U.S. patent application number 10/397062 was filed with the patent office on 2004-02-05 for bcr-abl directed compositions and uses for inhibiting philadelphia chromosome stimulated cell growth.
Invention is credited to Arlinghaus, Ralph B., Liu, Jiaxin, Lopez-Berestein, Gabriel, Lu, Dai, Wu, Yun.
Application Number | 20040022772 10/397062 |
Document ID | / |
Family ID | 23542142 |
Filed Date | 2004-02-05 |
United States Patent
Application |
20040022772 |
Kind Code |
A1 |
Arlinghaus, Ralph B. ; et
al. |
February 5, 2004 |
Bcr-Abl directed compositions and uses for inhibiting Philadelphia
chromosome stimulated cell growth
Abstract
Compositions comprising or encoding one or more peptides that
inhibit the Bcr--Abl oncoprotein and that bind to molecules
involved in Bcr--Abl function are disclosed. The peptides and
polypeptides inhibit the growth of, and induce cell death of,
Philadelphia chromosome-positive leukemia cells expressing the
Bcr--Abl oncoprotein. Methods for treating leukemias (e.g., CML,
ALL and AML), including autologous bone marrow transplant therapy,
using the peptide and polypeptide compositions of the invention are
also provided.
Inventors: |
Arlinghaus, Ralph B.;
(Bellaire, TX) ; Liu, Jiaxin; (Bellaire, TX)
; Lopez-Berestein, Gabriel; (Bellaire, TX) ; Lu,
Dai; (Pearland, TX) ; Wu, Yun; (Houston,
TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
23542142 |
Appl. No.: |
10/397062 |
Filed: |
March 25, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10397062 |
Mar 25, 2003 |
|
|
|
09101059 |
Jun 21, 1999 |
|
|
|
6537804 |
|
|
|
|
09101059 |
Jun 21, 1999 |
|
|
|
PCT/US96/02091 |
Feb 16, 1996 |
|
|
|
09101059 |
Jun 21, 1999 |
|
|
|
08390353 |
Feb 16, 1995 |
|
|
|
6107457 |
|
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/320.1; 435/372; 435/6.14; 435/69.1; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/82 20130101;
A61K 38/00 20130101; A61P 31/12 20180101 |
Class at
Publication: |
424/93.21 ;
435/6; 435/69.1; 435/320.1; 435/372; 530/350; 536/23.5 |
International
Class: |
A61K 048/00; C12Q
001/68; C07H 021/04; C12P 021/02; C12N 005/08; C07K 014/705 |
Goverment Interests
[0001] The present application is a continuation-in-part of
co-pending U.S. patent application Ser. No. 08/390,353, filed Feb.
16, 1995. The U.S. Governnent owns rights in the present invention
pursuant to grant number CA 65611 from the National Institutes of
Health.
Claims
1. A composition comprising a purified peptide or polypeptide, of
between about 4 and about 500 amino acids in length, comprising a
contiguous amino acid sequence from the Bcr--Abl protein that
includes tyrosine 177, tyrosine 283 or tyrosine 360, which peptide
or polypeptide becomes phosphorylated on tyrosine upon contact with
Bcr--Abl.
2. The composition of claim 1, wherein said composition comprises a
peptide that includes tyrosine 177.
3. The composition of claim 2, wherein said peptide comprises the
sequence of SEQ ID NO:8.
4. The composition of claim 1, wherein said composition comprises a
peptide that includes tyrosine 283.
5. The composition of claim 4, wherein said peptide comprises the
sequence of SEQ ID NO:11.
6. The composition of claim 1, wherein said composition comprises a
peptide that includes tyrosine 360.
7. The composition of claim 6, wherein said peptide comprises the
sequence of SEQ ID NO: 10.
8. The composition of claim 6, wherein said peptide comprises the
sequence of SEQ ID NO:22.
9. The composition of claim 6, wherein said peptide further
comprises a phosphorylated Serine that corresponds to Serine
354.
10. The composition of claim 1, wherein said composition comprises
a first peptide that includes tyrosine 177 and a second peptide
that includes tyrosine 283.
11. The composition of claim 1, wherein said composition comprises
a first peptide that includes tyrosine 177, a second peptide that
includes tyrosine 283 and a third peptide that includes tyrosine
360.
12. The composition of claim 1, wherein said composition comprises
a single peptide that includes tyrosine 177 and tyrosine 283.
13. The composition of claim 1, wherein said composition comprises
a single peptide that includes tyrosine 177, tyrosine 283 and
tyrosine 360.
14. The composition of claim 13, wherein said peptide comprises the
sequence of SEQ ID NO:28.
15. The composition of claim 1, wherein said peptide is between
about 10 and about 350 amino acids in length.
16. The composition of claim 15, wherein said peptide is between
about 10 and about 100 amino acids in length.
17. The composition of claim 16, wherein said peptide is between
about 10 and about 50 amino acids in length.
18. The composition of any preceding claim, further comprising: (a)
a purified Shc-binding peptide that binds to an Abl SH3 binding
protein-rich region of Shc; (b) a purified Crkl-binding peptide
that binds to a proline-rich Abl binding site on Crkl; (c) a
purified Ras Gap-binding peptide that binds to an SH2 domain of
p120 Ras Gap; (d) a purified Bcr-binding peptide or protein that
binds to an N-terminal coiled-coil region of Bcr; or (e) a purified
Grb2-binding peptide or protein that binds to an N-terminal
coiled-coil region of Bcr.
19. The composition of claim 18, wherein said Ras Gap-binding
peptide comprises the sequence of SEQ ID NO:11 or SEQ ID NO:12.
20. The composition of claim 18, wherein said Bcr-binding peptide
comprises the sequence of any one of SEQ ID NO:2 through SEQ ID
NO:7.
21. The composition of claim 18, wherein said Grb2-binding peptide
comprises the sequence of SEQ ID NO: 13 or SEQ ID NO:8.
22. The composition of any preceding claim, wherein said peptide or
polypeptide is further associated with a liposome.
23. The composition of any preceding claim, wherein said peptide or
polypeptide is comprised in a pharmaceutically acceptable
carrier.
24. A composition according to any preceding claim, for use in
enriching Philadelphia chromosome-negative cells in a mixture of
cells containing Philadelphia chromosome-positive cells.
25. An expression vector comprising a DNA sequence that expresses a
peptide or polypeptide of between about 4 and about 500 amino acids
in length that includes a contiguous amino acid sequence from the
Bcr--Abl protein that includes tyrosine 177, tyrosine 283 or
tyrosine 360, which peptide or polypeptide becomes phosphorylated
on tyrosine upon contact with Bcr--Abl.
26. The vector of claim 25, further defined as a retroviral
vector.
27. The vector of claim 25, further defined as an adenoviral
vector.
28. The vector of claim 25, further defined as a plasmid associated
with a liposome.
29. A vector according to any one of claims 25-28, for use in
enriching Philadelphia chromosome-negative cells in a mixture of
cells containing Philadelphia chromosome-positive cells.
30. A method for enriching Philadelphia chromosome-negative cells
in a mixture of cells containing Philadelphia chromosome-positive
cells, comprising contacting said cells with a composition in
accordance with any one of claims 1 through 23 or a vector in
accordance with any one of claims 25 through 28, in an amount
effective to enrich for Philadelphia chromosome-negative cells in
said mixture.
31. The method of claim 30, wherein said cells comprise bone marrow
cells.
32. The method of claim 30, wherein Philadelphia
chromosome-negative cells are enriched relative to numbers
naturally occurring in a bone marrow sample containing Philadelphia
chromosome-positive cells.
33. A method of purging a bone marrow sample of Philadelphia
chromosome-positive cells, comprising contacting a bone marrow
sample that contains Philadelphia chromosome-positive cells with a
composition in accordance with any one of claims 1 through 23 or a
vector in accordance with any one of claims 25 through 28, in an
amount effective to reduce the numbers of Philadelphia
chromosome-positive cells in said bone marrow sample.
34. The method of claim 33, wherein said bone marrow sample is
obtained from a patient having or suspected of having CML, AML or
ALL.
35. A method of treating a patient with Philadelphia
chromosome-positive leukemia, comprising treating a bone marrow
sample of said patient with a composition in accordance with any
one of claims 1 through 23 or a vector in accordance with any one
of claims 25 through 28 in an amount effective to prepare an
essentially leukemia cell-free autologous bone marrow sample and
administering said treated sample to said patient.
36. A method of treating a patient with Philadelphia
chromosome-positive leukemia, comprising obtaining a bone marrow
sample from said patient, contacting said sample ex vivo with a
composition in accordance with any one of claims 1 through 23 or a
vector in accordance with any one of claims 25 through 28, in an
amount effective and for a period of time sufficient to purge
Philadelphia chromosome-positive cells from said sample and
re-administering said purged sample to said patient.
37. A method of treating a patient with Philadelphia
chromosome-positive leukemia, comprising administering to said
patient a therapeutically effective amount of a composition in
accordance with any one of claims 1 through 23 or a vector in
accordance with any one of claims 25 through 28.
38. Use of a composition according to any one of claims 1 through
23 or a vector according to any one of claims 25 through 28 in the
manufacture of a medicament for treating an animal with leukemia
associated with Philadelphia chromosome-positive cells, wherein the
medicament is administered to a tissue sample removed from said
animal in an amount effective to enrich for Philadelphia
chromosome-negative cells in said tissue sample and wherein the
treated tissue sample is re-administered to said animal.
39. Use of a composition according to any one of claims 1 through
23 or a vector according to any one of claims 25 through 28 in the
manufacture of a medicament for treating an animal with leukemia
associated with Philadelphia chromosome-positive cells, wherein the
medicament is administered to an animal with leukemia in an amount
effective to enrich for Philadelphia chromosome-negative cells in
said animal.
Description
FIELD OF THE INVENTION
[0002] The present invention relates generally to the field of
malignant cell proliferation. More particularly, it provides
compositions and methods to limit Bcr--Abl oncoprotein-driven
malignant cell proliferation. Peptide and protein molecules are
provided that inhibit various Bcr--Abl signal transduction
pathways, e.g., activation of the Ras protein. Methods for reducing
Philadelphia chromosome-positive cells in cell populations,
including bone marrow culture, and methods of treating various
leukemias are also provided.
BACKGROUND OF THE INVENTION
[0003] The Philadelphia chromosome (Ph.sup.1) is associated with
the bulk of chronic myelogenous leukemia (CML) patients (more than
95%), 10-25% of acute lymphocytic leukemia (ALL) patients, and
about 2-3% of acute myelogenous leukemias (AML). This abnormal
chromosome fuses most of the ABL gene to the 5' two-thirds of the
BCR gene.
[0004] A number of different kinds of evidence support the
contention that Bcr--Abl oncoproteins, such as p210 and p185
BCR--ABL, are causative factors in these leukemias (Campbell et
al., 1991). The malignant activity is due in large part to the
Bcr--Abl protein's highly activated protein tyrosine kinase
activity and its abnormal interaction with protein substrates
(Campbell er al., 1991, Arlinghaus et al., 1990). The Bcr--Abl
oncoprotein p210 Bcr--Abl is associated with both CML and ALL,
whereas the smaller oncoprotein, p185 BCR--ABL, is associated with
ALL patients, although some CML patients also express p185
(Campbell et al., 1991).
[0005] Some reports suggest that Bcr--Abl oncoproteins, p210 and
p185 BCR--ABL, function at least in part by activating the Ras
pathway. The RAS gene is a proto-oncogene involved in controlling
normal cell growth. When continuously activated, the Ras protein
becomes a potent cancer gene product. Bcr--Abl oncoproteins have
been observed by the present inventors and others to perturb normal
Ras function (Pendergast et al., 1993).
[0006] The mechanism by which Bcr--Abl oncoproteins activate p21
Ras is believed to involves several factors. One event involves the
autophosphorylation of the Bcr--Abl oncoprotein on tyrosine
residues within the coding sequence of the first Bcr exon (Liu et
al., 1993). This finding was unexpected, as it had previously been
postulated that Bcr--Abl phosphorylates itself on Abl tyrosines,
not Bcr tyrosine residues.
[0007] Several adaptor proteins have been implicated in
Ras-activation as well. FIG. 2 lists several such adaptor proteins
that contain SH2/SH3 motifs. Such domains have been observed in
proteins involved in transmitting growth signals to the nucleus
(Pawson et al., 1992).
[0008] Grb2 is an adaptor protein that binds to tyrosine
phosphorylated receptor proteins. Bcr--Abl induced oncogenesis has
also been reported to be mediated by direct interaction with the
SH2 domain of Grb2 (Pendergast et al., 1993; Puil et al., 1994).
Grb2 also binds mSos1, a GTP exchange factor (see FIG. 3). The
latter activates Ras by forming GTP/Ras. GTP/Ras in turn activates
Raf, a serine/threonine protein kinase that activates Mek. Mek is a
kinase that phosphorylates and activates MAP kinase. The latter is
believed to activate and/or regulate various transcription factors
(i.e., c-Jun), resulting in cell growth (FIG. 4).
[0009] Another peptide that has been implicated in the malignant
effects of Bcr--Abl involves Shc (Puil et al., 1994). Crkl is
another adaptor molecule that forms a protein/protein interaction
with Bcr--Abl (Reichmnan et al., 1992; Ten Hoeve et al., 1993;
1994). Still another adaptor molecule that interacts with Bcr--Abl
is p120 Ras Gap (Druker et al. 1992).
[0010] Another protein/protein interaction that has been examined
in relation to Bcr--Abl induced malignancy concerns the formation
of tetramer structures. In Philadelphia chromosome-positive human
leukemias, the c-abl proto-oncogene on chromosome 9 becomes fused
to the bcr gene on chromosome 22, and chimeric Bcr--Abl proteins
are produced. The fused Bcr sequences activate the tyrosine kinase,
actin-binding, and transforming functions of Abl.
[0011] Activation of the Abl transforming function is believed to
require two distinct domains of Bcr: domain 1 (Bcr amino acids 1 to
63) and domain 2 (Bcr amino acids 176-242) (McWhirter et al.,
1993). Domain 1 of Bcr has been shown to form a homotetramer
(McWhirter et al., 1993). The Bcr--Abl tetrarner activates its
inherent Abl tyrosine kinase activity, its actin binding function,
and its cellular transformation function (McWhirter et al., 1993).
Disruption of the coiled coil by insertional mutagenesis
inactivates the oligomerization function and the ability of
Bcr--Abl to transform Rat-i fibroblasts.
[0012] Despite the description of certain events and molecules that
are believed to be involved in Bcr/Abl function and pathologies
associated with the activities of its gene product, comprehensive
strategies for controlling Bcr/Abl and, e.g., its activation of the
Ras oncogene, have not been developed. Thus, a need continues to
exist in the scientific and medical arts for approaches that target
effectively and specifically inhibit Bcr/Abl. Such techniques would
provide new therapies for inhibiting Philadelphia
chromosome-positive cells in tissues, such as in bone marrow.
SUMMARY OF THE INVENTION
[0013] The present invention overcomes certain of the limitations
of the prior art by defining specific peptide sequences from
Bcr--Abl that inhibit Bcr--Abl function and activation. The
peptides and compositions of the invention are thus useful in
methods for inhibiting Bcr--Abl, for purging bone marrow of
Philadelphia chromosome-positive cells in bone marrow samples and
for treating various leukemias, including chronic myelogenous
leukemia (CML), acute lymphocytic leukemia (ALL) and acute
myelogenous leukemias (AML).
[0014] The peptides of the present invention are those comprising a
sequence based upon a segment of a Bcr--Abl amino acid sequence
that includes at least one of a combination of several tyrosine
residues found by the present inventors to be important in Bcr--Abl
function. These are termed herein the "tyrosine-containing
peptides". Generally, the compositions and methods of the invention
require that at least one tyrosine-containing peptide be
present.
[0015] The amino acid sequence of the first exon of p160 Bcr is
given in SEQ ID NO:1. Tyrosines are present at residues 58, 70,
177, 231, 246, 276, 279, 283, 316, 328 and 360. The particularly
important tyrosines in the context of the present invention are
tyrosines at positions 177, 283 and 360, and also tyrosine 328.
[0016] The present invention thus provides purified peptides and
polypeptides, of between about 4 and about 500 amino acids in
length, that have or comprise a contiguous amino acid sequence from
the Bcr--Abl protein (of SEQ ID NO:1), which sequence includes or
surrounds at least one of tyrosine 177, tyrosine 283, tyrosine 360,
or even tyrosine 328, which peptides or polypeptides become
phosphorylated on tyrosine 177, 283, 360 and/or 328 upon contact
with active Bcr--Abl.
[0017] These peptides are thus characterized as being substrates
for the tyrosine phosphorylating activity of Bcr--Abl. The peptides
are also characterized as being capable of effectively competing
with Bcr as a substrate for Bcr--Abl, and being capable of reducing
the Bcr--Abl-mediated tyrosine phosphorylation of Bcr in an intact
cell that contains Bcr--Abl.
[0018] Exemplary useful peptides including tyrosine 177 are those
comprising the sequence of SEQ ID NO:8 (positions 164 to 181 of SEQ
ID NO: 1). Exemplary useful peptides including tyrosine 283 are
those comprising the sequence of SEQ ID NO: 11 (positions 255 to
293 of SEQ ID NO: 1). It is currently preferred that the peptide
include the tyrosine in a generally central region, rather than at
the extreme termini of the peptide.
[0019] Although understanding the mechanism of action of any given
peptide is not necessary in order to practice the invention, it
should be noted that peptides containing tyrosine 177 or tyrosine
283 likely function by inhibiting the oncogenic effects of
Bcr--Abl. This is believed to be achieved by the peptides competing
with other substrates, particularly Bcr, in order to become
phosphorylated by Bcr--Abl. In effect, this reduces the
Bcr--Abl-driven phosphorylation of other cellular targets and
limits the adverse effects of Bcr--Abl.
[0020] Still further useful tyrosine-containing peptides are those
containing tyrosine 360. Exemplary useful peptides of this group
include those comprising the sequence of SEQ ID NO: 10 (positions
353 to 364 of SEQ ID NO: 1) and SEQ ID NO:22 (positions 350 to 366
of SEQ ID NO: 1). It is currently preferred that the a
phosphorylated serine, corresponding to Serine 354, be provided in
these peptides.
[0021] The advantageous effects of peptides containing tyrosine 360
are believed to be based on the stimulation of the beneficial
effects of Bcr, which neutralizes Bcr--Abl. Such Bcr neutralization
is achieved, in part, by its Serine/Threonine kinase activity.
Phosphorylation of Bcr tyrosine 360 and tyrosine 328 by Bcr--Abl
has been shown by the inventors to reduce its Serine/Threonine
phosphorylating activity. Importantly, the Ser 354 form of a
tyrosine 360-containing peptide is demonstrated herein to be a
direct inhibitor of the Bcr--Abl oncoprotein's tyrosine kinase
activity.
[0022] Therefore, peptides containing tyrosine 360 sequences, or
even tyrosine 328 sequences, will compete with Bcr as a Bcr--Abl
substrate and will reduce the levels of Bcr--Tyr-360-P, thereby
facilitating the beneficial effects of Bcr. However, it will again
be understood that the present invention is still useful even if
this proposed mechanism of action does not prove to be entirely
correct.
[0023] In terms of the tyrosine-containing peptides of the
invention, peptides that include at least a 4-mer or 5-mer
sequence, or preferably, that include at least a 6-mer or 7-mer
sequence, that includes the tyrosine of importance are expected to
provide effective molecules in the compositions for Bcr--Abl
inhibition. For example, a sequence that includes at least the
amino acid sequence of SEQ ID NO:24 (positions 176 to 180 of SEQ ID
NO: 1) may be employed. Exemplary 5- and 7-mers are represented by
SEQ ID NO:25 (positions 359 to 363 of SEQ ID NO:1) and SEQ ID NO:26
(positions 279 to 285 of SEQ ID NO:1).
[0024] However, longer peptides, from about 10-12 to 15-20, to
about 50, 100, 150, 200, 250, 300, 350, 400 or about 500 residues
or so may also be used. An exemplary 13-mer is SEQ ID NO:27,
corresponding to positions 168 to 180 of SEQ ID NO:1. A currently
preferred longer peptide is that of SEQ ID NO:28.
[0025] Shorter peptides, such as SEQ ID NO: 10 and SEQ ID NO:22,
will generally be administered to cells or patients as a peptide or
liposomal-peptide formulation. Longer peptides and polypeptides,
such as SEQ ID NO:28, will generally be administered to cells or
patients using gene therapy, in which a vector that expresses the
peptide or polypeptide is employed.
[0026] While a given peptide alone will be useful in inhibiting
Bcr--Abl, the compositions and methods of the present invention may
include two or more such peptides. Where two peptides are employed,
it may be preferred to use peptides with sequences including
distinct tyrosine regions, preferably selected from those regions
of SEQ ID NO: 1 including 177, 283 and/or 360. Three distinct
peptides including the foregoing various tyrosine regions may also
be used to advantage.
[0027] A single peptide that itself contains sequences surrounding
two of the three tyrosines at positions 177, 283 and 360 may also
be used. Such peptides may contain only contiguous Bcr--Abl
sequences, or may contain two contiguous stretches of Bcr--Abl
sequence operatively joined by an irrelevant, preferably flexible,
linker sequence.
[0028] Further, the use of a single peptide that contains a
contiguous sequence that includes each of the three tyrosines at
positions 177, 283 and 360 is also contemplated. An exemplary
peptide containing only contiguous Bcr--Abl sequences is SEQ ID
NO:28, which begins at residue 64 and ends at residue 413 of SEQ ID
NO: 1. Peptides may also contain longer stretches of Bcr--Abl
sequences or other sequences as desired.
[0029] Other peptides of the present invention that may be used in
addition to at least one tyrosine-containing peptide are those that
comprise the sequence of an important binding site on Bcr--Abl for
an adaptor molecule, i.e., a molecular target of the Bcr--Abl
oncoprotein. These are termed the "binding site peptides".
[0030] The binding site peptides for use in the invention are
purified peptides and polypeptides, of between about 4 and about
500 amino acids in length, that have or comprise a contiguous
adaptor molecule binding site sequence from the Bcr--Abl sequence,
which peptides or polypeptides bind to an adaptor molecule.
[0031] The binding site peptides may also contain tyrosine
residues. However, binding site peptides are characterized as
binding to an adaptor molecule, such as Grb2, Shc, Crkl, Ras Gap or
an N-terminal coiled-coil region of Bcr. Preferably, they are
characterized as inhibiting the binding of Bcr--Abl to an adaptor
molecule, and as being capable of reducing Bcr--Abl-adaptor
molecule interactions in an intact cell.
[0032] The binding site peptides for use in the compositions and
methods of the invention generally mimic the sites on Bcr--Abl to
which key oncoproteins bind. In these embodiments, supplementary
peptides are provided that bind one or more signal transduction
molecules, such as Shc, Crkl, Ras Gap and/or Grb2/mSosl, thereby
preventing these molecules from carrying out their growth-promoting
functions.
[0033] Accordingly, the tyrosine-containing peptide compositions of
the invention may further comprise one or more of the binding
proteins: a purified peptide that binds to an Abl SH3 binding
protein-rich region of Shc; a purified peptide that binds to a
proline-rich ABl binding site on Crkl; a purified peptide that
binds to an SH2 domain of p120 Ras Gap; and/or a purified peptide
or protein that binds to an N-terminal coiled-coil region of
Bcr.
[0034] Exemplary compositions of the invention are those that
additionally comprise one or more peptides that bind an Abl SH3
binding protein-rich region of Shc. Shc binds to Grb2 and this
complex has potential to activate Ras. Peptides that bind to Shc
will comprises a sequence from the Abl region, not from the Bcr
region.
[0035] Further binding peptides of the present invention are those
that inhibit binding of Crkl to Bcr--Abl. Crkl is a 38-kDa protein
that forms complexes with both Abl and Bcr/Abl and is tyrosine
phosphorylated by Abl and Bcr--Abl. Peptides that mimic the
proline-rich Abl binding site on CRKL are thus also components of
some embodiments of the present invention.
[0036] Still further Bcr/Abl peptides included in these embodiments
are those that interact with p120 Ras Gap. Peptides of this nature
are described more particularly as peptides that bind an SH2 domain
of p120 Ras Gap. These peptides involve tyrosine 279 and a tyrosine
outside of the first exon of Bcr. Exemplary useful peptides are
those comprising the sequence of SEQ ID NO:11 (positions 255 to 293
of SEQ ID NO: 1) and SEQ ID NO: 12.
[0037] In further embodiments, the compositions of the invention
will comprise one or more peptides or proteins that bind an
N-terminal coiled-coil region of Bcr. These peptides and proteins
are exemplified by peptides that comprise a sequence corresponding
to SEQ ID NO:2 (positions 1 to 63 of SEQ ID NO:1); SEQ ID NO:3
(positions 1 to 71 of SEQ ID NO: 1); SEQ ID NO:4 (positions 28 to
58 of SEQ ID NO: 1); a sequence corresponding to SEQ ID NO:5
(positions 1 to 159 of SEQ ID NO: 1); a sequence corresponding to
SEQ ID NO:6 (positions 1 to 221 of SEQ ID NO: 1); or a sequence
corresponding to SEQ ID NO:7 (positions 1 to 413 of SEQ ID NO:
1).
[0038] The present inventors observed that the Bcr protein contains
the consensus binding site Y*VNV (SEQ ID NO: 13) for Grb2 that
enables the Bcr--Abl oncoprotein to form a complex with Grb2.
Tyrosine phosphorylation of Bcr sequences at tyrosine 177 causes
Grb2/mSosl to bind membrane-bound Bcr--Abl and to activate p21 Ras
(FIG. 5).
[0039] Peptides comprising the Y*VNV consensus binding site (SEQ ID
NO: 13; residues 177 to 180 of SEQ ID NO: 1) will thus interfere
with Grb2 binding to Bcr--Abl block Bcr--Abl induced malignant
effects, particularly when used in combination with one or more of
the Shc, Crkl, SH2 or p120 Ras Gap binding sequences. The Bcr
peptide GHGQPGADAEKPFp.Y.sub.177VNVE, SEQ ID NO:8 (residues 164-181
of SEQ ID NO:1), also strongly binds to the SH2 binding site on
Grb2 and may be used in the compositions of the invention.
[0040] The binding site peptides of the invention may thus be any
length from between about 4 amino acids to about 500 amino acids or
so, so long as the peptide is of sufficient length to include an
effective binding site, as described herein.
[0041] Any of the peptide compositions of the present invention may
further include a pharmaceutically acceptable carrier, such as
Ringers solution, saline, and the like. Such carriers are known to
those of ordinary skill in the pharmaceutical arts.
[0042] Another embodiment of the invention provides compositions
comprising one or more of the above tyrosine-containing peptides in
association with a liposomal formulation. The peptides may be
encapsulated within the liposome or simply maintained in functional
association with the liposome.
[0043] The foregoing peptide compositions may be used in enriching
for Philadelphia chromosome-negative cells in a mixture of cells
containing Philadelphia chromosome-positive cells.
[0044] Further provided by the present invention is a first
expression vector, such as a plasmid, adenovirus or retrovirus,
that contains a first DNA sequence or sequences that encodes and
expresses at least one of the tyrosine-containing peptides of the
invention. DNA sequences that encodes the amino acid sequence of
SEQ ID NO: 1 are known to those of skill in the art and are further
described herein. The identification of a particular coding region
that encodes one or more tyrosine-containing peptides will be
straightforward to one of skill in the art.
[0045] The first expression vector may further comprise a second
DNA sequence or sequences that encodes and expresses at least one
of: a peptide that binds an Abl SH3 binding protein-rich region of
Shc; a peptide that binds a proline-rich Abl binding site on Crkl;
a peptide that binds an SH2 domain of p120 Ras Gap; a peptide or
protein that binds an N-termninal coiled-coil region of Bcr; and/or
a peptide that binds an SH2 binding site on Grb2.
[0046] Equally, a second expression vector, such as a plasmid,
adenovirus or retrovirus, may be provided for use with the first
expression vector described above. The second expression vector
will generally be a plasmid, adenovirus or retrovirus that contains
a DNA sequence or sequences that encodes and expresses at least one
of: a peptide that binds an Abl SH3 binding protein-rich region of
Shc; a peptide that binds a proline-rich Abl binding site on Crkl;
a peptide that binds an SH2 domain of p120 Ras Gap; a peptide or
protein that binds an N-terminal coiled-coil region of Bcr; and/or
a peptide that binds an SH2 binding site on Grb2.
[0047] In certain embodiments, an amphotropic retrovirus, defective
in replication but capable of infecting bone marrow cells from
animals or patients, is provided that expresses one or more of the
peptides of the present invention, either singly or as part of a
fused polypeptide. AAV, adenoviral and plasmid vectors associated
with liposomes are also provided.
[0048] Methods of the invention provide for the inhibition, killing
or effective reversal of phenotype of Philadelphia
chromosome-positive cells. The methods generally comprise
contacting a Philadelphia chromosome-positive cell, or a population
of cells that includes Philadelphia chromosome-positive cells, with
a composition that includes or encodes a biologically effective
amount of any one of, or a combination of, any of the
tyrosine-containing peptide compositions described herein. The
compositions are maintained in contact with the cells for a period
of time effective to result in inhibition or killing of the
Philadelphia chromosome-positive cells.
[0049] It will be understood that the methods may be achieved by
contacting one or more Philadelphia chromosome-positive cells with
an effective amount of one or more tyrosine-containing peptides
themselves. Equally, the cells may be contacted with one or more
expression vectors, including viral vectors, that encode and
express one or more such tyrosine-containing peptides.
[0050] The compositions for use in such methods will generally
include or encode at least one peptide having or comprising a
sequence that includes at least one of the tyrosine residues 177,
283 or 360 from SEQ ID NO: 1. In certain embodiments, the
composition will further include or encode: a peptide that binds an
Abl SH3 binding protein-rich region of Shc; a peptide that binds a
proline-rich Abl binding site on Crkl; a peptide that binds an SH2
domain of p120 Ras Gap; a peptide or protein that binds an
N-terminal coiled-coil region of Bcr; and/or a peptide that binds
an SH2 binding site on Grb2.
[0051] In the methods for inhibiting, killing or reversing the
phenotype of Philadelphia chromosome-positive cells, the cells or
populations of cells may be contacted either in vivo or in vitro.
The methods thus encompass both in vivo treatment and in vitrolex
vivo protocols. Both in vivo and in vitro, the cells may be
contacted with a composition of peptides, a composition of
liposomally-associated peptides and/or with a composition
comprising an expression vector or virus that encodes and expresses
the peptides. The compositions will generally be pharmaceutically
acceptable.
[0052] The invention thus further provides methods for enriching
Philadelphia chromosome-negative cells in a mixture of cells
containing Philadelphia chromosome-positive cells. The methods
generally comprise contacting, for en effective period of time, a
mixture of cells, such as a bone marrow sample, that contains, or
is suspected of containing, Philadelphia chromosome-positive cells
with a composition that includes or encodes a Bcr--Abl-inhibiting
amount of any one of, or a combination of, any of the
tyrosine-containing peptide compositions of the present invention.
In certain embodiments, the bone marrow will be obtained from a
patient having CML, AML or ALL.
[0053] The invention particularly contemplates that the bone marrow
sample treated with the peptides of the invention will be
re-administered to the patient from whom it was obtained. The
invention thus provides methods for ex vivo treatment and bone
marrow purging prior to autologous bone marrow transplants. The
treated bone marrow samples enhance the immunocompetency of the
transplant recipient.
[0054] In the methods for enriching Philadelphia
chromosome-negative cells in a mixture of cells containing
Philadelphia chromosome-positive cells, the Philadelphia
chromosome-negative cells are generally enriched relative to
numbers naturally occurring in a sample containing Philadelphia
chromosome positive cells. An example is enriching for Philadelphia
chromosome-negative cells relative to numbers naturally occurring
in a bone marrow sample from a patient having CML, AML or ALL.
[0055] In still further embodiments, the invention provides methods
for purging a bone marrow sample of Philadelphia
chromosome-positive cells. The methods generally comprise exposing,
for an effective period of time, a bone marrow sample that contains
Philadelphia chromosome-positive cells to a composition that
includes or encodes any one of, or a combination of, any of the
tyrosine-containing peptide compositions of the present invention
in an amount effective to reduce the numbers of Philadelphia
chromosome-positive cells in the bone marrow sample.
[0056] Yet still further embodiments of the invention provide
methods of treating a patient having or suspected of having a
Philadelphia chromosome-positive leukemia, comprising treating a
bone marrow sample of the patient with a composition including or
encoding at least one of the tyrosine-containing peptides of the
invention in an amount effective to prepare an essentially leukemia
cell-free autologous bone marrow sample (i.e., using a leukemia
cell-cytotoxic amount) and administering the treated sample to the
patient.
[0057] The treatment methods also comprise obtaining a bone marrow
sample from the patient, contacting the bone marrow sample ex vivo
with a composition that includes or encodes any one or more of the
tyrosine-containing peptides of the invention in a therapeutic
amount and for a period of time effective to purge Philadelphia
chromosome-positive cells from the bone marrow sample and
re-administering the purged bone marrow sample to the patient.
[0058] For the purpose of this invention, an autologous bone marrow
sample is defined as a sample of bone marrow from a patient
intended for re-administration to the patient after treatment
outside the body.
[0059] A defined method for treating leukemia in a patient
according to the present invention comprises: administering to a
patient with leukemia a chemotherapeutic regimen sufficient to
generate at least some cytogenetic remission in the patient;
obtaining a bone marrow sample from the patient in remission;
exposing the bone marrow sample to a Philadelphia
chromosome-positive cell cytotoxic concentration of
tyrosine-containing peptides to provide an essentially Philadelphia
chromosome-positive cell free bone marrow sample; and reintroducing
the essentially Philadelphia chromosome-positive cell free bone
marrow sample into the patient, wherein the reintroduction replaces
Philadelphia chromosome-positive marrow cells with normal
hematopoietic progenitor cells.
[0060] The approaches of the present invention provide an
improvement over current strategies, e.g., anti-sense Bcr--Abl
approaches, in that the activity of Bcr--Abl is inhibited while at
the same time neutralizing more than one of the principal targets
of Bcr--Abl oncoproteins.
[0061] The present invention also has practical uses in that the
peptides mat be used as molecular weight markers, protein stain
standards and as standards for radioiodination.
BRIEF DESCRIPTION OF THE DRAWINGS
[0062] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0063] FIG. 1A and FIG. 1B provide models for Bcr and Bcr--Abl
interaction. FIG. 1A depicts a normal progenitor cell. FIG. 1B
depicts a leukemic progenitor cell.
[0064] FIG. 2 provides a diagram of SH2/SH3 containing proteins
involved in signal transduction.
[0065] FIG. 3 outlines the activation of RAS by ligand receptor
interaction.
[0066] FIG. 4 outlines the pathway of activation of transcription
factors by receptor/ligand interaction.
[0067] FIG. 5 outlines an activation pathway of Ras by
Bcr--Abl.
[0068] FIG. 6A and FIG. 6B. In vivo tyrosine phosphorylation of
truncated Bcr first exon sequences by Bcr--Abl. COS-1 vectors
expressing Bcr150, Bcr221, and Bcr4l3 proteins, respectively, were
expressed in COS-1 cells in the presence and absence of p20
Bcr--Abl. FIG. 6A shows a Western blot with Anti-Tyr antibody.
Bcr--Abl induces tyrosine phosphorylation of Bcr221 and Bcr413 but
not Bcr159, indicating that the first two tyrosines of Bcr are not
targets for Bcr--Abl. The next tyrosine is at residue 177, and it
is expected to be phosphorylated by Bcr--Abl (Puil et al., 1994).
Bcr221 is tyrosine phosphorylated, but as with Bcr413, only in the
presence of Bcr--Abl. FIG. 6B shows a Western Blot of the same
extracts probed with anti-Bcr 1-16. Note that all three Bcr
proteins fragments are specifically expressed under both
conditions.
[0069] FIG. 7 provides a schematic diagram of the BCR deletion
mutants.
[0070] FIG. 8A, FIG. 8B, FIG. 8C and FIG. 8D show two-D tryptic
maps of in vitro phosphorylated Bcr--Abl proteins. Mutant and wild
type Bcr--Abl proteins were expressed in COS-1 cells as described.
Bcr--Abl proteins were phosphorylated in vitro using
anti-Abl(52-64) immune complexes, and mapped. The dashed circles
identify peptides lacking in the mutant. FIG. 8A, p210-wild type;
FIG. 8B, p210-F283; FIG. 8C, p210-F276; FIG. 8D, p185-F360.
[0071] FIG. 9A and FIG. 9B show trypsin/V8 mapping of F283 and wild
type p210 Bcr--Abl. The F283 mutant of p210 Bcr--Abl (FIG. 9B)
expressed in COS-1 cells was compared to the map of p210 Bcr--Abl
from K562 cells (FIG. 9A). In vitro labeling and mapping was
performed. The dashed circles or Xs identify peptides lacking in
the mutant.
[0072] FIG. 10A and FIG. 10B show an absorbed tryptic map of p210.
GST--Abl SH2 binds phosphotyrosine tryptic peptide 3, which
contains tyrosine 283. p210 Bcr--Abl labeled in the in vitro kinase
assay from K562 cells was purified on SDS gels, digested with
trypsin and the digest was split in two parts. One was absorbed
with GST (FIG. 10A) and the other with GST--Abl SH2 (FIG. 10B). The
peptides that did not bind to the beads were separated on thin
layer plates as usual. The dashed circles identify peptides lacking
in the GST--Abl SH2 absorbed fractions.
[0073] FIG. 11 depicts a retroviral vector pG7CHT useful for
introducing peptides of the present invention into cells.
[0074] FIG. 12 shows Bcr--Abl protein expression in SUP-B15 cells
treated with sense and anti-sense 3'BCR. SUP-B15 cells express p185
BCR--ABL; they were derived from a patient with Philadelphia
chromosome-positive ALL. One-tenth of the cells harvested in the
study shown in FIG. 13 was assayed for Bcr--Abl expression by
Western blotting with the anti-Abl monoclonal antibody 8E9.
Quantitation of these results indicates that there was a 35%
reduction in Bcr--Abl protein in the anti-sense treated cultures
(lane 1) compared to sense (lane 2). Similarly, the Abl protein was
reduced about 26% in the anti-sense treated culture compared to
sense. Quantitation was done by a densitometer SI unit (Molecular
Dynamics).
[0075] FIG. 13 shows inhibition of p60 BCR expression by 3'
anti-sense BCR oligonucleotide treatment of SUP B15 ALL cells. SUP
B15 cells were treated with anti-sense BCR oligonucleotides as in
FIG. 12. Equal amounts of cells processed from sense and antisense
treated cultures were harvested at day 7. Cells were analyzed for
Bcr protein and Bcr/Bcr--Abl complexes by assaying with an antibody
to the carboxy terminal of Bcr, as described (Liu et al., 1993).
Lane 1 is an SDS gel pattern of the sense treated culture; lane 2
is the assay performed with peptide-blocked antibody. Lane 3 is the
pattern from anti-sense treated culture; lane 4 is the
peptide-blocked control. Comparison of lanes 1 and 3 indicates that
the level of Bcr protein as well as its ability to form
Bcr/Bcr--Abl complexes was severely inhibited by 3' BCR anti-sense
treatment. Quantitation measurements indicate that the level of Bcr
protein was reduced about 10-fold by antisense treatment compared
to sense, when normalized for the amount of Abl protein in the
cultures.
[0076] FIG. 14 shows treatment with 3' BCR anti-sense oligo
enhances the survival of p185 BCR--ABL expressing SUP-B15 cells
maintained in low serum. SUP-B15 cells (2.times.10.sup.6 cells)
were maintained in RPMI medium containing 5% fetal calf serum.
Cells will not grow under these conditions and will slowly die off
since cell growth requires 20% serum. Cells were treated with the
3' BCR anti-sense (open squares) or sense oligo (closed squares) at
a concentration of 10 .mu.M. The number of viable cells was
determined by trypan blue dye exclusion. The data are expressed as
the mean (+/-SEM) of three replicates.
[0077] FIG. 15 shows depression of Bcr serine/threonine autokinase
activity by the Bcr--Abl tyrosine kinase. (In vitro
transphosphorylation of Bcr by Bcr--Abl). Equal amounts of cell
extract from 3.times.10.sup.8 SMS-SB cells (lacking Bcr--Abl) were
divided into three portions and processed for immunoprecipitation
with anti-Bcr (1256-1271). One portion (from 1.times.10.sup.8
cells) was collected on protein A Sepharose beads for the
immunokinase assay. The second portion (1.times.10.sup.8 cells) was
added to anti-Abl(51-64) immune complexes bound to protein A
Sepharose beads obtained from 1.times.10.sup.6 SUP-B15 (p185
BCR--ABL expressing cells). These anti-Abl inunune complexes have a
high amount of p185 BCR--ABL but only a trace level of p160 BCR.
The third batch of Bcr immune complexes (1.times.10.sup.8) were
added to Bcr--Abl immnune complexes obtained from 2.times.10.sup.7
SUP-B15 cells. The whole procedure was performed as described (Liu
et al., 1993). Phosphoamino acid analysis of gel purified p160 BCR
following transphosphorylation by low and high levels of Bcr--Abl.
The three p160 BCR bands from panel A were eluted from the gel by
SDS buffer and treated with 6 N HCl for 90 min at 110.degree. C.
These conditions are a reasonable compromise to obtain both phospho
serine/threonine and tyrosine values. The hydrolysate was
fractionated on a thin layer plate under conditions for separating
phospho serine/threonine and tyrosine (Liu et al., 1993). About 200
cpm (Cerenkov) of acid hydrolysate from the p160 SMS-SB band, 200
cpm of the SMS-SB/5% SUP-B15 p160 band, and 500 cpm of the
SMS-SB/100% SUP-B15 p160 band were loaded on the plate. After
normalization, the intensities of the serine/threonine spots were
4,421 for p160 Bcr alone; 1763 for p160 BCR incubated with a low
level of Bcr--Abl (5%), and 142 for p160 BCR incubated with the
high level of Bcr--Abl. Phospho serine/threonine was reduced more
than 30-fold by Bcr--Abl kinase at relatively high levels and by
2.5-fold at the 5% Bcr--Abl level.
[0078] FIG. 16 shows transphosphorylation of casein by Bcr and
Bcr/Abl. T-150 flasks of COS 1 cells were transfected with either
pSGS BCR or pSG5 BCR--ABL. Two days after transfection, cells were
harvested and the kinase performed as in Liu et al., 1993. In lane
3, the same amount of protein A Sepharose beads with Bcr complexes
as in lane 2 was added to protein Sepharose beads with Bcr--Abl
complexes harvested with anti-Abl (51-64) p6D monoclonal antibody.
Casein (10 .mu.g) was added to each reaction mixture along with the
labeled ATP. After 15 min on ice, the reaction was stopped and the
sample treated with hot SDS sample buffer. After removal of the
protein A Sepharose beads, the supernatant fluid was fractionated
on a 8% SDS gel. Lane 1, p160 BCR autophosphorylation in the
absence of casein; lane 2, transphosphorylation of added casein by
Bcr, lane 3, transphosphorylation of casein by a mixture of p160
BCR and p210 BCR--ABL.
[0079] FIG. 17 shows phosphoamino acid analysis of casein
phosphorylated by Bcr and Bcr/Bcr--Abl. Approximately equal cpm of
casein from each of the reaction mixtures was treated with 6N HCl
for 90 min to favor detection of both phosphoserine/threonine and
phosphotyrosine. Casein phosphorylated by Bcr is shown in lane 1;
lane 2 shows the analysis of casein phosphorylated by the
Bcr/Bcr--ABl mixture. Despite the presence of equal amounts added
Bcr kinase, serine phosphorylation of casein by Bcr was severely
inhibited by added Bcr--Abl. That Bcr--Abl was present and active
is shown by the strong signal of phosphotyrosine in the added
casein molecules in the presence of Bcr--Abl.
[0080] FIG. 18 shows physical interaction of tyrosine
phosphorylated p160 BCR with simian Grb2 protein in COS1 cells
overexpressing both p160 BCR and p145 c-ABL. Anti-Grb2 Western
blotting was performed on lysates of COS1 cell lysates (lane 1) or
anti-BCR (1256-1271) antibody immunoprecipitates from COS1 cells
transfected with human full length c-ABL (1b) (lanes 2 and 3),
human full length Bcr (lanes 4 and 5) or cotransfected both human
full length Bcr and c-ABl(1b) (lanes 6 and 7). Lane 3, 5 and 7 are
immunoprecipitates obtained with pre-blocked anti-BCR (1256-1271)
antibody. The bands were detected using the ECL method. Exposure
time: 30 seconds.
[0081] FIG. 19 shows phosphotyrosine 177 of p160 BCR is critical
for its interaction with the simian Grb2 protein. Anti-Grb2 Western
blotting was performed on anti-BCR (1256-1271) antibody
immunoprecipitates of lysates from COS1 cells cotransfected p145
c-ABL with either wild type p160 BCR (lanes 1 and 2) or p160 BCR
(F177) (lanes 3 and 4) mutant. Lanes 2 and 4 are
immunoprecipitation with pre-blocked anti-BCR (1256-1271)
antibody.
[0082] FIG. 20A and FIG. 20B show effects of 3' BCR antisense
oligonucleotides on the growth of p185 BCR--ABL expressing SUP-B15
cells and p210 BCR--ABL expressing M3.16 cells. FIG. 20A, B15 cells
cultured in 20% FCS containing RPMI media with either the 3' BCR
antisense oligonucleotides (10 .mu.M at day 1) (open squares) or
the sense oligonucleotides (10 .mu.M at day 1) (closed squares).
FIG. 20B, M3.16 cells cultured in 10% FCS containing DMEM media
with either the 3' BCR antisense oligonucleotides (open squares) or
the sense oligonucleotide (closed squares) as above.
Oligonucleotides were added at day 1 at a final concentration of 10
.mu.M and added again at day 5 at half of the initial
concentration. Cell viability was determined by trypan blue dye
exclusion. The data are the mean+/-SEM of a triplicate
analysis.
[0083] FIG. 21. Phosphoserine Bcr peptide pS354 S17K (SEQ ID NO:22)
inhibits the Bcr--Abl tyrosine kinase activity. The SUP B15 cell
line derived from a patient with Bcr--Abl-positive acute
lymphocytic leukemia (ALL) were grown in culture; cells were lysed
and the Bcr--Abl oncoprotein immunoprecipitated with a monoclonal
antibody p6D (anti-Abl 51-64). The immune complexes were mixed with
either no peptide or 50 Ag of peptide prior to addition of the
kinase activating buffer containing [.gamma.-.sup.32P]ATP. After
the assay was completed, the proteins were fractionated by SDS gel
electrophoresis. Radioactive proteins were detected by phosphoimage
analysis. Lane 1, no peptide; lane 2, 50 .mu.g of pS354 S17K; lane
3, 50 .mu.g of unphosphorylated S17K.
[0084] FIG. 22. Structure of the Bcr fragment that inhibits the
Bcr--Abl protein tyrosine kinase. The amino acid sequence of the
Bcr fragment used is that of SEQ ID NO:28, which begins at residue
64 and ends at residue 413 of SEQ ID NO:1. The Bcr coding sequence
(McWhirter and Wang, 1991) was inserted into vector pLNL SLX CMV at
the Bam HI site of the vector with a linker sequence. The
translation product begins with five amino acids fused to the amino
terminal Bcr sequence beginning with AKE--; the linker sequence at
the 3' end adds a LV followed by a stop codon to the carboxy
terminus of the Bcr sequence (--GQI).
[0085] FIG. 23A, FIG. 23B and FIG. 23C. A Bcr fragment expressed in
COS-1 cells inhibits the Bcr--Abl tyrosine kinase in vitro. In
these studies, the Bcr fragment was expressed in COS-1 cells, then
isolated by immunoprecipitation with anti-Bcr 181-194 antibody.
This immune complex was isolated by binding to protein A Sepharose
beads; these immune complexes were added to protein A Sepharose
beads containing P185 BCR--ABL harvested from SUP B15 leukemic
cells with anti-Abl 51-64. The autokinase reaction was performed to
measure the tyrosine kinase activity of Bcr--Abl. FIG. 23A, Lane
1,l boiled Bcr fragment mixed with P185 BCR--ABL; lane 2, untreated
Bcr fragment mixed with P185 BCR--ABL; lane 3, 50 .mu.g of Bcr S17K
(not phosphorylated) added to P185 BCR--ABL; lane 4, P185 BCR--ABL
alone. FIG. 23B, Western blotting of the immune complexes
containing P185 BCR--ABL. The P185 protein present in lanes 2 and 4
of FIG. 23A was analyzed by Western blotting with anti-Bcr 181-194.
Lane 1, P185 detected in lane 2 of FIG. 23A; lane 2, P185 detected
in lane 4 of FIG. 23A. This shows that although the kinase activity
of Bcr--Abl was dramatically reduced by the Bcr fragment protein,
the amount of Bcr--Abl in the reaction mixtures was similar. FIG.
23C. The anti-Bcr 181-194 antibody does not inhibit the Bcr--Abl
tyrosine kinase activity. In this study anti-Bcr 181-194 antibody
was added to a reaction mixture containing P185 BCR--ABL to
determine whether the antibody itself was responsible for the
inhibitory activity exhibited by the antibody/Bcr fragment complex
(FIG. 23A, lane 2). Lane 1, P185 BCR--ABL alone; lane 2, P185
BCR--ABL plus protein A Sepharose beads containing the anti-Bcr
181-194. The top pattern is the P185 autokinase activity; the
bottom portion is the anti-Abl 8E9 Western blot of the immune
complexes. These results show that the anti-Bcr antibody itself
does not inhibit the Bcr--Abl kinase activity.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0086] The present invention provides one or more peptides
comprising BCR sequences including Y.sup.177, Y.sup.283 and/or
Y.sup.360, or even Y.sup.328, for the inhibition of Bcr--Abl
oncogenic activities. The peptides also inhibit BCR--Abl-adaptor
protein interactions (FIG. 1A and FIG. 1B). This inhibition
prevents the adaptor proteins from participating in the cascade
that leads to adverse effects, such as Ras oncogene activation.
[0087] 1. Tyrosine-Containing Peptides
[0088] Currently preferred tyrosine-containing peptides are those
comprising sequences of SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO: 10,
SEQ ID NO:22, and the longer peptide, SEQ ID NO:28. However,
peptides comprising sequences of any one or more of SEQ ID NO:1
through SEQ ID NO:28 may be used in the present invention.
[0089] These peptides have a tyrosine within their sequence, at the
beginning, middle or end, with the middle of the peptide being
generally preferred.
[0090] The peptides may be phosphorylated at tyrosine residues or
they may be provided in nonphosphorylated form because the target
cell has the capacity to phosphorylate the peptides. Peptides
comprising Y.sup.177 and Y.sup.283 will generally be provided in
nonphosphorylated form, in order to compete for tyrosine kinase
activity. Peptides comprising Y.sup.360 will generally be provided
in a form that includes a phosphorylated serine, e.g.,
corresponding to position 354, in order to be most effective.
Peptides comprising Y.sup.328 may even be provided.
[0091] In addition to the mechanisms discussed hereinabove,
phosphorylation of tyrosine 328 and 360 is contemplated to alter
the structure of Bcr. Bcr is a novel Ser/Thr kinase not
structurally related to other Ser/Thr kinases. Tyrosine 328 and 360
are located around two pairs of cysteines important in Bcr
function. When tyrosines 360 and/or 328 become phosphorylated it is
contemplated by the inventors to induce a conformational change
that hampers Bcr function. Thus, peptides comprising tyrosine
328-surrounding sequences form another aspect of the invention.
[0092] The Bcr--Abl peptides of the present invention may be
virtually any length from about 3-4 amino acids up to about 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or about 20 amino
acids long. Peptides of about 25, 30, 35, 40, 45, 50, 75, 100, 150,
200, 250, 300, 350, 400, 450 or about 500 amino acids in length may
also be employed.
[0093] Exemplary shorter peptides are those based upon the sequence
of SEQ ID NO:24. SEQ ID NO:9 (positions 314 to 320 of SEQ ID NO:1),
surrounding tyrosine 316, may even be used in certain embodiments.
Exemplary longer peptides include SEQ ID NO:23 (positions 299 to
351 of SEQ ID NO: 1) and SEQ ID NO:28.
[0094] A further embodiment of the invention is the use of the full
length normal Bcr protein. The normal Bcr protein has 1271 amino
acids and the sequence is presented in Campbell and Arlinghaus
(1991), incorporated by reference herein.
[0095] 2. Binding Site Peptides
[0096] Binding site peptides that comprise the sequence of an
important binding site on Bcr--Abl for an adaptor molecule may also
be used in the present invention. The binding site peptides are
generally characterized as binding to an adaptor molecule, such as
Grb2, Shc, Crkl, Ras Gap or an N-terminal coiled-coil region of
Bcr.
[0097] Preferred binding site peptides are: peptides that bind to
an Abl SH3 binding protein-rich region of Shc; peptides that bind
to a proline-rich ABl binding site on Crkl; peptides that bind to
an SH2 domain of p120 Ras Gap; and peptides or proteins that bind
to an N-terminal coiled-coil region of Bcr. The peptides or
proteins that bind an N-terminal coiled-coil region of Bcr include
peptides of any one of SEQ ID NO:2 through SEQ ID NO:7.
[0098] 3. Biologically Functional Equivalents
[0099] Modifications and changes may be made in the sequence of the
peptides of the present invention, except for the tyrosine residue
that is the site of phosphorylation and other key residues, and
still obtain a peptide having like or otherwise desirable
characteristics.
[0100] One of skill in this art would realize, in light of the
present disclosure, that the tyrosine site of phosphorylation of
the peptides is not amenable to replacement; nor are other key
residues, such as the asparagine at position 179 of SEQ ID NO: 1,
or the Serine 354 equivalent in SEQ ID NO:22. However, functional
equivalents of other amino acids are acceptable in the present
invention.
[0101] In a functional equivalent, certain amino acids may be
substituted for other amino acids in a protein structure without
appreciable loss of interactive binding capacity with structures
such as, for example, binding sites on substrate molecules. Since
it is the interactive capacity and nature of a protein that defines
that protein's biological functional activity, certain amino acid
sequence substitutions can be made in a protein sequence (or, of
course, its underlying DNA coding sequence) and nevertheless obtain
a protein with like (agonistic) properties.
[0102] It is thus contemplated by the inventors that various
changes may be made in the sequence of the tyrosine-containing
proteins or peptides (or underlying DNA) without appreciable loss
of their biological utility or activity. Equally, the same
considerations may be employed to create a protein or peptide with
countervailing (e.g., antagonistic) properties.
[0103] In terms of functional equivalents, it is also well
understood by the skilled artisan that, inherent in the definition
of a biologically functional equivalent protein or peptide, is the
concept that there is a limit to the number of changes that may be
made within a defined portion of the molecule and still result in a
molecule with an acceptable level of equivalent biological
activity. Biologically functional equivalent peptides are thus
defined herein as those peptides in which certain, not most or all,
of the amino acids may be substituted. In particular, where shorter
peptides are concerned, it is contemplated that less changes will
be tolerated. Of course, a plurality of distinct proteins/peptides
with different substitutions may easily be made and used in
accordance with the invention.
[0104] It is also well understood that where certain residues are
shown to be particularly important to the biological or structural
properties of a protein or peptide, such as the tyrosines of the
present invention, such residues may not generally be exchanged.
This is clearly the case in the present invention, as detailed
above.
[0105] Amino acid substitutions are generally based on the relative
similarity of the amino acid side-chain substituents, for example,
their hydrophobicity, hydrophilicity, charge, size, and the like.
An analysis of the size, shape and type of the amino acid
side-chain substituents reveals that arginine, lysine and histidine
are all positively charged residues; that alanine, glycine and
serine are all a similar size; and that phenylalanine, tryptophan
and tyrosine all have a generally similar shape. Therefore, based
upon these considerations, arginine, lysine and histidine; alanine,
glycine and serine; and phenylalanine, tryptophan and tyrosine; are
defined herein as biologically functional equivalents.
[0106] To effect more quantitative changes, the hydropathic index
of amino acids may be considered. Each amino acid has been assigned
a hydropathic index on the basis of their hydrophobicity and charge
characteristics, these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0107] The importance of the hydropathic amino acid index in
conferring interactive biological function on a protein is
generally understood in the art (Kyte & Doolittle, 1982,
incorporated herein by reference). It is known that certain amino
acids may be substituted for other amino acids having a similar
hydropathic index or score and still retain a similar biological
activity. In making changes based upon the hydropathic index, the
substitution of amino acids whose hydropathic indices are within
.+-.2 is preferred, those which are within .+-.1 are particularly
preferred, and those within .+-.0.5 are even more particularly
preferred.
[0108] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by
reference, states that the greatest local average hydrophilicity of
a protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with its immunogenicity and antigenicity, i.e.
with a biological property of the protein. It is understood that an
amino acid can be substituted for another having a similar
hydrophilicity value and still obtain a biologically equivalent,
and in particular, an inmmunologically equivalent protein.
[0109] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0110] In making changes based upon similar hydrophilicity values,
the substitution of amino acids whose hydrophilicity values are
within .+-.2 is preferred, those which are within .+-.1 are
particularly preferred, and those within .+-.0.5 are even more
particularly preferred.
[0111] While discussion has focused on functionally equivalent
polypeptides arising from amino acid changes, it will be
appreciated that these changes may be effected by alteration of the
encoding DNA; taking into consideration also that the genetic code
is degenerate and that two or more codons may code for the same
amino acid. A table of amino acids and their codons is presented
herein (Table 1) for use in such embodiments, as well as for other
uses, such as in the design of probes and primers and the like.
1TABLE 1 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine
Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA
GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K
AAA AAG Leucine Leu I UUA UUG CUA CUC CUG CUU Methionine Met M AUG
Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine
Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S
AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val
V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
[0112] In addition to the peptidyl compounds described herein, the
inventors also contemplate that other sterically similar compounds
may be formulated to mimic the key portions of the peptide
structure. Such compounds, which may be termed peptidomimetics, may
be used in the same manner as the peptides of the invention and
hence are also functional equivalents. The generation of a
structural functional equivalent may be achieved by the techniques
of modelling and chemical design known to those of skill in the
art. The art of modelling is now well known, and by such methods a
chemical that mimics a given peptide's function can be designed and
then synthesized. It will be understood that all such sterically
similar constructs fall within the scope of the present
invention.
[0113] 4. Peptide Synthesis
[0114] Peptides less than about 45 amino acids are generally
synthesized chemically. The synthesis of peptides is readily
achieved using conventional peptide synthetic techniques such as
the solid phase method (e.g., through the use of commercially
available peptide synthesizer such as an Applied Biosystems Model
430A Peptide Synthesizer, Foster City, Calif., or Vega Synthesizer,
DuPont Inc., Wilmington, Del.).
[0115] The solid phase technique uses the method of Merrifield
(Merrifield, 1963, incorporated by reference herein) using an
automatic peptide synthesizer with standard t-butoxycarbonyl
(t-Boc) chemistry. The amino acid composition of a synthesized
peptides is determined by amino acid analysis, e.g., with a Waters
Pico-tag analyzer (Medford, Mass.), to confirm that they correspond
to the expected compositions. The purity of the peptides is
determined by sequence analysis or HPLC.
[0116] It is generally desirable for the amino terminal end of
synthetic peptides to be protected from degradation by having an
N-terminal acetyl group. This can be accomplished during synthesis
of the peptide by using acetic anhydride to acetylate the
N-terminal end. Similarly, protection for the carboxyl end may be
achieved by forming an amide bond, as described in Example 2. Such
protecting groups will generally reduce the degradation of the
synthetic peptides by proteolytic enzymes once they are introduced
into a cell.
[0117] The phosphorylated form of peptides is obtained in vitro by
using standard methods for synthesis of peptides. The amino acid to
be phosphorylated is introduced without side-chain protection. The
terminal residue should be Boc protected by either direct
incorporation of a Boc protected amino acid or acylation of the
free amino group with Boc.sub.2O. The resin is washed and placed
into the reaction vessel. The peptidyl resin and reaction vessel
are dried overnight under high vacuum at 40.degree. C., sealed with
a rubber septum and flushed with dry argon.
[0118] An ampoule of DNA grade tetrazole is dissolved in dry DMF,
DMA or CH.sub.3CN and 50 eq. and transferred to the reaction vessel
using a dried argon flushed gas tight syringe. 10 eq. of
di-t-butyl-N,N,-disoprop- ylphosphoramidite are added to the
reaction vessel again using a dried, argon flushed gas tight
syringe, and gently agitated for 1 hour.
[0119] The contents of reaction vessel are transferred to a
sintered glass funnel and the resin washed with a generous volume
of solvent. 20 eq. of t-butyl peroxide in DMF are added to the
resin and left to stand for 30 mins. The resin is washed and dried
in a normal manner. Standard methods are used for cleavage.
[0120] Peptides synthesized in these manners may then be aliquoted
in predetermined amounts and stored in conventional manners, such
as in aqueous solutions or, even more preferably, in a powder or
lyophilized state pending use.
[0121] In general, due to the relative stability of peptides, they
may be readily stored in sterile aqueous solutions for fairly long
periods of time if desired, e.g., up to six months or more, in
virtually any aqueous solution without appreciable degradation or
loss of immunogenic activity.
[0122] However, where extended aqueous storage is contemplated, it
will generally be desirable to include agents including buffers
such as Tris--HCl or phosphate buffers to maintain a pH of 7.0 to
7.5. Moreover, it may be desirable to include agents which will
inhibit microbial growth, such as sodium azide or merthiolate. For
extended storage in an aqueous state, it will be desirable to store
the solutions at 4.degree. C., or more preferably, frozen.
[0123] Of course, where the peptide(s) are stored in a lyophilized
or powdered state, they may be stored virtually indefinitely, e.g.,
in metered aliquots that may be rehydrated with a predetermined
amount of water (preferably distilled) or buffer prior to use.
[0124] Peptides longer than about 50 or so amino acids are
preferably provided by a plasmid or viral expression system, as
described herein.
[0125] 5. Gene Therapy
[0126] Vectors that encode and express one or more
tyrosine-containing peptides, or even normal Bcr, form further
aspects of the present invention. Recombinant expression can be
used to provide any tyrosine-containing peptide, as desired, but it
will generally be preferred for providing peptides of intermediate
or longer length.
[0127] Exemplary vectors are those expressing the Bcr-159 fragment
(SEQ ID NO:5) or normal Bcr, as may be used to inhibit the Bcr--Abl
kinase to neutralize the malignant form of Bcr--Abl directly.
Further vectors are those expressing a polypeptide of SEQ ID
NO:28.
[0128] Suitable Bcr--Abl DNA sequences for use in the present
invention will be known to those of skill in the art. Further,
given the standard knowledge in the art and the information
presented herein, e.g., in Table 1, the synthesis or generation,
e.g., by cloning or PCR, of any given DNA fragment that encodes a
desired peptide sequence will be straightforward.
[0129] A first approach for gene therapy in the context of the
present invention is to transfect DNA containing the gene of
interest into cells, e.g., by permeabilizing the cell membrane
either chemically or physically. This approach is generally limited
to cells that can be temporarily removed from the body and can
tolerate the cytotoxicity of the treatment (i.e. lymphocytes).
However, it is very suitable for use with the present
invention.
[0130] Liposomes or protein conjugates formed with certain lipids
and amphophilic peptides can be used for transfection (Stewart er
al., 1992; Torchilin et al., 1992; Zhu et al., 1993), as described
herein. The use of naked DNA and plasmids to directly transfer
genetic material into a cell is also possible (Wolfe et al.,
1990).
[0131] A second approach capitalizes on the natural ability of
viruses to enter cells, bringing their own genetic material with
them. Retroviruses have promise as gene delivery vectors due to
their ability to integrate their genes into the host genome,
transferring a large amount of foreign genetic material, infecting
a broad spectrum of species and cell types and of being packaged in
special cell-lines (Miller, 1992).
[0132] A third method uses other viruses, such as adenovirus;
herpes simplex viruses (HSV), U.S. Pat. No. 5,288,641, incorporated
herein by reference; cytomegalovirus (CMV); and adeno-associated
virus (AAV), such as those described by Kotin (1994) and in U.S.
Pat. No. 5,139,941, incorporated herein by reference; which are
engineered to serve as vectors for gene transfer. Many viruses have
been demonstrated to successfully effect gene expression. The term
"herpes virus" is used in this context to particularly refer to
herpes simplex virus (HSV), Epstein-Barr Virus (EBV),
cytomegalovirus (CMV) and pseudorabies virus (PRV).
[0133] In using a retrovirus approach, the desired BCR coding
sequences are inserted into a retroviral vector; this vector is
transfected into a packaging cell line that generates an
amphotropic host range defective virus. The virus is used to infect
stem cells from the bone marrow of autotransplant patients.
[0134] Gene delivery using second generation retroviral vectors has
been reported. Kasahara er al. (1994) prepared an engineered
variant of the Moloney murine leukemia virus, that normally infects
only mouse cells, and modified an envelope protein so that the
virus specifically bound to, and infected, human cells bearing the
erythropoietin (EPO) receptor. This was achieved by inserting a
portion of the EPO sequence into an envelope protein to create a
chimeric protein with a new binding specificity. Engineering viral
vectors targeted to tumor cell markers is now straightforward in
light of the Kasahara et al. (1994) work.
[0135] Of course, in using any viral delivery systems, one will
desire to purify the virion sufficiently to render it essentially
free of undesirable contaminants, such as defective interfering
viral particles or endotoxins and other pyrogens such that it will
not cause any untoward reactions in the cell, animal or individual
receiving the vector construct. A preferred means of purifying the
vector involves the use of buoyant density gradients, such as
cesium chloride gradient centrifugation.
[0136] (a) Adenovirus
[0137] Human adenoviruses are a further means for introducing
nucleic acid expression vectors into tissue. Adenoviruses are
double-stranded DNA tumor viruses with genome sizes of
approximately 36 kb. As a model system for eukaryotic gene
expression, adenoviruses have been widely studied and well
characterized, which makes them an attractive system for
development of adenovirus as a gene transfer system. This group of
viruses is easy to grow and manipulate, and they exhibit a broad
host range in vitro and in vivo. In lytically infected cells,
adenoviruses are capable of shutting off host protein synthesis,
directing cellular machineries to synthesize large quantities of
viral proteins, and producing copious amounts of virus.
[0138] In general, adenovirus gene transfer systems are based upon
recombinant, engineered adenovirus which is rendered
replication-incompetent by deletion of a portion of its genome,
such as El, and yet still retains its competency for infection.
Relatively large foreign proteins can be expressed when additional
deletions are made in the adenovirus genome. For example,
adenoviruses deleted in both El and E3 regions are capable of
carrying up to 10 kb of foreign DNA and can be grown to high
titers. Persistent expression of transgenes follows adenoviral
infection.
[0139] Particular advantages of an adenovirus system for delivering
foreign genes and their protein products to a cell include (i) the
ability to substitute relatively large pieces of viral DNA with
foreign DNA; (ii) the structural stability of recombinant
adenoviruses; (iii) the safety of adenoviral administration to
humans; (iv) lack of any known association of adenoviral infection
with cancer or malignancies; (v) the ability to obtain high titers
of the recombinant virus; and (vi) the high infectivity of
adenovirus.
[0140] Further advantages of adenovirus vectors over retroviruses
include the higher levels of gene expression. Additionally,
adenovirus replication is independent of host gene replication,
unlike retroviral sequences. Because adenovirus transforming genes
in the El region can be readily deleted and still provide efficient
expression vectors, oncogenic risk from adenovirus vectors is
thought to be negligible.
[0141] Human subjects testing positive for the Philadelphia
chromosome and for whom the medical indication for
adenovirus-mediated gene transfer has been established are tested
for the presence of antibodies directed against adenovirus. If
antibodies are present and the patient has a history of allergy to
either pharmacological or naturally occurring substances,
application of a test dose of on the order of 10.sup.3 to 10.sup.6
recombinant adenovirus under close clinical observation is
indicated.
[0142] Recombinant adenovirus providing BCR peptides or fusion
peptides of the present invention is prepared and purified by any
method that is acceptable to the Food and Drug Administration for
administration to human subjects, including, but not limited to
cesium chloride density gradient centrifugation, and subsequently
tested for efficacy and purity. Virus is administered to patients
by means of administration to bone marrow in any pharmacologically
acceptable solution, either as a bolus or as an infusion over a
period of time. Generally speaking, it is believed that the
effective number of functional virus particles to be administered
would range from 5.times.10.sup.10 to 5.times.10.sup.12.
[0143] Patients would remain hospitalized for at least 48 hr to
monitor acute and delayed adverse reactions. Bone marrow levels of
Philadelphia chromosome-positive cells may be monitored.
Adjustments to the treatment may include adenovirus constructs that
use different promoters or a change in the number of pfu
administered.
[0144] 6. Pharmaceutical Formulations
[0145] (a) Liposomes
[0146] The peptides of the present invention may be associated with
liposomes. These liposome preparations may be used both in vivo and
in ex vivo protocols, e.g., in bone marrow purging.
[0147] Liposomes are formed from phospholipids that are dispersed
in an aqueous medium and spontaneously form multilamellar
concentric bilayer vesicles (also termed multilamellar vesicles
(MLVs). MLVs generally have diameters of from 25 nm to 4 .mu.m.
Sonication of MLVs results in the formation of small unilamellar
vesicles (SUVs) with diameters in the range of 200 to 500 .ANG.,
containing an aqueous solution in the core.
[0148] Liposomes bear many resemblances to cellular membranes and
are contemplated for use in connection with the present invention
as carriers for the BCR peptides. They are widely suitable as both
water- and lipid-soluble substances and can be entrapped, i.e., in
the aqueous spaces and within the bilayer itself, respectively. It
is possible that drug-bearing liposomes may even be employed for
site-specific delivery of active agents by selectively modifying
the liposomal formulation.
[0149] The formation and use of liposomes is generally known to
those of skill in the art. Phospholipids can form a variety of
structures other than liposomes when dispersed in water, depending
on the molar ratio of lipid to water. At low ratios the liposome is
the preferred structure. The physical characteristics of liposomes
depend on pH, ionic strength and the presence of divalent cations.
Liposomes can show low permeability to ionic and polar substances,
but at elevated temperatures undergo a phase transition which
markedly alters their permeability. The phase transition involves a
change from a closely packed, ordered structure, known as the gel
state, to a loosely packed, less-ordered structure, known as the
fluid state. This occurs at a characteristic phase-transition
temperature and results in an increase in permeability to ions,
sugars and drugs.
[0150] In addition to temperature, exposure to proteins can alter
the permeability of liposomes. Certain soluble proteins such as
cytochrome c bind, deform and penetrate the bilayer, thereby
causing changes in permeability. Cholesterol inhibits this
penetration of proteins, apparently by packing the phospholipids
more tightly.
[0151] The ability to trap solutes varies between different types
of liposomes. For example, MLVs are moderately efficient at
trapping solutes, but SUVs are extremely inefficient. SUVs offer
the advantage of homogeneity and reproducibility in size
distribution, however, and a compromise between size and trapping
efficiency is offered by large unilamellar vesicles (LUVs). These
are prepared by ether evaporation and are three to four times more
efficient at solute entrapment than MLVs.
[0152] In addition to liposome characteristics, an important
determinant in entrapping compounds is the physicochemical property
of the compound itself. Polar compounds are trapped in the aqueous
spaces and nonpolar compounds bind to the lipid bilayer of the
vesicle. Polar compounds are released through permeation or when
the bilayer is broken, but nonpolar compounds remain affiliated
with the bilayer unless it is disrupted by temperature or exposure
to lipoproteins. Both types show maximum efflux rates at the phase
transition temperature.
[0153] Liposomes interact with cells via four different mechanisms:
endocytosis by phagocytic cells of the reticuloendothelial system
such as macrophages and neutrophils; adsorption to the cell
surface, either by nonspecific weak hydrophobic or electrostatic
forces, or by specific interactions with cell-surface components;
fusion with the plasma cell membrane by insertion of the lipid
bilayer of the liposome into the plasma membrane, with simultaneous
release of liposomal contents into the cytoplasm; and by transfer
of liposomal lipids to cellular or subcellular membranes, or vice
versa, without any association of the liposome contents. It often
is difficult to determine which mechanism is operative and more
than one may operate at the same time.
[0154] The fate and disposition of intravenously injected liposomes
depend on their physical properties, such as size, fluidity and
surface charge. They may persist in tissues for hours or days,
depending on their composition, and half lives in the blood range
from minutes to several hours. Larger liposomes, such as MLVs and
LUVs, are taken up rapidly by phagocytic cells of the
reticuloendothelial system, but physiology of the circulatory
system restrains the exit of such large species at most sites. They
can exit only in places where large openings or pores exist in the
capillary endothelium, such as the sinusoids of the liver or
spleen. Thus, these organs are the predominate site of uptake. On
the other hand, SUVs show a broader tissue distribution but still
are sequestered highly in the liver and spleen. In general, this in
vivo behavior limits the potential targeting of liposomes to only
those organs and tissues accessible to their large size. These
include the blood, liver, spleen, bone marrow and lymphoid
organs.
[0155] Targeting is generally not a limitation in terms of the
present invention. However, should specific targeting be desired,
methods are available for this to be accomplished. Antibodies may
be used to bind to the liposome surface and to direct the antibody
and its drug contents to specific antigenic receptors located on a
particular cell-type surface. Carbohydrate determinants
(glycoprotein or glycolipid cell-surface components that play a
role in cell-cell recognition, interaction and adhesion) may also
be used as recognition sites as they have potential in directing
liposomes to particular cell types.
[0156] Mostly, it is contemplated that intravenous injection of
liposomal preparations be used, but other routes of administration
are also conceivable. Of course, with ex vivo protocols,
administration is straightforward.
[0157] (b) Injectables
[0158] Compositions of the present invention comprise an effective
amount of the tyrosine-containing peptide or peptides, liposomes,
or viral vectors, dissolved or dispersed in a pharmaceutically
acceptable carrier or aqueous medium. The phrases "pharmaceutically
or pharmacologically acceptable" refer to molecular entities and
compositions that do not produce an adverse, allergic or other
untoward reaction when administered to an animal, or a human, as
appropriate.
[0159] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents and the like. The use of such media and agents for
pharmaceutical active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active ingredient, its use in the therapeutic compositions is
contemplated. Supplementary active ingredients can also be
incorporated into the compositions.
[0160] The active compounds will generally be formulated for
parenteral administration, e.g., formulated for injection via the
intravenous, intramuscular, sub-cutaneous, intralesional, or even
intraperitoneal routes. The preparation of an aqueous composition
that contains a tyrosine-containing peptide or expression vector,
as an active component or ingredient will be known to those of
skill in the art in light of the present disclosure. Typically,
such compositions can be prepared as injectables, either as liquid
solutions or suspensions; solid forms suitable for using to prepare
solutions or suspensions upon the addition of a liquid prior to
injection can also be prepared; and the preparations can also be
emulsified.
[0161] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions; formulations including
sesame oil, peanut oil or aqueous propylene glycol; and sterile
powders for the extemporaneous preparation of sterile injectable
solutions or dispersions. In all cases the form must be sterile and
must be fluid to the extent that easy syringability exists. It must
be stable under the conditions of manufacture and storage and must
be preserved against the contaminating action of microorganisms,
such as bacteria and fungi.
[0162] Solutions of the active compounds as free base or
pharmacologically acceptable salts can be prepared in water
suitably mixed with a surfactant, such as hydroxypropylcellulose.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms.
[0163] A tyrosine-based peptide can be formulated into a
composition in a neutral or salt form. Pharmaceutically acceptable
salts, include the acid addition salts (formed with the free amino
groups of the protein) and which are formed with inorganic acids
such as, for example, hydrochloric or phosphoric acids, or such
organic acids as acetic, oxalic, tartaric, mandelic, and the like.
Salts formed with the free carboxyl groups can also be derived from
inorganic bases such as, for example, sodium, potassium, ammonium,
calcium, or ferric hydroxides, and such organic bases as
isopropylamine, trimethylamine, histidine, procaine and the
like.
[0164] The carrier can also be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol, and liquid polyethylene glycol, and the
like), suitable mixtures thereof, and vegetable oils. The proper
fluidity can be maintained, for example, by the use of a coating,
such as lecithin, by the maintenance of the required particle size
in the case of dispersion and by the use of surfactants.
[0165] The prevention of the action of microorganisms can be
brought about by various antibacterial ad antifungal agents, for
example, parabens, chlorobutanol, phenol, sorbic acid, thirnerosal,
and the like. In many cases, it will be preferable to include
isotonic agents, for example, sugars or sodium chloride. Prolonged
absorption of the injectable compositions can be brought about by
the use in the compositions of agents delaying absorption, for
example, aluminum monostearate and gelatin.
[0166] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus ny additional desired
ingredient from a previously sterile-filtered solution thereof.
[0167] The preparation of more, or highly, concentrated solutions
for intramuscular injection is also contemplated. In this regard,
the use of DMSO as solvent is preferred as this will result in
extremely rapid penetration, delivering high concentrations of the
active peptides or agents to a small area.
[0168] Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms, such as the type of injectable
solutions described above, but drug release capsules and the like
can also be employed.
[0169] For parenteral administration in an aqueous solution, for
example, the solution should be suitably buffered if necessary and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. In this connection, sterile aqueous
media which can be employed will be known to those of skill in the
art in light of the present disclosure. For example, one dosage
could be dissolved in 1 mL of isotonic NaCl solution and either
added to lOOOmL of hypodermoclysis fluid or injected at the
proposed site of infusion, (see for example, "Remington's
Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and
1570-1580). Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject.
[0170] In addition to the compounds formulated for parenteral
administration, such as intravenous or intramuscular injection,
other pharmaceutically acceptable forms include, e.g., tablets or
other solids for oral administration; time release capsules; and
any other form currently used, even including cremes, lotions,
mouthwashes, inhalants, suppositories and the like.
[0171] 7. Bone Marrow Purging
[0172] The present invention provides a most practical system for
purging human bone marrow samples of leukemic patients. The general
protocol for standard human bone marrow transplantion has already
been established in the medical arts and is thus an available
technique to those of ordinary skill in the art.
[0173] In the typical clinical management of a patient with
leukemia, the patient is given chemotherapy (for example,
Daunomycin, Ara-C, GMCSF). The chemotherapy treatment will
typically generate cytogenetic remissions in 50% of the treated
patients. Cytogenetic remission is defined as a reduction in the
ratio of leukemia cells (Philadelphia chromosome-positive) to
normal cells (Philadelphia chromosome-negative) from about 10,000/1
to 1/1.
[0174] The bone marrow of these patients is then subjected to
separations based on the immunophenotype of the patient. The
inventors will define a DR negative lineage CD33 negative, DC34
positive phenotype (i.e., through fractionation of a DR negative
CD34 cell line). This separation, based on irrnunophenotype, will,
in most cases, reduce the ratio of leukemic to normal cells by
another 2 logs (100 .times.).
[0175] By then employing the described BCR-peptide treatment
methods to bone marrow samples of the patient described herein, the
ratio of leukemia cells (Philadelphia chromosome-positive) to
normal cells may advantageously be expected to be reduced by still
another 2 or even 3 logs. Generally, the bone marrow sample is
exposed to about 10 .mu.M of the tyrosine-containing BCR peptide or
peptides.
[0176] The treated bone marrow is then transplanted back into the
patient. This method therefore provides a highly selective method
of treating leukemia in the patient without damaging or inhibiting
normal cells of the patient.
[0177] While the present technique may not accommodate the entire
population of patients afflicted with CML (because of the small
percentage of CML patients eligible for allogenic bone marrow
transplantation due to advanced age (i.e., a chronological age of
greater than 50 at most medical centers) or availability of donors
(25% of 30% of patients with CML have donors)), the present
invention nonetheless provides a marked improvement in the overall
effectiveness of bone marrow transplant procedures for treating
leukemic patients compared to those with non-pre-treated bone
marrow samples currently employed.
[0178] 8. Peptides as Standards for Radioiodination
[0179] The Bcr/Abl peptides of the present invention having a
tyrosine residue are also provided as standards for
radioiodination. The tyrosine-containing peptides are at least
about 3-4 amino acids long, preferably 10-12 amino acids long, and
may be 14-16 or 20-25 amino acids long or even longer. These
peptides are useful as controls for testing the efficiency of
radioiodinating a test peptide or protein by comparing the specific
radioactivities of the test radioiodinated peptide or protein to a
radioiodinated peptide of the present invention.
[0180] Radioiodination of proteins is discussed in Bailey 1984,
incorporated by reference herein. Radioiodinated molecules are of
major importance in studies of intermediary metabolism, in
determinations of agonist and antagonist binding to receptors, and
in quantitative measurements of physiologically active molecules in
tissues and biological fluids, for example. In those studies, it is
necessary to measure very low concentrations of the particular
substance, and that requires a radioactively labeled tracer
molecule of high specific radioactivity. Such tracers, particularly
in the case of peptides and proteins, are conveniently produced by
radioiodination.
[0181] Two .tau.-emitting radioisotopes of iodine are widely
available, .sup.125I and .sup.131I. As .tau.-emitters they can be
counted directly in a .tau. counter without the need for sample
preparation, which is in direct contrast to .beta.-emitting
radionuclides, such as .sup.3H and .sup.14C. The counting
efficiency for .sup.125I is approximately twice that for .sup.131I.
Thus, in most circumstances, .sup.125I is the radionuclide of
choice for radioiodination.
[0182] Several different methods of radioiodination of proteins
have been developed (Bolton 1977; incorporated herein by
reference). They differ primarily in the nature of the oxidizing
agent for converting .sup.125I.sup.- into the reactive species
.sup.125I.sub.2 or .sup.125I.sup.+. Those reactive species
substitute into tyrosine residues of the protein, but substitution
into other residues, such as histidine, cysteine, and tryptophan,
can occur.
[0183] The chloramine-T method, developed by Hunter and Greenwood
(1962; incorporated herein by reference), is a commonly used
technique for protein or peptide radioiodination. It is a
straightforward method in which the radioactive iodide is oxidized
by chloramine-T in aqueous solution. The oxidation is stopped after
a brief period of time by addition of excess reductant. Some
proteins or peptides are denatured under the relatively strong
oxidizing conditions, and so other methods of radioiodination that
employ more gentle conditions have been devised, e.g., the
lactoperoxidase method (Marchalonis, 1969).
[0184] Matenals:
[0185] 1. Na.sup.125I: 1 mCi, concentration 100 mCi/mL.
[0186] 2. Buffer A: 0.5M sodium phosphate buffer, pH 7.4.
[0187] 3. Buffer B: 0.05M sodium phosphate buffer, pH 7.4.
[0188] 4. Buffer C: 0.01M sodium phosphate buffer containing 1M
sodium chloride, 01% bovine serum albumin, and 1% potassium iodide,
final pH 7.4.
[0189] 5. Chloramine-T solution: A 2mg/mL solution in buffer B is
made just prior to use.
[0190] 6. Reductant: A 1 mg/mL solution of sodium metabisulfite in
buffer C is made just prior to use.
[0191] 7. Protein or peptide to be iodinated: A 0.5-2.5 mg/mL
solution is made in buffer B.
[0192] Method:
[0193] 1. Into a small plastic test tube (1.times.5.5 cm) are added
successively the protein or peptide to be iodinated (10 .mu.g),
radioactive iodide (5 .mu.L), buffer A (50 .mu.L), and chloramine-T
solution (25 .mu.L).
[0194] 2. After mixing by gentle shaking, the solution is allowed
to stand for 30 s to allow radioiodination to take place.
[0195] 3. Sodium metabisulfite solution (500 .mu.L) is added to
stop the radioiodination and the resultant solution is mixed. It is
then ready for purification.
[0196] Purification of Radioiodinated Protein or Peptide: For most
uses of radioiodinated proteins or peptides, it is desirable to
have the labeled species as pure as possible with the constraints,
however, that the purification is achieved as rapidly as possible.
For that purpose the most widely used of all separation techniques
is gel filtration. Various types of Sephadex resin can be employed,
e.g., G-50, G-75 and G-100 depending on the differences in sizes of
the molecules present in the mixture.
[0197] Typically the mixture is applied to a column (1.times.25 cm)
of Sephadex resin and is eluted with 0.05M sodium phosphate buffer
of pH 7.4 containing 0.15M sodium chloride and 0.1% bovine serum
albumin. Fractions (0.5-1.0 mL) are collected in plastic tubes and
aliquots (10 .mu.L) are counted. Using those results, an elution
profile is drawn.
[0198] Several parameters are used to assess the quality of the
labeled protein or peptide. The specific radioactivity of the
protein is the amount of radioactivity incorporated per unit mass
of protein or peptide. It can be calculated in terms of the total
radioactivity employed, the amount of the iodination mixture
transferred to the gel filtration column, and the amount of
radioactivity present in the labeled protein or peptide, in the
damaged components, and in the residual radioiodine.
[0199] However, in practice, the calculation does not usually take
into account damaged and undamaged protein. The specific activity
is thus calculated from the yield of the radioiodination procedure,
the amount of radioiodide and the amount of protein or peptide
used, assuming that there are not significant losses of those two
reactants. The yield of the reaction is simply the percentage
incorporation of the radionuclide into the protein.
[0200] The nature of the materials giving rise to elution peaks
from a chromatography column can be checked by employing a specific
antiserum to the protein or peptide being radioiodinated. Aliquots
(10 .mu.L) of different fractions making up the two peaks are
diluted so that each gives the same number of counts (e.g.,
5000-10,000 counts/min) per 100 .mu.L). Those samples are incubated
with an excess of the antiserum. Only samples containing
immunoreactive protein will react with the antiserum. The amount of
the radioactive protein associated with the antibody molecules can
then be measured by radioimmunoassay.
[0201] Having identified the peak or peaks containing the
radioiodinated protein or peptide, the yield of the radioiodination
can be calculated in terms of the ratio of the total counts
associated with the protein or peptide peak to the sum of the total
counts associated with the iodide peak.
[0202] It is important that the radioiodinated protein or peptide
should as far as possible have the same properties as the unlabeled
species. Thus the behavior of both molecules can be checked on
electrophoresis or ion-exchange chromatography. The ability of the
two species to bind to specific antibodies can be assessed by
radioimmunoassay.
[0203] To store the labelled protein or peptide, immediately after
purification, split the sample into small aliquots and then rapidly
freeze and store at -20.degree. C. Alternatively, the aliquots can
be freeze-dried. Each aliquot should be melted and used only once.
Radioiodinated proteins or peptides differ markedly in their
stability. Some can be stored for several weeks (though it must be
borne in mind that the half-life of .sup.125I is about 60 d),
whereas others can only be kept for several days. If necessary, the
labeled protein can be repurified by gel filtration or ion-exchange
chromatography prior to use.
[0204] The pH optimum for iodination of tyrosine residues of a
protein by the chloramine-T method is about pH 7.4. Lower yields of
iodinated protein are obtained at pH values below about 6.5 and
above about 8.5. Indeed, above pH 8.5, the iodination of histidine
residues appears to be favored.
[0205] The total volume of the chloramine-T reaction mix should be
as low. as practically possible to achieve a rapid and efficient
incorporation of the radioactive iodine into the protein or
peptide. Because of the small volumes of reactants that are
employed it is essential to ensure adequate mixing at the outset of
the reaction. Inadequate mixing is one of the conmnonest reasons
for a poor yield of radioiodinated protein by this procedure.
[0206] If the protein or peptide has been seriously damaged by the
use of 50 .mu.g of chloramine-T, it may be worthwhile repeating the
radioiodination using much less oxidant (10 .mu.g of less). The
minimum amount of chloramine-T that can be used will depend, among
other factors, on the nature and amount of protein to be
iodinated.
[0207] It is normal to carry out the chloramine-T method at room
temperature. However, if the protein is especially labile, it may
be beneficial to run the procedure at a low temperature.
[0208] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples that
follow represent techniques discovered by the inventors to function
well in the practice of the invention, and thus can be considered
to constitute preferred modes for its practice. However, those of
skill in the art should, in light of the present disclosure,
appreciate that many changes can be made in the specific
embodiments that are disclosed and still obtain a like or similar
result without departing from the spirit and scope of the
invention.
EXAMPLE I
[0209] Materials and Methods
[0210] Cell line K562: Source; American Type Culture Collection
(ATCC), Rockville, MD. Isolation; Established by Lozzio and Lozzio
(1975) from the pleural effusions of a female in blast crisis CML.
This cell line contains multiple copies of the Ph.sup.1 with
breakpoint on chromosome 22 within the Mbcr (b3/a2 translocation).
Cells are grown at 37.degree. C. and 5% CO.sub.2 in RPMI 1640
growth medium supplemented with 10% fetal calf serum (Gibco
Laboratories, Grand Island, N.Y.).
[0211] Cell lines, SUP-B13 and SUP-B15: Source: Cell lines were
obtained from Dr. Steve D. Smith, Department of Pediatrics,
University of Chicago. Isolation: Cell lines were obtained from the
first and second bone marrow relapse samples, respectively, of an
8-yr-old male admitted to Children's Hospital at Stanford,
California in 1983 (Naumovski et al., 1988).
[0212] Cell lines contain the Ph.sup.1 chromosome with ALL specific
breakpoint on chromosome 22 within the mbcr. However, these cell
lines differ in the expression of some cell surface antigens
rendering them related but unique.
[0213] Cells are grown at 37.degree. C. and 5% CO2 in RPMI 1640
growth medium supplemented with 20% fetal calf serum (Gibco
Laboratories, Grand Island, N.Y.). Initial culture conditions
require that these cells be grown in a six-well culture plate at
optimum cell density, 0.5.times.10.sup.6/ml, for 10-14 days. During
this period, the cells must be counted daily to insure against
overgrowth of the culture and the media must be replenished.
[0214] The cells are then diluted to appropriate volumes with fresh
culture media and the suspension aliquoted into the wells at
approximately 6 mIs of culture per well. After a sufficient number
of wells have been seeded and culture remains healthy, the stocks
are plated into T75 or T150 culture flasks for general growth.
[0215] However, these cells are extremely fragile and appear to
undergo a form of apoptosis or programmed cell death if the culture
becomes either too dense or too dilute from optimal cell
concentrations. This condition is immediately recognizable as the
culture flask appears to be bacterially contaminated with small
particles of cellular debris.
[0216] This condition can be remedied by gentle centrifugation of
the cell culture through 2 mls of fetal calf serum. The resulting
cell pellet, free of cellular debris, is resuspended at
appropriated cell concentrations in fresh culture media. Again, a
careful monitoring on the status of this cell culture is required
to insure proper cell viability.
[0217] Cell line SMS-SB: Source: R. Peter Gale, Los Angeles, Calif.
Cells were isolated from the peripheral blood of a 17-yr-old female
suffering from a relapse of lymphoblastic lymphoma. The cells
synthesize but do not secrete u-chains and except for the lack of
u-chain secretion, the phenotype of SMS-SB cells is the same as the
major population of marrow pre-B cells (see Smith et al., 1981).
Cells are cultured at 37.degree. C. in 5% CO.sub.2 in RPMI 1640
media supplemented with 10% fetal calf serum (Gibco Laboratories,
Grand Island, N.Y.).
[0218] Cell line HL60: Source: American Type Culture Collection
(ATCC), Rockville, Md. Isolation: Peripheral blood leukocytes were
obtained from an adult female with acute promyelocytic leukemia.
Most of the cells stained by the Wright-Giemsa procedure were
myeloblasts and promyelocytes with azurophilic granules, but more
mature myeloid cells were also seen (Collins et al., 1977). Cells
are grown at 37.degree. C. and 5% CO.sub.2 in RPMI 1640 growth
medium supplemented with 10% fetal calf serum (Gibco Laboratories,
Grand Island, N.Y.).
[0219] Cell line M3.16: Source: The cells were obtained from Dr.
Pierre Laneuville at Hospital Royal Victoria Hospital in Montreal,
Canada. Isolation: The IL3/GM-CSF-dependent cell line, designated
M-07E cells was derived from an early passage of the primary
culture from a patient with acute megakaryoblastic leukemia. M3.16
cell line was derived from M-07E cells that contain a retroviral
vector that expresses P210 BCR--ABL. M3.16 cells grow without added
IL3/GM-CSF in a DMEM/10%FCS (Sirard et al., 1994). Cells are grown
at 37.degree. C. and 5% CO.sub.2 in DMEM supplemented with 10%
fetal calf serum (Gibco Laboratories, Grand Island, N.Y.).
[0220] Cell line COS1: Source: ATCC (Rockville, Md.). Isolation:
COS1 is a fibroblast-like cell line established from simian kidney
cells (CV1) that were transformed by an origin-defective mutant of
SV40, which codes for wild-type T antigen. Cells were cultured in
37.degree. C. and 5% CO.sub.2 in DMEM supplemented with 10% fetal
calf serum (Gibco Laboratories, Grand Island, N.Y.).
[0221] Plasmid Psp65 BCR: This plasmid was obtained from Dr. John
Groffen (Childrens Hospital of Los Angeles, Calif.). It is used for
in vitro transcription (using SP6 polymerase) and translation.
[0222] Plasmid Psp65 c-ABL(1b) and Psp65/P21O BCR--ABL: These
plasmids contain full length c-ABL(1b) or P210 BCR--ABL cDNAs,
respectively. They were obtained from Dr. Eli Canaani (Weissman
Institute, Israel) and can be used for in vitro transcription
(using SP6 polymerase) and translation.
[0223] Plasmid pSG5BCR: The original human full length BCR cDNAs
were obtained from Dr. John Groffen (Children's Hospital of Los
Angeles, Calif.). The B3 clone that has the complete coding region
of BCR plus about 150 bp 5' untranslated region was cloned into the
EcoRI site of psp65 vector.
[0224] The original human full length p210 BCR--ABL cDNA was
obtained from Dr. Eli Canaani (The Weizmann Institute of Science,
Israel). The p210 BCR--ABL construct, having the complete coding
region plus about 10 bp 5' untranslated region, was positioned in
the EcoRI/HindIII sites of psp65 vector. In order to reduce the 5'
untranslated sequence of BCR for better expression, the EcoRI-XhoI
fragment from p210 BCR--ABL was used to replace the EcoRI-XhoI
fragment of the B3 clone.
[0225] The newly constructed human full length BCR cDNAs containing
about 10 bp 5' untranslated sequences were released from the psp65
vector by EcoRI digestion and subsequently inserted into the EcoRI
site of an eucaryotic expression vector pSG5 (Stratagene, La Jolla,
Calif.). The pSG5 vector contains the early SV40 promotor to
facilitate in vivo expression in cells also expressing the T
antigen.
[0226] Plasmid PSG5BCR--ABL: The human full length p210 BCR--ABL
was released from the psp65 vector by EcoRI complete digestion and
SacI partial digestion. The full length cDNA was then used to
replace the EcoRI-SacI fragment of BCR in the pSG5 vector. This
construct contains a large C-terminal BCR sequence after the stop
codon of p210 BCR--ABL. Almost all of this C-terrninal portion of
the BCR sequence was removed by releasing a BarnHI partial digested
fragment.
[0227] Plasmid PSG5ABL(1b): The human full length p145 c-Abl(1b)
cDNA was obtained from Dr. Eli Canaani (The Weizmann Institute of
Science, Israel). The c-Abl(1b) insert was released from psp65
vector by Stul (blunt end) partial digestion followed by EcoRI
complete digestion. The EcoRI-StuI fragment was then ligated with
PSG5 linearized by EcoRl and BalI (blunt end) digestion.
[0228] Plasmids PSG5BCRN553, PSGSBCRN413, PSG5BCRN221, PSG5BCRN159:
These deletion mutants were obtained by inserting a XbaI linker
containing stop codons at all three reading frames (CTAGTCTAGACTAG,
SEQ ID NO: 14, Stratagene, La Jolla, Calif.) into SacI, BglII, XhoI
or BamHI site within the BCR first exon coding sequences,
respectively (FIG. 7).
[0229] Mutations: p185 BCR--ABL and p160 BCR constructs with Tyr to
Phe mutations at residues 177 and 360 of BCR were supplied by Dr.
Groffen's group (Childrens Hospital of Los Angeles, Calif.). Other
mutations were first made in the wild type BCR by the method
described below. p210 BCR--ABL mutants were then obtained by
exchanging XhoI/SacI fragments of wild type p210 BCR--ABL with the
same fragment from the mutant p160 BCR.
[0230] The TRANSFORMER.TM. Site-Directed Mutagenesis Kit (CloneTech
Laboratories, Palo Alto, Calif.) was used for generating Tyr to Phe
mutants. The mutagenic primers used for mutating tyrosine residues
within BCR first exon were obtained from Operon Technologies
(Alameda, Calif.), and their sequences are listed below.
2 Tyrosine residue Mutagenic primer 276 5' CCCCTGGAGTTCCAGCCCTAC3'
SEQ ID NO:15 283 5' CAGAGCATCTTCGTCGGGGGC3' SEQ ID NO:16 316 5'
CGCAGGTCCTTCTCCCCCCGG3' SEQ ID NO:17 328 5' GGAGGCGGCTTTACCCCGGAC3'
SEQ ID NO:18
[0231] These mutagenic primers are used to mutate tyrosine to
phenylalanine. The selection primer (5' TGGTCGACTCGCGACTCTTCC 3'
(SEQ ID NO: 19)) for mutagenesis on pSG5BCR constructs was used to
eliminate a unique restriction site XbaI in the vector pSG5. All of
the mutations were verified by direct sequencing of the mutagenized
regions.
[0232] Immunokinase Assay: The imnmunokinase assays were performed
as described by Campbell et al. (1990) with modifications. The
cells are lysed by homogenizing the cell pellet in two different
lysis buffers at 0.degree. C. in a tight fitting Wheaton
homogenizer (either 0.1% Triton-X100, 100 mM NaCl, 5 mM EDTA, 10
mnM sodium phosphate, pH 7.2 or 1% Triton-X100, 100 mM NaCl, 0.5%
sodium deoxycholate, 0.1% SDS, 5 mM EDTA, 10 mM sodium phosphate pH
7.2). Both buffers were supplemented with 30 mM sodium
pyrophosphate, 100 KIU aprotinin, 1 mM benzamidine, 1 mM
phenylmethylsulfonyl fluoride and 0.2 mM sodium vanadate.
[0233] The cell lysate was then clarified by centrifugation at
100,000.times.G for 30-60 minutes at 4.degree. C. The clarified
supernatant was collected and divided equally among the samples for
immunoprecipitation.
[0234] Immunoprecipitation reactions were carried out utilizing
20-40 .mu.l of the respective anti-peptide rabbit sera or 5 .mu.l
of monoclonal antibody at 0.degree. C. for 1 hour. Blocked
irnmunoprecipitations refer to those immunoprecipitation reactions
performed with antisera that have been preincubated with excess
cognate peptide to specifically block the anti-peptide
antibodies.
[0235] The resulting antigen-antibody immunoprecipitates were
collected with 30 .mu.l of 50% protein A-Sepharose (Pharmacia,
Uppsala, Sweden), pelleted and washed with RIPA buffer (0.1% Triton
X-100, 0.05% SDS, 0.5% sodium deoxycholate, 100 mM NaCl in 10 mM
phosphate buffer, pH 7.2), wash buffer (0.1% Triton X-100, 100 mM
NaCl, in 10 mM phosphate buffer, pH 7.2) and finally with 50 mM
Tris buffer, pH 7.2.
[0236] The imnmunoprecipitate pellet was suspended in 50 .mu.l of
kinase assay buffer (100 mM NaCl, 0.1% Triton X-100, 10 mM
MnCl.sub.2 in 20 mM HEPES buffer pH 7.2) containing 0.02 mCi
[gamma-.sup.32P] adenosine triphosphate for 10 minutes at 0.degree.
C. The labeled pellets were washed once in RIPA buffer and then
denatured by boiling in mercaptoethanol/sodium dodecyl sulfate
(SDS) sample buffer (1% SDS, 10% 2-mercaptoethanol, 10% glycerol, 1
mM EDTA, in pH 8.0 Tris buffer).
[0237] The boiled supernatant was resolved by SDS polyacrylamide
gel electrophoresis (PAGE) on a 6.5% polyacrylamide gel. The dried
gel was exposed to X-ray film using enhancing screens.
[0238] Immunoblotting Assays: Cells were lysed in Laemmli sodium
dodecyl sulfate (SDS) sample buffer containing 10%
2-mercaptoethanol. The lysates were boiled for 3 minutes and then
clarified by centrifugation at 100,000.times.g for 1 hour at room
temperature. The supernatant fluid was collected and allocated.
[0239] The samples were resolved by SDS polyacrylamide gel
electrophoresis (PAGE). The gels were electroblotted onto Immobilon
P membranes (Millipore Corp., Bedford, Mass.) at 4.degree. C. in
transfer buffer (192 mM glycine, 25 mM Tris--HCl, pH 7.5, and 1%
methanol) for 4-5 hours at 1.2 amps.
[0240] Blots were blocked by washing in 1-3% bovine serum albumin
(BSA) in washing buffer (150 mM NaCl, 0.1% NONADET.TM. P40, 50 mM
Tris--HCl, pH 7.5 or 0.01M Tris, pH 7.5, 0.1 M NaCl, 0.1% TWEEN.TM.
20) or 10% nonfat milk in washing buffer (20 mM Tris--HCl base, pH
7.6, 137 mM NaCl, 3.8 mM HCl and 0.1% TWEEN.TM. 20) for 1-2 hours
at 37.degree. C. The filters were then reacted with antibodies of
appropriate dilution (1:20,000 for 8E9; 1:1,000 for anti-peptide
antibodies; 1:250 for anti-Grb2 antibody; 1:1,000-2,500 for
anti-phosphotyrosine antibodies) in blocking buffer 2 hours at room
temperature or overnight at 4.degree. C.
[0241] The filters were washed in washing buffer and scored with
I.sup.125-protein A (Amersham Co., Arlington Hts., Ill.) directly
for rabbit antibody or mixed with rabbit anti-mouse IgG for
monoclonal antibody (1 .mu.g/10 uCi of I.sup.125-protein A) for 1
hr at room temperature in blocking buffer. Filters were washed in
washing buffer, air dried and exposed to X-ray film.
[0242] An alternative method is to incubate the filters with
horseradish peroxidase coupled anti-rabbit or anti-mouse Ig and
then react with ECL reagents (Amersham Co., Arlington Hts., Ill.)
after washing with washing buffer. The signals are detected by
exposing the filters to hyperfilm (Amersham).
[0243] Tryptic Peptide Mapping of Phosphopeptides: .sup.32p labeled
proteins from in vitro kinase assays were resolved by
electrophoresis on a SDS-6.5% PAGE gel. After electrophoresis, the
gel was dried and autoradiographed with Kodak RP-1 X-ray film.
[0244] The .sup.32P-labeled proteins were excised from the dried
gel using the autoradiograph as a template. The blocking paper was
scraped from the dried gel bands that were cut into small pieces
and allowed to swell in a volume of elution buffer (0.05M
NH.sub.4CO.sub.3, pH 8.5, 0.1% SDS, 0.5% 2-mercaptoethanol)
corresponding to 2 ml buffer/I cm.sup.2 dried gel. The swollen gel
pieces were further crushed with a glass stir rod.
[0245] The homogenate solution was boiled for 5 min and shaken
overnight at 37.degree. C. in a rotating wheel mixer to elute the
labeled protein. The gel fragments were pelleted by centrifugation
at 10,000.times.G for 10 min and the supernatant fluid carefully
decanted and saved. A volume of fresh elution buffer at half the
initial volume was then added to the gel fragments and this
solution mixed at 37.degree. C. for 4 hours as before. The gel
fragments were pelleted again by centrifugation and the supernatant
fluid decanted and saved.
[0246] The elution fractions were pooled and the combined eluate
filtered through a 0.2.mu. pore size millipore syringe filter.
Bovine serum albumin (75 .mu.g) was added to the eluate and mixed
thoroughly. The BSA carrier and eluted .sup.32p labeled protein was
pelleted by making the solution 20% in trichloroacetic acid and
incubating on ice for 4 hr.
[0247] The precipitated protein was pelleted by centrifugation,
washed successively with ice-cold ethanol followed by an ice-cold
solution of ethanol: ether (1:1) and the washed pellet centrifuged
and air dried. The dried protein pellet was dissolved in 150 .mu.l
of chilled performic acid (30% H.sub.2O.sub.2 and 98% formic acid
[1:9]) previously incubated for 1 hr at room temperature and
incubated for 2 hr. at 0.degree. C. The performic acid oxidizing
solution was diluted with water and lyophilized on a speed vacuum
dryer.
[0248] The resulting oxidized protein was digested with 30 .mu.g of
L-(1-tosylamido-2-phenyl) ethyl choromethyl ketone-treated trypsin
(TPCK trypsin) in 0.5 ml of 0.05 M NH.sub.4HCO.sub.3 for 18 hr at
room temperature. After 28 hr, an additional 20 .mu.g of TPCK
trypsin was added to the solution and the digestion continued for
an additional 4 hrs.
[0249] The digested protein was diluted with water and lyophilized
repeatedly until the NH.sub.4HCO.sub.3 salt was removed. The
salt-free digest was dissolved in 15 .mu.l of pH 2.1
electrophoresis buffer (distilled water, formic acid and acetic
acid [90:2:8], pH 2.1) and applied as a spot to cellulose thin
layer plate (Kodak #13255, Rochester, N.Y.) and electrophoresed for
1 hr at 1000V on a Hunter systems electrophoretic unit (HTLE 7000,
CBS Scientific Co., Del Mar, Calif.).
[0250] Following electrophoresis, the plate was air dried and
chromatographed in a thing-layer chromatography tank using a
chromatography buffer consisting of N-butanol, acetic acid, water
and pyridine [75:15:60:50]. The chromatography was run until the
chromatography buffer had run the length of the plate or
approximately four hours.
[0251] Phosphoamino acid analysis of tryptic peptides was
accomplished by carefully removing the labeled tryptic peptide from
the chromatography plate by scraping the cellulose matrix using the
autoradiograph as a template. The labeled tryptic peptide was
eluted from the cellulose matrix with 20% acetonitrile and treated
with 6N HCl for 90 min at 110.degree. C.
[0252] The clarified supernatant fluid was fractionated on thin
layer plates (Chromogram without fluorescent indicator, Eastman
Kodak, Rochester, N.Y.) in the presence of standard phosphoserine,
phosphothreonine and phosphotyrosine. Radioactive phosphoamino
acids were detected by autoradiography and the position of the
standard phosphoamino acids detected by ninhydrin treatment.
[0253] V8 protease digestion: .sup.32p labeled protein bands were
cut out from a polyacrylamide gel and rehydrated with buffer A (0.
125M Tris--HCl, pH 6.8, 0.1% SDS, and 1 mM EDTA). The gel slice was
loaded into the wells of a 10.5% polyacrylamide gel and the wells
were covered with buffer A containing 20% glycerol and 1 .mu.g V8
protease. The gel was then run at 20 mA for 20 mins and stopped for
30 min. After that, electrophoresis continued.
EXAMPLE II
[0254] Bcr--Abl Peptides that Bind Adapter Proteins
[0255] The present inventors provide herein sets of adapter
protein-Bcr peptide pairs that demonstrate binding affinity for
each other. Therefore, these Bcr peptides, when provided in excess,
would bind their respective binding sites on the adapter protein
and prevent the adapter protein from interacting with endogenous
Bcr--Abl. This interaction prevents the adapter protein from
effecting its role in signal transduction, most particularly, in
the Ras activation pathway.
[0256] The peptides may be provided in a phosphorylated form or a
nonphosphorylated form. Phosphorylation is expected to occur within
the cell; the form of the peptide that binds to the adaptor protein
is the phosphorylated form.
[0257] The adapter protein-Bcr peptide pairs provided by the
present invention include the following:
[0258] Bcr peptide 164-181 (SEQ ID NO:8) and adapter protein
Grb2/mSosI: The Bcr binding site within Bcr--Abl has been
identified by the inventors. The following Bcr peptide sequence
binds the SH2 domain of Grb2:
[0259] GHGQPGADAEKPFpY.sup.177VNVE (residues 164-181) (SEQ ID
NO:8). The tyrosine residue at position 177 is phosphorylated by
the Abl tyrosine kinase within Bcr--Abl.
[0260] In using a Bcr peptide containing pY177 (SEQ ID NO:8), at
least a 4-mer fragment thereof should be used, such as Bcr 176-180
(SEQ ID NO:24). An exemplary 13-mer is that corresponding to
168-180 Bcr (SEQ ID NO:27).
[0261] SH3 domain of Abl, and adapter protein Shc: The SH3 domain
of Abl contains a sequence that binds a proline-rich sequence of
She.
[0262] Abl peptide, and adapter protein Crkl: Crkl has a structure
similar to Crk (the oncogene of V-Crk) (FIG.2) (Reichman et al.,
1992; Ten Hoeve et al., 1993). Crk is an SH2/SH3-containing adaptor
protein first discovered in an avian sarcoma virus (Reichman et
al., 1992).
[0263] The Crkl protein product is a 38-kDa protein that is
expressed in several cell types. This p38 is phosphorylated on
tyrosine by Abl and Bcr/Abl and forms complexes in vivo with both
Abl and Bcr/Abl. Crkl is tyrosine phosphorylated in cell lines
expressing Bcr--Abl and in uncultured blood cells from patients
that express the Bcr--Abl oncoprotein (Ten Hoeve et al., 1994). In
addition, Crkl is capable of binding to mSosl (Ten Hoeve et al.,
1993).
[0264] Crk is phosphorylated on Y.sup.221 by p145Abl. CRKL is
proposed to be a biologically significant substrate for Bcr/Abl.
One of the SH3 domains of CRKL binds to a proline-rich sequence
within the Abl domain of Bcr--Abl. Peptides that mimic the Abl
binding site on CRKL are therefore components of some embodimnents
of the present invention.
[0265] Bcr peptide 353-364 (SEQ ID NO:10) and an SH2 domain of an
adapter protein. Another phosphotyrosine peptide within Bcr,
VSPSPTTpY.sup.360RMFR, SEQ ID NO: 10, (residues 353-364) is also
involved in binding of an adapter SH2-containing protein. This
sequence surrounds tyrosine 360 of Bcr and Y.sup.360 is also
phosphorylated by the Abl tyrosine kinase within Bcr--Abl.
[0266] In using a Bcr peptide based upon 353-364 (SEQ ID NO: 10),
at least a 4-mer fragment thereof, such as Bcr 359-363 (SEQ ID
NO:25), should be used. SEQ ID NO:22 is also useful.
[0267] A preferred peptide combination of the present invention is
thus a set of peptides or a polypeptide having or comprising
sequences from Bcr that include Y.sup.177, Y.sup.283 and Y.sup.360,
such as, for example, the peptide of SEQ ID NO:8, SEQ ID NO:11
and/or SEQ ID NO:10. A peptide including this set of binding sites
should be at least 3 or 4 amino acids long, and preferably, about
10 or 12 or 15 amino acids long.
[0268] The tyrosine is about in the middle of the peptide since
sequences to the carboxy-terminal side may be especially important
for peptide binding, e.g., Asn 179 of the peptide that contains
Y.sup.177.
[0269] A polypeptide containing these sequences would have spacer
amino acids to allow flexibility of the molecule for optimum
binding.
[0270] The peptides of the present invention are preferably
provided with amino-terminal acetyl groups so as to block the
NH.sub.2-terminal end from protease degradation and with an amide
group at the carboxy terminal end.
[0271] Acetylation of the amino terminal end is accomplished using
acetic anhydride following completion of the peptide. The
acetylation is done on the nascent peptide bound to the resin
during synthesis. The carboxy-terminal amide is accomplished by
beginning the synthesis of the peptide onto derivatized resin
(i.e., PAL Support; Millipore #GEN077483; Medford, Mass.). When the
peptide is removed from this type of resin, it will have an amide
group at its C-terminus.
EXAMPLE III
[0272] Bcr Peptides for Inhibition of Coiled Coil Interaction
Between Bcr--Abl Molecules to Prevent Oligomerization
[0273] Peptides comprising sequences from the N-terminal region of
the Bcr portion of Bcr--Abl will inhibit a coiled-coil interaction
between the Bcr portion of Bcr--Abl monomers, an interaction that
is involved in formation of the tetrameric active form of Bcr--Abl.
An excess of these N-terminal peptides will prevent tetramer
formation and, thereby, prevent autophosphorylation of Bcr--Abl and
its subsequent oncogenic functions.
[0274] SEQ ID NO: 1 provides the amino acid sequence of the first
exon of Bcr. The N-terminal peptides for use in the invention may
comprise the sequence of amino acids 1-63 (SEQ ID NO:2), or amino
acids 1-71 (SEQ ID NO:3), or amino acids 28-58 (SEQ ID NO:4), or
amino acids 1-159 (SEQ ID NO:5), or amino acids 1-221 (SEQ ID NO:6)
or amino acids 1-413 (SEQ ID NO:7) or equivalents thereof.
[0275] A fragment of the BCR gene encoding a 159 amino acid amino
terminal fragment Bcr preferred in certain uses. Since normal Bcr
protein forms a stable complex with Bcr--Abl, overexpression of Bcr
159 is expected to generate heterotetrameric structures composed of
one molecule of Bcr--Abl and three molecules of Bcr 159. The
tetramer should be inactive as a tyrosine kinase not only for
autophosphorylation of Bcr--Abl but also inactive as a kinase to
phosphorylate substrates such as Shc and Crkl.
EXAMPLE IV
[0276] Peptide 255-293 Mutation Studies
[0277] The inventors have conducted studies in which the amino
terminal SH2 domain of Ras Gap was expressed as a fusion protein
containing the glutathione S transferase protein (GST). These
studies involve mixing GST-Gap SH2 with phosphotyrosine tryptic
peptides of Bcr--Abl.
[0278] FIG. 8A, FIG. 8B, FIG. 8C and FIG. 8D show two-D tryptic
maps of in vitro phosphorylated Bcr--Abl proteins. Bcr--Abl
proteins were phosphorylated in vitro using anti-Abl(52-64) immune
complexes, and mapped. The dashed circles identify peptides lacking
in the mutant.
[0279] FIG. 9A and FIG. 9B show trypsin/V8 mapping of F283 and wild
type p210 Bcr--Abl. The F283 mutant of p210 Bcr--Abl from COS cells
is compared to the map of p210 Bcr--Abl from K562 cells (FIG. 9A).
The dashed circles or Xs identify peptides lacking in the
mutant.
[0280] In FIG. 10A AND FIG. 10B, spots #3 and #8 specifically bound
to the GST-Ras Gap SH2 fusion protein, but not to GST. Spot #3
contains a peptide designated 255-293 (SEQ ID NO: 11) having
tyrosines 283, 279 and 276 (not phosphorylated). Tyrosine 283 is
not involved in binding Ras Gap. Therefore, tyrosine residue 279 is
likely to be part of the peptide of Bcr that binds Ras Gap.
[0281] The sequence 255-293 (SEQ ID NO: 11) binds Ras Gap and an
SH2 domain of Abl. Fragments of this peptide that include at least
Bcr 278-284 or Bcr 278-282, such as Bcr 278-290, provide useful
peptides for inhibition of Bcr--Abl.
[0282] A further tyrosine at position 283 (residues 255-293, SEQ ID
NO: 11) is also phosphorylated by the Abl tyrosine kinase within
Bcr--Abl. Several other tyrosines within Bcr are also
phosphorylated by Bcr--Abl. They are likely to be Y.sup.70 and
Y.sup.279, or possibly tyrosine at positions 58, 231 or 246.
Y.sup.276, Y.sup.316 and Y.sup.328 appear not to be sites of
phosphorylation.
EXAMPLE V
[0283] Abl SH2 Domain Binds to a Bcr Peptide Within the First Exon
of Bcr--Abl
[0284] The inventors performed similar studies with the SH2 domain
of Abl. These were performed with a mouse c-Abl SH2 sequence, which
differs by only two amino acids from the human sequence within the
SH2 domain.
[0285] The results indicate that phosphotyrosine tryptic peptides
#3 and #8 bind to GST--Abl SH2 but not to GST (FIG. 1OA and lOB).
It is not known why Ras Gap SH2 and Abl SH2 bind the very same
phosphotyrosine tryptic peptides.
[0286] The sequence of peptide 8 is 637 NSLETLLYK 644, (SEQ ID NO:
12), its position is outside of the first exon (it is lacking in
p185 Bcr--Abl but present in p210 Bcr--Abl; the former contains
only the first exon of Bcr whereas the latter contains more than
900 amino acids of Bcr.) Peptide #3 has the sequence of amino acids
255 FLKDNLIDANGGSRPPWPPLEYQPYQ- SIYVGGMMEGEGK 293 (SEQ ID NO: 11,
the underlined residues are sites resistant to trypsin).
EXAMPLE VI
[0287] p160 Bcr Binds to Grb2
[0288] The following study was carried out to demonstrate that
tyrosine 177 phosphorylated p160 Bcr binds to a simian Grb2
molecule, an activator of the Ras signaling pathway.
[0289] It has been shown that phosphotyrosine 177 of Bcr sequences
within Bcr--Abl is required for its direct interaction with SH2
domain of Grb2, an SH2 and SH3 domain-containing adaptor molecule
(Pendergast et al., 1993). The interaction is important for
activation of Ras function and transformation by Bcr--Abl
(Pendergast et al., 1993).
[0290] As p210 Bcr--Abl can transphosphorylate p160 Bcr on tyrosine
177, it was of interest to test whether tyrosine 177 phosphorylated
p160 Bcr might also be able to bind to Grb2 protein within cells.
Searching for such a complex is difficult in cells that express
both p210 Bcr--Abl and p160 BCR since p210 Bcr--Abl will interact
with both p160 Bcr and Grb2 proteins.
[0291] In order to demonstrate direct interaction between tyrosine
phosphorylated p160 Bcr and Grb2 proteins, it is reasonable to take
the advantage of the facts that p160 BCR can be tyrosine
phosphorylated by p146 c-Abl and the lack of physical interaction
of p145 c-ABL with either p160 Bcr or Grb2.
[0292] COS1 cells express an endogenous simian Grb2 protein
detected by Western blotting (FIG. 18, lane 1). P160 BCR and p145
c-ABL(1b) were separately or simultaneously expressed in COS1
cells. Two days after transfection, cells were harvested. The cell
lysates were clarified by ultracentrifugation and the supernatants
were incubated with either anti-BCR c-terminal (1256-1271) antibody
(FIG. 18, lanes 2, 4 and 6) or peptide preblocked antibody (FIG.
18, lanes 3, 5 and 7). The immunoprecipitated proteins were then
fractionated by a 10% polyacrylamide SDS PAGE and then transferred
to a p-immoblin membrane. The membrane was then blotted by an
anti-Grb2 antibody (FIG. 18).
[0293] The result showed that Grb2 protein can be specifically
co-immunoprecipitated with tyrosine phosphorylated p160 BCR by
anti-BCR c-terminal (1256-1271) antibody from COS1 cells
overexpressing both p160 BCR and p145 c-ABL(1b) (compare FIG. 18,
lanes 6 and 7). However, expression of either p160 BCR alone (FIG.
18, lanes 2 an d3) or p145 c-ABL alone (FIG. 18, lanes 4 and 5) did
not result in significantly specific co-immunoprecipitation of Grb2
protein by anti-BCR c-terminal (1256-1271) antibody. The weakly
blocked 24 kd protein bands are likely resulted form non-specific
imununoprecipitation of simian Grb2 molecule by the polyclonal
anti-BCR c-terminal (1256-1271) rabbit serum and the presence of
low amount of tyrosine phosphorylated endogenous BCR protein.
[0294] The results indicate that p160 BCR when tyrosine
phosphorylated by p145 c-ABL can interact with the endogenous
similar Grb2 protein.
[0295] In order to determine whether phosphorylation of tyrosine
177 of p160 BCR by p145 c-ABL(1b) is responsible for the
interaction of p160 BCR with simian Grb2 protein, the Grb2 binding
ability of tyrosine 177 to phenylalanine mutant of p160 BCR was
tested.
[0296] In this study, p145 c-ABL was coexpressed with either wild
type p160 BCR or the mutant p160 BCR(F177) in COS1 cells. Cell
lysates were subjected to immnunoprecipitation by anti-BCR
C-terminal (1256-1271) antibody and the immunoprecipitates were
analyzed by Western blotting with an anti-Grb2 antibody.
[0297] As expected, tyrosine phosphorylated wild type p160 PCR by
p145 c-ABL(1b) was able to bind specifically to simian Grb2
proteins (compare lanes 1 and 2 of FIG. 19). However, coexpression
of p145 c-ABL(1b) with p160 BCR lacking tyrosine 177 in COS1 cells
resulted in a much reduced level of communoprecipitate simian Grb2
protein by anti-BCR C-terminal (1256-1271) antibody (compare lanes
3 and 4 of FIG. 19 to lanes 1 and 2). This weak
coimmunoprecipitation observed in lane 3 and 4 of FIG. 19 is likely
resulted from non-specific immunoprecipitation by the anti-GBCR
(1256-1271) antibody and the presence of endogenous wild type
BCR.
[0298] These results indicate that not only phosphotyrosine 177 of
Bcr--Abl but also phosphotyrosine 177 of p160 BCR are able to bind
to Grb2 proteins. It also implicated that normal c-Abl protein,
when activated, may activate Ras pathway through phosphorylation of
tyrosine 177 of p160 BCR.
EXAMPLE VII
[0299] Inhibition of Bcr--Abl by Short Peptides
[0300] This example shows that a short peptide sequence encoded by
the first exon of the BCR gene (SEQ ID NO:22) strongly inhibits
Bcr--Abl protein tyrosine kinase activity in test tube kinase
reactions. This Bcr peptide must be phosphorylated on a serine
residue (possibly only one of several) in order for it to function
as an inhibitor.
[0301] SEQ ID NO: 10, Bcr 353-364 (housing Tyr 360), is identified
herein as a useful inhibitory peptide. The inventors next initiated
studies with a longer form of this peptide (SEQ ID NO:22). This was
chosen because SH2 domains generally require a motif that includes
sequences preceding and following a phosphorylated tyrosine
residue.
[0302] The inventors first focused on a modified form of SEQ ID
NO:22 containing a phosphoserine. This peptide is also termed pS354
S17K. The effect and inhibitory activity of pS354 S17K towards the
Bcr--Abl kinase was determined.
[0303] pS354 S17K is 350-SSRVpS*PSPTTYRMFRDK-366 (SEQ ID NO:22).
The sequence begins at Bcr residue 350 and ends at Bcr residues
366, located within the first exon coding region of the BCR gene.
The pS* identifies phosphoserine. The peptide was made by Merrified
chemistry and purified by column chromatography and HPLC to about
95% purity.
[0304] Assays that measure the Bcr--Abl kinase activity frequently
utilize the autophosphorylation reaction in which one molecule of
Bcr--Abl tyrosine phosphorylates another Bcr--Abl molecule. The Bcr
peptide was shown to inhibit the Bcr--Abl tyrosine kinase as
measured by its addition to immunocomplexes that contain P185
BCR--ABL in auto kinase assays (FIG. 21).
[0305] The pS354 S17K peptide sequence strongly inhibited the
Bcr--Abl kinase activity (compare lane 1 to lane 2), whereas
unphosphorylated SI 7K had little affect (lane 3). Similar results
were obtained with the other form of the Bcr--Abl oncoprotein (P210
BCR--ABL).
EXAMPLE VIII
[0306] Inhibition of Bcr--Abl by Long Peptides
[0307] The present example shows that a larger segment of the Bcr
protein, encoded by the first exon of the BCR gene, inhibits the
tyrosine kinase activity of the Bcr--Abl oncoprotein in test tube
kinase reactions. This Bcr protein is a potent inhibitor of the
Bcr--Abl tyrosine kinase within cells.
[0308] The inventors reasoned that a fragment of the Bcr protein
containing both serine-rich boxes of Bcr might also function as a
potent inhibitor of the Bcr--Abl tyrosine kinase.
[0309] The inventors constructed a DNA vector encoding Bcr
sequences from amino acid 64 to 413 (SEQ ID NO:28; FIG. 22). This
construct produces a short Bcr protein containing both A and B
serine-rich boxes (Pendergast et al., 1991). The DNA segment
encoding amino acids 64 to 413 was derived from a Bcr--Abl DNA
clone provided by Dr. Jean Wang (McWhirter and Wang, 1991). The Bcr
coding sequence was inserted into vector pLNL SLX CMV.
[0310] The Bcr fragment was expressed in COS-1 cells by transient
transfection with the Bcr fragment vector construct shown in FIG.
22. Lysates of transfected COS-1 cells were immunoprecipitated with
a rabbit antibody prepared against a synthetic Bcr peptide
encompassing Bcr residues EFHHERGLVKVNDKE (181-194 of SEQ ID NO:
1). In other studies, the inventors showed this construct produced
the expected size Bcr protein fragment of the appropriate size in
NIH 3T3 cells by Western blotting with the anti-Bcr 181-194
antibody.
[0311] The immunoprecipitate from the COS-1 cell transfected with
Bcr fragment (64413) was added to immuoprecipitates of P185
BCR--ABL derived from the leukemic cell line SUP B15. The results
showed that the Bcr fragment was a potent inhibitor of the Bcr--Abl
tyrosine kinase activity (FIG. 23A, compare lane 4 to lane 2).
[0312] When the immunoprecipitate was boiled for a few minutes
prior to addition to the kinase assay, the inhibitory activity was
strongly decreased (compare lanes 1 and 2). This is the expected
result if the inhibitor is in fact the Bcr fragment protein, as
protein confirmation is largely destroyed by temperatures
approaching 100.degree. C.
[0313] To measure the level of the Bcr--Abl oncoprotein in the
kinase assay, the anti-Abl inmmunocomplexes from lanes 2 and 4 were
analyzed by Western blotting with the anti-Bcr 181-194 antibody.
The results indicate that the amount of Bcr--Abl protein (P185) was
essentially unchanged in amount (FIG. 23B), but the level of
autophosphorylation was dramatically decreased by exposure to the
anti-Bcr immunocomplex containing the Bcr fragment protein (FIG.
23A, lane 2).
[0314] To eliminate the possibility that the anti-Bcr 181-194
antibody was itself inhibitory to Bcr--Abl, the inventors mixed
antibody not exposed to the Bcr fragment with Bcr--Abl (FIG. 23C).
The results show that the antibody itself was not inhibitory to
Bcr--Abl (compare lanes 1 and 2 of FIG. 23C). Again the inventors
measured the level of the Bcr--Abl protein in the immune complexes
but this time by Western blotting with anti-Abl 8E9 antibody (lower
portion of FIG. 23C of FIG. 4). The level of Bcr--Abl protein did
not change.
[0315] In this study (FIG. 23A), the level of the Bcr fragment
protein in COS-1 cells was likely to be at the same level as that
observed for the Bcr--Abl protein in most cell lines. Therefore,
the amount of the Bcr protein fragment was likely to be at similar
molar amounts to the amount of the Bcr--Abl protein in these kinase
assays.
[0316] Therefore, the inventors conclude that the Bcr fragment
protein of SEQ ID NO:28 is a very potent inhibitor of the Bcr--Abl
tyrosine kinase. The Bcr fragment was likely to be phosphorylated
on serine residues (at least on serine 354) as a result of
expression in COS-1 cells. The inventors presume that its
phosphorylation was catalyzed by cellular serine kinases present in
COS-1 cells (possibly endogenous Bcr, which is a serine/threonine
kinase).
[0317] The effects of the Bcr peptide on other kinases were
measured and results indicate that the Bcr inhibitory peptide
stimulates the Bcr kinase but has little effect on the p60 Src
tyrosine kinase.
[0318] These results support the proposal that normal Bcr can
oppose the growth effects of Bcr--Abl. Importantly, they strengthen
the strategy of producing specific drugs to counteract the leukemic
effects of the Bcr--Abl oncoprotein. The drugs include either
liposome/peptide formulations or gene therapy induced expression of
the Bcr fragment protein of SEQ ID NO:22 and the other peptides
described herein.
EXAMPLE IX
[0319] Inhibition of Bcr Serine Kinase by Tyrosine
Phosphorylation
[0320] Bcr is known to possess an intrinsic serine/threonine kinase
activity. In this example, the inventors have examined the
significance of tyrosine residues within the Bcr amino terminus
with regard to their effect on its serine/threonine kinase
activity. The phosphorylation of Bcr by Bcr--Abl on tyrosine
residues, including T-360, greatly inhibited the serine/threonine
kinase function of Bcr.
[0321] P160.sup.BCR (Y360F) has reduced transphosphorylation
activity, but its autophosphorylation activity is unaffected:
Tyrosine phosphorylation of different Bcr exon 1 residues could
affect Bcr's enzymatic activity. Moreover, tyrosine residues may be
involved in regulating Bcr's serine/threonine kinase activity.
[0322] To test this, the inventors generated Y*F BCR cDNAs for
several residues and these mutant Bcr proteins were examined for
serine/threonine kinase activity. Mutant forms of P160.sup.BCR were
expressed in COS-1 cells and tested for serine/threonine kinase
activities in immune complex kinase assays.
[0323] Mutant Y360F Bcr P160 was severely inhibited in its ability
to transphosphorylate an exogenously added substrate, casein,
compared with that of wild-type Bcr. In contrast, P.sub.160BCR
autophosphorylation was not detectably altered by the Y360F
mutation.
[0324] Western blotting of such extracts showed that the Y360F Bcr
mutant protein was stable. Using the intensities of the
P160.sup.BCR bands as an indication of the amount of active
P160.sup.BCR in the immune complex and the intensities of the
casein bands as a measure of transphosphorylation activity, the
transphosphorylation activity of the Y360F Bcr mutant was reduced
about sevenfold, compared with that of the wild type. Similarly,
the Y360F Bcr mutant was also defective in transphosphorylating
another exogenous substrate, histone H1.
[0325] To determine whether other tyrosine residues in Bcr exon 1
are similarly important to Bcr's serine/Threonine kinase activity,
the inventors assayed the Y283F mutant Bcr protein. Bcr Y283F was
not significantly altered in its ability to phosphorylate
casein.
[0326] The amounts of Bcr within these immune complexes were
quantitated in two ways. In a first method, the amounts of Bcr
mutants would be underestimated by about 10%, compared with that of
the wild type. On the basis of these measurements, the specific
activity of transkinase activity (casein intensity/P160.sup.BCR
intensity) of the Y360F Bcr mutant (0.03) was reduced more than
20-fold in this study, compared with that of the wild type.
[0327] The second method of estimating the amounts of P160.sup.BCR
in immune complexes involved the Western blotting of these immune
complexes with an anti-Bcr antibody. The specific activity of Y360F
was reduced by about sixfold. Thus, these two methods established
that the Y360F Bcr protein had significantly reduced ability to
phosphorylate an added substrate, compared with that of wild-type
Bcr. By using autophosphorylation of the Bcr protein as a measure
of its relative amount, the reduction of Bcr's transkinase by the
Y360F mutation was about sevenfold, confirming the results obtained
by the Western blot method.
[0328] Depression of Bcr's serine kinase activity by Bcr--Abl:
Because the Y-360 residue is critically involved in Bcr's
transphosphorylation activity and because of the failure of
wild-type Bcr--Abl to reduce the Y360F defect, the inventors tested
the effects of tyrosine phosphorylation of wild-type Bcr on it
serine/threonine kinase activity. Bcr--Abl and Bcr immune complexes
from separate aliquots of COS-1 cells were mixed to allow Bcr--Abl
to tyrosine phosphorylate Bcr. The inventors then assayed the
effect of tyrosine phosphorylation of Bcr on it serine/threonine
kinase activity.
[0329] Control Bcr P160 phosphorylated casein, mostly on serine
with low levels of threonine, P160.sup.BCR itself was also
phosphorylated on serine/threonine residues. However, the addition
of Bcr--Abl immune complexes to Bcr immune complexes severely
reduced the level of serine/threonine phosphorylation of casein and
caused phosphorylation of casein on tyrosine residues.
[0330] The addition of Bcr--Abl to Bcr immune complexes also
resulted in the transphosphorylation of Bcr on tyrosine residues
and simultaneously blocked the serine/threonine autophosphorylation
activity of Bcr. In these studies, the inventors measured the
phosphoamino acid contents in P160.sup.BCR with and without
treatnent of Bcr immune complexes with Bcr--Abl. In these studies,
Bcr and Bcr--Abl proteins were immunoprecipitated with anti-Bcr,
which directly reacts with Bcr and Bcr--Abl proteins.
[0331] Autophosphorylated P160.sup.BCR contained
phosphoserinelthreonine. In contrast, P160.sup.BCR treated with
Bcr--Abl contained predominantly phosphotyrosine, with only low
levels of phosphoserine/threonine. These results demonstrate that
in vitro tyrosine phosphorylation of wild-type Bcr severely
inhibits its serine/threonine protein kinase, including both
autokinase and transkinase activities.
[0332] Tyrosine-phosphorylated Bcr isolated from intact cells is
deficient in transkinase activity: To determine whether Bcr
harvested from cells coexpressing Bcr--Abl is also deficient in
transkinase activity, the inventors isolated Bcr from cells under
conditions that favor the retention of phosphotyrosine.
[0333] In these studies, the inventors immunoprecipitated Bar with
anti-Bcr either from extracts of cells lacking Bcr--Abl or from
cells that express Bcr--Abl. Under these conditions, Bcr--Abl is
co-immunoprecipitated with Bcr. The inventors lysed cells in buffer
containing 0.4 mM vanadate to block tyrosine phosphatases and
therefore maintain the phosphotyrosines with Bcr.
[0334] Cells coexpressing Bcr with either P.sub.210BCR--ABL was
severely deficient in casein phosphorylation activity. Quantitative
measurements indicated that was 25-fold less active for casein
phosphorylation than was Bcr from COS-1 cells lacking Bcr--Abl.
These results demonstrate that tyrosine phosphorylation of Bcr by
Bcr--Abl in the predominant factor in reducing Bcr's
serine/threonine kinase activity.
EXAMPLE X
[0335] Bcr is a Negative Regulator of Bcr--Abl Function
[0336] The present example demonstrates reduction of Bcr kinase
activity and Bcr/Bcr--Abl complexes by treatment of cells with a 3'
BCR anti-sense oligonucleotide.
[0337] The facts that p160 BCR is a target for BCR--ABL protein
tyrosine kinase and that tyrosine phosphorylated p160 BCR is able
to interact within live cells with the Grb2 molecule, an activator
of the Ras signaling pathway, are consistent with the hypothesis
that p160 BCR plays a role in the pathogenesis of Phl-positive
leukemias.
[0338] Tyrosine phosphorylation of p160 BCR by the activated
tyrosine kinase of p145 c-ABL and its subsequent interaction with
Grb2 protein indicate that p160 BCR might also be a very important
signaling molecule in certain normal physiological processes.
[0339] In order to address the role of BCR in the oncogenic effects
of BCR--ABL, BCR protein expression was specifically eliminated or
reduced in cells expressing BCR--ABL. Antisense
oligodeoxynucleotides are able to bind to the specific mRNA through
base-pairing and then by degradation of the mRNA, interfere with
protein expression. Since BCR--ABL lacks 3' BCR coding sequences
(amino acid residues 927-1271), a 3' BCR antisense
oligodeoxynucleotide should be useful in selectively reducing BCR
expression without interfering with BCR--ABL expression.
[0340] 3' BCR sequences share homology with several human genes
such as p21 RasGAP and ABR genes. Therefore, selected 3' BCR sense
and antisense oligonucleotide sequences were examined by FASTA
search in GeneBank database to eliminate oligonucleotides that
share significant homology with known human genes. Examination of
the oligonucleotides by a primer selection program showed no
significant secondary structure formation.
[0341] The following oligonucleotide sequences were selected:
BCR3351-antisense, 5'ATCATCACCGACACATCC 3', SEQ ID NO:20;
BCR3351-sense, 5' GGATGTGTCGGTGATGAT 3', SEQ ID NO:21. The
oligonucleotide sequences correspond to BCR coding sequences 3351
to 3368, which are not found within BCR--ABL sequences and other
known human gene sequences.
[0342] The oligonucleotides were synthesized by Genosys
Biotechnologies, Inc. (Houston, Tex. 77380-3600). Two
phosphotriester linkages were placed at both ends of each
oligonucleotide to enhance their resistance to endonuclease
digestion and prolong their effects.
[0343] The effects of the sense and antisense 3' BCR
oligonucleotides were tested on BCR expression in SUP-Bi5 cells, a
cell line derived from a Ph.sup.1-positive acute lymphocytic
leukemia patient that expresses p185 BCR--ABL. Immunokinase assays
were performed with anti-BCR (1256-1271) peptide antibody (the
antibody detects Bcr proteins but not Bcr--Abl proteins) to
determine the level of BCR expression in B15 cells after 7 days
treatment with either the sense or antisense 3' BCR
oligonucleotides (FIG. 13, lanes 1 and 3).
[0344] The results showed that the antisense treated B15 cells
express much lower levels of BCR protein compared with that of the
sense treated cells.
[0345] Since the C-terminal Bcr antibody does not detect Bcr--Abl,
the level of co-precipitated Bcr--Abl with Bcr gives an estimate of
the amount of Bcr/Bcr--Abl complexes. Of importance, these assays
showed that the amount of p160 BCR/p185 BCR--ABL complexes were
also reduced in the antisense treated B15 cell compared to the
sense treated cells (FIG. 13, lanes 1 and 3). In this study, equal
amounts of the sense and the antisense oligonucleotide treated B15
cells were analyzed. Western blot analyses with an anti-Abl
monoclonal antibody showed that the expression of p185 BCR--ABL was
not significantly altered by the antisense and the sense
oligonucleotides treatment (FIG. 12).
[0346] These results showed the 3' BCR antisense oligonucleotide
specifically reduced the expression of normal BCR without
interfering with the expression of BCR--ABL.
[0347] Quantitation analyses of the p160 BCR observed in lanes 1
and 3 of FIG. 13 by a densitometer (Molecular Dynamics) showed that
the antisense treated B15 cells contained about 14 times less Bcr
than that of the sense treated cells. However, quantitation
analyses of FIG. 12 showed that levels of Bcr--Abl and c-Abl of
antisense treated B15 cells were reduced about 1.6 and 1.35 fold,
respectively, than that of the sense treated cells. Using c-Abl as
an internal control, the actual reduction of p160 BCR in B15 cells
by the antisense treatment is about 10 fold.
[0348] The biological effects of the 3' BCR antisense
oligonucleotide treatment were tested on SUP-B15 cells. SUP-B15
cells were seeded in triplicate wells at a concentration of
1.6.times.10.sup.5 cells/ml in a 200 .mu.l volume of RPMI media
supplemented with 20% FCS. Oligonucleotides were added to the cells
at a final concentration of 10 .mu.M. Cell number was monitored by
trypan blue exclusion assay for 9 days. The mean cell number of the
triplicates was determined each day (FIG. 20A).
[0349] It was expected that antisense 3' BCR oligo would increase
growth of Bcr--Abl expressing cells because of the proven role of
Bcr phosphotyrosine 177 in stimulating the Ras pathway (Pendergast
et al., 1993; Puil et al., 1994; FIG. 18 and FIG. 19). Results
showed that antisense oligonucleotide treatment of SUP-B15 cells
sustained a higher growth density compared to sense oligonucleotide
treatment.
[0350] Similar results were obtained from treatment of M3.16 cells
(human megakaryocytic cells transfected with p210 BCR--ABL) (FIG.
20B). For this particular study, the cell number was followed up
for a longer period of time (11 days) and oligonucleotides were
added again at day 5 at half of the initial concentration. Light
microscopic examination of the cell culture at day 9 revealed that
the antisense treated M3.16 cells were more confluent than sense
treated cells.
[0351] In summary, the inventors performed studies to determine
whether Bcr protein was reduced by the 3' BCR anti-sense treatment.
Therefore, a sufficient amount of p185 BCR--ABL expressing SUP-B15
cells was treated with sense and anti-sense 3' BCR oligos for seven
days in culture. Anti-sense treated cultures had twice as many live
cells as the sense treated cultures. Two types of assays were
performed on these cultures.
[0352] First, the level of Bcr--Abl protein was assayed by Western
blotting. The anti-sense treated culture had no significant change
in the expression of the Bcr--Abl protein compared to the
sense-treated culture (FIG. 12). Therefore, the increased rate of
growth was not a result of increased Bcr--Abl expression.
[0353] Second, lysates of anti-sense and sense-treated cultures
were assayed by immune complex kinase assays with antibodies to the
carboxy terminus of Bcr, which have been shown to detect
Bcr/Bcr--Abl complexes (Campbell et al., 1990; Liu et al., 1993).
These antibodies detect Bcr directly but not Bcr--Abl protein.
However because Bcr can complex with Bcr--Abl, this assay also
detects Bcr--Abl which is co-precipitated along with Bcr.
[0354] Incubation of these immune complexes with labeled ATP causes
tyrosine phosphorylation of Bcr by Bcr--Abl and autophosphorylation
of Bcr--Abl (Liu et al., 1993). Comparison of lysates from sense
and anti-sense treated cultures showed a dramatic reduction in Bcr
and Bcr/Bcr--Abl complexes by anti-sense (FIG. 13). Phosphorimager
analyses indicated that the amount of Bcr was reduced about 14-fold
by anti-sense 3' BCR. Using Abl Western blot data as an internal
control for mass, the specific reduction in Bcr is estimated to be
about 10-fold.
[0355] Therefore, the data in FIG. 12 and FIG. 13 indicated that
the anti-sense 3' BCR oligo dramatically reduced the amount of
functional Bcr and Bcr/Bcr--Abl complexes while not significantly
affecting the level of Bcr--Abl protein. These results provide
support for Bcr being a negative regulator of Bcr--Abl
function.
EXAMPLE XI
[0356] Normal Bcr Protein has a Negative Regulatory Role
[0357] The present example demonstrates that 3' BCR anti-sense
treated Bcr--Abl expressing cells maintained in low serum have
enhanced survival compared to sense treated cells.
[0358] The differences between the growth patterns of sense and
antisense oligonucleotide treated cells are not observed until late
in the culture cycle. These results suggest that some factor in the
medium could overcome the effects of anti-sense 3' BCR
oligonucleotide. It is possible that reduced serum level is
required for the effects induced by antisense oligonucleotide
treatment.
[0359] B15 cells were cultured in a low serum containing media [5%
fetal calf serum (FCS)]. These cells normally require 20% FCS. A
batch of B15 cells (2.2.times.10.sup.6/ml) was cultured in RPMI
containing 5% FCS. 200 .mu.l of this suspension was seeded into
each well of a 96 well culture plate. Either the antisense or sense
oligonucleotides were added to the culture at a final concentration
of 10 .mu.M. The cell numbers were determined as an average of the
triplicates and plotted in FIG. 14.
[0360] B15 cells cultured in low serum containing media were found
to have increased survival after treatment with the 3' BCR
antisense oligonucleotide compared to sense oligonucleotide
treatment. Thus, after five days of treatment with antisense 3' BCR
the number of viable cells was about twice that of sense-treated
cells.
[0361] These results indicate that the normal Bcr protein inhibits
survival of Bcr--Abl expressing cells under serum conditions that
inhibit cell growth. Thus, this result is consistent with normal
Bcr protein having a negative effect on cells by stimulating cell
death.
[0362] In summary, inspection of the growth rate patterns of sense
and anti-sense treated Bcr--Abl expressing cultures showed that the
growth stimulatory effects of anti-sense were not seen until a lag
of several days. During that lag period, no differences in growth
rate between sense and anti-sense treated cells were observed in
two cell lines. This lag may be due to optimal growth stimulation
provided by high serum concentration in the medium. Therefore, the
effects of the anti-sense 3' oligo was tested at decreased levels
of serum, under conditions where cells fail to increase in cell
number. Anti-sense treated cultures showed enhanced survival when
compared to sense (FIG. 14).
[0363] These results suggest that Bcr protein may stimulate cell
death in the presence of Bcr--Abl, and that removal of Bcr will
enhance survival of Bcr--Abl expressing cells.
EXAMPLE XII
[0364] Phosphorylation of Bcr inhibits its Ser/Thr Kinase Activity
and Blocks the Negative Regulatory Role of Bcr
[0365] The present Example demonstrates inhibition of Ser--Thr Bcr
autophosphorylation activity by Bcr--Abl. Normal Bcr protein, in
addition to enhancing the growth stimulatory effects of Bcr--Abl,
also has a negative regulatory role as shown herein. The present
results indicate that normal Bcr counteracts the growth effects of
Bcr--Abl and that this negative effect of Bcr is neutralized by
tyrosine phosphorylation of Bcr by Bcr--Abl.
[0366] Bcr--Abl and Bcr appear to be in an intracellular battle.
Bcr--Abl is stimulating malignant growth whereas non-tyrosine
phosphorylated Bcr is inhibiting growth. Moreover, Bcr--Abl can
inhibit the kinase activity of Bcr by tyrosine phosphorylation. The
Ser/Thr kinase function of Bcr is presumed to be responsible for
its negative growth effects. Therefore, since tyrosine
phosphorylation of Bcr will inhibit its Ser/Thr kinase activity,
blocking the Ser/Thr kinase function of Bcr will block its negative
growth function.
[0367] Bcr--Abl catalyzed in vitro phosphorylation of Bcr
(harvested from cells lacking Bcr--Abl) reduces the level of Bcr
autophosphorylation. Therefore, the following study was carried
out. The phosphoamino acid ratios of gel purified Bcr labeled in
the immunokinase assay with [.sup.32P]ATP with no added Bcr--Abl
immune complexes was compared to that labeled with a relatively
high level of Bcr--Abl immune complexes, and to that with addition
of a low amount of Bcr--Abl (5% of the high level).
[0368] Addition of Bcr--Abl immune complexes to Bcr immune
complexes in kinase assays showed phosphorylation of Bcr--Abl and
Bcr (FIG. 15). The level of phosphorylated Bcr--Abl increased with
increased levels of Bcr--Abl immune complexes, but the intensity of
the phosphorylated Bcr band did not change appreciably. However,
phosphoamino acid analyses of the Bcr band under these different
conditions showed a dramatic decrease in the
phosphoserine/threonine content of the Bcr band with a relatively
low level of Bcr--Abl complexes (FIG. 15). Quantitative analyses
indicated that serine/threonine autophosphorylation of Bcr was
reduced more than 2.5-fold by a low level of Bcr--Abl (5%). With a
high level of Bcr--Abl complexes, the level of Bcr
autophosphorylation was reduced about 30-fold.
[0369] These results indicate that the level of tyrosine
phosphorylation of Bcr may be directly correlated with the level of
inhibition of Bcr autophosphorylation activity.
[0370] Studies were performed to determine whether the
transphosphorylation function of Bcr was similarly inhibited by
Bcr--Abl catalyzed tyrosine phosphorylation (FIG. 16 and FIG. 17).
In these studies, casein (10 .mu.g) was added to the kinase
reaction mixtures to allow transphosphorylation of the added
substrate by Bcr or by Bcr mixed in vitro with Bcr--Abl (FIG. 16
and FIG. 17).
[0371] The results showed that transphosphorylation of casein by
Bcr was quite effective (FIG. 16, compare lanes 1 and 2). Moreover,
phosphoamino analysis established that casein was phosphorylated on
serine and threonine residues (FIG. 17, lane 1).
[0372] Of interest, although the phosphorylation of added casein
was stimulated when Bcr--Abl was added to Bcr (FIG. 16, lane 3),
the level of casein serine/threonine phosphorylation was greatly
inhibited while at the same time casein was strongly phosphorylated
on tyrosine residues (FIG. 17, lane 2). These results show quite
clearly that the Bcr--Abl oncoprotein inhibits the
transphosphorylation function of normal Bcr.
[0373] These results support the hypothesis that Bcr--Abl may in
fact be able to neutralize the negative effects of Bcr by tyrosine
phosphorylation of first exon sequences within Bcr. It is the first
exon of Bcr that functions as a Ser/Thr protein kinase. Several
tyrosines within or near the kinase domain of Bcr are
phosphorylated by Bcr--Abl. The kinase domain of Bcr would include
residues 163-355 (Campbell and Arlinghaus, 1991); the present
disclosure demonstrates that tyrosines at positions 177, 283 and
360 are phosphorylated within the normal Bcr protein as a result of
Bcr--Abl catalyzed phosphorylation. Several other first exon
tyrosines are likely to be phosphorylated also. One or more of
these tyrosine phosphorylations might change the shape of the Bcr
protein in a way that inhibits its serine/threonine kinase
activity.
EXAMPLE XIII
[0374] Expression of Bcr Fragments
[0375] Materials and Methods: COS1 cells ATCC #CRL 1650 (Rockville,
Md.) COS1 is a fibroblast-like cell line established from simian
kidney cells (CV1) that were transformed by an origin-defective
mutant of SV40, that codes for wild-type T antigen. COS1 cells were
cultured at 37.degree. C. with 5% CO.sub.2 in DMEM (Grand Island
Biological Co. (Gibco) Grand Island, N.Y.) supplemented with 10%
fetal calf serum (Gibco Laboratories, Grand Island, N.Y.).
[0376] Transient transfections of COS1 cells were performed by the
diethylaminoethyl (DEAE)-Dextran procedure. Transfection was
initiated when COS1 cells were about 60%-80% confluent. After
washing once with phosphate-buffered saline (PBS) and once with
Tris-buffered Saline-0.02% Dextrose (TBS-D), cells were incubated
with TBS-D containing 0.2 mg/ml DEAE-Dextran and 2 Ag/ml of each
added plasmid. The supernatant was then removed after 5-10 minutes
when the cells started to round up and shrink.
[0377] After washing once with TBS-D and once with PBS, the cells
were incubated in DMEM supplemented with 10% fetal calf serum and
100 .mu.g/ml of chloroquine at 37.degree. C. The chloroquine
containing media was removed after 3-5 hours and the cells were
washed three times with DMEM without fetal calf serum. The cells
were then incubated in DMEM supplemented with 10% fetal calf serum
at 37.degree. C. for 2-3 days before harvesting.
[0378] COS-1 vectors expressing Bcrl59, Bcr221, and Bcr4l3
proteins, respectively, were expressed in COS-1 cells in the
presence and absence of p210 Bcr--Abl. FIG. 6A shows a Western blot
with Anti-pTyr antibody. Bcr--Abl induces tyrosine phosphorylation
of Bcr221 and Bcr4l3 but not Bcrl59, indicating that the first two
tyrosines of Bcr are not targets for Bcr--Abl.
[0379] The next tyrosine is at residue 177, and it is expected to
be phosphorylated by Bcr--Abl (Pendergast et al., 1993). Bcr221 is
tyrosine phosphorylated, but as with Bcr4l3, only in the presence
of Bcr--Abl. FIG. 6B shows a Western Blot of the same extracts
probed with anti-Bcr 1-16. Note that all three Bcr proteins
fragments are specifically expressed under both conditions.
[0380] In summary, Bcrl59 is not phosphorylated in cells expressing
Bcr--Abl despite the presence of two tyrosines (FIG. 6A and FIG.
6B). In contrast, a 221 residue N-terminal fragment and a 413
N-terminal fragment of Bcr are expressed and both are
phosphorylated on tyrosine 177 in cells expressing Bcr--Abl.
EXAMPLE XIV
[0381] Delivery of BCR--ABL Peptides via Retrovirus
[0382] This example describes the use of the invention in the
treatment of leukemia where Philadelphia positive cells are
present.
[0383] Nucleic acid sequences encoding BCR peptides or fusion
proteins are introduced into bone marrow to provide a copy of a BCR
synthetic gene and therefore, also a protein product comprising BCR
peptides or fusion peptides that would bind to adapter proteins and
inhibit the ras oncogene pathway, and bind to the coiled coil area
of BCR--ABL to inhibit autophosphorylation.
[0384] A retroviral vector pG7CHT (FIG. 11) containing the BCR--ABL
gene was obtained from Dr. Albert Deisseroth. The pA317 amphotropic
retrovirus packaging cell line (American Type Culture Collection,
Rockville, Md., #CRL9078) is used for producing high titer virus.
The BCR--ABL gene is released from the plasmid by digesting with
EcoRI and SphI restriction endonucleases. A full length BCR gene
released from pSG5BCR plasmid by digesting with EcoRI and SphI
restriction enzymes is then inserted into the. EcoRI and SphI sites
of pG7CHT vector. The BCR gene is expressed under MoMSV/LTR. The
vector also contains a hyromycin resistant gene (HyTK) which is
expressed under a CMV promotor (Pcmv). The N-terminal fragments of
BCR is expressed using the same strategies described above.
[0385] The Bcr 421 fragment interferes with Bcr--Abl
oligomerization and contains all the phosphorylation sites of
native Bcr--Abl. Therefore, overexpression of this fragment has all
the inhibitory activities of the first exon of Bcr. However, it
will not directly interfere with Shc and Crkl effects but because
it will inhibit oligomerization of Bcr--Abl, the kinase activity of
Bcr--Abl is greatly reduced. Therefore, Crkl and Shc should not be
tyrosine phosphorylated to any great extent.
[0386] Note that full length BCR with stop codons in all three
reading frames at codon 422 was inserted into the vector.
Therefore, only the 421 fragment is made. Similarly, the Bcrl59
fragment and the Bcr 221 fragment were made by inserting stop
codons after codon 159 and 221, respectively.
EXAMPLE XV
[0387] Treating a Bone Marrow Sample with Bcr--Abl Peptides to
Selectively Inhibit Philadelphia Chromosome-Positive Cells
[0388] The present example outlines autologous bone marrow purging
to remove leukemic (Philadelphia chromosome-positive) cells in
vitro prior to in vivo injection. This method may also
advantageously enrich the bone marrow population of diploid
(normal) cells, thus enhancing the therapeutic capacity in the
leukemic patient to whom it is administered.
[0389] As used in the present example, a "normal cell" is a cell in
bone marrow which is Philadelphia chromosome-negative. A "normal
cell" is also defined as a bone marrow cell which is dependent upon
ABL within the cell for growth.
[0390] Accordingly, a bone marrow sample of at least 1000 ml.
containing 2.times.10.sup.10 or 2.times.10.sup.8/kg of nucleated
cells is collected under sterile conditions from a leukemic
patient. The sample is then subjected to Ficoll hypaque or Percoll
discontinuous gradient separation. The nucleated cells (immature)
are collected from the interface. This reduces the number of
nucleated cells 5-fold (to 4.times.10.sup.7/kg). The cells are then
subjected to antibody separation by removing DR (Class II HLA
antigen family expressed in dividing hematopoietic cells) positive
cells by immunoadherance separation. This reduces the number of
cells to 2-5.times.10.sup.7 cells. These remaining cells are then
resuspended at 5.times.10.sup.5 cells per cc of tissue culture
medium (40-100 cc) of HLI medium, supplemented with 1000 U of GMCSF
and IL3, and incubated with BCR peptides for 3 days.
[0391] The Bcr--Abl peptides (or phosphopeptides), e.g., packaged
in liposomes, are then added to a cell culture of bone marrow cells
and cell supportive culture medium at a concentration of between 1
and 100 .mu.M. The BCR peptides, most preferably, are to be added
to the bone marrow cell culture system at a concentration of 10
.mu.M. After approximately 3 days in culture, changing the medium
daily, the culture is examined to determine the ratio of leukemic
cells to normal cells.
[0392] A ratio of not more than 1 leukemic cell: 100 normal cells
is considered acceptable for use as a therapeutic bone marrow
transplant for a leukemic patient. This ratio was chosen as
clinical studies have shown that reduction of the ratio of normal
cells to leukemia cells significantly below 100 to 1 respectively,
leads to prolonged remissions post transplant.
[0393] "Purged", Philadelphia chromosome-positive cell-depleted,
diploid cell-"enriched" (Philadelphia chromosome-negative cell)
autologous bone marrow samples, as processed above, are then
reintroduced into the transplant recipient patient.
EXAMPLE XVI
[0394] Method of Treating Leukemia In Humans with BCR
Peptide-Treated Tissue Transplants
[0395] The present example describes methods of using BCR peptide
therapy for treating leukemia. Specifically, the use of BCR peptide
therapy in methods for the processing and purging of bone marrow
samples that contain Philadelphia chromosome-positive cells is
described. According to one embodiment, the treated tissue is
enriched for Philadelphia chromosome-negative cells, and may be
reintroduced into the leukemic animal as an autologous transplant.
As such, a therapeutic tool to treat a patient with leukemia is
provided.
[0396] As part of a total clinical treatment protocol for a
patient, the method provides at least a two-log (100-fold)
reduction in the ratio of leukemic cells to normal cells, in
addition to the 10,000/1 to 1/1 reduction (from chemotherapy) and
the 2-log reduction (from fractionation of the marrow cells
subsequent thereto) of leukemia cells to normal cells which may be
achieved with conventional treatment regimens with non-pre-treated
bone marrow tissue transplants.
[0397] The regimen thereby effectively reduces the number of
leukemia cells in the patient to levels which enhance the
therapeutic index of the bone-marrow transplant treatment. In some
cases, an up to 3-log reduction (1000-fold) in the number of
Philadelphia chromosome-positive cells in a patient's bone marrow
cell population is achievable upon the reintroduction of a
pretreated bone marrow sample.
[0398] The reintroduction of a patient's pre-treated autologous
bone marrow sample also offers a method for curing CML disease and
for preventing the transition of leukemia from its chronic phase to
the more serious forms of acute leukemia. A processed autologous
bone marrow sample according as described herein depletes the
Philadelphia chromosome-positive population of marrow cells while
enriching the population of normal hematopoietic progenitor cells
(diploid cells) of the tissue sample.
[0399] Once a prepared bone marrow sample is processed according to
the methods disclosed herein, standard protocols employed for the
general technique of performing a bone marrow transplant in CML may
be used to obtain an initial bone marrow sample and to reintroduce
the processed bone marrow to the patient. Such general clinical
techniques are described by Canaani et al. (1990), which reference
is specifically incorporated herein by reference for this purpose.
A volume of about 50-100 cc of purified marrow (containing about
2.5.times.10.sup.7 cells) is the volume of processed bone marrow
tissue which is given to the patient to effect the claimed
treatment.
[0400] Preferred Patient Profile Eligibility
[0401] The following presents a generalized patient profile
defining those characteristics most desirable in a prospective
BCR-peptide-therapy patient.
[0402] 1. Interferon refractory CML patients in initial chronic
phase, or second chronic phase after accelerated phase or blast
crisis are particularly well suited for therapy according to the
presently described invention. Patients who have bone marrow
collected and stored in the chronic phase, or who have been
reinduced into chronic phase, are particularly preferred as
treatment subjects.
[0403] 2. Patients most preferably should be off interferon therapy
for about four weeks prior to storage of an autologous bone marrow
sample to be pre-treated with BCR-peptides. However, prior
treatment with interferon does not disqualify a patient from
eligibility for the BCR-peptide therapy where such a regimen had
been discontinued at least four weeks prior to bone marrow
sampling.
[0404] 3. Patients must have a performance of <3 on the Zubrod
scale (see Table 2--Zubrod Scale), a creatinine level less than 1.6
mg %, acceptable cardiac condition (class I or II), normal liver
functions with bilirubin less than 2 mg %, and an acceptable
pulmonary condition (FEV and DLCO >50% of predicted). Patients
should be free of infections at the time of treatment.
3TABLE 2 Zubrod Scale Performance Status Activity 0 No signs or
symptoms 1 Minor signs or symptoms 2 Ambulatory > 50% of time 3
Ambulatory < 50% of time 4 Bedridden
[0405] 4. A serum creatinine less than 1.6 and SGOT within the
normal range is requires.
[0406] Treatment Plan
[0407] 1. Bone marrow aspiration and collection of peripheral blood
stem cells and storage: Bone marrow is aspirated according to
standard techniques and stored when the patient is in an initial
chronic phase or after reinduction into chronic phase by
chemotherapy. In vivo (chemotherapy) methods are used to reduce the
level of Philadelphia chromosome-positive cells in the population
of transplanted cells, following which the marrow is collected and
treated with BCR-peptides.
[0408] 2. The procedure for BCR-peptide treatment is as
follows:
[0409] a. The nucleated cells of the bone marrow sample
(approximately 1.4.times.10.sup.10 nucleated cells for a 70 kg
weight human patient) are concentrated on a ficoll hypaque gradient
to remove cells of limited proliferative capability (this reduces
the total number of cells by 5-fold).
[0410] The remaining (approximately 2.8.times.10.sup.9) cells are
then further treated with SEPHAROSE.RTM. beads conjugated with
antibodies to DR antigens. Preparations of marrow thus treated have
been observed to generate rapid hematopoietic recovery. This
reduces the total number of cells by 10-fold (2.8.times.10.sup.8).
The cells are then diluted in 50 cc of HL1 medium supplemented with
1,000 units of GMCSF and IL-3 (concentration of cells is
5.6.times.10.sup.6/cc).
[0411] b. The cells are incubated for three days in sterile medium
at 37.degree. C. in the presence of 10 mM of each BCR-peptide as
liposomes.
[0412] c. Following rinsing, the BCR-peptides are washed from the
cells. The cells are then cryopreserved by standard procedures.
[0413] If this or other in vitro techniques are not available for
removing Philadelphia chromosome-positive cells, a combination of
peripheral blood and marrow may be utilized which has been
collected in chronic phase, or which has been collected following
reinduction of chronic phase in the patient with chemotherapy.
Multiple bone marrow aspirations from the patient's iliac crests
are performed before the administration of such agents as cytoxan,
VP-16 and TBI. A second bone marrow storage is considered if less
than 4.times.10.sup.8 total nucleated cells/kg are collected,
2.times.10.sup.8 cells/kg of which are used for the BCR peptide
incubation and 2.times.10.sup.8 cells/kg of which are used as a
back-up.
[0414] Another criterion for adequacy of the amount of nucleated
cells of a marrow sample collected from a patient is
4.times.10.sup.4 CFUGM/kg.
[0415] Alternatively, cells from the peripheral blood may be
collected for reconstitution as a back-up. A dose of
6.times.10.sup.8 mononuclear cells/kg from the peripheral blood or
2.times.10.sup.4/kg CFUGM is required as a back-up.
[0416] Treatment Plan
[0417] The preparative marrow ablative regimen comprises the
following systemic chemotherapy:
[0418] Cyclophosphamide: 60 mg/kg in 0.5 liter D5W intravenously
over 3 hours daily for 2 days--days 1 to 2 (total 120 mg/kg).
[0419] VP-16: 125 mg/m.sup.2 in 1 liter of normal saline is
administered intravenously over 3 hours every 12 hours
daily.times.3 (6 doses on days 1-3) (total 750 mg/m.sup.2).
[0420] The hydration given along with the VP16 and cyclophosphamide
is 4 liters every 24 hours, as tolerated. This is supplemented as
necessary to maintain intravascular fluid volume and urine output
of the patient.
[0421] Total body irradiation: Total body irradiation is about 1020
centrigrays. The patients are placed in the supine position and the
TBI is directed from the right side with a calculated mid plane
dose of 170 rads/fraction, each fraction even bid starting on day
6-8. Autologous bone marrow is then reinfused on day 9 after the
last dose of TBI, after premedication with benadryl 25 mg and
solucortef 100 mg 30 minutes before reinfusion to prevent
anaphylactic reactions.
[0422] Treatment in a 12LP (Protected Environment) is most
preferred. Patients will most preferably remain there until the
attainment of 500 granulocytes/mm.sup.3. Patients will receive
bactrim DS po BID and ketoconazole 200 mg poq8h while hospitalized.
All blood products are irradiated from the start of treatment and
for three months following transplantation.
[0423] Maintenance Therapy: Interferon maintenance therapy begins 6
weeks after engraftment (a return of the platelet count to greater
than 10000/deciliter and an absolute granulocyte count greater than
2,000/deciliter); at a dose of 3 to 9.times.10.sup.6 units, the
dose to be adjusted to keep to WBC counts between 2 and
4.times.10.sup.3/.mu.l with a platelet count
>50.times.10.sup.3/.mu.l.
[0424] Pre-Treatment Evaluation Bone marrow aspirate and biopsy for
morphology, pathology and cytogenetics are most preferably be
obtained prior to treatment. An EKG and CXR is performed on all
patients. A urinalysis ia also obtained before therapy. Pulmonary
function studies with diffusion capacity, where permitted, are also
conducted.
[0425] Evaluation During Study CBC, platelet, and differential
measurements are obtained every 1-2 days during the initial
induction.
[0426] Bone marrow aspirate and biopsy for morphologic pathology
are performed at marrow recovery (when WBC count >1.5
K/.mu.l).
[0427] Upon marrow recovery, a full work-up including CBC, platelet
count and differential, SMA 12, and marrow studies including
cytogenetics are performed. Studies at remission include CBC,
platelet count, differential and SMA 12 every 1-4 weeks, marrow
studies with cytogenetics every 1-3 months and as indicated by
disease status.
[0428] Criteria for Response and Toxicity Criteria for response are
similar for all phases of disease as follows:
[0429] Complete hematologic remission--normalization for at least 4
weeks of the bone marrow (less than 5% blasts) and peripheral blood
with WBC <10.times.10.sup.3/.mu.l and no peripheral blasts,
promyelocytes or myelocytes. This is in addition to disappearance
of all signs and symptoms of the disease.
[0430] Complete hematologic remission is further classified
according to suppression of the Philadelphia chromosome (Ph)
as:
[0431] a) no cytogenetic response--Ph positive 100%
[0432] b) minimal cytogenetic response--Ph positive 35-95%
[0433] c) partial cytogenetic response--Ph positive 5-30%
[0434] d) complete cytogenetic response--Ph positive 0%
[0435] This is done after a total neutrophil count of 1000/mm.sup.3
has been achieved after transplant and at 6-month intervals,
thereafter.
[0436] Progressive disease is defined for purposes of the present
invention as an increase in the WBC count to greater than
40.times.10.sup.3/.mu.l in chronic phase, or the appearance of
features of accelerated disease or blastic crisis. All patients
treated will be valuable for both toxicity and response.
4TABLE 3 Evaluation Before and During Therapy When WBC count >
1.5 K/.mu.l every Every 1-3 months in Pretreatment 2-3 days
remission History, physical exam X -- -- CBC, differential and X X
X platelet counts SMA12, PT.PTT, Fib, X X X FSP, electrolytes* Bone
marrow aspirate X -- X and biopsy Bone marrow X -- X cytogenetics*
EKG, CXR, urinalysis* X -- -- Pulmonary function test X -- -- *In
addition as indicated by clinical and hematologic situations
[0437] The patient may be given subsequent processed autologous
bone marrow transplants to supplement and/or further reduce the
ratio of leukemic cells:normal cells in the bone marrow and
peripheral blood.
EXAMPLE XVII
[0438] In vivo Treatment of Philadelphia Chromosome-Positive
Leukemia Patients
[0439] Either liposome/Bcr--Abl peptides (tyrosine phosphorylated
or not where appropriate) or retrovirus vectors that express p160
BCR or BCR N-T fragments) are injected i.v. periodically (daily or
twice weekly) to treat leukemia. The dose of liposome/peptides is
100 .mu.Moles of each peptide per 10 kg of body weight. The dose of
virus is 10.sup.9 infectious units per 150 kg body weight. Patients
are monitored as above for chemical response.
[0440] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light. of the present disclosure. While the compositions and
methods of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the composition, methods and in the
steps or in the sequence of steps of the method described herein
without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
[0441] References
[0442] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0443] Adelman et al., DNA, 2:183, 1983.
[0444] Arlinghaus et al., In: UCLA Symposia on Molecular and
Cellular Biology New Series, Acute Lymphoblastic Leukemia, Eds. R.
P. Gale, D. Hoelzer, New York, N.Y., Alan R. Liss, Inc., 108:81-90,
1990.
[0445] Bailey, Methods in Molecular Biology 1. Proteins, Ed. J. M.
Walker, Humana Press, Clifton, N.J. p. 325-333, 1984.
[0446] Bolton, "Radioiodination Techniques" Amersham International,
Amersham, Bucks, England, 1977.
[0447] Campbell and Arlinghaus, "Current Status of Bcr Gene
Involvement with Human Leukemia", In: Advances in Cancer Research,
Eds. Klein, VandeWoude, Orlando, Fla. Academic Press, Inc.,
57:227-256, 1991.
[0448] Campbell et al., Oncogene, 5:773-776, 1990.
[0449] Canaani et al., In: Chronic Myelogenous Leukemia: Molecular
Approaches to Research and Therapy, Deisseroth, A. and Arlinghaus,
R. (Eds.), Marcel Dekker Inc., pp. 217-241, 1990.
[0450] Crea et al., PNAS, 75:5765, 1978.
[0451] Druker et al., Blood, 79:2215-2220, 1992.
[0452] Fioretos et al., Oncogene, 8:2853-2855, 1993.
[0453] Hunter and Greenwood, Nature, 194:495496, 1962.
[0454] Kasahara, Dozy & Kan, Science, 266:1373-1376, 1994.
[0455] Kotin, Human Gene Therapy, 5:793:801, 1994.
[0456] Kyte and Doolittle, J. Mol. Biol., 157:105, 1982.
[0457] Liu et al., Oncogene, 8:101-109, 1993.
[0458] Maldini et al., Mol. Cell. Biol., 6:1803-1811, 1986.
[0459] Marchalonis, Biochem. J., 113:299-305, 1969.
[0460] Maru and Witte, Cell, 67:459468, 1991.
[0461] McWhirter and Wang, Mol. Cell. Biol., 11:1553-1565,
1991.
[0462] McWhirter et al., Mol. Cell Biol., 13:7587-7595, 1993.
[0463] Merrifield, J. Am. Chem. Soc., 85:2149, 1963.
[0464] Messing et al., Third Cleveland Symposium on Macromolecules
and Recombinant DNA. Editor: A. Walton, Elsevier Amsterdam,
1981.
[0465] Miller, Curr. Top. Microbiol Immunol. 158:1, 1992.
[0466] Pawson et al., Cell, 71:359-362, 1992.
[0467] Pendergast et. al., Cell, 66:161-171, 1991.
[0468] Pendergast et al., Cell, 75:175-185, 1993.
[0469] Puil et al., EMBO Journal, 13(4):764-773, 1994.
[0470] Reichman et al., Cell Growth amd Differ., 3:451-460,
1992.
[0471] Sambrook et al., Molecular Cloning: A Laboratory Manual, Ed.
2, Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory,
1989.
[0472] Stewart et al., Hum. Gene Ther., 3:267, 1992.
[0473] Tauchi et al., J. Exp. Med., 179:167-175, 1994.
[0474] Ten Hoeve et al., Blood, 84(6):1731-1736, 1994.
[0475] Ten Hoeve et al., Oncogene, 8:2469-2474, 1993.
[0476] Torchilin et al., FASEBJ. 6:2716, 1992.
[0477] Zhu, et al., Science, 261:209-211, 1993.
[0478] U.S. Pat. No. 4,554,101
Sequence CWU 1
1
28 1 426 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 1 Met Val Asp Pro Val Gly Phe Ala Glu Ala Trp Lys
Ala Gln Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro Arg Met Glu Leu Arg
Ser Val Gly Asp Ile Glu 20 25 30 Gln Glu Leu Glu Arg Cys Lys Ala
Ser Ile Arg Arg Leu Glu Gln Glu 35 40 45 Val Asn Gln Glu Arg Phe
Arg Met Ile Tyr Leu Gln Thr Leu Leu Ala 50 55 60 Lys Glu Lys Lys
Ser Tyr Asp Arg Gln Arg Trp Gly Phe Arg Arg Ala 65 70 75 80 Ala Gln
Ala Pro Asp Gly Ala Ser Glu Pro Arg Ala Ser Ala Ser Arg 85 90 95
Pro Gln Pro Ala Pro Ala Asp Gly Ala Asp Pro Pro Pro Ala Glu Glu 100
105 110 Pro Glu Ala Arg Pro Asp Gly Glu Gly Ser Pro Gly Lys Ala Arg
Pro 115 120 125 Gly Thr Ala Arg Arg Pro Gly Ala Ala Ala Ser Gly Glu
Arg Asp Asp 130 135 140 Arg Gly Pro Pro Ala Ser Val Ala Ala Leu Arg
Ser Asn Phe Glu Arg 145 150 155 160 Ile Arg Lys Gly His Gly Gln Pro
Gly Ala Asp Ala Glu Lys Pro Phe 165 170 175 Tyr Val Asn Val Glu Phe
His His Glu Arg Gly Leu Val Lys Val Asn 180 185 190 Asp Lys Glu Val
Ser Asp Arg Ile Ser Ser Leu Gly Ser Gln Ala Met 195 200 205 Gln Met
Glu Arg Lys Lys Ser Gln His Gly Ala Gly Ser Ser Val Gly 210 215 220
Asp Ala Ser Arg Pro Pro Tyr Arg Gly Arg Ser Ser Glu Ser Ser Cys 225
230 235 240 Gly Val Asp Gly Asp Tyr Glu Asp Ala Glu Leu Asn Pro Arg
Phe Leu 245 250 255 Lys Asp Asn Leu Ile Asp Ala Asn Gly Gly Ser Arg
Pro Pro Trp Pro 260 265 270 Pro Leu Glu Tyr Gln Pro Tyr Gln Ser Ile
Tyr Val Gly Gly Met Met 275 280 285 Glu Gly Glu Gly Lys Gly Pro Leu
Leu Arg Ser Gln Ser Thr Ser Glu 290 295 300 Gln Glu Lys Arg Leu Thr
Trp Pro Arg Arg Ser Tyr Ser Pro Arg Ser 305 310 315 320 Phe Glu Asp
Cys Gly Gly Gly Tyr Thr Pro Asp Cys Ser Ser Asn Glu 325 330 335 Asn
Leu Thr Ser Ser Glu Glu Asp Phe Ser Ser Gly Gln Ser Ser Arg 340 345
350 Val Ser Pro Ser Pro Thr Thr Tyr Arg Met Phe Arg Asp Lys Ser Arg
355 360 365 Ser Pro Ser Gln Asn Ser Gln Gln Ser Phe Asp Ser Ser Ser
Pro Pro 370 375 380 Thr Pro Gln Cys His Lys Arg His Arg His Cys Pro
Val Val Val Ser 385 390 395 400 Glu Ala Thr Ile Val Gly Val Arg Lys
Thr Gly Gln Ile Trp Pro Asn 405 410 415 Asp Gly Glu Gly Ala Phe His
Gly Asp Ala 420 425 2 63 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 2 Met Val Asp Pro Val Gly Phe
Ala Glu Ala Trp Lys Ala Gln Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro
Arg Met Glu Leu Arg Ser Val Gly Asp Ile Glu 20 25 30 Gln Glu Leu
Glu Arg Cys Lys Ala Ser Ile Arg Arg Leu Glu Gln Glu 35 40 45 Val
Asn Gln Glu Arg Phe Arg Met Ile Tyr Leu Gln Thr Leu Leu 50 55 60 3
71 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 3 Met Val Asp Pro Val Gly Phe Ala Glu Ala Trp Lys
Ala Gln Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro Arg Met Glu Leu Arg
Ser Val Gly Asp Ile Glu 20 25 30 Gln Glu Leu Glu Arg Cys Lys Ala
Ser Ile Arg Arg Leu Glu Gln Glu 35 40 45 Val Asn Gln Glu Arg Phe
Arg Met Ile Tyr Leu Gln Thr Leu Leu Ala 50 55 60 Lys Glu Lys Lys
Ser Tyr Asp 65 70 4 31 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 4 Val Gly Asp Ile Glu Gln Glu
Leu Glu Arg Cys Lys Ala Ser Ile Arg 1 5 10 15 Arg Leu Glu Gln Glu
Val Asn Gln Glu Arg Phe Arg Met Ile Tyr 20 25 30 5 159 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 5 Met Val Asp Pro Val Gly Phe Ala Glu Ala Trp Lys Ala Gln
Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro Arg Met Glu Leu Arg Ser Val
Gly Asp Ile Glu 20 25 30 Gln Glu Leu Glu Arg Cys Lys Ala Ser Ile
Arg Arg Leu Glu Gln Glu 35 40 45 Val Asn Gln Glu Arg Phe Arg Met
Ile Tyr Leu Gln Thr Leu Leu Ala 50 55 60 Lys Glu Lys Lys Ser Tyr
Asp Arg Gln Arg Trp Gly Phe Arg Arg Ala 65 70 75 80 Ala Gln Ala Pro
Asp Gly Ala Ser Glu Pro Arg Ala Ser Ala Ser Arg 85 90 95 Pro Gln
Pro Ala Pro Ala Asp Gly Ala Asp Pro Pro Pro Ala Glu Glu 100 105 110
Pro Glu Ala Arg Pro Asp Gly Glu Gly Ser Pro Gly Lys Ala Arg Pro 115
120 125 Gly Thr Ala Arg Arg Pro Gly Ala Ala Ala Ser Gly Glu Arg Asp
Asp 130 135 140 Arg Gly Pro Pro Ala Ser Val Ala Ala Leu Arg Ser Asn
Phe Glu 145 150 155 6 221 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 6 Met Val Asp Pro Val Gly Phe
Ala Glu Ala Trp Lys Ala Gln Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro
Arg Met Glu Leu Arg Ser Val Gly Asp Ile Glu 20 25 30 Gln Glu Leu
Glu Arg Cys Lys Ala Ser Ile Arg Arg Leu Glu Gln Glu 35 40 45 Val
Asn Gln Glu Arg Phe Arg Met Ile Tyr Leu Gln Thr Leu Leu Ala 50 55
60 Lys Glu Lys Lys Ser Tyr Asp Arg Gln Arg Trp Gly Phe Arg Arg Ala
65 70 75 80 Ala Gln Ala Pro Asp Gly Ala Ser Glu Pro Arg Ala Ser Ala
Ser Arg 85 90 95 Pro Gln Pro Ala Pro Ala Asp Gly Ala Asp Pro Pro
Pro Ala Glu Glu 100 105 110 Pro Glu Ala Arg Pro Asp Gly Glu Gly Ser
Pro Gly Lys Ala Arg Pro 115 120 125 Gly Thr Ala Arg Arg Pro Gly Ala
Ala Ala Ser Gly Glu Arg Asp Asp 130 135 140 Arg Gly Pro Pro Ala Ser
Val Ala Ala Leu Arg Ser Asn Phe Glu Arg 145 150 155 160 Ile Arg Lys
Gly His Gly Gln Pro Gly Ala Asp Ala Glu Lys Pro Phe 165 170 175 Tyr
Val Asn Val Glu Phe His His Glu Arg Gly Leu Val Lys Val Asn 180 185
190 Asp Lys Glu Val Ser Asp Arg Ile Ser Ser Leu Gly Ser Gln Ala Met
195 200 205 Gln Met Glu Arg Lys Lys Ser Gln His Gly Ala Gly Ser 210
215 220 7 413 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 7 Met Val Asp Pro Val Gly Phe Ala Glu
Ala Trp Lys Ala Gln Phe Pro 1 5 10 15 Asp Ser Glu Pro Pro Arg Met
Glu Leu Arg Ser Val Gly Asp Ile Glu 20 25 30 Gln Glu Leu Glu Arg
Cys Lys Ala Ser Ile Arg Arg Leu Glu Gln Glu 35 40 45 Val Asn Gln
Glu Arg Phe Arg Met Ile Tyr Leu Gln Thr Leu Leu Ala 50 55 60 Lys
Glu Lys Lys Ser Tyr Asp Arg Gln Arg Trp Gly Phe Arg Arg Ala 65 70
75 80 Ala Gln Ala Pro Asp Gly Ala Ser Glu Pro Arg Ala Ser Ala Ser
Arg 85 90 95 Pro Gln Pro Ala Pro Ala Asp Gly Ala Asp Pro Pro Pro
Ala Glu Glu 100 105 110 Pro Glu Ala Arg Pro Asp Gly Glu Gly Ser Pro
Gly Lys Ala Arg Pro 115 120 125 Gly Thr Ala Arg Arg Pro Gly Ala Ala
Ala Ser Gly Glu Arg Asp Asp 130 135 140 Arg Gly Pro Pro Ala Ser Val
Ala Ala Leu Arg Ser Asn Phe Glu Arg 145 150 155 160 Ile Arg Lys Gly
His Gly Gln Pro Gly Ala Asp Ala Glu Lys Pro Phe 165 170 175 Tyr Val
Asn Val Glu Phe His His Glu Arg Gly Leu Val Lys Val Asn 180 185 190
Asp Lys Glu Val Ser Asp Arg Ile Ser Ser Leu Gly Ser Gln Ala Met 195
200 205 Gln Met Glu Arg Lys Lys Ser Gln His Gly Ala Gly Ser Ser Val
Gly 210 215 220 Asp Ala Ser Arg Pro Pro Tyr Arg Gly Arg Ser Ser Glu
Ser Ser Cys 225 230 235 240 Gly Val Asp Gly Asp Tyr Glu Asp Ala Glu
Leu Asn Pro Arg Phe Leu 245 250 255 Lys Asp Asn Leu Ile Asp Ala Asn
Gly Gly Ser Arg Pro Pro Trp Pro 260 265 270 Pro Leu Glu Tyr Gln Pro
Tyr Gln Ser Ile Tyr Val Gly Gly Met Met 275 280 285 Glu Gly Glu Gly
Lys Gly Pro Leu Leu Arg Ser Gln Ser Thr Ser Glu 290 295 300 Gln Glu
Lys Arg Leu Thr Trp Pro Arg Arg Ser Tyr Ser Pro Arg Ser 305 310 315
320 Phe Glu Asp Cys Gly Gly Gly Tyr Thr Pro Asp Cys Ser Ser Asn Glu
325 330 335 Asn Leu Thr Ser Ser Glu Glu Asp Phe Ser Ser Gly Gln Ser
Ser Arg 340 345 350 Val Ser Pro Ser Pro Thr Thr Tyr Arg Met Phe Arg
Asp Lys Ser Arg 355 360 365 Ser Pro Ser Gln Asn Ser Gln Gln Ser Phe
Asp Ser Ser Ser Pro Pro 370 375 380 Thr Pro Gln Cys His Lys Arg His
Arg His Cys Pro Val Val Val Ser 385 390 395 400 Glu Ala Thr Ile Val
Gly Val Arg Lys Thr Gly Gln Ile 405 410 8 18 PRT Artificial
Sequence Description of Artificial Sequence Synthetic Peptide 8 Gly
His Gly Gln Pro Gly Ala Asp Ala Glu Lys Pro Phe Tyr Val Asn 1 5 10
15 Val Glu 9 7 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 9 Arg Ser Tyr Ser Pro Arg Ser 1 5 10 12
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 10 Val Ser Pro Ser Pro Thr Thr Tyr Arg Met Phe
Arg 1 5 10 11 39 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 11 Phe Leu Lys Asp Asn Leu Ile Asp Ala
Asn Gly Gly Ser Arg Pro Pro 1 5 10 15 Trp Pro Pro Leu Glu Tyr Gln
Pro Tyr Gln Ser Ile Tyr Val Gly Gly 20 25 30 Met Met Glu Gly Glu
Gly Lys 35 12 9 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 12 Asn Ser Leu Glu Thr Leu Leu Tyr Lys 1
5 13 4 PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 13 Tyr Val Asn Val 1 14 14 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 14
ctagtctaga ctag 14 15 21 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 15 cccctggagt tccagcccta c 21
16 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 16 cagagcatct tcgtcggggg c 21 17 21 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 17
cgcaggtcct tctccccccg g 21 18 21 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 18 ggaggcggct
ttaccccgga c 21 19 21 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 19 tggtcgactc gcgactcttc c 21
20 18 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 20 atcatcaccg acacatcc 18 21 18 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 21
ggatgtgtcg gtgatgat 18 22 17 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 22 Ser Ser Arg Val Ser Pro
Ser Pro Thr Thr Tyr Arg Met Phe Arg Asp 1 5 10 15 Lys 23 53 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 23 Ser Gln Ser Thr Ser Glu Gln Glu Lys Arg Leu Thr Trp Pro
Arg Arg 1 5 10 15 Ser Tyr Ser Pro Arg Ser Phe Glu Asp Cys Gly Gly
Gly Tyr Thr Pro 20 25 30 Asp Cys Ser Ser Asn Glu Asn Leu Thr Ser
Ser Glu Glu Asp Phe Ser 35 40 45 Ser Gly Gln Ser Ser 50 24 5 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 24 Phe Tyr Val Asn Val 1 5 25 5 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 25 Thr Tyr Arg
Met Phe 1 5 26 7 PRT Artificial Sequence Description of Artificial
Sequence Synthetic Peptide 26 Tyr Gln Ser Ile Tyr Val Gly 1 5 27 13
PRT Artificial Sequence Description of Artificial Sequence
Synthetic Peptide 27 Pro Gly Ala Asp Ala Glu Lys Pro Phe Tyr Val
Asn Val 1 5 10 28 350 PRT Artificial Sequence Description of
Artificial Sequence Synthetic Peptide 28 Ala Lys Glu Lys Lys Ser
Tyr Asp Arg Gln Arg Trp Gly Phe Arg Arg 1 5 10 15 Ala Ala Gln Ala
Pro Asp Gly Ala Ser Glu Pro Arg Ala Ser Ala Ser 20 25 30 Arg Pro
Gln Pro Ala Pro Ala Asp Gly Ala Asp Pro Pro Pro Ala Glu 35 40 45
Glu Pro Glu Ala Arg Pro Asp Gly Glu Gly Ser Pro Gly Lys Ala Arg 50
55 60 Pro Gly Thr Ala Arg Arg Pro Gly Ala Ala Ala Ser Gly Glu Arg
Asp 65 70 75 80 Asp Arg Gly Pro Pro Ala Ser Val Ala Ala Leu Arg Ser
Asn Phe Glu 85 90 95 Arg Ile Arg Lys Gly His Gly Gln Pro Gly Ala
Asp Ala Glu Lys Pro 100 105 110 Phe Tyr Val Asn Val Glu Phe His His
Glu Arg Gly Leu Val Lys Val 115 120 125 Asn Asp Lys Glu Val Ser Asp
Arg Ile Ser Ser Leu Gly Ser Gln Ala 130 135 140 Met Gln Met Glu Arg
Lys Lys Ser Gln His Gly Ala Gly Ser Ser Val 145 150 155 160 Gly Asp
Ala Ser Arg Pro Pro Tyr Arg Gly Arg Ser Ser Glu Ser Ser 165 170 175
Cys Gly Val Asp Gly Asp Tyr Glu Asp Ala Glu Leu Asn Pro Arg Phe 180
185 190 Leu Lys Asp Asn Leu Ile Asp Ala Asn Gly Gly Ser Arg Pro Pro
Trp 195 200 205 Pro Pro Leu Glu Tyr Gln Pro Tyr Gln Ser Ile Tyr Val
Gly Gly Met 210 215 220 Met Glu Gly Glu Gly Lys Gly Pro Leu Leu Arg
Ser Gln Ser Thr Ser 225 230 235 240 Glu Gln Glu Lys Arg Leu Thr Trp
Pro Arg Arg Ser Tyr Ser Pro Arg 245 250 255 Ser Phe Glu Asp Cys Gly
Gly Gly Tyr Thr Pro Asp Cys Ser Ser Asn 260 265 270 Glu Asn Leu Thr
Ser Ser Glu Glu Asp Phe Ser Ser Gly Gln Ser Ser 275 280 285 Arg Val
Ser Pro Ser Pro Thr Thr Tyr Arg Met Phe Arg Asp Lys Ser 290 295 300
Arg Ser Pro Ser Gln Asn Ser Gln Gln Ser Phe Asp Ser Ser Ser Pro 305
310 315 320 Pro Thr Pro Gln Cys His Lys Arg His Arg His Cys Pro Val
Val Val 325 330 335 Ser Glu Ala Thr Ile Val Gly Val Arg Lys Thr Gly
Gln Ile 340 345 350
* * * * *