U.S. patent application number 10/457304 was filed with the patent office on 2004-02-19 for compositions and methods for treatment of hepatitis c virus-associated diseases.
Invention is credited to Anderson, Kevin P., Dorr, F. Andrew, Hanecak, Ronnie C., Kwoh, T. Jesse, Nozaki, Chikateru.
Application Number | 20040033978 10/457304 |
Document ID | / |
Family ID | 26428490 |
Filed Date | 2004-02-19 |
United States Patent
Application |
20040033978 |
Kind Code |
A1 |
Anderson, Kevin P. ; et
al. |
February 19, 2004 |
Compositions and methods for treatment of Hepatitis C
virus-associated diseases
Abstract
Antisense oligonucleotides are provided which are complementary
to and hybridizable with at least a portion of HCV RNA and which
are capable of inhibiting the function of the HCV RNA. These
oligonucleotides can be administered to inhibit the activity of
Hepatitis C virus in vivo or in vitro. These compounds can be used
either prophylactically or therapeutically to reduce the severity
of diseases associated with Hepatitis C virus, and for diagnosis
and detection of HCV and HCV-associated diseases. Methods of using
these compounds are also disclosed.
Inventors: |
Anderson, Kevin P.;
(Carlsbad, CA) ; Hanecak, Ronnie C.; (San
Clemente, CA) ; Nozaki, Chikateru; (Kuamoto-shi,
JP) ; Dorr, F. Andrew; (Solana Beach, CA) ;
Kwoh, T. Jesse; (Carlsbad, CA) |
Correspondence
Address: |
Jane Massey Licata
Licata & Tyrrell P.C.
66 East Main Street
Marlton
NJ
08053
US
|
Family ID: |
26428490 |
Appl. No.: |
10/457304 |
Filed: |
June 9, 2003 |
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61P 31/12 20180101;
C12N 2310/315 20130101; C12N 2310/33 20130101; C12Q 1/707 20130101;
C07H 21/00 20130101; C12N 2770/24222 20130101; C12N 2310/3521
20130101; C12N 2310/3527 20130101; C12N 15/1131 20130101; C07K
14/005 20130101 |
Class at
Publication: |
514/44 ;
536/23.1 |
International
Class: |
A61K 048/00; C07H
021/02 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 10, 1993 |
WO |
PCT/JP93/01293 |
Claims
What is claimed is:
1. An oligonucleotide having the sequence of SEQ ID NO: 6, wherein
at least one adenosine nucleotide is replaced with a thymidine,
cytidine or guanosine nucleotide; at least one thymidine nucleotide
is replaced with an adenosine, cytidine or guanosine nucleotide; at
least one guanosine nucleotide is replaced with an adenosine,
thymidine or cytidine nucleotide or at least one cytidine
nucleotide is replaced with an adenosine, cytidine or guanosine
nucleotide.
2. An RNA compound between about 8 and 80 nucleobases in length
targeted to HCV genomic or messenger RNA, wherein said compound
specifically hybridizes with said HCV genomic or mRNA and inhibits
the expression of HCV.
3. The compound of claim 2 comprising between about 12 and 50
nucleobases in length.
4. The compound of claim 2 comprising between about 15 and 30
nucleobases in length.
5. The compound of claim 2, wherein said compound comprises SEQ ID
NO: 6.
6. The compound of claim 2, wherein said compound is double
stranded.
7. A double stranded RNA compound having SEQ ID NO: 6.
8. The compound of claim 7, wherein at least one adenosine
nucleotide is replaced with a thymidine, cytidine or guanosine
nucleotide; at least one uridine nucleotide is replaced with an
adenosine, cytidine or guanosine nucleotide; at least one guanosine
nucleotide is replaced with an adenosine, thymidine or cytidine
nucleotide or at least one cytidine nucleotide is replaced with an
adenosine, cytidine or guanosine nucleotide
Description
[0001] This application is a continuation-in-part of U.S. Ser. No.
______ (to be determined), filed Jun. 4, 2003, which is a
continuation-in-part of U.S. Ser. No. 09/853,409, filed May 11,
2001, which is a continuation-in-part of U.S. Ser. No. 09/690,936
filed Oct. 18, 2000, which is a continuation of U.S. Ser. No.
08/988,321, filed Dec. 10, 1997, now issued as U.S. Pat. No.
6,174,868, which is a continuation-in-part of U.S. Ser. No.
08/650,093, filed May 17, 1996, now issued as U.S. Pat. No.
6,391,542, which is a continuation-in-part of U.S. Ser. No.
08/452,841 filed May 30, 1995, now issued as U.S. Pat. No.
6,423,489, which in turn is a continuation-in-part of U.S. Ser. No.
08/397,220, filed Mar. 9, 1995, now issued as U.S. Pat. No.
6,284,458, which is the U.S. National Phase filing of
PCT/JP93/01293 filed Sep. 10, 1993, which is a continuation-in-part
of U.S. Ser. No. 07/945,289, filed Sep. 10, 1992, which is now
abandoned.
INTRODUCTION
FIELD OF THE INVENTION
[0002] This invention relates to the design and synthesis of
antisense oligonucleotides which can be administered to inhibit the
activity of Hepatitis C virus in vivo or in vitro and to prevent or
treat Hepatitis C virus-associated disease. These compounds can be
used either prophylactically or therapeutically to reduce the
severity of diseases associated with Hepatitis C virus. These
compounds can also be used for detection of Hepatitis C virus and
diagnosis of Hepatitis C virus-associated diseases.
Oligonucleotides which are specifically hybridizable with Hepatitis
C virus RNA targets and are capable of inhibiting the function of
these RNA targets are disclosed. Methods of using these compounds
are also disclosed.
BACKGROUND OF THE INVENTION
[0003] The predominant form of hepatitis currently resulting from
transfusions is not related to the previously characterized
Hepatitis A virus or Hepatitis B virus and has, consequently, been
referred to as Non-A, Non-B Hepatitis (NANBH). NANBH currently
accounts for over 90% of cases of post-transfusion hepatitis.
Estimates of the frequency of NANBH in transfusion recipients range
from 5%13% for those receiving volunteer blood, or 25-54% for those
receiving blood from commercial sources.
[0004] Acute NANBH, while often less severe than acute disease
caused by Hepatitis A or Hepatitis B viruses, can lead to severe or
fulminant hepatitis. Of greater concern, progression to chronic
hepatitis is much more common after NANBH than after either
Hepatitis A or Hepatitis B infection. Chronic NANBH has been
reported in 10%-70% of infected individuals. This form of hepatitis
can be transmitted even by asymptomatic patients, and frequently
progresses to malignant disease such as cirrhosis and
hepatocellular carcinoma. Chronic active hepatitis, with or without
cirrhosis, is seen in 44%-90% of posttransfusion hepatitis cases.
Of those patients who developed cirrhosis, approximately one-fourth
died of liver failure.
[0005] Chronic active NANBH is a significant problem to
hemophiliacs who are dependent on blood products; 5%-11% of
hemophiliacs die of chronic end-stage liver disease. Cases of NANBH
other than those traceable to blood or blood products are
frequently associated with hospital exposure, accidental needle
stick, or tattooing. Transmission through close personal contact
also occurs, though this is less common for NANBH than for
Hepatitis B.
[0006] The causative agent of the majority of NANBH has been
identified and is now referred to as Hepatitis C Virus (HCV).
Houghton et al., EP Publication 318,216; Choo et al., Science 1989,
244, 359-362. Based on serological studies using recombinant
DNA-generated antigens it is now clear that HCV is the causative
agent of most cases of post-transfusion NANBH. The HCV genome is a
positive or plus-strand RNA genome. EP Publication 318,216
(Houghton et al.) discloses partial genomic sequences of HCV-1, and
teaches recombinant DNA methods of cloning and expressing HCV
sequences and HCV polypeptides, techniques of HCV
immunodiagnostics, HCV probe diagnostic techniques, anti-HCV
antibodies, and methods of isolating new HCV sequences. Houghton et
al. also disclose additional HCV sequences and teach application of
these sequences and polypeptides in immunodiagnostics, probe
diagnostics, anti-HCV antibody production, PCR technology and
recombinant DNA technology. The concept of using antisense
polynucleotides as inhibitors of viral replication is disclosed,
but no specific targets are taught. Oligomer probes and primers
based on the sequences disclosed are also provided. EP Publication
419,182 (Miyamura et al.) discloses new HCV isolates J1 and J7 and
use of sequences distinct from HCV-1 sequences for screens and
diagnostics.
[0007] Current therapies for chronic HCV infection include
interferon-.alpha. (2a, 2b, consensus) alone, interferon-.alpha. in
combination with ribavirin, pegylated interferon-.alpha. alone, and
pegylated interferon-.alpha. in combination with ribavirin. Most
NANBH patients show an improvement of clinical symptoms during
interferon treatment, but relapse is observed in at least half of
patients when treatment is interrupted. Long term remissions are
achieved in only about 20% of patients even after 6 months of
therapy. Although ribavirin alone does not have any significant
antiviral activity in chronically infected patients, addition of
ribavirin to 48 weeks of interferon-.alpha..sub.2b therapy raises
the end-of-treatment response rate and the sustained response rate.
Conjugation of polyethylene glycol (PEG) to interferon increases
the physical and thermal stability of interferon and significantly
increases its serum half-life. The sustained response rates of
interferon-based therapy have been found to be lower for patients
chronically infected with HCV genotype 1a and 1b than for patients
infected with genotypes 2 and 3. HCV genotypes 1a and 1b are found
in 65-75% of patients in the USA.
[0008] Significant improvements in HCV therapy are therefore
greatly desired. An obvious need exists for a clinically effective
antiviral therapy for acute and chronic HCV infections. Such an
antiviral would also be useful for preventing the development of
HCV-associated disease, for example for individuals accidentally
exposed to blood products containing infectious HCV. There is also
a need for research reagents and diagnostics which are able to
differentiate HCV-derived hepatitis from hepatitis caused by other
agents and which are therefore useful in designing appropriate
therapeutic regimes.
[0009] Antisense Oligonucleotides
[0010] Oligonucleotides are commonly used as research reagents and
diagnostics. For example, antisense oligonucleotides, which, by
nature, are able to inhibit gene expression with exquisite
specificity, are often used by those of ordinary skill to elucidate
the function of particular genes, for example to determine which
viral genes are essential for replication, or to distinguish
between the functions of various members of a biological pathway.
This specific inhibitory effect has, therefore, been exploited for
research use. This specificity and sensitivity is also harnessed by
those of skill in the art for diagnostic uses. Viruses capable of
causing similar hepatic symptoms can be easily and readily
distinguished in patient samples, allowing proper treatment to be
implemented. Antisense oligonucleotide inhibition of viral activity
in vitro is useful as a means to determine a proper course of
therapeutic treatment. For example, before a patient suspected of
having an HCV infection is contacted with an oligonucleotide
composition of the present invention, cells, tissues or a bodily
fluid from the patient can be contacted with the oligonucleotide
and inhibition of viral RNA function can be assayed. Effective in
vitro inhibition of HCV RNA function, routinely assayable by
methods such as Northern blot or RT-PCR to measure RNA replication,
or Western blot or ELISA to measure protein translation, indicates
that the infection will be responsive to the oligonucleotide
treatment.
[0011] Oligonucleotides have also been employed as therapeutic
moieties in the treatment of disease states in animals and man. For
example, workers in the field have now identified antisense,
triplex and other oligonucleotide compositions which are capable of
modulating expression of genes implicated in viral, fungal and
metabolic diseases. As examples, U.S. Pat. No. 5,166,195 issued
Nov. 24, 1992, provides oligonucleotide inhibitors of HIV. U.S.
Pat. No. 5,004,810, issued Apr. 2, 1991, provides oligomers capable
of hybridizing to herpes simplex virus Vmw65 mRNA and inhibiting
replication. U.S. Pat. No. 5,194,428, issued Mar. 16, 1993,
provides antisense oligonucleotides having antiviral activity
against influenzavirus. U.S. Pat. No. 4,806,463, issued Feb. 21,
1989, provides antisense oligonucleotides and methods using them to
inhibit HTLV-III replication. U.S. Pat. No. 5,276,019 and U.S. Pat.
No. 5,264,423 (Cohen et al.) are directed to phosphorothioate
oligonucleotide analogs used to prevent replication of foreign
nucleic acids in cells. Antisense oligonucleotides have been safely
and effectively administered to humans and clinical trials of
several antisense oligonucleotide drugs are presently underway. The
phosphorothioate oligonucleotide, ISIS 2922, has been shown to be
effective against cytomegalovirus retinitis in AIDS patients.
BioWorld Today, Apr. 29, 1994, p. 3. It is thus established that
oligonucleotides can be useful drugs for treatment of cells and
animal subjects, especially humans.
[0012] Seki et al. have disclosed antisense compounds complementary
to specific defined regions of the HCV genome. Canadian patent
application 2,104,649.
[0013] Hang et al. have disclosed antisense oligonucleotides
complementary to the 5' untranslated region of HCV for controlling
translation of HCV proteins, and methods of using them. WO
94/08002.
[0014] Blum et al. have disclosed antisense oligonucleotides
complementary to an RNA complementary to a portion of a hepatitis
viral genome which encodes the terminal protein region of the viral
polymerase, and methods of inhibiting replication of a hepatitis
virus using such oligonucleotides. WO 94/24864. Wakita and Wands
have used sense and antisense oligonucleotides to determine the
role of the 5' end untranslated region in the life cycle of HCV.
Antisense oligonucleotides targeted to three regions of the 5'
untranslated region and one region of the core protein coding
region effectively blocked in vitro translation of HCV protein,
suggesting that these domains may be critical for HCV translation.
J. Biol. Chem. 1994, 269, 14205-14210.
SUMMARY OF THE INVENTION
[0015] In accordance with the present invention, compositions and
methods for modulating the effects of HCV infection are provided.
Oligonucleotides which are complementary to, and specifically
hybridizable with, selected sequences of HCV RNA and which are
capable of inhibiting the function of the HCV RNA are provided. The
HCV polyprotein translation initiation codon region is a preferred
target. An oligonucleotide (SEQ ID NO: 6) targeted to nucleotides
330-349 of the initiation codon region is particularly preferred,
and this sequence comprising a 5-methylcytidine at every cytidine
residue is even more preferred. Methods for diagnosing or treating
disease states by administering oligonucleotides, either alone or
in combination with a pharmaceutically acceptable carrier, to
animals suspected of having HCV-associated diseases are also
provided.
DETAILED DESCRIPTION OF THE INVENTION
[0016] Several regions of the HCV genome have been identified as
antisense targets in the present invention. The size of the HCV
genome is approximately 9400 nucleotides, with a single
translational reading frame encoding a polyprotein which is
subsequently processed to several structural and non-structural
proteins. It should be noted that sequence availability and
nucleotide numbering schemes vary from strain to strain. The 5'
untranslated region (5' UTR) or 5' noncoding region (5' NCR) of HCV
consists of approximately 341 nucleotides upstream of the
polyprotein translation initiation codon. A hairpin loop present at
nucleotides 1-22 at the 5' end of the genome (HCV-1) identified
herein as the "5' end hairpin loop" is believed to serve as a
recognition signal for the viral replicase or nucleocapsid
proteins. Han et al., Proc. Natl. Acad. Sci. 1991, 88, 1711-1715.
The 5' untranslated region is believed to have a secondary
structure which includes six stem-loop structures, designated loops
A-F. Loop A is present at approximately nucleotides 13-50, loop B
at approximately nucleotides 51-88, loop C at approximately
nucleotides 100-120, loop D at approximately nucleotides 147-162,
loop E at approximately nucleotides 163-217, and loop F at
approximately nucleotides 218-307. Tsukiyama-Kohara et al., J.
Virol. 1992, 66, 1476-1483. These structures are well conserved
between the two major HCV groups.
[0017] Three small (12-16 amino acids each) open reading frames
(ORFS) are located in the 5'-untranslated region of HCV RNA. These
ORFs may be involved in control of translation. The ORF 3
translation initiation codon as denominated herein is found at
nucleotides 315-317 of HCV-1 according to the scheme of Han et al.,
Proc. Natl. Acad. Sci. 1991, 88, 1711-1715; and at nucleotides -127
to -125 according to the scheme of Choo et al., Proc. Natl. Acad.
Sci. 1991, 88, 2451-2455.
[0018] The polyprotein translation initiation codon as denominated
herein is an AUG sequence located at nucleotides 342-344 of HCV-1
according to Han et al., Proc. Natl. Acad. Sci. 1991, 88, 1711-1715
or at nucleotide 1-3 according to the HCV-1 numbering scheme of
Choo et al., Proc. Natl. Acad. Sci. 1991, 88, 2451-2455. Extending
downstream (toward 3' end) from the polyprotein AUG is the core
protein coding region.
[0019] The 3' untranslated region, as denominated herein, consists
of nucleotides downstream of the polyprotein translation
termination site (ending at nt 9037 according to Choo et al.; nt
9377 according to schemes of Han and Inchauspe). Nucleotides
9697-9716 (numbering scheme of Inchauspe for HCV-H) at the 3'
terminus of the genome within the 3' untranslated region can be
organized into a stable hairpin loop structure identified herein as
the 3' hairpin loop. A short nucleotide stretch (R2) immediately
upstream (nt 9691-9696 of HCV-H) of the 3' hairpin, and denominated
herein "the R2 sequence", is thought to play a role in cyclization
of the viral RNA, possibly in combination with a set of 5' end
6-base-pair repeats of the same sequence at nt 23-28 and 38-43.
(Inchauspe et al., Proc. Natl. Acad. Sci. 1991, 88, 10292-10296) is
identified herein as "5' end 6-base-pair repeat". Palindrome
sequences present near the 3' end of the genome (nucleotides
9312-9342 according to the scheme of Takamizawa et al., J. Virol.
1991, 65, 1105-1113) are capable of forming a stable secondary
structure. This is referred to herein as the 3' end palindrome
region.
[0020] The present invention provides oligomeric compounds useful
in the modulation of gene expression. More specifically, oligomeric
compounds of the invention modulate gene expression by hybridizing
to a nucleic acid target resulting in loss of normal function of
the target nucleic acid. As used herein, the term "target nucleic
acid" or "nucleic acid target" is used for convenience to encompass
any nucleic acid capable of being targeted including without
limitation DNA, RNA (including pre-mRNA and mRNA or portions
thereof) transcribed from such DNA, and also cDNA derived from such
RNA. In a preferred embodiment of this invention modulation of gene
expression is effected via modulation of a RNA associated with the
particular gene RNA.
[0021] The invention provides for modulation of a target nucleic
acid where the target nucleic acid is a messenger RNA. The
messenger RNA is degraded by the RNA interference mechanism as well
as other mechanism wherein double stranded RNA/RNA structures are
recognized and degraded, cleaved or otherwise rendered
inoperable.
[0022] The functions of RNA to be interfered with can include
replication and transcription. Replication and transcription, for
example, can be from an endogenous cellular template, a vector, a
plasmid construct or otherwise. The functions of RNA to be
interfered with can include functions such as translocation of the
RNA to a site of protein translation, translocation of the RNA to
sites within the cell which are distant from the site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA
to yield one or more RNA species, and catalytic activity or complex
formation involving the RNA which may be engaged in or facilitated
by the RNA. In the context of the present invention, "modulation"
and "modulation of expression" mean either an increase
(stimulation) or a decrease (inhibition) in the amount or levels of
a nucleic acid molecule encoding the gene, e.g., DNA or RNA.
Inhibition is often the preferred form of modulation of expression
and mRNA is often a preferred target nucleic acid.
[0023] Antisense Oligonucleotides
[0024] The present invention employs oligonucleotides 8 to 80
nucleotides in length which are specifically hybridizable with
hepatitis C virus RNA and are capable of inhibiting the function of
the HCV RNA. In another embodiment, the oligonucleotide is about
12-50 nucleotides in length. In yet another embodiment, the
oligonucleotide is 15 to 30 nucleotides in length. In preferred
embodiments, oligonucleotides are targeted to the 5' end hairpin
loop, 5' end 6-base-pair repeats, 5' end untranslated region,
polyprotein translation initiation codon, core protein coding
region, ORF 3 translation initiation codon, 3'-untranslated region,
3' end palindrome region, R2 sequence and 3' end hairpin loop
region of HCV RNA. This relationship between an oligonucleotide and
the nucleic acid sequence to which it is targeted is commonly
referred to as "antisense". "Targeting" an oligonucleotide to a
chosen nucleic acid target, in the context of this invention, is a
multistep process. The process usually begins with identifying a
nucleic acid sequence whose function is to be modulated. This may
be, as examples, a cellular gene (or mRNA made from the gene) whose
expression is associated with a particular disease state, or a
foreign nucleic acid (RNA or DNA) from an infectious agent. In the
present invention, the target is the 5' end hairpin loop, 5' end
6-base-pair repeats, ORF 3 translation initiation codon (all of
which are contained within the 5' UTR), polyprotein translation
initiation codon, core protein coding region (both of which are
contained within the coding region), 3' end palindrome region, R2
sequence or 3' end hairpin loop (all of which are contained within
the 3' UTR) of HCV RNA. The targeting process also includes
determination of a site or sites within the nucleic acid sequence
for the oligonucleotide interaction to occur such that the desired
effect, i.e., inhibition of HCV RNA function, will result. Once the
target site or sites have been identified, oligonucleotides are
chosen which are sufficiently complementary to the target, i.e.,
hybridize sufficiently well and with sufficient specificity, to
give the desired modulation.
[0025] In the context of this invention "modulation" means either
inhibition or stimulation. Inhibition of HCV RNA function is
presently the preferred form of modulation in the present
invention. The oligonucleotides are able to inhibit the function of
viral RNA by interfering with its replication, transcription into
mRNA, translation into protein, packaging into viral particles or
any other activity necessary to its overall biological function.
The failure of the RNA to perform all or part of its function
results in failure of all or a portion of the normal life cycle of
the virus. This inhibition can be measured, in samples derived from
either in vitro or in vivo (animal) systems, in ways which are
routine in the art, for example by RT-PCR or Northern blot assay of
HCV RNA levels or by in vitro translation, Western blot or ELISA
assay of protein expression as taught in the examples of the
instant application.
[0026] "Hybridization", in the context of this invention, means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary bases, usually on
opposite nucleic acid strands or two regions of a nucleic acid
strand. Guanine and cytosine are examples of complementary bases
which are known to form three hydrogen bonds between them. Adenine
and thymine are examples of complementary bases which form two
hydrogen bonds between them. "Specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity such that stable and specific binding
occurs between the DNA or RNA target and the oligonucleotide. It is
understood that an oligonucleotide need not be 100% complementary
to its target nucleic acid sequence to be specifically
hybridizable. An oligonucleotide is specifically hybridizable when
binding of the oligonucleotide to the target interferes with the
normal function of the target molecule to cause a loss of activity,
and there is a sufficient degree of complementarity to avoid
non-specific binding of the oligonucleotide to non-target nucleic
acid sequences under conditions in which specific binding is
desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment or, in the case of in vitro
assays, under conditions in which the assays are conducted.
[0027] It is understood in the art that the sequence of the
oligomeric compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. Moreover, an
oligomeric compound may hybridize over one or more segments such
that intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure or hairpin structure).
It is preferred that the oligomeric compounds of the present
invention comprise at least 70% sequence complementarity to a
target region within the target nucleic acid, more preferably that
they comprise 90% sequence complementarity and even more preferably
comprise 95% sequence complementarity to the target region within
the target nucleic acid sequence to which they are targeted. For
example, an oligomeric compound in which 18 of 20 nucleobases of
the oligomeric compound are complementary to a target region, and
would therefore specifically hybridize, would represent 90 percent
complementarity. In this example, the remaining noncomplementary
nucleobases may be clustered or interspersed with complementary
nucleobases and need not be contiguous to each other or to
complementary nucleobases. As such, an oligomeric compound which is
18 nucleobases in length having 4 (four) noncomplementary
nucleobases which are flanked by two regions of complete
complementarity with the target nucleic acid would have 77.8%
overall complementarity with the target nucleic acid and would thus
fall within the scope of the present invention. Percent
complementarity of an oligomeric compound with a region of a target
nucleic acid can be determined routinely using BLAST programs
(basic local alignment search tools) and PowerBLAST programs known
in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410;
Zhang and Madden, Genome Res., 1997, 7, 649-656).
[0028] In the present invention the phrase "stringent hybridization
conditions" or "stringent conditions" refers to conditions under
which an oligomeric compound of the invention will hybridize to its
target sequence, but to a minimal number of other sequences.
Stringent conditions are sequence-dependent and will vary with
different circumstances and in the context of this invention;
"stringent conditions" under which oligomeric compounds hybridize
to a target sequence are determined by the nature and composition
of the oligomeric compounds and the assays in which they are being
investigated.
[0029] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of nucleotide or nucleoside
monomers consisting of naturally occurring bases, sugars and
intersugar (backbone) linkages. The term "oligonucleotide" also
includes oligomers or polymers comprising non-naturally occurring
monomers, or portions thereof, which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of properties such as, for example, enhanced
cellular uptake, increased stability in the presence of nucleases,
or enhanced target affinity. A number of nucleotide and nucleoside
modifications have been shown to make the oligonucleotide into
which they are incorporated more resistant to nuclease digestion
than the native oligodeoxynucleotide. Nuclease resistance is
routinely measured by incubating oligonucleotides with cellular
extracts or isolated nuclease solutions and measuring the extent of
intact oligonucleotide remaining over time, usually by gel
electrophoresis. Oligonucleotides which have been modified to
enhance their nuclease resistance survive intact for a longer time
than unmodified oligonucleotides. A number of modifications have
also been shown to increase binding (affinity) of the
oligonucleotide to its target. Affinity of an oligonucleotide for
its target is routinely determined by measuring the Tm of an
oligonucleotide/target pair, which is the temperature at which the
oligonucleotide and target dissociate. Dissociation is detected
spectrophotometrically. The higher the Tm, the greater the affinity
of the oligonucleotide for the target. In some cases,
oligonucleotide modifications which enhance target binding affinity
are also, independently, able to enhance nuclease resistance.
[0030] While the preferred form of antisense compound is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. This phenomenon occurs in both plants and
animals and is believed to have an evolutionary connection to viral
defense and transposon silencing.
[0031] The first evidence that dsRNA could lead to gene silencing
in animals came in 1995 from work in the nematode, Caenorhabditis
elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et
al. have shown that the primary interference effects of dsRNA are
posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA,
1998, 95, 15502-15507). The posttranscriptional antisense mechanism
defined in Caenorhabditis elegans resulting from exposure to
double-stranded RNA (dsRNA) has since been designated RNA
interference (RNAi). This term has been generalized to mean
antisense-mediated gene silencing involving the introduction of
dsRNA leading to the sequence-specific reduction of endogenous
targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811).
Recently, it has been shown that it is, in fact, the
single-stranded RNA oligomers of antisense polarity of the dsRNAs
which are the potent inducers of RNAi (Tijsterman et al., Science,
2002, 295, 694-697).
[0032] Oligomer and Monomer Modifications
[0033] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric compound can be further joined to form a circular
compound, however, linear compounds are generally preferred. In
addition, linear compounds may have internal nucleobase
complementarity and may therefore fold in a manner as to produce a
fully or partially double-stranded compound. Within
oligonucleotides, the phosphate groups are commonly referred to as
forming the internucleoside linkage or in conjunction with the
sugar ring the backbone of the oligonucleotide. The normal
internucleoside linkage that makes up the backbone of RNA and DNA
is a 3' to 5' phosphodiester linkage.
[0034] Modified Internucleoside Linkages
[0035] Specific examples of preferred antisense oligomeric
compounds useful in this invention include oligonucleotides
containing modified e.g. non-naturally occurring internucleoside
linkages. As defined in this specification, oligonucleotides having
modified internucleoside linkages include internucleoside linkages
that retain a phosphorus atom and internucleoside linkages that do
not have a phosphorus atom. For the purposes of this specification,
and as sometimes referenced in the art, modified oligonucleotides
that do not have a phosphorus atom in their internucleoside
backbone can also be considered to be oligonucleosides.
[0036] In the C. elegans system, modification of the
internucleotide linkage (phosphorothioate) did not significantly
interfere with RNAi activity. Based on this observation, it is
suggested that certain preferred oligomeric compounds of the
invention can also have one or more modified internucleoside
linkages. A preferred phosphorus containing modified
internucleoside linkage is the phosphorothioate internucleoside
linkage.
[0037] Preferred modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates
including 3'-alkylene phosphonates, 5'-alkylene phosphonates and
chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and borano-phosphates
having normal 3'-5' linkages, 2'-5' linked analogs of these, and
those having inverted polarity wherein one or more internucleotide
linkages is a 3' to 3', 51 to 5' or 2' to 21 linkage. Preferred
oligonucleotides having inverted polarity comprise a single 3' to
3' linkage at the 3'-most internucleotide linkage i.e. a single
inverted nucleoside residue which may be abasic (the nucleobase is
missing or has a hydroxyl group in place thereof). Various salts,
mixed salts and free acid forms are also included.
[0038] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0039] In more preferred embodiments of the invention, oligomeric
compounds have one or more phosphorothioate and/or heteroatom
internucleoside linkages, in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester internucleotide linkage is represented as
--O--P(.dbd.O)(OH)--O--CH.sub.2- --]. The MMI type internucleoside
linkages are disclosed in the above referenced U.S. Pat. No.
5,489,677. Preferred amide internucleoside linkages are disclosed
in the above referenced U.S. Pat. No. 5,602,240.
[0040] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0041] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0042] Oligomer Mimetics
[0043] Another preferred group of oligomeric compounds amenable to
the present invention includes oligonucleotide mimetics. The term
mimetic as it is applied to oligonucleotides is intended to include
oligomeric compounds wherein only the furanose ring or both the
furanose ring and the internucleotide linkage are replaced with
novel groups, replacement of only the furanose ring is also
referred to in the art as being a sugar surrogate. The heterocyclic
base moiety or a modified heterocyclic base moiety is maintained
for hybridization with an appropriate target nucleic acid. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA oligomeric compounds, the
sugar-backbone of an oligonucleotide is replaced with an amide
containing backbone, in particular an aminoethylglycine backbone.
The nucleobases are retained and are bound directly or indirectly
to aza nitrogen atoms of the amide portion of the backbone.
Representative United States patents that teach the preparation of
PNA oligomeric compounds include, but are not limited to, U.S. Pat.
Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA oligomeric
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0044] One oligonucleotide mimetic that has been reported to have
excellent hybridization properties is peptide nucleic acids (PNA).
The backbone in PNA compounds is two or more linked
aminoethylglycine units which gives PNA an amide containing
backbone. The heterocyclic base moieties are bound directly or
indirectly to aza nitrogen atoms of the amide portion of the
backbone. Representative United States patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is
herein incorporated by reference. Further teaching of PNA compounds
can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
[0045] PNA has been modified to incorporate numerous modifications
since the basic PNA structure was first prepared. The basic
structure is shown below: 1
[0046] wherein
[0047] Bx is a heterocyclic base moiety;
[0048] T.sub.4 is hydrogen, an amino protecting group,
--C(O)R.sub.5, substituted or unsubstituted C.sub.1-C.sub.10 alkyl,
substituted or unsubstituted C.sub.2-C.sub.10 alkenyl, substituted
or unsubstituted C.sub.2-C.sub.10 alkynyl, alkylsulfonyl,
arylsulfonyl, a chemical functional group, a reporter group, a
conjugate group, a D or L .alpha.-amino acid linked via the
.alpha.-carboxyl group or optionally through the .omega.-carboxyl
group when the amino acid is aspartic acid or glutamic acid or a
peptide derived from D, L or mixed D and L amino acids linked
through a carboxyl group, wherein the substituent groups are
selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl,
nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0049] T.sub.5 is --OH, --N(Z.sub.1)Z.sub.2, R.sub.5, D or L
.alpha.-amino acid linked via the .alpha.-amino group or optionally
through the .omega.-amino group when the amino acid is lysine or
ornithine or a peptide derived from D, L or mixed D and L amino
acids linked through an amino group, a chemical functional group, a
reporter group or a conjugate group;
[0050] Z.sub.1 is hydrogen, C.sub.1-C.sub.6 alkyl, or an amino
protecting group;
[0051] Z.sub.2 is hydrogen, C.sub.1-C.sub.6 alkyl, an amino
protecting group, --C(.dbd.O)--(CH.sub.2).sub.n-J-Z.sub.3, a D or L
.alpha.-amino acid linked via the .alpha.-carboxyl group or
optionally through the .omega.-carboxyl group when the amino acid
is aspartic acid or glutamic acid or a peptide derived from D, L or
mixed D and L amino acids linked through a carboxyl group;
[0052] Z.sub.3 is hydrogen, an amino protecting group,
--C.sub.1-C.sub.6 alkyl, --C(.dbd.O)--CH.sub.3, benzyl, benzoyl, or
--(CH.sub.2).sub.n--N(H- )Z.sub.1;
[0053] each J is O, S or NH;
[0054] R.sub.5 is a carbonyl protecting group; and
[0055] n is from 2 to about 50.
[0056] Another class of oligonucleotide mimetic that has been
studied is based on linked morpholino units (morpholino nucleic
acid) having heterocyclic bases attached to the morpholino ring. A
number of linking groups have been reported that link the
morpholino monomeric units in a morpholino nucleic acid. A
preferred class of linking groups have been selected to give a
non-ionic oligomeric compound. The non-ionic morpholino-based
oligomeric compounds are less likely to have undesired interactions
with cellular proteins. Morpholino-based oligomeric compounds are
non-ionic mimics of oligonucleotides which are less likely to form
undesired interactions with cellular proteins (Dwaine A. Braasch
and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510).
Morpholino-based oligomeric compounds are disclosed in U.S. Pat.
No. 5,034,506, issued Jul. 23, 1991. The morpholino class of
oligomeric compounds have been prepared having a variety of
different linking groups joining the monomeric subunits.
[0057] Morpholino nucleic acids have been prepared having a variety
of different linking groups (L.sub.2) joining the monomeric
subunits. The basic formula is shown below: 2
[0058] wherein
[0059] T.sub.1 is hydroxyl or a protected hydroxyl;
[0060] T.sub.5 is hydrogen or a phosphate or phosphate
derivative;
[0061] L.sub.2 is a linking group; and
[0062] n is from 2 to about 50.
[0063] A further class of oligonucleotide mimetic is referred to as
cyclohexenyl nucleic acids (CeNA). The furanose ring normally
present in an DNA/RNA molecule is replaced with a cyclohexyl ring.
CeNA DMT protected phosphoramidite monomers have been prepared and
used for oligomeric compound synthesis following classical
phosphoramidite chemistry. Fully modified CeNA oligomeric compounds
and oligonucleotides having specific positions modified with CeNA
have been prepared and studied (see Wang et al., J. Am. Chem. Soc.,
2000, 122, 8595-8602). In general the incorporation of CeNA
monomers into a DNA chain increases its stability of a DNA/RNA
hybrid. CeNA oligoadenylates formed complexes with RNA and DNA
complements with similar stability to the native complexes. The
study of incorporating CeNA structures into natural nucleic acid
structures was shown by NMR and circular dichroism to proceed with
easy conformational adaptation. Furthermore the incorporation of
CeNA into a sequence targeting RNA was stable to serum and able to
activate E. coli RNase resulting in cleavage of the target RNA
strand.
[0064] The general formula of CeNA is shown below: 3
[0065] wherein
[0066] each Bx is a heterocyclic base moiety;
[0067] T.sub.1 is hydroxyl or a protected hydroxyl; and
[0068] T2 is hydroxyl or a protected hydroxyl.
[0069] Another class of oligonucleotide mimetic (anhydrohexitol
nucleic acid) can be prepared from one or more anhydrohexitol
nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett.,
1999, 9, 1563-1566) and would have the general formula: 4
[0070] A further preferred modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4'
carbon atom of the sugar ring thereby forming a
2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar
moiety. The linkage is preferably a methylene (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and
LNA analogs display very high duplex thermal stabilities with
complementary DNA and RNA (Tm=+3 to +10 C), stability towards
3'-exonucleolytic degradation and good solubility properties. The
basic structure of LNA showing the bicyclic ring system is shown
below: 5
[0071] The conformations of LNAs determined by 2D NMR spectroscopy
have shown that the locked orientation of the LNA nucleotides, both
in single-stranded LNA and in duplexes, constrains the phosphate
backbone in such a way as to introduce a higher population of the
N-type conformation (Petersen et al., J. Mol. Recognit., 2000, 13,
44-53). These conformations are associated with improved stacking
of the nucleobases (Wengel et al., Nucleosides Nucleotides, 1999,
18, 1365-1370).
[0072] LNA has been shown to form exceedingly stable LNA:LNA
duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120,
13252-13253). LNA:LNA hybridization was shown to be the most
thermally stable nucleic acid type duplex system, and the
RNA-mimicking character of LNA was established at the duplex level.
Introduction of 3 LNA monomers (T or A) significantly increased
melting points (Tm=+15/+11) toward DNA complements. The
universality of LNA-mediated hybridization has been stressed by the
formation of exceedingly stable LNA:LNA duplexes. The RNA-mimicking
of LNA was reflected with regard to the N-type conformational
restriction of the monomers and to the secondary structure of the
LNA:RNA duplex.
[0073] LNAs also form duplexes with complementary DNA, RNA or LNA
with high thermal affinities. Circular dichroism (CD) spectra show
that duplexes involving fully modified LNA (esp. LNA:RNA)
structurally resemble an A-form RNA:RNA duplex. Nuclear magnetic
resonance (NMR) examination of an LNA:DNA duplex confirmed the
3'-endo conformation of an LNA monomer. Recognition of
double-stranded DNA has also been demonstrated suggesting strand
invasion by LNA. Studies of mismatched sequences show that LNAs
obey the Watson-Crick base pairing rules with generally improved
selectivity compared to the corresponding unmodified reference
strands.
[0074] Novel types of LNA-oligomeric compounds, as well as the
LNAs, are useful in a wide range of diagnostic and therapeutic
applications. Among these are antisense applications, PCR
applications, strand-displacement oligomers, substrates for nucleic
acid polymerases and generally as nucleotide based drugs. Potent
and nontoxic antisense oligonucleotides containing LNAs have been
described (Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638.) The authors have demonstrated that LNAs confer
several desired properties to antisense agents. LNA/DNA copolymers
were not degraded readily in blood serum and cell extracts. LNA/DNA
copolymers exhibited potent antisense activity in assay systems as
disparate as G-protein-coupled receptor signaling in living rat
brain and detection of reporter genes in E. coli.
Lipofectin-mediated efficient delivery of LNA into living human
breast cancer cells has also been accomplished.
[0075] The synthesis and preparation of the LNA monomers adenine,
cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along
with their oligomerization, and nucleic acid recognition properties
have been described (Koshkin et al., Tetrahedron, 1998, 54,
3607-3630). LNAs and preparation thereof are also described in WO
98/39352 and WO 99/14226.
[0076] The first analogs of LNA, phosphorothioate-LNA and
2'-thio-LNAs, have also been prepared (Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside
analogs containing oligodeoxyribonucleotide duplexes as substrates
for nucleic acid polymerases has also been described (Wengel et
al., PCT International Application WO 98-DK393 19980914).
Furthermore, synthesis of 2'-amino-LNA, a novel conformationally
restricted high-affinity oligonucleotide analog with a handle has
been described in the art (Singh et al., J. Org. Chem., 1998, 63,
10035-10039). In addition, 2'-Amino- and 2'-methylamino-LNA's have
been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0077] Further oligonucleotide mimetics have been prepared to
include bicyclic and tricyclic nucleoside analogs having the
formulas (amidite monomers shown): 6
[0078] (see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439;
Steffens et al., J. Am. Chem. Soc., 1999, 121, 3249-3255; and
Renneberg et al., J. Am. Chem. Soc., 2002, 124, 5993-6002). These
modified nucleoside analogs have been oligomerized using the
phosphoramidite approach and the resulting oligomeric compounds
containing tricyclic nucleoside analogs have shown increased
thermal stabilities (Tm's) when hybridized to DNA, RNA and itself.
Oligomeric compounds containing bicyclic nucleoside analogs have
shown thermal stabilities approaching that of DNA duplexes.
[0079] Another class of oligonucleotide mimetic is referred to as
phosphonomonoester nucleic acids incorporate a phosphorus group in
a backbone the backbone. This class of oligonucleotide mimetic is
reported to have useful physical and biological and pharmacological
properties in the areas of inhibiting gene expression (antisense
oligonucleotides, ribozymes, sense oligonucleotides and
triplex-forming oligonucleotides), as probes for the detection of
nucleic acids and as auxiliaries for use in molecular biology.
[0080] The general formula (for definitions of Markush variables
see: U.S. Pat. Nos. 5,874,553 and 6,127,346 herein incorporated by
reference in their entirety) is shown below. 7
[0081] Another oligonucleotide mimetic has been reported wherein
the furanosyl ring has been replaced by a cyclobutyl moiety.
[0082] Modified Sugars
[0083] Oligomeric compounds of the invention may also contain one
or more substituted sugar moieties. Preferred oligomeric compounds
comprise a sugar substituent group selected from: OH; F; O-, S-, or
N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be
substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2
to C.sub.10 alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.su- b.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
a sugar substituent group selected from: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethyl-aminoethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2.
[0084] Other preferred sugar substituent groups include methoxy
(--O--CH.sub.3), aminopropoxy
(--OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), allyl
(--CH.sub.2--CH.dbd.CH.sub.2), --O-allyl
(--O--CH.sub.2--CH.dbd.CH.- sub.2) and fluoro (F). 2'-Sugar
substituent groups may be in the arabino (up) position or ribo
(down) position. A preferred 2'-arabino modification is 2'-F.
Similar modifications may also be made at other positions on the
oligomeric compound, particularly the 3' position of the sugar on
the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and
the 5' position of 5' terminal nucleotide. Oligomeric compounds may
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0085] Further representative sugar substituent groups include
groups of formula I.sub.a or II.sub.a: 8
[0086] wherein:
[0087] R.sub.b is O, S or NH;
[0088] R.sub.d is a single bond, O, S or C(.dbd.O);
[0089] R.sub.e is C.sub.1-C.sub.10 alkyl, N(R.sub.k)(R.sub.m),
N(R.sub.k)(R.sub.n), N.dbd.C(R.sub.p)(R.sub.q),
N.dbd.C(R.sub.p)(R.sub.r) or has formula III.sub.a; 9
[0090] R.sub.p and R.sub.q are each independently hydrogen or
C.sub.1-C.sub.10 alkyl;
[0091] R.sub.r is --R.sub.x-R.sub.y;
[0092] each R.sub.s, R.sub.t, R.sub.u and R.sub.v is,
independently, hydrogen, C(O)R.sub.w, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10alkenyl, substituted or unsubstituted
C.sub.2-C.sub.10alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional group or a conjugate group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl,
phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and
alkynyl;
[0093] or optionally, R.sub.u and R.sub.v, together form a
phthalimido moiety with the nitrogen atom to which they are
attached;
[0094] each R.sub.w is, independently, substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, trifluoromethyl, cyanoethyloxy, methoxy,
ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy,
2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy,
butyryl, iso-butyryl, phenyl or aryl;
[0095] R.sub.k is hydrogen, a nitrogen protecting group or
--R.sub.x-R.sub.y;
[0096] R.sub.p is hydrogen, a nitrogen protecting group or
--R.sub.x-R.sub.y;
[0097] R.sub.x is a bond or a linking moiety;
[0098] R.sub.y is a chemical functional group, a conjugate group or
a solid support medium;
[0099] each R.sub.m and R.sub.n is, independently, H, a nitrogen
protecting group, substituted or unsubstituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10alkenyl,
substituted or unsubstituted C.sub.2-C.sub.10alkynyl, wherein the
substituent groups are selected from hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl, alkynyl; NH.sub.3.sup.+, N(R.sub.u)(R.sub.v),
guanidino and acyl where said acyl is an acid amide or an
ester;
[0100] or R.sub.m and R.sub.n, together, are a nitrogen protecting
group, are joined in a ring structure that optionally includes an
additional heteroatom selected from N and O or are a chemical
functional group;
[0101] R.sub.i is OR.sub.z, SR.sub.z, or N(R.sub.z).sub.2;
[0102] each R.sub.z is, independently, H, C.sub.1-C.sub.8 alkyl,
C.sub.1-C.sub.8 haloalkyl, C(.dbd.NH)N(H)R.sub.u,
C(.dbd.O)N(H)R.sub.u or OC(.dbd.O)N(H)R.sub.u;
[0103] R.sub.f, R.sub.g and R.sub.h comprise a ring system having
from about 4 to about 7 carbon atoms or having from about 3 to
about 6 carbon atoms and 1 or 2 heteroatoms wherein said
heteroatoms are selected from oxygen, nitrogen and sulfur and
wherein said ring system is aliphatic, unsaturated aliphatic,
aromatic, or saturated or unsaturated heterocyclic;
[0104] R.sub.j is alkyl or haloalkyl having 1 to about 10 carbon
atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2
to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms,
N(R.sub.k)(R.sub.m)OR.sub.k, halo, SR.sub.k or CN;
[0105] m.sub.a is 1 to about 10;
[0106] each m.sub.b is, independently, 0 or 1;
[0107] m.sub.c is 0 or an integer from 1 to 10;
[0108] m.sub.d is an integer from 1 to 10;
[0109] m.sub.e is from 0, 1 or 2; and
[0110] provided that when m.sub.c is 0, m.sub.d is greater than
1.
[0111] Representative substituents groups of Formula I are
disclosed in U.S. patent application Ser. No. 09/130,973, filed
Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy Oligonucleotides,"
hereby incorporated by reference in its entirety.
[0112] Representative cyclic substituent groups of Formula II are
disclosed in U.S. patent application Ser. No. 09/123,108, filed
Jul. 27, 1998, entitled "RNA Targeted 2'-Oligomeric compounds that
are Conformationally Preorganized," hereby incorporated by
reference in its entirety.
[0113] Particularly preferred sugar substituent groups include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and
m are from 1 to about 10.
[0114] Representative guanidino substituent groups that are shown
in formula III and IV are disclosed in co-owned U.S. patent
application Ser. No. 09/349,040, entitled "Functionalized
oligomers", filed Jul. 7, 1999, hereby incorporated by reference in
its entirety.
[0115] Representative acetamido substituent groups are disclosed in
U.S. Pat. No. 6,147,200 which is hereby incorporated by reference
in its entirety.
[0116] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in International Patent Application PCT/US99/17895,
entitled "2'-O-Dimethylaminoethyloxyethyl-Oligomeric compounds",
filed Aug. 6, 1999, hereby incorporated by reference in its
entirety.
[0117] Modified Nucleobases/Naturally Occurring Nucleobases
[0118] Oligomeric compounds may also include nucleobase (often
referred to in the art simply as "base" or "heterocyclic base
moiety") modifications or substitutions. As used herein,
"unmodified" or "natural" nucleobases include the purine bases
adenine (A) and guanine (G), and the pyrimidine bases thymine (T),
cytosine (C) and uracil (U). Modified nucleobases also referred
herein as heterocyclic base moieties include other synthetic and
natural nucleobases such as 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl (--C.ident.CCH.sub.3) uracil and cytosine and
other alkynyl derivatives of pyrimidine bases, 6-azo uracil,
cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil,
8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other
8-substituted adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine
and 3-deazaguanine and 3-deazaadenine.
[0119] Heterocyclic base moieties may also include those in which
the purine or pyrimidine base is replaced with other heterocycles,
for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Further nucleobases include those disclosed in U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the oligomeric
compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0120] In one aspect of the present invention oligomeric compounds
are prepared having polycyclic heterocyclic compounds in place of
one or more heterocyclic base moieties. A number of tricyclic
heterocyclic compounds have been previously reported. These
compounds are routinely used in antisense applications to increase
the binding properties of the modified strand to a target strand.
The most studied modifications are targeted to guanosines hence
they have been termed G-clamps or cytidine analogs. Many of these
polycyclic heterocyclic compounds have the general formula: 10
[0121] Representative cytosine analogs that make 3 hydrogen bonds
with a guanosine in a second strand include
1,3-diazaphenoxazine-2-one (R.sub.10=O, R.sub.11-R.sub.14=H)
[Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16,
1837-1846], 1,3-diazaphenothiazine-2-one (R.sub.10=S,
R.sub.11-R.sub.14=H), [Lin, K.-Y.; Jones, R. J.; Matteucci, M. J.
Am. Chem. Soc. 1995, 117, 3873-3874] and
6,7,8,9-tetrafluoro-1,3-di- azaphenoxazine-2-one (R.sub.10=O,
R.sub.11-R.sub.14=F) [Wang, J.; Lin, K.-Y., Matteucci, M.
Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into
oligonucleotides these base modifications were shown to hybridize
with complementary guanine and the latter was also shown to
hybridize with adenine and to enhance helical thermal stability by
extended stacking interactions (also see U.S. patent application
entitled "Modified Peptide Nucleic Acids" filed May 24, 2002, Ser.
No. 10/155,920; and U.S. patent application entitled "Nuclease
Resistant Chimeric Oligonucleotides" filed May 24, 2002, Ser. No.
10/013,295, both of which are commonly owned with this application
and are herein incorporated by reference in their entirety).
[0122] Further helix-stabilizing properties have been observed when
a cytosine analog/substitute has an aminoethoxy moiety attached to
the rigid 1,3-diazaphenoxazine-2-one scaffold (R.sub.10=O,
R.sub.11=--O--(CH.sub.2).sub.2--NH.sub.2, R.sub.12-14=H [Lin,
K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532].
Binding studies demonstrated that a single incorporation could
enhance the binding affinity of a model oligonucleotide to its
complementary target DNA or RNA with a .DELTA.Y.sub.m of up to
18.degree. relative to 5-methyl cytosine (dC5.sup.me), which is the
highest known affinity enhancement for a single modification, yet.
On the other hand, the gain in helical stability does not
compromise the specificity of the oligonucleotides. The T.sub.m
data indicate an even greater discrimination between the perfect
match and mismatched sequences compared to dC5.sup.me. It was
suggested that the tethered amino group serves as an additional
hydrogen bond donor to interact with the Hoogsteen face, namely the
O6, of a complementary guanine thereby forming 4 hydrogen bonds.
This means that the increased affinity of G-clamp is mediated by
the combination of extended base stacking and additional specific
hydrogen bonding.
[0123] Further tricyclic heterocyclic compounds and methods of
using them that are amenable to the present invention are disclosed
in U.S. Pat. No. 6,028,183, which issued on May 22, 2000, and U.S.
Pat. No. 6,007,992, which issued on Dec. 28, 1999, the contents of
both are commonly assigned with this application and are
incorporated herein in their entirety.
[0124] The enhanced binding affinity of the phenoxazine derivatives
together with their uncompromised sequence specificity makes them
valuable nucleobase analogs for the development of more potent
antisense-based drugs. In fact, promising data have been derived
from in vitro experiments demonstrating that heptanucleotides
containing phenoxazine substitutions are capable to activate
RNaseH, enhance cellular uptake and exhibit an increased antisense
activity [Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120,
8531-8532]. The activity enhancement was even more pronounced in
case of G-clamp, as a single substitution was shown to
significantly improve the in vitro potency of a 20mer
2'-deoxyphosphorothioate oligonucleotides [Flanagan, W. M.; Wolf,
J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci,
M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518]. Nevertheless,
to optimize oligonucleotide design and to better understand the
impact of these heterocyclic modifications on the biological
activity, it is important to evaluate their effect on the nuclease
stability of the oligomers.
[0125] Further modified polycyclic heterocyclic compounds useful as
heterocyclcic bases are disclosed in but not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269;
5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S.
patent application Ser. No. 09/996,292 filed Nov. 28, 2001, certain
of which are commonly owned with the instant application, and each
of which is herein incorporated by reference.
[0126] The oligonucleotides of the present invention also include
variants in which a different base is present at one or more of the
nucleotide positions in the oligonucleotide. For example, if the
first nucleotide is an adenosine, variants may be produced which
contain thymidine (or uridine if RNA), guanosine or cytidine at
this position. This may be done at any of the positions of the
oligonucleotide. Thus, a 20-mer may comprise 60 variations (20
positions x 3 alternates at each position) in which the original
nucleotide is substituted with any of the three alternate
nucleotides. These oligonucleotides are then tested using the
methods described herein to determine their ability to inhibit
expression of HCV mRNA and/or HCV replication.
[0127] Conjugates
[0128] A further preferred substitution that can be appended to the
oligomeric compounds of the invention involves the linkage of one
or more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the resulting oligomeric
compounds. In one embodiment such modified oligomeric compounds are
prepared by covalently attaching conjugate groups to functional
groups such as hydroxyl or amino groups. Conjugate groups of the
invention include intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, polyethers, groups that enhance
the pharmacodynamic properties of oligomers, and groups that
enhance the pharmacokinetic properties of oligomers. Typical
conjugates groups include cholesterols, lipids, phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance
the pharmacodynamic properties, in the context of this invention,
include groups that improve oligomer uptake, enhance oligomer
resistance to degradation, and/or strengthen sequence-specific
hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that
improve oligomer uptake, distribution, metabolism or excretion.
Representative conjugate groups are disclosed in International
Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire
disclosure of which is incorporated herein by reference. Conjugate
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Let., 1994, 4, 1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330;
Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glyc- ero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937.
[0129] The oligomeric compounds of the invention may also be
conjugated to active drug substances, for example, aspirin,
warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen,
ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in U.S. patent application Ser. No.
09/334,130 (filed Jun. 15, 1999) which is incorporated herein by
reference in its entirety.
[0130] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0131] Chimeric Oligomeric Compounds
[0132] It is not necessary for all positions in an oligomeric
compound to be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
oligomeric compound or even at a single monomeric subunit such as a
nucleoside within a oligomeric compound. The present invention also
includes oligomeric compounds which are chimeric oligomeric
compounds. "Chimeric" oligomeric compounds or "chimeras," in the
context of this invention, are oligomeric compounds that contain
two or more chemically distinct regions, each made up of at least
one monomer unit, i.e., a nucleotide in the case of a nucleic acid
based oligomer.
[0133] Chimeric oligomeric compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
oligomeric compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
inhibition of gene expression. Consequently, comparable results can
often be obtained with shorter oligomeric compounds when chimeras
are used, compared to for example phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0134] Chimeric oligomeric compounds of the invention may be formed
as composite structures of two or more oligonucleotides,
oligonucleotide analogs, oligonucleosides and/or oligonucleotide
mimetics as described above. Such oligomeric compounds have also
been referred to in the art as hybrids hemimers, gapmers or
inverted gapmers. Representative United States patents that teach
the preparation of such hybrid structures include, but are not
limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0135] 3'-Endo Modifications
[0136] In one aspect of the present invention oligomeric compounds
include nucleosides synthetically modified to induce a 3'-endo
sugar conformation. A nucleoside can incorporate synthetic
modifications of the heterocyclic base, the sugar moiety or both to
induce a desired 3'-endo sugar conformation. These modified
nucleosides are used to mimic RNA like nucleosides so that
particular properties of an oligomeric compound can be enhanced
while maintaining the desirable 3'-endo conformational geometry.
There is an apparent preference for an RNA type duplex (A form
helix, predominantly 3'-endo) as a requirement (e.g. trigger) of
RNA interference which is supported in part by the fact that
duplexes composed of 2'-deoxy-2'-F-nucleosides appears efficient in
triggering RNAi response in the C. elegans system. Properties that
are enhanced by using more stable 3'-endo nucleosides include but
aren't limited to modulation of pharmacokinetic properties through
modification of protein binding, protein off-rate, absorption and
clearance; modulation of nuclease stability as well as chemical
stability; modulation of the binding affinity and specificity of
the oligomer (affinity and specificity for enzymes as well as for
complementary sequences); and increasing efficacy of RNA cleavage.
The present invention provides oligomeric triggers of RNAi having
one or more nucleosides modified in such a way as to favor a
C3'-endo type conformation. 11
[0137] Nucleoside conformation is influenced by various factors
including substitution at the 2', 3' or 4'-positions of the
pentofuranosyl sugar. Electronegative substituents generally prefer
the axial positions, while sterically demanding substituents
generally prefer the equatorial positions (Principles of Nucleic
Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation
can be achieved while maintaining the 2'-OH as a recognition
element, as illustrated in FIG. 2, below (Gallo et al., Tetrahedron
(2001), 57, 5707-5713. Harry-O'kuru et al., J. Org. Chem., (1997),
62(6), 1754-1759 and Tang et al., J. Org. Chem. (1999), 64,
747-754.) Alternatively, preference for the 3'-endo conformation
can be achieved by deletion of the 2'-OH as exemplified by
2'deoxy-2.degree. F.-nucleosides (Kawasaki et al., J. Med. Chem.
(1993), 36, 831-841), which adopts the 3'-endo conformation
positioning the electronegative fluorine atom in the axial
position. Other modifications of the ribose ring, for example
substitution at the 4'-position to give 4'-F modified nucleosides
(Guillerm et al., Bioorganic and Medicinal Chemistry Letters
(1995), 5, 1455-1460 and Owen et al., J. Org. Chem. (1976), 41,
3010-3017), or for example modification to yield methanocarba
nucleoside analogs (Jacobson et al., J. Med. Chem. Lett. (2000),
43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry
Letters (2001), 11, 1333-1337) also induce preference for the
3'-endo conformation. Along similar lines, oligomeric triggers of
RNAi response might be composed of one or more nucleosides modified
in such a way that conformation is locked into a C3'-endo type
conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem.
Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids
(ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters
(2002), 12, 73-76.) Examples of modified nucleosides amenable to
the present invention are shown below in Table I. These examples
are meant to be representative and not exhaustive.
1TABLE I 12 13 14 15 16 17 18
[0138] The preferred conformation of modified nucleosides and their
oligomers can be estimated by various methods such as molecular
dynamics calculations, nuclear magnetic resonance spectroscopy and
CD measurements. Hence, modifications predicted to induce RNA like
conformations, A-form duplex geometry in an oligomeric context, are
selected for use in the modified oligonucleotides of the present
invention. The synthesis of numerous of the modified nucleosides
amenable to the present invention are known in the art (see for
example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed.
Leroy B. Townsend, 1988, Plenum press., and the examples section
below.) Nucleosides known to be inhibitors/substrates for RNA
dependent RNA polymerases (for example HCV NS5B
[0139] In one aspect, the present invention is directed to
oligonucleotides that are prepared having enhanced properties
compared to native RNA against nucleic acid targets. A target is
identified and an oligonucleotide is selected having an effective
length and sequence that is complementary to a portion of the
target sequence. Each nucleoside of the selected sequence is
scrutinized for possible enhancing modifications. A preferred
modification would be the replacement of one or more RNA
nucleosides with nucleosides that have the same 3'-endo
conformational geometry. Such modifications can enhance chemical
and nuclease stability relative to native RNA while at the same
time being much cheaper and easier to synthesize and/or incorporate
into an oligonucleotide. The selected sequence can be further
divided into regions and the nucleosides of each region evaluated
for enhancing modifications that can be the result of a chimeric
configuration. Consideration is also given to the 5' and 3'-termini
as there are often advantageous modifications that can be made to
one or more of the terminal nucleosides. The oligomeric compounds
of the present invention include at least one 5'-modified phosphate
group on a single strand or on at least one 5'-position of a double
stranded sequence or sequences. Further modifications are also
considered such as internucleoside linkages, conjugate groups,
substitute sugars or bases, substitution of one or more nucleosides
with nucleoside mimetics and any other modification that can
enhance the selected sequence for its intended target. The terms
used to describe the conformational geometry of homoduplex nucleic
acids are "A Form" for RNA and "B Form" for DNA. The respective
conformational geometry for RNA and DNA duplexes was determined
from X-ray diffraction analysis of nucleic acid fibers (Arnott and
Hukins, Biochem. Biophys. Res. Comm., 1970, 47, 1504.) In general,
RNA:RNA duplexes are more stable and have higher melting
temperatures (Tm's) than DNA:DNA duplexes (Sanger et al.,
Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New
York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815;
Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The
increased stability of RNA has been attributed to several
structural features, most notably the improved base stacking
interactions that result from an A-form geometry (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2'
hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e.,
also designated as Northern pucker, which causes the duplex to
favor the A-form geometry. In addition, the 2' hydroxyl groups of
RNA can form a network of water mediated hydrogen bonds that help
stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35,
8489-8494). On the other hand, deoxy nucleic acids prefer a C2'
endo sugar pucker, i.e., also known as Southern pucker, which is
thought to impart a less stable B-form geometry (Sanger, W. (1984)
Principles of Nucleic Acid Structure, Springer-Verlag, New York,
N.Y.). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and 04'-endo pucker. This is consistent with
Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who
pointed out that in considering the furanose conformations which
give rise to B-form duplexes consideration should also be given to
a O4'-endo pucker contribution.
[0140] DNA:RNA hybrid duplexes, however, are usually less stable
than pure RNA:RNA duplexes, and depending on their sequence may be
either more or less stable than DNA:DNA duplexes (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid
duplex is intermediate between A- and B-form geometries, which may
result in poor stacking interactions (Lane et al., Eur. J.
Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993,
233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of
the duplex formed between a target RNA and a synthetic sequence is
central to therapies such as but not limited to antisense and RNA
interference as these mechanisms require the binding of a synthetic
oligonucleotide strand to an RNA target strand. In the case of
antisense, effective inhibition of the mRNA requires that the
antisense DNA have a very high binding affinity with the mRNA.
Otherwise the desired interaction between the synthetic
oligonucleotide strand and target mRNA strand will occur
infrequently, resulting in decreased efficacy.
[0141] One routinely used method of modifying the sugar puckering
is the substitution of the sugar at the 2'-position with a
substituent group that influences the sugar geometry. The influence
on ring conformation is dependant on the nature of the substituent
at the 2'-position. A number of different substituents have been
studied to determine their sugar puckering effect. For example,
2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the
2'-iodo exhibits the lowest population (7%). The populations of
adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively. Furthermore, the effect of the 2'-fluoro group of
adenosine dimers
(2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosin- e) is
further correlated to the stabilization of the stacked
conformation.
[0142] As expected, the relative duplex stability can be enhanced
by replacement of 2'-OH groups with 2'-F groups thereby increasing
the C3'-endo population. It is assumed that the highly polar nature
of the 2'-F bond and the extreme preference for C3'-endo puckering
may stabilize the stacked conformation in an A-form duplex. Data
from UV hypochromicity, circular dichroism, and .sup.1H NMR also
indicate that the degree of stacking decreases as the
electronegativity of the halo substituent decreases. Furthermore,
steric bulk at the 2'-position of the sugar moiety is better
accommodated in an A-form duplex than a B-form duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate
is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen
bonding capabilities. These substituent effects are thought to be
determined by the molecular size, electronegativity, and
hydrophobicity of the substituent. Melting temperatures of
complementary strands is also increased with the 2'-substituted
adenosine diphosphates. It is not clear whether the 3'-endo
preference of the conformation or the presence of the substituent
is responsible for the increased binding. However, greater overlap
of adjacent bases (stacking) can be achieved with the 3'-endo
conformation.
[0143] One synthetic 2'-modification that imparts increased
nuclease resistance and a very high binding affinity to nucleotides
is the 2-methoxyethoxy (2'-MOE, 2'-OCH.sub.2CH.sub.2OCH.sub.3) side
chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One
of the immediate advantages of the 2'-MOE substitution is the
improvement in binding affinity, which is greater than many similar
2' modifications such as O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-O-methoxyethyl substituent also have
been shown to be antisense inhibitors of gene expression with
promising features for in vivo use (Martin, P., Helv. Chim. Acta,
1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176;
Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and
Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
Relative to DNA, the oligonucleotides having the 2'-MOE
modification displayed improved RNA affinity and higher nuclease
resistance. Chimeric oligonucleotides having 2'-MOE substituents in
the wing nucleosides and an internal region of
deoxy-phosphorothioate nucleotides (also termed a gapped
oligonucleotide or gapmer) have shown effective reduction in the
growth of tumors in animal models at low doses. 2'-MOE substituted
oligonucleotides have also shown outstanding promise as antisense
agents in several disease states. One such MOE substituted
oligonucleotide is presently being investigated in clinical trials
for the treatment of CMV retinitis.
[0144] Chemistries Defined
[0145] Unless otherwise defined herein, alkyl means
C.sub.1-C.sub.12, preferably C.sub.1-C.sub.8, and more preferably
C.sub.1-C.sub.6, straight or (where possible) branched chain
aliphatic hydrocarbyl.
[0146] Unless otherwise defined herein, heteroalkyl means
C.sub.1C.sub.12, preferably C.sub.1-C.sub.8, and more preferably
C.sub.1-C.sub.6, straight or (where possible) branched chain
aliphatic hydrocarbyl containing at least one, and preferably about
1 to about 3, hetero atoms in the chain, including the terminal
portion of the chain. Preferred heteroatoms include N, O and S.
[0147] Unless otherwise defined herein, cycloalkyl means
C.sub.3C.sub.12, preferably C.sub.3-C.sub.8, and more preferably
C.sub.3-C.sub.6, aliphatic hydrocarbyl ring.
[0148] Unless otherwise defined herein, alkenyl means
C.sub.2-C.sub.12, preferably C.sub.2-C.sub.8, and more preferably
C.sub.2-C.sub.6 alkenyl, which may be straight or (where possible)
branched hydrocarbyl moiety, which contains at least one
carbon-carbon double bond.
[0149] Unless otherwise defined herein, alkynyl means
C.sub.2-C.sub.12, preferably C.sub.2-C.sub.8, and more preferably
C.sub.2-C.sub.6 alkynyl, which may be straight or (where possible)
branched hydrocarbyl moiety, which contains at least one
carbon-carbon triple bond.
[0150] Unless otherwise defined herein, heterocycloalkyl means a
ring moiety containing at least three ring members, at least one of
which is carbon, and of which 1, 2 or three ring members are other
than carbon. Preferably the number of carbon atoms varies from 1 to
about 12, preferably 1 to about 6, and the total number of ring
members varies from three to about 15, preferably from about 3 to
about 8. Preferred ring heteroatoms are N, O and S. Preferred
heterocycloalkyl groups include morpholino, thiomorpholino,
piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl,
homomorpholino, homothiomorpholino, pyrrolodinyl,
tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl,
tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and
tetrahydroisothiazolyl.
[0151] Unless otherwise defined herein, aryl means any hydrocarbon
ring structure containing at least one aryl ring. Preferred aryl
rings have about 6 to about 20 ring carbons. Especially preferred
aryl rings include phenyl, napthyl, anthracenyl, and
phenanthrenyl.
[0152] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least one fully unsaturated ring, the ring consisting
of carbon and non-carbon atoms. Preferably the ring system contains
about 1 to about 4 rings. Preferably the number of carbon atoms
varies from 1 to about 12, preferably 1 to about 6, and the total
number of ring members varies from three to about 15, preferably
from about 3 to about 8. Preferred ring heteroatoms are N, O and S.
Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl,
imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl,
quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl,
etc.
[0153] Unless otherwise defined herein, where a moiety is defined
as a compound moiety, such as hetarylalkyl (hetaryl and alkyl),
aralkyl (aryl and alkyl), etc., each of the sub-moieties is as
defined herein.
[0154] Unless otherwise defined herein, an electron withdrawing
group is a group, such as the cyano or isocyanato group that draws
electronic charge away from the carbon to which it is attached.
Other electron withdrawing groups of note include those whose
electronegativities exceed that of carbon, for example halogen,
nitro, or phenyl substituted in the ortho- or para-position with
one or more cyano, isothiocyanato, nitro or halo groups.
[0155] Unless otherwise defined herein, the terms halogen and halo
have their ordinary meanings. Preferred halo (halogen) substituents
are Cl, Br, and I. The aforementioned optional substituents are,
unless otherwise herein defined, suitable substituents depending
upon desired properties. Included are halogens (Cl, Br, I), alkyl,
alkenyl, and alkynyl moieties, NO.sub.2, NH.sub.3 (substituted and
unsubstituted), acid moieties (e.g. --CO.sub.2H,
--OSO.sub.3H.sub.2, etc.), heterocycloalkyl moieties, hetaryl
moieties, aryl moieties, etc.
[0156] In all the preceding formulae, the squiggle (.about.)
indicates a bond to an oxygen or sulfur of the 5'-phosphate.
[0157] Phosphate protecting groups include those described in U.S.
Pat. No. 5,760,209, US 5,614,621, US 6,051,699, US 6,020,475, US
6,326,478, US 6,169,177, US 6,121,437, US 6,465,628 each of which
is expressly incorporated herein by reference in its entirety.
[0158] Affinity of an oligonucleotide for its target (in this case
a nucleic acid encoding HCV RNA) is routinely determined by
measuring the Tm of an oligonucleotide/target pair, which is the
temperature at which the oligonucleotide and target dissociate;
dissociation is detected spectrophotometrically. The higher the Tm,
the greater the affinity of the oligonucleotide for the target. In
a more preferred embodiment, the region of the oligonucleotide
which is modified to increase HCV RNA binding affinity comprises at
least one nucleotide modified at the 2' position of the sugar, most
preferably a 2'-O-alkyl or 2'-fluoro-modified nucleotide. Such
modifications are routinely incorporated into oligonucleotides and
these oligonucleotides have been shown to have a higher Tm (i.e.,
higher target binding affinity) than 2'-deoxyoligonucleotides
against a given target. The effect of such increased affinity is to
greatly enhance antisense oligonucleotide inhibition of HCV RNA
function. RNAse H is a cellular endonuclease that cleaves the RNA
strand of RNA:DNA duplexes; activation of this enzyme therefore
results in cleavage of the RNA target, and thus can greatly enhance
the efficiency of antisense inhibition. Cleavage of the RNA target
can be routinely demonstrated by gel electrophoresis. In another
preferred embodiment, the chimeric oligonucleotide is also modified
to enhance nuclease resistance. Cells contain a variety of exo- and
endo-nucleases which can degrade nucleic acids. A number of
nucleotide and nucleoside modifications have been shown to make the
oligonucleotide into which they are incorporated more resistant to
nuclease digestion than the native oligodeoxynucleotide. Nuclease
resistance is routinely measured by incubating oligonucleotides
with cellular extracts or isolated nuclease solutions and measuring
the extent of intact oligonucleotide remaining over time, usually
by gel electrophoresis. Oligonucleotides which have been modified
to enhance their nuclease resistance survive intact for a longer
time than unmodified oligonucleotides. A variety of oligonucleotide
modifications have been demonstrated to enhance or confer nuclease
resistance. In some cases, oligonucleotide modifications which
enhance target binding affinity are also, independently, able to
enhance nuclease resistance. Oligonucleotides which contain at
least one phosphorothioate modification are presently more
preferred.
[0159] The compounds of the present invention include bioequivalent
compounds, including pharmaceutically acceptable salts and
prodrugs.
[0160] The compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to pharmaceutically
acceptable salts of the nucleic acids of the invention and prodrugs
of such nucleic acids. Pharmaceutically acceptable salts are
physiologically and pharmaceutically acceptable salts of the
nucleic acids of the invention, i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0161] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci. 1977, 66:1). The base
addition salts of said acidic compounds are prepared by contacting
the free acid form with a sufficient amount of the desired base to
produce the salt in the conventional manner. The free acid form may
be regenerated by contacting the salt form with an acid and
isolating the free acid in the conventional manner. The free acid
forms differ from their respective salt forms somewhat in certain
physical properties such as solubility in polar solvents, but
otherwise the salts are equivalent to their respective free acid
for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric
acid; with organic carboxylic, sulfonic, sulfo or phospho acids or
N-substituted sulfamic acids, for example acetic acid, propionic
acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic
acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid,
lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic
acid, citric acid, benzoic acid, cinnamic acid, mandelic acid,
salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid,
2-acetoxybenzoic acid, nicotinic acid or isonicotinic acid; and
with amino acids, such as the 20 alpha-amino acids involved in the
synthesis of proteins in nature, for example glutamic acid or
aspartic acid, and also with phenylacetic acid, methanesulfonic
acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid,
ethane-1,2-disulfonic acid, benzenesulfonic acid,
4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid,
naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate,
glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation
of cyclamates), or with other acid organic compounds, such as
ascorbic acid.
[0162] Pharmaceutically acceptable salts of compounds may also be
formed with a pharmaceutically acceptable cation. Suitable
pharmaceutically acceptable cations are well known to those skilled
in the art and include alkaline, alkaline earth, ammonium and
quaternary ammonium cations. Carbonates or hydrogen carbonates are
also possible.
[0163] For oligonucleotides, examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as acetic acid, oxalic acid, tartaric acid, succinic acid,
maleic acid, fumaric acid, gluconic acid, citric acid, malic acid,
ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic
acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic
acid, p-toluenesulfonic acid, naphthalenedisulfonic acid,
polygalacturonic acid, and the like; and (d) salts formed from
elemental anions such as chlorine, bromine, and iodine.
[0164] The oligonucleotides of the invention may additionally or
alternatively be prepared to be delivered in a prodrug form. The
term "prodrug" indicates a therapeutic agent that is prepared in an
inactive form that is converted to an active form (i.e., drug)
within the body or cells thereof by the action of endogenous
enzymes or other chemicals and/or conditions. In particular,
prodrug versions of the oligonucleotides of the invention are
prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives
according to the methods disclosed in WO 93/24510 to Gosselin et
al., published Dec. 9, 1993.
[0165] The oligonucleotides in accordance with this invention
preferably are from about 5 to about 50 nucleotides in length. In
the context of this invention it is understood that this
encompasses non-naturally occurring oligomers as hereinbefore
described, having 5 to 50 monomers.
[0166] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed; the actual synthesis
of the oligonucleotides is well within the talents of the
routineer. It is also well known to use similar techniques to
prepare other oligonucleotides such as the phosphorothioates and
alkylated derivatives. It is also well known to use similar
techniques and commercially available modified amidites and
controlled-pore glass (CPG) products such as those available from
Glen Research, Sterling, Va., to synthesize modified
oligonucleotides such as cholesterol-modified oligonucleotides.
[0167] Methods of modulating the activity of HCV virus are
provided, in which the virus, or cells, tissues or bodily fluid
suspected of containing the virus, is contacted with an
oligonucleotide of the invention. In the context of this invention,
to "contact" means to add the oligonucleotide to a preparation of
the virus, or vice versa, or to add the oligonucleotide to a
preparation or isolate of cells, tissues or bodily fluid, or vice
versa, or to add the oligonucleotide to virus, cells tissues or
bodily fluid in situ, i.e., in an animal, especially a human.
[0168] The oligonucleotides of this invention can be used in
diagnostics, therapeutics and as research reagents and kits. Since
the oligonucleotides of this invention hybridize to RNA from HCV,
sandwich and other assays can easily be constructed to exploit this
fact. Provision of means for detecting hybridization of
oligonucleotide with HCV or HCV RNA present in a sample suspected
of containing it can routinely be accomplished. Such provision may
include enzyme conjugation, radiolabelling or any other suitable
detection systems. Kits for detecting the presence or absence of
HCV may also be prepared. The specific ability of the
oligonucleotides of the invention to inhibit HCV RNA function can
also be exploited in the detection and diagnosis of HCV, HCV
infection and HCV-associated diseases. As described in the examples
of the present application, the decrease in HCV RNA or protein
levels as a result of oligonucleotide inhibition of HCV RNA
function can be routinely detected, for example by RT-PCR, Northern
blot, Western blot or ELISA.
[0169] For prophylactics and therapeutics, methods of preventing
HCV-associated disease and of treating HCV infection and
HCV-associated disease are provided. The formulation of therapeutic
compositions and their subsequent administration is believed to be
within the skill in the art. Oligonucleotides may be formulated in
a pharmaceutical composition, which may include carriers,
thickeners, diluents, buffers, preservatives, surface active
agents, liposomes or lipid formulations and the like in addition to
the oligonucleotide. Pharmaceutical compositions may also include
one or more active ingredients such as antiviral agents (e.g.
interferons, PEG-interferons, ribavirin), antimicrobial agents,
anti-inflammatory agents, anesthetics, and the like. In a preferred
embodiment, the antiviral agent is interferon-.alpha..sub.2b. ISIS
14803 may be administered in combination with one or more of these
agents. In a preferred embodiment, ISIS 14803 is administered in
combination with is interferon-.alpha..sub.2b and ribavirin. Since
HCV patients with high viral load don't respond as well to
PEG-interferon/ribavirin as do patients with lower viral load, ISIS
14803 is adminstered first to lower the viral load, followed by
PEG-interferon administration. In an alternate embodiment,
PEG-interferon/ribavirin is administered first, followed bt ISIS
14803. Lastly, PEG-interferon, ribavirin and ISIS 14803 may be
administered at the same time (triple combination therapy).
[0170] Formulations for parenteral administration may include
sterile aqueous solutions which may also contain buffers,
liposomes, diluents and other suitable additives.
[0171] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, epidermal and transdermal), oral or parenteral.
Parenteral administration includes intravenous drip, subcutaneous,
intraperitoneal or intramuscular injection, pulmonary
administration, e.g., by inhalation or insufflation, or
intracranial, e.g., intrathecal or intraventricular,
administration. For oral administration, it has been found that
oligonucleotides with at least one 2'-substituted ribonucleotide
are particularly useful because of their absorption and
distribution characteristics. U.S. Pat. No. 5,591,721 issued to
Agrawal et al. Oligonucleotides with at least one 2'-O-methoxyethyl
modification are believed to be particularly useful for oral
administration.
[0172] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0173] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be desirable.
Compositions for oral administration also include pulsatile
delivery compositions and bioadhesive composition as described in
copending U.S. patent application Ser. No. 09/944,493, filed Aug.
22, 2001, and Ser. No. 09/935,316, filed Aug. 22, 2001, the entire
disclosures of which are incorporated herein by reference.
[0174] Compositions for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives.
[0175] Dosing is dependent on severity and responsiveness of the
condition to be treated, with course of treatment lasting from
several days to several months or until a reduction in viral titer
(routinely measured by Western blot, ELISA, RT-PCR, or RNA
(Northern) blot, for example) is effected or a diminution of
disease state is achieved. Optimal dosing schedules are easily
calculated from measurements of drug accumulation in the body.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Therapeutically or
prophylactically effective amounts (dosages) may vary depending on
the relative potency of individual compositions, and can generally
be routinely calculated based on molecular weight and EC50s in in
vitro and/or animal studies. For example, given the molecular
weight of drug compound (derived from oligonucleotide sequence and
chemical structure) and an experimentally derived effective dose
such as an IC.sub.50, for example, a dose in mg/kg is routinely
calculated. In general, dosage is from 0.001 .mu.g to 100 g and may
be administered once or several times daily, weekly, monthly or
yearly, or even every 2 to 20 years.
[0176] Pharmacokinetics of Antisense Oligonucleotides
[0177] Because the primary pathology associated with HCV infection
occurs in the liver of infected individuals, the ability of a
potential anti-HCV compound to achieve significant concentrations
in the liver is advantageous. Pharmacokinetic profiles for a number
of oligonucleotides, primarily phosphorothioate oligonucleotides,
have been determined. Phosphorothioate oligonucleotides have been
shown to have very similar pharmacokinetics and tissue
distribution, regardless of sequence. This is characterized in
plasma by a rapid distribution phase (approximately 30 minutes) and
a prolonged elimination phase (approximately 40 hours).
Phosphorothioates are found to be broadly distributed to peripheral
tissues (i.e., excepting the brain, which is reachable directly,
e.g., by intraventricular drug administration, and in addition may
be reachable via a compromised blood-brain barrier in many nervous
system conditions), with the highest concentrations found in liver,
renal cortex and bone marrow. There is good accumulation of intact
compound in most tissues, particularly liver, kidney and bone
marrow, with very extended compound half-life in tissues. Similar
distribution profiles are found whether the oligonucleotide is
administered intravenously or subcutaneously. Furthermore, the
pharmacokinetic and tissue distribution profiles are very
consistent among animal species, including rodents, monkeys and
humans.
PREFERRED EMBODIMENTS OF THE INVENTION
[0178] It has been found that antisense oligonucleotides designed
to target viruses can be effective in diminishing viral
infection.
[0179] In accordance with this invention, persons of ordinary skill
in the art will understand that messenger RNA includes not only the
sequence information to encode a protein using the three letter
genetic code, but also associated ribonucleotides which form
regions known to such persons as the 5'-untranslated region, the
3'-untranslated region, and the 5' cap region, as well as
ribonucleotides which form various secondary structures. Thus,
oligonucleotides may be formulated in accordance with this
invention which are targeted wholly or in part to these associated
ribonucleotides as well as to the coding ribonucleotides. In
preferred embodiments, the oligonucleotide is specifically
hybridizable with the HCV 5' end hairpin loop, 5' end 6-base-pair
repeats, ORF 3 translation initiation codon, (all of which are
contained within the 5' UTR) polyprotein translation initiation
codon, core protein coding region (both of which are contained
within the coding region), R2 region, 3' hairpin loop or 3' end
palindrome region (all of which are contained within the
3'-untranslated region). It is to be expected that differences in
the RNA of HCV from different strains and from different types
within a strain exist. It is believed that the regions of the
various HCV strains serve essentially the same function for the
respective strains and that interference with homologous or
analogous RNA regions will afford similar results in the various
strains. This is believed to be so even though differences in the
nucleotide sequences among the strains exist.
[0180] Accordingly, nucleotide sequences set forth in the present
specification will be understood to be representational for the
particular strain being described. Homologous or analogous
sequences for different strains of HCV are specifically
contemplated as being within the scope of this invention. In
preferred embodiments of the present invention, antisense
oligonucleotides are targeted to the 5' untranslated region, core
protein translation initiation codon region, core protein coding
region, ORF 3 translation initiation codon and 3'-untranslated
region of HCV RNA.
[0181] In preferred embodiments, the antisense oligonucleotides are
hybridizable with at least a portion of the polyprotein translation
initiation codon or with at least a portion of the core protein
coding region. The sequence of nucleotides 1-686 (SEQ ID NO: 37)
comprises the entire 5'-untranslated region (nucleotides 1-341) and
a 145-nucleotide core region sequence of HCV RNA. A highly
preferred oligonucleotide hybridizable with at least a portion of
the polyprotein translation initiation codon comprises SEQ ID NO:
6.
[0182] In Vitro Evaluation of HCV Antisense Oligonucleotides
[0183] HCV replication in cell culture has not yet been achieved.
Consequently, in vitro translation assays are used to evaluate
antisense oligonucleotides for anti-HCV activity. One such in vitro
translation assay was used to evaluate oligonucleotide compounds
for the ability to inhibit synthesis of HCV 5' UTR-core-env
transcript in a rabbit reticulocyte assay.
[0184] Cell-based assays are also used for evaluation of
oligonucleotides for anti-HCV activity. In one such assay, effects
of oligonucleotides on HCV RNA function are evaluated by measuring
RNA and/or HCV core protein levels in transformed hepatocytes
expressing the 5'end of the HCV genome. Recombinant HCV/vaccinia
virus assays can also be used, such as those described in the
examples of the present application. Luciferase assays can be used,
for example, as described in the examples of the present
application, in which recombinant vaccinia virus containing HCV
sequences fused to luciferase sequences are used. Quantitation of
luciferase with a luminometer is a simple way of measuring HCV core
protein expression and its inhibition by antisense compounds. This
can be done in cultured hepatocytes or in tissue samples, such as
liver biopsies, from treated animals.
[0185] Animal Models for HCV
[0186] There is no small animal model for chronic HCV infection. A
recombinant vaccinia/HCV/luciferase virus expression assay has been
developed for testing compounds in mice. Mice are inoculated with
recombinant vaccinia virus (either expressing HCV/luciferase or
luciferase alone for a control). Organs (particularly liver) are
harvested one or more days later and luciferase activity in the
tissue is assayed by luminometry.
[0187] The following specific examples are provided for
illustrative purposes only and are not intended to limit the
invention.
EXAMPLES
Example 1
Oligonucleotide Synthesis
[0188] Unmodified oligodeoxynucleotides were synthesized on an
automated DNA synthesizer (Applied Biosystems model 380B) using
standard phosphoramidite chemistry with oxidation by iodine.
.beta.-cyanoethyldiisopropyl-phosphoramidites were purchased from
Applied Biosystems (Foster City, Calif.). For phosphorothioate
oligonucleotides, the standard oxidation bottle was replaced by a
0.2 M solution of .sup.3H-1,2-benzodithiole-3-one 1,1-dioxide in
acetonitrile for the stepwise thiation of the phosphite linkages.
The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step.
[0189] 2'-methoxy oligonucleotides were synthesized using
2'-methoxy .beta.-cyanoethyldiisopropyl-phosphoramidites
(Chemgenes, Needham Mass.) and the standard cycle for unmodified
oligonucleotides, except the wait step after pulse delivery of
tetrazole and base was increased to 360 seconds. Other 2'-alkoxy
oligonucleotides were synthesized by a modification of this method,
using appropriate 2'-modified amidites such as those available from
Glen Research, Inc., Sterling, Va.
[0190] 2'-fluoro oligonucleotides were synthesized as described in
Kawasaki et al., J. Med. Chem. 1993, 36, 831. Briefly, the
protected nucleoside N.sup.6-benzoyl-2'-deoxy-2'-fluoroadenosine
was synthesized utilizing commercially available
9-8-D-arabinofuranosyladenine as starting material and by modifying
literature procedures whereby the 2'-"-fluoro atom is introduced by
a S.sub.N2-displacement of a 2'-8-O-trifyl group. Thus
N.sup.6-benzoyl-9-8-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
[0191] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-8-D-arabinofuranosylguanine as starting material, and conversion
to the intermediate diisobutyrylarabinofuranosylguanosine.
Deprotection of the TPDS group was followed by protection of the
hydroxyl group with THP to give diisobutyryl di-THP protected
arabinofuranosylguanine. Selective O-deacylation and triflation was
followed by treatment of the crude product with fluoride, then
deprotection of the THP groups. Standard methodologies were used to
obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidi- tes.
[0192] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-8-D-arabin- ofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0193] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N.sup.4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures
were used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0194] Oligonucleotides having methylene(methylimino) backbones are
synthesized according to U.S. Pat. No. 5,378,825, which is
coassigned to the assignee of the present invention and is
incorporated herein in its entirety. Other nitrogen-containing
backbones are synthesized according to WO 92/20823 which is also
coassigned to the assignee of the present invention and
incorporated herein in its entirety.
[0195] Oligonucleotides having amide backbones are synthesized
according to De Mesmaeker et al., Acc. Chem. Res. 1995, 28, 366.
The amide moiety is readily accessible by simple and well-known
synthetic methods and is compatible with the conditions required
for solid phase synthesis of oligonucleotides.
[0196] Oligonucleotides with morpholino backbones are synthesized
according to U.S. Pat. No. 5,034,506 (Summerton and Weller).
[0197] Peptide-nucleic acid (PNA) oligomers are synthesized
according to P. E. Nielsen et al., Science 1991, 254, 1497).
[0198] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides are
purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes
ethanol. Synthesized oligonucleotides were analyzed by
polyacrylamide gel electrophoresis on denaturing gels and judged to
be at least 85% full length material. The relative amounts of
phosphorothioate and phosphodiester linkages obtained in synthesis
were periodically checked by .sup.31p nuclear magnetic resonance
spectroscopy, and for some studies oligonucleotides were purified
by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266,
18162. Results obtained with HPLC-purified material were similar to
those obtained with non-HPLC purified material.
[0199] Oligonucleotides having 2'-O--CH.sub.2CH.sub.2OCH.sub.3
modified nucleotides were synthesized according to the method of
Martin. Helv. Chim. Acta 1995, 78, 486-504. All
2'-O--CH.sub.2CH.sub.2OCH.sub.3-cytosin- es were 5-methyl
cytosines, synthesized as follows:
[0200] Monomers:
[0201]
2,2'-Anhydro[1-(.beta.-D-arabinofuranosyl)-5-methyluridine]
[0202] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate
(90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were
added to DMF (300 mL). The mixture was heated to reflux, with
stirring, allowing the evolved carbon dioxide gas to be released in
a controlled manner. After 1 hour, the slightly darkened solution
was concentrated under reduced pressure. The resulting syrup was
poured into diethylether (2.5 L), with stirring. The product formed
a gum. The ether was decanted and the residue was dissolved in a
minimum amount of methanol (ca. 400 mL). The solution was poured
into fresh ether (2.5 L) to yield a stiff gum. The ether was
decanted and the gum was dried in a vacuum oven (60.degree. C. at 1
mm Hg for 24 h) to give a solid which was crushed to a light tan
powder (57 g, 85% crude yield). The material was used as is for
further reactions.
[0203] 2'-O-Methoxyethyl-5-methyluridine
[0204] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of
product.
[0205] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0206] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0207]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0208] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by tlc by first quenching the tlc
sample with the addition of MeOH. Upon completion of the reaction,
as judged by tlc, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/Hexane (4:1). Pure product
fractions were evaporated to yield 96 g (84%).
[0209]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine
[0210] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the later
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0211] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0212] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (tlc showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
[0213]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0214] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, tic showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/Hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0215]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine--
3'-amidite
[0216]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine (74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L)
Tetrazole diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (tic showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using
EtOAc.backslash.Hexane (3:1) as the eluting solvent. The pure
fractions were combined to give 90.6 g (87%) of the title
compound.
[0217] 5-methylcytidine DMT .beta.-cyanoethyl phosphoramidites are
commercially available from PerSeptive Biosystems (Framingham,
Mass.).
Example 2
Evaluation of Inhibitory Activity of Antisense Oligonucleotides
Which are Targeted to the Polyprotein Ranslation Initiation Codon
Region and Adjacent Core Protein Coding Region
[0218] (1) In order to evaluate the inhibitory activity of
antisense oligonucleotides which are complementary to the region
including the translation initiation codon (nucleotide number
342-344) of HCV-RNA and the adjacent core protein coding region, a
series of 20 mer antisense oligonucleotides were prepared which are
complementary to the region from nucleotide 320 to nucleotide 379.
These are named according to their target sequence on the HCV RNA,
i.e., the oligonucleotide name (e.g., 330) is the number of the
5'-most nucleotide of the corresponding HCV RNA target sequence
shown in SEQ ID NO: 37. Accordingly, oligonucleotide 330 is
targeted to nucleotides 330-349 of the HCV RNA shown in SEQ ID NO:
37. Of these oligonucleotides, oligonucleotides 324 through 344
contain all or part of the sequence CAT which is complementary to
the AUG initiation codon itself. The nucleotide sequence of these
antisense oligonucleotides are shown in Table 1.
2TABLE 1 Antisense oligonucleotides to HCV % Inhi- SEQ ID Oligo
Sequence bition NO: 320 TGC ACG GTC TAC GAG ACC TC 3 1 322 GGT GCA
CGG TCT ACG AGA CC 5 2 324 ATG GTG CAC GGT CTA CGA GA 31 3 326 TCA
TGG TGC ACG GTC TAC GA 39 4 328 GCT CAT GGT GCA CGG TCT AC 71 5 330
GTG CTC ATG GTG CAC GGT CT 38 6 332 TCG TGC TCA TGG TGC ACG GT 5 7
334 ATT CGT GCT CAT GGT GCA CG 39 8 336 GGA TTC GTG CTC ATG GTG CA
98 9 338 TAG GAT TCG TGC TCA TGG TG 99 10 340 TTT AGG ATT CGT GCT
CAT GG 97 11 342 GGT TTA GGA TTC GTG CTC AT 96 12 344 GAG GTT TAG
GAT TCG TGC TC 99 13 344-i1 GAG GTT TAG GAT TIG TGC TC 95 14 344-i3
GIG GTT TIG GAI IIG TGC TC 90 15 344-i5 GIG GTT TIG GAI IIG TGC TC
51 16 346 TTG AGG TTT AGG ATT CGT GC 98 17 348 CTT TGA GGT TTA GGA
TTC GT 98 18 350 TTC TTT GAG GTT TAG GAT TC 99 19 352 TTT TCT TTG
AGG TTT AGG AT 99 20 354 GTT TTT CTT TGA GGT TTA GG 91 21 356 TGG
TTT TTC TTT GAG GTT TA 86 22 358 TTT GGT TTT TCT TTG AGG TT 83 23
360 CGT TTG GTT TTT CTT TGA GG 81 24
[0219] The inhibitory activity of these 21 antisense
oligonucleotides was evaluated in the in vitro translation assay.
As shown in Table 1, antisense oligonucleotides 328, 336, 338, 340,
342, 344, 346, 348, 350, 352, 354, 356, 358 and 360 showed an
inhibitory activity of greater than 70%, and are preferred. Of
these, 336, 338, 340, 342, 344, 346, 348, 350 and 352 showed an
extremely high inhibitory activity of over 95% and are most
preferred.
[0220] The HCV target sequence regions complementary to the above 9
most active antisense oligonucleotides have in common the four
nucleotides from number 352 to 355 in the core protein coding
region near the polyprotein translation initiation codon. Thus, it
is preferred to target these four nucleotides in order to inhibit
the translation. Accordingly, oligonucleotides comprising the
sequence GGAT are preferred embodiments of the invention.
[0221] (2) Evaluation of antisense oligonucleotides in which the
nucleotides known to be variable among strains were replaced by
inosine:
[0222] It is known that in the nucleotide sequences in the core
protein coding region near the translation initiation codon,
variation of bases among strains occasionally occurs at nucleotides
350, 351, 352, 356 and 362. Based on this knowledge, it was studied
whether substitution of these bases by the "universal base" inosine
would be effective for inhibition of various viruses.
[0223] An antisense DNA, designated oligonucleotide 344-i1, was
prepared in which the base at base number 350 in oligonucleotide
344 was replaced by inosine. Likewise, an antisense DNA, designated
oligonucleotide 344-i3, in which three bases at base numbers 350,
356 and 362 were substituted by inosine, and an antisense DNA,
designated oligonucleotide 344-i5, in which five bases at base
numbers 350, 351, 352, 356, and 362 were substituted by inosine,
were prepared. The inhibitory activity of these antisense
oligonucleotides was evaluated in the in vitro translation assay.
As a result, oligonucleotides 344-i1 and 344-i3 showed high
inhibitory activity. Therefore, antisense oligonucleotides targeted
to nucleotides 344-363 of HCV RNA and which have three inosine
substituents or less are preferred. Their inhibitory activities are
shown in Table 1.
Example 3
Evaluation of Oligonucleotides 120, 330 and 340 and Truncated
Versions of Oligonucleotides 120, 260, 330 and 340 in H8Ad17 Cell
Assay for Effects on HCV RNA Levels
[0224] The anti-HCV activity of P.dbd.S oligonucleotides 120, 330
and 340 was evaluated in H8Ad17 cells as follows.
[0225] An expression plasmid containing a gene (1.3 kb) coding for
5' NCR-core-env region of HCV gene was prepared by conventional
methods and transfected into a liver cell strain (H8Ad17) by
lipofection according to standard methods. The desired liver cell
transformant, which expressed HCV core protein, was obtained.
[0226] HCV RNA was isolated and quantitated by Northern blot
analysis to determine levels of expression. Core protein expression
could also be detected by ELISA method using an anti-HCV core-mouse
monoclonal antibody as the solid phase antibody; an anti-HCV human
polyclonal antibody as the primary antibody; and an HRP
(horseradish peroxidase) conjugated anti-human IgG-mouse monoclonal
antibody as the secondary antibody.
[0227] The liver cell transformant (2.5.times.10.sup.5 cells) were
inoculated on 6-well plates. To each plate was added each of the
above-obtained five antisense oligonucleotides (each at a
concentration of 5 .mu.M). After two days, the cells were harvested
and counted. The cells were washed once and lysed, and the
inhibitory activity was measured by Northern blot. The inhibitory
activities of the P.dbd.S antisense oligonucleotides were
calculated, compared to control without antisense
oligonucleotide.
[0228] As before, the oligonucleotide number is the number of the
5'-most nucleotide of the corresponding HCV RNA target sequence
shown in SEQ ID NO: 37. For example, oligonucleotide 120 is a 20
mer targeted to nucleotides 120-139 of HCV RNA. Each of these
compounds induced reduction in HCV RNA levels at doses of 0.5 .mu.M
and 0.17 .mu.M. These three compounds (P.dbd.S 20 mers 120, 330 and
340) are therefore highly preferred. 15 mer versions (truncated at
by 5 nucleotides at either the 3' or 5' end) induced a reduction of
HCV RNA at the 0.5 .mu.M dose. These compounds are therefore
preferred. 10 mers did not show sequence-specific inhibition at
either dose.
[0229] A number of shortened analogs of oligonucleotide 330 were
also synthesized as phosphorothioates and evaluated for effects on
HCV RNA levels in the same manner. The sequence of oligonucleotide
330 was truncated at one or both ends. These oligonucleotides are
shown in Table 2. Oligonucleotide concentration was 100 nM.
3TABLE 2 Activity % SEQ ID Oligo Sequence control NO 330 GTG CTC
ATG GTG CAC GGT CT 30% 6 9559 GTG CTC ATG GTG CAC GGT 53 25 9557
GTG CTC ATG GTG CAC GG 52 26 9558 GTG CTC ATG GTG CAC G 66 27 9036
GTG CTC ATG GTG CAC 37 28 9035 GTG CTC ATG G 100 29 10471 G CTC ATG
GTG CAC GGT CT 27 30 10470 CTC ATG GTG CAC GGT CT 35 31 9038 C ATG
GTG CAC GGT CT 32 32 9034 T TG CAC GGT CT 82 33 10549 TG CTC ATG
GTG CAC GGT C 17 34 10550 G CTC ATG GTG CAC GGT 36 35
[0230] In this assay, oligonucleotides 9036, 10471, 10470, 9038,
10549 and 10550 gave greater than 50% inhibition of HCV RNA
expression and are therefore preferred.
Example 4
Evaluation of Oligos 259, 260 and 330 in the HCV H8Ad17 RNA
Assay
[0231] The anti-HCV activity of P.dbd.S and 2'-O-propyl/P.dbd.S
gapped oligonucleotides was evaluated in H8Ad17 cells as described
in Example 3. P.dbd.S oligonucleotides 259, 260 and 330 all induced
similar (approx 55%) reduction in HCV RNA levels in this assay,
using 170 nM oligonucleotide concentration. The 2'-O-propyl gapped
version of oligonucleotide 259 showed approximately 25% inhibition
of HCV RNA levels (170 nM oligo dose), but oligonucleotides 260 and
330 were not active as 2'-O-propyl gapped oligonucleotides in this
assay. In a previous assay of the same type, the gapped 2'-O-propyl
version of oligonucleotide 330 did induce a reduction of HCV RNA,
though less than was observed for the P.dbd.S 330
oligonucleotide.
Example 5
Evaluation of Oligos 259, 260 and 330 in an HCV H8Ad17 Protein
Assay
[0232] A Western blot assay employing affinity-purified human
polyclonal anti-HCV serum and .sup.125I-conjugated goat anti-human
IgG was developed in place of ELISA assays previously used to
evaluate effects of oligonucleotides on HCV core protein levels.
Six-well plates were seeded with H8 cells at 3.5.times.10.sup.5
cells/well. Cells were grown overnight. Cells were treated with
oligonucleotide in OPTIMEM.TM. containing 5 .mu.g/ml lipofectin for
4 hours. Cells were fed with 2 ml H8 medium and allowed to recover
overnight. To harvest cells, cells were washed once with 2 ml PBS,
lysed in 100 .mu.l Laemmli buffer and harvested by scraping. For
electrophoresis, cell lysates were boiled, and 10-14 .mu.l of cell
lysate was loaded on each lane of a 16% polyacrylamide gel. After
electrophoresing, proteins were transferred electrophoretically
onto PVDF membrane. The membrane was blocked in PBS containing 2%
goat serum and 0.3% TWEEN-20, and incubated overnight with primary
antibody (human anti-core antibody 2243 and rabbit anti-G3PDH
antibody). The membrane was washed 5.times.5 minutes in buffer,
then incubated with secondary antibodies for 4-8 hours
(.sup.125I-conjugated goat anti-human, and .sup.125I-conjugated
goat anti-rabbit). The membrane was washed 5.times.5 minutes in
buffer, sealed in plastic and exposed in a PhosphorImager cassette
overnight. Bands were quantitated on the PhosphorImager (Molecular
Dynamics, Sunnyvale Calif.), normalized to G3PDH expression levels,
and results were plotted as a percentage of control untreated
cells.
[0233] P.dbd.S and 2'-modified 330 oligonucleotides were evaluated
using this Western blot assay. These oligonucleotides are shown in
Table 3. In the sequences shown, capital letters represent base
sequence, small letters (o or s) represent internucleoside linkage,
either phosphodiester (P=O) or phosphorothioate (P.dbd.S),
respectively. Bold=2'-O-propyl. *=2'-O-butylimidazole.
+=2'-O-propylamine.
4TABLE 3 SEQ Oligo ID # Sequence NO 330
GsTsGsCsTsCsAsTsGsGsTsGsCsAsCsGsGsTsCsT 6 330
GsTsGsCsTsCsAsTsGsGsTsGsCsAsCsGsGsTsCsT 6 * * * * 330
GsTsGsCsTsCsAsTsGsGsTsGsCsAsCsGsGsTsCsT 6 + + + + 330
GsTsGsCsTsCsAsTsGsGsTsGsCsAsCsGsGsTsCsT 6
[0234] Cells were treated with oligonucleotide at doses of 25 nM,
100 nM or 400 nM. The greatest reduction in core protein (approx
90-95% at higher doses) was observed with the P.dbd.S
oligonucleotide. This compound is therefore highly preferred. The
2'-O-propyl gapped P.dbd.S oligonucleotide gave approximately 80%
inhibition of core protein expression. This compound is therefore
preferred. The 2'-O-propyl/P.dbd.O compound did not show activity
in this assay.
Example 6
Evaluation of Modified 330 Oligos in Cellular Assays
[0235] Oligonucleotides with the 330 sequence (SEQ ID NO: 6) and
containing various modifications [P.dbd.S deoxy; 2'-O-propyl
(uniform 2'-O-propyl or 2'-O-propyl gapped, both uniformly
P.dbd.S); or 2'-fluoro modifications (gapped or uniform, both
uniformly P.dbd.S)] were evaluated in the H8Ad17 core protein
Western blot assay compared to a scrambled phosphorothioate
control.
[0236] In this assay, the P.dbd.S oligonucleotide was consistently
the best, giving an average of 62.4% inhibition of HCV core protein
translation (n=7) compared to control. 2'-O-propyl and 2'-fluoro
gapped oligonucleotides gave over 50% inhibition in at least one
experiment. Uniformly 2'-fluoro or uniformly 2'-O-propyl
oligonucleotides were inactive in this experiment.
[0237] In this assay, the P.dbd.S oligonucleotides were
consistently the best and are preferred. Of these, P.dbd.S
oligonucleotides 260, 270, 275, 277 and 330 are more preferred.
Uniform 2'fluoro P.dbd.S oligonucleotides 345, 347 and 355 are also
more preferred.
[0238] Additional uniform 2'-fluoro phosphorothioate
oligonucleotides were synthesized and tested for ability to inhibit
HCV core protein expression. Oligonucleotide 344 was also found to
be extremely active and is preferred. The region of the HCV RNA
target from nucleotide 344 to nucleotide 374 was found to be
extremely sensitive to antisense oligonucleotide inhibition.
Oligonucleotides complementary to this target region, therefore,
are preferred. More preferred among these are the 2'fluoro
phosphorothioate oligonucleotides.
Example 7
Evaluation of a "Single Virus" Recombinant Vaccinia/HCV Core
Protein Assay
[0239] A "single virus" vaccinia assay system was developed, which
does not require co-infection with helper vaccinia virus expressing
T7 polymerase. Cells were pretreated with oligonucleotide in the
absence of lipofectin prior to infection with recombinant vaccinia
virus expressing HCV sequences. Cells were then infected with
recombinant vaccinia virus expressing HCV 5' UTR-core at a m.o.i.
of 2.0 pfu/cell. After infection, cells were rinsed and
post-treated with medium containing oligonucleotide. Initial
results obtained with this assay indicate that P.dbd.S
oligonucleotides 259 and 260 inhibit HCV 5'-UTR core expression by
>60% at a concentration of 1 .mu.M. Inhibition is
dose-dependent.
[0240] Uniformly 2'-fluoro P.dbd.S oligonucleotides 260, 330 and
340 were evaluated for activity in the recombinant vaccinia "single
virus" assay using RY5 cells. Medium containing oligonucleotide was
added after infection. 2'-fluoro modified oligonucleotide 260
induced a dose-dependent inhibitory effect on HCV core protein
expression (up to approximately 65% inhibition) even without
pretreatment of cells with oligonucleotide before infection. In the
same assay with pretreatment, 2'-fluoro P.dbd.S modified
oligonucleotide 340 effectively inhibited HCV core protein
expression at doses of 0.1 .mu.M, 0.3 .mu.M and 1.0 .mu.M, with a
maximum inhibition of about 75%. This oligonucleotide is therefore
preferred. In the "single virus" assay using HepG2 cells, a
dose-dependent inhibitory effect of oligonucleotide 340 as a
uniform 2'-fluoro phosphorothioate was also observed (approximately
60% inhibition). This oligonucleotide is therefore preferred. The
phosphorothioate oligonucleotide 260 also gave approximately 60%
inhibition in the HepG2 cell assay.
Example 8
Diagnostic Use of Oligonucleotides Which Inhibit HCV
[0241] Definitive diagnosis of HCV-caused hepatitis can be readily
accomplished using antisense oligonucleotides which inhibit HCV RNA
function, measurable as a decrease in HCV RNA levels or HCV core
protein levels. RNA is extracted from blood samples or liver tissue
samples obtained by needle biopsy, and electrophoresed and
transferred to nitrocellulose for Northern blotting according to
standard methods routinely used by those skilled in the art. An
identical sample of blood or tissue is treated with antisense
oligonucleotide prior to RNA extraction. The intensity of putative
HCV signal in the two blots is then compared. If HCV is present
(and presumably causative of disease), the HCV RNA signal will be
reduced in the oligonucleotide-treated sample compared to the
untreated sample. If HCV is not the cause of the disease, the two
samples will have identical signals. Similar assays can be designed
which employ other methods such as RT-PCR for HCV RNA detection and
quantitation, or Western blotting or ELISA measurement of HCV core
protein translation, all of which are routinely performed by those
in the art.
[0242] Diagnostic methods using antisense oligonucleotides capable
of inhibiting HCV RNA function are also useful for determining
whether a given virus isolated from a patient with hepatitis will
respond to treatment, before such treatment is initiated. RNA is
isolated from a patient's blood or a liver tissue sample and
blotted as described above. An identical sample of blood or tissue
is treated with antisense oligonucleotide to inhibit HCV prior to
RNA extraction and blotting. The intensity of putative HCV signal
in the two blots is then compared. If the oligonucleotide is
capable of inhibiting RNA function of the patient-derived virus,
the HCV signal will be reduced in the oligonucleotide-treated
sample compared to the untreated sample. This indicates that the
patient's HCV infection is responsive to treatment with the
antisense oligonucleotide, and a course of therapeutic treatment
can be initiated. If the two samples have identical signals the
oligonucleotide is not able to inhibit replication of the virus,
and another method of treatment is indicated. Similar assays can be
designed which employ other methods such as RT-PCR for RNA
detection and quantitation, or Western blotting or ELISA for
quantitation of HCV core protein expression, all of which are
routinely performed by those in the art.
Example 9
The VHCV-IRES Vaccinia/HCV Recombinant Virus Infected Mouse
Model
[0243] pSC11 (licensed from NIH) is a vaccinia virus expression
vector that uses vaccinia early and late promoter P7.5 to express
foreign genes, and vaccinia late promoter P11 to express a LacZ
gene. The vaccinia viral thymidine kinase (TK) sequence flanked
these two promoter-expression DNA arrangements for homologous
recombination. HCV RNA nucleotides 1-1357, including the HCV 5'
noncoding region, core and part of E1, obtained from pHCV3, a cDNA
clone from a chronic HCV patient with HCV type H infection, was
fused to the 5' end of a luciferase gene containing a SV40
polyadenylation signal sequence (Promega, pGL-2 promoter vector).
The fused DNA fragment was placed under vaccinia promoter P7.5 of
pSC11. The resultant construct was named pVNCELUA. A deletion of
HCV RNA nucleotides 709 to 1357 was made in pVNCELUA and religation
yielded the construct pVHCV-IRES. This construct uses the HCV
initiator with the internal ribosome entry initiating mechanism for
translation. pVC-LUA is a luciferase control virus construct in
which the luciferase gene including the translation initiation
codon and polyadenylation signal was directly placed under the
P71.5 promoter of pSC11.
[0244] The basic experimental procedures for generating recombinant
vaccinia virus by homologous recombination are known in the art.
CV-1 cells for homologous recombination and viral plaque and Hu
TK-143B for TK-selection were purchased from the ATCC. Plasmid DNA
transfection was done using lipofectin (GIBCO BRL). The selection
of recombinant virus was done by selection of viral plaques
resistant to BrdU and demonstrating luciferase and
.beta.-galactosidase activity. The virus was purified through three
rounds of plaque selection and used to prepare a 100% pure viral
stock. The virus-containing BSC-40 cells were harvested in DMEM
with 0.5% FBS followed by freeze-thawing three times to dissociate
the virus. Cellular debris was centrifuged out and the supernatant
was used for viral infection. A capital "V" was given to the name
of each recombinant virus to distinguish it from the corresponding
DNA construct (named with "p").
[0245] Six-week old female Balb/c mice were purchased from Charles
River Laboratories (Boston Mass.). The mice were randomly grouped
and were pretreated with oligonucleotide given subcutaneously once
daily for two days before virus infection and post-treated once at
4 hours after infection. The infection was carried out by
intraperitoneal injection of 1.times.10.sup.8 pfu of virus in 0.5
ml saline solution. At 24 hours after infection the liver was taken
from each mouse and kept on dry ice until it was homogenized at
30,000 rpm for about 30 seconds in 20 .mu.l/mg luciferase reporter
lysis buffer (Promega) using a Tissue Tearor (Biospec Products
Inc.). Samples were transferred to eppendorf tubes on ice and
shaken by vortex for 20 seconds followed by centrifuging at
4.degree. C. for 3 minutes 20 .mu.l of supernatant was transferred
to a 96-well microtiter plate and 100 .mu.l Luciferase Assay
Reagent (Promega) was added. Immediately thereafter, the relative
light units emitted were measured using a luminometer (ML
1000/Model 2.4, Dynatech Laboratories, Inc.).
Example 10
Evaluation of the 330 Oligonucleotide ISIS 6547 in the VCHV-IRES
Infected Mouse Model
[0246] A 20 mer deoxy oligonucleotide (the "330 oligonucleotide,"
SEQ ID NO: 6) targeted to nucleotides 330-349 surrounding the HCV
translation initiation codon has been shown in previous examples to
specifically inhibit HCV core protein synthesis in an in vitro
translation assay, when tested as a phosphodiester. The
phosphorothioate deoxyoligonucleotide of the same sequence, ISIS
6547 demonstrated at least a 50% reduction of HCV RNA when
administered at dose of 100 nM to transformed human hepatocytes
expressing HCV 5' noncoding region, core, and part of the E1
product (nucleotides 1-1357 of HCV). Hanecak et al., J. Virol.
1996, 70, 5203-5212. This effect was dose-dependent and
sequence-dependent.
[0247] ISIS 6547 was evaluated in vivo using the VHCV-IRES infected
mouse model. Eight female Balb/c mice were pretreated
subcutaneously with oligonucleotide in saline once daily for two
days, then infected intraperitoneally with 1.times.10.sup.8 pfu
VHCV-IRES followed by a post-treatment with oligonucleotide four
hours after infection. A group treated with saline and infected
with the same amount of VHCV-IRES served as controls. The effect of
oligonucleotide on HCV gene expression was measured by luciferase
activity at 24 hours after infection. When compared to luciferase
activity from VHCV-IRES-infected but saline-treated controls, ISIS
6547 reduced luciferase signal in a dose-dependent manner, giving
10.5% inhibition at 2 mg/kg, 28.2% inhibition at 6 mg/kg and 51.9%
inhibition at 20 mg/kg. In contrast, the unrelated control
oligonucleotide ISIS 1082 (GCCGAGGTCCATGTCGTACGC; SEQ ID NO. 36)
exhibited no inhibitory effect at lower doses, though non-specific
inhibition of luciferase signal was observed at 20 mg/kg. Various
routes of administration of oligonucleotide 6547 (subcutaneous,
intravenous or intraperitoneal) gave similar levels of inhibition
(76%, 63% and 58%, respectively, at 20 mg/kg).
Example 11
Evaluation of 5-methyl-C Modified 330 Oligonucleotide, ISIS 14803
in the VCHV-IRES Infected Mouse Model
[0248] One of the heterocyclic base modifications presently
available is 5-methylcytosine (5-me-C) in which the nucleobase
cytosine is methylated at the 5-position. The corresponding
nucleotide is 5-methylcytidine. Oligonucleotides containing this
modification demonstrate higher target binding affinity than
analogs without the base modification, and are substrates for RNAse
H. Dean and Griffey, Antisense and Nucleic Acid Drug Development
1997, 7, 229-233. They also elicit less immune stimulation and
complement stimulation than unmodified versions. Henry et al.,
Anti-Cancer Drug Design 1997, 12, 409-412.
[0249] A 5-me-C version of ISIS 6547 was synthesized in which every
cytidine nucleotide was replaced by a 5-methylcytidine. This
oligonucleotide, ISIS 14803, was evaluated in the VHCV-IRES system
in mice, in direct comparison to its parent compound, ISIS 6547.
Eight female Balb/c mice were subcutaneously treated with
oligonucleotide in saline at one day and two hours before infection
and again at 4 hours after infection. Mice were infected by
intraperitoneal injection with 1.times.10.sup.8 pfu per mouse of
VHCV-IRES or VC-LUA. At 24 hours after infection, luciferase
activity in liver was determined and compared to luciferase
activity in livers of a group of mice treated with saline and
infected with the same amount of VHCV-IRES or VC-LUA. ISIS 14803
showed 11.1% inhibition of liver luciferase activity at 2 mg/kg,
33.5% inhibition at 6 mg/kg and 59.1% inhibition at 20 mg/kg. ISIS
14803 did not show any inhibition of luciferase activity in the
control VC-LUA virus at the lower doses, though some nonspecific
inhibition of luciferase activity was observed at the high dose of
20 mg/kg. Because this nonspecific inhibition was also observed
with the control oligonucleotide, ISIS 1082, it was thought to be a
general class effect of high doses of phosphorothioate
oligonucleotides.
Example 12
Design and Screening of Duplexed Antisense Compounds Targeting
HCV
[0250] In accordance with the present invention, a series of
nucleic acid duplexes comprising the antisense compounds of the
present invention and their complements can be designed to target
HCV. The nucleobase sequence of the antisense strand of the duplex
comprises at least a portion of an oligonucleotide to HCV as
described herein. The ends of the strands may be modified by the
addition of one or more natural or modified nucleobases to form an
overhang. The sense strand of the dsRNA is then designed and
synthesized as the complement of the antisense strand and may also
contain modifications or additions to either terminus. For example,
in one embodiment, both strands of the dsRNA duplex would be
complementary over the central nucleobases, each having overhangs
at one or both termini. For example, a duplex comprising an
antisense strand having the sequence CGAGAGGCGGACGGGACCG (SEQ ID
NO:38) and having a two-nucleobase overhang of deoxythymidine (dT)
would have the following structure:
5 Antisense cgagaggcggacgggaccgTT Strand (SEQ ID NO:39)
.vertline..vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline..vertline.
TTgctctccgcctgccctggc Complement (SEQ ID NO:40)
[0251] RNA strands of the duplex can be synthesized by methods
disclosed herein or purchased from Dharmacon Research Inc.,
(Lafayette, Colo.). Once synthesized, the complementary strands are
annealed. The single strands are aliquoted and diluted to a
concentration of 50 uM. Once diluted, 30 uL of each strand is
combined with 15 uL of a 5.times. solution of annealing buffer. The
final concentration of said buffer is 100 mM potassium acetate, 30
mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume
is 75 uL. This solution is incubated for 1 minute at 90.degree. C.
and then centrifuged for 15 seconds. The tube is allowed to sit for
1 hour at 37.degree. C. at which time the dsRNA duplexes are used
in experimentation. The final concentration of the dsRNA duplex is
20 uM. This solution can be stored frozen (-20.degree. C.) and
freeze-thawed up to 5 times.
[0252] Once prepared, the duplexed antisense compounds are
evaluated for their ability to modulate HCV expression according to
the protocols described herein.
Example 13
Design of Phenotypic Assays and In Vivo Studies for the Use of HCV
Inhibitors
[0253] Phenotypic Assays
[0254] Once HCV inhibitors have been identified by the methods
disclosed herein, the compounds are further investigated in one or
more phenotypic assays, each having measurable endpoints predictive
of efficacy in the treatment of a particular disease state or
condition. Phenotypic assays, kits and reagents for their use are
well known to those skilled in the art and are herein used to
investigate the role and/or association of HCV in health and
disease. Representative phenotypic assays, which can be purchased
from any one of several commercial vendors, include those for
determining cell viability, cytotoxicity, proliferation or cell
survival (Molecular Probes, Eugene, Oreg.; Perkin-Elmer, Boston,
Mass.), protein-based assays including enzymatic assays (Panvera,
LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene
Research Products, San Diego, Calif.), cell regulation, signal
transduction, inflammation, oxidative processes and apoptosis
(Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation
(Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube
formation assays, cytokine and hormone assays and metabolic assays
(Chemicon International Inc., Temecula, Calif.; Amersham
Biosciences, Piscataway, N.J.).
[0255] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with HCV inhibitors identified from the in vitro
studies as well as control compounds at optimal concentrations
which are determined by the methods described above. At the end of
the treatment period, treated and untreated cells are analyzed by
one or more methods specific for the assay to determine phenotypic
outcomes and endpoints.
[0256] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0257] Analysis of the genotype of the cell (measurement of the
expression of one or more of the genes of the cell) after treatment
is also used as an indicator of the efficacy or potency of the HCV
inhibitors. Hallmark genes, or those genes suspected to be
associated with a specific disease state, condition, or phenotype,
are measured in both treated and untreated cells.
6 Example 14: An Open-Label, Multi-Center, Dose-Escalation Study to
Assess the Safety,Tolerability, and Activity of ISIS 14803 in
Chronic Hepatitis C Patients Undergoing Pegylated
Interferon-.alpha.2b and Ribavirin Treatment Who Have Not Achieved
an Early Virologic Response 1. PROTOCOL SYNOPSIS Objectives: 1. To
evaluate the safety and tolerability of ISIS 14803 when
administered in combination with pegylated interferon-(.sub.2b and
ribavirin for 12 weeks. 2. To evaluate the antiviral activity of
ISIS 14803 when administered in combination with pegylated
interferon-(2b and ribavirin for 12 weeks. Study Phase: 1/2 Study
Design: Open-label, multi-center, uncontrolled, dose-escalation
study Ten eligible subjects who have not achieved an early
virologic response (i.e., <2 log.sub.10 reduction in HCV RNA at
Week 12) while receiving pegylated interferon-(.sub.2b and
ribavirin therapy and who have successfully completed all screening
procedures will be enrolled into Cohort A (3 mg/kg ideal body
weight (IBW) twice weekly). Enrollment in Cohort B (6 mg/kg IBW
twice weekly) may begin when the subjects in Cohort A have
completed treatment with ISIS 14803, pegylated interferon-(.sub.2b
and ribavirin with an acceptable safety profile. Number of 30
subjects (10 in Cohort A and 20 in Cohort B). The actual number of
Subjects: subjects in each cohort may be higher if additional
subjects are enrolled to replace subjects that withdraw prior to
completing eight weeks of treatment. Study Adult patients with
chronic hepatitis C who have not achieved an early Population:
virologic response (i.e., <2 log.sub.10 reduction in plasma HCV
RNA at Week 12) while receiving pegylated interferon-(.sub.2b and
ribavirin therapy Inclusion Criteria: 1. Age 18 to 65 years 2.
Infection with HCV genotype 1 3. Prior liver biopsy indicating
chronic hepatitis 4. Received at least 12 weeks but no more than 18
weeks of continuous pegylated interferon-(.sub.2b and ribavirin
therapy 5. HCV infection was untreated prior to current pegylated
interferon-(2b ribavirin regimen 6. Less than 2 logia reduction in
plasma or serum HCV RNA despite receiving 12 weeks of pegylated
interferon-(.sub.2b and ribavirin therapy (<1 logio reduction
from the upper limit of quantitation for those patients whose
pretreatment HCV RNA level was above the quantitation limit their
assay) 7. WBC count .ltoreq. upper limit of normal range 8.
Absolute neutrophil count 750 cells/mm3 9. Platelet count .ltoreq.
50.000 cells /mm3 10. Hemoglobin concentration 10.0 gm/dL 11. PT
and a PTT within normal reference range 12. Serum creatinine
concentrations .ltoreq. 1.5x upper limit of normal range 13. Serum
bilirubin concentration within normal reference range unless to
documented Gilbert's disease 14. Give written informed consent to
participate in the study Study Exclusion Criteria Population:
Patients with any of the following characteristics will be
excluded: Continued 1. Pregnant women or nursing mothers 2. Females
of childbearing potential without adequate contraception (see
Section 8.2) 3. Systemic corticosteroid therapy within 3 months of
screening 4. Serum ALT > 5x upper limit of normal range 5. HIV
or HBV infection 6. Decompensated liver disease 7. Histologic
evidence of cirrhosis 8. Severe depression with suicidal ideation
requiring hospitalization within one year of screening 9. Any
disease condition associated with active bleeding or requiring
anticoagulation with heparin or warfarin 10. Active infection
requiring systemic antimicrobial therapy 11. Malignancy (with the
exception of basal or squamous cell carcinoma of the skin if
adequately treated and no recurrence within one year of screening)
12. Any other concurrent condition which, in the opinion of the
Investigator, would preclude participation in or interfere with
compliance 13. Is unable to continue to receive pegylated
interferon-(.sub.2b and ribavirin therapy 14. Alcohol or drug abuse
within one year of screening 15. Is undergoing or has undergone
treatment with another investigational drug, biologic agent or
device within 30 days of screening 16. Has previously received ISIS
14803 17. History of cryoglobulinemia or vasculitis Treatment
Cohort A: ten subjects will receive ISIS 14803 administered
intravenously Groups: twice weekly at 3 mg/kg IBW in combination
with pegylated interferon-(.sub.2b and ribavirin for 12 weeks.
Cohort B: 20 subjects will receive ISIS 14803, pegylated
interferon-(.sub.2b and ribavirin for 12 weeks. ISIS 14803 will be
administered intravenously twice weekly at a dose of 6 mg/kg IBW
for 12 weeks with the exception that the first dose of ISIS 14803
will be at 3 mg/kg IBW. In both cohorts, pegylated interferon-(2b
and ribavirin will be self administered by study subjects as per
the direction of the Investigator (or designee). Study Visit The
study consists of a 4-week screening period, 12-week treatment
period, Schedule: and 8-week post-treatment evaluation period. If
the Investigator and subject elect to continue the subject's
treatment with pegylated interferon- (.sub.2b and ribavirin after
the study treatment period, the subject will be enrolled into a
post-study registry after Study Week 20 for a period that may
extend up to 37 weeks in order to collect HCV RNA results related
to the continued treatment and any follow-up to ascertain sustained
virologic response. Patients who have been receiving pegylated
interferon-(.sub.2b and ribavirin therapy for 6 12 weeks should be
prescreened to determine if they satisfy the inclusion and
exclusion criteria. Screening procedures will be performed on those
subjects who give written informed consent. The screening
procedures include a medical history, physical examination, and
clinical laboratory evaluations. During the 12-week treatment
period, subjects will be seen at the study center twice weekly for
infusion of ISIS 14803. Pegylated interferon-(.sub.2b and ribavirin
will be self administered by study subjects as per the direction of
the Investigator (or designee). Laboratory evaluation including
serum chemistry, hematology and HCV RNA will be performed at
selected intervals. At the end of the 12-week treatment period,
subjects will enter an 8-week post-treatment evaluation (Study
Weeks 13 to 20) period that concludes with an end-of-study physical
examination (including laboratory evaluations). Study Visit Any
subjects continuing to receive pegylated interferon-(.sub.2b and
ribavirin Schedule: beyond Study Week 20 will be entered into a
post-study registry. The Continued purpose of the registry is to
collect HCV RNA results associated with the subject's continued
treatment and any follow-up for sustained virologic response. In
the post-study period, the subject may be followed up to 37 weeks.
There will be no study procedures performed during this poststudy
period with the exception of collecting the results of plasma HCV
RNA tests performed locally by the clinical site. Safety and The
safety and tolerability of the triple combination of ISIS 14803,
pegylated Tolerability interferon-(.sub.2b and ribavirin will be
assessed by determining the incidence, Evaluations: intensity and
dose-relationship of adverse effects and changes in laboratory
evaluations. Efficacy The antiviral activity of ISIS 14803,
pegylated interferon-(.sub.2b and ribavirin in combination will be
determined by the percentage of subjects who achieve Evaluations:
end-of-treatment and sustained virologic responses.
[0258]
Sequence CWU 1
1
37 1 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic 1 tgcacggtct acgagacctc 20 2 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 2 ggtgcacggt
ctacgagacc 20 3 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 3 atggtgcacg gtctacgaga 20 4 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 4
tcatggtgca cggtctacga 20 5 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 5 gctcatggtg cacggtctac 20 6 20
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 6 gtgctcatgg tgcacggtct 20 7 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 7 tcgtgctcat
ggtgcacggt 20 8 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 8 attcgtgctc atggtgcacg 20 9 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 9
ggattcgtgc tcatggtgca 20 10 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 10 taggattcgt gctcatggtg 20 11 20
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 11 tttaggattc gtgctcatgg 20 12 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 12 ggtttaggat
tcgtgctcat 20 13 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 13 gaggtttagg attcgtgctc 20 14 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 14
gaggtttagg attngtgctc 20 15 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 15 gnggtttngg attngtgctc 20 16 20
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 16 gnggtttngg annngtgctc 20 17 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 17 ttgaggttta
ggattcgtgc 20 18 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 18 ctttgaggtt taggattcgt 20 19 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 19
ttctttgagg tttaggattc 20 20 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 20 ttttctttga ggtttaggat 20 21 20
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 21 gtttttcttt gaggtttagg 20 22 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 22 tggtttttct
ttgaggttta 20 23 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 23 tttggttttt ctttgaggtt 20 24 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 24
cgtttggttt ttctttgagg 20 25 18 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 25 gtgctcatgg tgcacggt 18 26 17
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 26 gtgctcatgg tgcacgg 17 27 16 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 27 gtgctcatgg tgcacg
16 28 15 DNA Artificial Sequence Description of Artificial Sequence
Synthetic 28 gtgctcatgg tgcac 15 29 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 29 gtgctcatgg 10 30 18
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 30 gctcatggtg cacggtct 18 31 17 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 31 ctcatggtgc acggtct
17 32 15 DNA Artificial Sequence Description of Artificial Sequence
Synthetic 32 catggtgcac ggtct 15 33 10 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 33 tgcacggtct 10 34 18
DNA Artificial Sequence Description of Artificial Sequence
Synthetic 34 tgctcatggt gcacggtc 18 35 16 DNA Artificial Sequence
Description of Artificial Sequence Synthetic 35 gctcatggtg cacggt
16 36 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic 36 gccgaggtcc atgtcgtacg c 21 37 685 RNA Hepatitis C
virus 37 gccagccccc gauugggggc gacacuccac cauagaucac uccccuguga
ggaacuacug 60 ucuucacgca gaaagcgucu agccauggcg uuaguaugag
ugucgugcag ccuccaggac 120 ccccccuccc gggagagcca uaguggucug
cggaaccggu gaguacaccg gaauugccag 180 gacgaccggg uccuuucuug
gaucaacccg ccaaugccug gagauuuggg cgugcccccg 240 cgagacugcu
agccgaguag uguugggucg cgaaaggccu ugugguacug ccugauaggg 300
ugcuugcgag ugccccggga ggucucguag accgugcacc augagcacga auccuaaacc
360 ucaaagaaaa accaaacgua acaccaaccg ccgcccacag gaggucaagu
ucccgggcgg 420 uggucagauc guugguggag uuuaccuguu gccgcgcagg
ggccccaggu ugggugugcg 480 cgcgaucagg aagacuuccg agcggucgca
accccgugga aggcgacagc cuauccccaa 540 ggcucgccgg cccgagggca
gggccugggc ucagcccggg uauccuuggc cccucuaugg 600 caaugagggc
augggguggg caggauggcu ccugucaccc cgcggcuccc ggccuaguug 660
gggccccacg gacccccggc guagg 685
* * * * *