RNA can be accomplished in
any available format. For instance, total cellular RNA or RNA
enriched for polyA RNA can be affixed to a solid support and the
solid support exposed to at least one probe comprising at least
one, or part of one of the nucleic acid sequences of the invention
under conditions in which the probe will specifically hybridize.
Alternatively, nucleic acid fragments comprising at least one, or
part of one of the sequences of the invention can be affixed to a
solid support, such as a porous glass wafer. The glass or silica
wafer can then be exposed to total cellular RNA or polyA RNA from a
sample under conditions in which the affixed sequences will
specifically hybridize. Such glass wafers and hybridization methods
are widely available, for example, those disclosed by Beattie (WO
95/11755). By examining for the ability of a given probe to
specifically hybridize to an RNA sample from an untreated cell
population and from a cell population exposed to the agent, agents
which up- or down-regulate the expression of a nucleic acid
encoding Dkk, a Dkk interacting protein, and/or LRP5 can be
identified.
[0358] Microarray technology and transcriptional profiling are
examples of methods which can be used to analyze the impact of
putative Dkk or Dkk interacting protein modulating compounds. For
transcriptional profiling, mRNA from cells exposed in vivo to a
potential Dkk modulating agent, such as the Dkk interacting
proteins identified in the present invention (e.g., those
identified in FIG. 5), agents which modulate Dkk interacting
proteins, and mRNA from the same type of cells that were not
exposed to the agent could be reverse transcribed and hybridized to
a chip containing DNA from numerous genes, to thereby compare the
expression of genes in cells treated and not treated with the
agent. If, for example a putative Dkk modulating agent
down-regulates the expression of Dkk in the cells, then use of the
agent may be undesirable in certain patient populations. For
additional methods of transcriptional profiling and the use of
microarrays, refer to, for example, U.S. Pat. No. 6,124,120 issued
to Lizardi (2000).
[0359] Additional methods for screening the impact of Dkk and Dkk
interacting protein modulating compounds or the impact of Dkk or
Dkk interacting proteins on modulation of LRP5, LRP6, HBM or the
Wnt pathway include the use of TaqMan PCR, conventional reverse
transcriptase PCR (RT-PCR), changes in downstream surrogate markers
(i.e., Wnt responsive genes), and anti-Dkk Western blots for
protein detection. Other methods would be readily apparent to the
artisan of ordinary skill.
[0360] 12. Methods to Identify Agents that Modulate at Least One
Activity of Dkk, a Dkk Interacting Protein, or LRP5/LRP6/HBM
[0361] Another embodiment of the present invention provides methods
for identifying agents that modulate at least one activity of Dkk,
Dkk interacting proteins, and/or LRP5/LRP6/HBM proteins or
preferably which specifically modulate an activity of a Dkk/Dkk
interacting protein complex or an LRP5(or LRP6/HBM)/Dkk complex, or
a biologically active fragment of Dkk (e.g., comprising the domain
which binds LRP5/LRP6/HBM) or a Dkk interacting protein complex.
Such methods or assays may utilize any means of monitoring or
detecting the desired activity as would be known in the art (See,
e.g., Wu et al., Curr. Biol. 10:1611-4 (2000); Fedi et al., J.
Biol. Chem. 274:19465-72 (1991); Grotewold et al., Mech. Dev.
89:151-3 (1999); Shibata et al., Mech. Dev. 96:243-6 (2000); Wang
et al., Oncogene 19:1843-8 (2000); and Glinka et al., Nature
391:357-62 (1998)). Potential agents which modulate Dkk include,
for example, p53, the tumor suppressor protein, which can induce
Dkk-1. Damage to DNA has also been observed to up-regulate Dkk-1
expression via a stabilization and activation of p53 (Wang et al.,
Oncogene 19:1843-48 (2000)); and, Shou et al., Oncogene 21:878-89
(2002)). Additionally, Fedi et al. (1999) purportedly showed that
Dkk-1 can block the Wnt2-induced oncogenic transformation of
NIH-3T3 cells. Furthermore, it has been suggested that Dkk
expression can be modulated by BMP signaling in the developing
skeleton (Mukhopadhyay et al., Dev. Cell. 1:423-34 (2001); and
Grotewold et al., EMBO J. 21:966-75 (2002)). Grotewold et al.
additionally describe altered Dkk expression levels in response to
stress signals including UV irradiation and other genotoxic
stimuli. They propose that Dkk expression is proapoptotic. In
animals expressing HBM constructs conferring high bone mass, a
reduced osteoblast apoptosis effect was observed. Thus, HBM and
HBM-like variants may control/alter Dkk's role in programmed cell
death. Other agents which potentially modulate Dkk activity include
the Dkk interacting proteins identified in FIG. 5.
[0362] In one embodiment, the relative amounts of Dkk or a Dkk
interacting protein of a cell population that has been exposed to
the agent to be tested is compared to an unexposed control cell
population. Antibodies can be used to monitor the differential
expression of the protein in the different cell populations. Cell
lines or populations are exposed to the agent to be tested under
appropriate conditions and time. Cellular lysates may be prepared
from the exposed cell line or population and a control, unexposed
cell line or population. The cellular lysates are then analyzed
with the probe, as would be known in the art. See, e.g., Ed Harlow
and David Lane, Antibodies: A Laboratory Manual (Cold Spring
Harbor, N.Y., 1988) and Ed Harlow and David Lane, Using Antibodies:
A Laboratory Manual (Cold Spring Harbor, N.Y. 1998).
[0363] For example, N- and C- terminal fragments of Dkk can be
expressed in bacteria and used to search for proteins which bind to
these fragments. Fusion proteins, such as His-tag or GST fusion to
the N- or C-terminal regions of Dkk (or to biologically active
domains of Dkk-1) or a whole Dkk protein can be prepared. These
fusion proteins can be coupled to, for example, Talon or
Glutathione-Sepharose beads and then probed with cell lysates to
identify molecules which bind to Dkk. Prior to lysis, the cells may
be treated with purified Wnt proteins, RNA, or drugs which may
modulate Wnt signaling or proteins that interact with downstream
elements of the Wnt pathway. Lysate proteins binding to the fusion
proteins can be resolved by SDS-PAGE, isolated and identified by,
for example protein sequencing or mass spectroscopy, as is known in
the art. See, e.g., Protein Purification Applications: A Practical
Approach (Simon Roe, ed., 2.sup.nd ed. Oxford Univ. Press, 2001)
and "Guide to Protein Purification" in Meth. Enzymology vol. 182
(Academic Press, 1997).
[0364] The activity of Dkk, a Dkk interacting protein, or a complex
of Dkk with LRP5/LRP6/HBM may be affected by compounds which
modulate the interaction between Dkk and a Dkk interacting protein
(such as those shown in FIG. 5) and/or Dkk and LRP5/LRP6/HBM. The
present invention provides methods and research tools for the
discovery and characterization of these compounds. The interaction
between Dkk and a Dkk interacting protein and/or Dkk and LRP5/6/HBM
may be monitored in vivo and in vitro. Compounds which modulate the
stability of a Dkk-LRP5/LRP6/HBM complex are potential therapeutic
compounds. Example in vitro methods include: Binding LRP5/6/HBM,
Dkk, or a Dkk interacting protein to a sensor chip designed for an
instrument such are made by Biacore (Uppsala, Sweden) for the
performance of an plasmon resonance spectroscopy observation. In
this method, the chip with one of Dkk, a Dkk interacting protein,
or LRP5/6 is first exposed to the other under conditions which
permit them to form the complex. A test compound is then introduced
and the output signal of the instrument provides an indication of
any effect exerted by the test compound. By this method, compounds
may be rapidly screened. Another, in vitro, method is exemplified
by the SAR-by-NMR methods (Shuker et al., Science. 274:1531-4
(1996)). Briefly, a Dkk-1 binding domain and/or LRP 5 or 6 LBD are
expressed and purified as .sup.15N labeled protein by expression in
labeled media. The labeled protein(s) are allowed to form the
complex in solution in an NMR sample tube. The heteronuclear
correlation spectrum in the presence and absence of a test compound
provides data at the level of individual residues with regard to
interactions with the test compound and changes at the
protein-protein interface of the complex. One of skill in the art
knows of many other protocols, e.g. affinity capillary
electrophoresis (Okun et al. J Biol Chem 276:1057-62 (2001); Vergun
and Chu, Methods, 19:270-7 (1999)), fluorescence spectroscopy,
electron paramagnetic resonance, etc. which can monitor the
modulation of a complex and/or measure binding affinities for
complex formation.
[0365] In vitro protocols for monitoring the modulation of a
Dkk/LRP5/LRP6/HBM complex include the yeast two hybrid protocol.
The yeast two hybrid method may be used to monitor the modulation
of a complex in vivo by monitoring the expression of genes
activated by the formation of a complex of fusion proteins of Dkk
and LRP ligand binding domains. Nucleic acids according to the
invention which encode the interacting Dkk and LRP LBD domains are
incorporated into bait and prey plasmids. The Y2H protocol is
performed in the presence of one or more test compounds. The
modulation of the complex is observed by a change in expression of
the complex activated gene. It will be appreciated by one skilled
in the art that test compounds can be added to the assay directly
or, in the case of proteins, can be coexpressed in the yeast with
the bait and prey compounds. Similarly, fusion proteins of Dkk and
Dkk interacting proteins can also be used in a Y2H screen to
identify other proteins which modulate the Dkk/Dkk interacting
protein complex.
[0366] Assay protocols such as these may be used in methods to
screen for compounds, drugs, treatments which modulate the Dkk/Dkk
interacting protein and/or Dkk/LRP5/6 complex, whether such
modulation occurs by competitive binding, or by altering the
structure of either LRP 5/6 or Dkk at the binding site, or by
stabilizing or destablizing the protein-protein interface. It may
be anticipated that peptide aptamers may competitively bind,
although induction of an altered binding site structure by steric
effects is also possible.
[0367] 12.1 Antibodies and Antibody Fragments
[0368] Polyclonal and monoclonal antibodies and fragments of these
antibodies which bind to Dkk or LRP5/LRP6/HBM can be prepared as
would be known in the art. For example, suitable host animals can
be immunized using appropriate immunization protocols and the
peptides, polypeptides or proteins of the invention. Peptides for
use in immunization are typically about 8-40 residues long. If
necessary or desired, the polypeptide immunogens can be conjugated
to suitable carriers. Methods for preparing immunogenic conjugates
with carriers such as bovine serum albumin (BSA), keyhole limpet
hemocyanin (KLH), or other carrier proteins are well known in the
art (See, Harlow et al., 1988). In some circumstances, direct
conjugation using, for example, carbodiimide reagents, may be
effective; in other instances linking reagents such as those
supplied by Pierce Chemical Co., Rockford, Ill., may be desirable
to provide accessibility to the polypeptide or hapten. The hapten
peptides can be extended at either the amino or carboxy terminus
with a cysteine residue or interspersed with cysteine residues, for
example, to facilitate linking to a carrier. Administration of the
immunogens is conducted generally by injection over a suitable time
period and with use of suitable adjuvants, as is generally
understood in the art. During the immunization schedule, titers of
antibodies are taken to determine adequacy of antibody
formation.
[0369] Anti-peptide antibodies can be generated using synthetic
peptides, for example, the peptides derived from the sequence of
any Dkk, including Dkk-1, or LRP5/LRP6/HBM. Synthetic peptides can
be as small as 2-3 amino acids in length, but are preferably at
least 3, 5, 10, or 15 or more amino acid residues long. Such
peptides can be determined using programs such as DNAStar. The
peptides are coupled to KLH using standard methods and can be
immunized into animals such as rabbits. Polyclonal anti-Dkk or
anti-LRP5/LRP6/HBM peptide antibodies can then be purified, for
example using Actigel beads containing the covalently bound
peptide.
[0370] While the polyclonal antisera produced in this way may be
satisfactory for some applications, for pharmaceutical
compositions, use of monoclonal preparations is preferred.
Immortalized cell lines which secrete the desired monoclonal
antibodies may be prepared using the standard method of Kohler and
Milstein or modifications which effect immortalization of
lymphocytes or spleen cells, as is generally known (See, e.g.,
Harlow et al., 1988 and 1998). The immortalized cell lines
secreting the desired antibodies can be screened by immunoassay in
which the antigen is the peptide hapten, polypeptide or protein.
When the appropriate immortalized cell culture secreting the
desired antibody is identified, the cells can be cultured either in
vitro or by production in ascites fluid.
[0371] The desired monoclonal antibodies are then recovered from
the culture supernatant or from the ascites supernatant. Fragments
of the monoclonal antibodies which contain the immunologically
significant portion can be used as agonists or antagonists of Dkk
activity. Use of immunologically reactive fragments, such as the
Fab, scFV, Fab', of F(ab').sub.2 fragments are often preferable,
especially in a therapeutic context, as these fragments are
generally less immunogenic than the whole immunoglobulin.
[0372] The antibodies or fragments may also be produced, using
current technology, by recombinant means. Regions that bind
specifically to the desired regions of Dkk or LRP5/LRP6/HBM can
also be produced in the context of chimeras with multiple species
origin. Antibody reagents so created are contemplated for use
diagnostically or as stimulants or inhibitors of Dkk activity.
[0373] In one embodiment, antibodies against Dkk, bind Dkk with
high affinity, i.e., ranging from 10.sup.-5 to 10.sup.-9 M.
Preferably, the anti-Dkk antibody will comprise a chimeric,
primate, Primatized.RTM., human or humanized antibody. Also, the
invention embraces the use of antibody fragments, e.g., Fab's,
Fv's, Fab's, F(ab).sub.2, and aggregates thereof.
[0374] Another embodiment contemplates chimeric antibodies which
recognize Dkk or LRP5/LRP6/HBM. A chimeric antibody is intended to
refer to an antibody with non-human variable regions and human
constant regions, most typically rodent variable regions and human
constant regions.
[0375] A "primatized.RTM. antibody" refers to an antibody with
primate variable regions, e.g., CDR's, and human constant regions.
Preferably, such primate variable regions are derived from an Old
World monkey.
[0376] A "humanized antibody" refers to an antibody with
substantially human framework and constant regions, and non-human
complementarity-determining regions (CDRs). "Substantially" refers
to the fact that humanized antibodies typically retain at least
several donor framework residues (i.e., of non-human parent
antibody from which CDRs are derived).
[0377] Methods for producing chimeric, primate, primatized.RTM.,
humanized and human antibodies are well known in the art. See,
e.g., U.S. Pat. No. 5,530,101, issued to Queen et al.; U.S. Pat.
No. 5,225,539, issued to Winter et al.; U.S. Pat. Nos. 4,816,397
and 4,816,567, issued to Boss et al. and Cabilly et al.
respectively, all of which are incorporated by reference in their
entirety.
[0378] The selection of human constant regions may be significant
to the therapeutic efficacy of the subject anti-Dkk or
LRP5/LRP6/HBM antibody. In a preferred embodiment, the subject
anti-Dkk or LRP5/LRP6/HBM antibody will comprise human, gamma 1, or
gamma 3 constant regions and, more preferably, human gamma 1
constant regions.
[0379] Methods for making human antibodies are also known and
include, by way of example, production in SCID mice, and in vitro
immunization.
[0380] The subject anti-Dkk or LRP5/LRP6/HBM antibodies can be
administered by various routes of administration, typically
parenteral. This is intended to include intravenous, intramuscular,
subcutaneous, rectal, vaginal, and administration with intravenous
infusion being preferred.
[0381] The anti-Dkk or LRP5/LRP6/HBM antibody will be formulated
for therapeutic usage by standard methods, e.g., by addition of
pharmaceutically acceptable buffers, e.g., sterile saline, sterile
buffered water, propylene glycol, and combinations thereof.
[0382] Effective dosages will depend on the specific antibody,
condition of the patient, age, weight, or any other treatments,
among other factors. Typically effective dosages will range from
about 0.001 to about 30 mg/kg body weight, more preferably from
about 0.01 to 25 mg/kg body weight, and most preferably from about
0.1 to about 20 mg/kg body weight.
[0383] Such administration may be effected by various protocols,
e.g., weekly, bi-weekly, or monthly, depending on the dosage
administered and patient response. Also, it may be desirable to
combine such administration with other treatments.
[0384] Antibodies to Dkk-1 interacting proteins, such as those
identified in FIG. 5, are also contemplated according to the
present invention, and can be used similarly to the Dkk-1
antibodies mentioned in the above methodology.
[0385] The antibodies of the present invention can be utilized in
experimental screening, as diagnostic reagents, and in therapeutic
compositions.
[0386] 12.2 Chemical Libraries
[0387] Agents that are assayed by these methods can be randomly
selected or rationally selected or designed. As used herein, an
agent is said to be randomly selected when the agent is chosen
randomly without considering the specific sequences involved in the
association of Dkk-1 alone, Dkk-1 interacting proteins alone, or
with their associated substrates, binding partners, etc. An example
of randomly selected agents is the use of a chemical library or a
peptide combinatorial library, or a growth broth of an
organism.
[0388] The agents of the present invention can be, as examples,
peptides, small molecules, vitamin derivatives, as well as
carbohydrates. A skilled artisan can readily recognize that there
is no limit as to the structural nature of the agents of the
present invention.
[0389] 12.3 Peptide Synthesis
[0390] The peptide agents of the invention can be prepared using
standard solid phase (or solution phase) peptide synthesis methods,
as is known in the art. In addition, the DNA encoding these
peptides may be synthesized using commercially available
oligonucleotide synthesis instrumentation and produced
recombinantly using standard recombinant production systems. The
production of polypeptides using solid phase peptide synthesis is
necessitated if non-nucleic acid-encoded amino acids are to be
included.
[0391] 13. Uses for Agents that Modulate at Least One Activity of
Dkk. a Dkk Interacting Protein, a Dkk/Dkk Interacting Protein
Complex, or a Dkk/LRP5 or Dkk/LRP6 Complex
[0392] The proteins and nucleic acids of the invention, such as the
proteins or polypeptides containing an amino acid sequence of LRP5,
Dkk, and Dkk interacting proteins are involved in bone mass
modulation and lipid modulation of other Wnt pathway mediated
activity. Agents that modulate (i.e., up and down-regulate) the
expression of Dkk or Dkk interacting proteins, or agents, such as
agonists and antagonists respectively, of at least one activity of
Dkk or a Dkk interacting protein may be used to modulate biological
and pathologic processes associated with the function and activity
of Dkk or a Dkk interacting protein.
[0393] As used herein, a subject can be preferably any mammal, so
long as the mammal is in need of modulation of a pathological or
biological process modulated by a protein of the invention. The
term "mammal" means an individual belonging to the class Mammalia.
The invention is particularly useful in the treatment of human
subjects.
[0394] As used herein, a biological or pathological process
modulated by Dkk or a Dkk interacting protein may include binding
of Dkk to a Dkk interacting protein, Dkk to LRP5 or LRP6 or release
therefrom, inhibiting or activating Dkk or a Dkk interacting
protein mRNA synthesis or inhibiting Dkk or Dkk interacting protein
modulated inhibition of LRP5 or LRP6 mediated Wnt signaling.
Further bone-related markers may be observed such as alkaline
phosphatase activity, osteocalcin production, or
mineralization.
[0395] Pathological processes refer to a category of biological
processes which produce a deleterious effect. For example,
expression or up-regulation of expression of LRP5 or LRP6 and/or
Dkk and/or a Dkk interacting protein may be associated with certain
diseases or pathological conditions. As used herein, an agent is
said to modulate a pathological process when the agent
statistically significantly (p<0.05) alters the process from its
base level in the subject. For example, the agent may reduce the
degree or severity of the process mediated by that protein in the
subject to which the agent was administered. For instance, a
disease or pathological condition may be prevented, or disease
progression modulated by the administration of agents which reduce
or modulate in some way the expression or at least one activity of
a protein of the invention.
[0396] As LRP5/6 and Dkk are involved both directly and indirectly
in bone mass modulation, one embodiment of this invention is to use
Dkk or Dkk interacting protein expression as a method of diagnosing
a bone condition or disease. Certain markers are associated with
specific Wnt signaling conditions (e.g., TCF/LEF activation).
Diagnostic tests for bone conditions may include the steps of
testing a sample or an extract thereof for the presence of Dkk or
Dkk interacting protein nucleic acids (i.e., DNA or RNA), oligomers
or fragments thereof or protein products of TCF/LEF regulated
expression. For example, standard in situ hybridization or other
imaging techniques can be utilized to observe products of Wnt
signaling.
[0397] This invention also relates to methods of modulating bone
development or bone loss conditions. Inhibition of bone loss may be
achieved by inhibiting or modulating changes in the LRP5/6 mediated
Wnt signaling pathway. For example, absence of LRP5 activity may be
associated with low bone mass. Increased activity LRP5 may be
associated with high bone mass. Therefore, modulation of LRP5
activity will in turn modulate bone development. Modulation of the
Dkk1 LRP5/6 or Dkk/Dkk interacting protein complex via agonists and
antagonists is one embodiment of a method to regulate bone
development. Such modulation of bone development can result from
inhibition of the activity of, for example, a Dkk/LRP(5/6) protein
complex, a Dkk/Dkk interacting protein complex, upregulated
transcription of the LRP5 gene or inhibited translation of Dkk or
Dkk interacting protein mRNA.
[0398] The agents of the present invention can be provided alone,
or in combination with other agents that modulate a particular
pathological process. As used herein, two agents are said to be
administered in combination when the two agents are administered
simultaneously or are administered independently in a fashion such
that the agents will act at the same time.
[0399] The agents of the present invention can be administered via
parenteral, subcutaneous (sc), intravenous (iv), intramuscular
(im), intraperitoneal (ip), transdermal or buccal routes.
Alternatively, or concurrently, administration may be by the oral
route. The dosage administered will be dependent upon the age,
health, and weight of the recipient, kind of concurrent treatment,
if any, frequency of treatment, and the nature of the effect
desired.
[0400] The present invention further provides compositions
containing one or more agents which modulate expression or at least
one activity of a protein of the invention. While individual needs
vary, determination of optimal ranges of effective amounts of each
component is within the skill of the art. Typical dosages of the
active agent which mediate Dkk or Dkk interacting protein activity
comprise from about 0.0001 to about 50 mg/kg body weight. The
preferred dosages comprise from about 0.001 to about 50 mg/kg body
weight. The most preferred dosages comprise from about 0.1 to about
1 mg/kg body weight. In an average human of 70 kg, the range would
be from about 7 pg to about 3.5 g, with a preferred range of about
0.5 mg to about 5 mg.
[0401] In addition to the pharmacologically active agent, the
compositions of the present invention may contain suitable
pharmaceutically acceptable carriers comprising excipients and
auxiliaries which facilitate processing of the active compounds
into preparations which can be used pharmaceutically for delivery
to the site of action. Suitable formulations for parenteral
administration include aqueous solutions of the active compounds in
water-soluble form, for example, water-soluble salts. In addition,
suspensions of the active compounds as appropriate oily injection
suspensions may be administered. Suitable lipophilic solvents or
vehicles include fatty oils, for example, sesame oil, or synthetic
fatty acid esters, (e.g., ethyl oleate or triglycerides). Aqueous
injection suspensions may contain substances which increase the
viscosity of the suspension include, for example, sodium
carboxymethyl cellulose, sorbitol and/or dextran. Optionally, the
suspension may also contain stabilizers. Liposomes and other
non-viral vectors can also be used to encapsulate the agent for
delivery into the cell.
[0402] The pharmaceutical formulation for systemic administration
according to the invention may be formulated for enteral,
parenteral, or topical (top) administration. Indeed, all three
types of formulations may be used simultaneously to achieve
systemic administration of the active ingredient.
[0403] Suitable formulations for oral administration include hard
or soft gelatin capsules, pills, tablets, including coated tablets,
elixirs, suspensions, syrups or inhalations and controlled release
forms thereof.
[0404] Potentially, any compound which binds Dkk or a Dkk
interacting protein or modulates the Dkk/LRP5 or Dkk/LRP6 or
Dkk/Dkk interacting protein complex may be a therapeutic compound.
In one embodiment of the invention, a peptide or nucleic acid
aptamer according to the invention is used in a therapeutic
composition. Such compositions may comprise an aptamer, or a LRP5
or LRP6 fragment unmodified or modified. In another embodiment, the
therapeutic compound comprises a Dkk-1 interacting protein, or
biologically active fragment thereof.
[0405] Nucleic acid aptamers have been used in compositions for
example by chemical bonding to a carrier molecule such as
polyethylene glycol (PEG) which may facilitate uptake or stabilize
the aptamer. A di-alkylgylcerol moiety attached to an RNA will
embed the aptamer in liposomes, thus stabilizing the compound.
Incorporating chemical substitutions (i.e. changing the 2'OH group
of ribose to a 2'NH in RNA confers ribonuclease resistance) and
capping, etc. can prevent breakdown. Several such techniques are
discussed for RNA aptamers in Brody and Gold (Rev. Mol. Biol.
74:3-13 (2000)).
[0406] Peptide aptamers may by used in therapeutic applications by
the introduction of an expression vector directing aptamer
expression into the affected tissue such as for example by
retroviral delivery, by encapsulating the DNA in a delivery complex
or simple by naked DNA injection. Or, the aptamer itself or a
synthetic analog may be used directly as a drug. Encapsulation in
polymers and lipids may assist in delivery. The use of peptide
aptamers as therapeutic and diagnostic agents is reviewed by
Hoppe-Syler and Butz (J. Mol. Med. 78:426430 (2000)).
[0407] In another aspect of the invention. The structure of a
constrained peptide aptamer of the invention may be determined such
as by NMR or X-ray crystallography. (Cavanagh et al., Protein NMR
Spectroscopy: Principles and Practice, Academic Press, 1996;
Drenth, Principles of Protein X-Ray Crystallography, Springer
Verlag, 1999) Preferably the structure is determined in complex
with the target protein. A small molecule analog is then designed
according to the positions of functional elements of the 3D
structure of the aptamer. (Guidebook on Molecular Modeling in Drug
Design, Cohen, Ed., Academic Press, 1996; Molecular Modeling and
Drug Design (Topics in Molecular and Structural Biology), Vinter
and Gardner Eds., CRC Press, 1994) Thus the present invention
provides a method for the design of effective and specific drugs
which modulate the activity of Dkk, Dkk interacting proteins,
Dkk/Dkk interacting protein complex and the Dkk/LRP complex. Small
molecule mimetics of the peptide aptamers of the present invention
are encompassed within the scope of the invention.
[0408] In practicing the methods of this invention, the compounds
of this invention may be used alone or in combination, or in
combination with other therapeutic or diagnostic agents. In certain
preferred embodiments, the compounds of this invention may be
co-administered along with other compounds typically prescribed for
these conditions according to generally accepted medical practice.
For example, the compounds of this invention can be administered in
combination with other therapeutic agents for the treatment of bone
loss. Bone loss mediating agents include bone resorption inhibitors
such as bisphosphonates (e.g., alendronic acid, clodronic acid,
etidronic acid, pamidronic acid, risedronic acid and tiludronic
acid), vitamin D and vitamin D analogs, cathepsin K inhibitors,
hormonal agents (e.g., calcitonin and estrogen), and selective
estrogen receptor modulators or SERMs (e.g., raloxifene). And bone
forming agents such as parathyroid hormone (PTH) and bone
morphogenetic proteins (BMP).
[0409] Additionally contemplated are combinations of agents which
regulate Dkk-1 and agents which regulate lipid levels such as
HMG-COA reductase inhibitors (i.e., statins such as Mevacor.RTM.,
Lipitor.RTM. and other inhibitors such as Baycol.RTM., Lescol.RTM.,
Pravachol.RTM. and Zocor.RTM.), bile acid sequestrants (e.g.,
Colestid.RTM. and Welchol.RTM.), fibric acid derivatives
(Atromid-S.RTM., Lopid.RTM., Tricor.RTM.), and nicotinic acid.
[0001] The compounds of this invention can be utilized in vivo,
ordinarily in vertebrates and preferably in mammals, such as
humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or
in vitro.
[0410] 14. Transgenic Animals
[0411] Transgenic animal models can be created which conditionally
express Dkk and/or LRP5 or LRP6 and/or Dkk interacting proteins,
such as those shown in FIG. 5. These animals can be used as
research tools for the study of the physiological effects of the
Dkk-1/Dkk-1 interacting protein interaction and/or the LRP5 / Dkk
interaction. Alternatively, transgenic animals can be created which
express a transgenic form of Dkk alone or in addition to a
transgenic form of HBM or express Dkk interacting proteins alone or
in addition to a transgenic form of Dkk. Transgenic animals
expressing HBM or LRP5 can be crossed with transgenic animals
expressing Dkk or Dkk interacting proteins to obtain heterozygote
as well as homozygote animals which express both desired genes.
[0412] Animal models may be created to directly modulate the
Dkk/Dkk interacting protein or Dkk/LRP5 interaction activity in
vivo to serve as a research tool for determining the efficacy of
candidate compounds which modulate the Dkk/Dkk interacting protein
or LRP5/Dkk interaction activity in vitro. Animals, such as
transgenic mice, can be created using the techniques employed to
make transgenic mice that express for example, human Dkk or a Dkk
interacting protein, or knockouts (KO), which may be conditional,
of the gene encoding mouse Dkk or Dkk interacting protein. Knock-in
animals include animals wherein genes have been introduced and
animals wherein a gene that was previously knocked-out is
reintroduced into the animal. Other transgenic animals can be
created with inducible forms of Dkk or a Dkk interacting protein to
study the effects of the gene on bone mass development and loss as
well as lipid level regulation. These animals can also be used to
study long term effects of Dkk or Dkk interacting protein
modulation. Transgenic animals may be created to express peptide
aptamers, or produce RNA aptamers. The transgenic vectors may
direct expression in a tissue specific manner by the use of tissue
specific promoters. In a preferred embodiment, a peptide aptamer
fusion protein is expressed using a bone specific promoter. Such
systems can provide a tissue specific knock-out of Dkk or Dkk
interacting protein activity.
[0413] General methods for creating transgenic animals are known in
the art, and are described in, for example, Strategies in
Transgenic Animal Science (Glenn M. Monastersky and James M. Robl
eds., ASM Press; Washington, D.C., 1995); Transgenic Animal
Technology: A Laboratory Handbook (Carl A. Pinkert ed., Academic
Press 1994); Transgenic Animals (Louis Marie Houdebine, ed.,
Harwood Academic Press, 1997); Overexpression and Knockout of
Cytokines in Transgenic Mice (Chaim O. Jacob, ed., Academic Press
1994); Microinjection and Transgenesis: Strategies and Protocols
(Springer Lab Manual) (Angel Cid-Arregui and Alejandro
Garcia-Carranca, eds., Springer Verlag 1998); and Manipulating the
Mouse Embryo: A Laboratory Manual (Brigid Hogan et al., eds., Cold
Spring Harbor Laboratory Press 1994).
[0414] 15. Peptide and Nucleotide Aptamers and Peptide Aptamer
Mimetics
[0415] Another embodiment contemplates the use of peptide and
nucleotide aptamer technology to screen for agents which interact
with Dkk, which block Dkk from interacting with LRP5 or LRP6, or
which block any other Dkk ligand interaction, or which interact
with Dkk interacting proteins, such as those shown in FIG. 5.
Peptide aptamers are molecules in which a variable peptide domain
is displayed from a scaffold protein. Thioredoxin A (trxA) is
commonly used for a scaffold. The peptide insert destroys the
catalytic site of trxA. It is recognized that numerous proteins may
also be used as scaffolding proteins to constrain and/or present a
peptide aptamer. Other scaffold proteins that could display a
constrained peptide aptamer could include staphylococcal nuclease,
the protease inhibitor eglin C, the Streptomyces tendea
alpha-amylase inhibitor Tendamistat, Sp1, and green fluorescent
protein (GFP) (reviewed in Hoppe-Seyler et al., J. Steroid Biochem
Mol. Biol. 78:105-11 (2001)), and the S1 nuclease from
Staphylococcus or M13 for phage display. Any molecule to which the
aptamer could be anchored and presented in its bioactive
conformation would be suitable.
[0416] Aptamers can then specifically bind to a given target
protein in vitro and in vivo and have the potential to selectively
block the function of their target protein. Peptide aptamers are
selected from randomized expression libraries on the basis of their
in vivo binding capacity to the desired target protein. Briefly, a
target protein (e.g., Dkk, a Dkk interacting protein, or LRP5/6) is
linked to a heterologous DNA binding domain (BD) and expressed as
bait in a yeast test strain. Concomitantly, a library coding for
different peptides (e.g., 16-mers) of randomized sequence inserted
in a scaffold protein sequence, which are linked to a heterologous
transcriptional activation domain (AD) is expressed as prey. If a
peptide binds to a target protein, a functional transcription
factor is reconstituted, in which the BD and AD are bridged
together by interacting proteins. This transcription factor is then
able to activate the promoter of a marker gene which can be
monitored by colorimetric enzymatic assays or by growth selection.
Additional variation, methods of preparing and screening
methodologies are described in, for example, Hoppe-Seyler et al.,
J. Mol Med. 78: 426-430 (2000). Nucleotide aptamers are described
for example in Brody et al., Trends Mol. Biotechnol. 74: 5-13
(2000). Additional methods of making and using nucleotide aptamers
include SELEX, i.e., Systematic Evolution of Ligands by Exponential
Enrichment. SELEX is a process of isolating oligonucleotide ligands
of a chosen target molecule (see Tuerk and Gold, Science
249:505-510 (1990); U.S. Pat. Nos. 5,475,096, 5,595,877, and
5,660,985). SELEX, as described in Tuerk and Gold, involves
admixing the target molecule with a pool of oligonucleotides (e.g.,
RNA) of diverse sequences; retaining complexes formed between the
target and oligonucleotides; recovering the oligonucleotides bound
to the target; reverse-transcribing the RNA into DNA; amplifying
the DNA with polymerase chain reactions (PCR); transcribing the
amplified DNA into RNA; and repeating the cycle with ever
increasing binding stringency. Three enzymatic reactions are
required for each cycle. It usually takes 12-15 cycles to isolate
aptamers of high affinity and specificity to the target. An aptamer
is an oligonucleotide that is capable of binding to an intended
target substance but not other molecules under the same
conditions.
[0417] In another reference, Bock et al., Nature 355:564-566
(1990), describe a different process from the SELEX method of Tuerk
and Gold in that only one enzymatic reaction is required for each
cycle (i.e., PCR) because the nucleic acid library in Bock's method
is comprised of DNA instead of RNA. The identification and
isolation of aptamers of high specificity and affinity with the
method of Bock et al. still requires repeated cycles in a
chromatographic column.
[0418] Other nucleotide aptamer methods include those described by
Conrad et al., Meth. Enzymol. 267:336-367 (1996). Conrad et al.
describe a variety of methods for isolating aptamers, all of which
employ repeated cycles to enrich target-bound ligands and require a
large amount of purified target molecules. More recently described
methods of making and using nucleotide aptamers include, but are
not limited to those described in U.S. Pat. Nos. 6,180,348;
6,051,388; 5,840,867; 5,780,610, 5,756,291 and 5,582,981.
[0419] Potentially, any compound which binds Dkk or a Dkk
interacting protein or modulates the Dkk/Dkk interacting protein or
Dkk/LRP5 or Dkk/LRP6 complex may be a therapeutic compound. In one
embodiment of the invention, a peptide or nucleic acid aptamer
according to the invention is used in a therapeutic composition.
Such compositions may comprise an aptamer, or a LRP5 or LRP6
fragment unmodified or modified.
[0420] Nucleic acid aptamers have been used in compositions for
example by chemical bonding to a carrier molecule such as
polyethylene glycol (PEG) which may facilitate uptake or stabilize
the aptamer. A di-alkylglycerol moiety attached to an RNA will
embed the aptamer in liposomes, thus stabilizing the compound.
Incorporating chemical substitutions (i.e., changing the 2'-OH
group of ribose to a 2'-NH in RNA confers ribonuclease resistance)
and capping, etc. can prevent breakdown. Several such techniques
are discussed for RNA aptamers in Brody and Gold Rev. Mol. Biol.
74:3-13 (2000).
[0421] Peptide aptamers may by used in therapeutic applications by
the introduction of an expression vector directing aptamer
expression into the affected tissue such as for example by
retroviral delivery, by encapsulating the DNA in a delivery complex
or simple by naked DNA injection. Or, the aptamer itself or a
synthetic analog may be used directly as a drug. Encapsulation in
polymers and lipids may assist in delivery. The use of peptide
aptamers as therapeutic and diagnostic agents is reviewed by
Hoppe-Syler and Butz J. Mol. Med. 78:426-430 (2000).
[0422] In another aspect of the invention, the structure of a
constrained peptide aptamer of the invention may be determined such
as by NMR or X-ray crystallography. (Cavanagh et al., Protein NMR
Spectroscopy: Principles and Practice, Academic Press, 1996;
Drenth, Principles of Protein X-Ray Crystallography, Springer
Verlag, 1999) Preferably the structure is determined in complex
with the target protein. A small molecule analog is then designed
according to the positions of functional elements of the 3D
structure of the aptamer. (Guidebook on Molecular Modeling in Drug
Design, Cohen, Ed., Academic Press, 1996; Molecular Modeling and
Drug Design (Topics in Molecular and Structural Biology), Vinter
and Gardner Eds., CRC Press, 1994) Thus, a method is provided for
the design of effective and specific drugs which modulate the
activity of Dkk, Dkk interacting proteins, Dkk/Dkk interacting
protein complex, and the Dkk/LRP complex. Small molecule mimics of
the peptide aptamers of the present invention are also encompassed
within the scope of the invention.
[0423] 16. Alternative Variants of LRP5/LRP6 Having HBM
Activity
[0424] A structural model of the LRP5/Zmax1 first beta-propeller
module was generated based on a model prediction in Springer et
al., (1998) J. Molecular Biology, 283:837-862. Based on the model,
certain amino acid residues were identified as important variants
of LRP5/HBM/Zmax1. The following three categories provide examples
of such variants:
[0425] The shape of the beta-propeller resembles a disk with
inward-sloping sides and a hole down the middle. Residue 171 is in
a loop on the outer or top surface of the domain in blade 4 of
propeller module 1. Thus, variants comprising changed residues in
structurally equivalent positions in other blades; as well as
residues that are slightly more interior to the binding pocket, but
still accessible to the surface, are important embodiments of the
present invention for the study of bone mass modulation by
LRP5/HBM, for the development of pharmaceuticals and treatments of
bone mass disorders, and for other objectives of the present
invention. The following are examples of such variants:
[0426] A214V ( a position equivalent to 171 in blade 5; alanine is
not conserved in other propellers),
[0427] E128V (a position equivalent to 171 in blade 3; glutamate is
not conserved in other propellers),
[0428] A65V (a position equivalent to 171 in blade 2; alanine is
conserved in propellers 1-3 but not 4),
[0429] G199V (an accessible interior position in blade 5; glycine
is conserved in propellers 1-3 but not 4), and
[0430] M282V (accessible interior position in blade 1; methionine
is conserved in propellers 1-3 but not 4).
[0431] LRP5/Zmax1 has four beta-propeller structures; the first
three beta-propeller modules conserve a glycine in the position
corresponding to residue 171 in human LRP5/Zmax1. Therefore,
variants bearing a valine in the equivalent positions in the other
propellers are important embodiments of the present invention. The
following variants are useful for the study of bone mass modulation
by LRP5/HBM, for the development of pharmaceuticals and treatments
of bone mass disorders, and for other objectives of the present
invention: G479V, G781V, and Q1087V.
[0432] The G171V HBM polymorphism results in "occupied space" of
the beta-propeller 1, with the side-chain from the valine residue
sticking out into an open binding pocket and potentially altering a
ligand/protein interaction. The glycine residue is conserved in
LRP5/Zmax1 propellers 1, 2 and 3 but is a glutamine in propeller 4.
Therefore, the following variants of LRP5/HBM are important
embodiments of the present invention for the study of bone mass
modulation by LRP5/HBM, for the development of pharmaceuticals and
treatments of bone mass disorders, and for other objectives of the
present invention:
[0433] G171K (which introduces a charged side-chain),
[0434] G171F (which introduces a ringed side-chain),
[0435] G171I (which introduces a branched side-chain), and
[0436] G171Q (which introduces the propeller 4 residue).
[0437] Furthermore, LRP6 is the closest homolog of LRP5/Zmax1. LRP6
has a beta-propeller structure predicted to be similar, if not
identical to Zmax1. The position corresponding to glycine 171 in
human LRP5/Zmax1 is glycine 158 of human LRP6. Thus, corresponding
variants of LRP6 are an important embodiment of the present
invention for the study of the specificity of LRP5/Zmax1 versus its
related family member, for the development of pharmaceuticals and
treatments of bone mass disorders, and for other objectives of the
present invention. Specifically, for example, a glycine to valine
substitution at the structurally equivalent position, residue 158,
of human LRP6 and similar variants of other species' LRP6 homologs
represent important research tools.
[0438] Site-directed mutants of LRP5 were generated in the
full-length human LRP5 cDNA using the QuikChange XL-Site-Directed
Mutagenesis Kit (catalog #200516, Stratagene, La Jolla, Calif.)
following the manufacturer's protocol. The mutant sequences were
introduced using complementary synthetic oligonucleotides:
3 A65V: TGGTCAGCGGCCTGGAGGATGTGGCCGCAGTGGACTTCC (SEQ ID NO:129) and
GGAAGTCCACTGCGGCCACATCCTCCAGGCCGCTGACCA (SEQ ID NO:130) E128V:
AAGCTGTACTGGACGGACTCAGTGACCAACCGCATCGAGG (SEQ ID NO:131) and
CCTCGATGCGGTTGGTCACTGAGTCCGTCCAGTACAGCTT (SEQ ID NO:132) G171K:
ATGTACTGGACAGACTGGAAGGAGACGCCCCGGATTGAG- CG (SEQ ID NO:133) and
CGCTCAATCCGGGGCGTCTCCTTCCAGTCTGTCCAG- TACAT (SEQ ID NO:134) G171F:
ATGTACTGGACAGACTGGTTTGAGACGCC- CCGGATTGAGCG (SEQ ID NO:135) and
CGCTCAATCCGGGGCGTCTCAAACCA- GTCTGTCCAGTACAT (SEQ ID NO:136) G171I:
ATGTACTGGACAGACTGGATTGAGACGCCCCGGATTGAGCG (SEQ ID NO:137) and
CGCTCAATCCGGGGCGTCTCAATCCAGTCTGTCCAGTACAT (SEQ ID NO:138) G171Q:
ATGTACTGGACAGACTGGCAGGAGACGCCCCGGAUGAGCG (SEQ ID NO:139) and
CGCTCAATCCGGGGCGTCTCCTGCCAGTCTGTCCAGTACAT (SEQ ID NO:140) G199V:
CGGACATTTACTGGCCCAATGTACTGACCATCGACCTGGAGG (SEQ ID NO:141) and
CCTCCAGGTCGATGGTCAGTACATTGGGCCAGTAAATGTCCG (SEQ ID NO:142) A214V:
AGCTCTACTGGGCTGACGTCAAGCTCAGCTTCAT- CCACCG (SEQ ID NO:143) and
CGGTGGATGAAGCTGAGCTTGACGTCAGCCCA- GTAGAGCT (SEQ ID NO:144) M282V:
GAGTGCCCTCTACTCACCCGTGGACA- TCCAGGTGCTGAGCC (SEQ ID NO:145) and
GGCTCAGCACCTGGATGTCCACG- GGTGAGTAGAGGGCACTC (SEQ ID NO:146) G479V:
CATGTACTGGACAGACTGGGTAGAGAACCCTAAAATCGAGTGTGC (SEQ ID NO:147) and
GCACACTGGATTTTAGGGTTCTCTACCCAGTCTGTCCAGTACATG (SEQ ID NO:148)
G781V: CATCTACTGGACCGAGTGGGTCGGCAAGCCGAGGATCGTGCG (SEQ ID NO:149)
and CGCACGATCCTCGGCTTGCCGACCCACTCGGTCCAGTAGATG (SEQ ID NO:150)
Q1087V: GTACTTCACCAACATGGTGGACCGGGCAGCCAA- GATCGAACG (SEQ ID
NO:151) and CGTTCGATCTTGGCTGCCCGGTCCACCAT- G1TGGTGAAGTAC (SEQ ID
NO:152) LRP6 G158V: GTACTGGACAGACTGGGTAGAAGTGCCIMAGATAGAACGTGC (SEQ
ID NO:153) and GCACGTTCTATCTTTGGCACTTCTACCCAGTCTGTCCAGTAC. (SEQ ID
NO:154)
[0439] All constructs were sequence verified to ensure that only
the engineered modification was present in the gene. Once verified,
each variant was functionally evaluated in the TCF-luciferase assay
in U2OS cells (essentially as described in Example 7. Other
functional evaluations could also be performed, such as the Xenopus
embryo assay (essentially as described in Example 6), or other
assays to evaluate Wnt signaling, Dkk modulation, or anabolic bone
effect. Binding of these mutants to Dkk, LRP-interacting proteins,
Dkk-interacting proteins, or peptide aptamers to any of the
preceding could also be investigated in a variety of ways such as
in a two-hybrid system (such as in yeast as described in this
application), or other methods.
[0440] FIG. 24 shows the effects of the G171F mutation in propeller
1 of LRP5. This mutation is at the same position as HBM's G171V
substitution. Expression of G171F results in an HBM effect. That
is, in the presence of Wnt, G171F is able to activate the
TCF-luciferase reporter construct. In fact, it may activate the
reporter to a greater extent than either LRP5 or HBM. Furthermore,
in the presence of Dkk1 and Wnt1, G171F is less susceptible than
LRP5 to modulation by Dkk. These data exemplify that the G171F
variant modulates Wnt signaling in a manner similar to HBM. In
addition, this data confirms that HBM's valine residue at 171 is
not the only modification at 171 that can result in an HBM effect.
Together these data support an important role for LRP5 propeller 1
in modulating Wnt pathway activity; in responding to Dkk
modulation; and, in the ability to generate an HBM effect.
[0441] FIG. 25 shows the effects of the M282V mutation in propeller
1 of LRP5. M282 expression results in an HBM-effect. That is, in
the presence of Wnt, M282 is able to activate the TCF-luciferase
reporter construct. Furthermore, in the presence of Dkk1 and Wnt1,
M282V is less susceptible than LRP5 to modulation by Dkk. These
data show that the M282V variant modulates Wnt signaling in a
manner similar to HBM. In addition, this data confirms that
modifications of other residues in propeller 1 of LRP5 can result
in an HBM effect.
[0442] These data support an "occupied space" model of the HBM
mutation in propeller 1 and show that multiple mutations of
propeller 1 are capable of generating an HBM effect; the original
G171V HBM mutation is not unique in this ability. Moreover, various
perturbations in propeller 1 can modulate Dkk activity.
[0443] These data illustrate the molecular mechanism of Dkk
modulation of LRP signaling. Using the methods disclosed herein and
in U.S. Application 60/290,071, generation of a comprehensive
mutant panel will reveal residues in LRP that function in Dkk
modulation of Wnt signaling. Such variants of LRP5 and LRP6 that
modulate Dkk activity and the residues which distinguish them from
LRP5 and LRP6 are points for therapeutic intervention by small
molecule compound, antibody, peptide aptamer, or other agents.
Furthermore, models of each HBM-effect mutation/polymorphism may be
used in rational drug design of an HBM mimetic agent.
[0444] These are only a few illustrative examples presented to
better describe the present invention. Variants of LRP5 which have
demonstrated HBM activity in assays include G171F, M282V, G171K,
G171Q and A214V. Clearly, other variants may be contemplated within
the scope of the present invention. Furthermore, wherever HBM is
recited in the methods of the invention, it should be understood
that any such alternative variant of LRP which demonstrates HBM
biological activity is also encompassed by those claims.
[0445] 17. Screening Assays
[0446] The two-hybrid system is extremely useful for studying
protein:protein interactions. See, e.g., Chien et al., Proc. Natl
Acad. Sci. USA 88:9578-82 (1991); Fields et al., Trends Genetics
10:286-92 (1994); Harper et al., Cell 75:805-16 (1993); Vojtek et
al., Cell 74:205-14 (1993); Luban et al., Cell 73:1067-78 (1993);
Li et al., FASEB J. 7:957-63 (1993); Zang et al., Nature 364:308-13
(1993); Golemis et al., Mol. Cell. Biol. 12:3006-14 (1992); Sato et
al., Proc. Natl Acad. Sci. USA 91:9238-42 (1994); Coghlan et al.;
Science 267:108-111 (1995); Kalpana et al., Science 266:2002-6
(1994); Helps et al., FEBS Lett. 340:93-8 (1994); Yeung et al.,
Genes & Devel. 8:2087-9 (1994); Durfee et al., Genes &
Devel. 7:555-569 (1993); Paetkau et al., Genes & Devel.
8:2035-45; Spaargaren et al., 1994 Proc. Natl. Acad. Sci. USA
91:12609-13 (1994); Ye et al., Proc. Natl Acad. Sci. USA
91:12629-33 (1994); and U.S. Pat. Nos. 5,989,808; 6,251,602; and
6,284,519.
[0447] Variations of the system are available for screening yeast
phagemid (see, e.g., Harper, Cellular Interactions and Development:
A Practical Approach, 153-179 (1993); Elledge et al., Proc. Natl
Acad. Sci. USA 88:1731-5 (1991)) or plasmid (Bartel, 1993 and
Bartel, Cell 14:920-4 (1993)); Finley et al., Proc. Natl Acad. Sci.
USA 91:12980-4 (1994)) cDNA libraries to clone interacting
proteins, as well as for studying known protein pairs.
[0448] The success of the two-hybrid system relies upon the fact
that the DNA binding and polymerase activation domains of many
transcription factors, such as GAL4, can be separated and then
rejoined to restore functionality (Morin et al., Nuc. Acids Res.
21:2157-63 (1993)). While these examples describe two-hybrid
screens in the yeast system, it is understood that a two-hybrid
screen may be conducted in other systems such as mammalian cell
lines. The invention is therefore not limited to the use of a yeast
two-hybrid system, but encompasses such alternative systems.
[0449] Yeast strains with integrated copies of various reporter
gene cassettes, such as for example GAL.fwdarw.LacZ,
GAL.fwdarw.HIS3 or GAL.fwdarw.URA3 (Bartel, in Cellular
Interactions and Development: A Practical Approach, 153-179 (1993);
Harper et al., Cell 75:805-16 (1993); Fields et al., Trends
Genetics 10:286-92 (1994)) are co-transformed with two plasmids,
each expressing a different fusion protein. One plasmid encodes a
fusion between protein "X" and the DNA binding domain of, for
example, the GAL4 yeast transcription activator (Brent et al., Cell
43:729-36 (1985); Ma et al., Cell 48:847-53 (1987); Keegan et al.,
Science 231:699-704 (1986)), while the other plasmid encodes a
fusion between protein "Y" and the RNA polymerase activation domain
of GAL4 (Keegan et al., 1986). The plasmids are transformed into a
strain of the yeast that contains a reporter gene, such as lacZ,
whose regulatory region contains GAL4 binding sites. If proteins X
and Y interact, they reconstitute a functional GAL4 transcription
activator protein by bringing the two GAL4 components into
sufficient proximity to activate transcription. It is well
understood that the role of bait and prey proteins may be
alternatively switched and thus the embodiments of this invention
contemplate and encompass both alternative arrangements.
[0450] Either hybrid protein alone must be unable to activate
transcription of the reporter gene, the DNA-binding domain hybrid,
because it does not provide an activation function, and the
activation domain hybrid, because it cannot localize to the GAL4
binding sites. Interaction of the two test proteins reconstitutes
the function of GAL4 and results in expression of the reporter
gene. The reporter gene cassettes consist of minimal promoters that
contain the GAL4 DNA recognition site (Johnson et al., Mol. Cell.
Biol. 4:1440-8 (1984); Lorch et a., J. Mol. Biol. 186:821-824
(1984)) cloned 5' to their TATA box. Transcription activation is
scored by measuring either the expression of .beta.-galactosidase
or the growth of the transformants on minimal medium lacking the
specific nutrient that permits auxotrophic selection for the
transcription product, e.g., URA3 (uracil selection) or HIS3
(histidine selection). See, e.g., Bartel, 1993; Durfee et al.,
Genes & Devel. 7:555-569 (1993); Fields et al., Trends Genet.
10:286-292 (1994); and U.S. Pat. No. 5,283,173.
[0451] Generally, these methods include two proteins to be tested
for interaction which are expressed as hybrids in the nucleus of a
yeast cell. One of the proteins is fused to the DNA-binding domain
(DBD) of a transcription factor and the other is fused to a
transcription activation domain (AD). If the proteins interact,
they reconstitute a functional transcription factor that activates
one or more reporter genes that contain binding sites for the DBD.
Exemplary two-hybrid assays which have been used for Dkk-1 or
Dkk-1/LRP5 are presented in the Examples below.
[0452] Additional methods of preparing two hybrid assay systems for
Dkk-1 interactors would be evident to one of ordinary skill in the
art. See for example, Finley et al., "Two-Hybrid Analysis of
Genetic Regulatory Networks," in The Yeast Two-Hybrid System (Paul
L. Bartel et al., eds., Oxford, 1997); Meijia Yang, "Use of a
Combinatorial Peptide Library in the Two-Hybrid Assay," in The
Yeast Two-Hybrid System (Paul L. Bartel et al., eds., Oxford,
1997); Gietz et a., "Identification of proteins that interact with
a protein of interest: Applications of the yeast two-hybrid
system," Mol. & Cell. Biochem. 172:67-9 (1997); K. H. Young,
"Yeast Two-Hybrid: So Many Interactions,(in) so Little Time," Biol.
Reprod. 58:302-311 (1998); R. Brent et al., "Understanding Gene and
Allele Function with Two-Hybrid Methods," Annu. Rev. Genet
31:663-704 (1997). It will be appreciated that protein networks can
be elucidated by performing sequential screens of activation
domain-fusion libraries.
[0453] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
EXAMPLES
[0454] The present invention is described by reference to the
following Examples, which are offered by way of illustration and
are not intended to limit the invention in any manner. Standard
techniques well-known in the art or the techniques specifically
described below were utilized.
[0455] For routine practice of the protocols referenced below, one
of skill in the art is directed to the references cited in this
application as well as the several Current Protocol guides, which
are continuously updated, widely available and published by John
Wiley and Sons, (New York). In the life sciences, Current Protocols
publishes comprehensive manuals in Molecular Biology, Immunology,
Human Genetics, Protein Science, Cytometry, Neuroscience,
Pharmacology, Cell Biology, Toxicology, and Nucleic Acid Chemistry.
Additional sources are known to one of skill in the art.
Example 1
Yeast Two Hybrid Screen Using LRP5 Ligand Binding Domain (LBD) Bait
Sequences
[0456] In a screen against human osteoblast library (i.e., HOB03C5,
a custom Gibco generated Y2H compatible cDNA library from a human
osteoblast cell line as described by Bodine and Komm, Bone
25:535-43 (1999)), an interaction with Dkk-1 was identified. The
LRP5 ligand binding domain (LBD) baits used for this screen are
depicted in FIGS. 2B and C. The basic protocol is as follows:
[0457] An overnight culture of the yeast strain containing the bait
of interest is grown in 20 ml of appropriate selective medium
containing 2% glucose at 30.degree. C. The overnight culture is
diluted by a 10 fold factor into YPDmedia supplemented with 40 mg/l
of adenine, and grown for 4 hours at 30.degree. C.
[0458] For each mating event, an aliquot of the frozen prey library
is grown in 150 ml YAPD medium for 5 hours at 30.degree. C.
[0459] Appropriate volumes calculated by measuring the OD600 of
each culture are combined into a tube. The number of diploids to be
screened is typically ten times the number of clones originally
present in the prey library of interest. Assuming a mating
efficiency of 20% minimum, fifty times (i.e., ten times coverage
multiplied by 20% mating efficiency) as many haploid cells
containing the bait and as many cells containing the prey are used
in any given mating event. The mixture is filtered over a 47 mm,
0.45 mm sterile Metricel filter membrane (Gelman).
[0460] Using sterile forceps, the filter is transferred onto a 100
mm.sup.2 YAPD agar plate with the cell side up, removing all air
bubbles underneath the filter. The plate is incubated overnight at
room temperature.
[0461] The filter is transferred into a 50 ml Falcon tube using
sterile forceps and 10 ml SD medium containing 2% glucose are added
to resuspend the cells. The filter, once free of cells, is removed
and the cell suspension is spun for 5 min. at 2,000 xg.
[0462] The cells are resuspended in 10 ml SD medium containing 2%
glucose. An aliquot of 100 .mu.l is set aside for titration.
[0463] The cells are plated onto large square plates containing
appropriate selective media and incubated at 30.degree. C. for
three to five days.
[0464] To calculate the mating efficiency and to determine the
total number of diploid cells screened, the 100 .mu.l aliquot set
aside for titration is diluted and plated onto different selective
media. The mating efficiency is calculated by dividing the number
of diploids/ml by the lowest number of haploids/ml, either bait or
prey, and multiplied by 100. For example, if 2 million diploids
were obtained by mating 10 million of haploids containing a bait
and 12 million of haploids containing a prey, then the mating
efficiency is calculated by dividing 2 million by 10 million, which
equals 0.2 and multiplied by 100 which equals 20%. Typical mating
efficiencies under the above conditions are within about 20 to
about 40%. The total number of diploids screened in a mating event
is obtained by multiplying the number of diploids/ml by the total
number of ml plated, typically about 10.
[0465] Isolation of Colonies Containing Pairs of Interacting
Proteins
[0466] Yeast colonies from the interaction selection (large square)
plates are picked with a sterile toothpick and patched onto plates
containing the appropriate selective media and incubated at
30.degree. C. for two days.
[0467] To further ensure purity of the yeast, the plates are
replicated onto another plate containing the same media and
incubated at 30.degree. C. for another two days.
[0468] Yeast patches are scraped using a sterile toothpick and
placed into a 96-well format plate containing 100 .mu.l SD-L-W-H
with 2% glucose liquid medium.
[0469] Half the volume of the plate is transferred to a 96-well
plate containing 50 .mu.l of 40% glycerol for storage. The other
half is set aside for replication and galactosidase-activity assay
(see below).
[0470] Cells are replicated onto a SD-L-W-H plate with 2% glucose
plate to create a master plate, and incubated two days at
30.degree. C. The master plate is replicated onto different
selective media to score the strength of each interaction.
[0471] Cells are also replicated onto media selecting for the prey
vector only for colony PCR and incubated two days at 30.degree.
C.
[0472] Galactosidase Activity Assay
[0473] Ten microliters from the 96-well plate (set aside from
above) are transferred into another 96-well plate containing 100
.mu.l SD and 2% glucose media. The cell density is measured at
OD.sub.600 using a spectrophotometer, the OD.sub.600 is usually
between 0.03 and 0.1. Fifty microliters of Galactosidase reaction
mixture (Tropix) are added to microplates (Marsh) specifically
designed for the luminometer (Hewlett Packard Lumicount). Fifty
microliters of the diluted cells are then added and mixed by
pipetting. The reaction is incubated sixty to one hundred twenty
minutes at room temperature. Relative Light Units (RLUs) are read
by the luminometer. Each plate contains a negative control,
constituted by diploid yeast containing the bait of interest and an
empty prey vector. To be scored as positive, the diploids tested
have to have an RLU number at least twice as high as the negative
control.
Example 2
Minimum Interaction Domain Mapping
[0474] Further analysis of yeast two hybrid (Y2H) interacting
proteins includes the dissection of protein motifs responsible for
the interaction. Sequence alignment of multiple clones identified
in the Y2H screens can help identify the smallest common region
responsible for the interaction. In the absence of appropriate
clones, deletion mapping of interacting domains is necessary.
[0475] PCR primers containing restriction sites suitable for
cloning are designed to cover multiple sub-domains of the protein
of interest (bait or prey). The methods involved in cloning,
sequencing, yeast transformation, mating, and scoring of
interactions are readily performed by one of ordinary skill in the
art of molecular biology and genetic engineering.
[0476] Materials and Methods
[0477] Minimum interaction domain: primers were designed for PCR of
the Dkk-1 clone isolated by screening a primary osteoblast cell
strain (HOB03C5) library with pooled Zmax1/LRP5 ligand binding
domain (LBD) baits: LBD1 (Leu969-Pro1376) and LBD4
(Arg1070-Pro1376). The primers, which are presented in 5' to 3'
orientation, were as follows:
4 SEQ ID NO Primer Sequence 155 Forward 1
TTTTTTGTCGACCAATTCCAACGCTATCAAG 156 Forward 2
TTTTTTGTCGACCTGCGCTAGTCCCACCCGC 157 Forward 3
TTTTTTGTCGACCGTGTCTTCTGATCAAAATC 158 Forward 4
TTTTTTGTCGACCGGACAAGAAGGTTCTGTTTG 159 Reverse 1
TTTTTTGCGGCCGCTTATTTGGTGTGATACATTTTTG 160 Reverse 2
TTTTTTGCGGCCGCTTAGCAAGACAGACCTTCTCC 161 Reverse 3
TTTTTTGCGGCCGCTTAGTGTCTCTGACAAGTGTG
[0478] PCR was performed using PfuTurbo.RTM. polymerase
(Stratagene). The PCR products were gel purified, digested with
SalI/NotI and ligated to pPC86 (Gibco/BRL) which had been
linearized with SalI/NotI. Clones were recovered and sequenced to
ascertain that the structure was as expected and that the Gal4
activation domain and Dkk-1 were in-frame. The ORF of Dkk-1 was
Metl-His266, as in human Dkk-1 (GenBank Accession No.
XM.sub.--005730).
[0479] The clones used were as follows: D5 (F1/R3: Asn34-His266),
D4 (F1/R2: Asn34-Cys245), D3 (F1/R1: Asn34-Lys182), D9 (F2/R3:
Cys97-His266), D12 (F3/R3, val 139-His266), D14 (F4/R3:
Gly183-His266), D8 (F2/R2: Cys97-Cys245), and D11 (F3/R2:
Val39-Cys245). F1, F2, F3 and F4 refer respectively to Forward
primers 1, 2, 3 and 4. R1, R2 and R3 refer respectively to reverse
primers 1, 2 and 3.
[0480] These clones were transformed into yeast and mated with each
of three yeast strains containing pDBleu (Gibco/BRL), pDBleuLBD1,
and pDBleuLBD4. Positive interactions were detected by growth of
the hybrids on appropriate selective media.
[0481] Results
[0482] Minimum interaction domain: FIG. 6 shows that while growth
was observed in diploids of D4, D5, D8, D9, and D12, no growth was
observed in hybrids of D3, D11, and D12. Carboxy terminal
(C-terminal) deletions indicated that while the C-terminal amino
acids of Dkk-1 containing the potential N-glycosylation site
(Arg246-His266) are not required for interaction with Zmax1/LRP5
LBD baits, the Cys2 domain, Gly183-Cys245, is required. N-terminal
deletions also demonstrated that the region between the two
cysteine domains, i.e. Val139 to Lys182, is also required. Two
minimum interaction domain constructs were isolated: D12
(Val139-His266) and D8 (Cys97-Cys245). Similar constructs could be
prepared for Dkk-1 interactors.
Example 3
Yeast-2 Hybrid Screen for Peptide Aptamer Sequences to Dkk-1
Peptide Aptamer Library Construction
[0483] A peptide aptamer library, Tpep, was constructed, which
provides a means to identify chimeric proteins that bind to a
protein target (or bait) of interest using classic yeast two hybrid
(Y2H) assays. The Tpep library is a combinatorial aptamer library
composed of constrained random peptides, expressed within the
context of the disulfide loop of E. coli thioredoxin (trxA), and as
C-termini fusion to the S. cerevisiae Gal4 activation domain. The
Tpep library was generated using a restriction enzyme modified
recombinant Y2H prey vector, pPC86 (Gibco), which contains the trxA
scaffold protein.
[0484] Generation of Aptamer-Encoding Sequences
[0485] Aptamer-encoding sequences were produced as follows. DNA
encoding random stretches of approximately sixteen amino acids
surrounded by appropriate restriction sites were generated by
semi-random oligonucleotide synthesis. The synthetic
oligonucleotides were PCR-amplified, restriction digested, and
cloned into the permissive sites within the trxA scaffold protein.
The cloning strategy was to insert the random oligonucleotide
sequence is in-frame with the scaffold protein coding sequence,
resulting in expression of a scaffold protein-aptamer chimera. The
scaffold protein is itself in-frame with the activation domain of
Gal4, within the pPC86 vector that is appropriate for the aptamer
to be expressed and functional in a regular Y2H assay. Additional
methods of preparing aptamers would be apparent to the skilled
artisan.
[0486] Generation of a Permissive Recombinant pPC86 Vector
Containing the trxA Coding Sequence
[0487] First the RsrII restriction site located within the Gal4
activation domain of pPC86 (Gibco) was eliminated by site-directed
mutagenesis (Quickchange.TM. kit, Stratagene). The amino acid
sequence of the Gal4 activation domain was unchanged by this
modification. The strength of different control interactions was
verified to be unchanged by the modification.
[0488] Second, the E. coli trxA coding sequence was cloned into the
SalI and NotI sites of the RstII-modified pPC86. EcoRI and SpeI
sites were then introduced within the trxA RsrII site. The
oligonucleotides encoding the peptide aptamers were cloned into the
EcoRI and SpeI sites of the resulting vector.
Example 4
Yeast-2 Hybrid Screen for Dkk-1 Interacting Proteins
[0489] A Dkk-1 bait sequence was utilized in a yeast two hybrid
screen to identify Dkk-1 interacting proteins. The procedure for
the Y2H was carried out similarly to that employed in Example 1,
except that the Dkk-1 bait from FIG. 2C was used instead of LRP
baits. The screen was performed using Hela and fetal brain
libraries (Invitrogen Corporation, Carlsbad, Calif.). Multiple
libraries were used to identify additional Dkk-1 interacting
proteins and to confirm interactions found in other libraries.
[0490] The list of Dkk-1 interacting proteins uncovered in these
Y2H screens are listed in FIG. 5.
[0491] The interacting proteins identified in the Dkk-1 bait screen
can be used in other Y2H screens with LRP baits and other Dkk-1
interacting proteins to determine more complex interactions which
may modulate Dkk-1/LRP interactions and/or Wnt signaling.
Example 5
Generation of Antibodies
[0492] In each of the following antibody-generating examples, the
synthesis of these linear peptides is followed by injection into
two New Zealand Rabbits. Subsequent boosts and bleeds are taken
according to a standard ten-week protocol. The end-user receives
back 5 mgs of peptide, aliquots of pre-bleeds, roughly 80 ml of
crude sera from each of the two rabbits and, and ELISA titration
data is obtained.
[0493] Generation of LRP5 Polymorphism-Specific Antibodies
[0494] Antibodies were generated to the following peptides to
obtain antibodies which distinguish the HBM polymorphism versus
wild-type LRP5/Zmax: MYWTDWVETPRIE (SEQ ID NO:123) (mutant peptide)
and MYWTDWGETPRIE (SEQ ID NO:124) (wild-type peptide for negative
selection). Immunofluorescence data confirmed that the antibody,
after affinity purification, is specific for HBM and does not
recognize LRP5 (FIG. 17).
[0495] Generation of LRP5 Monospecific Antibodies
[0496] LRP5 monospecific polyclonal antibodies were generated to
the following amino acid sequences of LRP5: Peptide 1 (a.a.
265-277)--KRTGGKRKEILSA (SEQ ID NO:125), Peptide 2 (a.a.
1178-1194)--ERVEKTTGDKRTRIQGR (SEQ ID NO:126), and Peptide 3 (a.a.
1352-1375)--KQQCDSFPDCIDGSDE (SEQ ID NO:127). Immunofluorescence
confirmed that the antibody generated detects LRP5.
[0497] Generation of Dkk-1 Monospecific Polyclonal Antibodies
[0498] Dkk-1 monospecific polyclonal antibodies were generated to
the following amino acid sequences of Dkk-1: Peptide 1 (a.a.
71-85)--GNKYQTIDNYQPYPC (SEQ ID NO:118), Peptide 2 (a.a.
165-186)--LDGYSRRTTLSSKMYHTKGQEG (SEQ ID NO:119), Peptide 3 (a.a.
246-266)--RIQKDHHQASNSSRLHTCQRH (SEQ ID NO:120), Peptide 4 (a.a.
147-161)--RGEIEETITESFGND (SEQ ID NO:121), and Peptide 5
(232-250)--EIFQRCYCGEGLSCRIQKD (SEQ ID NO:122) of human Dkk-1. FIG.
26 shows the location of the various peptides selected, their
relationship to the Dkk-1 amino acid sequence and polyclonal
antibodies generated.
[0499] Western blots demonstrated that the antibodies generated
against peptides 2 (Antibody #5521) (FIG. 27) and 4 (Antibody
#74397) (FIG. 28) are specific toward Dkk-1. FIG. 27 shows Western
blots using 500 .mu.l of conditioned medium (CM) from
non-transfected 293 cells or from 293 cells transfected with Dkk1
-V5 that were immunoprecipitated by anti-V5 antibody. Bead elutes
were separated by non-reducing SDS-PAGE (lanes #4, 5 of FIG. 27).
20 .mu.l of conditioned medium from both samples (lanes #2, 3 of
FIG. 27) and from Dkk1-AP transfected 293 cells (lane #6 of FIG.
27) were additionally separated on the gel. The Western was
performed using antibodies Anti-V5/AP (1:10,000) and Ab#5521 (10
.mu.g/ml). Ab#5521 detected Dkk1-V5 and Dkk1-AP from conditioned
medium.
[0500] FIG. 28 shows Western blot results using Ab#74397.
Anti-V5/AP was tested at a 1:4000 dilution and Ab#74397 was tested
at a 1:500 dilution. Ab#74397 was able to detect Dkk1-V5 in both
conditioned medium and immunoprecipitated conditioned medium.
[0501] The results obtained with antibodies #5521 and #74397 are
summarized in the following table:
5 Rabbit Peptide Peptide Purified Immuno- No. Position Sequence
(Y/N) Western precipitation Location 5521 165-186 LDGYSR Y (Protein
Y N/A Between RTTLSSK G Cy1 and MYHTKG purified) Cys2 QEG domain
74397 147-161 RGEIEETI N Y N/A Between TESFGN Cyl and D Cys2
domain
Example 6
Effects of Exogenous Dkk-1 on Wnt-Mediated Signaling in the Xenopus
Embryo Assay
[0502] Xenopus embryos are an informative and well-established in
vivo assay system to evaluate the modulation of Wnt signaling
(McMahon et al., Cell 58: 1075-84 (1989); Smith and Harland, 1991;
reviewed in Wodarz and Nusse 1998).
[0503] Modification of the Wnt signaling pathway can be visualized
by examining the embryos for a dorsalization phenotype (duplicated
body axis) after RNA injection into the ventral blastomere at the
4- or 8-cell stage. On the molecular level, phenotypes can be
analyzed by looking for expression of various marker genes in stage
10.5 embryos. Such markers would include general endoderm,
mesoderm, and ectoderm markers as well as a variety of
tissue-specific transcripts.
[0504] Analysis can be done by RT-PCR/TaqMan.RTM. and can be done
on whole embryo tissue or in a more restricted fashion
(microdissection). Because this system is very flexible and rapid,
by injecting combinations of transcripts, such as HBM and different
Wnts or Wnt antagonists, the mechanism of HBM in the Wnt pathwaycan
thereby be dissected. Furthermore, investigations are conducted to
determine whether Zmax/LRP5 and HBM differentially modulate Wnt
signaling either alone, or in combination with other components.
Previous studies have demonstrated that LRP6 alone or LRP5+Wnt5a
were able to induce axis duplication (dorsalization) in this system
(Tamai et al., Nature 407: 530-35 (2000)).
[0505] Constructs for Xenopus Expression (Vector pCS2.sup.+)
[0506] Constructs were prepared using the vector pCS2.sup.+. DNA
inserts were subcloned in the sense orientation with respect to the
vector SP6 promoter. The pCS2.sup.+ vector contains an SV40 virus
polyadenylation signal and T3 promoter sequence (for generation of
antisense mRNA) downstream of the insert.
[0507] Full length Zmax/LRP5 and HBM ORF cDNA: Insert cDNA was
isolated from the full length cDNA retrovirus constructs (with
optimized Kozak sequences) by BglII-EcoRI digestion and subcloned
into the BamHI-EcoRI sites of the pCS2.sup.+ vector.
[0508] Full length XWnt8: This cDNA was PCR amplified from a
Xenopus embryo cDNA library using oligos 114484 (SEQ ID NO:162)
(5'-CAGTGAATTCACCATGCAAAACACCACTTTGTTC-3') and 114487 (SEQ ID
NO:163) (5'-CAGTTGCGGCCGCTCATCTCCGGTGGCCTCTG-3'). The oligos were
designed to amplify the ORF with a consensus Kozak sequence at the
5' end as determined from GenBank #X57234. PCR was carried out
using the following conditions: 96.degree. C., 45 sec.; 63.degree.
C., 45 sec.; 72.degree. C., 2 min. for 30 cycles. The resulting PCR
product was purified, subcloned into pCRII-TOPO (Invitrogen Corp.),
sequence verified, and digested with BamHI/Xhol. This insert was
subcloned into the vector at the BamHI-Xhol sites.
[0509] Full length Wnt5a: A murine Wnt5a cDNA clone was purchased
from Upstate Biotechnology (Lake Placid, N.Y.) and subcloned into
the EcoRI site of the vector. Sequencing confirmed insert
orientation.
[0510] Full length human Dkk-1: A human cDNA with GenBank accession
number AF127563 was available in the public database. Using this
sequence, PCR primers were designed to amplify the open reading
frame with a consensus Kozak sequence immediately upstream of the
initiating ATG. Oligos 117162 (SEQ ID NO:164)
(5'-CAATAGTCGACGAATTCACCATGGCTCTGGGCGCAGCGG-3') and 117163 (SEQ ID
NO:165) (5'-GTATTGCGGCCGCTCTAGATTAGTGTCTCTGACAAGTGTGAA-3') were
used to screen a human uterus cDNA library by PCR. The resulting
PCR product was purified, subcloned into pCRII-TOPO (Invitrogen
Corp.), sequence verified, and digested with EcoRI/Xhol. This
insert was subcloned into the pCS2.sup.+ vector at the EcoRI-Xhol
sites.
[0511] Full length human Dkk-2: A full length cDNA encoding human
Dkk-2 was isolated to investigate the specificity of the
Zmax/LRP5/HBM interaction with the Dkk family of molecules. Dkk-1
was identified in yeast as a potential binding partner of
Zmax/LRP5/HBM. Dkk-1 has also been shown in the literature to be an
antagonist of the Wnt signaling pathway, while Dkk-2 is not
(Krupnik et a., 1999). The Dkk-2 full length cDNA serves as a tool
to discriminate the specificity and biological significance of
Zmax/LRP5/HBM interactions with the Dkk family (e.g., Dkk-1, Dkk-2,
Dkk-3, Dkk-4, Soggy, their homologs and variant, etc.). A human
cDNA sequence for Dkk-2 (GenBank Accession No. NM.sub.--014421) was
available in the public database. Using this sequence, PCR primers
were designed to amplify the open reading frame with a consensus
Kozak sequence immediately upstream of the initiating ATG. Oligos
51409 (SEQ ID NO:166) (5'-CTAACGGATCCACCATGGCCGCGTTGATGCGG-3') and
51411 (SEQ ID NO:167) (5'-GATTCGAATTCTCAAATTTTCTGACACACATGG-3')
were used to screen human embryo and brain cDNA libraries by PCR.
The resulting PCR product was purified, subcloned into pCRII-TOPO,
sequence verified, and digested with BamHI/EcoRI. This insert was
subcloned into the pCS2.sup.+vector at the BamHI-EcoRI sites.
[0512] Full length LRP6 was isolated from the pED6dpc4 vector by
XhoI-XbaI digestion. The full length cDNA was reassembled into the
XhoI-XbaI sites of pCS2.sup.+. Insert orientation was confirmed by
DNA sequencing.
[0513] mRNA Synthesis and Microinjection Protocol
[0514] mRNA for microinjection into Xenopus embryos is generated by
in vitro transcription using the cDNA constructs in the pCS2.sup.+
vector described above as template. RNA is synthesized using the
Ambion mMessage mMachine high yield capped RNA transcription kit
(Cat. #1340) following the manufacturer's specifications for the
Sp6 polymerase reactions. RNA products were brought up to a final
volume of 50 .mu.l in sterile, glass-distilled water and purified
over Quick Spin Columns for Radiolabelled RNA Purification
G50-Sephadex (Roche, Cat. #1274015) following the manufacturer's
specifications. The resulting eluate was finally extracted with
phenol:chloroform:isoamyl alcohol and isopropanol precipitated
using standard protocols (Sambrook et al., 1989). Final RNA volumes
were approximately 50 .mu.l. RNA concentration was determined by
absorbance values at 260 nm and 280 nm. RNA integrity was
visualized by ethidium bromide staining of denaturing
(formaldehyde) agarose gel electrophoresis (Sambrook et al., 1989).
Various amounts of RNA (2 pg to 1 ng) are injected into the ventral
blastomere of the 4- or 8-cell Xenopus embryo. These protocols are
described in Moon et al., Technique-J. of Methods in Cell and Mol.
Biol. 1: 76-89 (1989), and Peng, Meth. Cell. Biol. 36: 657-62
(1991).
[0515] Screening for Duplicated Body Axis
[0516] In vitro transcribed RNA is purified and injected into a
ventral blasomere of the 4- or 8-cell Xenopus embryo (approx. 2
hours post-fertilization). At stage 10.5 (approx. 11 hours
post-fertilization), the injected embryos are cultured for a total
of 72 hours and then screened for the presence of a duplicated body
axis (dorsalization) (FIG. 7). Using XWnt8-injected (2-10 pg) as a
positive control (Christian et al. (1991)) and water-injected or
non-injected embryos as negative controls, we replicated the
published observation that Zmax(LRP5)+Wnt5a (500 and 20 pg,
respectively) could induce axis duplication. Wnt5a (20 pg) alone
could not induce axis duplication (as previously reported by Moon
et al. (1993)). We have also injected GFP RNA (100-770 pg) as a
negative control to show that the amount of RNA injected is not
perturbing embryo development (not shown). Strikingly, HBM+Wnt5a
(500 and 20 pg, respectively) yielded an approximately 3.5 fold
more robust response of the phenotype (p=0.043 by Fisher's exact
test) compared to Zmax(LRP5)+Wnt5a, suggesting that the HBM
mutation is activating the Wnt pathway (FIGS. 8 and 9). The
HBM/Wnt5a embryos also appear to be more "anteriorized" than the
Zmax(LRP5)/Wnt5a embryos, again suggestive of a gain-of-function
mutation.
[0517] The role of Dkk-1 as a modulator of Zmax/LRP5- and
HBM-mediated Wnt signaling was investigated. Literature reports
have previously characterized Xenopus and murine Dkk-1 as
antagonists of the canonical Wnt pathway in the Xenopus system
(Glinka et al., Nature 391:357-362 (1998)). Using the human Dkk-1
construct, a dose-response assay was performed to confirm that our
construct was functional and to identify the optimal amount of RNA
for microinjection. Using 250 pg/embryo of hDkk-1 RNA, over 90%
(p<0.001) of the embryos were observed to display enlarged
anterior structures (big heads) as anticipated from the published
reports (FIG. 10).
[0518] The mechanism of hDkk-1 modulation of Wnt signaling in the
presence of Zmax/LRP5 or HBM was also investigated. Without any
hDkk-1 present, it was confirmed that HBM+Wnt5a was a more potent
activator of Wnt signaling than Zmax/LRP5+Wnt5a (p<0.05).
Interestingly, in the presence of hDkk-1 (250 pg),
Zmax/LRP5-mediated Wnt signaling was repressed (p<0.05) but
hDkk-1 was unable to repress HBM-mediated Wnt signaling (p<0.01)
(FIG. 11). The specificity of this observation can be further
addressed by investigating other members of the Dkk family, other
Wnt genes, LRP6, additional Zmax/LRP5 mutants, and the peptide
aptamers.
Example 7
Effects of Exogenous Dkk and LRP5 on Wnt Signaling in the
TCF-Luciferase Assay
[0519] Wnt activity can be antagonized by many proteins including
secreted Frizzled related proteins (SFRPs), Cerberus, Wnt
Inhibitory Factor-1 and Dkk-1 (Krupnik et al., 1999). The Dkk
family of proteins consists of Dkk-14 and Soggy, a Dkk-3-like
protein. Dkk-1 and Dkk4 have been shown to antagonize Wnt mediated
Xenopus embryo development, whereas Dkk-2, Dkk-3, and Soggy do not.
Unlike many of these proteins that antagonize Wnt activity by
directly interacting with Wnt proteins, Dkk-1 acts by binding to
two recently identified Wnt coreceptors, LRP5 and LRP6. (Mao et
al., 2001; Bafico et al., 2001). The details of this interaction
have been examined by the present inventors and Mao et al. using
deletion constructs of LRP6, which demonstrated that EGF repeats 3
and 4 are important for Dkk-1 interaction. Accordingly, the
activity of two Dkk proteins, Dkk-1 and Dkk-2, were investigated
with various Wnt members, LRP5, LRP6, and the mutant form of LRP5,
designated HBM. The present invention explores whether there is any
functional difference between LRP5 and HBM with regard to Dkk
action on Wnt mediated signaling. Various reagents were developed,
including Dkk-1 peptides, constrained LRP5 peptide aptamers,
constrained Dkk-1 peptide aptamers and polyclonal antibodies to
Dkk-1 (in Example 5 above) to identify factors that mimic HBM
mediated Wnt signaling.
[0520] Methods
[0521] Various LRP5 constrained peptides were developed.
Specifically, four peptides that interact with the LBD of LRP5
(FIG. 4 constructs OST259-262 in FIG. 12) and three peptides that
interact with the cytoplasmic domain of LRP5 (constructs
OST266-OST268 in FIG. 12). In addition two Dkk-1 peptides were
developed: constructs OST264 and OST265 in FIG. 12, corresponding
to Dkk-1 amino acids 139-266 and 96-245, containing the smallest
region of Dkk-1 that interacts with LRP5 (FIG. 6). The cDNA clones
encoding the LRP5 LBD interacting peptides and the Dkk-1 peptides
were subcloned into pcDNA3.1 with the addition of a Kozak and
signal sequence to target the peptide for secretion. The constructs
encoding the three peptides interacting with the cytoplasmic domain
of LRP5 were also subcloned into pcDNA3.1. However, these latter
constructs do not contain a signal sequence.
[0522] HOB-03-CE6 osteoblastic cells developed by Wyeth Ayerst
(Philadelphia, Pa.) were seeded into 24-well plates at 150,000
cells per well in 1 ml of the growth media (D-MEM/F12 phenol
red-free) containing 10% (v/v) heat-inactivated FBS, 1.times.
penicillin streptomycin, and 1.times. Glutamax-1, and incubated
overnight at 34.degree. C. The following day, the cells were
transfected using Lipofectamine 2000.RTM. (as described by the
manufacturer, Invitrogen) in OptiMEM (Invitrogen) with 0.35 .mu.g
/well of LRP5, HBM, or control plasmid DNA (empty vector pcDNA3.1)
and either Wnt1 or Wnt3a plasmid DNA. Similar experiments were
performed with LRP6 plasmid DNA (0.35 .mu.g/well) or a control
pEDdpc4 empty vector. Furthermore, each of these groups were then
divided into three groups, those receiving 0.35 .mu.g/well Dkk-1,
Dkk-2, or pcDNA3.1 control DNA. All wells were transfected with
0.025 .mu.g/well of CMV beta-galactosidase plasmid DNA and 0.35
.mu.g/well 16.times. TCF(AS)-luciferase reporter DNA (developed by
Ramesh Bhat, Wyeth-Ayerst (Philadelphia, Pa.)). After 4 hours of
incubation, the cells were rinsed and 1 ml of fresh growth media
was added to each well. The cells were cultured overnight at
34.degree. C., followed by a wash and a change of media. Cells were
cultured for an additional 18-24 hours at 37.degree. C. Cells were
then lysed with 50 .mu.l/well of 1.times. lysis buffer. The
extracts were assayed for beta-galactosidase activity (Galacto
Reaction Buffer Diluent & Light Emission Accelerator, Tropix)
using 5 .mu.l extract+50 .mu.l beta-galactosidase diluent and
luciferase activity (Luciferase Assay Reagent, Promega) using 20
.mu.l extract.
[0523] U2OS human osteosarcoma cells were also utilized. U2OS cells
(ATCC) were seeded into 96-well plates at 30,000 cells per well in
200 .mu.l of the growth media (McCoy's 5A) containing 10% (v/v)
heat-inactivated FBS, 1.times. penicillin streptomycin, and
1.times. Glutamax-1, and incubated overnight at 37.degree. C. The
following day, the media was replaced with OptiMEM (Invitroge) and
cells were transfected using Lipofectamine 2000.RTM. (as described
by the manufacturer, Invitrogen) with 0.005 .mu.g/well of LRP5,
HBM, LRP6 or contol plasmid DNA (empty vector pcDNA3.1) and either
Wnt1 (0.0025 .mu.g/well) or Wnt3a (0.0025 ug/well) plasmid DNA. In
addition, the 16x-(AS) TCF-TK-firefly-luciferase (Ramesh Bhat,
WHRI, Wyeth) and control TK-renilla luciferase (Promega Corp.) were
co-transfected at 0.3 ug/well and 0.06 ug/well respectively in all
experiments. Futhermore, each of these groups was then divided into
different groups, those receiving 0.05 ug/well Dkk-1, Dkk-2, Dkk3,
Dkk1 -Alkaline Phosphatase (AP), mutant Dkk-1 (C220A), Soggy or
pcDNA3.1 control DNA. In other experiments, cells were
co-transfected with 0.005 pg/well of LRP5, 0.0025 ug/well of Wnt1
or Wnt3a (using 0.0025 pg/well of a control pcDNA3.1) with
LRP5-interacting aptamers (0.05 ug/well). Cells were cultured for
an additional 18-20 hours at 37.degree. C. Culture medium was
removed. Cells were cultured for an additional 18-20 hours at
37.degree. C. Culture medium was removed. Cells were then lysed
with 100 .mu.l/well of 1.times. Passive Lysis Buffer (PLB) of Dual
Luciferase Reagent kit (DLR-kit-Promega Corp.) 20 .mu.l of the
lysates were combined with LARII reagent of DLR-kit and assayed for
TCF-firefly luciferase signal in Top Count (Packard) instrument.
After measuring the Firefly readings, 100 .mu.l of the "Stop and
Glo" reagent of DLR kit that contains a quencher and a substrate
for renilla luciferase was added into each well. Immediately the
renilla luciferase reading was measured using the Top Count
(Packard) Instrument. The ratios of the TCF-firefly luciferase to
control renilla readings were calculated for each well and the mean
ratio of triplicate or more wells was expressed in all data.
[0524] Results
[0525] The results of these experiments demonstrate that Dkk-1, in
the presence of Wnt1 and LRP5, significantly antagonized
TCF-luciferase activity (FIG. 14). In marked contrast, Dkk-1 had no
effect on HBM/Wnt1 mediated TCF-luciferase activity (FIG. 14). In
similar experiments, Dkk-1 was also able to antagonize LRP5/Wnt3a
but not HBM/Wnt3a mediated TCF-luciferase activity (FIG. 15). These
results indicate that the HBM mutation renders Dkk-1 inactive as an
antagonist of Wnt1 and Wnt3a signaling in HOB03CE6 osteoblastic
cells. In other experiments with Wnt1, Dkk-1 had no effect on LRP5
or HBM mediated TCF-luciferase activity (FIG. 14). In contrast,
with either LRP5 or HBM in the presence of Wnt3a, Dkk-2 was able to
antagonize the TCF-luciferase activity (FIG. 15). These latter
results indicate that the HBM mutation has no effect on Dkk-2
action in the presence of Wnt3a. Experiments were also performed
using the closely related LRP6 cDNA in HOB-03-CE6 cells. In these
experiments, LRP6/Wnt1 and LRP6/Wnt3a mediated TCF-luciferase were
regulated in the same manner as LRP5. Specifically, Dkk-1
antagonized LRP6/Wnt1 mediated TCF-luciferase activity, whereas
Dkk-2 had no effect (FIG. 14). However, similar to the action of
Dkk-2 with LRP5/Wnt3a, Dkk-2 was able to antagonize LRP6/Wnt3a
mediated TCF-luciferase activity (FIG. 15).
[0526] The results in the U2OS cells show a robust effect of the
OST262 LRP5 peptide aptamer activation of Wnt signaling in the
presence of Wnt3a (FIG. 16). These functional results are confirmed
by the results shown below in Example 11 using LRP5 peptide
aptamers in the Xenopus assay. Such results affirmatively
demonstrate that the effects of small molecules on LRP5/LRP6/HBM
signaling can be detected using the TCF-luciferase assay.
[0527] These data demonstrate that there is a functional difference
between LRP5 and HBM regarding the ability of Dkk-1 to antagonize
Wnt1 and Wnt3a signaling. These data and previous data showing that
Dkk-1 directly interacts with LRP5 suggests that the inability of
Dkk-1 to antagonize HBM/Wnt signaling may in part contribute to the
HBM phenotype. These experiments further demonstrate the ability to
test various molecules (e.g., small molecules, aptamers, peptides,
antibodies, LRP5 interacting proteins or Dkk-1 interacting
proteins, and the like) for a LRP5 ligand that mimics HBM mediated
Wnt signaling or factors that block Dkk-1 interaction with
LRP5.
Example 8
Yeast-2 Hybrid Interaction Trap
[0528] Small molecule inhibitors (or partial inhibitors) of the
Dkk-LRP interaction may be an excellent osteogenic therapeutic. One
way to investigate this important protein-protein interaction is
using Y2H techniques substantially as described above and as is
well known in the art. Regions of LRP5, such as LRP5 LBD, have been
found to functionally interact with Dkk. This interaction is
quantitated using a reporter element known in the art, e.g., LacZ
or luciferase, which is only activated when bait and prey interact.
The Y2H assay is used to screen for compounds which modulate the
LRP-Dkk interaction. Such a modulation would be visualized by a
reduction in reporter element activation signifying a weaker or
disrupted interaction, or by an enhancement of the reporter element
activation signifying a stronger interaction. Thus, the Y2H assay
can be used as a high-throughput screening technique to identify
compounds which disrupt or enhance Dkk interaction with
LRP5/LRP6/HBM, which may serve as potential therapeutics.
[0529] For example, the Interaction Trap methodology can be used as
follows. The LRP5 LBD, for example, was fused with LexA and Dkk-1
was fused with either Gal4-AD or B42. With the LRP5LBD-LexA bait
and the Gal4AD-Dkk prey, over a 20-fold activation of a lacZ
reporter (under the control of a single LexA operator) was detected
over the background. Using a Dkk-1 mutant (C220A) that is unable to
bind to LRP, the interaction was reduced in yeast, showing the
specificity of this interaction and system (FIG. 18). As a result,
small molecules may be identified that modulate this interaction
between LRP and Dkk.
Example 9
Cell-Based Functional High-Throughput Assay
[0530] To develop a high throughput assay, the TCF-luciferase assay
described in Example 7 was modified utilizing low level expression
of endogenous LRP5/6 in U2OS and HEK293 cells. However, HOB-03-CE6
cells and any other cells which show a differential response to Dkk
depending on whether LRP5, LRP6 or HBM are expressed. Using U2OS
(human osteosarcoma) and HEK293 (ATCC) cells, the TCF-luciferase
and tk-Renilla reporter element constructs were co-transfected
along with Wnt3a/l and Dkk. Wnt3a alone, by using endogenous
LRP5/6, was able to stimulate TCF reporter gene activation. When
Dkk, is co-transfected with Wnt3a/Wnt 1 and reporters (TCF-luci and
tk-Renilla), Dkk represses reporter element activity. In addition,
the TCF-luci signal is activated by Wnt3a/Wnt1 can be repressed by
the addition of Dkk-enriched conditioned media to the cells
containing Wnt3a/Wnt1 and reporters. The assay is further validated
by the lack of TCF-reporter inhibition by a point mutant construct
(C220A) of Dkk1.
[0531] The Dkk-mediated repression of the reporter is dependent
upon the concentration of transfected Dkk cDNA or on the amount of
Dkk-conditioned media added. In addition, the Dkk-mediated reporter
suppression can be altered by the co-transfection of LRP5, LRP6,
and HBM cDNAs in the U2OS or HEK293 cells. In general, U2OS cells
show greater sensitivity to Dkk-mediated reporter suppression than
that in HEK-293 cells. In U2OS cells, the transfection of
LRP5/LRP6/HBM cDNA leads to moderate activation of TCF-luci in the
absence of Wnt3a/Wnt1 transfection. This activation presumably
utilizes the endogenous Wnts present in U2OS cells. Under this
condition, Dkk1 can repress TCF-luci and shows a differential
signal between LRP5 and HBM. By co-transfecting Wnt3a/Wnt1, there
is a generalized increase in the TCF-luci signal in the assay.
Further, one can detect Dkk-mediated differential repression of the
reporter due to LRP5 and HBM cDNA expression as well as between
LRP5 and LRP6 cDNA. The repression is maximal with LRP6, moderate
with LRP5, and least with HBM cDNA expression. In addition, the
assay can detect the functional impact of the LRP5 interacting
peptide aptamers (FIG. 4), Dkk1 interacting aptamers and binding
domains of Dkk-1 (FIG. 6; OST264 and OST265 of FIGS. 12 and
13).
[0532] Using this system with a suppressed Wnt-TCF signal due to
the presence of both Dkk and Wnt3a, one can screen for compounds
that could alter Dkk modulation of Wnt signaling, by looking for
compounds that activate or the TCF-luciferase reporter, and thereby
relieve the Dkk-mediated repression of the Wnt pathway. Such
compounds identified may potentially serve as HBM-mimetics and be
useful, for example, as osteogenic therapeutics. Data generated
from this high throughput screen are demonstrated in FIGS. 19-21.
FIG. 19 shows that Dkk1 represses Wnt3a-mediated signaling in U2OS
bone cells. FIG. 20 demonstrates the functional differences between
LRP5, LRP6, and HBM. Dkk-1 represses LRP6 and LRP5 but has little
or no effect on HBM-generated Wnt1 signaling in U2OS cells. FIG. 21
demonstrates the differential effects of various Dkk family members
and modified Dkks, including Dkk-1, a mutated Dkk-1 (C220A),
Dkk-1-AP (modified with alkaline phosphatase), Dkk-3, and
Soggy.
Example 10
DKK/LRP5/6/HBM ELISA Assay
[0533] A further method to investigate Dkk binding to LRP is via
ELISA assay. Two possible permutations of this assay are
exemplified. LRP5 is immobilized to a solid surface, such as a
tissue culture plate well. One skilled in the art will recognize
that other supports such as a nylon or nitrocellulose membrane, a
silicon chip, a glass slide, beads, etc. can be utilized. In this
example, the form of LRP5 used is actually a fusion protein where
the extracellular domain of LRP5 is fused to the Fc portion of
human IgG. The LRP5-Fc fusion protein is produced in CHO cell
extracts from stable cell lines. The LRP5-Fc fusion protein is
immobilized on the solid surface via anti-human Fc antibody or by
Protein-A or Protein G-coated plates, for example. The plate is
then washed to remove any non-bound protein. Conditioned media
containing secreted Dkk protein or secreted Dkk-epitope tagged
protein (or purified Dkk or purified Dkk-epitope tagged protein) is
incubated in the wells and binding of Dkk to LRP is investigated
using antibodies to either Dkk or to an epitope tag. Dkk-V5 epitope
tagged protein would be detected using an alkaline phosphatase
tagged anti-V5 antibody.
[0534] Alternatively, the Dkk protein could be directly fused to a
detection marker, such as alkaline phosphatase. Here the detection
of the Dkk-LRP interaction can be directly investigated without
subsequent antibody-based experiments. The bound Dkk is detected in
an alkaline phosphatase assay. If the Dkk-alkaline phosphatase
fusion protein is bound to the immobilized LRP5, alkaline
phosphatase activity would be detected in a colorimetric readout.
As a result, one can assay the ability of small molecule compounds
to alter the binding of Dkk to LRP using this system. Compounds,
when added with Dkk (or epitope-tagged Dkk) to each well of the
plate, can be scored for their ability to modulate the interaction
between Dkk and LRP based on the signal intensity of bound Dkk
present in the well after a suitable incubation time and washing.
The assay can be calibrated by doing cold competition experiments
with unlabeled Dkk or with a second type of epitope-tagged Dkk. Any
small molecule that is able to modulate the Dkk-LRP interaction may
be a suitable therapeutic candidate, more preferably an osteogenic
therapeutic candidate.
Example 11
Functional Evaluation of Peptide Aptamers in Xenopus
[0535] The constrained peptide aptamers constructs OST258-263
(where 258 contains the signal sequence by itself and 263 contains
an irrelevant constrained peptide) (FIGS. 12 and 13) were used to
generate RNA substantially as described in Example 7, except the
vector was linearized by restriction endonuclease digestion and RNA
was generated using T7 RNA polymerase.
[0536] Aptamer RNA was injected at 250 pg per blastomere using the
protocol of Example 7. Wnt signaling was activated, as visualized
by embryo dorsalization (duplicated body axis) with aptamers 261
and, more strongly, 262. The results of this assay are shown in
FIGS. 22 and 23. These results suggest that aptamers 261 and 262
are able to activate Wnt signaling possibly by binding to the LBD
of LRP, thereby preventing the modulation of LRP-mediated signaling
by Dkk.
[0537] The aptamers of the present invention can serve as
HBM-mimetics. In the Xenopus system they are able to induce Wnt
signaling all by themselves. They may also serve as tools for
rational drug design by enhancing the understanding of how peptides
are able to interact with LRP and modulate Wnt signaling at the
specific amino acid level. Thus, one would be able to design small
molecules to mimic their effects as therapeutics. In addition, the
aptamers identified as positives in this assay may be used as
therapeutic molecules themselves.
Example 12
Homogenous Assay
[0538] An excellent method to investigate perturbations in
protein-protein interactions is via Fluorescence Resonance Energy
Transfer (FRET). FRET is a quantum mechanical process where a
fluorescent molecule, the donor, transfers energy to an acceptor
chromophore molecule which is in close proximity. This system has
been successfully used in the literature to characterize the
intermolecular interactions between LRP5 and Axin (Mao et al.,
Molec. Cell Biol. 7:801-809). There are many different fluorescent
tags available for such studies and there are several ways to
fluorescently tag the proteins of interest. For example, CFP (cyan
fluorescent protein) and YFP (yellow fluorescent protein) can be
used as donor and acceptor, respectively. Fusion proteins, with a
donor and an acceptor, can be engineered, expressed, and
purified.
[0539] For instance, purified LRP protein, or portions or domains
thereof, fused to CFP and purified Dkk protein, or portions or
domains thereof that interact with Dkk or LRP respectively, fused
to YFP can be generated and purified using standard approaches.
[0540] If LRP-CFP and Dkk-YFP are in close proximity, the transfer
of energy from CFP to YFP will result in a reduction of CFP
emission and an increase in YFP emission.
[0541] Energy is supplied with an excitation wavelength of 450 nm
and the energy transfer is recorded at emission wavelengths of 480
nm and 570 nm. The ratio of YFP emission to CFP emission provides a
guage for changes in the interaction between LRP and Dkk. This
system is amenable for screening small molecule compounds that may
alter the Dkk-LRP protein-protein interaction. Compounds that
disrupt the interaction would be identified by a decrease in the
ratio of YFP emission to CFP emission. Such compounds that modulate
the LRP-Dkk interaction would then be considered candidate HBM
mimetic molecules. Further characterization of the compounds can be
done using the TCF-luciferase or Xenopus embryo assays to elucidate
the effects of the compounds on Wnt signaling.
[0542] While the above example describes a cell-fee, solution-phase
assay using purified components, a similar cell-based assay could
also be performed. For example, LRP-CFP fusion protein can be
expressed in cells. The Dkk-YFP fusion protein then could be added
to the cells either as purified protein or as conditioned media.
The interaction of LRP and Dkk is then monitored as described
above.
[0543] All references cited herein are hereby incorporated by
reference in their entirety for all purposes. The following
applications are also incorporated by reference in their entirety
herein for all purposes: U.S. Application No. 60/290,071, filed May
11, 2001;
[0544] U.S. application Ser. No. 09/544,398, filed on Apr. 5, 2000;
U.S. application Ser. No. 09/543,771, filed Apr. 5, 2000;
09/578,900; U.S. application Ser. No. 09/229,319, filed Jan. 13,
1999; U.S. Provisional Application 60/071,449, filed Jan. 13, 1998;
and
[0545] International Application PCT/US00/16951, filed Jun. 21,
2000; International PCT Application entitled "HBM Variants That
Modulate Bone Mass and Lipid Levels," filed May 13, 2002; and
International PCT Application entitled "Transgenic Animal Model of
Bone Mass Modulation," filed May 13, 2002. Additionally, this
application claims priority to U.S. provisional applications
60/291,311, filed May 17, 2001; 60/353,058, filed Feb. 1, 2002; and
60/361,293, filed Mar. 4, 2002; the texts of which are herein
incorporated by reference in their entirety for all purposes.
Sequence CWU 0
0
* * * * *
References