U.S. patent application number 10/352618 was filed with the patent office on 2004-02-05 for chlamydia antigens and corresponding dna fragments and uses thereof.
Invention is credited to Dunn, Pamela L., Murdin, Andrew D., Oomen, Raymond P..
Application Number | 20040022801 10/352618 |
Document ID | / |
Family ID | 27380151 |
Filed Date | 2004-02-05 |
United States Patent
Application |
20040022801 |
Kind Code |
A1 |
Murdin, Andrew D. ; et
al. |
February 5, 2004 |
Chlamydia antigens and corresponding DNA fragments and uses
thereof
Abstract
In summary of this disclosure, the present invention provides a
method of nucleic acid, including DNA, immunization of a host,
including humans, against disease caused by infection by a strain
of Chlamydia, specifically C. pneumoniae, employing a vector,
containing a nucleotide sequence encoding an POMP91B precursor
protein of a strain of Chlamydia pneumoniae and a promoter to
effect expression of the POMP91B precursor gene in the host.
Modifications are possible within the scope of this invention.
Inventors: |
Murdin, Andrew D.; (Ontario,
CA) ; Oomen, Raymond P.; (Ontario, CA) ; Dunn,
Pamela L.; (Ontario, CA) |
Correspondence
Address: |
MINTZ, LEVIN, COHN, FERRIS, GLOVSKY
AND POPEO, P.C.
ONE FINANCIAL CENTER
BOSTON
MA
02111
US
|
Family ID: |
27380151 |
Appl. No.: |
10/352618 |
Filed: |
January 28, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10352618 |
Jan 28, 2003 |
|
|
|
09430723 |
Oct 29, 1999 |
|
|
|
6607730 |
|
|
|
|
60106590 |
Nov 2, 1998 |
|
|
|
60133071 |
May 7, 1999 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/252.3; 435/320.1; 435/6.12; 435/6.15; 435/69.7; 530/350;
536/23.7 |
Current CPC
Class: |
A61P 9/10 20180101; C07K
14/295 20130101; A61K 39/00 20130101; C07K 2319/02 20130101; C07K
2319/00 20130101; A61P 11/06 20180101; A61P 31/00 20180101; A61K
2039/53 20130101; A61P 11/00 20180101 |
Class at
Publication: |
424/190.1 ;
435/6; 435/69.7; 435/252.3; 435/320.1; 530/350; 536/23.7 |
International
Class: |
A61K 039/02; C12Q
001/68; C07H 021/04; C12P 021/04; C12N 001/21; C07K 014/295 |
Claims
What is claimed is:
1. An isolated polynucleotide selected from the group consisting
of: (a) a polynucleotide having a sequence comprising the
nucleotide sequence SEQ ID NO: 1, and functional fragments thereof;
(c) a polynucleotide encoding a polypeptide having a sequence that
is at least 75% homologous to SEQ ID NO: 2, and functional
fragments thereof; and (d) a polynucleotide capable of hybridizing
under stringent conditions to a polynucleotide having a sequence
comprising the nucleotide sequence SEQ ID NO: 1, and functional
fragments thereof.
2. The polynucleotide of claim 1, linked to a second nucleotide
sequence encoding a fusion polypeptide.
3. The nucleotide of claim 2 wherein the fusion polypeptide is a
heterologous signal peptide.
4. The nucleotide of claim 2 wherein the polynucleotide encodes a
functional fragment of the polypeptide having the SEQ ID NO: 2.
5. An isolated polypeptide having a sequence that is at least 75%
homologous to SEQ ID NO: 2, and functional fragments thereof.
6. The polypeptide of claim 5, wherein said polypeptide has the
sequence of SEQ ID NO: 2 or functional fragments thereof.
7. A polypeptide comprising the polypeptide of claim 5 linked to a
fusion polypeptide.
8. The polypeptide of claim 7, wherein the fusion polypeptide is a
signal peptide.
9. The polypeptide of claim 7, wherein the fision polypeptide
comprises a heterologous polypeptide having adjuvant activity.
10. An expression cassette, comprising the polynucleotide of claim
1 operably linked to a promoter.
11. An expression vector, comprising the expression cassette of
claim 10.
12. A host cell, comprising the expression cassette of claim
10.
13. The host cell of claim 10, wherein said host cell is a
prokaryotic cell.
14. The host cell of claim 13, wherein said host cell is a
eukaryotic cell.
15. A method for producing a recombinant polypeptide having SEQ ID
NO: 2, comprising: (a) culturing a host cell of claim 12, under
conditions that the allow the expression of the polypeptide; and
(b) recovering the recombinant polypeptide.
16. A vaccine vector, comprising the expression cassette of claim
10.
17. The vaccine vector of claim 16, wherein said host mammal is
human.
18. The vaccine vector of claim 16, in a pharmaceutically
acceptable excipient.
19. A pharmaceutical composition, comprising a immunologically
effective amount of the vaccine vector of claim 14.
20. A method for inducing an immune response in a mammal,
comprising: administering to said mammal an immunologically
effective amount of the vaccine vector of claim 16, wherein said
administration induces an immune response.
21. A pharmaceutical composition, comprising an immunologically
effective amount of the polypeptide of claim 5 and pharmaceutically
acceptable diluent.
22. The pharmaceutical composition of claim 21, further comprising
an adjuvant.
23. The pharmaceutical composition of claim 21, further comprising
one or more known Chlamydia antigens.
24. A method for inducing an immune response in a mammal,
comprising: administering to said mammal an immunologically
effective amount of the pharmaceutical composition of claim 21,
wherein said administration induces an immune response.
25. A polynucleotide probe reagent capable of detecting the
presence of Chlamydia in biological material, comprising a
polynucleotide that hybridizes to the polynucleotide of claim 1
under stringent conditions.
26. The polynucleotide probe reagent of claim 25, wherein said
reagent is a DNA primer.
27. A hybridization method for detecting the presence of Chlamydia
in a sample, comprising the steps of: (a) obtaining polynucleotide
from the sample; (b) hybridizing said obtained polynucleotide with
a polynucleotide probe reagent of claim 21 under conditions which
allow for the hybridization of said probe and said sample; and (c)
detecting said hybridization of said detecting reagent with a
polynucleotide in said sample.
28. An amplification method for detecting the presence of Chlamydia
in a sample, comprising the steps of: (a) obtaining polynucleotide
from the sample; (c) amplifying said obtained polynucleotide using
one or more polynucleotide probe reagents of claim 25; and (d)
detecting said amplified polypeptide.
29. A method for detecting the presence of Chlamydia in a sample
comprising the steps of: (a) contacting said sample with a
detecting reagent that binds to the polypeptide having SEQ ID NO: 2
to form a complex; and (b) detecting said formed complex.
30. The method of claim 29, wherein said detecting reagent is an
antibody.
31. The method of claim 30, wherein said antibody is a monoclonal
antibody.
32. The method of claim 30, wherein said antibody is a polyclonal
antibody.
33. An affinity chromatography method for substantially purifying a
polypeptide having SEQ ID NO: 2, comprising the steps of: (a)
contacting a sample containing said polypeptide with a detecting
reagent that binds to said polypeptide to form a complex; (c)
isolating said formed complex; (c) dissociating said formed
complex; and (d) isolating the dissociated polypeptide.
34. The method of claim 33, wherein said detecting reagent is an
antibody.
35. The method of claim 34, wherein said antibody is a monoclonal
antibody.
36. The method of claim 34, wherein said antibody is a polyclonal
antibody.
37. An antibody that immunospecifically binds a polypeptide of
claim 5, or a fragment or derivative of said antibody containing
the binding domain thereof.
Description
RELATED U.S. APPLICATION
[0001] The present patent application claims priority to the
following United States provisional patent applications: U.S. Ser.
Nos. 60/106,590, filed Nov. 2, 1998 and 60/133,071, filed May 7,
1999, each incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to Chlamydia antigens and
corresponding DNA molecules, which can be used in methods to
prevent and treat disease caused by Chlamydia infection in mammals,
such as humans.
BACKGROUND OF THE INVENTION
[0003] Chlamydiae are prokaryotes. They exhibit morphologic and
structural similarities to Gram negative bacteria including a
trilaminar outer membrane, which contains lipopolysaccharide and
several membrane proteins. Chlamydiae are differentiated from other
bacteria by their morphology and by a unique developmental cycle.
They are obligate intracellular parasites with a unique biphasic
life cycle consisting of a metabolically inactive but infectious
extracellular stage and a replicating but non-infectious
intracellular stage. The replicative stage of the life-cycle takes
place within a membrane-bound inclusion which sequesters the
bacteria away from the cytoplasm of the infected host cell.
[0004] Because chlamydiae are small and multiply only within
susceptible cells they were long thought to be viruses. However,
they have many characteristics in common with other bacteria: (1)
they contain both DNA and RNA, (2) they divide by binary fission,
(3) their cell envelopes resemble those of other Gram-negative
bacteria, (4) they contain ribosomes similar to those of other
bacteria, and (5) they are susceptible to various antibiotics.
Chlamydiae can be seen in the light microscope, and the genome is
about one-third the size of the Escherichia coli genome.
[0005] Many different strains of chlamydiae have been isolated from
birds, man, and other mammals, and these strains can be
distinguished on the basis of host range, virulence, pathogenesis,
and antigenic composition. There is strong homology of DNA within
each species, but surprisingly little between species, suggesting
long-standing evolutionary separation.
[0006] C. trachomatis has a high degree of host specificity, being
almost completely limited to man; it causes ocular and
genitourinary infections of widely varying severity. In contrast,
C. psittaci strains are rare in man but are found in a wide range
of birds and also in wild, domestic, and laboratory mammals, where
they multiply in cells of many organs.
[0007] C. pneumoniae is a common human pathogen, originally
described as the TWAR strain of C. psittaci, but subsequently
recognized to be a new species. C. pneumoniae is antigenically,
genetically, and morphologically distinct from other Chlamydia
species (C. trachomatis, C. pecorum and C. psittaci). It shows 10%
or less DNA sequence homology with either of C. trachomatis or C.
psittaci and so far appears to consist of only a single strain,
TWAR.
[0008] C. pneumoniae is a common cause of community acquired
pneumonia, less frequent only than Streptococcus pneumoniae and
Mycoplasma pneumoniae. Grayston et al., J. Infect. Dis. 168: 1231
(1995); Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477
(1995), each incorporated herein by reference. It can also cause
upper respiratory tract symptoms and disease, including bronchitis
and sinusitis. See, e.g., Grayston et al., J. Infect. Dis. 168:
1231 (1995); Campos et al., Invest. Ophthalmol. Vis. Sci. 36: 1477
(1995); Grayston et al., J. Infect. Dis. 161: 618 (1990); Marrie,
Clin. Infect. Dis. 18: 501 (1993). The great majority of the adult
population (over 60%) has antibodies to C. pneumoniae (Wang et al.,
Chlamydial Infections, Cambridge University Press, Cambridge, p.
329 (1986)), indicating past infection which was unrecognized or
asymptomatic.
[0009] C. pneumoniae infection usually presents as an acute
respiratory disease (i.e., cough, sore throat, hoarseness, and
fever; abnormal chest sounds on auscultation). For most patients,
the cough persists for 2 to 6 weeks, and recovery is slow. In
approximately 10% of these cases, upper respiratory tract infection
is followed by bronchitis or pneumonia. Furthermore, during a C.
pneumoniae epidemic, subsequent co-infection with pneumococcus has
been noted in about half of these pneumonia patients, particularly
in the infirm and the elderly. As noted above, there is more and
more evidence that C. pneumoniae infection is also linked to
diseases other than respiratory infections.
[0010] The reservoir for the organism is presumably people. In
contrast to C. psittaci infections, there is no known bird or
animal reservoir. Transmission has not been clearly defined. It may
result from direct contact with secretions, from formites, or from
airborne spread. There is a long incubation period, which may last
for many months. Based on analysis of epidemics, C. pneumoniae
appears to spread slowly through a population (case-to-case
interval averaging 30 days) because infected persons are
inefficient transmitters of the organism. Susceptibility to C.
pneumoniae is universal. Reinfections occur during adulthood,
following the primary infection as a child. C. pneumoniae appears
to be an endemic disease throughout the world, noteworthy for
superimposed intervals of increased incidence (epidemics) that
persist for 2 to 3 years. C. trachomatis infection does not confer
cross-immunity to C. pneumoniae. Infections are easily treated with
oral antibiotics, tetracycline or erythromycin (2 g/day, for at
least 10 to 14 days). A recently developed drug, azithromycin, is
highly effective as a single-dose therapy against chlamydial
infections.
[0011] In most instances, C. pneumoniae infection is mild and
without complications, and up to 90% of infections are subacute or
unrecognized. Among children in industrialized countries,
infections have been thought to be rare up to the age of five
years, although a recent study has reported that many children in
this age group show PCR evidence of infection despite being
seronegative, and estimates a prevalence of 17-19% in 2-4 years
old. See, Normann et al., Acta Paediatrica, 87: 23-27 (1998). In
developing countries, the seroprevalence of C. pneumoniae
antibodies among young children is elevated, and there are
suspicions that C. pneumoniae may be an important cause of acute
lower respiratory tract disease and mortality for infants and
children in tropical regions of the world.
[0012] From seroprevalence studies and studies of local epidemics,
the initial C. pneumoniae infection usually happens between the
ages of 5 and 20 years. In the USA, for example, there are
estimated to be 30,000 cases of childhood pneumonia each year
caused by C. pneumoniae. Infections may cluster among groups of
children or young adults (e.g., school pupils or military
conscripts).
[0013] C. pneumoniae causes 10 to 25% of community-acquired lower
respiratory tract infections (as reported from Sweden, Italy,
Finland, and the USA). During an epidemic, C. pneumonia infection
may account for 50 to 60% of the cases of pneumonia. During these
periods, also, more episodes of mixed infections with S. pneumoniae
have been reported.
[0014] Reinfection during adulthood is common; the clinical
presentation tends to be milder. Based on population seroprevalence
studies, there tends to be increased exposure with age, which is
particularly evident among men. Some investigators have speculated
that a persistent, asymptomatic C. pneumoniae infection state is
common.
[0015] In adults of middle age or older, C. pneumoniae infection
may progress to chronic bronchitis and sinusitis. A study in the
USA revealed that the incidence of pneumonia caused by C.
pneumoniae in persons younger than 60 years is 1 case per 1,000
persons per year; but in the elderly, the disease incidence rose
three-fold. C. pneumoniae infection rarely leads to
hospitalization, except in patients with an underlying illness.
[0016] Of considerable importance is the association of
atherosclerosis and C. pneumoniae infection. There are several
epidemiological studies showing a correlation of previous
infections with C. pneumoniae and heart attacks, coronary artery
and carotid artery disease. See, Saikku et al., Lancet 2: 983
(1988); Thom et al., JAMA 268: 68 (1992); Linnanmaki et al.,
Circulation 87: 1030 (1993); Saikku et al., Annals Int. Med. 116:
273 (1992); Melnick et al., Am. J. Med. 95: 499 (1993). Moreover,
the organisms has been detected in atheromas and fatty streaks of
the coronary, carotid, peripheral arteries and aorta. See, Shor et
al., South African Med. J. 82: 158 (1992); Kuo et al., J. Infect.
Dis. 167: 841 (1993); Kuo et al., Arteriosclerosis and Thrombosis
13: 1500 (1993); Campbell et al., J. Infect. Dis. 172: 585 (1995);
Chiu et al., Circulation 96: 2144-2148 (1997). Viable C. pneumoniae
has been recovered from the coronary and carotid artery. Ramirez et
al., Annals Int. Med. 125: 979 (1996); Jackson et al., Abst. K121,
p272, 36th ICAAC, New Orleans (1996). Furthermore, it has been
shown that C. pneumoniae can induce changes of atherosclerosis in a
rabbit model. See, Fong et al., (1997) Journal of Clinical
Microbiolology 35: 48. Taken together, these results indicate that
it is highly probable that C. pneumoniae can cause atherosclerosis
in humans, though the epidemiological importance of chlamydial
atherosclerosis remains to be demonstrated.
[0017] A number of recent studies have also indicated an
association between C. pneumoniae infection and asthma. Infection
has been linked to wheezing, asthmatic bronchitis, adult-onset
asthma and acute exacerbation of asthma in adults, and small-scale
studies have shown that prolonged antibiotic treatment was
effective at greatly reducing the severity of the disease in some
individuals. Hahn et al., Ann Allergy Asthma Immunol. 80: 45-49
(1998); Hahn et al., Epidemiol Infect. 117: 513-517 (1996);
Bjornsson et al, Scand J Infect. Dis. 28: 63-69 (1996); Hahn, J.
Fam. Pract. 41: 345-351 (1995); Allegra et al, Eur. Respir. J. 7:
2165-2168 (1994); Hahn et al., JAMA 266: 225-230 (1991).
[0018] In light of these results, a protective vaccine against
disease caused by C. pneumoniae infection would be of considerable
importance. There is not yet an effective vaccine for human C.
pneumoniae infection. Nevertheless, studies with C. trachomatis and
C. psittaci indicate that this is an attainable goal. For example,
mice which have recovered from a lung infection with C. trachomatis
are protected from infertility induced by a subsequent vaginal
challenge. Pal et al., Infection and Immunity 64: 5341 (1996).
Similarly, sheep immunized with inactivated C. psittaci were
protected from subsequent chlamydial-induced abortions and
stillbirths. Jones et al., Vaccine 13: 715 (1995). Protection from
chlamydial infections has been associated with Th1 immune
responses, particularly the induction of INF.gamma.-producing CD4+T
cells. Igietsemes et al., Immunology 5: 317 (1993). The adoptive
transfer of CD4+ cell lines or clones to nude or SCID mice
conferred protection from challenge or cleared chronic disease
(Igietseme et al., Regional Immunology 5: 317 (1993); Magee et al.,
Regional Immunology 5: 305 (1993)), and in vivo depletion of CD4+T
cells exacerbated disease post-challenge (Landers et al., Infection
& Immunity 59: 3774 (1991); Magee et al., Infection &
Immunity 63: 516 (1995)). However, the presence of sufficiently
high titres of neutralizing antibody at mucosal surfaces can also
exert a protective effect. Cotter et al., Infection and Immunity
63: 4704 (1995).
[0019] The extent of antigenic variation within the species C.
pneumoniae is not well characterized. Serovars of C. trachomatis
are defined on the basis of antigenic variation in major outer
membrane proteins (MOMP), but published C. pneumoniae MOMP gene
sequences show no variation between several diverse isolates of the
organism. See, Campbell et al., Infection and Immunity 58: 93
(1990); McCafferty et al., Infection and Immunity 63: 2387-9
(1995); Knudsen et al., Third Meeting of the European Society for
Chlamydia Research, Vienna (1996). Regions of the protein known to
be conserved in other chlamydial MOMPs are conserved in C.
pneumoniae. See, Campbell et al., Infection and Immunity 58: 93
(1990); McCafferty et al., Infection and Immunity 63: 2387-9
(1995). One study has described a strain of C. pneumoniae with a
MOMP of greater that usual molecular weight, but the gene for this
has not been sequenced. Grayston et al., J. Infect. Dis. 168: 1231
(1995). Partial sequences of outer membrane protein 2 from nine
diverse isolates were also found to be invariant. Ramirez et al.,
Annals Int. Med. 125: 979 (1996). The genes for HSP60 and HSP70
show little variation from other chlamydial species, as would be
expected. The gene encoding a 76 kDa antigen has been cloned from a
single strain of C. pneumoniae. It has no significant similarity
with other known chlamydial genes. Marrie, Clin. Infect. Dis. 18:
501 (1993).
[0020] Many antigens recognized by immune sera to C. pneumoniae are
conserved across all chlamydiae, but 98 kDa, 76 kDa and 54 kDa
proteins may be C. pneumoniae-specific. Campos et al., Invest.
Ophthalmol. Vis. Sci. 36: 1477 (1995); Marrie, Clin. Infect. Dis.
18: 501 (1993); Wiedmann-Al-Ahmad et al., Clin. Diagn. Lab.
Immunol. 4: 700-704 (1997). Immunoblotting of isolates with sera
from patients does show variation of blotting patterns between
isolates, indicating that serotypes C. pneumoniae may exist.
Grayston et al., J. Infect. Dis. 168: 1231 (1995); Ramirez et al.,
Annals Int. Med. 125: 979 (1996). However, the results are
potentially confounded by the infection status of the patients,
since immunoblot profiles of a patient's sera change with time
post-infection. An assessment of the number and relative frequency
of any serotypes, and the defining antigens, is not yet
possible.
[0021] Thus, a need remains for effective compositions for
preventing, treating, and diagnosing Chlamydia infections.
SUMMARY OF THE INVENTION
[0022] In one aspect, the present invention provides purified and
isolated DNA molecules that encode Chlamydia which can be used in
methods to prevent, treat, and diagnose Chlamydia infection.
Encoded polypeptides, designated POMP91B precursor, include
polypeptides having the amino acid sequence shown in SEQ ID NO: 2
and the DNA molecules include SEQ ID NO: 1 full-length sequence
(top sequence) and coding sequence (bottom sequence) for the mature
polypeptide. Those skilled in the art will appreciate that the
invention also includes DNA molecules that encode mutants,
variants, and derivatives of such polypeptides, which result from
the addition, deletion, or substitution of non-essential amino
acids as described herein. The invention also includes RNA
molecules corresponding to the DNA molecules of the invention.
[0023] In addition to the DNA and RNA molecules, the invention
includes the corresponding polypeptides and monospecific antibodies
that specifically bind to such polypeptides.
[0024] The present invention has wide application and includes
expression cassettes, vectors, and cells transformed or transfected
with the polynucleotides of the invention. Accordingly, the present
invention provides (i) a method for producing a polypeptide of the
invention in a recombinant host system and related expression
cassettes, vectors, and transformed or transfected cells; (ii) a
live vaccine vectors such as viral or bacterial live vaccine
vectors, including, pox virus, alphavirus, Salmonella typhimurium,
or Vibrio cholerae vector, containing a polynucleotide of the
invention, such vaccine vectors being useful for, e.g., preventing
and treating Chlamydia infection, in combination with a diluent or
carrier, and related pharmaceutical compositions and associated
therapeutic and/or prophylactic methods; (iii) a therapeutic and/or
prophylactic method involving administration of an RNA or DNA
molecule of the invention, either in a naked form or formulated
with a delivery vehicle, a polypeptide or combination of
polypeptides, or a monospecific antibody of the invention, and
related pharmaceutical compositions; (iv) a method for diagnosing
the presence of Chlamydia in a biological sample, which can involve
the use of a DNA or RNA molecule, a monospecific antibody, or a
polypeptide of the invention; and (v) a method for purifying a
polypeptide of the invention by antibody-based affinity
chromatography. The present invention provides purified and
isolated DNA molecules, which encode Chlamydia that can be used in
methods to prevent, treat, and diagnose Chlamydia infection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The present invention will be further understood from the
following description with reference to the drawings, in which:
[0026] FIG. 1 shows the nucleotide sequence (top sequence) and the
deduced amino acid sequence (bottom sequence) of the full length
POMP91B precursor gene (SEQ ID NO: 1) and the processed sequence
from Chlamydia pneumoniae (SEQ ID NO: 2).
[0027] FIG. 2 shows the restriction enzyme analysis of nucleotide
sequence encoding the C. pneumoniae POMP91B precursor gene.
[0028] FIG. 3 shows the construction and elements of plasmid
pCAI632.
[0029] FIG. 4 illustrates protection against C. pneumoniae
infection by pCAI632 following DNA immunization. Individual data
points are shown for each animal (hollow diamonds) as well as mean
and standard deviation for each group (solid squares).
DETAILED DESCRIPTION OF THE INVENTION
[0030] In the C. pneumoniae genome, open reading frames (ORFs)
encoding chlamydial polypeptides have been identified. These
polypeptides include polypeptides permanently found in the
bacterial membrane structure, polypeptides that are present in the
external vicinity of the bacterial membrane, include polypeptides
permanently found in the inclusion membrane structure, polypeptides
that are present in the external vicinity of the inclusion
membrane, and polypeptides that are released into the cytoplasm of
the infected cell. These polypeptides can be used in vaccination
methods for preventing and treating Chlamydia infection.
[0031] According to a first aspect of the invention, there are
provided isolated polynucleotides encoding the precursor and mature
forms of Chlamydia polypeptides.
[0032] An isolated polynucleotide of the invention encodes a
polypeptide having an amino acid sequence that is homologous to a
Chlamydia amino acid sequence, the Chlamydia amino acid sequence
being selected from the group consisting of the amino acid
sequences as shown in SEQ ID NOS: 1 and 2.
[0033] The term "isolated polynucleotide" is defined as a
polynucleotide removed from the environment in which it naturally
occurs. For example, a naturally-occurring DNA molecule present in
the genome of a living bacteria or as part of a gene bank is not
isolated, but the same molecule separated from the remaining part
of the bacterial genome, as a result of, e.g., a cloning event
(amplification), is isolated. Typically, an isolated DNA molecule
is free from DNA regions (e.g., coding regions) with which it is
immediately contiguous at the 5' or 3' end, in the naturally
occurring genome. Such isolated polynucleotides could be part of a
vector or a composition and still be isolated in that such a vector
or composition is not part of its natural environment.
[0034] A polynucleotide of the invention can be in the form of RNA
or DNA (e.g., cDNA, genomic DNA, or synthetic DNA), or
modifications or combinations thereof. The DNA can be
double-stranded or single-stranded, and, if single-stranded, can be
the coding strand or the non-coding (anti-sense) strand. The
sequence that encodes a polypeptide of the invention as shown in
SEQ ID NO: 1 can be (a) the coding sequence (bottom sequence); (b)
a ribonucleotide sequence derived by transcription of (a); or (c) a
different coding sequence. This latter, as a result of the
redundancy or degeneracy of the genetic code, encodes the same
polypeptides as the DNA molecules of which the nucleotide sequences
are illustrated in SEQ ID NOS: 1 or 2.
[0035] By "homologous amino acid sequence" is meant an amino acid
sequence that differs from an amino acid sequence shown in SEQ ID
NO: 2, only by one or more conservative amino acid substitutions,
or by one or more non-conservative amino acid substitutions,
deletions, or additions located at positions at which they do not
destroy the specific antigenicity of the polypeptide.
[0036] Preferably, such a sequence is at least 75%, more preferably
80%, and most preferably 90% identical to an amino acid sequence
shown in SEQ ID NO: 2.
[0037] Homologous amino acid sequences include sequences that are
identical or substantially identical to an amino acid sequence as
shown in SEQ ID NO: 2. By "amino acid sequence substantially
identical" is meant a sequence that is at least 90%, preferably
95%, more preferably 97%, and most preferably 99% identical to an
amino acid sequence of reference and that preferably differs from
the sequence of reference, if at all, by a majority of conservative
amino acid substitutions.
[0038] Conservative amino acid substitutions typically include
substitutions among amino acids of the same class. These classes
include, for example, (a) amino acids having uncharged polar side
chains, such as asparagine, glutamine, serine, threonine, and
tyrosine; (b) amino acids having basic side chains, such as lysine,
arginine, and histidine; (c) amino acids having acidic side chains,
such as aspartic acid and glutamic acid; and (d) amino acids having
nonpolar side chains, such as glycine, alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan, and
cysteine.
[0039] Homology is typically measured using sequence analysis
software (e.g., Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center, 1710
University Avenue, Madison, Wis. 53705). Similar amino acid
sequences are aligned to obtain the maximum degree of homology
(i.e., identity). To this end, it may be necessary to artificially
introduce gaps into the sequence. Once the optimal alignment has
been set up, the degree of homology (i.e., identity) is established
by recording all of the positions in which the amino acids of both
sequences are identical, relative to the total number of
positions.
[0040] Similarity factors include similar size, shape and
electrical charge. One particularly preferred method of determining
amino acid similarities is the PAM250 matrix described in Dayhoff
et al., 5 ATLAS OF PROTEIN SEQUENCE AND STRUCTURE 345-352 (1978
& Suppl.), incorporated by reference herein. A similarity score
is first calculated as the sum of the aligned pairwise amino acid
similarity scores. Insertions and deletions are ignored for the
purposes of percent homology and identity. Accordingly, gap
penalties are not used in this calculation. The raw score is then
normalized by dividing it by the geometric mean of the scores of
the candidate compound and the reference sequence. The geometric
mean is the square root of the product of these scores. The
normalized raw score is the percent homology.
[0041] Preferably, a homologous sequence is one that is at least
45%, more preferably 60%, and most preferably 85% identical to the
coding sequence of SEQ ID NO: 1.
[0042] Polypeptides having a sequence homologous to one of the
sequences shown in SEQ ID NOS: 1 and 2, include naturally-occurring
allelic variants, as well as mutants and variants or any other
non-naturally-occurring variants that are analogous in terms of
antigenicity, to a polypeptide having a sequence as shown in SEQ ID
NOS: 1 or 2.
[0043] An allelic variant is an alternate form of a polypeptide
that is characterized as having a substitution, deletion, or
addition of one or more amino acids that does not substantially
alter the biological function of the polypeptide. By "biological
function" is meant the function of the polypeptide in the cells in
which it naturally occurs, even if the function is not necessary
for the growth or survival of the cells. For example, the
biological function of a porin is to allow the entry into cells of
compounds present in the extracellular medium. The biological
function is distinct from the antigenic function. A polypeptide can
have more than one biological function.
[0044] Allelic variants are very common in nature. For example, a
bacterial species, e.g., C. pneumoniae, is usually represented by a
variety of strains that differ from each other by minor allelic
variations. Indeed, a polypeptide that fulfills the same biological
function in different strains can have an amino acid sequence that
is not identical in each of the strains. Such an allelic variation
may be equally reflected at the polynucleotide level.
[0045] Support for the use of allelic variants of polypeptide
antigens comes from, e.g., studies of the Chlamydial MOMP antigen.
The amino acid sequence of the MOMP varies from strain to strain,
yet cross-strain antibody binding plus neutralization of
infectivity occurs, indicating that the MOMP, when used as an
immunogen, is tolerant of amino acid variations.
[0046] Polynucleotides, e.g., DNA molecules, encoding allelic
variants can easily be retrieved by polymerase chain reaction (PCR)
amplification of genomic bacterial DNA extracted by conventional
methods. This involves the use of synthetic oligonucleotide primers
matching upstream and downstream of the 5' and 3' ends of the
encoding domain. Suitable primers can be designed according to the
nucleotide sequence information provided in SEQ ID NOS: 1 and 2.
Typically, a primer can consist of 10-40, preferably 15-25
nucleotides. It may be also advantageous to select primers
containing C and G nucleotides in a proportion sufficient to ensure
efficient hybridization; e.g., an amount of C and G nucleotides of
at least 40%, preferably 50% of the total nucleotide amount.
[0047] Useful homologs that do not naturally occur can be designed
using known methods for identifying regions of an antigen that are
likely to be tolerant of amino acid sequence changes and/or
deletions. For example, sequences of the antigen from different
species can be compared to identify conserved sequences.
[0048] Polypeptide derivatives that are encoded by polynucleotides
of the invention include, e.g., fragments, polypeptides having
large internal deletions derived from full-length polypeptides, and
fusion proteins.
[0049] Polypeptide fragments of the invention can be derived from a
polypeptide having a sequence homologous to any of the sequences
shown in SEQ ID NOS: 1 and 2, to the extent that the fragments
retain the desired substantial antigenicity of the parent
polypeptide (specific antigenicity). Polypeptide derivatives can
also be constructed by large internal deletions that remove a
substantial part of the parent polypeptide, while retaining the
desired specific antigenicity. Generally, polypeptide derivatives
should be about at least 12 amino acids in length to maintain the
antigenicity. Advantageously, they can be at least 20 amino acids,
preferably at least 50 amino acids, more preferably at least 75
amino acids, and most preferably at least 100 amino acids in
length.
[0050] Useful polypeptide derivatives, e.g., polypeptide fragments,
can be designed using computer-assisted analysis of amino acid
sequences in order to identify sites in protein antigens having
potential as surface-exposed, antigenic regions. Hughes et al.,
Infect. Immun. 60: 3497 (1992).
[0051] Polypeptide fragments and polypeptides having large internal
deletions can be used for revealing epitopes that are otherwise
masked in the parent polypeptide and that may be of importance for
inducing, for example, a protective T cell-dependent immune
response. Deletions can also remove immunodominant regions of high
variability among strains.
[0052] It is an accepted practice in the field of immunology to use
fragments and variants of protein immunogens as vaccines and
immunogens, as all that is required to induce an immune response to
a protein may be a small (e.g., 8 to 10 amino acid) region of the
protein. This has been done for a number of vaccines against
pathogens other than Chlamydia. For example, short synthetic
peptides corresponding to surface-exposed antigens of pathogens
such as murine mammary tumor virus, peptide containing 11 amino
acids (Dion et al., Virology 179: 474-477 (1990)); Semliki Forest
virus, peptide containing 16 amino acids (Snijders et al., J. Gen.
Virol. 72: 557-565 (1991)); and canine parvovirus, two overlapping
peptides, each containing 15 amino acids (Langeveld et al., Vaccine
12: 1473-1480 (1994)) have been shown to be effective vaccine
antigens against their respective pathogens.
[0053] Polynucleotides encoding polypeptide fragments and
polypeptides having large internal deletions can be constructed
using standard methods (see, e.g., Ausubel et al., CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons Inc. (1994));
for example, by PCR, including inverse PCR, by restriction enzyme
treatment of the cloned DNA molecules, or by the method of Kunkel
et al. (Proc. Natl. Acad. Sci. USA 82: 448 (1985)); biological
material available at Stratagene.
[0054] A polypeptide derivative can also be produced as a fusion
polypeptide that contains a polypeptide or a polypeptide derivative
of the invention fused, e.g.;at the N- or C-terminal end, to any
other polypeptide. For construction of DNA encoding the amino acid
sequence corresponding to hybrid fusion proteins, a first DNA
encoding amino acid sequence corresponding to portions of SEQ ID
NO: 1 or 2 is joined to a second DNA using methods described in,
for example, U.S. Pat. No. 5,844,095, incorporated herein by
reference. A product can then be easily obtained by translation of
the genetic fusion. Vectors for expressing fusion polypeptides are
commercially available, such as the pMa1-c2 or pMa1-p2 systems of
New England Biolabs, in which the fusion peptide is a maltose
binding protein, the glutathione-S-transferase system of Pharmacia,
or the His-Tag system available from Novagen. These and other
expression systems provide convenient means for further
purification of polypeptides and derivatives of the invention.
[0055] Another particular example of fusion polypeptides included
in the invention includes a polypeptide or polypeptide derivative
of the invention fused to a polypeptide having adjuvant activity,
such as, e.g., the subunit B of either cholera toxin or E. coli
heat-labile toxin. Several possibilities are can be used for
achieving fusion. First, the polypeptide of the invention can be
fused to the N-, or preferably, to the C-terminal end of the
polypeptide having adjuvant activity. Second, a polypeptide
fragment of the invention can be fused within the amino acid
sequence of the polypeptide having adjuvant activity.
[0056] As stated above, the polynucleotides of the invention encode
Chlamydia polypeptides in precursor or mature form. They can also
encode hybrid precursors containing heterologous signal peptides,
which can mature into polypeptides of the invention. By
"heterologous signal peptide" is meant a signal peptide that is not
found in the naturally-occurring precursor of a polypeptide of the
invention.
[0057] A polynucleotide of the invention, having a homologous
coding sequence, hybridizes, preferably under stringent conditions,
to a polynucleotide having a sequence as shown in SEQ ID NO: 1.
Hybridization procedures are described in, e.g., Ausubel et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons Inc.
(1994); Silhavy et al., EXPERIMENTS WITH GENE FUSIONS, Cold Spring
Harbor Laboratory Press (1984); Davis et al., A MANUAL FOR GENETIC
ENGINEERING: ADVANCED BACTERIAL GENETICS, Cold Spring Harbor
Laboratory Press (1980), each incorporated herein by reference.
Important parameters that can be considered for optimizing
hybridization conditions are reflected in a formula that allows
calculation of a critical value, the melting temperature above
which two complementary DNA strands separate from each other. Casey
and Davidson, Nucl. Acid Res. 4: 1539 (1977). This formula is as
follows:
Tm=81.5+0.5.times.(% G+C)+1.6 log (positive ion
concentration)-0.6.times.(- % formamide).
[0058] Under appropriate stringency conditions, hybridization
temperature (Th) is approximately 20-40.degree. C., 20-25.degree.
C. or, preferably, 30-40.degree. C. below the calculated Tm. Those
skilled in the art will understand that optimal temperature and
salt conditions can be readily determined empirically in
preliminary experiments using conventional procedures.
[0059] For example, stringent conditions can be achieved, both for
pre-hybridizing and hybridizing incubations, (i) within 4-16 hours
at 42.degree. C., in 6.times.SSC containing 50% formamide or (ii)
within 4-16 hours at 65.degree. C. in an aqueous 6.times.SSC
solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)).
[0060] For polynucleotides containing 30 to 600 nucleotides, the
above formula is used and then is corrected by subtracting
(600/polynucleotide size in base pairs). Stringency conditions are
defined by a Th that is 5 to 10.degree. C. below Tm.
[0061] Hybridization conditions with oligonucleotides shorter than
20-30 bases do not exactly follow the rules set forth above. In
such cases, the formula for calculating the Tm is as follows:
Tm=4.times.(G+C)+2(A+T).
[0062] For example, an 18 nucleotide fragment of 50% G+C would have
an approximate Tm of 54.degree. C.
[0063] A polynucleotide molecule of the invention, containing RNA,
DNA, or modifications or combinations thereof, can have various
applications. For example, a DNA molecule can be used (i) in a
process for producing the encoded polypeptide in a recombinant host
system, (ii) in the construction of vaccine vectors such as
poxviruses, which are further used in methods and compositions for
preventing and/or treating Chlamydia infection, (iii) as a vaccine
agent (as well as an RNA molecule), in a naked form or formulated
with a delivery vehicle and, (iv) in the construction of attenuated
Chlamydia strains that can overexpress a polynucleotide of the
invention or express it in a modified, mutated form, such as a
non-toxic form, if appropriate. For vaccine compositions and uses
of the proteins and peptides and encoding nucleotides of the
present invention for protection against diseases caused by
Chlamydia, it is not preferred to use naked DNA encoding the
protein or peptides and administering these nucleotides
intranasally or intramuscularly. For these proteins, it is
preferred to administer the encoding nucleic acids by other routes
such as intradermally and/or to formulate the encoding nucleic
acids to improve (or adjuvant) the immune response. It is also
preferred to include the encoding nucleic acid as part of a
recombinant live vector, such as a viral or bacterial vector for
use as the immunizing agent. It is also preferred to immunize with
vaccine formulations comprising the proteins or peptides of the
invention themselves. These vaccine formulations may include the
use of adjuvants.
[0064] According to a second aspect of the invention, there is
therefore provided (i) an expression cassette containing a DNA
molecule of the invention placed under the control of the elements
required for expression, in particular under the control of an
appropriate promoter; (ii) an expression vector containing an
expression cassette of the invention; (iii) a prokaryotic or
eukaryotic cell transformed or transfected with an expression
cassette and/or vector of the invention, as well as (iv) a process
for producing a polypeptide or polypeptide derivative encoded by a
polynucleotide of the invention, which involves culturing a
prokaryotic or eukaryotic cell transformed or transfected with an
expression cassette and/or vector of the invention, under
conditions that allow expression of the DNA molecule of the
invention and, recovering the encoded polypeptide or polypeptide
derivative from the cell culture.
[0065] A recombinant expression system can be selected from
prokaryotic and eukaryotic hosts. Eukaryotic hosts include yeast
cells (e.g., Saccharomyces cerevisiae or Pichia pastoris),
mammalian cells (e.g., COS1, NTH3T3, or JEG3 cells), arthropods
cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells.
Preferably, a prokaryotic host such as E. coli is used. Bacterial
and eukaryotic cells are available from a number of different
sources to those skilled in the art, e.g., the American Type
Culture Collection (ATCC; Rockville, Md.).
[0066] The choice of the expression system depends on the features
desired for the expressed polypeptide. For example, it may be
useful to produce a polypeptide of the invention in a particular
lipidated form or any other form.
[0067] The choice of the expression cassette will depend on the
host system selected as well as the features desired for the
expressed polypeptide. Typically, an expression cassette includes a
promoter that is functional in the selected host system and can be
constitutive or inducible; a ribosome binding site; a start codon
(ATG) if necessary, a region encoding a signal peptide, e.g., a
lipidation signal peptide; a DNA molecule of the invention; a stop
codon; and optionally a 3' terminal region (translation and/or
transcription terminator). The signal peptide encoding region is
adjacent to the polynucleotide of the invention and placed in
proper reading frame. The signal peptide-encoding region can be
homologous or heterologous to the DNA molecule encoding the mature
polypeptide and can be specific to the secretion apparatus of the
host used for expression. The open reading frame constituted by the
DNA molecule of the invention, solely or together with the signal
peptide, is placed under the control of the promoter so that
transcription and translation occur in the host system. Promoters,
signal peptide encoding regions are widely known and available to
those skilled in the art and includes, for example, the promoter of
Salmonella typhimurium (and derivatives) that is inducible by
arabinose (promoter araB) and is functional in Gram-negative
bacteria such as E. coli (as described in U.S. Pat. No. 5,028,530
and in Cagnon et al., Protein Engineering 4: 843 (1991)); the
promoter of the gene of bacteriophage T7 encoding RNA polymerase,
that is functional in a number of E. coli strains expressing T7
polymerase (described in U.S. Pat. No. 4,952,496); OspA lipidation
signal peptide; and R1pB lipidation signal peptide (Takase et al.,
J. Bact. 169: 5692 (1987)).
[0068] The expression cassette is typically part of an expression
vector, which is selected for its ability to replicate in the
chosen expression system. Expression vectors (e.g., plasmids or
viral vectors) can be chosen from those described in Pouwels et al.
(CLONING VECTORS: LABORATORY MANUAL, 85, Supp. 1987). They can be
purchased from various commercial sources.
[0069] Methods for transforming/transfecting host cells with
expression vectors will depend on the host system selected as
described in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
John Wiley & Sons Inc. (1994).
[0070] Upon expression, a recombinant polypeptide of the invention
(or a polypeptide derivative) is produced and remains in the
intracellular compartment, is secreted/excreted in the
extracellular medium or in the periplasmic space, or is embedded in
the cellular membrane. The polypeptide can then be recovered in a
substantially purified form from the cell extract or from the
supernatant after centrifugation of the recombinant cell culture.
Typically, the recombinant polypeptide can be purified by
antibody-based affinity purification or by any other method that
can be readily adapted by a person skilled in the art, such as by
genetic fusion to a small affinity binding domain. Antibody-based
affinity purification methods are also available for purifying a
polypeptide of the invention extracted from a Chlamydia strain.
Antibodies useful for purifying by immunoaffinity the polypeptides
of the invention can be obtained as described below.
[0071] A polynucleotide of the invention can also be useful in the
vaccine field, e.g., for achieving DNA vaccination. There are two
major possibilities, either using a viral or bacterial host as gene
delivery vehicle (live vaccine vector) or administering the gene in
a free form, e.g., inserted into a plasmid. Therapeutic or
prophylactic efficacy of a polynucleotide of the invention can be
evaluated as described below.
[0072] Accordingly, in a third aspect of the invention, there is
provided (i) a vaccine vector such as a poxvirus, containing a DNA
molecule of the invention, placed under the control of elements
required for expression; (ii) a composition of matter containing a
vaccine vector of the invention, together with a diluent or
carrier; particularly, (iii) a pharmaceutical composition
containing a therapeutically or prophylactically effective amount
of a vaccine vector of the invention; (iv) a method for inducing an
immune response against Chlamydia in a mammal (e.g., a human;
alternatively, the method can be used in veterinary applications
for treating or preventing Chlamydia infection of animals, e.g.,
cats or birds), which involves administering to the mammal an
immunogenically effective amount of a vaccine vector of the
invention to elicit an immune response, e.g., a protective or
therapeutic immune response to Chlamydia; and particularly, (v) a
method for preventing and/or treating a Chlamydia (e.g. C.
trachomatis, C. psittaci, C. pneumonia, C. pecorum) infection,
which involves administering a prophylactic or therapeutic amount
of a vaccine vector of the invention to an individual in need.
Additionally, the third aspect of the invention encompasses the use
of a vaccine vector of the invention in the preparation of a
medicament for preventing and/or treating Chlamydia infection.
[0073] A vaccine vector of the invention can express one or several
polypeptides or derivatives of the invention, as well as at least
one additional Chlamydia antigen, fragment, homolog, mutant, or
derivative thereof. In addition, it can express a cytokine, such as
interleukin-2 (IL-2) or interleukin-12 (IL-12), that enhances the
immune response (adjuvant effect). Thus, a vaccine vector can
include an additional DNA sequence encoding, e.g., a chlamydial
antigen, or a cytokine, placed under the control of elements
required for expression in a mammalian cell.
[0074] Alternatively, a composition of the invention can include
several vaccine vectors, each of them being capable of expressing a
polypeptide or derivative of the invention. A composition can also
contain a vaccine vector capable of expressing an additional
Chlamydia antigen, or a subunit, fragment, homolog, mutant, or
derivative thereof, or a cytokine such as IL-2 or IL-12.
[0075] In vaccination methods for treating or preventing infection
in a mammal, a vaccine vector of the invention can be administered
by any conventional route in use in the vaccine field,
particularly, to a mucosal (e.g., ocular, intranasal, oral,
gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract)
surface or via the parenteral (e.g., subcutaneous, intradermal,
intramuscular, intravenous, or intraperitoneal) route. Preferred
routes depend upon the choice of the vaccine vector. The
administration can be achieved in a single dose or repeated at
intervals. The appropriate dosage depends on various parameters
understood by skilled artisans such as the vaccine vector itself,
the route of administration or the condition of the mammal to be
vaccinated (weight, age and the like).
[0076] Live vaccine vectors available in the art include viral
vectors such as adenoviruses, alphavirus, and poxviruses as well as
bacterial vectors, e.g., Shigella, Salmonella, Vibrio cholerae,
Lactobacillus, Bacille bili de Calmette-Gurin (BCG), and
Streptococcus.
[0077] An example of an adenovirus vector, as well as a method for
constructing an adenovirus vector capable of expressing a DNA
molecule of the invention, are described in U.S. Pat. No.
4,920,209. Poxvirus vectors that can be used include, e.g.,
vaccinia and canary pox virus, described in U.S. Pat. No. 4,722,848
and U.S. Pat. No. 5,364,773, respectively (also see, e.g.,
Tartaglia et al., Virology 188: 217 (1992)) for a description of a
vaccinia virus vector; and Taylor et al, Vaccine 13: 539 (1995) for
a reference of a canary pox). Poxvirus vectors capable of
expressing a polynucleotide of the invention can be obtained by
homologous recombination as described in Kieny et al., Nature 312:
163 (1984) so that the polynucleotide of the invention is inserted
in the viral genome under appropriate conditions for expression in
mammalian cells. Generally, the dose of vaccine viral vector, for
therapeutic or prophylactic use, can be of from about
1.times.10.sup.4 to about 1.times.10.sup.11, advantageously from
about 1.times.10.sup.7 to about 1.times.10.sup.10, preferably of
from about 1.times.10.sup.7 to about 1.times.10.sup.9
plaque-forming units per kilogram. Preferably, viral vectors are
administered parenterally; for example, in three doses, four weeks
apart. Those skilled in the art recognize that it is preferable to
avoid adding a chemical adjuvant to a composition containing a
viral vector of the invention and thereby minimizing the immune
response to the viral vector itself.
[0078] Non-toxicogenic Vibrio cholerae mutant strains that are
useful as a live oral vaccine are described in Mekalanos et al.,
Nature 306: 551 (1983) and U.S. Pat. No. 4,882,278 (strain in which
a substantial amount of the coding sequence of each of the two ctxA
alleles has been deleted so that no functional cholerae toxin is
produced); WO 92/11354 (strain in which the irgA locus is
inactivated by mutation; this mutation can be combined in a single
strain with ctxA mutations); and WO 94/1533 (deletion mutant
lacking functional ctxA and attRS1 DNA sequences). These strains
can be genetically engineered to express heterologous antigens, as
described in WO 94/19482. An effective vaccine dose of a Vibrio
cholerae strain capable of expressing a polypeptide or polypeptide
derivative encoded by a DNA molecule of the invention can contain,
e.g., about 1.times.10.sup.5 to about 1.times.10.sup.9, preferably
about 1.times.10.sup.6 to about 1.times.10.sup.8 viable bacteria in
an appropriate volume for the selected route of administration.
Preferred routes of administration include all mucosal routes; most
preferably, these vectors are administered intranasally or
orally.
[0079] Attenuated Salmonella typhimurium strains, genetically
engineered for recombinant expression of heterologous antigens or
not, and their use as oral vaccines are described in Nakayama et
al., Bio/Technology 6: 693 (1988) and WO 92/11361. Preferred routes
of administration include all mucosal routes; most preferably,
these vectors are administered intranasally or orally.
[0080] Others bacterial strains useful as vaccine vectors are
described in High et al., EMBO 11: 1991 (1992); Sizemore et al.,
Science 270: 299 (1995) (Shigella flexneri); Medaglini et al.,
Proc. Natl. Acad. Sci. USA 92: 6868 (1995) (Streptococcus
gordonii); and Flynn, Cell. Mol. Biol. 40: 31 (1994), WO 88/6626,
WO 90/0594, WO 91/13157, WO 92/1796, and WO 92/21376 (Bacille
Calmette Guerin).
[0081] In bacterial vectors, polynucleotide of the invention can be
inserted into the bacterial genome or can remain in a free state,
carried on a plasmid.
[0082] An adjuvant can also be added to a composition containing a
vaccine bacterial vector. A number of adjuvants are known to those
skilled in the art. Preferred adjuvants can be selected from the
list provided below.
[0083] According to a fourth aspect of the invention, there is also
provided (i) a composition of matter containing a polynucleotide of
the invention, together with a diluent or carrier; (ii) a
pharmaceutical composition containing a therapeutically or
prophylactically effective amount of a polynucleotide of the
invention; (iii) a method for inducing an immune response against
Chlamydia, in a mammal, by administering to the mammal, an
immunogenically effective amount of a polynucleotide of the
invention to elicit an immune response, e.g., a protective immune
response to Chlamydia; and particularly, (iv) a method for
preventing and/or treating a Chlamydia (e.g., C. trachomatis, C.
psittaci, C. pneumoniae, or C. pecorum) infection, by administering
a prophylactic or therapeutic amount of a polynucleotide of the
invention to an individual in need. Additionally, the fourth aspect
of the invention encompasses the use of a polynucleotide of the
invention in the preparation of a medicament for preventing and/or
treating Chlamydia infection. The fourth aspect of the invention
preferably includes the use of a DNA molecule placed under
conditions for expression in a mammalian cell, e.g., in a plasmid
that is unable to replicate in mammalian cells and to substantially
integrate in a mammalian genome.
[0084] Polynucleotides (DNA or RNA) of the invention can also be
administered as such to a mammal for vaccine, e.g., therapeutic or
prophylactic, purpose. When a DNA molecule of the invention is
used, it can be in the form of a plasmid that is unable to
replicate in a mammalian cell and unable to integrate in the
mammalian genome. Typically, a DNA molecule is placed under the
control of a promoter suitable for expression in a mammalian cell.
The promoter can function ubiquitously or tissue-specifically.
Examples of non-tissue specific promoters include the early
Cytomegalovirus (CMV) promoter (described in U.S. Pat. No.
4,168,062) and the Rous Sarcoma Virus promoter (described in Norton
& Coffin, Molec. Cell Biol. 5: 281(1985)). The desmin promoter
(Li et al., Gene 78: 243 (1989), Li & Paulin, J. Biol. Chem.
266: 6562 (1991), and Li & Paulin, J. Biol. Chem. 268: 10403
(1993)) is tissue-specific and drives expression in muscle cells.
More generally, useful vectors are described, i.a., WO 94/21797 and
Hartikka et al., Human Gene Therapy 7: 1205 (1996).
[0085] For DNA/RNA vaccination, the polynucleotide of the invention
can encode a precursor or a mature form. When it encodes a
precursor form, the precursor form can be homologous or
heterologous. In the latter case, a eukaryotic leader sequence can
be used, such as the leader sequence of the tissue-type plasminogen
factor (tPA).
[0086] A composition of the invention can contain one or several
polynucleotides of the invention. It can also contain at least one
additional polynucleotide encoding another Chlamydia antigen or a
fragment, derivative, mutant, or analog thereof. A polynucleotide
encoding a cytokine, such as interleukin-2 (IL-2) or interleukin-
12 (IL-12), can also be added to the composition so that the immune
response is enhanced. These additional polynucleotides are placed
under appropriate control for expression. Advantageously, DNA
molecules of the invention and/or additional DNA molecules to be
included in the same composition, can be carried in the same
plasmid.
[0087] Standard techniques of molecular biology for preparing and
purifying polynucleotides can be used in the preparation of
polynucleotide therapeutics of the invention. For use as a vaccine,
a polynucleotide of the invention can be formulated according to
various methods.
[0088] First, a polynucleotide can be used in a naked form, free of
any delivery vehicles, such as anionic liposomes, cationic lipids,
microparticles, e.g., gold microparticles, precipitating agents,
e.g., calcium phosphate, or any other transfection-facilitating
agent. In this case, the polynucleotide can be simply diluted in a
physiologically acceptable solution, such as sterile saline or
sterile buffered saline, with or without a carrier. When present,
the carrier preferably is isotonic, hypotonic, or weakly
hypertonic, and has a relatively low ionic strength, such as
provided by a sucrose solution, e.g., a solution containing 20%
sucrose.
[0089] Alternatively, a polynucleotide can be associated with
agents that assist in cellular uptake. It can be, i.a., (i)
complemented with a chemical agent that modifies the cellular
permeability, such as bupivacaine (see, e.g., WO 94/16737), (ii)
encapsulated into liposomes, or (iii) associated with cationic
lipids or silica, gold, or tungsten microparticles.
[0090] Anionic and neutral liposomes are well-known in the art
(see, e.g., LIPOSOMES: A PRACTICAL APPROACH, RPC New Ed, IRL Press
(1990)), for a detailed description of methods for making
liposomes) and are useful for delivering a large range of products,
including polynucleotides.
[0091] Cationic lipids are also known in the art and are commonly
used for gene delivery. Such lipids include Lipofectin.TM. also
known as DOTMA
(N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride),
DOTAP (1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB
(dimethyldioctadecylammonium bromide), DOGS
(dioctadecylamidologlycyl spermine) and cholesterol derivatives
such as DC-Chol (3 beta-(N-(N',N'-dimethyl aminomethane)-carbamoyl)
cholesterol). A description of these cationic lipids can be found
in EP 187,702, WO 90/11092, U.S. Pat. No. 5,283,185, WO 91/15501,
WO 95/26356, and U.S. Pat. No. 5,527,928. Cationic lipids for gene
delivery are preferably used in association with a neutral lipid
such as DOPE (dioleyl phosphatidylethanolamine), as described in,
e.g., WO 90/11092.
[0092] Other transfection-facilitating compounds can be added to a
formulation containing cationic liposomes. A number of them are
described in, e.g., WO 93/18759, WO 93/19768, WO 94/25608, and WO
95/2397. They include, i.a., spermine derivatives useful for
facilitating the transport of DNA through the nuclear membrane
(see, for example, WO 93/18759) and membrane-permeabilizing
compounds such as GALA, Gramicidine S, and cationic bile salts
(see, for example, WO 93/19768).
[0093] Gold or tungsten microparticles can also be used-for gene
delivery, as described in WO 91/359, WO 93/17706, and Tang et al.
(Nature 356: 152 (1992)). In this case, the microparticle-coated
polynucleotides can be injected via intradermal or intra-epidermal
routes using a needleless injection device ("gene gun"), such as
those described in U.S. Pat. No. 4,945,050, U.S. Pat. No.
5,015,580, and WO 94/24263.
[0094] The amount of DNA to be used in a vaccine recipient depends,
e.g., on the strength of the promoter used in the DNA construct,
the immunogenicity of the expressed gene product, the condition of
the mammal intended for administration (e.g., the weight, age, and
general health of the mammal), the mode of administration, and the
type of formulation. In general, a therapeutically or
prophylactically effective dose from about 1 .mu.g to about 1 mg,
preferably, from about 10 .mu.g to about 800 .mu.g and, more
preferably, from about 25 .mu.g to about 250 .mu.g, can be
administered to human adults. The administration can be achieved in
a single dose or repeated at intervals.
[0095] The route of administration can be any conventional route
used in the vaccine field. As general guidance, a polynucleotide of
the invention can be administered via a mucosal surface, e.g., an
ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal,
and urinary tract surface; or via a parenteral route, e.g., by an
intravenous, subcutaneous, intraperitoneal, intradermal,
intraepidermal, or intramuscular route. The choice of the
administration route will depend on, e.g., the formulation that is
selected. A polynucleotide formulated in association with
bupivacaine is advantageously administered into muscles. When a
neutral or anionic liposome or a cationic lipid, such as DOTMA or
DC-Chol, is used, the formulation can be advantageously injected
via intravenous, intranasal (aerosolization), intramuscular,
intradermal, and subcutaneous routes. A polynucleotide in a naked
form can advantageously be administered via the intramuscular,
intradermal, or subcutaneous routes.
[0096] Although not absolutely required, such a composition can
also contain an adjuvant. If so, a systemic adjuvant that does not
require concomitant administration in order to exhibit an adjuvant
effect is preferable such as, e.g., QS21, which is described in
U.S. Pat. No. 5,057,546.
[0097] The sequence information provided in the present application
enables the design of specific nucleotide probes and primers that
can be useful in diagnosis. Accordingly, in a fifth aspect of the
invention, there is provided a nucleotide probe or primer having a
sequence found in or derived by degeneracy of the genetic code from
a sequence shown in SEQ ID NO: 1.
[0098] The term "probe" as used in the present application refers
to DNA (preferably single stranded) or RNA molecules (or
modifications or combinations thereof) that hybridize under the
stringent conditions, as defined above, to nucleic acid molecules
having sequences homologous to those shown in SEQ ID NOS: 1 and 2,
or to a complementary or anti-sense sequence. Generally, probes are
significantly shorter than full-length sequences shown in SEQ ID
NOS: 1 and 2; for example, they can contain from about 5 to about
100, preferably from about 10 to about 80 nucleotides. In
particular, probes have sequences that are at least 75%, preferably
at least 85%, more preferably 95% homologous to a portion of a
sequence as shown in SEQ ID NOS: 1 and 2 or that are complementary
to such sequences. Probes can contain modified bases such as
inosine, methyl-5-deoxycytidine, deoxyuridine,
dimethylamino-5-deoxyuridine, or diamino-2, 6-purine. Sugar or
phosphate residues can also be modified or substituted. For
example, a deoxyribose residue can be replaced by a polyamide
(Nielsen et al., Science 254: 1497 (1991)) and phosphate residues
can be replaced by ester groups such as diphosphate, alkyl,
arylphosphonate and phosphorothioate esters. In addition, the
2'-hydroxyl group on ribonucleotides can be modified by including,.
e.g., alkyl groups.
[0099] Probes of the invention can be used in diagnostic tests, as
capture or detection probes. Such capture probes can be
conventionally immobilized on a solid support, directly or
indirectly, by covalent means or by passive adsorption. A detection
probe can be labelled by a detection marker selected from
radioactive isotopes; enzymes such as peroxidase, alkaline
phosphatase, and enzymes able to hydrolyze a chromogenic,
fluorogenic, or luminescent substrate; compounds that are
chromogenic, fluorogenic, or luminescent; nucleotide base analogs;
and biotin.
[0100] Probes of the invention can be used in any conventional
hybridization technique, such as dot blot (Maniatis et al.,
MOLECULAR CLONING: A LABORATORY MANUAL (1982) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.), Southern blot
(Southern, J. Mol. Biol. 98: 503 (1975)), northern blot (identical
to Southern blot to the exception that RNA is used as a target), or
the sandwich technique (Dunn et al., Cell 12: 23 (1977)). The
latter technique involves the use of a specific capture probe
and/or a specific detection probe with nucleotide sequences that at
least partially differ from each other.
[0101] A primer is usually a probe of about 10 to about 40
nucleotides that is used to initiate enzymatic polymerization of
DNA in an amplification process (e.g., PCR), in an elongation
process, or in a reverse transcription method. In a diagnostic
method involving PCR, primers can be labelled.
[0102] Thus, the invention also encompasses (i) a reagent
containing a probe of the invention for detecting and/or
identifying the presence of Chlamydia in a biological material;
(ii) a method for detecting and/or identifying the presence of
Chlamydia in a biological material, in which (a) a sample is
recovered or derived from the biological material, (b) DNA or RNA
is extracted from the material and denatured, and (c) exposed to a
probe of the invention, for example, a capture, detection probe or
both, under stringent hybridization conditions, such that
hybridization is detected; and (iii) a method for detecting and/or
identifying the presence of Chlamydia in a biological material, in
which (a) a sample is recovered or derived from the biological
material, (b) DNA is extracted therefrom, (c) the extracted DNA is
primed with at least one, and preferably two, primers of the
invention and amplified by polymerase chain reaction, and (d) the
amplified DNA fragment is produced.
[0103] As previously mentioned, polypeptides that can be produced
upon expression of the newly identified open reading frames are
useful vaccine agents.
[0104] Therefore, a sixth aspect of the invention features a
substantially purified polypeptide or polypeptide derivative having
an amino acid sequence encoded by a polynucleotide of the
invention.
[0105] A "substantially purified polypeptide" is defined as a
polypeptide that is separated from the environment in which it
naturally occurs and/or that is free of the majority of the
polypeptides that are present in the environment in which it was
synthesized. For example, a substantially purified polypeptide is
free from cytoplasmic polypeptides. Those skilled in the art will
understand that the polypeptides of the invention can be purified
from a natural source, i.e., a Chlamydia strain, or can be produced
by recombinant means.
[0106] Homologous polypeptides or polypeptide derivatives encoded
by polynucleotides of the invention can be screened for specific
antigenicity by testing cross-reactivity with an antiserum raised
against the polypeptide of reference having an amino acid sequence
as shown in SEQ ID NOS: 1 and 2. Briefly, a monospecific
hyperimmune antiserum can be raised against a purified reference
polypeptide as such or as a fusion polypeptide, for example, an
expression product of MBP, GST, or His-tag systems or a synthetic
peptide predicted to be antigenic. The homologous polypeptide or
derivative screened for specific antigenicity can be produced as
such or as a fusion polypeptide. In this latter case and if the
antiserum is also raised against a fusion polypeptide, two
different fusion systems are employed. Specific antigenicity can be
determined according to a number of methods, including Western blot
(Towbin et al., Proc. Natl. Acad. Sci. USA 76: 4350 (1979)), dot
blot, and ELISA, as described below.
[0107] In a Western blot assay, the product to be screened, either
as a purified preparation or a total E. coli extract, is submitted
to SDS-Page electrophoresis as described by Laemmli, Nature 227:
680 (1970). After transfer to a nitrocellulose membrane, the
material is further incubated with the monospecific hyperimmune
antiserum diluted in the range of dilutions from about 1:5 to about
1:5000, preferably from about 1:100 to about 1:500. Specific
antigenicity is shown once a band corresponding to the product
exhibits reactivity at any of the dilutions in the above range.
[0108] In an ELISA assay, the product to be screened is preferably
used as the coating antigen. A purified preparation is preferred,
although a whole cell extract can also be used. Briefly, about 100
.mu.l of a preparation at about 10 .mu.g protein/ml are distributed
into wells of a 96-well polycarbonate ELISA plate. The plate is
incubated for 2 hours at 37.degree. C. then overnight at 4.degree.
C. The plate is washed with phosphate buffer saline (PBS)
containing 0.05% Tween 20 (PBS/Tween buffer). The wells are
saturated with 250 .mu.l PBS containing 1% bovine serum albumin
(BSA) to prevent non-specific antibody binding. After 1 hour
incubation at 37.degree. C., the plate is washed with PBS/Tween
buffer. The antiserum is serially diluted in PBS/Tween buffer
containing 0.5% BSA. 100 .mu.l of dilutions are added per well. The
plate is incubated for 90 minutes at 37.degree. C., washed and
evaluated according to standard procedures. For example, a goat
anti-rabbit peroxidase conjugate is added to the wells when
specific antibodies were raised in rabbits. Incubation is carried
out for 90 minutes at 37.degree. C. and the plate is washed. The
reaction is developed with the appropriate substrate and the
reaction is measured by colorimetry (absorbance measured
spectrophotometrically). Under the above experimental conditions, a
positive reaction is shown by O.D. values greater than a non immune
control serum.
[0109] In a dot blot assay, a purified product is preferred,
although a whole cell extract can also be used. Briefly, a solution
of the product at about 100 .mu.g/ml is serially two-fold diluted
in 50 mM Tris-HCl (pH 7.5). 100 .mu.l of each dilution are applied
to a nitrocellulose membrane 0.45 .mu.m set in a 96-well dot blot
apparatus (Biorad). The buffer is removed by applying vacuum to the
system. Wells are washed by addition of 50 mM Tris-HCl (pH 7.5) and
the membrane is air-dried. The membrane is saturated in blocking
buffer (50 mM Tris-HCl (pH 7.5) 0.15 M NaCl, 10 g/L skim milk) and
incubated with an antiserum dilution from about 1:50 to about
1:5000, preferably about 1:500. The reaction is revealed according
to standard procedures. For example, a goat anti-rabbit peroxidase
conjugate is added to the wells when rabbit antibodies are used.
Incubation is carried out 90 minutes at 37.degree. C. and the blot
is washed. The reaction is developed with the appropriate substrate
and stopped. The reaction is measured visually by the appearance of
a colored spot, e.g., by colorimetry. Under the above experimental
conditions, a positive reaction is shown once a colored spot is
associated with a dilution of at least about 1:5, preferably of at
least about 1:500.
[0110] Therapeutic or prophylactic efficacy of a polypeptide or
derivative of the invention can be evaluated as described
below.
[0111] According to a seventh aspect of the invention, there is
provided (i) a composition of matter containing a polypeptide of
the invention together with a diluent or carrier; in particular,
(ii) a pharmaceutical composition containing a therapeutically or
prophylactically effective amount of a polypeptide of the
invention; (iii) a method for inducing an immune response against
Chlamydia in a mammal, by administering to the mammal an
immunogenically effective amount of a polypeptide of the invention
to elicit an immune response, e.g., a protective immune response to
Chlamydia; and particularly, (iv) a method for preventing and/or
treating a Chlamydia (e.g., C. trachomatis. C. psittaci, C.
pneumoniae. or C. pecorum) infection, by administering a
prophylactic or therapeutic amount of a polypeptide of the
invention to an individual in need. Additionally, the seventh
aspect of the invention encompasses the use of a polypeptide of the
invention in the preparation of a medicament for preventing and/or
treating Chlamydia infection.
[0112] The immunogenic compositions of the invention can be
administered by any conventional route in use in the vaccine field,
in particular to a mucosal (e.g., ocular, intranasal, pulmonary,
oral, gastric, intestinal, rectal, vaginal, or urinary tract)
surface or via the parenteral (e.g., subcutaneous, intradermal,
intramuscular, intravenous, or intraperitoneal) route. The choice
of the administration route depends upon a number of parameters,
such as the adjuvant associated with the polypeptide. For example,
if a mucosal adjuvant is used, the intranasal or oral route will be
preferred and if a lipid formulation or an aluminum compound is
used, the parenteral route will be preferred. In the latter case,
the subcutaneous or intramuscular route is most preferred. The
choice can also depend upon the nature of the vaccine agent. For
example, a polypeptide of the invention fused to CTB or LTB will be
best administered to a mucosal surface.
[0113] A composition of the invention can contain one or several
polypeptides or derivatives of the invention. It can also contain
at least one additional Chlamydia antigen, or a subunit, fragment,
homolog, mutant, or derivative thereof.
[0114] For use in a composition of the invention, a polypeptide or
derivative thereof can be formulated into or with liposomes,
preferably neutral or anionic liposomes, microspheres, ISCOMS, or
virus-like-particles (VLPs) to facilitate delivery and/or enhance
the immune response. These compounds are readily available to one
skilled in the art; for example, see LIPOSOMES: A PRACTICAL
APPROACH (supra).
[0115] Adjuvants other than liposomes and the like can also be used
and are known in the art. An appropriate selection can
conventionally be made by those skilled in the art, for example,
from the list provided below.
[0116] Administration can be achieved in a single dose or repeated
as necessary at intervals as can be determined by one skilled in
the art. For example, a priming dose can be followed by three
booster doses at weekly or monthly intervals. An appropriate dose
depends on various parameters including the recipient (e.g., adult
or infant), the particular vaccine antigen, the route and frequency
of administration, the presence/absence or type of adjuvant, and
the desired effect (e.g., protection and/or treatment), as can be
determined by one skilled in the art. In general, a vaccine antigen
of the invention can be administered by a mucosal route in an
amount from about 10 .mu.g to about 500 mg, preferably from about 1
mg to about 200 mg. For the parenteral route of administration, the
dose usually should not exceed about 1 mg, preferably about 100
.mu.g.
[0117] When used as vaccine agents, polynucleotides and
polypeptides of the invention can be used sequentially as part of a
multistep immunization process. For example, a mammal can be
initially primed with a vaccine vector of the invention such as a
pox virus, e.g., via the parenteral route, and then boosted twice
with the polypeptide encoded by the vaccine vector, e.g., via the
mucosal route. In another example, liposomes associated with a
polypeptide or derivative of the invention can also be used for
priming, with boosting being carried out mucosally using a soluble
polypeptide or derivative of the invention in combination with a
mucosal adjuvant (e.g., LT).
[0118] A polypeptide derivative of the invention is also useful as
a diagnostic reagent for detecting the presence of anti-Chlamydia
antibodies, e.g., in a blood sample. Such polypeptides are about 5
to about 80, preferably about 10 to about 50 amino acids in length
and can be labeled or unlabeled, depending upon the diagnostic
method. Diagnostic methods involving such a reagent are described
below.
[0119] Upon expression of a DNA molecule of the invention, a
polypeptide or polypeptide derivative is produced and can be
purified using known laboratory techniques. For example, the
polypeptide or polypeptide derivative can be produced as a fusion
protein containing a fused tail that facilitates purification. The
fusion product can be used to immunize a small mammal, e.g., a
mouse or a rabbit, in order to raise antibodies against the
polypeptide or polypeptide derivative (monospecific antibodies).
The eighth aspect of the invention thus provides a monospecific
antibody that binds to a polypeptide or polypeptide derivative of
the invention.
[0120] By "monospecific antibody" is meant an antibody that is
capable of reacting with a unique naturally-occurring Chlamydia
polypeptide. An antibody of the invention can be polyclonal or
monoclonal. Monospecific antibodies can be recombinant, e.g.,
chimeric (e.g., constituted by a variable region of murine origin
associated with a human constant region), humanized (a human
immunoglobulin constant backbone together with hypervariable region
of animal, e.g., murine, origin), and/or single chain. Both
polyclonal and monospecific antibodies can also be in the form of
immunoglobulin fragments, e.g., F(ab)'2 or Fab fragments. The
antibodies of the invention can be of any isotype, e.g., IgG or
IgA, and polyclonal antibodies can be of a single isotype or can
contain a mixture of isotypes.
[0121] The antibodies of the invention, which are raised to a
polypeptide or polypeptide derivative of the invention, can be
produced and identified using standard immunological assays, e.g.,
Western blot analysis, dot blot assay, or ELISA (see, e.g., Coligan
et al., CURRENT PROTOCOLS IN IMMUNOLOGY (1994) John Wiley &
Sons, Inc., New York, N.Y.). The antibodies can be used in
diagnostic methods to detect the presence of a Chlamydia antigen in
a sample, such as a biological sample. The antibodies can also be
used in affinity chromatography methods for purifying a polypeptide
or polypeptide derivative of the invention. As is discussed further
below, such antibodies can be used in prophylactic and therapeutic
passive immunization methods.
[0122] Accordingly, a ninth aspect of the invention provides (i) a
reagent for detecting the presence of Chlamydia in a biological
sample that contains an antibody, polypeptide, or polypeptide
derivative of the invention; and (ii) a diagnostic method for
detecting the presence of Chlamydia in a biological sample, by
contacting the biological sample with an antibody, a polypeptide,
or a polypeptide derivative of the invention, such that an immune
complex is formed, and by detecting such complex to indicate the
presence of Chlamydia in the sample or the organism from which the
sample is derived.
[0123] Those skilled in the art will understand that the immune
complex is formed between a component of the sample and the
antibody, polypeptide, or polypeptide derivative, whichever is
used, and that any unbound material can be removed prior to
detecting the complex. As can be easily understood, a polypeptide
reagent is useful for detecting the presence of anti-Chlamydia
antibodies in a sample, e.g., a blood sample, while an antibody of
the invention can be used for screening a sample, such as a gastric
extract or biopsy, for the presence of Chlamydia polypeptides.
[0124] For use in diagnostic applications, the reagent (i.e., the
antibody, polypeptide, or polypeptide derivative of the invention)
can be in a free state or immobilized on a solid support, such as a
tube, a bead, or any other conventional support used in the field.
Immobilization can be achieved using direct or indirect means.
Direct means include passive adsorption (non-covalent binding) or
covalent binding between the support and the reagent. By "indirect
means" is meant that an anti-reagent compound that interacts with a
reagent is first attached to the solid support. For example, if a
polypeptide reagent is used, an antibody that binds to it can serve
as an anti-reagent, provided that it binds to an epitope that is
not involved in the recognition of antibodies in biological
samples. Indirect means can also employ a ligand-receptor system,
for example, a molecule such as a vitamin can be grafted onto the
polypeptide reagent and the corresponding receptor can be
immobilized on the solid phase. This is illustrated by the
biotin-streptavidin system. Alternatively, indirect means can be
used, e.g., by adding to the reagent a peptide tail, chemically or
by genetic engineering, and immobilizing the grafted or fused
product by passive adsorption or covalent linkage of the peptide
tail.
[0125] According to a tenth aspect of the invention, there is
provided a process for purifying, from a biological sample, a
polypeptide or polypeptide derivative of the invention, which
involves carrying out antibody-based affinity chromatography with
the biological sample, wherein the antibody is a monospecific
antibody of the invention.
[0126] For use in a purification process of the invention, the
antibody can be polyclonal or monospecific, and preferably is of
the IgG type. Purified IgGs can be prepared from an antiserum using
standard methods (see, e.g., Coligan et al., supra). Conventional
chromatography supports, as well as standard methods for grafting
antibodies, are disclosed in, e.g., ANTIBODIES: A LABORATORY
MANUAL, D. Lane, E. Harlow, Eds. (1988).
[0127] Briefly, a biological sample, such as an C. pneumoniae
extract, preferably in a buffer solution, is applied to a
chromatography material, preferably equilibrated with the buffer
used to dilute the biological sample so that the polypeptide or
polypeptide derivative of the invention (i.e., the antigen) is
allowed to adsorb onto the material. The chromatography material,
such as a gel or a resin coupled to an antibody of the invention,
can be in batch form or in a column. The unbound components are
washed off and the antigen is then eluted with an appropriate
elution buffer, such as a glycine buffer or a buffer containing a
chaotropic agent, e.g., guanidine HCl, or high salt concentration
(e.g., 3 M MgCl.sub.2). Eluted fractions are recovered and the
presence of the antigen is detected, e.g., by measuring the
absorbance at 280 nm.
[0128] An antibody of the invention can be screened for therapeutic
efficacy as described as follows. According to an eleventh aspect
of the invention, there is provided: (i) a composition of matter
containing a monospecific antibody of the invention, together with
a diluent or carrer; (ii) a pharmaceutical composition containing a
therapeutically or prophylactically effective amount of a
monospecific antibody of the invention, and (iii) a method for
treating or preventing a Chlamydia (e.g., C. trachomatis, C.
psittaci, C. pneumoniae or C. pecorum) infection, by administering
a therapeutic or prophylactic amount of a monospecific antibody of
the invention to an individual in need. Additionally, the eleventh
aspect of the invention encompasses the use of a monospecific
antibody of the invention in the preparation of a medicament for
treating or preventing Chlamydia infection.
[0129] To this end, the monospecific antibody can be polyclonal or
monoclonal, preferably of the IgA isotype (predominantly). In
passive immunization, the antibody can be administered to a mucosal
surface of a mammal, e.g., the gastric mucosa, e.g., orally or
intragastrically, advantageously, in the presence of a bicarbonate
buffer. Alternatively, systemic administration, not requiring a
bicarbonate buffer, can be carried out. A monospecific antibody of
the invention can be administered as a single active component or
as a mixture with at least one monospecific antibody specific for a
different Chlamydia polypeptide. The amount of antibody and the lo
particular regimen used can be readily determined by one skilled in
the art. For example, daily administration of about 100 to 1,000 mg
of antibodies over one week, or three doses per day of about 100 to
1,000 mg of antibodies over two or three days, can be an effective
regimens for most purposes.
[0130] Therapeutic or prophylactic efficacy can be evaluated using
standard methods in the art, e.g., by measuring induction of a
mucosal immune response or induction of protective and/or
therapeutic immunity, using, e.g., the C. pneumoniae mouse model.
Those skilled in the art will recognize that the C. pneumoniae
strain of the model can be replaced with another Chlamydia strain.
For example, the efficacy of DNA molecules and polypeptides from C.
pneumoniae is preferably evaluated in a mouse model using an C.
pneumoniae strain. Protection can be determined by comparing the
degree of Chlamydia infection to that of a control group.
Protection is shown when infection is reduced by comparison to the
control group. Such an evaluation can be made for polynucleotides,
vaccine vectors, polypeptides and derivatives thereof, as well as
antibodies of the invention.
[0131] Adjuvants useful in any of the vaccine compositions
described above are as follows.
[0132] Adjuvants for parenteral administration include aluminum
compounds, such as aluminum hydroxide, aluminum phosphate, and
aluminum hydroxy phosphate. The antigen can be precipitated with,
or adsorbed onto, the aluminum compound according to standard
protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton,
Mont.), can be used in parenteral administration.
[0133] Adjuvants for mucosal administration include bacterial
toxins, e.g., the cholera toxin (CT), the E. coli heat-labile toxin
(LT), the Clostridium difficile toxin A and the pertussis toxin
(PT), or combinations, subunits, toxoids, or mutants thereof. For
example, a purified preparation of native cholera toxin subunit B
(CTB) can be of use. Fragments, homologs, derivatives, and fusions
to any of these toxins are also suitable, provided that they retain
adjuvant activity. Preferably, a mutant having reduced toxicity is
used. Suitable mutants are described, e.g., in WO 95/17211
(Arg-7-Lys CT mutant), WO 96/6627 (Arg-192-Gly LT mutant), and WO
95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant). Additional LT
mutants that can be used in the methods and compositions of the
invention include, e.g., Ser-63-Lys, Ala-69-Gly, Glu-110-Asp, and
Glu-112-Asp mutants. Other adjuvants, such as a bacterial
monophosphoryl lipid A (MPLA) of, e.g., E. coli, Salmonella
minnesota, Salmonella typhimurium, or Shigella flexneri; saponins,
or polylactide glycolide (PLGA) microspheres, can also be used in
mucosal administration.
[0134] Adjuvants useful for both mucosal and parenteral
administrations include polyphosphazene (WO 95/2415), DC-chol (3
b-(N-(N',N'-dimethyl aminomethane)-carbamoyl) cholesterol (U.S.
Pat. No. 5,283,185 and WO 96/14831) and QS-21 (WO 88/9336).
[0135] Any pharmaceutical composition of the invention, containing
a polynucleotide, a polypeptide, a polypeptide derivative, or an
antibody of the invention, can be manufactured in a conventional
manner. In particular, it can be formulated with a pharmaceutically
acceptable diluent or carrier, e.g., water or a saline solution
such as phosphate buffer saline. In general, a diluent or carrier
can be selected on the basis of the mode and route of
administration, and standard pharmaceutical practice. Suitable
pharmaceutical carriers or diluents, as well as pharmaceutical
necessities for their use in pharmaceutical formulations, are
described in Remington's Pharmaceutical Sciences, a standard
reference text in this field and in the USP/NF.
[0136] The invention also includes methods in which Chlamydia
infection, are treated by oral administration of a Chlamydia
polypeptide of the invention and a mucosal adjuvant, in combination
with an antibiotic, an antacid, sucralfate, or a combination
thereof. Examples of such compounds that can be administered with
the vaccine antigen and the adjuvant are antibiotics, including,
e.g., macrolides, tetracyclines, and derivatives thereof (specific
examples of antibiotics that can be used include azithromycin or
doxicyclin or immunomodulators such as cytokines or steroids. In
addition, compounds containing more than one of the above-listed
components coupled together, can be used. The invention also
includes compositions for carrying out these methods, i.e.,
compositions containing a Chlamydia antigen (or antigens) of the
invention, an adjuvant, and one or more of the above-listed
compounds, in a pharmaceutically acceptable carrier or diluent.
[0137] Amounts of the above-listed compounds used in the methods
and compositions of the invention can readily be determined by one
skilled in the art. In addition, one skilled in the art can readily
design treatment/immunization schedules. For example, the
non-vaccine components can be administered on days 1-14, and the
vaccine antigen+adjuvant can be administered on days 7, 14, 21, and
28.
[0138] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific examples. These examples are
described solely for purposes of illustration and are not intended
to limit the scope of the invention. Changes in form and
substitution of equivalents are contemplated as circumstances may
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended in a descriptive sense and
not for purposes of limitation. Polypeptides having a sequence
homologous to one of the sequences shown in SEQ ID NOS: 1 and 2,
include naturally-occurring allelic variants, as well as mutants or
any other non-naturally occurring variants that are analogous in
terms of antigenicity, to a polypeptide.
[0139] As is known in the art, an allelic variant is an alternate
form of a polypeptide that is characterized as having a
substitution, deletion, or addition of one or more amino acids that
does not alter the biological function of the polypeptide. By
"biological function" is meant the function of the polypeptide in
the cells in which it naturally occurs, even if the function is not
necessary for the growth or survival of the cells. For example, the
biological function of a porin is to allow the entry into cells of
compounds present in the extracellular medium. The biological
function is distinct from the antigenic function. A polypeptide can
have more than one biological function.
[0140] Allelic variants are very common in nature. For example, a
bacterial species, e.g., C. pneumoniae, is usually represented by a
variety of strains that differ from each other by minor allelic
variations. Indeed, a polypeptide that fulfills the same biological
function in different strains can have an amino acid sequence that
is not identical in each of the strains. Such an allelic variation
may be equally reflected at the polynucleotide level.
[0141] Support for the use of allelic variants of polypeptide
antigens comes from, e.g., studies of the Chlamydial MOMP antigen.
The amino acid sequence of the MOMP varies from strain to strain,
yet cross-strain antibody binding plus neutralization of
infectivity occurs, indicating that the MOMP, when used as an
immunogen, is tolerant of amino acid variations.
[0142] Polynucleotides, e.g., DNA molecules, encoding allelic
variants can easily be retrieved by polymerase chain reaction (PCR)
amplification of genomic bacterial DNA extracted by conventional
methods. This involves the use of synthetic oligonucleotide primers
matching upstream and downstream of the 5' and 3' ends of the
encoding domain. Suitable primers can be designed according to the
nucleotide sequence information provided in SEQ ID NOS: 1 and
2.
[0143] Typically, a primer can consist of 10 to 40, preferably 15
to 25 nucleotides. It may be also advantageous to select primers
containing C and G nucleotides in a proportion sufficient to ensure
efficient hybridization; e.g., an amount of C and G nucleotides of
at least 40%, preferably 50% of the total nucleotide amount.
[0144] Useful homologs that do not naturally occur can be designed
using known methods for identifying regions of an antigen that are
likely to be tolerant of amino acid sequence changes and/or
deletions. For example, sequences of the antigen from different
species can be compared to identify conserved sequences.
[0145] Polypeptide derivatives that are encoded by polynucleotides
of the invention include, e.g., fragments, polypeptides having
large internal deletions derived from full-length polypeptides, and
fusion proteins.
[0146] Polypeptide fragments of the invention can be derived from a
polypeptide having a sequence homologous to any of the sequences
shown in SEQ ID NO: 1, to the extent that the fragments retain the
substantial antigenicity of the parent polypeptide (specific
antigenicity). Polypeptide derivatives can also be constructed by
large internal deletions that remove a substantial part of the
parent polypeptide, while retaining specific antigenicity.
Generally, polypeptide derivatives should be about at least 12
amino acids in length to maintain antigenicity. Advantageously,
they can be at least 20 amino acids, preferably at least 50 amino
acids, more preferably at least 75 amino acids, and most preferably
at least 100 amino acids in length.
[0147] Useful polypeptide derivatives, e.g., polypeptide fragments,
can be designed using computer-assisted analysis of amino acid
sequences in order to identify sites in protein antigens having
potential as surface-exposed, antigenic regions. See e.g., Hughes
et al. Infect. Immun. 60: 3497 1992.
[0148] Polypeptide fragments and polypeptides having large internal
deletions can be used for revealing epitopes that are otherwise
masked in the parent polypeptide and that may be of importance for
inducing a protective T cell-dependent immune response. Deletions
can also remove immunodominant regions of high variability among
strains.
[0149] It is an accepted practice in the field of immunology to use
fragments and variants of protein immunogens as vaccines, as all
that is required to induce an immune response to a protein is a
small (e.g., 8 to 10 amino acid) immunogenic region of the protein.
This has been done for a number of vaccines against pathogens other
than Chlamydia. For example, short synthetic peptides corresponding
to surface-exposed antigens of pathogens such as murine mammary
tumor virus, peptide containing 11 amino acids; (see e.g., Dion et
al., Virology 179: 474-477 (1990)) Semliki Forest virus, peptide
containing 16 amino acids (see e.g., Snijders et al., J. Gen.
Virol. 72: 557-565 (1991)), and canine parvovirus, 2 overlapping
peptides, each containing 15 amino acids (see e.g., Langeveld et
al. Vaccine 12: 1473-1480 (1994)), have been shown to be effective
vaccine antigens against their respective pathogens.
[0150] Polynucleotides encoding polypeptide fragments and
polypeptides having large internal deletions can be constructed
using standard methods, for example, by PCR, including inverse PCR,
by restriction enzyme treatment of the cloned DNA molecules, or by
the method of Kunkel et al. (Proc. Natl. Acad. Sci. USA 82: 448
(1985)) using biological material available at Stratagene.
[0151] A polypeptide derivative can also be produced as a fusion
polypeptide that contains a polypeptide or a polypeptide derivative
of the invention fused, e.g., at the N- or C-terminal end, to any
other polypeptide (hereinafter referred to as a peptide tail). Such
a product can be easily obtained by translation of a genetic
fusion, i.e., a hybrid gene. Vectors for expressing fusion
polypeptides are commercially available, such as the pMa1-c2 or
pMa1-p2 systems of New England Biolabs, in which the peptide tail
is a maltose binding protein, the glutathione-S-transferase system
of Pharmacia, or the His-Tag system available from Novagen. These
and other expression systems provide convenient means for further
purification of polypeptides and derivatives of the invention.
[0152] Another particular example of fusion polypeptides included
in invention includes a polypeptide or polypeptide derivative of
the invention fused to a polypeptide having adjuvant activity, such
as, e.g., subunit B of either cholera toxin or E. coli heat-labile
toxin. Several possibilities are can be used for achieving fision.
First, the polypeptide of the invention can be fused to the N-, or
preferably, to the C-terminal end of the polypeptide having
adjuvant activity. Second, a polypeptide fragment of the invention
can be fused within the amino acid sequence of the polypeptide
having adjuvant activity.
[0153] As stated above, the polynucleotides of the invention encode
Chlamydia polypeptides in precursor or mature form. They can also
encode hybrid precursors containing heterologous signal peptides,
which can mature into polypeptides of the invention. By
"heterologous signal peptide" is meant a signal peptide that is not
found in the naturally-occurring precursor of a polypeptide of the
invention.
[0154] A polynucleotide of the invention, having a homologous
coding sequence, hybridizes, preferably under stringent conditions,
to a polynucleotide having a sequence as shown in SEQ ID NOS: 1 or
2. Hybridization procedures are, e.g., described in Ausubel et al.,
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons Inc.
(1994), Silhavy et al. EXPERIMENTS WITH GENE FUSIONS, Cold Spring
Harbor Laboratory Press (1984); Davis et al., A MANUAL FOR GENETIC
ENGINEERING: ADVANCED BACTERIAL GENETICS, Cold Spring Harbor
Laboratory Press (1980). Important parameters that can be
considered for optimizing hybridization conditions are reflected in
a formula that allows calculation of a critical value, the melting
temperature above which two complementary DNA strands separate from
each other. Casey and Davidson, Nucl. Acid Res. 4: 1539 (1977).
This formula is as follows: Tm=81.5+0.41.times.(% G+C)+16.6 log
(cation ion concentration)-0.63.times.(% formamide)-600/base
number. Under appropriate stringency conditions, hybridization
temperature (Th) is approximately 20-40.degree. C., 20-25.degree.
C., or, preferably 30-40.degree. C. below the calculated Tm. Those
skilled in the art will understand that optimal temperature and
salt conditions can be readily determined empirically in
preliminary experiments using conventional procedures.
[0155] For example, stringent conditions can be achieved, both for
pre-hybridizing and hybridizing incubations, (i) within 4-16 hours
at 42.degree. C., in 6.times.SSC containing 50% formamide or to
(ii) within 4-16 hours at 65.degree. C. in an aqueous 6.times.SSC
solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)). Typically,
hybridization experiments are performed at a temperature from 60 to
68.degree. C., e.g., 65.degree. C. At such a temperature, stringent
hybridization conditions can be achieved in 6.times.SSC, preferably
in 2.times.SSC or 1.times.SSC, more preferably in 0.5.times.SSC,
0.3.times.SSC or 0.1.times.SSC (in the absence of formamide).
1.times.SSC contains 0.15 M NaCl and 0.015 M sodium citrate.
[0156] For polynucleotides containing 30 to 600 nucleotides, the
above formula is used and then is corrected by subtracting
(600/polynucleotide size in base pairs). Stringency conditions are
defined by a Th that is 5 to 10.degree. C. below Tm.
[0157] Hybridization conditions with oligonucleotides shorter than
20-30 bases do not exactly follow the rules set forth above. In
such cases, the formula for calculating the Tm is as follows:
Tm=4.times.(G+C)+2(A+T). For example, an 18 nucleotide fragment of
50% G+C would have an approximate Tm of 54.degree. C.
[0158] A polynucleotide molecule of the invention, containing RNA,
DNA, or modifications or combinations thereof, can have various
applications. For example, a DNA molecule can be used (i) in a
process for producing the encoded polypeptide in a recombinant host
system, (ii) in the construction of vaccine vectors such as
poxviruses, which are further used in methods and compositions for
preventing and/or treating Chlamydia infection, (iii) as a vaccine
agent (as well as an RNA molecule), in a naked form or formulated
with a delivery vehicle and, (iv) in the construction of attenuated
Chlamydia strains that can over-express a polynucleotide of the
invention or express it in a non-toxic, mutated form.
[0159] According to a second aspect of the invention, there is
therefore provided (i) an expression cassette containing a DNA
molecule of the invention placed under the control of the elements
required for expression, in particular under the control of an
appropriate promoter; (ii) an expression vector containing an
expression cassette of the invention; (iii) a prokaryotic or
eukaryotic cell transformed or transfected with an expression
cassette and/or vector of the invention, as well as (iv) a process
for producing a polypeptide or polypeptide derivative encoded by a
polynucleotide of the invention, which involves culturing a
prokaryotic or eukaryotic cell transformed or transfected with an
expression cassette and/or vector of the invention, under
conditions that allow expression of the DNA molecule of the
invention and, recovering the encoded polypeptide or polypeptide
derivative from the cell culture.
[0160] A recombinant expression system can be selected from
prokaryotic and eukaryotic hosts. Eukaryotic hosts include yeast
cells (e.g., Saccharomyces cerevisiae or Pichia pastoris),
mammalian cells (e.g., COS1, NIH3T3, or JEG3 cells), arthropods
cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells.
Preferably, a prokaryotic host such as E. coli is used. Bacterial
and eukaryotic cells are available from a number of different
sources to those skilled in the art, e.g., the American Type
Culture Collection (ATCC; Rockville, Md.).
[0161] The choice of the expression system depends on the features
desired for the expressed polypeptide. For example, it may be
useful to produce a polypeptide of the invention in a particular
lipidated form or any other form.
[0162] The choice of the expression cassette will depend on the
host system selected as well as the features desired for the
expressed polypeptide. Typically, an expression cassette includes a
promoter that is functional in the selected host system and can be
constitutive or inducible; a ribosome binding site; a start codon
(ATG) if necessary, a region encoding a signal peptide, e.g., a
lipidation signal peptide; a DNA molecule of the invention, a stop
codon; and optionally a 3' terminal region (translation and/or
transcription terminator). The signal peptide encoding region is
adjacent to the polynucleotide of the invention and placed in
proper reading frame. The signal peptide-encoding region can be
homologous or heterologous to the DNA molecule encoding the mature
polypeptide and can be specific to the secretion apparatus of the
host used for expression. The open reading frame constituted by the
DNA molecule of the invention, solely or together with the signal
peptide, is placed under the control of the promoter so that
transcription and translation occur in the host system. Promoters,
signal peptide encoding regions are widely known and available to
those skilled in the art and includes, for example, the promoter of
Salmonella typhimurium (and derivatives) that is inducible by
arabinose (promoter araB) and is functional in Gram-negative
bacteria such as E. coli (as described in U.S. Pat. No. 5,028,530
and in Cagnon et al., Protein Engineering 4: 843 (1991); the
promoter of the gene of bacteriophage T7 encoding RNA polymerase,
that is functional in a number of E. coli strains expressing T7
polymerase (described in U.S. Pat. No. 4,952,496); OspA lipidation
signal peptide; and R1pB lipidation signal peptide. See Takase et
al., J. Bact. 169: 5692 (1987).
[0163] The expression cassette is typically part of an expression
vector, which is selected for its ability to replicate in the
chosen expression system. Expression vectors (e.g., plasmids or
viral vectors) can be chosen from those described in Pouwels et al.
(CLONING VECTORS: A LABORATORY MANUAL 1985, Suppl., 1987). They can
be purchased from various commercial sources.
[0164] Methods for transforming/transfecting host cells with
expression vectors will depend on the host system selected as
described in Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons Inc. (1994)).
[0165] Upon expression, a recombinant polypeptide of the invention
(or a polypeptide derivative) is produced and remains in the
intracellular compartment, is secreted/excreted in the
extracellular medium or in the periplasmic space, or is embedded in
the cellular membrane. The polypeptide can then be recovered in a
substantially purified form from the cell extract or from the
supernatant after centrifugation of the recombinant cell culture.
Typically, the recombinant polypeptide can be purified by
antibody-based affinity purification or by any other method that
can be readily adapted by a person skilled in the art, such as by
genetic fusion to a small affinity binding domain. Antibody-based
affinity purification methods are also available for purifying a
polypeptide of the invention extracted from a Chlamydia strain.
Antibodies useful for purifying by immunoaffinity the polypeptides
of the invention can be obtained as described below.
[0166] A polynucleotide of the invention can also be useful in the
vaccine field, e.g., for achieving DNA vaccination. There are two
major possibilities, either using a viral or bacterial host as gene
delivery vehicle (live vaccine vector) or administering the gene in
a free form, e.g., inserted into a plasmid. Therapeutic or
prophylactic efficacy of a polynucleotide of the invention can be
evaluated as described below.
[0167] Accordingly, in a third aspect of the invention, there is
provided (i) a vaccine vector such as a poxvirus, containing a DNA
molecule of the invention, placed under the control of elements
required for expression; (ii) a composition of matter containing a
vaccine vector of the invention, together with a diluent or
carrier; particularly, (iii) a pharmaceutical composition
containing a therapeutically or prophylactically effective amount
of a vaccine vector of the invention; (iv) a method for inducing an
immune response against Chlamydia in a mammal (e.g., a human;
alternatively, the method can be used in veterinary applications
for treating or preventing Chlamydia infection of animals, e.g.,
cats or birds), which involves administering to the mammal an
immunogenically effective amount of a vaccine vector of the
invention to elicit an immune response, e.g., a protective or
therapeutic immune response to Chlamydia; and particularly, (v) a
method for preventing and/or treating a Chlamydia (e.g., C.
trachomatis, C. psittaci, C. pneumoniae, C. pecorum) infection,
which involves administering a prophylactic or therapeutic amount
of a vaccine vector of the invention to an individual in need.
Additionally, the third aspect of the invention encompasses the use
of a vaccine vector of the invention in the preparation of a
medicament for preventing and/or treating Chlamydia infection.
[0168] A vaccine vector of the invention can express one or several
polypeptides or derivatives of the invention, as well as at least
one additional Chlamydia antigen, fragment, homolog, mutant, or
derivative thereof. In addition, it can express a cytokine, such as
interleukin-2 (IL-2) or interleukin-12 (IL-12), that enhances the
immune response (adjuvant effect). Thus, a vaccine vector can
include an additional DNA sequence encoding, e.g., a chlamydial
antigen, or a cytokine, placed under the control of elements
required for expression in a mammalian cell.
[0169] Alternatively, a composition of the invention can include
several vaccine vectors, each of them being capable of expressing a
polypeptide or derivative of the invention. A composition can also
contain a vaccine vector capable of expressing an additional
Chlamydia antigen, or a subunit, fragment, homolog, mutant, or
derivative thereof; or a cytokine such as IL-2 or IL-12.
[0170] In vaccination methods for treating or preventing infection
in a mammal, a vaccine vector of the invention can be administered
by any conventional route in use in the vaccine field,
particularly, to a mucosal (e.g., ocular, intranasal, oral,
gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract)
surface or via the parenteral (e.g., subcutaneous, intradermal,
intramuscular, intravenous, or intraperitoneal) route. Preferred
routes depend upon the choice of the vaccine vector. The
administration can be achieved in a single dose or repeated at
intervals. The appropriate dosage depends on various parameters
understood by skilled artisans such as the vaccine vector itself,
the route of administration or the condition of the mammal to be
vaccinated (weight, age and the like).
[0171] Live vaccine vectors available in the art include viral
vectors such as adenoviruses and poxviruses as well as bacterial
vectors, e.g., Shigella, Salmonella, Vibrio cholerae,
Lactobacillus, Bacille bili{acute over (e )} de Calmette-Gurin
(BCG), and Streptococcus.
[0172] An example of an adenovirus vector, as well as a method for
constructing an adenovirus vector capable of expressing a DNA
molecule of the invention, are described in U.S. Pat. No.
4,920,209. Poxvirus vectors that can be used include, e.g.,
vaccinia and canary pox virus, described in U.S. Pat. No. 4,722,848
and U.S. Pat. No. 5,364,773, respectively. Also see, e.g.,
Tartaglia et al., Virology 188: 217 (1992) for a description of a
vaccinia virus vector; and Taylor et al, Vaccine 13: 539 (1995) for
a reference of a canary pox. Poxvirus vectors capable of expressing
a polynucleotide of the invention can be obtained by homologous
recombination as described in Kieny et al., Nature 312: 163 (1984)
so that the polynucleotide of the invention is inserted in the
viral genome under appropriate conditions for expression in
mammalian cells. Generally, the dose of vaccine viral vector, for
therapeutic or prophylactic use, can be of from about
1.times.10.sup.4 to about 1.times.10.sup.11, advantageously from
about 1.times.10.sup.7 to about 1.times.10.sup.10, preferably of
from about 1.times.10.sup.7 to about 1.times.10.sup.9
plaque-forming units per kilogram. Preferably, viral vectors are
administered parenterally; for example, in 3 doses, 4 weeks apart.
Those skilled in the art recognize that it is preferable to avoid
adding a chemical adjuvant to a composition containing a viral
vector of the invention and thereby, minimizing the immune response
to the viral vector itself.
[0173] Non-toxicogenic Vibrio cholerae mutant strains that are
useful as a live oral vaccine are described in Mekalanos et al.,
Nature 306: 551 (1983) and U.S. Pat. No. 4,882,278 (strain in which
a substantial amount of the coding sequence of each of the two ctxA
alleles has been deleted so that no functional cholerae toxin is
produced); WO 92/11354 (strain in which the irgA locus is
inactivated by mutation; this mutation can be combined in a single
strain with ctxA mutations); and WO 94/1533 (deletion mutant
lacking functional ctxA and attRS1 DNA sequences). These strains
can be genetically engineered to express heterologous antigens, as
described in WO 94/19482. An effective vaccine dose of a Vibrio
cholerae strain capable of expressing a polypeptide or polypeptide
derivative encoded by a DNA molecule of the invention can contain,
e.g., about 1.times.10.sup.5 to about 1.times.10.sup.9, preferably
about 1.times.10.sup.6 to about 1.times.10.sup.8 viable bacteria
appropriate volume for the selected route of administration.
Preferred routes of administration include all mucosal routes; most
preferably, these vectors are administered intranasally or
orally.
[0174] Attenuated Salmonella typhimurium strains, genetically
engineered for recombinant expression of heterologous antigens or
not, and their use as oral vaccines are described in Nakayama et
al., Bio/Technology 6: 693 (1998) and WO 92/11361. Preferred routes
of administration include all mucosal routes; most preferably,
these vectors are administered intranasally or orally.
[0175] Others bacterial strains useful as vaccine vectors are
described in High et al., EMBO 11: 1991 (1992) and Sizemore et al.,
Science 270: 299 (1995) (Shigella flexneri); Medaglini et al.,
Proc. Natl. Acad. Sci. USA 92: 6868 (1995) (Streptococcus
gordonii); and Flynn, Cell. Mol. Biol. 40 (suppl. I): 31 (1994), WO
88/6626, WO 90/0594, WO 91/13157, WO 92/1796, and WO 92/21376
(Bacille Calmette Guerin).
[0176] In bacterial vectors, polynucleotide of the invention can be
inserted into the bacterial genome or can remain in a free state,
carried on a plasmid.
[0177] An adjuvant can also be added to a composition containing a
vaccine bacterial vector. A number of adjuvants are known to those
skilled in the art. Preferred adjuvants can be selected from the
list provided below.
[0178] According to a fourth aspect of the invention, there is also
provided (i) a composition of matter containing a polynucleotide of
the invention, together with a diluent or carrier; (ii) a
pharmaceutical composition containing a therapeutically or
prophylactically effective amount of a polynucleotide of the
invention; (iii) a method for inducing an immune response against
Chlamydia, in a mammal, by administering to the mammal, an
immunogenically effective amount of a polynucleotide of the
invention to elicit an immune response, e.g., a protective immune
response to Chlamydia; and particularly, (iv) a method for
preventing and/or treating a Chlamydia (e.g., C. trachomatis, C.
psittaci, C. pneumoniae, or C. pecorum) infection, by administering
a prophylactic or therapeutic amount of a polynucleotide of the
invention to an individual in need. Additionally, the fourth aspect
of the invention encompasses the use of a polynucleotide of the
invention in the preparation of a medicament for preventing and/or
treating Chlamydia infection. The fourth aspect of the invention
preferably includes the use of a DNA molecule placed under
conditions for expression in a mammalian cell, e.g., in a plasmid
that is unable to replicate in mammalian cells and to substantially
integrate in a mammalian genome.
[0179] Polynucleotides (DNA or RNA) of the invention can also be
administered as such to a mammal for vaccine, e.g., therapeutic or
prophylactic, purpose. When a DNA molecule of the invention is
used, it can be in the form of a plasmid that is unable to
replicate in a mammalian cell and unable to integrate in the
mammalian genome. Typically, a DNA molecule is placed under the
control of a promoter suitable for expression in a mammalian cell.
The promoter can function ubiquitously or tissue-specifically.
Examples of non-tissue specific promoters include the early
Cytomegalovirus (CMV) promoter (described in U.S. Pat. No.
4,168,062) and the Rous Sarcoma Virus promoter (described in Norton
& Coffin, Molec. Cell Biol. 5: 281 (1985)). The desmin promoter
(Li et al., Gene 78: 243 (1989); Li & Paulin, J. Biol. Chem.
266: 6562 (1991); and Li & Paulin, J. Biol. Chem. 268: 10403
(1993)) is tissue-specific and drives expression in muscle cells.
More generally, useful vectors are described, i.a., WO 94/21797 and
Hartikka et al., Human Gene Therapy 7: 1205 (1996).
[0180] For DNA/RNA vaccination, the polynucleotide of the invention
can encode a precursor or a mature form. When it encodes a
precursor form, the precursor form can be homologous or
heterologous. In the latter case, a eukaryotic leader sequence can
be used, such as the leader sequence of the tissue-type plasminogen
factor (tPA).
[0181] A composition of the invention can contain one or several
polynucleotides of the invention. It can also contain at least one
additional polynucleotide encoding another Chlamydia antigen such
as urease subunit A, B, or both; or a fragment, derivative, mutant,
or analog thereof. A polynucleotide encoding a cytokine, such as
interleukin-2 (IL-2) or interleukin-12 (IL- 12), can also be added
to the composition so that the immune response is enhanced. These
additional polynucleotides are placed under appropriate control for
expression. Advantageously, DNA molecules of the invention and/or
additional DNA molecules to be included in the same composition,
can be carried in the same plasmid.
[0182] Standard techniques of molecular biology for preparing and
purifying polynucleotides can be used in the preparation of
polynucleotide therapeutics of the invention. For use as a vaccine,
a polynucleotide of the invention can be formulated according to
various methods.
[0183] First, a polynucleotide can be used in a naked form, free of
any delivery vehicles, such as anionic liposomes, cationic lipids,
microparticles, e.g., gold microparticles, precipitating agents,
e.g., calcium phosphate, or any other transfection-facilitating
agent. In this case, the polynucleotide can be simply diluted in a
physiologically acceptable solution, such as sterile saline or
sterile buffered saline, with or without a carrier. When present,
the carrier preferably is isotonic, hypotonic, or weakly
hypertonic, and has a relatively low ionic strength, such as
provided by a sucrose solution, e.g., a solution containing 20%
sucrose.
[0184] Alternatively, a polynucleotide can be associated with
agents that assist in cellular uptake. It can be, i.a., (i)
complemented with a chemical agent that modifies the cellular
permeability, such as bupivacaine (see, e.g., WO 94/16737), (ii)
encapsulated into liposomes, or (iii) associated with cationic
lipids or silica, gold, or tungsten microparticles.
[0185] Anionic and neutral liposomes are well known in the art
(see, e.g., LIPOSOMES: A PRACTICAL APPROACH, RPC New Ed, IRL Press
(1990), for a detailed description of methods for making liposomes)
and are useful for delivering a large range of products, including
polynucleotides.
[0186] Cationic lipids are also known in the art and are commonly
used for gene delivery. Such lipids include Lipofectin.TM. also
known as DOTMA
(N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride),
DOTAP (1,2-bis(oleyloxy)-3-(trimethylammonio)propane), DDAB
(dimethyldioctadecylammonium bromide), DOGS
(dioctadecylamidologlycyl spermine) and cholesterol derivatives
such as DC-Chol (3 beta-(N-(N',N'-dimethyl aminomethane)-carbamoyl)
cholesterol). A description of these cationic lipids can be found
in EP 187,702, WO 90/11092, U.S. Pat. No. 5,283,185, WO 91/15501,
WO 95/26356, and U.S. Pat. No. 5,527,928. Cationic lipids for gene
delivery are preferably used in association with a neutral lipid
such as DOPE (dioleyl phosphatidylethanolamine), as described in,
e.g., WO 90/11092.
[0187] Other transfection-facilitating compounds can be added to a
formulation containing cationic liposomes. A number of them are
described in, e.g., WO 93/18759, WO 93/19768, WO 94/25608, and WO
95/2397. They include, i.a., spermine derivatives useful for
facilitating the transport of DNA through the nuclear membrane
(see, for example, WO 93/18759) and membrane-permeabilizing
compounds such as GALA, Gramicidine S, and cationic bile salts
(see, for example, WO 93/19768).
[0188] Gold or tungsten microparticles can also be used for gene
delivery, as described in WO 91/359, WO 93/17706, and Tang et al.
(Nature 356: 152 (1992)). In this case, the microparticle-coated
polynucleotides can be injected via intradermal or intraepidermal
routes using a needleless injection device ("gene gun"), such as
those described in U.S. Pat. No. 4,945,050, U.S. Pat. No.
5,015,580, and WO 94/24263.
[0189] The amount of DNA to be used in a vaccine recipient depends,
e.g., on the strength of the promoter used in the DNA construct,
the immunogenicity of the expressed gene product, the condition of
the mammal intended for administration (e.g., the weight, age, and
general health of the mammal), the mode of administration, and the
type of formulation. In general, a therapeutically or
prophylactically effective dose from about 1 .mu.g to about 1 mg,
preferably, from about 10 .mu.g to about 800 .mu.g and, more
preferably, from about 25 .mu.g to about 250 .mu.g, can be
administered to human adults. The administration can be achieved in
a single dose or repeated at intervals.
[0190] The route of administration can be any conventional route
used in the vaccine field. As general guidance, a polynucleotide of
the invention can be administered via a mucosal surface, e.g., an
ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal,
and urinary tract surface; or via a parenteral route, e.g., by an
intravenous, subcutaneous, intraperitoneal, intradermal,
intraepidermal, or intramuscular route. The choice of the
administration route will depend on, e.g., the formulation that is
selected. A polynucleotide formulated in association with
bupivacaine is advantageously administered into muscles. When a
neutral or anionic liposome or a cationic lipid, such as DOTMA or
DC-Chol, is used, the formulation can be advantageously injected
via intravenous, intranasal (aerosolization), intramuscular,
intradermal, and subcutaneous routes. A polynucleotide in a naked
form can advantageously be administered via the intramuscular,
intradermal, or subcutaneous routes.
[0191] Although not absolutely required, such a composition can
also contain an adjuvant. If so, a systemic adjuvant that does not
require concomitant administration in order to exhibit an adjuvant
effect is preferable such as, e.g., QS21, which is described in
U.S. Pat. No. 5,057,546.
[0192] The sequence information provided in the present application
enables the design of specific nucleotide probes and primers that
can be useful in diagnosis. Accordingly, in a fifth aspect of the
invention, there is provided a nucleotide probe or primer having a
sequence found in or derived by degeneracy of the genetic code from
a sequence shown in SEQ ID NOS: 1 or 2.
[0193] The term "probe" as used in the present application refers
to DNA (preferably single stranded) or RNA molecules (or
modifications or combinations thereof) that hybridize under the
stringent conditions, as defined above, to nucleic acid molecules
having sequences homologous to those shown in SEQ ID NOS: 1 and 2,
or to a complementary or anti-sense sequence. Generally, probes are
significantly shorter than full-length sequences shown in SEQ ID
NOS: 1 and 2; for example, they can contain from about 5 to about
100, preferably from about 10 to about 80 nucleotides. In
particular, probes have sequences that are at least 75%, preferably
at least 85%, more preferably 95% homologous to a portion of a
sequence as shown in SEQ ID NOS: 1 and 2 or that are complementary
to such sequences. Probes can contain modified bases such as
inosine, methyl-5-deoxycytidine, deoxyuridine,
dimethylamino-5-deoxyuridine, or diamino-2, 6-purine. Sugar or
phosphate residues can also be modified or substituted. For
example, a deoxyribose residue can be replaced by a polyamide
(Nielsen et al., Science 254: 1497 (1991)) and phosphate residues
can be replaced by ester groups such as diphosphate, alkyl,
arylphosphonate and phosphorothioate esters. In addition, the
2'-hydroxyl group on ribonucleotides can be modified by including,
e.g., alkyl groups.
[0194] Probes of the invention can be used in diagnostic tests, as
capture or detection probes. Such capture probes can be
conventionally immobilized on a solid support, directly or
indirectly, by covalent means or by passive adsorption. A detection
probe can be labeled by a detection marker selected from
radioactive isotopes; enzymes such as peroxidase, alkaline
phosphatase, and enzymes able to hydrolyze a chromogenic,
fluorogenic, or luminescent substrate; compounds to that are
chromogenic, fluorogenic, or luminescent; nucleotide base analogs;
and biotin.
[0195] Probes of the invention can be used in any conventional
hybridization technique, such as dot blot (Maniatis et al.,
MOLECULAR CLONING: A LABORATORY MANUAL (1982) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.), Southern blot
(Southern, J. Mol. Biol. 98: 503 (1975)), northern blot (identical
to Southern blot to the exception that RNA is used as a target), or
the sandwich technique (Dunn et al., Cell 12: 23 (1977)). The
latter technique involves the use of a specific capture probe
and/or a specific detection probe with nucleotide sequences that at
least partially differ from each other.
[0196] A primer is usually a probe of about 10 to about 40
nucleotides that is used to initiate enzymatic polymerization of
DNA in an amplification process (e.g., PCR), in an elongation
process, or in a reverse transcription method. In a diagnostic
method involving PCR, primers can be labeled.
[0197] Thus, the invention also encompasses (i) a reagent
containing a probe of the invention for detecting and/or
identifying the presence of Chlamydia in a biological material;
(ii) a method for detecting and/or identifying the presence of
Chlamydia in a biological material, in which (a) a sample is
recovered or derived from the biological material, (b) DNA or RNA
is extracted from the material and denatured, and (c) exposed to a
probe of the invention, for example, a capture, detection probe or
both, under stringent hybridization conditions, such that
hybridization is detected; and (iii) a method for detecting and/or
identifying the presence of Chlamydia in a biological material, in
which (a) a sample is recovered or derived from the biological
material, (b) DNA is extracted therefrom, (c) the extracted DNA is
primed with at least one, and preferably two, primers of the
invention and amplified by polymerase chain reaction, and (d) the
amplified DNA fragment is produced.
[0198] As previously mentioned, polypeptides that can be produced
upon expression of the newly identified open reading frames are
useful vaccine agents.
[0199] Therefore, a sixth aspect of the invention features a
substantially purified polypeptide or polypeptide derivative having
an amino acid sequence encoded by a polynucleotide of the
invention.
[0200] A "substantially purified polypeptide" is defined as a
polypeptide that is separated from the environment in which it
naturally occurs and/or that is free of the majority of the
polypeptides that are present in the environment in which it was
synthesized. For example, a substantially purified polypeptide is
free from cytoplasmic polypeptides. Those skilled in the art will
understand that the polypeptides of the invention can be purified
from a natural source, i.e., a Chlamydia strain, or can be produced
by recombinant means.
[0201] Homologous polypeptides or polypeptide derivatives encoded
by polynucleotides of the invention can be screened for specific
antigenicity by testing cross-reactivity with an antiserum raised
against the polypeptide of reference having an amino acid sequence
as shown in SEQ ID NO: 2. Briefly, a monospecific hyperimmune
antiserum can be raised against a purified reference polypeptide as
such or as a fusion polypeptide, for example, an expression product
of MBP, GST, or His-tag systems or a synthetic peptide predicted to
be antigenic. The homologous polypeptide or derivative screened for
specific antigenicity can be produced as such or as a fusion
polypeptide. In this latter case and if the antiserum is also
raised against a fusion polypeptide, two different fusion systems
are employed. Specific antigenicity can be determined according to
a number of methods, including Western blot (Towbin et al., Proc.
Natl. Acad. Sci. USA 76: 4350 (1979)), dot blot, and ELISA, as
described below.
[0202] In a Western blot assay, the product to be screened, either
as a purified preparation or a total E. coli extract, is submitted
to SDS-Page electrophoresis as described by Laemmli (Nature 227:
680 (1970)). After transfer to a nitrocellulose membrane, the
material is further incubated with the monospecific hyperimmune
antiserum diluted in the range of dilutions from about 1:5 to about
1:5000, preferably from about 1:100 to about 1:500. Specific
antigenicity is shown once a band corresponding to the product
exhibits reactivity at any of the dilutions in the above range.
[0203] In an ELISA assay, the product to be screened is preferably
used as the coating antigen. A purified preparation is preferred,
although a whole cell extract can also be used. Briefly, about 100
.mu.l of a preparation at about 10 .mu.g protein/ml are distributed
into wells of a 96-well polycarbonate ELISA plate. The plate is
incubated for 2 hours at 37.degree. C. then overnight at 4.degree.
C. The plate is washed with phosphate buffer saline (PBS)
containing 0.05% Tween 20 (PBS/Tween buffer). The wells are
saturated with 250 .mu.l PBS containing 1% bovine serum albumin
(BSA) to prevent non-specific antibody binding. After 1 hour
incubation at 37.degree. C., the plate is washed with PBS/Tween
buffer. The antiserum is serially diluted in PBS/Tween buffer
containing 0.5% BSA. 100 .mu.l of dilutions are added per well. The
plate is incubated for 90 minutes at 37.degree. C., washed and
evaluated according to standard procedures. For example, a goat
anti-rabbit peroxidase conjugate is added to the wells when
specific antibodies were raised in rabbits. Incubation is carried
out for 90 minutes at 37.degree. C. and the plate is washed. The
reaction is developed with the appropriate substrate and the
reaction is measured by colorimetry (absorbance measured
spectrophotometrically). Under the above experimental conditions, a
positive reaction is shown by O.D. values greater than a non immune
control serum.
[0204] In a dot blot assay, a purified product is preferred,
although a whole cell extract can also be used. Briefly, a solution
of the product at about 100 .mu.g/ml is serially two-fold diluted
in 50 mM Tris-HCl (pH 7.5). 100 .mu.l of each dilution are applied
to a nitrocellulose membrane 0.45 .mu.m set in a 96-well dot blot
apparatus (Biorad). The buffer is removed by applying vacuum to the
system. Wells are washed by addition of 50 mM Tris-HCl (pH 7.5) and
the membrane is air-dried. The membrane is saturated in blocking
buffer (50 mM Tris-HCl (pH 7.5) 0.15 M NaCl, 10 g/L skim milk) and
incubated with an antiserum dilution from about 1:50 to about
1:5000, preferably about 1:500. The reaction is revealed according
to standard procedures. For example, a goat anti-rabbit peroxidase
conjugate is added to the wells when rabbit antibodies are used.
Incubation is carried out 90 minutes at 37.degree. C. and the blot
is washed. The reaction is developed with the appropriate substrate
and stopped. The reaction is measured visually by the appearance of
a colored spot, e.g., by colorimetry. Under the above experimental
conditions, a positive reaction is shown once a colored spot is
associated with a dilution of at least about 1:5, preferably of at
least about 1:500.
[0205] Therapeutic or prophylactic efficacy of a polypeptide or
derivative of the invention can be evaluated as described
below.
[0206] According to a seventh aspect of the invention, there is
provided (i) a composition of matter containing a polypeptide of
the invention together with a diluent or carrier; in particular,
(ii) a pharmaceutical composition containing a therapeutically or
prophylactically effective amount of a polypeptide of the
invention; (iii) a method for inducing an immune response against
Chlamydia in a mammal, by administering to the mammal an
immunogenically effective amount of a polypeptide of the invention
to elicit an immune response, e.g., a protective immune response to
Chlamydia; and particularly, (iv) a method for preventing and/or
treating a Chlamydia (e.g., C. trachomatis. C. psittaci, C.
pneumoniae. or C. pecorum) infection, by administering a
prophylactic or therapeutic amount of a polypeptide of the
invention to an individual in need. Additionally, the seventh
aspect of the invention encompasses the use of a polypeptide of the
invention in the preparation of a medicament for preventing and/or
treating Chlamydia infection.
[0207] The immunogenic compositions of the invention can be
administered by any conventional route in use in the vaccine field,
in particular to a mucosal (e.g., ocular, intranasal, pulmonary,
oral, gastric, intestinal, rectal, vaginal, or urinary tract)
surface or via the parenteral (e.g., subcutaneous, intradermal,
intramuscular, intravenous, or intraperitoneal) route. The choice
of the administration route depends upon a number of parameters,
such as the adjuvant associated with the polypeptide. For example,
if a mucosal adjuvant is used, the intranasal or oral route will be
preferred and if a lipid formulation or an aluminum compound is
used, the parenteral route will be preferred. In the latter case,
the subcutaneous or intramuscular route is most preferred. The
choice can also depend upon the nature of the vaccine agent. For
example, a polypeptide of the invention fused to CTB or LTB will be
best administered to a mucosal surface.
[0208] A composition of the invention can contain one or several
polypeptides or derivatives of the invention. It can also contain
at least one additional Chlamydia antigen, or a subunit, fragment,
homolog, mutant, or derivative thereof.
[0209] For use in a composition of the invention, a polypeptide or
derivative thereof can be formulated into or with liposomes,
preferably neutral or anionic liposomes, microspheres, ISCOMS, or
virus-like-particles (VLPs) to facilitate delivery and/or enhance
the immune response. These compounds are readily available to one
skilled in the art; for example, see Liposomes: A Practical
Approach (supra).
[0210] Adjuvants other than liposomes and the like can also be used
and are known in the art. An appropriate selection can
conventionally be made by those skilled in the art, for example,
from the list provided below.
[0211] Administration can be achieved in a single dose or repeated
as necessary at intervals as can be determined by one skilled in
the art. For example, a priming dose can be followed by three
booster doses at weekly or monthly intervals. An appropriate dose
depends on various parameters including the recipient (e.g., adult
or infant), the particular vaccine antigen, the route and frequency
of administration, the presence/absence or type of adjuvant, and
the desired effect (e.g., protection and/or treatment), as can be
determined by one skilled in the art. In general, a vaccine antigen
of the invention can be administered by a mucosal route in an
amount from about 10 .mu.g to about 500 mg, preferably from about 1
mg to about 200 mg. For the parenteral route of administration, the
dose usually should not exceed about 1 mg, preferably about 100
.mu.g.
[0212] When used as vaccine agents, polynucleotides and
polypeptides of the invention can be used sequentially as part of a
multistep immunization process. For example, a mammal can be
initially primed with a vaccine vector of the invention such as a
pox virus, e.g., via the parenteral route, and then boosted twice
with the polypeptide encoded by the vaccine vector, e.g., via the
mucosal route. In another example, liposomes associated with a
polypeptide or derivative of the invention can also be used for
priming, with boosting being carried out mucosally using a soluble
polypeptide or derivative of the invention in combination with a
mucosal adjuvant (e.g., LT).
[0213] A polypeptide derivative of the invention is also useful as
a diagnostic reagent for detecting the presence of anti-Chlamydia
antibodies, e.g., in a blood sample. Such polypeptides are about 5
to about 80, preferably about 10 to about 50 amino acids in length
and can be labeled or unlabeled, depending upon the diagnostic
method. Diagnostic methods involving such a reagent are described
below.
[0214] Upon expression of a DNA molecule of the invention, a
polypeptide or polypeptide derivative is produced and can be
purified using known laboratory techniques. For example, the
polypeptide or polypeptide derivative can be produced as a fusion
protein containing a fused tail that facilitates purification. The
fusion product can be used to immunize a small mammal, e.g., a
mouse or a rabbit, in order to raise antibodies against the
polypeptide or polypeptide derivative (monospecific antibodies).
The eighth aspect of the invention thus provides a monospecific
antibody that binds to a polypeptide or polypeptide derivative of
the invention.
[0215] By "monospecific antibody" is meant an antibody that is
capable of reacting with a unique naturally-occurring Chlamydia
polypeptide. An antibody of the invention can be polyclonal or
monoclonal. Monospecific antibodies can be recombinant, e.g.,
chimeric (e.g., constituted by a variable region of murine origin
associated with a human constant region), humanized (a human
immunoglobulin constant backbone together with hypervariable region
of animal, e.g., murine, origin), and/or single chain. Both
polyclonal and monospecific antibodies can also be in the form of
immunoglobulin fragments, e.g., F(ab)'2 or Fab fragments. The
antibodies of the invention can be of any isotype, e.g., IgG or
IgA, and polyclonal antibodies can be of a single isotype or can
contain a mixture of isotypes.
[0216] The antibodies of the invention, which are raised to a
polypeptide or polypeptide derivative of the invention, can be
produced and identified using standard immunological assays, e.g.,
Western blot analysis, dot blot assay, or ELISA (see, e.g., Coligan
et al., Current Protocols in Immunology (1994) John Wiley &
Sons, Inc., New York, N.Y.). The antibodies can be used in
diagnostic methods to detect the presence of a Chlamydia antigen in
a sample, such as a biological sample. The antibodies can also be
used in affinity chromatography methods for purifying a polypeptide
or polypeptide derivative of the invention. As is discussed further
below, such antibodies can be used in prophylactic and therapeutic
passive immunization methods.
[0217] Accordingly, a ninth aspect of the invention provides (i) a
reagent for detecting the presence of Chlamydia in a biological
sample that contains an antibody, polypeptide, or polypeptide
derivative of the invention; and (ii) a diagnostic method for
detecting the presence of Chlamydia in a biological sample, by
contacting the biological sample with an antibody, a polypeptide,
or a polypeptide derivative of the invention, such that an immune
complex is formed, and by detecting such complex to indicate the
presence of Chlamydia in the sample or the organism from which the
sample is derived.
[0218] Those skilled in the art will understand that the immune
complex is formed between a component of the sample and the
antibody, polypeptide, or polypeptide derivative, whichever is
used, and that any unbound material can be removed prior to
detecting the complex. As can be easily understood, a polypeptide
reagent is useful for detecting the presence of anti-Chlamydia
antibodies in a sample, e.g., a blood sample, while an antibody of
the invention can be used for screening a sample, such as a gastric
extract or biopsy, for the presence of Chlamydia polypeptides.
[0219] For use in diagnostic applications, the reagent (i.e., the
antibody, polypeptide, or polypeptide derivative of the invention)
can be in a free state or immobilized on a solid support, such as a
tube, a bead, or any other conventional support used in the field.
Immobilization can be achieved using direct or indirect means.
Direct means include passive adsorption (non-covalent binding) or
covalent binding between the support and the reagent. By "indirect
means" is meant that an anti-reagent compound that interacts with a
reagent is first attached to the solid support. For example, if a
polypeptide reagent is used, an antibody that binds to it can serve
as an anti-reagent, provided that it binds to an epitope that is
not involved in the recognition of antibodies in biological
samples. Indirect means can also employ a ligand-receptor system,
for example, a molecule such as a vitamin can be grafted onto the
polypeptide reagent and the corresponding receptor can be
immobilized on the solid phase. This is illustrated by the
biotin-streptavidin system. Alternatively, indirect means can be
used, e.g., by adding to the reagent a peptide tail, chemically or
by genetic engineering, and immobilizing the grafted or fused
product by passive adsorption or covalent linkage of the peptide
tail.
[0220] According to a tenth aspect of the invention, there is
provided a process for purifying, from a biological sample, a
polypeptide or polypeptide derivative of the invention, which
involves carrying out antibody-based affinity chromatography with
the biological sample, wherein the antibody is a monospecific
antibody of the invention.
[0221] For use in a purification process of the invention, the
antibody can be polyclonal or monospecific, and preferably is of
the IgG type. Purified IgGs can be prepared from an antiserum using
standard methods (see, e.g., Coligan et al., supra). Conventional
chromatography supports, as well as standard methods for grafting
antibodies, are disclosed in, e.g., ANTIBODIES: A LABORATORY
MANUAL, D. Lane, E. Harlow, Eds. (1988).
[0222] Briefly, a biological sample, such as an C. pneumoniae
extract, preferably in a buffer solution, is applied to a
chromatography material, preferably equilibrated with the buffer
used to, dilute the biological sample so that the polypeptide or
polypeptide derivative of the invention (i.e., the antigen) is
allowed to adsorb onto the material. The chromatography material,
such as a gel or a resin coupled to an antibody of the invention,
can be in batch form or in a column. The unbound components are
washed off and the antigen is then eluted with an appropriate
elution buffer, such as a glycine buffer or a buffer containing a
chaotropic agent, e.g., guanidine HCl, or high salt concentration
(e.g., 3 M MgCl.sub.2). Eluted fractions are recovered and the
presence of the antigen is detected, e.g., by measuring the
absorbance at 280 nm.
[0223] An antibody of the invention can be screened for therapeutic
efficacy as described as follows. According to an eleventh aspect
of the invention, there is provided (i) a composition of matter
containing a monospecific antibody of the invention, together with
a diluent or carrier; (ii) a pharmaceutical composition containing
a therapeutically or prophylactically effective amount of a
monospecific antibody of the invention, and (iii) a method for
treating or preventing a Chlamydia (e.g., C. trachomatis, C.
psittaci, C. pneumoniae or C. pecorum) infection, by administering
a therapeutic or prophylactic amount of a monospecific antibody of
the invention to an individual in need. Additionally, the eleventh
aspect of the invention encompasses the use of a mono specific
antibody of the invention in the preparation of a medicament for
treating or preventing Chlamydia infection.
[0224] To this end, the monospecific antibody can be polyclonal or
monoclonal, preferably of the IgA isotype (predominantly). In
passive immunization, the antibody can be administered to a mucosal
surface of a mammal, e.g., the gastric mucosa, e.g., orally or
intragastrically, advantageously, in the presence of a bicarbonate
buffer. Alternatively, systemic administration, not requiring a
bicarbonate buffer, can be carried out. A monospecific antibody of
the invention can be administered as a single active component or
as a mixture with at least one monospecific antibody specific for a
different Chlamydia polypeptide. The amount of antibody and the
particular regimen used can be readily determined by one skilled in
the art. For example, daily administration of about 100 to 1,000 mg
of antibodies over one week, or three doses per day of about 100 to
1,000 mg of antibodies over two or three days, can be an effective
regimens for most purposes.
[0225] Therapeutic or prophylactic efficacy can be evaluated using
standard methods in the art, e.g., by measuring induction of a
mucosal immune response or induction of protective and/or
therapeutic immunity, using, e.g., the C. pneumoniae mouse model.
Those skilled in the art will recognize that the C. pneumoniae
strain of the model can be replaced with another Chlamydia strain.
For example, the efficacy of DNA molecules and polypeptides from C.
pneumoniae is preferably evaluated in a mouse model using an C.
pneumoniae strain. Protection can be determined by comparing the
degree of Chlamydia infection to that of a control group.
Protection is shown when infection is reduced by comparison to the
control group. Such an evaluation can be made for polynucleotides,
vaccine vectors, polypeptides and derivatives thereof, as well as
antibodies of the invention.
[0226] Adjuvants useful in any of the vaccine compositions
described above are as follows.
[0227] Adjuvants for parenteral administration include aluminum
compounds, such as aluminum hydroxide, aluminum phosphate, and
aluminum hydroxy phosphate. The antigen can be precipitated with,
or adsorbed onto, the aluminum compound according to standard
protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton,
Mont.), can be used in parenteral administration.
[0228] Adjuvants for mucosal administration include bacterial
toxins, e.g., the cholera toxin (CT), the E. coli heat-labile toxin
(LT), the Clostridium difficile toxin A and the pertussis toxin
(PT), or combinations, subunits, toxoids, or mutants thereof. For
example, a purified preparation of native cholera toxin subunit B
(CTB) can be of use. Fragments, homologs, derivatives, and fusions
to any of these toxins are also suitable, provided that they retain
adjuvant activity. Preferably, a mutant having reduced toxicity is
used. Suitable mutants are described, e.g., in WO 95/17211
(Arg-7-Lys CT mutant), WO 96/6627 (Arg-192-Gly LT mutant), and WO
95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant). Additional LT
mutants that can be used in the methods and compositions of the
invention include, e.g., Ser-63-Lys, Ala-69-Gly, Glu-110-Asp, and
Glu-112-Asp mutants. Other adjuvants, such as a bacterial
monophosphoryl lipid A (MPLA) of, e.g., E. coli, Salmonella
minnesota, Salmonella typhimurium, or Shigella flexneri; saponins,
or polylactide glycolide (PLGA) microspheres, can also be used in
mucosal administration.
[0229] Adjuvants useful for both mucosal and parenteral
administrations include polyphosphazene (WO 95/2415), DC-chol (3
b-(N-(N',N'-dimethyl aminomethane)-carbamoyl) cholesterol; U.S.
Pat. No. 5,283,185 and WO 96/14831) and QS-21 (WO 88/9336).
[0230] Any pharmaceutical composition of the invention, containing
a polynucleotide, a polypeptide, a polypeptide derivative, or an
antibody of the invention, can be manufactured in a conventional
manner. In particular, it can be formulated with a pharmaceutically
acceptable diluent or carrier, e.g., water or a saline solution
such as phosphate buffer saline. In general, a diluent or carrier
can be selected on the basis of the mode and route of
administration, and standard pharmaceutical practice. Suitable
pharmaceutical carriers or diluents, as well as pharmaceutical
necessities for their use in pharmaceutical formulations, are
described in Remington's Pharmaceutical Sciences, a standard
reference text in this field and in the USP/NF.
[0231] The invention also includes methods in which Chlamydia
infection, are treated by oral administration of a Chlamydia
polypeptide of the invention and a mucosal adjuvant, in combination
with an antibiotic, an antacid, sucralfate, or a combination
thereof. Examples of such compounds that can be administered with
the vaccine antigen and the adjuvant are antibiotics, including,
e.g., macrolides, tetracyclines, and derivatives thereof (specific
examples of antibiotics that can be used include azithromycin or
doxicyclin or immunomodulators such as cytokines or steroids. In
addition, compounds containing more than one of the above-listed
components coupled together, can be used. The invention also
includes compositions for carrying out these methods, i.e.,
compositions containing a Chlamydia antigen (or antigens) of the
invention, an adjuvant, and one or more of the above-listed
compounds, in a pharmaceutically acceptable carrier or diluent.
[0232] Amounts of the above-listed compounds used in the methods
and compositions of the invention can readily be determined by one
skilled in the art. In addition, one skilled in the art can readily
design treatment/immunization schedules. For example, the
non-vaccine components can be administered on days 1-14, and the
vaccine antigen+adjuvant can be administered on days 7, 14, 21, and
28.
[0233] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific examples. These examples are
described solely for purposes of illustration and are not intended
to limit the scope of the invention. Changes in form and
substitution of equivalents are contemplated as circumstances may
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended in a descriptive sense and
not for purposes of limitation.
EXAMPLE 1
Preparation of Plasmid Vector pCAI632 Containing the POMP91B
Precursor Gene
[0234] This example illustrates the preparation of a plasmid vector
pCAI632 containing the POMP91B precursor gene.
[0235] The POMP91B precursor gene was amplified from Chlamydia
pneumoniae genomic DNA by polymerase chain reaction (PCR) using a
5' primer:
[0236] (5' ATAAGAATGCGGCCGCCACCATGAAAACGTCTATTCGTAAGTTC 3') (SEQ ID
NO: 3), which contains a Not I restriction site, a ribosome binding
site, an initiation codon and a sequence at the 5' end of the
POMP91B precursor coding sequence, and a 3' primer:
[0237] (5' CGGGGTACCGAAATCGTAATTTGCTTCCTATATC 3') (SEQ ID NO: 4).
The 3' primer includes the sequence encoding the C-terminal
sequence of the POMP91B precursor and a Kpn I restriction site. The
stop codon was excluded and an additional nucleotide was inserted
to obtain an in-frame fusion with the Histidine tag.
[0238] After amplification, the PCR fragment was purified using
QIAquick.TM. PCR purification kit (Qiagen) and then digested with
Not I and Kpn I and cloned into the pCA-Myc-His eukaryotic
expression vector describe in Example 2 (FIG. 3) with transcription
under control of the human CMV promoter.
EXAMPLE 2
Preparation of the Eukaryotic Expression Vector pCA/Myc-His
[0239] This example illustrates the preparation of the eukaryotic
expression vector pCA/Myc-His.
[0240] Plasmid pcDNA3.1(-)Myc-His C (Invitrogen) was restricted
with Spe I and Bam HI to remove the CMV promoter and the remaining
vector fragment was isolated. The CMV promoter and intron A from
plasmid VR-1012 (Vical) was isolated on a Spe I/Bam HI fragment.
The fragments were ligated together to produce plasmid pCA/Myc-His.
The Not I/Kpn I restricted PCR fragment containing the POMP91B
precursor gene was ligated into the Not I and Kpn I restricted
plasmid pCA/Myc-His to produce plasmid pCAI632 (FIG. 3).
[0241] The resulting plasmid, pCAI632, was transfered by
electroporation into E. coli XL-1 blue (Stratagene) which was grown
in LB broth containing 50 .mu.g/ml of carbenicillin. The plasmid
was isolated by Endo Free Plasmid Giga Kit.TM. (Qiagen) large scale
DNA purification system. DNA concentration was determined by
absorbance at 260 nm and the plasmid was verified after gel
electrophoresis and ethidium bromide staining and comparison to
molecular weight standards. The 5' and 3' ends of the gene were
verified by sequencing using a LiCor model 4000 L DNA sequencer and
IRD-800 labelled primers.
EXAMPLE 3
Protection Against Intranasal C. Pneumoniae
[0242] This example illustrates the immunization of mice to achieve
protection against an intranasal challenge of C. pneumoniae.
[0243] It has been previously demonstrated (Yang et. al., 1993)
that mice are susceptible to intranasal infection with different
isolates of C. pneumoniae. Strain AR-39 (Grayston, 1989) was used
in Balb/c mice as a challenge infection model to examine the
capacity of chlamydia gene products delivered as naked DNA to
elicit a protective response against a sublethal C. pneumoniae lung
infection. Protective immunity is defined as an accelerated
clearance of pulmonary infection.
[0244] Groups of 7 to 9 week old male Balb/c mice (8 to 10 per
group) were immunized intramuscularly (i.m.) plus intranasally
(i.n.) with plasmid DNA containing the coding sequence of C.
pneumoniae POMP91B precursor as described in Example 1 and 2.
Saline or the plasmid vector lacking an inserted chlamydial gene
was given to groups of control animals.
[0245] For i.m. immunization alternate left and right quadriceps
were injected with 100 .mu.g of DNA in 50 .mu.l of PBS on three
occasions at 0, 3 and 6 weeks. For i.n. immunization, anaesthetized
mice aspirated 50 .mu.l of PBS containing 50 .mu.g DNA on three
occasions at 0, 3 and 6 weeks. At week 8, immunized mice were
inoculated i.n. with 5.times.10.sup.5 IFU of C. pneumoniae, strain
AR39 in 100 .mu.l of SPG buffer to test their ability to limit the
growth of a sublethal C. pneumoniae challenge.
[0246] Lungs were taken from mice at days 5 and 9 post-challenge
and immediately homogenised in SPG buffer (7.5% sucrose, 5 mM
glutamate, 12.5 mM phosphate pH 7.5). The homogenate was stored
frozen at -70.degree. C. until assay. Dilutions of the homogenate
were assayed for the presence of infectious chlamydia by
inoculation onto monolayers of susceptible cells. The inoculum was
centrifuged onto the cells at 3000 rpm for 1 hour, then the cells
were incubated for three days at 35.degree. C. in the presence of 1
.mu.g/ml cycloheximide. After incubation the monolayers were fixed
with formalin and methanol then immunoperoxidase stained for the
presence of chlamydial inclusions using convalescent sera from
rabbits infected with C. pneumoniae and metal-enhanced DAB as a
peroxidase substrate.
[0247] FIG. 4 and Table 1 show that mice immunized i.n. and i.m.
with pCA1632 had chlamydial lung titers less than 161,300 in 4 of 4
cases at day 5 and less than 188,400 in 4 of 4 cases at day 9
whereas the range of values for control mice sham immunized with
saline was 202,400-886,800 IFU/lung (mean 429,800) at day 5 and
68,600-284,600 IFU/lung (mean 157,080) at day 9.
1 TABLE 1 BACTERIAL LOAD (INCLUSION FORMING UNITS PER LUNG) IN THE
LUNGS OF BALB/C MICE IMMUNIZED WITH VARIOUS DNA IMMUNIZATION
CONSTRUCTS Immunizing Construct Saline Saline pCAI632 pCAI632 Mouse
Day 5 Day 9 Day 5 Day 9 1 348200 68600 161300 66000 2 202400 284600
108600 188400 3 422400 132000 148400 114000 4 289200 78400 77800
121400 5 886800 221800 MEAN 429800 157080 124025 122450 SD
267881.24 93672.69 38114.947 50360.40
EQUIVALENTS
[0248] From the foregoing detailed description of the specific
embodiments of the invention, it should be apparent that a unique
Chlamydia antigen has been described. Although particular
embodiments have been disclosed herein in detail, this has been
done by way of example for purposes of illustration only, and is
not intended to be limiting with respect to the scope of the
appended claims which follow. In particular, it is contemplated by
the inventor that various substitutions, alterations, and
modifications may be made to the invention without departing from
the spirit and scope of the invention as defined by the claims.
Sequence CWU 1
1
4 1 3150 DNA Chlamydia pneumoniae CDS (101)..(3019) 1 gctgtcaaaa
ttaagagatt aaaactgtgt cttattgtac ttgttttttt acagcctttc 60
ccttatttgt aggataatct ggtttcatct ctacgtgcaa atg aaa acg tct att 115
Met Lys Thr Ser Ile 1 5 cgt aag ttc tta att tct acc aca ctg gcg cca
tgt ttt gct tca aca 163 Arg Lys Phe Leu Ile Ser Thr Thr Leu Ala Pro
Cys Phe Ala Ser Thr 10 15 20 gcg ttt act gta gaa gtt atc atg cct
tcc gag aac ttt gat gga tcg 211 Ala Phe Thr Val Glu Val Ile Met Pro
Ser Glu Asn Phe Asp Gly Ser 25 30 35 agt ggg aag att ttt cct tac
aca aca ctt tct gat cct aga ggg aca 259 Ser Gly Lys Ile Phe Pro Tyr
Thr Thr Leu Ser Asp Pro Arg Gly Thr 40 45 50 ctc tgt att ttt tca
ggg gat ctc tac att gcg aat ctt gat aat gcc 307 Leu Cys Ile Phe Ser
Gly Asp Leu Tyr Ile Ala Asn Leu Asp Asn Ala 55 60 65 ata tcc aga
acc tct tcc agt tgc ttt agc aat agg gcg gga gca cta 355 Ile Ser Arg
Thr Ser Ser Ser Cys Phe Ser Asn Arg Ala Gly Ala Leu 70 75 80 85 caa
atc tta gga aaa ggt ggg gtt ttc tcc ttc tta aat atc cgt tct 403 Gln
Ile Leu Gly Lys Gly Gly Val Phe Ser Phe Leu Asn Ile Arg Ser 90 95
100 tca gct gac gga gcc gcg att agt agt gta atc acc caa aat cct gaa
451 Ser Ala Asp Gly Ala Ala Ile Ser Ser Val Ile Thr Gln Asn Pro Glu
105 110 115 cta tgt ccc ttg agt ttt tca gga ttt agt cag atg atc ttc
gat aac 499 Leu Cys Pro Leu Ser Phe Ser Gly Phe Ser Gln Met Ile Phe
Asp Asn 120 125 130 tgt gaa tct ttg act tca gat acc tca gcg agt aat
gtc ata cct cac 547 Cys Glu Ser Leu Thr Ser Asp Thr Ser Ala Ser Asn
Val Ile Pro His 135 140 145 gca tcg gcg att tac gct aca acg ccc atg
ctc ttt aca aac aat gac 595 Ala Ser Ala Ile Tyr Ala Thr Thr Pro Met
Leu Phe Thr Asn Asn Asp 150 155 160 165 tcc ata cta ttc caa tac aac
cgt tct gca gga ttt gga gct gcc att 643 Ser Ile Leu Phe Gln Tyr Asn
Arg Ser Ala Gly Phe Gly Ala Ala Ile 170 175 180 cga ggc aca agc atc
aca ata gaa aat acg aaa aag agc ctt ctc ttt 691 Arg Gly Thr Ser Ile
Thr Ile Glu Asn Thr Lys Lys Ser Leu Leu Phe 185 190 195 aat ggt aat
gga tcc atc tct aat gga ggg gcc ctc acg gga tct gca 739 Asn Gly Asn
Gly Ser Ile Ser Asn Gly Gly Ala Leu Thr Gly Ser Ala 200 205 210 gcg
atc aac ctc atc aac aat agc gct cct gtg att ttc tca acg aat 787 Ala
Ile Asn Leu Ile Asn Asn Ser Ala Pro Val Ile Phe Ser Thr Asn 215 220
225 gct aca ggg atc tat ggt ggg gct att tac ctt acc gga gga tct atg
835 Ala Thr Gly Ile Tyr Gly Gly Ala Ile Tyr Leu Thr Gly Gly Ser Met
230 235 240 245 ctc acc tct ggg aac ctc tca gga gtc ttg ttc gtt aat
aat agc tcg 883 Leu Thr Ser Gly Asn Leu Ser Gly Val Leu Phe Val Asn
Asn Ser Ser 250 255 260 cgc tca gga ggc gct atc tat gct aac gga aat
gtc aca ttt tct aat 931 Arg Ser Gly Gly Ala Ile Tyr Ala Asn Gly Asn
Val Thr Phe Ser Asn 265 270 275 aac agc gac ctg act ttc caa aac aat
aca gca tct cca caa aac tcc 979 Asn Ser Asp Leu Thr Phe Gln Asn Asn
Thr Ala Ser Pro Gln Asn Ser 280 285 290 tta cct gca cct aca cct cca
cct aca cca cca gca gtc act cct ttg 1027 Leu Pro Ala Pro Thr Pro
Pro Pro Thr Pro Pro Ala Val Thr Pro Leu 295 300 305 tta gga tat gga
ggc gcc atc ttc tgt act cct cca gct acc ccc cca 1075 Leu Gly Tyr
Gly Gly Ala Ile Phe Cys Thr Pro Pro Ala Thr Pro Pro 310 315 320 325
cca aca ggt gtt agc ctg act ata tct gga gaa aac agc gtt aca ttc
1123 Pro Thr Gly Val Ser Leu Thr Ile Ser Gly Glu Asn Ser Val Thr
Phe 330 335 340 cta gaa aac att gcc tcc gaa caa gga gga gcc ctc tat
ggc aaa aag 1171 Leu Glu Asn Ile Ala Ser Glu Gln Gly Gly Ala Leu
Tyr Gly Lys Lys 345 350 355 atc tct ata gat tct aat aaa tct aca ata
ttt ctt gga aat aca gct 1219 Ile Ser Ile Asp Ser Asn Lys Ser Thr
Ile Phe Leu Gly Asn Thr Ala 360 365 370 gga aaa gga ggc gct att gct
att ccc gaa tct ggg gag ctc tct cta 1267 Gly Lys Gly Gly Ala Ile
Ala Ile Pro Glu Ser Gly Glu Leu Ser Leu 375 380 385 tcc gca aat caa
ggt gat atc ctc ttt aac aag aac ctc agc atc act 1315 Ser Ala Asn
Gln Gly Asp Ile Leu Phe Asn Lys Asn Leu Ser Ile Thr 390 395 400 405
agt ggg aca cct act cgc aat agt att cac ttc gga aaa gat gcc aag
1363 Ser Gly Thr Pro Thr Arg Asn Ser Ile His Phe Gly Lys Asp Ala
Lys 410 415 420 ttt gcc act cta ggg aat acg caa ggc tat acc cta tac
ttc tat gat 1411 Phe Ala Thr Leu Gly Asn Thr Gln Gly Tyr Thr Leu
Tyr Phe Tyr Asp 425 430 435 ccg att aca tct gat gat tta tct gct gca
tcc gca gcc gct act gtg 1459 Pro Ile Thr Ser Asp Asp Leu Ser Ala
Ala Ser Ala Ala Ala Thr Val 440 445 450 gtc gtc aat ccc aaa gcc agt
gca gat ggt gcg tat tca ggg act att 1507 Val Val Asn Pro Lys Ala
Ser Ala Asp Gly Ala Tyr Ser Gly Thr Ile 455 460 465 gtc ttt tca gga
gaa acc ctc act gct acc gaa gca gca acc cct gca 1555 Val Phe Ser
Gly Glu Thr Leu Thr Ala Thr Glu Ala Ala Thr Pro Ala 470 475 480 485
aat gct aca tct aca tta aac caa aag cta gaa ctt gaa ggc ggt act
1603 Asn Ala Thr Ser Thr Leu Asn Gln Lys Leu Glu Leu Glu Gly Gly
Thr 490 495 500 ctc gct tta aga aac ggt gct acc tta aat gtt cat aac
ttc acg caa 1651 Leu Ala Leu Arg Asn Gly Ala Thr Leu Asn Val His
Asn Phe Thr Gln 505 510 515 gat gaa aag tcc gtc gtc atc atg gat gca
ggg acc aca tta gca act 1699 Asp Glu Lys Ser Val Val Ile Met Asp
Ala Gly Thr Thr Leu Ala Thr 520 525 530 aca aat gga gct aat aat act
gac ggt gct atc acc tta aac aag ctt 1747 Thr Asn Gly Ala Asn Asn
Thr Asp Gly Ala Ile Thr Leu Asn Lys Leu 535 540 545 gta atc aat ctg
gat tct ttg gat ggc act aaa gcg gct gtc gtt aat 1795 Val Ile Asn
Leu Asp Ser Leu Asp Gly Thr Lys Ala Ala Val Val Asn 550 555 560 565
gtg cag agt acc aat gga gct ctc act ata tcc gga act tta gga ctt
1843 Val Gln Ser Thr Asn Gly Ala Leu Thr Ile Ser Gly Thr Leu Gly
Leu 570 575 580 gtg aaa aac tct caa gat tgc tgt gac aac cac ggg atg
ttt aat aaa 1891 Val Lys Asn Ser Gln Asp Cys Cys Asp Asn His Gly
Met Phe Asn Lys 585 590 595 gat tta cag caa gtt ccg att tta gaa ctc
aaa gcg act tca aat act 1939 Asp Leu Gln Gln Val Pro Ile Leu Glu
Leu Lys Ala Thr Ser Asn Thr 600 605 610 gta acc act acg gac ttc agt
ctc ggc aca aac ggc tat cag caa tct 1987 Val Thr Thr Thr Asp Phe
Ser Leu Gly Thr Asn Gly Tyr Gln Gln Ser 615 620 625 ccc tat ggg tat
caa gga act tgg gag ttt acc ata gac acg aca acc 2035 Pro Tyr Gly
Tyr Gln Gly Thr Trp Glu Phe Thr Ile Asp Thr Thr Thr 630 635 640 645
cat acg gtc aca gga aat tgg aaa aaa acc ggt tat ctt cct cat ccg
2083 His Thr Val Thr Gly Asn Trp Lys Lys Thr Gly Tyr Leu Pro His
Pro 650 655 660 gag cgt ctt gct ccc ctc att cct aat agc cta tgg gca
aac gtc ata 2131 Glu Arg Leu Ala Pro Leu Ile Pro Asn Ser Leu Trp
Ala Asn Val Ile 665 670 675 gat tta cga gct gta agt caa gcg tca gca
gct gat ggc gaa gat gtc 2179 Asp Leu Arg Ala Val Ser Gln Ala Ser
Ala Ala Asp Gly Glu Asp Val 680 685 690 cct ggg aag caa ctg agc atc
aca gga att aca aat ttc ttc cat gcg 2227 Pro Gly Lys Gln Leu Ser
Ile Thr Gly Ile Thr Asn Phe Phe His Ala 695 700 705 aat cat acc ggt
gat gca cgc agc tac cgc cat atg ggt gga ggc tac 2275 Asn His Thr
Gly Asp Ala Arg Ser Tyr Arg His Met Gly Gly Gly Tyr 710 715 720 725
ctc atc aat acc tac aca cgc atc act cca gat gct gcg tta agt cta
2323 Leu Ile Asn Thr Tyr Thr Arg Ile Thr Pro Asp Ala Ala Leu Ser
Leu 730 735 740 ggt ttt gga cag ctg ttt aca aaa tct aag gat tac ctc
gta ggt cac 2371 Gly Phe Gly Gln Leu Phe Thr Lys Ser Lys Asp Tyr
Leu Val Gly His 745 750 755 ggt cat tct aac gtt tat ttc gct aca gta
tac tct aac atc acc aag 2419 Gly His Ser Asn Val Tyr Phe Ala Thr
Val Tyr Ser Asn Ile Thr Lys 760 765 770 tct ctg ttt gga tca tcg aga
ttc ttc tca gga ggc act tct cga gtt 2467 Ser Leu Phe Gly Ser Ser
Arg Phe Phe Ser Gly Gly Thr Ser Arg Val 775 780 785 acc tat agc cgt
agc aat gag aaa gta aag act tca tat aca aaa ttg 2515 Thr Tyr Ser
Arg Ser Asn Glu Lys Val Lys Thr Ser Tyr Thr Lys Leu 790 795 800 805
cct aaa ggg cgc tgc tct tgg agt aac aat tgc tgg tta gga gaa ctc
2563 Pro Lys Gly Arg Cys Ser Trp Ser Asn Asn Cys Trp Leu Gly Glu
Leu 810 815 820 gaa ggg aac ctt ccc atc act ctc tct tct cgc atc tta
aac ctc aag 2611 Glu Gly Asn Leu Pro Ile Thr Leu Ser Ser Arg Ile
Leu Asn Leu Lys 825 830 835 cag atc att ccc ttt gta aaa gct gaa gtt
gct tac gcg act cat ggg 2659 Gln Ile Ile Pro Phe Val Lys Ala Glu
Val Ala Tyr Ala Thr His Gly 840 845 850 ggc atc caa gaa aat acc ccc
gag ggg agg att ttt gga cac ggt cat 2707 Gly Ile Gln Glu Asn Thr
Pro Glu Gly Arg Ile Phe Gly His Gly His 855 860 865 cta ctc aac gtt
gca gtt ccc gta ggc gtc cgc ttt ggt aaa aat tct 2755 Leu Leu Asn
Val Ala Val Pro Val Gly Val Arg Phe Gly Lys Asn Ser 870 875 880 885
cat aat cga cca gat ttt tac act ata atc gta gcc tat gct cct gat
2803 His Asn Arg Pro Asp Phe Tyr Thr Ile Ile Val Ala Tyr Ala Pro
Asp 890 895 900 gtc tat cgt cac aat cct gat tgc gat acg aca tta cct
att aat gga 2851 Val Tyr Arg His Asn Pro Asp Cys Asp Thr Thr Leu
Pro Ile Asn Gly 905 910 915 gct acg tgg acc tct ata ggg aat aat cta
acc aga agt act ttg cta 2899 Ala Thr Trp Thr Ser Ile Gly Asn Asn
Leu Thr Arg Ser Thr Leu Leu 920 925 930 gta caa gca tcc agc cat act
tca gta aat gat gtt cta gag atc ttc 2947 Val Gln Ala Ser Ser His
Thr Ser Val Asn Asp Val Leu Glu Ile Phe 935 940 945 ggg cac tgt gga
tgt gat att cgc aga acc tcc cgt aaa tat act cta 2995 Gly His Cys
Gly Cys Asp Ile Arg Arg Thr Ser Arg Lys Tyr Thr Leu 950 955 960 965
gat ata gga agc aaa tta cga ttt taaaccttat ttaacgacag ggttgaggca
3049 Asp Ile Gly Ser Lys Leu Arg Phe 970 tgcctctttc tttcaaatct
tcatcttttt gtctacttgc ctgtttatgt agtgcaagtt 3109 gcgcgtttgc
tgagactaga ctcggaggga actttgttcc t 3150 2 973 PRT Chlamydia
pneumoniae 2 Met Lys Thr Ser Ile Arg Lys Phe Leu Ile Ser Thr Thr
Leu Ala Pro 1 5 10 15 Cys Phe Ala Ser Thr Ala Phe Thr Val Glu Val
Ile Met Pro Ser Glu 20 25 30 Asn Phe Asp Gly Ser Ser Gly Lys Ile
Phe Pro Tyr Thr Thr Leu Ser 35 40 45 Asp Pro Arg Gly Thr Leu Cys
Ile Phe Ser Gly Asp Leu Tyr Ile Ala 50 55 60 Asn Leu Asp Asn Ala
Ile Ser Arg Thr Ser Ser Ser Cys Phe Ser Asn 65 70 75 80 Arg Ala Gly
Ala Leu Gln Ile Leu Gly Lys Gly Gly Val Phe Ser Phe 85 90 95 Leu
Asn Ile Arg Ser Ser Ala Asp Gly Ala Ala Ile Ser Ser Val Ile 100 105
110 Thr Gln Asn Pro Glu Leu Cys Pro Leu Ser Phe Ser Gly Phe Ser Gln
115 120 125 Met Ile Phe Asp Asn Cys Glu Ser Leu Thr Ser Asp Thr Ser
Ala Ser 130 135 140 Asn Val Ile Pro His Ala Ser Ala Ile Tyr Ala Thr
Thr Pro Met Leu 145 150 155 160 Phe Thr Asn Asn Asp Ser Ile Leu Phe
Gln Tyr Asn Arg Ser Ala Gly 165 170 175 Phe Gly Ala Ala Ile Arg Gly
Thr Ser Ile Thr Ile Glu Asn Thr Lys 180 185 190 Lys Ser Leu Leu Phe
Asn Gly Asn Gly Ser Ile Ser Asn Gly Gly Ala 195 200 205 Leu Thr Gly
Ser Ala Ala Ile Asn Leu Ile Asn Asn Ser Ala Pro Val 210 215 220 Ile
Phe Ser Thr Asn Ala Thr Gly Ile Tyr Gly Gly Ala Ile Tyr Leu 225 230
235 240 Thr Gly Gly Ser Met Leu Thr Ser Gly Asn Leu Ser Gly Val Leu
Phe 245 250 255 Val Asn Asn Ser Ser Arg Ser Gly Gly Ala Ile Tyr Ala
Asn Gly Asn 260 265 270 Val Thr Phe Ser Asn Asn Ser Asp Leu Thr Phe
Gln Asn Asn Thr Ala 275 280 285 Ser Pro Gln Asn Ser Leu Pro Ala Pro
Thr Pro Pro Pro Thr Pro Pro 290 295 300 Ala Val Thr Pro Leu Leu Gly
Tyr Gly Gly Ala Ile Phe Cys Thr Pro 305 310 315 320 Pro Ala Thr Pro
Pro Pro Thr Gly Val Ser Leu Thr Ile Ser Gly Glu 325 330 335 Asn Ser
Val Thr Phe Leu Glu Asn Ile Ala Ser Glu Gln Gly Gly Ala 340 345 350
Leu Tyr Gly Lys Lys Ile Ser Ile Asp Ser Asn Lys Ser Thr Ile Phe 355
360 365 Leu Gly Asn Thr Ala Gly Lys Gly Gly Ala Ile Ala Ile Pro Glu
Ser 370 375 380 Gly Glu Leu Ser Leu Ser Ala Asn Gln Gly Asp Ile Leu
Phe Asn Lys 385 390 395 400 Asn Leu Ser Ile Thr Ser Gly Thr Pro Thr
Arg Asn Ser Ile His Phe 405 410 415 Gly Lys Asp Ala Lys Phe Ala Thr
Leu Gly Asn Thr Gln Gly Tyr Thr 420 425 430 Leu Tyr Phe Tyr Asp Pro
Ile Thr Ser Asp Asp Leu Ser Ala Ala Ser 435 440 445 Ala Ala Ala Thr
Val Val Val Asn Pro Lys Ala Ser Ala Asp Gly Ala 450 455 460 Tyr Ser
Gly Thr Ile Val Phe Ser Gly Glu Thr Leu Thr Ala Thr Glu 465 470 475
480 Ala Ala Thr Pro Ala Asn Ala Thr Ser Thr Leu Asn Gln Lys Leu Glu
485 490 495 Leu Glu Gly Gly Thr Leu Ala Leu Arg Asn Gly Ala Thr Leu
Asn Val 500 505 510 His Asn Phe Thr Gln Asp Glu Lys Ser Val Val Ile
Met Asp Ala Gly 515 520 525 Thr Thr Leu Ala Thr Thr Asn Gly Ala Asn
Asn Thr Asp Gly Ala Ile 530 535 540 Thr Leu Asn Lys Leu Val Ile Asn
Leu Asp Ser Leu Asp Gly Thr Lys 545 550 555 560 Ala Ala Val Val Asn
Val Gln Ser Thr Asn Gly Ala Leu Thr Ile Ser 565 570 575 Gly Thr Leu
Gly Leu Val Lys Asn Ser Gln Asp Cys Cys Asp Asn His 580 585 590 Gly
Met Phe Asn Lys Asp Leu Gln Gln Val Pro Ile Leu Glu Leu Lys 595 600
605 Ala Thr Ser Asn Thr Val Thr Thr Thr Asp Phe Ser Leu Gly Thr Asn
610 615 620 Gly Tyr Gln Gln Ser Pro Tyr Gly Tyr Gln Gly Thr Trp Glu
Phe Thr 625 630 635 640 Ile Asp Thr Thr Thr His Thr Val Thr Gly Asn
Trp Lys Lys Thr Gly 645 650 655 Tyr Leu Pro His Pro Glu Arg Leu Ala
Pro Leu Ile Pro Asn Ser Leu 660 665 670 Trp Ala Asn Val Ile Asp Leu
Arg Ala Val Ser Gln Ala Ser Ala Ala 675 680 685 Asp Gly Glu Asp Val
Pro Gly Lys Gln Leu Ser Ile Thr Gly Ile Thr 690 695 700 Asn Phe Phe
His Ala Asn His Thr Gly Asp Ala Arg Ser Tyr Arg His 705 710 715 720
Met Gly Gly Gly Tyr Leu Ile Asn Thr Tyr Thr Arg Ile Thr Pro Asp 725
730 735 Ala Ala Leu Ser Leu Gly Phe Gly Gln Leu Phe Thr Lys Ser Lys
Asp 740 745 750 Tyr Leu Val Gly His Gly His Ser Asn Val Tyr Phe Ala
Thr Val Tyr 755 760 765 Ser Asn Ile Thr Lys Ser Leu Phe Gly Ser Ser
Arg Phe Phe Ser Gly 770 775 780 Gly Thr Ser Arg Val Thr Tyr Ser Arg
Ser Asn Glu Lys Val Lys Thr 785 790 795 800 Ser Tyr Thr Lys Leu Pro
Lys Gly Arg Cys Ser Trp Ser Asn Asn Cys 805 810 815 Trp Leu Gly
Glu
Leu Glu Gly Asn Leu Pro Ile Thr Leu Ser Ser Arg 820 825 830 Ile Leu
Asn Leu Lys Gln Ile Ile Pro Phe Val Lys Ala Glu Val Ala 835 840 845
Tyr Ala Thr His Gly Gly Ile Gln Glu Asn Thr Pro Glu Gly Arg Ile 850
855 860 Phe Gly His Gly His Leu Leu Asn Val Ala Val Pro Val Gly Val
Arg 865 870 875 880 Phe Gly Lys Asn Ser His Asn Arg Pro Asp Phe Tyr
Thr Ile Ile Val 885 890 895 Ala Tyr Ala Pro Asp Val Tyr Arg His Asn
Pro Asp Cys Asp Thr Thr 900 905 910 Leu Pro Ile Asn Gly Ala Thr Trp
Thr Ser Ile Gly Asn Asn Leu Thr 915 920 925 Arg Ser Thr Leu Leu Val
Gln Ala Ser Ser His Thr Ser Val Asn Asp 930 935 940 Val Leu Glu Ile
Phe Gly His Cys Gly Cys Asp Ile Arg Arg Thr Ser 945 950 955 960 Arg
Lys Tyr Thr Leu Asp Ile Gly Ser Lys Leu Arg Phe 965 970 3 44 DNA
Chlamydia pneumoniae 3 ataagaatgc ggccgccacc atgaaaacgt ctattcgtaa
gttc 44 4 34 DNA Chlamydia pneumoniae 4 cggggtaccg aaatcgtaat
ttgcttccta tatc 34
* * * * *