Nematicidal proteins

Abstract

This invention concerns nematicidal proteins obtainable from Bacillus thuringiensis isolates. The subject invention also provides various methods of using these proteins for controlling nematodes.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This is a division of co-pending application Ser. No. 09/738,363 (filed Dec. 15, 2000) which is a division of application Ser. No. 09/076,137 (filed on May 12, 1998, which issued as U.S. Pat. No. 6,166,195 on Dec. 26, 2000) which is a division of application Ser. No. 08/316,301 (filed on Sep. 30, 1994, which issued as U.S. Pat. No. 5,753,492 on May 19, 1998) which is a division of application Ser. No. 07/871,510 (filed on Apr. 23, 1992, now abandoned) which is a continuation-in-part of application Ser. No. 07/693,018 (filed on May 3, 1991, now abandoned) and a continuation-in-part of application Ser. No. 07/830,050 (filed on Jan. 31, 1992, now abandoned). Ser. No. 07/693,018 was a continuation-in-part of Ser. No. 07/565,544 (filed on Aug. 10, 1990, now abandoned) which is a continuation-in-part of application Ser. No. 07/084,653 (filed on Aug. 12, 1987, now U.S. Pat. No. 4,948,734). The subject application is also a continuation-in-part of application Ser. No. 07/675,772 (filed Mar. 27, 1991, now U.S. Pat. No. 5,262,399) which is a continuation-in-part of Ser. No. 07/565,544 and a continuation-in-part of Ser. No. 07/557,246 (filed on Jul. 24, 1990, now U.S. Pat. No. 5,281,530). Ser. No. 07/557,246 is a continuation-in-part of Ser. No.07/535,810 (filed Jun. 11, 1990, now abandoned) which is a continuation-in-part of Ser. No. 07/084,653.

BACKGROUND OF THE INVENTION

[0002] Regular use of chemicals to control unwanted organisms can select for chemical resistant strains. This has occurred in many species of economically important insects and has also occurred in nematodes of sheep, goats, and horses. The development of chemical resistance necessitates a continuing search for new control agents having different modes of action.

[0003] In recent times, the accepted methodology for control of nematodes has centered around the drug benzimidazole and its congeners. The use of these drugs on a wide scale has led to many instances of resistance among nematode populations (Prichard, R. K. et al. [1980] "The problem of anthelmintic resistance in nematodes," Austr. Vet. J. 56:239-251; Coles, G. C. [1986] "Anthelmintic resistance in sheep," In Veterinary Clinics of North America: Food Animal Practice, Vol 2:423-432 [Herd, R. P., eds.] W. B. Saunders, New York). There are more than 100,000 described species of nematodes.

[0004] The bacterium Bacillus thuringiensis (B.t.) produces a .delta.-endotoxin polypeptide that has been shown to have activity against a rapidly growing number of insect species. The earlier observations of toxicity only against lepidopteran insects have been expanded with descriptions of B.t. isolates with toxicity to dipteran and coleopteran insects. These toxins are deposited as crystalline inclusions within the organism. Many strains of B.t. produce crystalline inclusions with no demonstrated toxicity to any insect tested.

[0005] A small number of research articles have been published about the effects of delta endotoxins from B. thuringiensis species on the viability of nematode eggs. Bottjer, Bone and Gill (Experimental Parasitology 60:239-244, 1985) have reported that B.t. kurstaki and B.t. israelensis were toxic in vitro to eggs of the nematode Trichostrongylus colubriformis. In addition, 28 other B.t. strains were tested with widely variable toxicities. The most potent had LD.sub.50 values in the nanogram range. Ignoffo and Dropkin (Ignoffo, C. M. and Dropkin, V. H. [1977] J. Kans. Entomol. Soc. 50:394-398) have reported that the thermostable toxin from Bacillus thuringiensis (beta exotoxin) was active against a free-living nematode, Panagrellus redivivus (Goodey); a plant-parasitic nematode, Meloidogyne incognita (Chitwood); and a fungus-feeding nematode, Aphelenchus avena (Bastien). Beta exotoxin is a generalized cytotoxic agent with little or no specificity. Also, H. Ciordia and W. E. Bizzell (Jour. of Parasitology 47:41 [abstract] 1961) gave a preliminary report on the effects of B. thuringiensis on some cattle nematodes.

[0006] At the present time there is a need to have more effective means to control the many nematodes that cause considerable damage to susceptible hosts. Advantageously, such effective means would employ biological agents.

BRIEF SUMMMARY OF THE INVENTION

[0007] The subject invention concerns novel toxins active against nematodes. A further aspect of the invention concerns genes coding for nematicidal toxins. The subject invention provides the person skilled in this art with a vast array of nematicidal toxins, methods for using these toxins, and genes that code for the toxins.

[0008] One aspect of the invention is the discovery of two generalized chemical formulae common to a wide range of nematicidal toxins. These formulae can be used by those skilled in this art to obtain and identify a wide variety of toxins having the desired nematicidal activity. The subject invention concerns other teachings which enable the skilled practitioner to identify and isolate nematode active toxins and the genes which code therefor. For example, characteristic features of nematode-active toxin crystals are disclosed herein. Furthermore, characteristic levels of amino acid homology can be used to characterize the toxins ofthe subject invention. Yet another characterizing feature pertains to immunoreactivity with certain antibodies. Also, nucleotide probes specific for genes encoding toxins with nematicidal activity are described.

[0009] In addition to the teachings of the subject invention which define groups of B.t. toxins with advantageous nematicidal activity, a further aspect of the subject invention is the provision of specific nematicidal toxins and the nucleotide sequences which code for these toxins.

[0010] One aspect of the of the subject invention is the discovery of two groups of B.t.-derived nematode-active toxins. One group (CryV) is exemplified by the gene expression products of PS17, PS33F2 and PS63B, while the other group (CryVI) is exemplified by the gene expression products of PS52A1 and PS69D1. The organization of the toxins within each of the two groups can be accomplished by sequence-specific motifs, overall sequence similarity, immunoreactivity, and ability to hybridize with specific probes.

[0011] The genes or gene fragments of the invention encode Bacillus thuringiensis .delta.-endotoxins which have nematicidal activity. The genes or gene fragments can be transferred to suitable hosts via a recombinant DNA vector.

BRIEF DESCRIPTION OF THE SEQUENCES

[0012] SEQ ID NO. 1 discloses the DNA of 17a.

[0013] SEQ ID NO. 2 discloses the amino acid sequence of the toxin encoded by 17a.

[0014] SEQ ID NO. 3 discloses the DNA of 17b.

[0015] SEQ ID NO. 4 discloses the amino acid sequence of the toxin encoded by 17b.

[0016] SEQ ID NO. 5 is the nucleotide sequence of a gene from 33F2.

[0017] SEQ ID NO. 6 is the amino acid sequence of the protein expressed by the gene from 33F2.

[0018] SEQ ID NO. 7 is the nucleotide sequence of a gene from 52A1.

[0019] SEQ ID NO. 8 is the amino acid sequence of the protein expressed by the gene from 52A1.

[0020] SEQ ID NO. 9 is the nucleotide sequence of a gene from 69D1.

[0021] SEQ ID NO. 10 is the amino acid sequence of the protein expressed by the gene from 69D1.

[0022] SEQ ID NO. 11 is the nucleotide sequence of a gene from 63B.

[0023] SEQ ID NO. 12 is the amino acid sequence of the protein expressed by the gene from 63B.

[0024] SEQ ID NO. 13 is the amino acid sequence of a probe which can be used according to the subject invention.

[0025] SEQ ID NO. 14 is the DNA coding for the amino acid sequence of SEQ ID NO. 13.

[0026] SEQ ID NO. 15 is the amino acid sequence of a probe which can be used according to the subject invention.

[0027] SEQ ID NO. 16 is the DNA coding for the amino acid sequence of SEQ ID NO. 15.

[0028] SEQ ID NO. 17 is the N-terminal amino acid sequence of 17a.

[0029] SEQ ID NO. 18 is the N-terminal amino acid sequence of 17b.

[0030] SEQ ID NO. 19 is the N-terminal amino acid sequence of 52A1.

[0031] SEQ ID NO. 20 is the N-terminal amino acid sequence of 63B.

[0032] SEQ ID NO. 21 is the N-terminal amino acid sequence of 69D1.

[0033] SEQ ID NO. 22 is the N-terminal amino acid sequence of 33F2.

[0034] SEQ ID NO. 23 is an internal amino acid sequence for 63B.

[0035] SEQ ID NO. 24 is a synthetic oligonucleotide derived from 17.

[0036] SEQ ID NO. 25 is an oligonucleotide probe designed from the N-terminal amino acid sequence of 52A1.

[0037] SEQ ID NO. 26 is the synthetic oligonucleotide probe designated as 69D1-D.

[0038] SEQ ID NO. 27 is the forward oligonucleotide primer from 63B.

[0039] SEQ ID NO. 28 is the reverse oligonucleotide primer from 63B.

[0040] SEQ ID NO. 29 is the nematode (NEMI) variant of region 5 of Hofte and Whiteley.

[0041] SEQ ID NO. 30 is the reverse complement primer to SEQ ID NO. 29, used according to the subject invention.

[0042] SEQ ID NO. 31 is a peptide used according to the subject invention.

[0043] SEQ ID NO. 32 is an oligonucleotide coding for the peptide of SEQ ID NO. 31.

[0044] SEQ ID NO. 33 is oligonucleotide probe 33F2A.

[0045] SEQ ID NO. 34 is oligonucleotide probe 33F2B.

[0046] SEQ ID NO. 35 is a reverse primer used according to the subject invention.

[0047] SEQ ID NO. 36 is a forward primer according to the subject invention.

[0048] SEQ ID NO. 37 is a probe according to the subject invention.

[0049] SEQ ID NO. 38 is a probe according to the subject invention.

[0050] SEQ ID NO. 39 is a probe according to the subject invention.

[0051] SEQ ID NO. 40 is a forward primer according to the subject invention.

DETAILED DISCLOSURE OF THE INVENTION

[0052] The subject invention concerns a vast array of B.t. .delta.-endotoxins having nematicidal activity. In addition to having nematicidal activity, the toxins of the subject invention will have one or more of the following characteristics:

[0053] 1. An amino acid sequence according to either of the two generic formulae disclosed herein.

[0054] 2. A high degree of amino acid homology with specific toxins disclosed herein.

[0055] 3. A DNA sequence encoding the toxin which hybridizes with probes or genes disclosed herein.

[0056] 4. A nucleotide sequence which can be amplified using primers disclosed herein.

[0057] 5. A crystal toxin presentation as described herein.

[0058] 6. Immunoreactivity to an antibody raised to a specific toxin disclosed herein.

[0059] One aspect of the subject invention concerns the discovery of generic chemical formulae which describe toxins having activity against nematodes. Two formulae are provided: one which pertains to nematicidal toxins having molecular weights of between about 45 kDa and 65 kDa, and the other pertains to larger nematicidal proteins having molecular weights from about 65 kDa to about 155 kDa. These formulae represent two different categories of B.t. .delta.-endotoxins, each of which has activity against nematodes. The formula describing smaller proteins describes many CryV proteins, while the formula describing larger proteins describes many CryVI proteins. A description of these two formulae is as follows:

[0060] Generic Formula I. This formula describes toxin proteins having molecular weights from about 65 kDa to about 155 kDa. The first 650-700 amino acids for proteins in excess of about 75 kDa and the entire molecule (for proteins of less than about 75 kDa) have substantially the following sequence:

1 1 MOXXXXXXPX BPYNBLOXXP XZXXXXXXXX OXxXXBXXXE UXBKXBJJXX XOxxxxZXXZ xXOBXJXBJX XBXXXXBXYX XXVUXZLZLB xxXXXOBPXB 101 ZBXXPBLZBB BXXBXXXXOx xxXUXOXLBX XBOXXBUJBL DJXLXXXXXX XLUXELXXBX XLXXKXXXXB XExxBXXHXX BXXBXXZXXX KBXXXXBZXX 201 ZBXOXXBXXB LOEXXXJxxx LXBPXYXBXO XMXLXXXXXX LXXZXOWXXK BxxxxxxxxX XXXXOLXXXK XXBKXXLXBY XXXXXXBBXX XLXZXZxxZX 301 XXXBXJXXXY XJXMXXX*LE BXXXXPOBXP EXYxxxZZXL XLXKOKXLBZ XBBXXXXXxx XZBOLXUXXX XOXXXXXXXX ZXXXBXXXXJ JBXKxUBKBY 401 XXXXXXX*XX *Bx*YXXXBX BUXXXXOXXY ZXxxxXEPXX ZXXxxxBXXX XPBXXBUXXO XXOXXXXXXX XXOXXXKZXB *XLxxxxxxx *BXXKX*XXX 501 ZXZXZXZ*XX XLXZXXXXXX XXXXXXXXXX XZXXxxxxx XLBXXXXPXE XXXXUXLZXX EXXZxUBXXX ZBPBEKxxOZ XXXXBxxBKE WLUZOXXXXL 601 ZPZUZXZBXB OUXOZZXYXB RCRYOZXXXO XBBBUxBXXZ ZXUPLXXUBX BXXOXEXXOX XXXXUXBXXB KZLXXXXXXB xxxxXxJLPX XXBXBXBOUX 701 ZSSXBXLDKL EBBPBX

[0061] Numbering is for convenience and approximate location only.

2 Symbols used: A = ala G = gly M = met S = ser C = cys H = his N = asn T = thr D = asp I = ile P = pro V = val E = glu K = lys Q = gln W = trp F = phe L = leu R = arg Y = tyr K = K or R E = E or D L = L or I B = M, L, I, V, or F J = K, R, E, or D O = A or T U = N or Q Z = G or S X = any naturally occurring amino acid, except C. * = any naturally occurring amino acid. x = any naturally occurring amino acid, except C (or complete omission of any amino acids).

[0062] Where a stretch of wild-card amino acids are encountered (X(n) or x(n) where n>2), repetition of a given amino acid should be avoided. Similarly, P, C, E, D, K, or R utilization should be minimized.

[0063] This formula (hereinafter referred to as Generic Formula I) is exemplified in the current application by the specific toxins 17a, 17b and 63b.

[0064] Generic Formula II. This formula describes toxin proteins having molecular weights from about 45 kDa to about 65 kDa. Their primary amino acid structure substantially follows the motif illustrated below:

3 1 MLBXXXXOBP KHxxxXXXXO XXXXZXKKxx xXZPXXBXXX XXBLLZKXEW OXBXOYBXOZ XZLPBUJXXB KXHBXLXXJL XLPXJBXULY JBYXXJKXXX 101 XWWUXXLXPLBBKXOUJLXX YZBKXOZJXX KKxxZXXJXB UJJBJULXJU XXJJOXXXKO XKJBXOKCXL LLKEOJUYJX OOJXBXXXLX XBLXZXUxxx 201 xXJBXZBXXB UXXLXXBXXX LXXXXZJXZP XXJELLJKBJ XLKXXLEXXL KOEUJLEKKB BXZBXLZPLL ZBBBYELLEX OOBXXLXXXB JXLXXXLJXO 301 UXJLJKJBKL LZBBUZLXOJ LJXBXXUZXX OLXBBXKLXZ LWXXLXXULX ULKXOZXXEB XJXXJXJXLX LELXJOXXXW XXBOXEOXXB XLUZYXXxxx 401 (x)n.sup.a .sup.aWhere n = 0-100

[0065] The symbols used for this formula are the same as those used for Generic Formula I.

[0066] This formula (hereinafter referred to as Generic Formula II) is exemplified in the current application by specific toxins 52A1 and 69D1.

[0067] Nematode-active toxins according to the formulae of the subject invention are specifically exemplified herein by the toxins encoded by the genes designated 17a, 17b, 63B, 52A1, and 69D1. Since these toxins are merely exemplary of the toxins represented by the generic formulae presented herein, it should be readily apparent that the subject invention further comprises equivalent toxins (and nucleotide sequences coding for equivalent toxins) having the same or similar biological activity of the specific toxins disclosed or claimed herein. These equivalent toxins will have amino acid homology with the toxins disclosed and claimed herein. This amino acid homology will typically be greater than 50%, preferably be greater than 75%, and most preferably be greater than 90%. The amino acid homology will be highest in certain critical regions of the toxin which account for biological activity or are involved in the determination of three-dimensional configuration which ultimately is responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions which are not critical to activity or are conservative amino acid substitutions which do not affect the three-dimensional configuration of the molecule. For example, amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound. Table 1 provides a listing of examples of amino acids belonging to each class.

4 TABLE 1 Class of Amino Acid Examples of Amino Acids Nonpolar Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Uncharged Polar Gly, Ser, Thr, Cys, Tyr, Asn, Gln Acidic Asp, Glu Basic Lys, Arg, His

[0068] In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not significantly detract from the biological activity of the toxin. The information presented in the generic formulae of the subject invention provides clear guidance to the person skilled in this art in making various amino acid substitutions.

[0069] Further guidance for characterizing the nematicidal toxins of the subject invention is provided in Tables 3 and 4, which demonstrate the relatedness among toxins within each of the above-noted groups of nematicidal toxins (CryV and CryVI). These tables show a numeric score for the best matching alignment between two proteins that reflects: (1) positive scores for exact matches, (2) positive or negative scores reflecting the likelihood (or not) of one amino acid substituting for another in a related protein, and (3) negative scores for the introduction of gaps. A protein sequence aligned to itself will have the highest possible score--i.e., all exact matches and no gaps. However, an unrelated protein or a randomly generated sequence will typically have a low positive score. Related sequences have scores between the random background score and the perfect match score.

[0070] The sequence comparisons were made using the algorithm of Smith and Waterman ([1981] Advances in Applied Mathematics 2:482-489), implemented as the program "Bestfit" in the GCG Sequence Analysis Software Package Version 7 April 1991. The sequences were compared with default parameter values (comparison table: Swgappep.Cmp, Gap weight:3.0, Length weight:0.1) except that gap limits of 175 residues were applied to each sequence compared. The program output value compared is referred to as the Quality score.

[0071] Tables 3 and 4 show the pairwise alignments between the indicated amino acids of the two classes of nematode-active proteins CryV and CryVI and representatives of dipteran (CryIV; Sen, K. et al. [1988] Agric. Biol. Chem. 52:873-878), lepidopteran and dipteran (CryIIA; Widner and Whiteley [1989] J. Bacteriol. 171:965-974), lepidopteran (CryIA(c); Adang et al. [1981] Gene 36:289-300), and coleopteran (CryIIIA; Herrnstadt et al. [1987] Gene 57:37-46) proteins.

[0072] Table 2 shows which amino acids were compared from the proteins of interest.

5 TABLE 2 Protein Amino acids compared 63B 1-692 33F2 1-618 17a 1-677 17b 1-678 CryIV 1-633 CryIIA 1-633 CryIA(c) 1-609 CryIIIA 1-644 69D1 1-395 52A1 1-475

[0073] Table 3 shows the scores prior to adjustment for random sequence scores.

6 TABLE 3 63B 33F2 17a CryIVA CryIIA CryIA(c) CryIIIA 52A1 69D1 63B 1038 274 338 235 228 232 244 154 122 33F2 927 322 251 232 251 270 157 130 17a 1016 240 240 237 249 152 127 CryIVA 950 245 325 326 158 125 CryIIA 950 244 241 151 132 CryIA(c) 914 367 151 127 CryIIIA 966 150 123 52A1 713 350 69D1 593

[0074] Note that for each nematode-active protein, the highest score is always with another nematode-active protein. For example, 63B's highest score, aside from itself, is with 17a. Furthermore, 33F2's highest score, aside from itself, is also with 17a.

[0075] Similarly, 52A1 and 69D1 have a higher score versus each other than with the other proteins.

[0076] Table 4 shows the same analysis after subtraction of the average score of 50 alignments of random shuffles of the column sequences with the row sequences.

7 TABLE 4 63B 33F2 17a CryIVA CryIIA CryIA(c) CryIIIA 52A1 69D1 63B 830 81 130 40 32 42 48 0.1 -8.8 33F2 740 128 66 48 72 85 1.4 -2.9 17a 808 45 45 45 54 -0.8 -5.2 CryIVA 759 54 142 138 5.4 -4.1 CryIIA 755 58 53 -2.3 6 CryIA(c) 728 185 3.1 0 CryIIIA 766 -2.3 -6.9 52A1 566 221 69D1 465

[0077] Note that in Table 4 the same relationships hold as in Table 3, i.e., 63B's highest score, aside from itself, is with 17a, and 33F2's highest score, aside from itself, is also with 17a.

[0078] Similarly, 52A1 and 69D1 have a better score versus each other than with the other proteins.

[0079] Thus, certain toxins according to the subject invention can be defined as those which have nematode activity and either have an alignment value (according to the procedures of Table 4) greater than 100 with 17a or have an alignment value greater than 100 with 52A1. As used herein, the term "alignment value" refers to the scores obtained above and used to create the scores reported in Table 4.

[0080] The toxins of the subject invention can also be characterized in terms of the shape and location of crystal toxin inclusions. Specifically, nematode-active inclusions typically remain attached to the spore after cell lysis. These inclusions are not inside the exosporium, as in previous descriptions of attached inclusions, but are held within the spore by another mechanism. Inclusions of the nematode-active isolates are typically amorphic, generally long and/or multiple. These inclusions are distinguishable from the larger round/amorphic inclusions that remain attached to the spore. No B.t. strains that fit this description have been found to have activity against the conventional targets--Lepidoptera, Diptera, or Colorado Potato Beetle. All nematode-active strains fit this description except one. Thus, there is a very high correlation between this crystal structure and nematode activity.

[0081] The genes and toxins according to the subject invention include not only the full length sequences disclosed herein but also fragments of these sequences, or fusion proteins, which retain the characteristic nematicidal activity of the sequences specifically exemplified herein.

[0082] It should be apparent to a person skilled in this art that genes coding for nematode-active toxins can be identified and obtained through several means. The specific genes may be obtained from a culture depository as described below. These genes, or portions thereof, may be constructed synthetically, for example, by use of a gene machine. Variations of these genes may be readily constructed using standard techniques for making point mutations. Also, fragments of these genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cut off nucleotides from the ends of these genes. Also, genes which code for active fragments may be obtained using a variety of other restriction enzymes. Proteases may be used to directly obtain active fragments of these toxins.

[0083] Equivalent toxins and/or genes encoding these equivalent toxins can also be located from B.t. isolates and/or DNA libraries using the teachings provided herein. There are a number of methods for obtaining the nematode-active toxins of the instant invention which occur in nature. For example, antibodies to the nematode-active toxins disclosed and claimed herein can be used to identify and isolate other toxins from a mixture of proteins. Specifically, antibodies maybe raised to the portions of the nematode-active toxins which are most constant and most distinct from other B.t. toxins. These antibodies can then be used to specifically identify equivalent toxins with the characteristic nematicidal activity by immunoprecipitation, enzyme linked immunoassay (ELISA), or Western blotting. Antibodies to the toxins disclosed herein, or to equivalent toxins, or fragments of these toxins, can readily be prepared using standard procedures in this art. The genes coding for these toxins can then be obtained from the microorganism.

[0084] A further method for identifying the toxins and genes of the subject invention is through the use of oligonucleotide probes. These probes are nucleotide sequences having a detectable label. As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical. The probe's detectable label provides a means for determining in a known manner whether hybridization has occurred. Such a probe analysis provides a rapid method for identifying nematicidal endotoxin genes of the subject invention.

[0085] The nucleotide segments which are used as probes according to the invention can be synthesized by use of DNA synthesizers using standard procedures. In the use of the nucleotide segments as probes, the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and non-radioactive labels. Typical radioactive labels include .sup.32P, .sup.125I, .sup.35S, or the like. A probe labeled with a radioactive isotope can be constructed from a nucleotide sequence complementary to the DNA sample by a conventional nick translation reaction, using a DNase and DNA polymerase. The probe and sample can then be combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting.

[0086] Non-radioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases or perioxidases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives. The probe may also be labeled at both ends with different types of labels for ease of separation, as, for example, by using an isotopic label at the end mentioned above and a biotin label at the other end.

[0087] Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probes of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to an ordinarily skilled artisan. Other methods may become known in the future.

[0088] The known methods include, but are not limited to:

[0089] (1) synthesizing chemically or otherwise an artificial sequence which is a mutation, insertion or deletion of the known sequence;

[0090] (2) using a probe of the present invention to obtain via hybridization a new sequence or a mutation, insertion or deletion of the probe sequence; and

[0091] (3) mutating, inserting or deleting a test sequence in vitro or in vivo.

[0092] It is important to note that the mutational, insertional, and deletional variants generated from a given probe may be more or less efficient than the original probe. Notwithstanding such differences in efficiency, these variants are within the scope of the present invention.

[0093] Thus, mutational, insertional, and deletional variants of the disclosed test sequences can be readily prepared by methods which are well known to those skilled in the art. These variants can be used in the same manner as the instant probes so long as the variants have substantial sequence homology with the probes. As used herein, substantial sequence homology refers to homology which is sufficient to enable the variant to function in the same capacity as the original probe. Preferably, this homology is greater than 50%; more preferably, this homology is greater than 75%; and most preferably, this homology is greater than 90%. The degree of homology needed for the variant to function in its intended capacity will depend upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are designed to improve the function of the sequence or otherwise provide a methodological advantage.

[0094] Specific nucleotide probes useful, according to the subject invention, in the rapid identification of nematode-active genes are

[0095] (i) DNA coding for a peptide sequence whose single letter amino acid designation is "REWINGAN" (SEQ ID NO. 13) or variations thereof which embody point mutations according to the following: position 1, R or P or K; position 3, W or Y; position 4, I or L; position 8, N or P; a specific example of such a probe is "AGA(A or G)T(G or A)(G or T)(A or T)T(A or T)AATGG(A or T)GC(G or T)(A or C)A(A or T)" (SEQ ID NO. 14);

[0096] (ii) DNA coding for a peptide sequence whose single letter amino acid designation is "PTFDPDLY" (SEQ ID NO. 15) or variations thereof which embody point mutations according to the following: position 3, F or L; position 4, D or Y; position 7, L or H or D; a specific example of such a probe is "CC(A or T)AC(C or T)TTT(T or G)ATCCAGAT(C or G)(T or A)TAT" (SEQ ID NO. 16).

[0097] The potential variations in the probes listed is due, in part, to the redundancy of the genetic code. Because of the redundancy of the genetic code, i.e., more than one coding nucleotide triplet (codon) can be used for most of the amino acids used to make proteins. Therefore different nucleotide sequences can code for a particular amino acid. Thus, the amino acid sequences of the B.t. toxins and peptides can be prepared by equivalent nucleotide sequences encoding the same amino acid sequence of the protein or peptide. Accordingly, the subject invention includes such equivalent nucleotide sequences. Also, inverse or complement sequences are an aspect of the subject invention and can be readily used by a person skilled in this art. In addition it has been shown that proteins of identified structure and function may be constructed by changing the amino acid sequence if such changes do not alter the protein secondary structure (Kaiser, E. T. and Kezdy, F. J. [1984] Science 223:249-255). Thus, the subject invention includes mutants of the amino acid sequence depicted herein which do not alter the protein secondary structure, or if the structure is altered, the biological activity is substantially retained. Further, the invention also includes mutants of organisms hosting all or part of a toxin encoding a gene of the invention. Such microbial mutants can be made by techniques well known to persons skilled in the art. For example, UV irradiation can be used to prepare mutants of host organisms. Likewise, such mutants may include asporogenous host cells which also can be prepared by procedures well known in the art.

[0098] The toxin genes or gene fragments exemplified according to the subject invention can be obtained from nematode-active B. thuringiensis (B.t.) isolates designated PS17, PS33F2, PS63B, PS52A1, and PS69D1. Subcultures of the E. coli host harboring the toxin genes of the invention were deposited in the permanent collection of the Northern Research Laboratory, U.S. Department of Agriculture, Peoria, Ill., USA. The accession numbers are as follows:

8 Culture Repository No. Deposit Date B.t. isolate PS17 NRRL B-18243 Jul. 28, 1987 B.t. isolate PS33F2 NRRL B-18244 Jul. 28, 1987 B.t. isolate PS63B NRRL B-18246 Jul. 28, 1987 B.t. isolate PS52A1 NRRL B-18245 Jul. 28, 1987 B.t. isolate PS69D1 NRRL B-18247 Jul. 28, 1987 E. coli NM522 (pMYC 2316) NRRL B-18785 Mar. 15, 1991 E. coli NM522 (pMYC 2321) NRRL B-18770 Feb. 14, 1991 E. coli NM522 (pMYC 2317) NRRL B-18816 Apr. 24, 1991 E. coli NM522 (pMYC 1627) NRRL B-18651 May 11, 1990 E. coli NM522 (pMYC 1628) NRRL B-18652 May 11, 1990 E. coli NM522 (pMYC 1642) NRRL B-18961 Apr. 10, 1992

[0099] The subject cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 USC 122. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

[0100] Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposit(s). All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them.

[0101] The novel B.t. genes or gene fragments of the invention encode toxins which show activity against tested nematodes. The group of diseases described generally as helminthiasis is due to infection of an animal host with parasitic worms known as helminths. Helminthiasis is a prevalent and serious economic problem in domesticated animals such as swine, sheep, horses, cattle, goats, dogs, cats and poultry. Among the helminths, the group of worms described as nematodes causes wide-spread and often times serious infection in various species of animals. The most common genera of nematodes infecting the animals referred to above are Haemonchus, Trichostrongylus, Ostertagia, Nematodirus, Cooperia, Ascaris, Bunostomum, Oesophagostomum, Chabertia, Trichuris, Strongylus, Trichonema, Dictyocaulus, Capillaria, Heterakis, Toxocara, Ascaridia, Oxyuris, Ancylostoma, Uncinaria, Toxascaris, Caenorhabditis and Parascaris. Certain of these, such as Nematodirus, Cooperia, and Oesophagostomum, attack primarily the intestinal tract, while others, such as Dictyocaulus are found in the lungs. Still other parasites may be located in other tissues and organs of the body.

[0102] The toxins encoded by the novel B.t. genes of the invention are useful as nematicides for the control of soil nematodes and plant parasites selected from the genera Bursaphalenchus, Criconemella, Ditylenchus, Globodera, Helicotylenchus, Heterodera, Melodoigyne, Pratylenchus, Radolpholus, Rotelynchus, or Tylenchus.

[0103] Alternatively, because some plant parasitic nematodes are obligate parasites, genes coding for nematicidal B.t. toxins can be engineered into plant cells to yield nematode-resistant plants. The methodology for engineering plant cells is well established (cf. Nester, E. W., Gordon, M. P., Amasino, R. M. and Yanofsky, M. F., Ann. Rev. Plant Physiol. 35:387-399, 1984).

[0104] The B.t. toxins of the invention can be administered orally in a unit dosage form such as a capsule, bolus or tablet, or as a liquid drench when used as an anthelmintic in mammals, and in the soil to control plant nematodes. The drench is normally a solution, suspension or dispersion of the active ingredient, usually in water, together with a suspending agent such as bentonite and a wetting agent or like excipient. Generally, the drenches also contain an antifoaming agent. Drench formulations generally contain from about 0.001 to 0.5% by weight of the active compound.

[0105] Preferred drench formulations may contain from 0.01 to 0.1% by weight, the capsules and boluses comprise the active ingredient admixed with a carrier vehicle such as starch, talc, magnesium stearate, or dicalcium phosphate.

[0106] Where it is desired to administer the toxin compounds in a dry, solid unit dosage form, capsules, boluses or tablets containing the desired amount of active compound usually are employed. These dosage forms are prepared by intimately and uniformly mixing the active ingredient with suitable finely divided diluents, fillers, disintegrating agents and/or binders such as starch, lactose, talc, magnesium stearate, vegetable gums and the like. Such unit dosage formulations may be varied widely with respect to their total weight and content of the antiparasitic agent, depending upon the factors such as the type of host animal to be treated, the severity and type of infection and the weight of the host.

[0107] When the active compound is to be administered via an animal feedstuff, it is intimately dispersed in the feed or used as a top dressing or in the form of pellets which may then be added to the finished feed or, optionally, fed separately. Alternatively, the antiparasitic compounds may be administered to animals parenterally, for example, by intraruminal, intramuscular, intratracheal, or subcutaneous injection, in which event the active ingredient is dissolved or dispersed in a liquid carrier vehicle. For parenteral administration, the active material is suitably admixed with an acceptable vehicle, preferably of the vegetable oil variety, such as peanut oil, cotton seed oil and the like. Other parenteral vehicles, such as organic preparations using solketal, glycerol, formal and aqueous parenteral formulations, are also used. The active compound or compounds are dissolved or suspended in the parenteral formulation for administration; such formulations generally contain from 0.005 to 5% by weight of the active compound.

[0108] When the toxins are administered as a component of the feed of the animals, or dissolved or suspended in the drinking water, compositions are provided in which the active compound or compounds are intimately dispersed in an inert carrier or diluent. By inert carrier is meant one that will not react with the antiparasitic agent and one that may be administered safely to animals. Preferably, a carrier for feed administration is one that is, or may be, an ingredient of the animal ration.

[0109] Suitable compositions include feed premixes or supplements in which the active ingredient is present in relatively large amounts and which are suitable for direct feeding to the animal or for addition to the feed either directly or after an intermediate dilution or blending step. Typical carriers or diluents suitable for such compositions include, for example, distillers' dried grains, corn meal, citrus meal, fermentation residues, ground oyster shells, wheat shorts, molasses solubles, corn cob meal, edible bean mill feed, soya grits, crushed limestone and the like.

[0110] The toxin genes or gene fragments of the subject invention can be introduced into a wide variety of microbial hosts. Expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of the nematicide. With suitable hosts, e.g., Pseudomonas, the microbes can be applied to the situs of nematodes where they will proliferate and be ingested by the nematodes. The result is a control of the nematodes. Alternatively, the microbe hosting the toxin gene can be treated under conditions that prolong the activity of the toxin produced in the cell. The treated cell then can be applied to the environment of target pest(s). The resulting product retains the toxicity of the B.t. toxin.

[0111] Where the B.t. toxin gene or gene fragment is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the nematicide from environmental degradation and inactivation.

[0112] A large number of microorganisms are known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syringae. Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, and Azotobacter vinlandii; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms.

[0113] A wide variety of ways are known and available for introducing the B.t. genes or gene fragments expressing the toxin into the microorganism host under conditions which allow for stable maintenance and expression of the gene. The transformants can be isolated in accordance with conventional ways, usually employing a selection technique, which allows for selection of the desired organism as against unmodified organisms or transferring organisms, when present. The transformants then can be tested for nematicidal activity.

[0114] Suitable host cells, where the nematicide-containing cells will be treated to prolong the activity of the toxin in the cell when the then treated cell is applied to the environment of target pest(s), may include either prokaryotes or eukaryotes, normally being limited to those cells which do not produce substances toxic to higher organisms, such as mammals. However, organisms which produce substances toxic to higher organisms could be used, where the toxin is unstable or the level of application sufficiently low as to avoid any possibility of toxicity to amammalian host. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi. Illustrative prokaryotes, both Gram-negative and -positive, include Enterobacteriaceae, such as Escherichia, Erwinia, Shigella, Salmonella, and Proteus; Bacillaceae; Rhizobiceae, such as Rhizobium; Spirillaceae, such as photobacterium, Zymomonas, Serratia, Aeromonas, Vibrio, Desulovibrio, Spirillum; Lactobacillaceae; Pseudomonadaceae, such as Pseudomonas and Acetobacter; Azotobacteraceae and Nitrobacteraceae. Among eukaryotes are fungi, such as Phycomycetes and Ascomycetes, which includes yeast, such as Saccharomyces and Schizosaccharomyces; and Basidiomycetes yeast, such as Rhodotorula, Aureobasidium, Sporobolomyces, and the like.

[0115] Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the B.t. gene or gene fragment into the host, availability of expression systems, efficiency of expression, stability of the nematicide in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a nematicide microcapsule include protective qualities for the nematicide, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; leaf affinity; lack of mammalian toxicity; attractiveness to pests for ingestion; ease of killing and fixing without damage to the toxin; and the like. Other considerations include ease of formulation and handling, economics, storage stability, and the like.

[0116] Host organisms of particular interest include yeast, such as Rhodotorula sp., Aureobasidium sp., Saccharomyces sp., and Sporobolomyces sp.; phylloplane organisms such as Pseudomonas sp., Erwinia sp. and Flavobacterium sp.; or such other organisms as Escherichia, Lactobacillus sp., Bacillus sp., and the like. Specific organisms include Pseudomonas aeruginosa, Pseudomonas fluorescens, Saccharomyces cerevisiae, Bacillus thuringiensis, Escherichia coli, Bacillus subtilis, and the like.

[0117] The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form, although in some instances spores may be employed.

[0118] Treatment of the microbial cell, e.g., a microbe containing the B.t. toxin gene or gene fragment, can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously affect the properties of the toxin, nor diminish the cellular capability in protecting the toxin. Examples of chemical reagents are halogenating agents, particularly halogens of atomic no. 17-80. More particularly, iodine can be used under mild conditions and for sufficient time to achieve the desired results. Other suitable techniques include treatment with aldehydes, such as formaldehyde and glutaraldehyde; anti-infectives, such as zephiran chloride and cetylpyridinium chloride; alcohols, such as isopropyl and ethanol; various histologic fixatives, such as Bouin's fixative and Helly's fixative (See: Humason, Gretchen L., Animal Tissue Techniques, W. H. Freeman and Company, 1967); or a combination of physical (heat) and chemical agents that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host animal. Examples of physical means are short wavelength radiation such as gamma-radiation and X-radiation, freezing, UV irradiation, lyophilization, and the like.

[0119] The cells generally will have enhanced structural stability which will enhance resistance to environmental conditions. Where the pesticide is in a proform, the method of inactivation should be selected so as not to inhibit processing of the proform to the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will crosslink proteins and could inhibit processing of the proform of a polypeptide pesticide. The method of inactivation or killing retains at least a substantial portion of the bio-availability or bioactivity of the toxin.

[0120] The cellular host containing the B.t. nematicidal gene or gene fragment maybe grown in any convenient nutrient medium, where the DNA construct provides a selective advantage, providing for a selective medium so that substantially all or all of the cells retain the B.t. gene or gene fragment. These cells may then be harvested in accordance with conventional ways. Alternatively, the cells can be treated prior to harvesting.

[0121] The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. These procedures are all described in Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. Thus, it is within the skill of those in the genetic engineering art to extract DNA from microbial cells, perform restriction enzyme digestions, electrophorese DNA fragments, tail and anneal plasmid and insert DNA, ligate DNA, transform cells, prepare plasmid DNA, electrophorese proteins, and sequence DNA.

[0122] The B.t. cells may be formulated in a variety of ways. They may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be aqueous-based or non-aqueous and employed as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers.

[0123] The nematicide concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The nematicide will be present in at least 1% by weight and may be 100% by weight. The dry formulations will have from about 1-95% by weight of the nematicide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 10.sup.2 to about 10.sup.4 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare.

[0124] The formulations can be applied to the environment of the nematodes, e.g., plants, soil or water, by spraying, dusting, sprinkling, or the like.

[0125] Following are examples which illustrate procedures, including the best mode, for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

EXAMPLE 1

[0126] Culturing B.t. Isolates of the Invention

[0127] A subculture of a B.t. isolate can be used to inoculate the following medium, a peptone, glucose, salts medium.

9 Bacto Peptone 7.5 g/l Glucose 1.0 g/l KH.sub.2PO.sub.4 3.4 g/l K.sub.2HPO.sub.4 4.35 g/l Salts Solution 5.0 ml/l CaCl.sub.2 Solution 5.0 ml/l Salts Solution (100 ml) MgSO.sub.4.7H.sub.2O 2.46 g MnSO.sub.4.H.sub.2O 0.04 g ZnSO.sub.4.7H.sub.2O 0.28 g FeSO.sub.4.7H.sub.2O 0.40 g CaCl.sub.2 Solution (100 ml) CaCl.sub.2.2H.sub.2O 3.66 g pH 7.2

[0128] The salts solution and CaCl.sub.2 solution are filter-sterilized and added to the autoclaved and cooked broth at the time of inoculation. Flasks are incubated at 30.degree. C. on a rotary shaker at 200 rpm for 64 hr.

EXAMPLE 2

[0129] Purification of Protein and Amino Acid Sequencing

[0130] The B.t. isolates PS17, PS63B, PS52A1, and PS69D1 were cultured as described in Example 1. The parasporal inclusion bodies were partially purified by sodium bromide (28-38%) isopycnic gradient centrifugation (Pfannenstiel, M. A., E. J. Ross, V. C. Kramer, and K. W. Nickerson [1984] FEMS Microbiol. Lett. 21:39). The proteins toxic for the nematode Caenorhabditis elegans were bound to PVDF membranes (Millipore, Bedford, Mass.) by western blotting techniques (Towbin, H., T. Staehlelin, and K. Gordon [1979] Proc. Natl. Acad. Sci. USA 76:4350) and the N-terminal amino acid sequences were determined by the standard Edman reaction with an automated gas-phase sequenator (Hunkapiller, M. W., R. M. Hewick, W. L. Dreyer, and L. E. Hood [1983] Meth. Enzymol. 91:399). The sequences obtained were:

10 PS17a: A I L N E L Y P S V P Y N V (SEQ ID NO.17) PS17b: A I L N E L Y P S V P Y N V (SEQ ID NO.18) PS52A1: M I I D S K T T L P R H S L I N T (SEQ ID NO.19) PS63B: Q L Q A Q P L I P Y N V L A (SEQ ID NO.20) PS69D1: M I L G N G K T L P K H I R L A H I F A T Q N S (SEQ ID NO.21) PS33F2: A T L N E V Y P V N (SEQ ID NO.22)

[0131] In addition, internal amino acid sequence data were derived for PS63B. The toxin protein was partially digested with Staphylococcus aureus V8 protease (Sigma Chem. Co., St. Louis, Mo.) essentially as described (Cleveland, D. W., S. G. Fischer, M. W. Kirschner, and U. K. Laemmli [1977] J. Biol. Chem. 252:1102). The digested material was blotted onto PVDF membrane and a ca. 28 kDa limit peptide was selected for N-terminal sequencing as described above. The sequence obtained was:

[0132] PS63B(2) V Q R I L D E K L S F Q L I K (SEQ ID NO. 23)

[0133] From these sequence data oligonucleotide probes were designed by utilizing a codon frequency table assembled from available sequence data of other B.t. toxin genes. The probes were synthesized on an Applied Biosystems, Inc. DNA synthesis machine.

[0134] Protein purification and subsequent amino acid analysis of the N-terminal peptides listed above has led to the deduction of several oligonucleotide probes for the isolation of toxin genes from nematicidal B.t. isolates. RFLP analysis of restricted total cellular DNA using radiolabeled oligonucleotide probes has elucidated different genes or gene fragments.

EXAMPLE 3

[0135] Cloning of Novel Toxin Genes and Transformation into Escherichia coli

[0136] Total cellular DNA was prepared by growing the cells B.t. PS17 to a low optical density (OD.sub.600=1.0) and recovering the cells by centrifugation. The cells were protoplasted in TES buffer (30 mM Tris-Cl, 10 mM EDTA, 50 mM NaCl, pH=8.0) containing 20% sucrose and 50 mg/ml lysozyme. The protoplasts were lysed by addition of SDS to a final concentration of 4%. The cellular material was precipitated overnight at 4.degree. C. in 100 mM (final concentration) neutral potassium chloride. The supernate was extracted twice with phenol/chloroform (1:1). The DNA was precipitated with ethanol and purified by isopycnic banding on a cesium chloride-ethidium bromide gradient.

[0137] Total cellular DNA from PS17 was digested with EcoRI and separated by electrophoresis on a 0.8% (w/v) Agarose-TAE (50 mM Tris-HCl, 20 mM NaOAc, 2.5 mM EDTA, pH=8.0) buffered gel. A Southern blot of the gel was hybridized with a [.sup.32P]-radiolabeled oligonucleotide probe derived from the N-terminal amino acid sequence of purified 130 kDa protein from PS17. The sequence of the oligonucleotide synthesized is (GCAATTTTAAATGAATTATATCC) (SEQ ID NO. 24). Results showed that the hybridizing EcoRI fragments of PS17 are 5.0 kb, 4.5 kb, 2.7 kb and 1.8 kb in size, presumptively identifying at least four new nematode-active toxin genes, PS17d, PS17b, PS17a and PS17e, respectively.

[0138] A library was constructed from PS17 total cellular DNA partially digested with Sau3A and size fractionated by electrophoresis. The 9 to 23 kb region of the gel was excised and the DNA was electroeluted and then concentrated using an Elutip.TM. ion exchange column (Schleicher and Schuel, Keene N.H.). The isolated Sau3A fragments were ligated into LambdaGEM-11.TM. (PROMEGA). The packaged phage were plated on KW251 E. coli cells (PROMEGA) at a high titer and screened using the above radiolabeled synthetic oligonucleotide as a nucleic acid hybridization probe. Hybridizing plaques were purified and rescreened at a lower plaque density. Single isolated purified plaques that hybridized with the probe were used to infect KW251 E. coli cells in liquid culture for preparation of phage for DNA isolation. DNA was isolated by standard procedures.

[0139] Recovered recombinant phage DNA was digested with EcoRI and separated by electrophoresis on a 0.8% agarose-TAE gel. The gel was Southern blotted and hybridized with the oligonucleotide probe to characterize the toxin genes isolated from the lambda library. Two patterns were present, clones containing the 4.5 kb (PS17b) or the 2.7 kb (PS17a) EcoRI fragments. Preparative amounts of phage DNA were digested with SalI (to release the inserted DNA from lambda arms) and separated by electrophoresis on a 0.6% agarose-TAE gel. The large fragments, electroeluted and concentrated as described above, were ligated to SalI-digested and dephosphorylated pBClac, an E. coli/B.t. shuttle vector comprised of replication origins from pBC16 and pUC19. The ligation mix was introduced by transformation into NM522 competent E. coli cells and plated on LB agar containing ampicillin, isopropyl-(Beta)-D-thiogalactosi- de (IPTG) and 5-Bromo-4-Chloro-3-indolyl-(Beta)-D-galactoside (XGAL). White colonies, with putative insertions in the (Beta)-galactosidase gene of pBClac, were subjected to standard rapid plasmid purification procedures to isolate the desired plasmids. The selected plasmid containing the 2.7 kb EcoRI fragment was named pMYC1627 and the plasmid containing the 4.5 kb EcoRI fragment was called pMYC1628.

[0140] The toxin genes were sequenced by the standard Sanger dideoxy chain termination method using the synthetic oligonucleotide probe, disclosed above, and by "walking" with primers made to the sequence of the new toxin genes.

[0141] The PS17 toxin genes were subcloned into the shuttle vector pHT3101 (Lereclus, D. et al. [1989] FEMS Microbiol. Lett. 60:211-218) using standard methods for expression in B.t. Briefly, SalI fragments containing the 17a and 17b toxin genes were isolated from pMYC1629 and pMYC1627, respectively, by preparative agarose gel electrophoresis, electroelution, and concentrated, as described above. These concentrated fragments were ligated into SalI-cleaved and dephosphorylated pHT3101. The ligation mixtures were used separately to transform frozen, competent E. coli NM522. Plasmids from each respective recombinant E. coli strain were prepared by alkaline lysis and analyzed by agarose gel electrophoresis. The resulting subclones, pMYC2311 and pMYC2309, harbored the 17a and 17b toxin genes, respectively. These plasmids were transformed into the acrystalliferous B.t. strain, HD-1 cryB (Aronson, A., Purdue University, West Lafayette, Ind.), by standard electroporation techniques (Instruction Manual, Biorad, Richmond, Calif.).

[0142] Recombinant B.t. strains HD-1 cryB [pMYC2311] and [pMYC2309] were grown to sporulation and the proteins purified by NaBr gradient centrifugation as described above for the wild-type B.t. proteins.

EXAMPLE 4

[0143] Activity of the B.t. Toxin Protein and Gene Product against Caenorhabditis elegans

[0144] Caenorhabditis elegans (CE) was cultured as described by Simpkin and Coles (J. Chem. Tech. Biotechnol. 31:66-69, 1981) in coming (Corning Glass Works, Corning, N.Y.) 24-well tissue culture plates containing 1 ml S-basal media, 0.5 mg ampicillin and 0.01 mg cholesterol. Each well also contained ca. 10.sup.8 cells of Escherichia coli strain OP-50, a uracil auxotroph. The wells were seeded with ca. 100-200 CE per well and incubated at 20.degree. C. Samples of protein (obtained from the wild type B.t. or the recombinant B.t.) were added to the wells by serial dilution. Water served as the control as well as the vehicle to introduce the proteins to the wells.

[0145] Each of the wells were examined daily and representative results are shown in Table 5 as follow:

11TABLE 5 .mu.g % Kill with protein from indicated isolate Toxin HD-1 cryB [pMYC 2309] HD-1 cryB [pMYC 2311] PS17 100 25 50 75 32 25 50 75 10 50 25 50 1 0 0 0

EXAMPLE 5

[0146] Molecular Cloning of Gene Encoding a Novel Toxin from Bacillus thuringiensis Strain PS52A1.

[0147] Total cellular DNA was prepared from Bacillus thuringiensis PS52A1 (B.t. PS52A1) as disclosed in Example 3.

[0148] RFLP analyses were performed by standard hybridization of Southern blots of PS52A1 DNA with a .sup.32P-labeled oligonucleotide probe designed from the N-terminal amino acid sequence disclosed in Example 2. The sequence of this probe is:

12 5' ATG ATT ATT GAT TCT AAA ACA ACA TTA CCA AGA CAT TCA/T TTA ATA/T AAT (SEQ ID NO.25) ACA/T ATA/T AA 3'

[0149] This probe was designated 52A1-C. Hybridizing bands included an approximately 3.6 kbp HindIII fragment and an approximately 8.6 kbp EcoRV fragment. A gene library was constructed from PS52A1 DNA partially digested with Sau3A. Partial restriction digests were fractionated by agarose gel electophoresis. DNA fragments 6.6 to 23 kbp in size were excised from the gel, electroeluted from the gel slice, and recovered by ethanol precipitation after purification on an Elutip-D ion exchange column. The Sau3A inserts were ligated into BamHI-digested LambdaGem-11 (Promega). Recombinant by phage were packaged and plated on E. coli KW251 cells (Promega). Plaques were screened by hybridization with the radiolabeled 52A1-C oligonucleotide probe disclosed above. Hybridizing phage were plaque-purified and used to infect liquid cultures ofE. coli KW251 cells for isolation of phage DNA by standard procedures (Maniatis et al.). For subeloning, preparative amounts of DNA were digested with EcoRI and SalI, and electrophoresed on an agarose gel. The approximately 3.1 kbp band containing the toxin gene was excised from the gel, electroeluted from the gel slice, and purified by ion exchange chromatography as above. The purified DNA insert was ligated into EcoRI+SalI-digested pHTBlueII (an E. coli/B. thuringiensis shuttle vector comprised of pBluescript S/K [Stratagene] and the replication origin from a resident B.t. plasmid [D. Lereclus et al. 1989. FEMS Microbiology Letters 60:211-218]). The ligation mix was used to transform frozen, competent E. coli NM522 cells (ATCC 47000). Transformants were plated on LB agar containing ampicillin, isopropyl-(Beta)-D-thiogalactoside (IPTG), and 5-Bromo4-Chloro-3-indolyl-(Beta)-D-galactoside (XGAL). Plasmids were purified from putative recombinants by alkaline lysis (Maniatis et al.) and analyzed by electrophoresis of EcoRI and SalI digests on agarose gels. The desired plasmid construct, pMYC2321 contains a toxin gene that is novel compared to the maps of other toxin genes encoding nematicidal proteins.

[0150] Plasmid pMYC2321 was introduced into an acrystalliferous (Cry.sup.-) B.t. host by electroporation. Expression of an approximately 55-60 kDa crystal protein was verified by SDS-PAGE analysis. NaBr-purified crystals were prepared as described in Example 3 for determination of toxicity of the cloned gene product to Pratylenchus spp.

EXAMPLE 6

[0151] Activity of the B.t. PS52A1 Toxin Protein and Gene Product against the Root Lesion Nematode, Pratylenchus scribneri

[0152] Pratylenchus scribneri was reared aseptically on excised corn roots in Gamborg's B5 medium (GIBCO Laboratories, Grand Island, N.Y.). Bioassays were done in 24 well assay plates (Corning #25820) using L 3-4 larvae as described by Tsai and Van Gundy (J. Nematol. 22(3):327-332). Approximately 20 nematodes were placed in each well. A total of 80-160 nematodes were used in each treatment. Samples of protein were suspended in aqueous solution using a hand-held homogenizer.

[0153] Mortality was assessed by prodding with a dull probe 7 days after treatment. Larvae that did not respond to prodding were considered moribund. Representative results are shown below.

13 Rate (ppm) Percent Moribund 200 75 Control 5

EXAMPLE 7

[0154] Molecular Cloning of Gene Encoding a Novel Toxin from Bacillus Thuringiensis Strain PS69D1

[0155] Total cellular DNA was prepared from PS69D1 (B.t. PS69D1) as disclosed in Example 3. RFLP analyses were performed by standard hybridization of Southern blots of PS69D1 DNA with a 32P-labeled oligonucleotide probe designated as 69D1-D. The sequence of the 69D1-D probe was:

[0156] 5'AAA CAT ATT AGA TTA GCA CAT ATT TTT GCA ACA CAA AA 3'(SEQ ID NO. 26)

[0157] Hybridizing bands included an approximately 2.0 kbp HindIII fragment.

[0158] A gene library was constructed from PS69D1 DNA partially digested with Sau3A. Partial restriction digests were fractionated by agarose gel electrophoresis. DNA fragments 6.6 to 23 kbp in size were excised from the gel, electroeluted from the gel slice, and recovered by ethanol precipitation after purification on an Elutip-D ion exchange column. The Sau3A inserts were ligated into BamHI-digested LambdaGem-11 (Promega, Madison, Wis.). Recombinant phage were packaged and plated on E. coli KW251 cells (Promega, Madison, Wis.). Plaques were screened by hybridization with the radiolabeled 69D1-D oligonucleotide probe. Hybridizing phage were plaque-purified and used to infect liquid cultures of E. coli KW251 cells for isolation of phage DNA by standard procedures (Maniatis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.). For subcloning, preparative amounts of DNA were digested with HindIII and electrophoresed on an agarose gel. The approximately, 2.0 kbp band containing the toxin gene was excised from the gel, electroeluted from the gel slice, and purified by ion exchange chromatography as above. The purified DNA insert was ligated into HindIII-digested pHTBlueII (and E. coli/B.t. shuttle vector comprised of pBluescript S/K (Stratagene, San Diego, Calif.) and the replication origin from a resident B.t. plasmid (D. Lereclus et al [1989] FEMS Microbiol. Lett. 60:211-218). The ligation mix was used to transform frozen, competent E. coli NM522 cells (ATCC 47000). Transformants were plated on LB agar containing 5-bromo-4-chloro-3-indolyl-(Beta)-D-galactos- ide (XGAL). Plasmids were purified from putative recombinants by alkaline lysis (Maniatis et al., supra) and analyzed by electrophoresis of HindIII digests on agarose gels. The desired plasmid construct, pMYC2317, contains a toxin gene that is novel compared to the maps ofother toxin genes encoding insecticidal proteins.

EXAMPLE 8

[0159] Molecular Cloning of a Gene Encoding a Novel Toxin from Bacillus thuringiensis Strain PS63B

[0160] Example 2 shows the aminoterminal and internal polypeptide sequences of the PS63B toxin protein as determined by standard Edman protein sequencing. From these sequences, two oligonucleotide primers were designed using a codon frequency table assembled from B.t. genes encoding .delta.-endotoxins. The sequence of the forward primer (63B-A) was complementary to the predicted DNA sequence at the 5' end of the gene:

[0161] 63B-A-5'CAA T/CTA CAA GCA/T CAA CC 3'(SEQ ID NO. 27)

[0162] The sequence of the reverse primer (63B-INT) was complementary to the inverse of the internal predicted DNA sequence:

[0163] 63B-INT-5'TTC ATC TAA AAT TCT TTG A/TAC 3'(SEQ ID NO. 28)

[0164] These primers were used in standard polymerase chain reactions (Cetus Corporation) to amplify an approximately 460 bp fragment of the 63B toxin gene for use as a DNA cloning probe. Standard Southern blots oftotal cellular DNA from PS63B were hybridized with the radiolabeled PCR probe. Hybridizing bands included an approximately 4.4 kbp XbaI fragment, an approximately 2.0 kbp HindIII fragment, and an approximately 6.4 kbp SpeI fragment.

[0165] Total cellular DNA was prepared from Bacillus thuringiensis (B.t.) cells grown to an optical density of 1.0 at 600 nm. The cells were recovered by centrifugation and protoplasts were prepared in lysis mix (300 mM sucrose, 25 mM Tris-HCl, 25 mM EDTA, pH=8.0) and lysozyme at a concentration of 20 mg/ml. The protoplasts were ruptured by addition of ten volumes of 0.1 M NaCl, 0.1 M Tris-HCl pH 8.0, and 0.1% SDS. The cellular material was quickly frozen at -70.degree. C. and thawed to 37.degree. C. twice. The supernatant was extracted twice with phenol/chloroform (1:1). The nucleic acids were precipitated with ethanol. To remove as much RNA as possible from the DNA preparation, RNase at final concentration of 200,.mu.g/ml was added. After incubation at 37.degree. C. for 1 hour, the solution was extracted once with phenol/chloroform and precipitated with ethanol.

[0166] A gene library was constructed from PS63B total cellular DNA partially digested with NdeII and size fractioned by gel electrophoresis. The 9-23 kb region of the gel was excised and the DNA was electroeluted and then concentrated using an Elutip-d ion exchange column (Schleicher and Schuel, Keene, N.H.). The isolated NdeII fragments were ligated into BamHI-digested LambdaGEM-11 (PROMEGA). The packaged phage were plated on E. coli KW251 cells (PROMEGA) at a high titer and screened using the radiolabeled approximately 430 bp fragment probe amplified with the 63B-A and 63B internal primers (SEQ ID NOS. 27 and 28, respectively) by polymerase chain reaction. Hybridizing plaques were purified and rescreened at a lower plaque density. Single isolated, purified plaques that hybridized with the probe were used to infect KW251 cells in liquid culture for preparation of phage for DNA isolation. DNA was isolated by standard procedures (Maniatis et al., supra). Preparative amounts of DNA were digested with SalI (to release the inserted DNA from lambda sequences) and separated by electrophoresis on a 0.6% agarose-TAE gel. The large fragments were purified by ion exchange chromatography as above and ligated to SalI-digested, dephosphorylated pHTBlueII (an E. coli/B.t. shuttle vector comprised of pBlueScript S/K [Stratagene, San Diego, Calif.] and the replication origin from a resident B.t. plasmid [Lereclus, D. et al. (1989) FEMS Microbiol. Lett. 60:211-218]). The ligation mix was introduced by transformation into competent E. coli NM522 cells (ATCC 47000) and plated on LB agar containing ampicillin (100 .mu.g/ml), IPTG (2%), and XGAL (2%). White colonies, with putative restriction fragment insertions in the (Beta)-galactosidase gene of pHTBlueII, were subjected to standard rapid plasmid purification procedures (Maniatis et al., supra). Plasmids ere analyzed by SalI digestion and agarose gel electrophoresis. The desired plasmid construct, pMYC1641, contains an approximately 14 kb SalI insert.

[0167] For subdloning, preparative amounts of DNA were digested with XbaI and electrophoresed on an agarose gel. The approximately 4.4 kbp band containing the toxin gene was excised from the gel, electroeluted from the gel slice, and purified by ion exchange chromatography as above. This fragment was ligated into XbaI cut pHTBlueII and the resultant plasmid was designated pMYC1642.

EXAMPLE 9

[0168] Cloning of a Novel Toxin Gene from B.t. PS33F2 and Transformation into Escherichia coli

[0169] Total cellular DNA was prepared from B.t. PS33F2 cells grown to an optical density, at 600 nm, of 1.0. Cells were pelleted by centrifugation and resuspended in protoplast buffer (20 mg/ml lysozyme in 0.3 M sucrose, 25 mM Tris-Cl [pH 8.0], 25 mM EDTA). After incubation at 37.degree. C. for 1 hour, protoplasts were lysed by the addition of nine volumes of a solution of 0.1 M NaCl, 0.1% SDS, 0.1 M Tris-Cl followed by two cycles of freezing and thawing. The cleared lysate was extracted twice with phenol:chloroform (1:1). Nucleic acids were precipitated with two volumes of ethanol and pelleted by centrifugation. The pellet was resuspended in 10 mM Tris-Cl, 1 mM EDTA (TE) and RNase was added to a final concentration of 50 .mu.g/ml. After incubation at 37.degree. C. for 1 hour, the solution was extracted once each with phenol:chloroforrn (1:1) and TE-saturated chloroform. DNA was precipitated from the aqueous phase by the addition of one-tenth volume of 3 M NaOAc and two volumes of ethanol. DNA was pelleted by centrifugation, washed with 70% ethanol, dried, and resuspended in TE.

[0170] Plasmid DNA was extracted from protoplasts prepared as described above. Protoplasts were lysed by the addition of nine volumes of a solution of 10 mM Tris-Cl, 1 mM EDTA, 0.085 N NaOH, 0.1% SDS, pH=8.0. SDS was added to 1% final concentration to complete lysis. One-half volume of 3 M KOAc was then added and the cellular material was precipitated overnight at 4.degree. C. After centrifugation, the DNA was precipitated with ethanol and plasmids were purified by isopycnic centrifugation on cesium chloride-ethidium bromide gradients.

[0171] Restriction Fragment Length Polymorphism (RFLP) analyses were performed by standard hybridization of Southern blots of PS33F2 plasmid and total cellular DNA with the following two .sup.32P-labelled oligonucleotide probes (designed to the N-terminal amino acid sequence disclosed in Example 2):

14 Probe 33F2A: 5' GCA/T ACA/T TTA AAT GAA GTA/T TAT 3' (SEQ ID NO.33) Probe 33F2B: 5' AAT GAA GTA/T TAT CCA/T GTA/T AAT 3' (SEQ ID NO.34)

[0172] Hybridizing bands included an approximately 5.85 kbp EcoRI fragment. Probe 33F2A and a reverse PCR primer were used to amplify a DNA fragment of approximately 1.8 kbp for use as a hybridization probe for cloning the PS33F2 toxin gene. The sequence of the reverse primer was:

[0173] 5'GCAAGCGGCCGCTTATGGAATAAATTCAATT C/T T/G A/G TC T/A A 3'(SEQ ID NO. 35).

[0174] A gene library was constructed from PS33F2 plasmid DNA digested withEcoRI. Restriction digests were fractionated by agarose gel electrophoresis. DNA fragments 4.3-6.6 kbp were excised from the gel, electroeluted from the gel slice, and recovered by ethanol precipitation after purification on an Elutip-D ion exchange column (Schleicher and Schuel, Keene N.H.). The EcoRI inserts were ligated into EcoRI-digested pHTBlueII (an E. coli/B. thuringiensis shuttle vector comprised of pBluescript S/K [Stratagene] and the replication origin from a resident B.t. plasmid [D. Lereclus et al. 1989. FEMS Microbial. Lett. 60:211-218]). The ligation mixture was transformed into frozen, competent NM522 cells (ATCC 47000). Transformants were plated on LB agar containing ampicillin, isopropyl-(Beta)-D-thiogalactoside (IPTG), and 5-bromo-4-chloro-3-indolyl-(Beta)-D-galactoside (XGAL). Colonies were screened by hybridization with the radiolabeled PCR amplified probe described above. Plasmids were purified from putative toxin gene clones by alkaline lysis and analyzed by agarose gel electrophoresis of restriction digests. The desired plasmid construct, pMYC2316, contains an approximately 5.85 kbp Eco4RI insert; the toxin gene residing on this DNA fragment (33F2a) is novel compared to the DNA sequences of other toxin genes encoding nematicidal proteins.

[0175] Plasmid pMYC2316 was introduced into the acrystalliferous (Cry-) B.t. host, HD-1 CryB (A. Aronson, Purdue University, West Lafayette, Ind.) by electroporation. Expression of an approximately 120-140 kDa crystal protein was verified by SDS-PAGE analysis. Crystals were purified on NaBr gradients (M. A. Pfannenstiel et al. 1984. FEMS Microbiol. Lett. 21:39) for determination of toxicity of the cloned gene product to Pratylenchus spp.

EXAMPLE 10

[0176] Activity of the B.t. Gene Product 33F2 against the Plant Nematode Pratylenchus spp.

[0177] Pratylenchus spp. was reared aseptically on excised corn roots in Gamborg's B5 medium (GIBCO.RTM. Laboratories, Grand Island, N.Y.) Bioassays were done in 24 well assay plates (Corning #25820) using L 3-4 larvae as described by Tsai and van Gundy (J. Nematol. 22(3):327-332). Approximately 20 nematodes were placed in each well. A total of 80-160 nematodes were used in each treatment. Samples of protein were suspended in an aqueous solution using a hand-held Dounce homogenizer.

[0178] Mortality was assessed visually 3 days after treatment. Larvae that were nearly straight and not moving were considered moribund. Representative results are as follows:

15 33F2a (ppm) % Moribund 0 12 75 78

[0179] Species of Pratylenchus, for example P. scribneri, are known pathogens of many economically important crops including corn, peanuts, soybean, alfalfa, beans, tomato, and citrus. These "root lesion" nematodes are the second most economically damaging genus of plant parasitic nematodes (after Meloidogyne--the "root knot" nematode), and typify the migratory endoparasites.

EXAMPLE 11

[0180] Cloning of Novel Nematode-Active Genes Using Generic Oligonucleotide Primers

[0181] The nematicidal gene of a new nematicidal B.t. can be obtained from DNA of the strain by performing the standard polymerase chain reaction procedure as in Example 8 using the oligonucleotides of SEQ ID NO. 32 or SEQ ID NO. 30 as reverse primers and SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 24, Probe B of SEQ ID NO. 5 (AAT GAA GTA/T TAT CCA/T GTA/T AAT), or SEQ ID NO. 27 as forward primers. The expected PCR fragments would be approximately 330 to 600 bp (with either reverse primer and SEQ ID NO. 14), 1000 to 1400 bp (with either reverse primer and SEQ ID NO. 16), and 1800 to 2100 bp (with either reverse primer and any of the three N-terminal primers, SEQ ID NO. 5 (Probe B), SEQ ID NO. 24, and SEQ ID NO. 27). Alternatively, a complement from the primer family described by SEQ ID NO. 14 can be used as reverse primer with SEQ ID NO. 16, SEQ ID NO. 24, SEQ ID NO. 5 (Probe B), or SEQ ID NO. 27 as forward primers. The expected PCR fragments would be approximately 650 to 1000 bp with SEQ ID NO. 16, and 1400 to 1800 bp (for the three N-terminal primers, SEQ ID NO. 5 (Probe B), SEQ ID NO. 24, and SEQ ID NO. 27). Amplified DNA fragments of the indicated sizes can be radiolabeled and used as probes to clone the entire gene as in Example 8.

EXAMPLE 12

[0182] Further Cloning of Novel Nematode-Active Genes Using Generic Oligonucleotide Primers

[0183] A gene coding for a nematicidal toxin a new nematicidal B.t. isolate can also be obtained from DNA of the strain by performing the standard polymerase chain reaction procedure as in Example 8 using oligonucleotides derived from the PS52A1 and PS69D1 gene sequences as follows:

[0184] 1. Forward primer "TGATTTT(T or A)(C or A)TCAATTATAT(A or G)A(G or T)GTTTAT" (SEQ ID NO. 36) can be used with primers complementary to probe "AAGAGTTA(C or T)TA(A or G)A(G or A)AAAGTA" (SEQ ID NO. 37), probe "TTAGGACCATT(A or G)(C or T)T(T or A)GGATTTGTTGT(A or T)TATGAAAT" (SEQ ID NO. 38), and probe "GA(C or T)AGAGATGT(A or T)AAAAT(C or T)(T or A)TAGGAATG" (SEQ ID NO. 39) to produce amplified fragments of approximately 440, 540, and 650 bp, respectively.

[0185] 2. Forward primer "TT(A or C)TTAAA(A or T)C(A or T)GCTAATGATATT" (SEQ ID NO. 40) can be used with primers complementary to SEQ ID NO. 37, SEQ ID NO. 38, and SEQ ID NO. 39 to produce amplified fragments of approximately 360, 460, and 570 bp, respectively.

[0186] 3. Forward primer SEQ ID NO. 37 can be used with primers complementary to SEQ ID NO. 38 and SEQ ID NO. 39 to produce amplified fragments of approximately 100 and 215 bp, respectively.

[0187] Amplified DNA fragments of the indicated sizes can be radiolabeled and used as probes to clone the entire gene as in Example 8.

EXAMPLE 13

[0188] Insertion of Toxin Gene into Plants

[0189] One aspect of the subject invention is the transformation of plants with genes coding for a nematicidal toxin. The transformed plants are resistant to attack by nematodes.

[0190] Genes coding for nematicidal toxins, as disclosed herein, can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that permits selection of the transformed cells are available for preparation for the insertion of foreign genes into higher plants. The vectors comprise, for example, pBR322, pUC series, M13mp series, pACYC184, etc. Accordingly, the sequence coding for the B.t. toxin can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli. The E. coli cells are cultivated in a suitable nutrient medium, then harvested and lysed. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biological methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be cleaved and joined to the next DNA sequence. Each plasmid sequence can be cloned in the same or other plasmids. Depending on the method of inserting desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right border, but often the right and the left border of the Ti or Ri plasmid T-DNA, has to be joined as the flanking region of the genes to be inserted.

[0191] The use of T-DNA for the transformation of plant cells has been intensively researched and sufficiently described in EP 120 516; Hoekema (1985) In: The Binary Plant Vector System, Offset-durkkerij Kanters B. V., Alblasserdam, Chapter 5; Fraley et al., Crit. Rev. Plant Sci. 4:1-46; and An et al. (1985) EMBO J. 4:277-287.

[0192] Once the inserted DNA has been integrated in the genome, it is relatively stable there and, as a rule, does not come out again. It normally contains a selection marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G 418, bleomycin, hygromycin, or chloramphenicol, inter alia. The individually employed marker should accordingly permit the selection of transformed cells rather than cells that do not contain the inserted DNA.

[0193] A large number of techniques are available for inserting DNA into a plant host cell. Those techniques include transformation with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation agent, fusion, injection, or electroporation as well as other possible methods. If agrobacteria are used for the transformation, the DNA to be inserted has to be cloned into special plasmids, namely either into an intermediate vector or into a binary vector. The intermediate vectors can be integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate themselves in agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors can replicate themselves both in E. coli and in agrobacteria. They comprise a selection marker gene and a linker or polylinker which are framed by the right and left T-DNA border regions. They can be transformed directly into agrobacteria (Holsters et al. [1978] Mol. Gen. Genet. 163:181-187). The agrobacterium used as host cell is to comprise a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be contained. The bacterium so transformed is used for the transformation of plant cells. Plant explants can advantageously be cultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes for the transfer of the DNA into the plant cell. Whole plants can then be regenerated from the infected plant material (for example, pieces of leaf, segments of stalk, roots, but also protoplasts or suspension-cultivated cells) in a suitable medium, which may contain antibiotics or biocides for selection. The plants so obtained can then be tested for the presence of the inserted DNA. No special demands are made of the plasmids in the case of injection and electroporarion. It is possible to use ordinary plasmids, such as, for example, pUC derivatives.

[0194] The transformed cells grow inside the plants in the usual manner. They can form germ cells and transmit the transformed trait(s) to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid indivuals have the corresponding phenotypic properties.

[0195] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.

Sequence CWU 1

1

40 1 4155 DNA Bacillus thuringiensis 1 atggcaattt taaatgaatt atatccatct gtaccttata atgtattggc gtatacgcca 60 ccctcttttt tacctgatgc gggtacacaa gctacacctg ctgacttaac agcttatgaa 120 caattgttga aaaatttaga aaaagggata aatgctggaa cttattcgaa agcaatagct 180 gatgtactta aaggtatttt tatagatgat acaataaatt atcaaacata tgtaaatatt 240 ggtttaagtt taattacatt agctgtaccg gaaattggta tttttacacc tttcatcggt 300 ttgttttttg ctgcattgaa taaacatgat gctccacctc ctcctaatgc aaaagatata 360 tttgaggcta tgaaaccagc gattcaagag atgattgata gaactttaac tgcggatgag 420 caaacatttt taaatgggga aataagtggt ttacaaaatt tagcagcaag ataccagtct 480 acaatggatg atattcaaag ccatggagga tttaataagg tagattctgg attaattaaa 540 aagtttacag atgaggtact atctttaaat agtttttata cagatcgttt acctgtattt 600 attacagata atacagcgga tcgaactttg ttaggtcttc cttattatgc tatacttgcg 660 agcatgcatc ttatgttatt aagagatatc attactaagg gtccgacatg ggattctaaa 720 attaatttca caccagatgc aattgattcc tttaaaaccg atattaaaaa taatataaag 780 ctttactcta aaactattta tgacgtattt cagaagggac ttgcttcata cggaacgcct 840 tctgatttag agtcctttgc aaaaaaacaa aaatatattg aaattatgac aacacattgt 900 ttagattttg caagattgtt tcctactttt gatccagatc tttatccaac aggatcaggt 960 gatataagtt tacaaaaaac acgtagaatt ctttctcctt ttatccctat acgtactgca 1020 gatgggttaa cattaaataa tacttcaatt gatacttcaa attggcctaa ttatgaaaat 1080 gggaatggcg cgtttccaaa cccaaaagaa agaatattaa aacaattcaa actgtatcct 1140 agttggagag cgggacagta cggtgggctt ttacaacctt atttatgggc aatagaagtc 1200 caagattctg tagagactcg tttgtatggg cagcttccag ctgtagatcc acaggcaggg 1260 cctaattatg tttccataga ttcttctaat ccaatcatac aaataaatat ggatacttgg 1320 aaaacaccac cacaaggtgc gagtgggtgg aatacaaatt taatgagagg aagtgtaagc 1380 gggttaagtt ttttacaacg agatggtacg agacttagtg ctggtatggg tggtggtttt 1440 gctgatacaa tatatagtct ccctgcaact cattatcttt cttatctcta tggaactcct 1500 tatcaaactt ctgataacta ttctggtcac gttggtgcat tggtaggtgt gagtacgcct 1560 caagaggcta ctcttcctaa tattataggt caaccagatg aacagggaaa tgtatctaca 1620 atgggatttc cgtttgaaaa agcttcttat ggaggtacag ttgttaaaga atggttaaat 1680 ggtgcgaatg cgatgaagct ttctcctggg caatctatag gtattcctat tacaaatgta 1740 acaagtggag aatatcaaat tcgttgtcgt tatgcaagta atgataatac taacgttttc 1800 tttaatgtag atactggtgg agcaaatcca attttccaac agataaactt tgcatctact 1860 gtagataata atacgggagt acaaggagca aatggtgtct atgtagtcaa atctattgct 1920 acaactgata attcttttac agaaattcct gcgaagacga ttaatgttca tttaaccaac 1980 caaggttctt ctgatgtctt tttagaccgt attgaattta tacctttttc tctacctctt 2040 atatatcatg gaagttataa tacttcatca ggtgcagatg atgttttatg gtcttcttca 2100 aatatgaatt actacgatat aatagtaaat ggtcaggcca atagtagtag tatcgctagt 2160 tctatgcatt tgcttaataa aggaaaagtg ataaaaacaa ttgatattcc agggcattcg 2220 gaaaccttct ttgctacgtt cccagttcca gaaggattta atgaagttag aattcttgct 2280 ggccttccag aagttagtgg aaatattacc gtacaatcta ataatccgcc tcaacctagt 2340 aataatggtg gtggtgatgg tggtggtaat ggtggtggtg atggtggtca atacaatttt 2400 tctttaagcg gatctgatca tacgactatt tatcatggaa aacttgaaac tgggattcat 2460 gtacaaggta attataccta tacaggtact cccgtattaa tactgaatgc ttacagaaat 2520 aatactgtag tatcaagcat tccagtatat tctccttttg atataactat acagacagaa 2580 gctgatagcc ttgagcttga actacaacct agatatggtt ttgccacagt gaatggtact 2640 gcaacagtaa aaagtcctaa tgtaaattac gatagatcat ttaaactccc aatagactta 2700 caaaatatca caacacaagt aaatgcatta ttcgcatctg gaacacaaaa tatgcttgct 2760 cataatgtaa gtgatcatga tattgaagaa gttgtattaa aagtggatgc cttatcagat 2820 gaagtatttg gagatgagaa gaaggcttta cgtaaattgg tgaatcaagc aaaacgtttg 2880 agtagagcaa gaaatcttct gataggtggg agttttgaaa attgggatgc atggtataaa 2940 ggaagaaatg tagtaactgt atctgatcat gaactattta agagtgatca tgtattatta 3000 ccaccaccag gattgtctcc atcttatatt ttccaaaaag tggaggaatc taaattaaaa 3060 ccaaatacac gttatattgt ttctggattc atcgcacatg gaaaagacct agaaattgtt 3120 gtttcacgtt atgggcaaga agtgcaaaag gtcgtgcaag ttccttatgg agaagcattc 3180 ccgttaacat caaatggacc agtttgttgt cccccacgtt ctacaagtaa tggaacctta 3240 ggagatccac atttctttag ttacagtatc gatgtaggtg cactagattt acaagcaaac 3300 cctggtattg aatttggtct tcgtattgta aatccaactg gaatggcacg cgtaagcaat 3360 ttggaaattc gtgaagatcg tccattagca gcaaatgaaa tacgacaagt acaacgtgtc 3420 gcaagaaatt ggagaaccga gtatgagaaa gaacgtgcgg aagtaacaag tttaattcaa 3480 cctgttatca atcgaatcaa cggattgtat gaaaatggaa attggaacgg ttctattcgt 3540 tcagatattt cgtatcagaa tatagacgcg attgtattac caacgttacc aaagttacgc 3600 cattggttta tgtcagatag attcagtgaa caaggagata taatggctaa attccaaggt 3660 gcattaaatc gtgcgtatgc acaactggaa caaagtacgc ttctgcataa tggtcatttt 3720 acaaaagatg cagctaattg gacaatagaa ggcgatgcac atcagataac actagaagat 3780 ggtagacgtg tattgcgact tccagattgg tcttcgagtg tatctcaaat gattgaaatc 3840 gagaatttta atccagataa agaatacaac ttagtattcc atgggcaagg agaaggaacg 3900 gttacgttgg agcatggaga agaaacaaaa tatatagaaa cgcatacaca tcattttgcg 3960 aattttacaa cttctcaacg tcaaggactc acgtttgaat caaataaagt gacagtgacc 4020 atttcttcag aagatggaga attcttagtg gataatattg cgcttgtgga agctcctctt 4080 cctacagatg accaaaattc tgagggaaat acggcttcca gtacgaatag cgatacaagt 4140 atgaacaaca atcaa 4155 2 1385 PRT Bacillus thuringiensis 2 Met Ala Ile Leu Asn Glu Leu Tyr Pro Ser Val Pro Tyr Asn Val Leu 1 5 10 15 Ala Tyr Thr Pro Pro Ser Phe Leu Pro Asp Ala Gly Thr Gln Ala Thr 20 25 30 Pro Ala Asp Leu Thr Ala Tyr Glu Gln Leu Leu Lys Asn Leu Glu Lys 35 40 45 Gly Ile Asn Ala Gly Thr Tyr Ser Lys Ala Ile Ala Asp Val Leu Lys 50 55 60 Gly Ile Phe Ile Asp Asp Thr Ile Asn Tyr Gln Thr Tyr Val Asn Ile 65 70 75 80 Gly Leu Ser Leu Ile Thr Leu Ala Val Pro Glu Ile Gly Ile Phe Thr 85 90 95 Pro Phe Ile Gly Leu Phe Phe Ala Ala Leu Asn Lys His Asp Ala Pro 100 105 110 Pro Pro Pro Asn Ala Lys Asp Ile Phe Glu Ala Met Lys Pro Ala Ile 115 120 125 Gln Glu Met Ile Asp Arg Thr Leu Thr Ala Asp Glu Gln Thr Phe Leu 130 135 140 Asn Gly Glu Ile Ser Gly Leu Gln Asn Leu Ala Ala Arg Tyr Gln Ser 145 150 155 160 Thr Met Asp Asp Ile Gln Ser His Gly Gly Phe Asn Lys Val Asp Ser 165 170 175 Gly Leu Ile Lys Lys Phe Thr Asp Glu Val Leu Ser Leu Asn Ser Phe 180 185 190 Tyr Thr Asp Arg Leu Pro Val Phe Ile Thr Asp Asn Thr Ala Asp Arg 195 200 205 Thr Leu Leu Gly Leu Pro Tyr Tyr Ala Ile Leu Ala Ser Met His Leu 210 215 220 Met Leu Leu Arg Asp Ile Ile Thr Lys Gly Pro Thr Trp Asp Ser Lys 225 230 235 240 Ile Asn Phe Thr Pro Asp Ala Ile Asp Ser Phe Lys Thr Asp Ile Lys 245 250 255 Asn Asn Ile Lys Leu Tyr Ser Lys Thr Ile Tyr Asp Val Phe Gln Lys 260 265 270 Gly Leu Ala Ser Tyr Gly Thr Pro Ser Asp Leu Glu Ser Phe Ala Lys 275 280 285 Lys Gln Lys Tyr Ile Glu Ile Met Thr Thr His Cys Leu Asp Phe Ala 290 295 300 Arg Leu Phe Pro Thr Phe Asp Pro Asp Leu Tyr Pro Thr Gly Ser Gly 305 310 315 320 Asp Ile Ser Leu Gln Lys Thr Arg Arg Ile Leu Ser Pro Phe Ile Pro 325 330 335 Ile Arg Thr Ala Asp Gly Leu Thr Leu Asn Asn Thr Ser Ile Asp Thr 340 345 350 Ser Asn Trp Pro Asn Tyr Glu Asn Gly Asn Gly Ala Phe Pro Asn Pro 355 360 365 Lys Glu Arg Ile Leu Lys Gln Phe Lys Leu Tyr Pro Ser Trp Arg Ala 370 375 380 Gly Gln Tyr Gly Gly Leu Leu Gln Pro Tyr Leu Trp Ala Ile Glu Val 385 390 395 400 Gln Asp Ser Val Glu Thr Arg Leu Tyr Gly Gln Leu Pro Ala Val Asp 405 410 415 Pro Gln Ala Gly Pro Asn Tyr Val Ser Ile Asp Ser Ser Asn Pro Ile 420 425 430 Ile Gln Ile Asn Met Asp Thr Trp Lys Thr Pro Pro Gln Gly Ala Ser 435 440 445 Gly Trp Asn Thr Asn Leu Met Arg Gly Ser Val Ser Gly Leu Ser Phe 450 455 460 Leu Gln Arg Asp Gly Thr Arg Leu Ser Ala Gly Met Gly Gly Gly Phe 465 470 475 480 Ala Asp Thr Ile Tyr Ser Leu Pro Ala Thr His Tyr Leu Ser Tyr Leu 485 490 495 Tyr Gly Thr Pro Tyr Gln Thr Ser Asp Asn Tyr Ser Gly His Val Gly 500 505 510 Ala Leu Val Gly Val Ser Thr Pro Gln Glu Ala Thr Leu Pro Asn Ile 515 520 525 Ile Gly Gln Pro Asp Glu Gln Gly Asn Val Ser Thr Met Gly Phe Pro 530 535 540 Phe Glu Lys Ala Ser Tyr Gly Gly Thr Val Val Lys Glu Trp Leu Asn 545 550 555 560 Gly Ala Asn Ala Met Lys Leu Ser Pro Gly Gln Ser Ile Gly Ile Pro 565 570 575 Ile Thr Asn Val Thr Ser Gly Glu Tyr Gln Ile Arg Cys Arg Tyr Ala 580 585 590 Ser Asn Asp Asn Thr Asn Val Phe Phe Asn Val Asp Thr Gly Gly Ala 595 600 605 Asn Pro Ile Phe Gln Gln Ile Asn Phe Ala Ser Thr Val Asp Asn Asn 610 615 620 Thr Gly Val Gln Gly Ala Asn Gly Val Tyr Val Val Lys Ser Ile Ala 625 630 635 640 Thr Thr Asp Asn Ser Phe Thr Glu Ile Pro Ala Lys Thr Ile Asn Val 645 650 655 His Leu Thr Asn Gln Gly Ser Ser Asp Val Phe Leu Asp Arg Ile Glu 660 665 670 Phe Ile Pro Phe Ser Leu Pro Leu Ile Tyr His Gly Ser Tyr Asn Thr 675 680 685 Ser Ser Gly Ala Asp Asp Val Leu Trp Ser Ser Ser Asn Met Asn Tyr 690 695 700 Tyr Asp Ile Ile Val Asn Gly Gln Ala Asn Ser Ser Ser Ile Ala Ser 705 710 715 720 Ser Met His Leu Leu Asn Lys Gly Lys Val Ile Lys Thr Ile Asp Ile 725 730 735 Pro Gly His Ser Glu Thr Phe Phe Ala Thr Phe Pro Val Pro Glu Gly 740 745 750 Phe Asn Glu Val Arg Ile Leu Ala Gly Leu Pro Glu Val Ser Gly Asn 755 760 765 Ile Thr Val Gln Ser Asn Asn Pro Pro Gln Pro Ser Asn Asn Gly Gly 770 775 780 Gly Asp Gly Gly Gly Asn Gly Gly Gly Asp Gly Gly Gln Tyr Asn Phe 785 790 795 800 Ser Leu Ser Gly Ser Asp His Thr Thr Ile Tyr His Gly Lys Leu Glu 805 810 815 Thr Gly Ile His Val Gln Gly Asn Tyr Thr Tyr Thr Gly Thr Pro Val 820 825 830 Leu Ile Leu Asn Ala Tyr Arg Asn Asn Thr Val Val Ser Ser Ile Pro 835 840 845 Val Tyr Ser Pro Phe Asp Ile Thr Ile Gln Thr Glu Ala Asp Ser Leu 850 855 860 Glu Leu Glu Leu Gln Pro Arg Tyr Gly Phe Ala Thr Val Asn Gly Thr 865 870 875 880 Ala Thr Val Lys Ser Pro Asn Val Asn Tyr Asp Arg Ser Phe Lys Leu 885 890 895 Pro Ile Asp Leu Gln Asn Ile Thr Thr Gln Val Asn Ala Leu Phe Ala 900 905 910 Ser Gly Thr Gln Asn Met Leu Ala His Asn Val Ser Asp His Asp Ile 915 920 925 Glu Glu Val Val Leu Lys Val Asp Ala Leu Ser Asp Glu Val Phe Gly 930 935 940 Asp Glu Lys Lys Ala Leu Arg Lys Leu Val Asn Gln Ala Lys Arg Leu 945 950 955 960 Ser Arg Ala Arg Asn Leu Leu Ile Gly Gly Ser Phe Glu Asn Trp Asp 965 970 975 Ala Trp Tyr Lys Gly Arg Asn Val Val Thr Val Ser Asp His Glu Leu 980 985 990 Phe Lys Ser Asp His Val Leu Leu Pro Pro Pro Gly Leu Ser Pro Ser 995 1000 1005 Tyr Ile Phe Gln Lys Val Glu Glu Ser Lys Leu Lys Pro Asn Thr 1010 1015 1020 Arg Tyr Ile Val Ser Gly Phe Ile Ala His Gly Lys Asp Leu Glu 1025 1030 1035 Ile Val Val Ser Arg Tyr Gly Gln Glu Val Gln Lys Val Val Gln 1040 1045 1050 Val Pro Tyr Gly Glu Ala Phe Pro Leu Thr Ser Asn Gly Pro Val 1055 1060 1065 Cys Cys Pro Pro Arg Ser Thr Ser Asn Gly Thr Leu Gly Asp Pro 1070 1075 1080 His Phe Phe Ser Tyr Ser Ile Asp Val Gly Ala Leu Asp Leu Gln 1085 1090 1095 Ala Asn Pro Gly Ile Glu Phe Gly Leu Arg Ile Val Asn Pro Thr 1100 1105 1110 Gly Met Ala Arg Val Ser Asn Leu Glu Ile Arg Glu Asp Arg Pro 1115 1120 1125 Leu Ala Ala Asn Glu Ile Arg Gln Val Gln Arg Val Ala Arg Asn 1130 1135 1140 Trp Arg Thr Glu Tyr Glu Lys Glu Arg Ala Glu Val Thr Ser Leu 1145 1150 1155 Ile Gln Pro Val Ile Asn Arg Ile Asn Gly Leu Tyr Glu Asn Gly 1160 1165 1170 Asn Trp Asn Gly Ser Ile Arg Ser Asp Ile Ser Tyr Gln Asn Ile 1175 1180 1185 Asp Ala Ile Val Leu Pro Thr Leu Pro Lys Leu Arg His Trp Phe 1190 1195 1200 Met Ser Asp Arg Phe Ser Glu Gln Gly Asp Ile Met Ala Lys Phe 1205 1210 1215 Gln Gly Ala Leu Asn Arg Ala Tyr Ala Gln Leu Glu Gln Ser Thr 1220 1225 1230 Leu Leu His Asn Gly His Phe Thr Lys Asp Ala Ala Asn Trp Thr 1235 1240 1245 Ile Glu Gly Asp Ala His Gln Ile Thr Leu Glu Asp Gly Arg Arg 1250 1255 1260 Val Leu Arg Leu Pro Asp Trp Ser Ser Ser Val Ser Gln Met Ile 1265 1270 1275 Glu Ile Glu Asn Phe Asn Pro Asp Lys Glu Tyr Asn Leu Val Phe 1280 1285 1290 His Gly Gln Gly Glu Gly Thr Val Thr Leu Glu His Gly Glu Glu 1295 1300 1305 Thr Lys Tyr Ile Glu Thr His Thr His His Phe Ala Asn Phe Thr 1310 1315 1320 Thr Ser Gln Arg Gln Gly Leu Thr Phe Glu Ser Asn Lys Val Thr 1325 1330 1335 Val Thr Ile Ser Ser Glu Asp Gly Glu Phe Leu Val Asp Asn Ile 1340 1345 1350 Ala Leu Val Glu Ala Pro Leu Pro Thr Asp Asp Gln Asn Ser Glu 1355 1360 1365 Gly Asn Thr Ala Ser Ser Thr Asn Ser Asp Thr Ser Met Asn Asn 1370 1375 1380 Asn Gln 1385 3 3867 DNA Bacillus thuringiensis 3 atggcaattt taaatgaatt atatccatct gtaccttata atgtattggc gtatacgcca 60 ccctcttttt tacctgatgc gggtacacaa gctacacctg ctgacttaac agcttatgaa 120 caattgttga aaaatttaga aaaagggata aatgctggaa cttattcgaa agcaatagct 180 gatgtactta aaggtatttt tatagatgat acaataaatt atcaaacata tgtaaatatt 240 ggtttaagtt taattacatt agctgtaccg gaaattggta tttttacacc tttcatcggt 300 ttgttttttg ctgcattgaa taaacatgat gctccacctc ctcctaatgc aaaagatata 360 tttgaggcta tgaaaccagc gattcaagag atgattgata gaactttaac tgcggatgag 420 caaacatttt taaatgggga aataagtggt ttacaaaatt tagcagcaag ataccagtct 480 acaatggatg atattcaaag ccatggagga tttaataagg tagattctgg attaattaaa 540 aagtttacag atgaggtact atctttaaat agtttttata cagatcgttt acctgtattt 600 attacagata atacagcgga tcgaactttg ttaggtcttc cttattatgc tatacttgcg 660 agcatgcatc ttatgttatt aagagatatc attactaagg gtccgacatg ggattctaaa 720 attaatttca caccagatgc aattgattcc tttaaaaccg atattaaaaa taatataaag 780 ctttactcta aaactattta tgacgtattt cagaagggac ttgcttcata cggaacgcct 840 tctgatttag agtcctttgc aaaaaaacaa aaatatattg aaattatgac aacacattgt 900 ttagattttg caagattgtt tcctactttt gatccagatc tttatccaac aggatcaggt 960 gatataagtt tacaaaaaac acgtagaatt ctttctcctt ttatccctat acgtactgca 1020 gatgggttaa cattaaataa tacttcaatt gatacttcaa attggcctaa ttatgaaaat 1080 gggaatggcg cgtttccaaa cccaaaagaa agaatattaa aacaattcaa actgtatcct 1140 agttggagag cggcacagta cggtgggctt ttacaacctt atttatgggc aatagaagtc 1200 caagattctg tagagactcg tttgtatggg cagcttccag ctgtagatcc acaggcaggg 1260 cctaattatg tttccataga ttcttctaat ccaatcatac aaataaatat ggatacttgg 1320 aaaacaccac cacaaggtgc gagtgggtgg aatacaaatt taatgagagg aagtgtaagc 1380 gggttaagtt ttttacaacg agatggtacg agacttagtg ctggtatggg tggtggtttt 1440 gctgatacaa tatatagtct ccctgcaact cattatcttt cttatctcta tggaactcct 1500 tatcaaactt ctgataacta ttctggtcac gttggtgcat tggtaggtgt gagtacgcct 1560 caagaggcta ctcttcctaa tattataggt caaccagatg aacagggaaa tgtatctaca 1620 atgggatttc cgtttgaaaa agcttcttat ggaggtacag ttgttaaaga atggttaaat 1680 ggtgcgaatg cgatgaagct ttctcctggg caatctatag gtattcctat tacaaatgta 1740 acaagtggag aatatcaaat tcgttgtcgt tatgcaagta atgataatac taacgttttc 1800 tttaatgtag atactggtgg agcaaatcca attttccaac agataaactt tgcatctact 1860 gtagataata atacgggagt acaaggagca aatggtgtct atgtagtcaa atctattgct 1920 acaactgata attcttttac agtaaaaatt cctgcgaaga cgattaatgt tcatttaacc 1980 aaccaaggtt cttctgatgt ctttttagat cgtattgagt ttgttccaat tctagaatca 2040 aatactgtaa ctatattcaa caattcatat actacaggtt cagcaaatct tataccagca 2100 atagctcctc tttggagtac tagttcagat aaagccctta caggttctat gtcaataaca 2160 ggtcgaacta cccctaacag tgatgatgct ttgcttcgat tttttaaaac

taattatgat 2220 acacaaacca ttcctattcc gggttccgga aaagatttta caaatactct agaaatacaa 2280 gacatagttt ctattgatat ttttgtcgga tctggtctac atggatccga tggatctata 2340 aaattagatt ttaccaataa taatagtggt agtggtggct ctccaaagag tttcaccgag 2400 caaaatgatt tagagaatat cacaacacaa gtgaatgctc tattcacatc taatacacaa 2460 gatgcacttg caacagatgt gagtgatcat gatattgaag aagtggttct aaaagtagat 2520 gcattatctg atgaagtgtt tggaaaagag aaaaaaacat tgcgtaaatt tgtaaatcaa 2580 gcgaagcgct taagcaaggc gcgtaatctc ctggtaggag gcaattttga taacttggat 2640 gcttggtata gaggaagaaa tgtagtaaac gtatctaatc acgaactgtt gaagagtgat 2700 catgtattat taccaccacc aggattgtct ccatcttata ttttccaaaa agtggaggaa 2760 tctaaattaa aacgaaatac acgttatacg gtttctggat ttattgcgca tgcaacagat 2820 ttagaaattg tggtttctcg ttatgggcaa gaaataaaga aagtggtgca agttccttat 2880 ggagaagcat tcccattaac atcaagtgga ccagtttgtt gtatcccaca ttctacaagt 2940 aatggaactt taggcaatcc acatttcttt agttacagta ttgatgtagg tgcattagat 3000 gtagacacaa accctggtat tgaattcggt cttcgtattg taaatccaac tggaatggca 3060 cgcgtaagca atttggaaat tcgtgaagat cgtccattag cagcaaatga aatacgacaa 3120 gtacaacgtg tcgcaagaaa ttggagaacc gagtatgaga aagaacgtgc ggaagtaaca 3180 agtttaattc aacctgttat caatcgaatc aatggattgt atgacaatgg aaattggaac 3240 ggttctattc gttcagatat ttcgtatcag aatatagacg cgattgtatt accaacgtta 3300 ccaaagttac gccattggtt tatgtcagat agatttagtg aacaaggaga tatcatggct 3360 aaattccaag gtgcattaaa tcgtgcgtat gcacaactgg aacaaaatac gcttctgcat 3420 aatggtcatt ttacaaaaga tgcagccaat tggacggtag aaggcgatgc acatcaggta 3480 gtattagaag atggtaaacg tgtattacga ttgccagatt ggtcttcgag tgtgtctcaa 3540 acgattgaaa tcgagaattt tgatccagat aaagaatatc aattagtatt tcatgggcaa 3600 ggagaaggaa cggttacgtt ggagcatgga gaagaaacaa aatatataga aacgcataca 3660 catcattttg cgaattttac aacttctcaa cgtcaaggac tcacgtttga atcaaataaa 3720 gtgacagtga ccatttcttc agaagatgga gaattcttag tggataatat tgcgcttgtg 3780 gaagctcctc ttcctacaga tgaccaaaat tctgagggaa atacggcttc cagtacgaat 3840 agcgatacaa gtatgaacaa caatcaa 3867 4 1289 PRT Bacillus thuringiensis 4 Met Ala Ile Leu Asn Glu Leu Tyr Pro Ser Val Pro Tyr Asn Val Leu 1 5 10 15 Ala Tyr Thr Pro Pro Ser Phe Leu Pro Asp Ala Gly Thr Gln Ala Thr 20 25 30 Pro Ala Asp Leu Thr Ala Tyr Glu Gln Leu Leu Lys Asn Leu Glu Lys 35 40 45 Gly Ile Asn Ala Gly Thr Tyr Ser Lys Ala Ile Ala Asp Val Leu Lys 50 55 60 Gly Ile Phe Ile Asp Asp Thr Ile Asn Tyr Gln Thr Tyr Val Asn Ile 65 70 75 80 Gly Leu Ser Leu Ile Thr Leu Ala Val Pro Glu Ile Gly Ile Phe Thr 85 90 95 Pro Phe Ile Gly Leu Phe Phe Ala Ala Leu Asn Lys His Asp Ala Pro 100 105 110 Pro Pro Pro Asn Ala Lys Asp Ile Phe Glu Ala Met Lys Pro Ala Ile 115 120 125 Gln Glu Met Ile Asp Arg Thr Leu Thr Ala Asp Glu Gln Thr Phe Leu 130 135 140 Asn Gly Glu Ile Ser Gly Leu Gln Asn Leu Ala Ala Arg Tyr Gln Ser 145 150 155 160 Thr Met Asp Asp Ile Gln Ser His Gly Gly Phe Asn Lys Val Asp Ser 165 170 175 Gly Leu Ile Lys Lys Phe Thr Asp Glu Val Leu Ser Leu Asn Ser Phe 180 185 190 Tyr Thr Asp Arg Leu Pro Val Phe Ile Thr Asp Asn Thr Ala Asp Arg 195 200 205 Thr Leu Leu Gly Leu Pro Tyr Tyr Ala Ile Leu Ala Ser Met His Leu 210 215 220 Met Leu Leu Arg Asp Ile Ile Thr Lys Gly Pro Thr Trp Asp Ser Lys 225 230 235 240 Ile Asn Phe Thr Pro Asp Ala Ile Asp Ser Phe Lys Thr Asp Ile Lys 245 250 255 Asn Asn Ile Lys Leu Tyr Ser Lys Thr Ile Tyr Asp Val Phe Gln Lys 260 265 270 Gly Leu Ala Ser Tyr Gly Thr Pro Ser Asp Leu Glu Ser Phe Ala Lys 275 280 285 Lys Gln Lys Tyr Ile Glu Ile Met Thr Thr His Cys Leu Asp Phe Ala 290 295 300 Arg Leu Phe Pro Thr Phe Asp Pro Asp Leu Tyr Pro Thr Gly Ser Gly 305 310 315 320 Asp Ile Ser Leu Gln Lys Thr Arg Arg Ile Leu Ser Pro Phe Ile Pro 325 330 335 Ile Arg Thr Ala Asp Gly Leu Thr Leu Asn Asn Thr Ser Ile Asp Thr 340 345 350 Ser Asn Trp Pro Asn Tyr Glu Asn Gly Asn Gly Ala Phe Pro Asn Pro 355 360 365 Lys Glu Arg Ile Leu Lys Gln Phe Lys Leu Tyr Pro Ser Trp Arg Ala 370 375 380 Ala Gln Tyr Gly Gly Leu Leu Gln Pro Tyr Leu Trp Ala Ile Glu Val 385 390 395 400 Gln Asp Ser Val Glu Thr Arg Leu Tyr Gly Gln Leu Pro Ala Val Asp 405 410 415 Pro Gln Ala Gly Pro Asn Tyr Val Ser Ile Asp Ser Ser Asn Pro Ile 420 425 430 Ile Gln Ile Asn Met Asp Thr Trp Lys Thr Pro Pro Gln Gly Ala Ser 435 440 445 Gly Trp Asn Thr Asn Leu Met Arg Gly Ser Val Ser Gly Leu Ser Phe 450 455 460 Leu Gln Arg Asp Gly Thr Arg Leu Ser Ala Gly Met Gly Gly Gly Phe 465 470 475 480 Ala Asp Thr Ile Tyr Ser Leu Pro Ala Thr His Tyr Leu Ser Tyr Leu 485 490 495 Tyr Gly Thr Pro Tyr Gln Thr Ser Asp Asn Tyr Ser Gly His Val Gly 500 505 510 Ala Leu Val Gly Val Ser Thr Pro Gln Glu Ala Thr Leu Pro Asn Ile 515 520 525 Ile Gly Gln Pro Asp Glu Gln Gly Asn Val Ser Thr Met Gly Phe Pro 530 535 540 Phe Glu Lys Ala Ser Tyr Gly Gly Thr Val Val Lys Glu Trp Leu Asn 545 550 555 560 Gly Ala Asn Ala Met Lys Leu Ser Pro Gly Gln Ser Ile Gly Ile Pro 565 570 575 Ile Thr Asn Val Thr Ser Gly Glu Tyr Gln Ile Arg Cys Arg Tyr Ala 580 585 590 Ser Asn Asp Asn Thr Asn Val Phe Phe Asn Val Asp Thr Gly Gly Ala 595 600 605 Asn Pro Ile Phe Gln Gln Ile Asn Phe Ala Ser Thr Val Asp Asn Asn 610 615 620 Thr Gly Val Gln Gly Ala Asn Gly Val Tyr Val Val Lys Ser Ile Ala 625 630 635 640 Thr Thr Asp Asn Ser Phe Thr Val Lys Ile Pro Ala Lys Thr Ile Asn 645 650 655 Val His Leu Thr Asn Gln Gly Ser Ser Asp Val Phe Leu Asp Arg Ile 660 665 670 Glu Phe Val Pro Ile Leu Glu Ser Asn Thr Val Thr Ile Phe Asn Asn 675 680 685 Ser Tyr Thr Thr Gly Ser Ala Asn Leu Ile Pro Ala Ile Ala Pro Leu 690 695 700 Trp Ser Thr Ser Ser Asp Lys Ala Leu Thr Gly Ser Met Ser Ile Thr 705 710 715 720 Gly Arg Thr Thr Pro Asn Ser Asp Asp Ala Leu Leu Arg Phe Phe Lys 725 730 735 Thr Asn Tyr Asp Thr Gln Thr Ile Pro Ile Pro Gly Ser Gly Lys Asp 740 745 750 Phe Thr Asn Thr Leu Glu Ile Gln Asp Ile Val Ser Ile Asp Ile Phe 755 760 765 Val Gly Ser Gly Leu His Gly Ser Asp Gly Ser Ile Lys Leu Asp Phe 770 775 780 Thr Asn Asn Asn Ser Gly Ser Gly Gly Ser Pro Lys Ser Phe Thr Glu 785 790 795 800 Gln Asn Asp Leu Glu Asn Ile Thr Thr Gln Val Asn Ala Leu Phe Thr 805 810 815 Ser Asn Thr Gln Asp Ala Leu Ala Thr Asp Val Ser Asp His Asp Ile 820 825 830 Glu Glu Val Val Leu Lys Val Asp Ala Leu Ser Asp Glu Val Phe Gly 835 840 845 Lys Glu Lys Lys Thr Leu Arg Lys Phe Val Asn Gln Ala Lys Arg Leu 850 855 860 Ser Lys Ala Arg Asn Leu Leu Val Gly Gly Asn Phe Asp Asn Leu Asp 865 870 875 880 Ala Trp Tyr Arg Gly Arg Asn Val Val Asn Val Ser Asn His Glu Leu 885 890 895 Leu Lys Ser Asp His Val Leu Leu Pro Pro Pro Gly Leu Ser Pro Ser 900 905 910 Tyr Ile Phe Gln Lys Val Glu Glu Ser Lys Leu Lys Arg Asn Thr Arg 915 920 925 Tyr Thr Val Ser Gly Phe Ile Ala His Ala Thr Asp Leu Glu Ile Val 930 935 940 Val Ser Arg Tyr Gly Gln Glu Ile Lys Lys Val Val Gln Val Pro Tyr 945 950 955 960 Gly Glu Ala Phe Pro Leu Thr Ser Ser Gly Pro Val Cys Cys Ile Pro 965 970 975 His Ser Thr Ser Asn Gly Thr Leu Gly Asn Pro His Phe Phe Ser Tyr 980 985 990 Ser Ile Asp Val Gly Ala Leu Asp Val Asp Thr Asn Pro Gly Ile Glu 995 1000 1005 Phe Gly Leu Arg Ile Val Asn Pro Thr Gly Met Ala Arg Val Ser 1010 1015 1020 Asn Leu Glu Ile Arg Glu Asp Arg Pro Leu Ala Ala Asn Glu Ile 1025 1030 1035 Arg Gln Val Gln Arg Val Ala Arg Asn Trp Arg Thr Glu Tyr Glu 1040 1045 1050 Lys Glu Arg Ala Glu Val Thr Ser Leu Ile Gln Pro Val Ile Asn 1055 1060 1065 Arg Ile Asn Gly Leu Tyr Asp Asn Gly Asn Trp Asn Gly Ser Ile 1070 1075 1080 Arg Ser Asp Ile Ser Tyr Gln Asn Ile Asp Ala Ile Val Leu Pro 1085 1090 1095 Thr Leu Pro Lys Leu Arg His Trp Phe Met Ser Asp Arg Phe Ser 1100 1105 1110 Glu Gln Gly Asp Ile Met Ala Lys Phe Gln Gly Ala Leu Asn Arg 1115 1120 1125 Ala Tyr Ala Gln Leu Glu Gln Asn Thr Leu Leu His Asn Gly His 1130 1135 1140 Phe Thr Lys Asp Ala Ala Asn Trp Thr Val Glu Gly Asp Ala His 1145 1150 1155 Gln Val Val Leu Glu Asp Gly Lys Arg Val Leu Arg Leu Pro Asp 1160 1165 1170 Trp Ser Ser Ser Val Ser Gln Thr Ile Glu Ile Glu Asn Phe Asp 1175 1180 1185 Pro Asp Lys Glu Tyr Gln Leu Val Phe His Gly Gln Gly Glu Gly 1190 1195 1200 Thr Val Thr Leu Glu His Gly Glu Glu Thr Lys Tyr Ile Glu Thr 1205 1210 1215 His Thr His His Phe Ala Asn Phe Thr Thr Ser Gln Arg Gln Gly 1220 1225 1230 Leu Thr Phe Glu Ser Asn Lys Val Thr Val Thr Ile Ser Ser Glu 1235 1240 1245 Asp Gly Glu Phe Leu Val Asp Asn Ile Ala Leu Val Glu Ala Pro 1250 1255 1260 Leu Pro Thr Asp Asp Gln Asn Ser Glu Gly Asn Thr Ala Ser Ser 1265 1270 1275 Thr Asn Ser Asp Thr Ser Met Asn Asn Asn Gln 1280 1285 5 3771 DNA Bacillus thuringiensis misc_feature (4)..(24) /function= "oligonucleotide hybridization probe" /product= "GCA/T ACA/T TTA AAT GAA GTA/T TAT" /standard_name= "probe a" /note= "probe a" 5 atggctacac ttaatgaagt atatcctgtg aattataatg tattatcttc tgatgctttt 60 caacaattag atacaacagg ttttaaaagt aaatatgatg aaatgataaa agcattcgaa 120 aaaaaatgga aaaaaggggc aaaaggaaaa gaccttttag atgttgcatg gacttatata 180 actacaggag aaattgaccc tttaaatgta attaaaggtg ttttatctgt attaacttta 240 attcctgaag ttggtactgt ggcctctgca gcaagtacta ttgtaagttt tatttggcct 300 aaaatatttg gagataaacc aaatgcaaaa aatatatttg aagagctcaa gcctcaaatt 360 gaagcattaa ttcaacaaga tataacaaac tatcaagatg caattaatca aaaaaaattt 420 gacagtcttc agaaaacaat taatctatat acagtagcta tagataacaa tgattacgta 480 acagcaaaaa cgcaactcga aaatctaaat tctatactta cctcagatat ctccatattt 540 attccagaag gatatgaaac tggaggttta ccttattatg ctatggttgc taatgctcat 600 atattattgt taagagacgc tatagttaat gcagagaaat taggctttag tgataaagaa 660 gtagacacac ataaaaaata tatcaaaatg acaatacaca atcatactga agcagtaata 720 aaagcattct taaatggact tgacaaattt aagagtttag atgtaaatag ctataataaa 780 aaagcaaatt atattaaagg tatgacagaa atggttcttg atctagttgc tctatggcca 840 actttcgatc cagatcatta tcaaaaagaa gtagaaattg aatttacaag aactatttct 900 tctccaattt accaacctgt acctaaaaac atgcaaaata cctctagctc tattgtacct 960 agcgatctat ttcactatca aggagatctt gtaaaattag aattttctac aagaacggac 1020 aacgatggtc ttgcaaaaat ttttactggt attcgaaaca cattctacaa atcgcctaat 1080 actcatgaaa cataccatgt agattttagt tataataccc aatctagtgg taatatttca 1140 agaggctctt caaatccgat tccaattgat cttaataatc ccattatttc aacttgtatt 1200 agaaattcat tttataaggc aatagcggga tcttctgttt tagttaattt taaagatggc 1260 actcaagggt atgcatttgc ccaagcacca acaggaggtg cctgggacca ttcttttatt 1320 gaatctgatg gtgccccaga agggcataaa ttaaactata tttatacttc tccaggtgat 1380 acattaagag atttcatcaa tgtatatact cttataagta ctccaactat aaatgaacta 1440 tcaacagaaa aaatcaaagg ctttcctgcg gaaaaaggat atatcaaaaa tcaagggatc 1500 atgaaatatt acggtaaacc agaatatatt aatggagctc aaccagttaa tctggaaaac 1560 cagcaaacat taatattcga atttcatgct tcaaaaacag ctcaatatac cattcgtata 1620 cgttatgcca gtacccaagg aacaaaaggt tattttcgtt tagataatca ggaactgcaa 1680 acgcttaata tacctacttc acacaacggt tatgtaaccg gtaatattgg tgaaaattat 1740 gatttatata caataggttc atatacaatt acagaaggta accatactct tcaaatccaa 1800 cataatgata aaaatggaat ggttttagat cgtattgaat ttgttcctaa agattcactt 1860 caagattcac ctcaagattc acctccagaa gttcacgaat caacaattat ttttgataaa 1920 tcatctccaa ctatatggtc ttctaacaaa cactcatata gccatataca tttagaagga 1980 tcatatacaa gtcagggaag ttatccacac aatttattaa ttaatttatt tcatcctaca 2040 gaccctaaca gaaatcatac tattcatgtt aacaatggtg atatgaatgt tgattatgga 2100 aaagattctg tagccgatgg gttaaatttt aataaaataa ctgctacgat accaagtgat 2160 gcttggtata gcggtactat tacttctatg cacttattta atgataataa ttttaaaaca 2220 ataactccta aatttgaact ttctaatgaa ttagaaaaca tcacaactca agtaaatgct 2280 ttattcgcat ctagtgcaca agatactctc gcaagtaatg taagtgatta ctggattgaa 2340 caggtcgtta tgaaagtcga tgccttatca gatgaagtat ttggaaaaga gaaaaaagca 2400 ttacgtaaat tggtaaatca agcaaaacgt ctcagtaaaa tacgaaatct tctcataggt 2460 ggtaattttg acaatttagt cgcttggtat atgggaaaag atgtagtaaa agaatcggat 2520 catgaattat ttaaaagtga tcatgtctta ctacctcccc caacattcca tccttcttat 2580 attttccaaa aggtggaaga atcaaaacta aaaccaaata cacgttatac tatttctggt 2640 tttatcgcac atggagaaga tgtagagctt gttgtctctc gttatgggca agaaatacaa 2700 aaagtgatgc aagtgccata tgaagaagca cttcctctta catctgaatc taattctagt 2760 tgttgtgttc caaatttaaa tataaatgaa acactagctg atccacattt ctttagttat 2820 agcatcgatg ttggttctct ggaaatggaa gcgaatcctg gtattgaatt tggtctccgt 2880 attgtcaaac caacaggtat ggcacgtgta agtaatttag aaattcgaga agaccgtcca 2940 ttaacagcaa aagaaattcg tcaagtacaa cgtgcagcaa gagattggaa acaaaactat 3000 gaacaagaac gaacagagat cacagctata attcaacctg ttcttaatca aattaatgcg 3060 ttatacgaaa atgaagattg gaatggttct attcgttcaa atgtttccta tcatgatcta 3120 gagcaaatta tgcttcctac tttattaaaa actgaggaaa taaattgtaa ttatgatcat 3180 ccagcttttt tattaaaagt atatcattgg tttatgacag atcgtatagg agaacatggt 3240 actattttag cacgtttcca agaagcatta gatcgtgcat atacacaatt agaaagtcgt 3300 aatctcctgc ataacggtca ttttacaact gatacagcga attggacaat agaaggagat 3360 gcccatcata caatcttaga agatggtaga cgtgtgttac gtttaccaga ttggtcttct 3420 aatgcaactc aaacaattga aattgaagat tttgacttag atcaagaata ccaattgctc 3480 attcatgcaa aaggaaaagg ttccattact ttacaacatg gagaagaaaa cgaatatgtg 3540 gaaacacata ctcatcatac aaatgatttt ataacatccc aaaatattcc tttcactttt 3600 aaaggaaatc aaattgaagt ccatattact tcagaagatg gagagttttt aatcgatcac 3660 attacagtaa tagaagtttc taaaacagac acaaatacaa atattattga aaattcacca 3720 atcaatacaa gtatgaatag taatgtaaga gtagatatac caagaagtct c 3771 6 1257 PRT Bacillus thuringiensis 6 Met Ala Thr Leu Asn Glu Val Tyr Pro Val Asn Tyr Asn Val Leu Ser 1 5 10 15 Ser Asp Ala Phe Gln Gln Leu Asp Thr Thr Gly Phe Lys Ser Lys Tyr 20 25 30 Asp Glu Met Ile Lys Ala Phe Glu Lys Lys Trp Lys Lys Gly Ala Lys 35 40 45 Gly Lys Asp Leu Leu Asp Val Ala Trp Thr Tyr Ile Thr Thr Gly Glu 50 55 60 Ile Asp Pro Leu Asn Val Ile Lys Gly Val Leu Ser Val Leu Thr Leu 65 70 75 80 Ile Pro Glu Val Gly Thr Val Ala Ser Ala Ala Ser Thr Ile Val Ser 85 90 95 Phe Ile Trp Pro Lys Ile Phe Gly Asp Lys Pro Asn Ala Lys Asn Ile 100 105 110 Phe Glu Glu Leu Lys Pro Gln Ile Glu Ala Leu Ile Gln Gln Asp Ile 115 120 125 Thr Asn Tyr Gln Asp Ala Ile Asn Gln Lys Lys Phe Asp Ser Leu Gln 130 135 140 Lys Thr Ile Asn Leu Tyr Thr Val Ala Ile Asp Asn Asn Asp Tyr Val 145 150 155 160 Thr Ala Lys Thr Gln Leu Glu Asn Leu Asn Ser Ile Leu Thr Ser Asp 165 170 175 Ile Ser Ile Phe Ile Pro Glu Gly Tyr Glu Thr Gly Gly Leu Pro Tyr 180 185 190 Tyr Ala Met Val Ala Asn Ala His Ile Leu Leu Leu Arg Asp Ala Ile 195 200 205 Val Asn Ala Glu Lys Leu Gly Phe Ser Asp Lys Glu Val Asp Thr His 210 215 220 Lys Lys Tyr Ile

Lys Met Thr Ile His Asn His Thr Glu Ala Val Ile 225 230 235 240 Lys Ala Phe Leu Asn Gly Leu Asp Lys Phe Lys Ser Leu Asp Val Asn 245 250 255 Ser Tyr Asn Lys Lys Ala Asn Tyr Ile Lys Gly Met Thr Glu Met Val 260 265 270 Leu Asp Leu Val Ala Leu Trp Pro Thr Phe Asp Pro Asp His Tyr Gln 275 280 285 Lys Glu Val Glu Ile Glu Phe Thr Arg Thr Ile Ser Ser Pro Ile Tyr 290 295 300 Gln Pro Val Pro Lys Asn Met Gln Asn Thr Ser Ser Ser Ile Val Pro 305 310 315 320 Ser Asp Leu Phe His Tyr Gln Gly Asp Leu Val Lys Leu Glu Phe Ser 325 330 335 Thr Arg Thr Asp Asn Asp Gly Leu Ala Lys Ile Phe Thr Gly Ile Arg 340 345 350 Asn Thr Phe Tyr Lys Ser Pro Asn Thr His Glu Thr Tyr His Val Asp 355 360 365 Phe Ser Tyr Asn Thr Gln Ser Ser Gly Asn Ile Ser Arg Gly Ser Ser 370 375 380 Asn Pro Ile Pro Ile Asp Leu Asn Asn Pro Ile Ile Ser Thr Cys Ile 385 390 395 400 Arg Asn Ser Phe Tyr Lys Ala Ile Ala Gly Ser Ser Val Leu Val Asn 405 410 415 Phe Lys Asp Gly Thr Gln Gly Tyr Ala Phe Ala Gln Ala Pro Thr Gly 420 425 430 Gly Ala Trp Asp His Ser Phe Ile Glu Ser Asp Gly Ala Pro Glu Gly 435 440 445 His Lys Leu Asn Tyr Ile Tyr Thr Ser Pro Gly Asp Thr Leu Arg Asp 450 455 460 Phe Ile Asn Val Tyr Thr Leu Ile Ser Thr Pro Thr Ile Asn Glu Leu 465 470 475 480 Ser Thr Glu Lys Ile Lys Gly Phe Pro Ala Glu Lys Gly Tyr Ile Lys 485 490 495 Asn Gln Gly Ile Met Lys Tyr Tyr Gly Lys Pro Glu Tyr Ile Asn Gly 500 505 510 Ala Gln Pro Val Asn Leu Glu Asn Gln Gln Thr Leu Ile Phe Glu Phe 515 520 525 His Ala Ser Lys Thr Ala Gln Tyr Thr Ile Arg Ile Arg Tyr Ala Ser 530 535 540 Thr Gln Gly Thr Lys Gly Tyr Phe Arg Leu Asp Asn Gln Glu Leu Gln 545 550 555 560 Thr Leu Asn Ile Pro Thr Ser His Asn Gly Tyr Val Thr Gly Asn Ile 565 570 575 Gly Glu Asn Tyr Asp Leu Tyr Thr Ile Gly Ser Tyr Thr Ile Thr Glu 580 585 590 Gly Asn His Thr Leu Gln Ile Gln His Asn Asp Lys Asn Gly Met Val 595 600 605 Leu Asp Arg Ile Glu Phe Val Pro Lys Asp Ser Leu Gln Asp Ser Pro 610 615 620 Gln Asp Ser Pro Pro Glu Val His Glu Ser Thr Ile Ile Phe Asp Lys 625 630 635 640 Ser Ser Pro Thr Ile Trp Ser Ser Asn Lys His Ser Tyr Ser His Ile 645 650 655 His Leu Glu Gly Ser Tyr Thr Ser Gln Gly Ser Tyr Pro His Asn Leu 660 665 670 Leu Ile Asn Leu Phe His Pro Thr Asp Pro Asn Arg Asn His Thr Ile 675 680 685 His Val Asn Asn Gly Asp Met Asn Val Asp Tyr Gly Lys Asp Ser Val 690 695 700 Ala Asp Gly Leu Asn Phe Asn Lys Ile Thr Ala Thr Ile Pro Ser Asp 705 710 715 720 Ala Trp Tyr Ser Gly Thr Ile Thr Ser Met His Leu Phe Asn Asp Asn 725 730 735 Asn Phe Lys Thr Ile Thr Pro Lys Phe Glu Leu Ser Asn Glu Leu Glu 740 745 750 Asn Ile Thr Thr Gln Val Asn Ala Leu Phe Ala Ser Ser Ala Gln Asp 755 760 765 Thr Leu Ala Ser Asn Val Ser Asp Tyr Trp Ile Glu Gln Val Val Met 770 775 780 Lys Val Asp Ala Leu Ser Asp Glu Val Phe Gly Lys Glu Lys Lys Ala 785 790 795 800 Leu Arg Lys Leu Val Asn Gln Ala Lys Arg Leu Ser Lys Ile Arg Asn 805 810 815 Leu Leu Ile Gly Gly Asn Phe Asp Asn Leu Val Ala Trp Tyr Met Gly 820 825 830 Lys Asp Val Val Lys Glu Ser Asp His Glu Leu Phe Lys Ser Asp His 835 840 845 Val Leu Leu Pro Pro Pro Thr Phe His Pro Ser Tyr Ile Phe Gln Lys 850 855 860 Val Glu Glu Ser Lys Leu Lys Pro Asn Thr Arg Tyr Thr Ile Ser Gly 865 870 875 880 Phe Ile Ala His Gly Glu Asp Val Glu Leu Val Val Ser Arg Tyr Gly 885 890 895 Gln Glu Ile Gln Lys Val Met Gln Val Pro Tyr Glu Glu Ala Leu Pro 900 905 910 Leu Thr Ser Glu Ser Asn Ser Ser Cys Cys Val Pro Asn Leu Asn Ile 915 920 925 Asn Glu Thr Leu Ala Asp Pro His Phe Phe Ser Tyr Ser Ile Asp Val 930 935 940 Gly Ser Leu Glu Met Glu Ala Asn Pro Gly Ile Glu Phe Gly Leu Arg 945 950 955 960 Ile Val Lys Pro Thr Gly Met Ala Arg Val Ser Asn Leu Glu Ile Arg 965 970 975 Glu Asp Arg Pro Leu Thr Ala Lys Glu Ile Arg Gln Val Gln Arg Ala 980 985 990 Ala Arg Asp Trp Lys Gln Asn Tyr Glu Gln Glu Arg Thr Glu Ile Thr 995 1000 1005 Ala Ile Ile Gln Pro Val Leu Asn Gln Ile Asn Ala Leu Tyr Glu 1010 1015 1020 Asn Glu Asp Trp Asn Gly Ser Ile Arg Ser Asn Val Ser Tyr His 1025 1030 1035 Asp Leu Glu Gln Ile Met Leu Pro Thr Leu Leu Lys Thr Glu Glu 1040 1045 1050 Ile Asn Cys Asn Tyr Asp His Pro Ala Phe Leu Leu Lys Val Tyr 1055 1060 1065 His Trp Phe Met Thr Asp Arg Ile Gly Glu His Gly Thr Ile Leu 1070 1075 1080 Ala Arg Phe Gln Glu Ala Leu Asp Arg Ala Tyr Thr Gln Leu Glu 1085 1090 1095 Ser Arg Asn Leu Leu His Asn Gly His Phe Thr Thr Asp Thr Ala 1100 1105 1110 Asn Trp Thr Ile Glu Gly Asp Ala His His Thr Ile Leu Glu Asp 1115 1120 1125 Gly Arg Arg Val Leu Arg Leu Pro Asp Trp Ser Ser Asn Ala Thr 1130 1135 1140 Gln Thr Ile Glu Ile Glu Asp Phe Asp Leu Asp Gln Glu Tyr Gln 1145 1150 1155 Leu Leu Ile His Ala Lys Gly Lys Gly Ser Ile Thr Leu Gln His 1160 1165 1170 Gly Glu Glu Asn Glu Tyr Val Glu Thr His Thr His His Thr Asn 1175 1180 1185 Asp Phe Ile Thr Ser Gln Asn Ile Pro Phe Thr Phe Lys Gly Asn 1190 1195 1200 Gln Ile Glu Val His Ile Thr Ser Glu Asp Gly Glu Phe Leu Ile 1205 1210 1215 Asp His Ile Thr Val Ile Glu Val Ser Lys Thr Asp Thr Asn Thr 1220 1225 1230 Asn Ile Ile Glu Asn Ser Pro Ile Asn Thr Ser Met Asn Ser Asn 1235 1240 1245 Val Arg Val Asp Ile Pro Arg Ser Leu 1250 1255 7 1425 DNA Artificial Sequence Clone E. coli NM522 (pMYC 2321) NRRL B-18770 7 atgattattg atagtaaaac gactttacct agacattcac ttattcatac aattaaatta 60 aattctaata agaaatatgg tcctggtgat atgactaatg gaaatcaatt tattatttca 120 aaacaagaat gggctacgat tggagcatat attcagactg gattaggttt accagtaaat 180 gaacaacaat taagaacaca tgttaattta agtcaggata tatcaatacc tagtgatttt 240 tctcaattat atgatgttta ttgttctgat aaaacttcag cagaatggtg gaataaaaat 300 ttatatcctt taattattaa atctgctaat gatattgctt catatggttt taaagttgct 360 ggtgatcctt ctattaagaa agatggatat tttaaaaaat tgcaagatga attagataat 420 attgttgata ataattccga tgatgatgca atagctaaag ctattaaaga ttttaaagcg 480 cgatgtggta ttttaattaa agaagctaaa caatatgaag aagctgcaaa aaatattgta 540 acatctttag atcaattttt acatggtgat cagaaaaaat tagaaggtgt tatcaatatt 600 caaaaacgtt taaaagaagt tcaaacagct cttaatcaag cccatgggga aagtagtcca 660 gctcataaag agttattaga aaaagtaaaa aatttaaaaa caacattaga aaggactatt 720 aaagctgaac aagatttaga gaaaaaagta gaatatagtt ttctattagg accattgtta 780 ggatttgttg tttatgaaat tcttgaaaat actgctgttc agcatataaa aaatcaaatt 840 gatgagataa agaaacaatt agattctgct cagcatgatt tggatagaga tgttaaaatt 900 ataggaatgt taaatagtat taatacagat attgataatt tatatagtca aggacaagaa 960 gcaattaaag ttttccaaaa gttacaaggt atttgggcta ctattggagc tcaaatagaa 1020 aatcttagaa caacgtcgtt acaagaagtt caagattctg atgatgctga tgagatacaa 1080 attgaacttg aggacgcttc tgatgcttgg ttagttgtgg ctcaagaagc tcgtgatttt 1140 acactaaatg cttattcaac taatagtaga caaaatttac cgattaatgt tatatcagat 1200 tcatgtaatt gttcaacaac aaatatgaca tcaaatcaat acagtaatcc aacaacaaat 1260 atgacatcaa atcaatatat gatttcacat gaatatacaa gtttaccaaa taattttatg 1320 ttatcaagaa atagtaattt agaatataaa tgtcctgaaa ataattttat gatatattgg 1380 tataataatt cggattggta taataattcg gattggtata ataat 1425 8 475 PRT Bacillus thuringiensis 8 Met Ile Ile Asp Ser Lys Thr Thr Leu Pro Arg His Ser Leu Ile His 1 5 10 15 Thr Ile Lys Leu Asn Ser Asn Lys Lys Tyr Gly Pro Gly Asp Met Thr 20 25 30 Asn Gly Asn Gln Phe Ile Ile Ser Lys Gln Glu Trp Ala Thr Ile Gly 35 40 45 Ala Tyr Ile Gln Thr Gly Leu Gly Leu Pro Val Asn Glu Gln Gln Leu 50 55 60 Arg Thr His Val Asn Leu Ser Gln Asp Ile Ser Ile Pro Ser Asp Phe 65 70 75 80 Ser Gln Leu Tyr Asp Val Tyr Cys Ser Asp Lys Thr Ser Ala Glu Trp 85 90 95 Trp Asn Lys Asn Leu Tyr Pro Leu Ile Ile Lys Ser Ala Asn Asp Ile 100 105 110 Ala Ser Tyr Gly Phe Lys Val Ala Gly Asp Pro Ser Ile Lys Lys Asp 115 120 125 Gly Tyr Phe Lys Lys Leu Gln Asp Glu Leu Asp Asn Ile Val Asp Asn 130 135 140 Asn Ser Asp Asp Asp Ala Ile Ala Lys Ala Ile Lys Asp Phe Lys Ala 145 150 155 160 Arg Cys Gly Ile Leu Ile Lys Glu Ala Lys Gln Tyr Glu Glu Ala Ala 165 170 175 Lys Asn Ile Val Thr Ser Leu Asp Gln Phe Leu His Gly Asp Gln Lys 180 185 190 Lys Leu Glu Gly Val Ile Asn Ile Gln Lys Arg Leu Lys Glu Val Gln 195 200 205 Thr Ala Leu Asn Gln Ala His Gly Glu Ser Ser Pro Ala His Lys Glu 210 215 220 Leu Leu Glu Lys Val Lys Asn Leu Lys Thr Thr Leu Glu Arg Thr Ile 225 230 235 240 Lys Ala Glu Gln Asp Leu Glu Lys Lys Val Glu Tyr Ser Phe Leu Leu 245 250 255 Gly Pro Leu Leu Gly Phe Val Val Tyr Glu Ile Leu Glu Asn Thr Ala 260 265 270 Val Gln His Ile Lys Asn Gln Ile Asp Glu Ile Lys Lys Gln Leu Asp 275 280 285 Ser Ala Gln His Asp Leu Asp Arg Asp Val Lys Ile Ile Gly Met Leu 290 295 300 Asn Ser Ile Asn Thr Asp Ile Asp Asn Leu Tyr Ser Gln Gly Gln Glu 305 310 315 320 Ala Ile Lys Val Phe Gln Lys Leu Gln Gly Ile Trp Ala Thr Ile Gly 325 330 335 Ala Gln Ile Glu Asn Leu Arg Thr Thr Ser Leu Gln Glu Val Gln Asp 340 345 350 Ser Asp Asp Ala Asp Glu Ile Gln Ile Glu Leu Glu Asp Ala Ser Asp 355 360 365 Ala Trp Leu Val Val Ala Gln Glu Ala Arg Asp Phe Thr Leu Asn Ala 370 375 380 Tyr Ser Thr Asn Ser Arg Gln Asn Leu Pro Ile Asn Val Ile Ser Asp 385 390 395 400 Ser Cys Asn Cys Ser Thr Thr Asn Met Thr Ser Asn Gln Tyr Ser Asn 405 410 415 Pro Thr Thr Asn Met Thr Ser Asn Gln Tyr Met Ile Ser His Glu Tyr 420 425 430 Thr Ser Leu Pro Asn Asn Phe Met Leu Ser Arg Asn Ser Asn Leu Glu 435 440 445 Tyr Lys Cys Pro Glu Asn Asn Phe Met Ile Tyr Trp Tyr Asn Asn Ser 450 455 460 Asp Trp Tyr Asn Asn Ser Asp Trp Tyr Asn Asn 465 470 475 9 1185 DNA Bacillus thuringiensis 9 atgattttag ggaatggaaa gactttacca aagcatataa gattagctca tatttttgca 60 acacagaatt cttcagctaa gaaagacaat cctcttggac cagaggggat ggttactaaa 120 gacggtttta taatctctaa ggaagaatgg gcatttgtgc aggcctatgt gactacaggc 180 actggtttac ctatcaatga cgatgagatg cgtagacatg ttgggttacc atcacgcatt 240 caaattcctg atgattttaa tcaattatat aaggtttata atgaagataa acatttatgc 300 agttggtgga atggtttctt gtttccatta gttcttaaaa cagctaatga tatttccgct 360 tacggattta aatgtgctgg aaagggtgcc actaaaggat attatgaggt catgcaagac 420 gatgtagaaa atatttcaga taatggttat gataaagttg cacaagaaaa agcacataag 480 gatctgcagg cgcgttgtaa aatccttatt aaggaggctg atcaatataa agctgcagcg 540 gatgatgttt caaaacattt aaacacattt cttaaaggcg gtcaagattc agatggcaat 600 gatgttattg gcgtagaggc tgttcaagta caactagcac aagtaaaaga taatcttgat 660 ggcctatatg gcgacaaaag cccaagacat gaagagttac taaagaaagt agacgacctg 720 aaaaaagagt tggaagctgc tattaaagca gagaatgaat tagaaaagaa agtgaaaatg 780 agttttgctt taggaccatt acttggattt gttgtatatg aaatcttaga gctaactgcg 840 gtcaaaagta tacacaagaa agttgaggca ctacaagccg agcttgacac tgctaatgat 900 gaactcgaca gagatgtaaa aatcttagga atgatgaata gcattgacac tgatattgac 960 aacatgttag agcaaggtga gcaagctctt gttgtattta gaaaaattgc aggcatttgg 1020 agtgttataa gtcttaatat cggcaatctt cgagaaacat ctttaaaaga gatagaagaa 1080 gaaaatgatg acgatgcact gtatattgag cttggtgatg ccgctggtca atggaaagag 1140 atagccgagg aggcacaatc ctttgtacta aatgcttata ctcct 1185 10 395 PRT Bacillus thuringiensis 10 Met Ile Leu Gly Asn Gly Lys Thr Leu Pro Lys His Ile Arg Leu Ala 1 5 10 15 His Ile Phe Ala Thr Gln Asn Ser Ser Ala Lys Lys Asp Asn Pro Leu 20 25 30 Gly Pro Glu Gly Met Val Thr Lys Asp Gly Phe Ile Ile Ser Lys Glu 35 40 45 Glu Trp Ala Phe Val Gln Ala Tyr Val Thr Thr Gly Thr Gly Leu Pro 50 55 60 Ile Asn Asp Asp Glu Met Arg Arg His Val Gly Leu Pro Ser Arg Ile 65 70 75 80 Gln Ile Pro Asp Asp Phe Asn Gln Leu Tyr Lys Val Tyr Asn Glu Asp 85 90 95 Lys His Leu Cys Ser Trp Trp Asn Gly Phe Leu Phe Pro Leu Val Leu 100 105 110 Lys Thr Ala Asn Asp Ile Ser Ala Tyr Gly Phe Lys Cys Ala Gly Lys 115 120 125 Gly Ala Thr Lys Gly Tyr Tyr Glu Val Met Gln Asp Asp Val Glu Asn 130 135 140 Ile Ser Asp Asn Gly Tyr Asp Lys Val Ala Gln Glu Lys Ala His Lys 145 150 155 160 Asp Leu Gln Ala Arg Cys Lys Ile Leu Ile Lys Glu Ala Asp Gln Tyr 165 170 175 Lys Ala Ala Ala Asp Asp Val Ser Lys His Leu Asn Thr Phe Leu Lys 180 185 190 Gly Gly Gln Asp Ser Asp Gly Asn Asp Val Ile Gly Val Glu Ala Val 195 200 205 Gln Val Gln Leu Ala Gln Val Lys Asp Asn Leu Asp Gly Leu Tyr Gly 210 215 220 Asp Lys Ser Pro Arg His Glu Glu Leu Leu Lys Lys Val Asp Asp Leu 225 230 235 240 Lys Lys Glu Leu Glu Ala Ala Ile Lys Ala Glu Asn Glu Leu Glu Lys 245 250 255 Lys Val Lys Met Ser Phe Ala Leu Gly Pro Leu Leu Gly Phe Val Val 260 265 270 Tyr Glu Ile Leu Glu Leu Thr Ala Val Lys Ser Ile His Lys Lys Val 275 280 285 Glu Ala Leu Gln Ala Glu Leu Asp Thr Ala Asn Asp Glu Leu Asp Arg 290 295 300 Asp Val Lys Ile Leu Gly Met Met Asn Ser Ile Asp Thr Asp Ile Asp 305 310 315 320 Asn Met Leu Glu Gln Gly Glu Gln Ala Leu Val Val Phe Arg Lys Ile 325 330 335 Ala Gly Ile Trp Ser Val Ile Ser Leu Asn Ile Gly Asn Leu Arg Glu 340 345 350 Thr Ser Leu Lys Glu Ile Glu Glu Glu Asn Asp Asp Asp Ala Leu Tyr 355 360 365 Ile Glu Leu Gly Asp Ala Ala Gly Gln Trp Lys Glu Ile Ala Glu Glu 370 375 380 Ala Gln Ser Phe Val Leu Asn Ala Tyr Thr Pro 385 390 395 11 2412 DNA Bacillus thuringiensis 11 atgacttgtc aattacaagc gcaaccactt attccctata acgtactagc aggagttcca 60 actagtaata caggtagtcc aatcggcaat gcaggtaatc aatttgatca gtttgagcaa 120 accgttaaag agctcaagga agcatgggaa gcgttccaaa aaaacggaag tttctcatta 180 gcagctcttg aaaagggatt tgatgcagca atcggaggag gatcctttga ttatttaggt 240 ttagttcaag ccggcctagg attagttggt acgctaggcg ccgcaatccc tggtgtttca 300 gtggcagtgc ctcttattag catgcttgtt ggtgtttttt ggccaaaggg cacaaacaac 360 caagaaaacc ttattacagt tattgataag gaagttcaga gaatactaga tgaaaagcta 420 tctgatcagt taataaagaa attgaacgca gatttaaatg cttttacgga cctagtaact 480 cgtttggaag aagtaataat agatgcaact ttcgagaatc acaagcctgt

actacaagta 540 agtaaatcaa attatatgaa agtggattca gcatatttct caacaggagg tattcttact 600 cttggcatga gtgattttct tactgatacc tattcaaagc ttaccttccc attatatgta 660 ctaggcgcaa ctatgaaact ttcagcatat catagttata tacaattcgg aaatacatgg 720 cttaataaag tttatgattt atcatcagat gagggaaaaa caatgtcgca ggctttagca 780 cgagctaaac agcatatgcg ccaagacata gcattttata caagccaagc tttaaacatg 840 tttactggga atctcccttc attatcatct aataaatatg caattaatga ctataatgta 900 tacactcgag caatggtatt gaatggctta gatatagtag caacatggcc taccctatat 960 ccagatgact attcgtctca gataaaactg gagaaaacac gcgtgatctt ttcagatatg 1020 gtcgggcaaa gtgagagtag agatggcagc gtaacgatta aaaatatttt tgacaataca 1080 gattcacatc aacatggatc cataggtctc aattcaatct cttatttccc agatgagtta 1140 cagaaagcac aacttcgcat gtatgattat aatcacaaac cttattgtac ggactgtttc 1200 tgctggccgt atggagtgat tttaaactat aacaagaata cctttagata tggcgataat 1260 gatccaggtc tttcaggaga cgttcaactc ccagcaccta tgagtgtagt taatgcccaa 1320 actcaaacag cccaatatac agatggagaa aacatatgga cagatactgg ccgcagttgg 1380 ctttgtactc tacgtggcta ctgtactaca aactgttttc caggaagagg ttgttataat 1440 aatagtactg gatatggaga aagttgcaat caatcacttc caggtcaaaa aatacatgca 1500 ctatatcctt ttacacaaac aaatgtgctg ggacaatcag gcaaactagg attgctagca 1560 agtcatattc catatgacct aagtccgaac aatacgattg gtgacaaaga tacagattct 1620 acgaatattg tcgcaaaagg aattccagtg gaaaaagggt atgcatccag tggacaaaaa 1680 gttgaaatta tacgagagtg gataaatggt gcgaatgtag ttcaattatc tccaggccaa 1740 tcttggggaa tggattttac caatagcaca ggtggtcaat atatggtccg ctgtcgatat 1800 gcaagtacaa acgatactcc aatctttttt aatttagtgt atgacggggg atcgaatcct 1860 atttataacc agatgacatt ccctgctaca aaagagactc cagctcacga ttcagtagat 1920 aacaagatac taggcataaa aggaataaat ggaaattatt cactcatgaa tgtaaaagat 1980 tctgtcgaac ttccatctgg gaaatttcat gtttttttca caaataatgg atcatctgct 2040 atttatttag atcgacttga gtttgttcct ttagatcaac cagcagcgcc aacacagtca 2100 acacaaccaa ttaattatcc tatcacaagt aggttacctc atcgttccgg agaaccacct 2160 gcaataatat gggagaaatc agggaatgtt cgcgggaatc aactaactat atcggcacaa 2220 ggtgttccag aaaattccca aatatatctt tcggtgggtg gcgatcgcca aattttagac 2280 cgtagcaacg gatttaaatt agttaattac tcacctactt attctttcac taacattcag 2340 gctagctcgt caaatttagt agatattaca agtggtacca tcactggcca agtacaagta 2400 tctaatctat aa 2412 12 803 PRT Bacillus thuringiensis 12 Met Thr Cys Gln Leu Gln Ala Gln Pro Leu Ile Pro Tyr Asn Val Leu 1 5 10 15 Ala Gly Val Pro Thr Ser Asn Thr Gly Ser Pro Ile Gly Asn Ala Gly 20 25 30 Asn Gln Phe Asp Gln Phe Glu Gln Thr Val Lys Glu Leu Lys Glu Ala 35 40 45 Trp Glu Ala Phe Gln Lys Asn Gly Ser Phe Ser Leu Ala Ala Leu Glu 50 55 60 Lys Gly Phe Asp Ala Ala Ile Gly Gly Gly Ser Phe Asp Tyr Leu Gly 65 70 75 80 Leu Val Gln Ala Gly Leu Gly Leu Val Gly Thr Leu Gly Ala Ala Ile 85 90 95 Pro Gly Val Ser Val Ala Val Pro Leu Ile Ser Met Leu Val Gly Val 100 105 110 Phe Trp Pro Lys Gly Thr Asn Asn Gln Glu Asn Leu Ile Thr Val Ile 115 120 125 Asp Lys Glu Val Gln Arg Ile Leu Asp Glu Lys Leu Ser Asp Gln Leu 130 135 140 Ile Lys Lys Leu Asn Ala Asp Leu Asn Ala Phe Thr Asp Leu Val Thr 145 150 155 160 Arg Leu Glu Glu Val Ile Ile Asp Ala Thr Phe Glu Asn His Lys Pro 165 170 175 Val Leu Gln Val Ser Lys Ser Asn Tyr Met Lys Val Asp Ser Ala Tyr 180 185 190 Phe Ser Thr Gly Gly Ile Leu Thr Leu Gly Met Ser Asp Phe Leu Thr 195 200 205 Asp Thr Tyr Ser Lys Leu Thr Phe Pro Leu Tyr Val Leu Gly Ala Thr 210 215 220 Met Lys Leu Ser Ala Tyr His Ser Tyr Ile Gln Phe Gly Asn Thr Trp 225 230 235 240 Leu Asn Lys Val Tyr Asp Leu Ser Ser Asp Glu Gly Lys Thr Met Ser 245 250 255 Gln Ala Leu Ala Arg Ala Lys Gln His Met Arg Gln Asp Ile Ala Phe 260 265 270 Tyr Thr Ser Gln Ala Leu Asn Met Phe Thr Gly Asn Leu Pro Ser Leu 275 280 285 Ser Ser Asn Lys Tyr Ala Ile Asn Asp Tyr Asn Val Tyr Thr Arg Ala 290 295 300 Met Val Leu Asn Gly Leu Asp Ile Val Ala Thr Trp Pro Thr Leu Tyr 305 310 315 320 Pro Asp Asp Tyr Ser Ser Gln Ile Lys Leu Glu Lys Thr Arg Val Ile 325 330 335 Phe Ser Asp Met Val Gly Gln Ser Glu Ser Arg Asp Gly Ser Val Thr 340 345 350 Ile Lys Asn Ile Phe Asp Asn Thr Asp Ser His Gln His Gly Ser Ile 355 360 365 Gly Leu Asn Ser Ile Ser Tyr Phe Pro Asp Glu Leu Gln Lys Ala Gln 370 375 380 Leu Arg Met Tyr Asp Tyr Asn His Lys Pro Tyr Cys Thr Asp Cys Phe 385 390 395 400 Cys Trp Pro Tyr Gly Val Ile Leu Asn Tyr Asn Lys Asn Thr Phe Arg 405 410 415 Tyr Gly Asp Asn Asp Pro Gly Leu Ser Gly Asp Val Gln Leu Pro Ala 420 425 430 Pro Met Ser Val Val Asn Ala Gln Thr Gln Thr Ala Gln Tyr Thr Asp 435 440 445 Gly Glu Asn Ile Trp Thr Asp Thr Gly Arg Ser Trp Leu Cys Thr Leu 450 455 460 Arg Gly Tyr Cys Thr Thr Asn Cys Phe Pro Gly Arg Gly Cys Tyr Asn 465 470 475 480 Asn Ser Thr Gly Tyr Gly Glu Ser Cys Asn Gln Ser Leu Pro Gly Gln 485 490 495 Lys Ile His Ala Leu Tyr Pro Phe Thr Gln Thr Asn Val Leu Gly Gln 500 505 510 Ser Gly Lys Leu Gly Leu Leu Ala Ser His Ile Pro Tyr Asp Leu Ser 515 520 525 Pro Asn Asn Thr Ile Gly Asp Lys Asp Thr Asp Ser Thr Asn Ile Val 530 535 540 Ala Lys Gly Ile Pro Val Glu Lys Gly Tyr Ala Ser Ser Gly Gln Lys 545 550 555 560 Val Glu Ile Ile Arg Glu Trp Ile Asn Gly Ala Asn Val Val Gln Leu 565 570 575 Ser Pro Gly Gln Ser Trp Gly Met Asp Phe Thr Asn Ser Thr Gly Gly 580 585 590 Gln Tyr Met Val Arg Cys Arg Tyr Ala Ser Thr Asn Asp Thr Pro Ile 595 600 605 Phe Phe Asn Leu Val Tyr Asp Gly Gly Ser Asn Pro Ile Tyr Asn Gln 610 615 620 Met Thr Phe Pro Ala Thr Lys Glu Thr Pro Ala His Asp Ser Val Asp 625 630 635 640 Asn Lys Ile Leu Gly Ile Lys Gly Ile Asn Gly Asn Tyr Ser Leu Met 645 650 655 Asn Val Lys Asp Ser Val Glu Leu Pro Ser Gly Lys Phe His Val Phe 660 665 670 Phe Thr Asn Asn Gly Ser Ser Ala Ile Tyr Leu Asp Arg Leu Glu Phe 675 680 685 Val Pro Leu Asp Gln Pro Ala Ala Pro Thr Gln Ser Thr Gln Pro Ile 690 695 700 Asn Tyr Pro Ile Thr Ser Arg Leu Pro His Arg Ser Gly Glu Pro Pro 705 710 715 720 Ala Ile Ile Trp Glu Lys Ser Gly Asn Val Arg Gly Asn Gln Leu Thr 725 730 735 Ile Ser Ala Gln Gly Val Pro Glu Asn Ser Gln Ile Tyr Leu Ser Val 740 745 750 Gly Gly Asp Arg Gln Ile Leu Asp Arg Ser Asn Gly Phe Lys Leu Val 755 760 765 Asn Tyr Ser Pro Thr Tyr Ser Phe Thr Asn Ile Gln Ala Ser Ser Ser 770 775 780 Asn Leu Val Asp Ile Thr Ser Gly Thr Ile Thr Gly Gln Val Gln Val 785 790 795 800 Ser Asn Leu 13 8 PRT Artificial sequence Probe 13 Arg Glu Trp Ile Asn Gly Ala Asn 1 5 14 22 DNA Artificial sequence DNA coding for probe of SEQ ID NO13 14 agartrkwtw aatggwgckm aw 22 15 8 PRT Artificial Sequence Probe 15 Pro Thr Phe Asp Pro Asp Leu Tyr 1 5 16 24 DNA Artificial Sequence DNA coding for probe of SEQ ID NO15 16 ccnacytttk atccagatsw ytat 24 17 14 PRT Artificial Sequence N-terminal amino acid sequence of 17a. 17 Ala Ile Leu Asn Glu Leu Tyr Pro Ser Val Pro Tyr Asn Val 1 5 10 18 14 PRT Artificial Sequence N-terminal amino acid sequence of 17b. 18 Ala Ile Leu Asn Glu Leu Tyr Pro Ser Val Pro Tyr Asn Val 1 5 10 19 17 PRT Artificial Sequence N-terminal amino acid sequence of 52A1. 19 Met Ile Ile Asp Ser Lys Thr Thr Leu Pro Arg His Ser Leu Ile Asn 1 5 10 15 Thr 20 14 PRT Artificial Sequence N-terminal amino acid sequence of 63B. 20 Gln Leu Gln Ala Gln Pro Leu Ile Pro Tyr Asn Val Leu Ala 1 5 10 21 24 PRT Artificial Sequence N-terminal amino acid sequence of 69D1. 21 Met Ile Leu Gly Asn Gly Lys Thr Leu Pro Lys His Ile Arg Leu Ala 1 5 10 15 His Ile Phe Ala Thr Gln Asn Ser 20 22 10 PRT Artificial Sequence N-terminal amino acid sequence of 33F2. 22 Ala Thr Leu Asn Glu Val Tyr Pro Val Asn 1 5 10 23 15 PRT Artificial Sequence Internal amino acid sequence for 63B. 23 Val Gln Arg Ile Leu Asp Glu Lys Leu Ser Phe Gln Leu Ile Lys 1 5 10 15 24 23 DNA Artificial Sequence Synthetic oligonucleotide derived from 17. 24 gcaattttaa atgaattata tcc 23 25 56 DNA Artificial Sequence Oligonucleotide probe designed from the N-terminal amino acid sequence of 52A1. 25 atgattattg attctaaaac aacattacca agacattcwt taatwaatac watwaa 56 26 38 DNA Artificial Sequence Synthetic oligonucleotide probe designated as 69D1-D. 26 aaacatatta gattagcaca tatttttgca acacaaaa 38 27 17 DNA Artificial Sequence Forward oligonucleotide primer from 63B. 27 caaytacaag cwcaacc 17 28 21 DNA Artificial Sequence Reverse oligonucleotide primer from 63B. 28 ttcatctaaa attctttgwa c 21 29 8 PRT Artificial Sequence Nematode (NEMI) variant of region 5 of Hofte and Whiteley. 29 Leu Asp Arg Ile Gln Phe Ile Pro 1 5 30 23 DNA Artificial Sequence Reverse complement primer to SEQ ID NO29. 30 aggaacaaay tcaakwcgrt cta 23 31 9 PRT Artificial Sequence Peptide 31 Tyr Ile Asp Lys Ile Glu Phe Ile Pro 1 5 32 23 DNA Artificial Sequence Oligonucleotide coding for the peptide of SEQ ID NO31. 32 tggaataaat tcaattykrt cwa 23 33 21 DNA Artificial Sequence Oligonucleotide probe 33F2A. 33 gcwacwttaa atgaagtwta t 21 34 21 DNA Artificial Sequence Oligonucleotide probe 33F2B. 34 aatgaagtwt atccwgtwaa t 21 35 38 DNA Artificial sequence Reverse primer. 35 gcaagcggcc gcttatggaa taaattcaat tykrtcwa 38 36 28 DNA Artificial Sequence Forward primer. 36 tgattttwmt caattatatr akgtttat 28 37 20 DNA Artificial Sequence Probe 37 aagagttayt araraaagta 20 38 35 DNA Artificial Sequence Probe 38 ttaggaccat trytwggatt tgttgtwtat gaaat 35 39 27 DNA Artificial Sequence Probe 39 gayagagatg twaaaatywt aggaatg 27 40 23 DNA Artificial Sequence Forward primer. 40 ttmttaaawc wgctaatgat att 23

Claims

1. An isolated, nematicidal protein wherein said protein comprises a nematicidal portion of an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10, and SEQ ID NO:12.

2. The protein of claim 1 wherein said protein comprises a nematicidal portion of SEQ ID No:2.

3. The protein of claim 1 wherein said protein comprises a nematicidal portion of SEQ ID NO:4.

4. The protein of claim 1 wherein said protein comprises a nematicidal portion of SEQ ID NO:6.

5. The protein of claim 1 wherein said protein comprises a nematicidal portion of SEQ ID NO:10.

6. The protein of claim 1 wherein said protein comprises a nematicidal portion of SEQ ID NO:12.

7. The protein of claim 1 wherein said protein comprises the amino acid sequence of SEQ ID NO:2.

8. The protein of claim 1 wherein said protein comprises the amino acid sequence of SEQ ID NO:4.

9. The protein of claim 1 wherein said protein comprises the amino acid sequence of SEQ ID NO:6.

10. The protein of claim 1 wherein said protein comprises the amino acid sequence of SEQ ID NO:10.

11. The protein of claim 1 wherein said protein comprises the amino acid sequence of SEQ ID NO:12.

12. An isolated, nematicidal protein wherein said protein comprises a nematicidal portion of a .delta.-endotoxin obtainable from a Bacillus thuringiensis isolate selected from the group consisting of PS17 (NRRL B-18243), PS33F2 (NRRL B-18244), PS63B (NRRL B-18246), and PS69D1 (NRRL B-18247).

13. The protein of claim 12 wherein said Bacillus thuringiensis isolate is PS17 (NRRL B-18243).

14. The protein of claim 12 wherein said Bacillus thuringiensis isolate is PS33F2 (NRRL B-18244).

15. The protein of claim 12 wherein said Bacillus thuringiensis isolate is PS63B (NRRL B-18246).

16. The protein of claim 12 wherein said Bacillus thuringiensis isolate is PS69D1 (NRRL B-18247).

17. The protein of claim 15 wherein said .delta.-endotoxin comprises the amino acid sequence of SEQ ID NO:20.

18. The protein of claim 15 wherein said .delta.-endotoxin comprises the amino acid sequence of SEQ ID NO:23.

19. The protein of claim 16 wherein said .delta.-endotoxin comprises the amino acid sequence of SEQ ID NO:21.

20. The protein of claim 14 wherein said .delta.-endotoxin comprises the amino acid sequence of SEQ ID NO:22.

21. The protein of claim 12 wherein said protein comprises the amino acid sequence of a .delta.-endotoxin obtainable from a Bacillus thuringiensis isolate selected from the group consisting of PS17 (NRRL B-18243), PS33F2 (NRRL B-18244), PS52A1 (NRRL B-18245), PS63B (NRRL B-18246), and PS69D1 (NRRL B-18247).

22. The protein of claim 21 wherein said Bacillus thuringiensis isolate is PS17 (NRRL B-18243).

23. The protein of claim 21 wherein said Bacillus thuringiensis isolate is PS33F2 (NRRL B-18244).

24. The protein of claim 21 wherein said Bacillus thuringiensis isolate is PS63B (NRRL B-18246).

25. The protein of claim 21 wherein said Bacillus thuringiensis isolate is PS69D1 (NRRL B-18247).

26. A method for controlling a nematode pest wherein said method comprises administering a nematicidal protein to said pest so that said pest ingests said protein, wherein said protein comprises a nematicidal portion of an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:10.

27. The method of claim 26 wherein said protein comprises a nematicidal portion of SEQ ID NO:2.

28. The method of claim 26 wherein said protein comprises a nematicidal portion of SEQ ID NO:4.

29. The method of claim 26 wherein said protein comprises a nematicidal portion of SEQ ID NO:6.

30. The method of claim 26 wherein said protein comprises a nematicidal portion of SEQ ID NO:10.

31. The method of claim 26 wherein said protein comprises the amino acid sequence of SEQ ID NO:2.

32. The method of claim 26 wherein said protein comprises the amino acid sequence of SEQ ID NO:4.

33. The method of claim 26 wherein said protein comprises the amino acid sequence of SEQ ID NO:6.

34. The method of claim 26 wherein said protein comprises the amino acid sequence of SEQ ID NO:10.

35. A method for controlling a nematode pest wherein said method comprises administering a nematicidal protein to said pest so that said pest ingests said protein, wherein said protein comprises a nematicidal portion of a .delta.-endotoxin obtainable from a Bacillus thuringiensis isolate selected from the group consisting of PS33F2 (NRRL B-18244), PS52A1 (NRRL B-18245), and PS69D1 (NRRL B-18247), wherein said .delta.-endotoxin comprises SEQ ID NO:22 when said isolate is PS33F2, said .delta.-endotoxin comprises SEQ ID NO:19 when said isolate is PS52A1, and said .delta.-endotoxin comprises SEQ ID NO:21 when said isolate is PS69D1.

36. The method of claim 35 wherein said isolate is PS33F2 and said .delta.-endotoxin comprises SEQ ID NO:22.

37. The method of claim 35 wherein said isolote is PS69D1 and said .delta.-endotoxin comprises SEQ ID NO:21.