U.S. patent application number 10/434943 was filed with the patent office on 2004-01-22 for modulation of neural stem cells and neural progenitor cells.
Invention is credited to Lindquist, Per, Mercer, Alex, Ronnholm, Harriet, Wikstrom, Lilian.
Application Number | 20040014662 10/434943 |
Document ID | / |
Family ID | 29423656 |
Filed Date | 2004-01-22 |
United States Patent
Application |
20040014662 |
Kind Code |
A1 |
Lindquist, Per ; et
al. |
January 22, 2004 |
Modulation of neural stem cells and neural progenitor cells
Abstract
The invention relates generally to methods of influencing
central nervous system cells to produce progeny useful in the
treatment of CNS disorders. More specifically, the invention
includes methods of exposing a patient suffering from such a
disorder to a reagent that modulates the proliferation, migration,
differentiation and survival of central nervous system cells via
S1P or LPA signaling. These methods are useful for reducing at
least one symptom of the disorder.
Inventors: |
Lindquist, Per;
(Staltradsvagen 21, SE) ; Mercer, Alex;
(Staltradsvagen 15, SE) ; Ronnholm, Harriet;
(Tornslingan 8, 1tr, SE) ; Wikstrom, Lilian;
(Stjarnfallsvagen 9, SE) |
Correspondence
Address: |
Ivor R. Elrifi
Mintz, Levin, Cohn, Ferris,
Glovsky and Popeo, P.C.
666 Third Avenue, 24th Floor
New York
NY
10017
US
|
Family ID: |
29423656 |
Appl. No.: |
10/434943 |
Filed: |
May 8, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60379114 |
May 8, 2002 |
|
|
|
60393159 |
Jul 2, 2002 |
|
|
|
Current U.S.
Class: |
424/141.1 ;
514/17.7; 514/9.6 |
Current CPC
Class: |
G01N 33/502 20130101;
G01N 33/5058 20130101; A61K 2039/505 20130101; G01N 33/5008
20130101; A61K 31/00 20130101; G01N 33/5011 20130101; G01N 33/5073
20130101; A61P 25/00 20180101; A61K 38/17 20130101; A61K 31/66
20130101 |
Class at
Publication: |
514/12 |
International
Class: |
A61K 038/17 |
Claims
We claim:
1. A method of alleviating a symptom of a disorder of the nervous
system in a patient comprising administering an S1P, LPA or EDG
receptor agonist or a combination thereof to modulate NSC activity
in vivo to a patient suffering from the disorder of the nervous
system.
2. The method of claim 1 wherein the EDG receptor is selected from
the group consisting of EDG2, EDG3, EDG4 and EDG5.
3. The method of claim 1 wherein the EDG receptor is EDG1 or
EDG8.
4. The method of claim 1 wherein the NSC activity is proliferation,
migration or survival.
5. The method of claim 1 wherein the S1P, LPA or EDG receptor
agonist or a combination thereof is administered in an amount of
0.1 ng/kg/day to 10 mg/kg/day.
6. The method of claim 1 wherein the S1P, LPA or EDG receptor
agonist is administered to achieve a target tissue concentration of
0.1 nM to 10 .mu.M.
7. The method of claim 6 wherein the target tissue is selected from
the group consisting of the ventricular wall, the volume adjacent
to the wall of the ventricular system, piriform cortex,
hippocampus, alveus, striatum, substantia nigra, retina, nucleus
basalis of Meynert, spinal cord, thalamus, hypothalamus piriform
cortex and cortex.
8. The method of claim 1 wherein the S1P, LPA or EDG receptor
agonist is administered by injection.
9. The method of claim 8 wherein the injection is given
subcutaneously, intraperitoneally, intramuselularly,
intracerebroventricularly, intraparenchymally, intrathecally or
intracranially.
10. The method of claim 1 wherein the S1P, LPA or EDG receptor
agonist is administered orally.
11. The method of claim 1 wherein the disorder of the nervous
system is selected from the group consisting of neurodegenerative
disorders, NSC disorders, neural progenitor disorders, ischemic
disorders, neurological traumas, affective disorders,
neuropsychiatric disorders, degenerative diseases of the retina,
retinal injury/trauma, cognitive performance and learning and
memory disorders.
12. A method of modulating the activity of an S1P, LPA, EDG
receptor or a combination thereof, on a NSC comprising the step of
exposing the cell expressing the receptor to a modulator agent,
wherein the exposure induces an NSC to proliferate, differentiate,
migrate or survive.
13. The method of claim 12 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
14. The method of claim 12 wherein the modulator agent is an
exogenous reagent, an antibody, an affibody or a combination
thereof.
15. The method of claim 12 wherein the modulator agent is selected
from the group consisting of S1P, LPA or EDG receptor agonist.
16. The method of claim 12 wherein the modulator agent is
pegylated.
17. The method of claim 14 wherein the antibody is a monoclonal or
a polyclonal antibody.
18. The method of claim 12 wherein the NSC is derived from fetal
brain, adult brain, neural cell culture or a neurosphere.
19. The method of claim 12 wherein the NSC is derived from tissue
enclosed by dura mater, peripheral nerves or ganglia.
20. The method of claim 12 wherein the NSC is derived from stem
cells originating from a tissue selected from the group consisting
of pancreas, skin, muscle, adult bone marrow, liver, umbilical cord
tissue and umbilical cord blood.
21. A method for stimulating mammalian adult NSC proliferation or
neurogenesis comprising the step of contacting a cell population
comprising mammalian adult NSC to a agent selected from the group
consisting of an S1P, LPA or EDG receptor agonist to form a treated
NSC, wherein the treated NSC cell shows improved proliferation or
neurogenesis compared to untreated cells.
22. The method of claim 21 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
23. The method of claim 21 wherein the NSC is derived from lateral
ventricle wall of a mammalian brain.
24. The method of claim 21 wherein the NSC is derived from stem
cells originating from a tissue selected from the group consisting
of pancreas, skin, muscle, adult bone marrow, liver, umbilical cord
tissue and umbilical cord blood.
25. The method of claim 21 wherein the treated NSC shows improved
survival, proliferation or migration compared to untreated
cells.
26. A method for stimulating primary adult mammalian NSC to
proliferate to form neurospheres comprising contacting the cell
with an agent selected from the group consisting of an S1P, LPA or
EDG receptor agonist to produce a proliferating NSC.
27. The method of claim 26 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
28. A method for inducing the in situ proliferation, migration or
survival of an NSC located in the neural tissue of a mammal, the
method comprising administering a therapeutically effective amount
of an S1P, LPA or EDG receptor agonist to the neural tissue to
induce the proliferation, migration or survival of the cell.
29. The method of claim 28 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
30. A method of enhancing neurogenesis in a patient suffering from
a central nervous system disorder comprising the step of infusing
an S1P, LPA or EDG receptor agonist thereof into the patient.
31. The method of claim 30 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
32. The method of claim 30 wherein the infusion is selected from
the group consisting of intraventricular, intravenous, sublingual,
subcutaneous and intraarterial infusion.
33. A method of alleviating a symptom of a central nervous system
disorder in a patient comprising the step of infusing an S1P, LPA
or EDG receptor agonist into the patient.
34. A method for producing a cell population enriched for human
NSC, comprising: (a) contacting a cell population containing NSC
with a reagent that recognizes a determinant on an S1P, LPA or EDG
receptor; and (b) selecting for cells in which there is contact
between the reagent and the determinant on the surface of the cells
of step (a) to produce a population highly enriched for central
nervous system stem cells.
35. The method of claim 34 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
36. The method of claim 34 wherein the reagent is selected from the
group consisting of a small molecule, a peptide, an antibody and an
affibody.
37. The method of claim 34 wherein the population containing NSC
are obtained from neural tissue.
38. The method of claim 34 wherein the cell population is derived
from whole mammalian fetal brain or whole mammalian adult
brain.
39. The method of claim 34 wherein the human NSCs are derived from
stem cells originating from a tissue selected from the group
consisting of pancreas, skin, muscle, adult bone marrow, liver,
umbilical cord tissue and umbilical cord blood.
40. An in vitro cell culture comprising a cell population generated
by the method of claim 34 wherein the cell population is enriched
for cells expressing receptors selected from the group consisting
of an S1P, LPA or EDG receptor.
41. The in vitro cell culture of claim 40 wherein the EDG receptor
is selected from the group consisting of EDG1, EDG2, EDG3, EDG4,
EDG5 and EDG8.
42. A method for alleviating a symptom of a central nervous system
disorder comprising administering the cell population of claim 40
to a mammal in need thereof.
43. A method of reducing a symptom of a central nervous system
disorder in a patient comprising the step of administering into the
spinal cord of the subject a composition comprising (a) a
population of isolated NSCs obtained from fetal or adult tissue;
and (b) an S1P, LPA or EDG receptor agonist or a combination
thereof; whereby the symptom is reduced.
44. The method of claim 43 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
45. A method of reducing a symptom of a central nervous disorder in
a patient comprising the steps of: (a) introducing a viral vector
into the target cell, wherein the viral vector has at least one
insertion site containing a nucleic acid which encodes an S1P, LPA
or EDG receptor agonist, the nucleic acid gene operably linked to a
promoter capable of expression in the host; and (b) expressing the
nucleic acid to produce a protein in a target cell to reduce the
symptom.
46. The method of claim 45 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
47. A method for alleviating a symptom of a disease or disorder of
the nervous system in a patient comprising the steps of: (a)
providing a population of NSC; (b) suspending the NSC in a solution
comprising an S1P, LPA or EDG receptor agonist or a combination
thereof to generate a cell suspension; and (c) delivering the cell
suspension to an injection site in the nervous system of the
patient to alleviate the symptom.
48. The method of claim 47 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
49. The method of claim 47 further comprising the step of
administering to the injection site a growth factor for a period of
time before the step of delivering the cell suspension.
50. The method of claim 47 further comprising the step of
administering to the injection site a growth factor after the
delivering step.
51. A method for transplanting a population of cells enriched for
human NSC, comprising: (a) contacting a population containing NSC
with a reagent that recognizes a determinant on an S1P, LPA or EDG
receptor; (b) selecting for cells in which there is contact between
the reagent and the determinant on the surface of the cells of step
(a), to produce a population highly enriched for central nervous
system stem cells; and (c) implanting the selected cells of step
(b) into a non-human mammal.
52. The method of claim 51 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
53. A method of modulating an S1P, LPA or EDG receptor agonist on
the surface of an NSC comprising the step of contacting the cell
expressing the receptor to exogenous reagent, antibody, or
affibody, wherein the exposure induces the NSC to proliferate,
migrate or survive.
54. The method of claim 53 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
55. The method of claim 53 wherein the NSC is derived from fetal
brain, adult brain, neural cell culture or a neurosphere.
56. A method of determining an isolated candidate S1P, LPA or EDG
receptor modulator compound for its ability to modulate NSC
activity comprising the steps of: (a) administering the isolated
candidate compound to a non-human mammal; and (b) determining if
the candidate compound has an effect on modulating the NSC activity
in the non-human mammal.
57. The method of claim 56 wherein the EDG receptor is selected
from the group consisting of EDG1, EDG2, EDG3, EDG4, EDG5 and
EDG8.
58. The method of claim 56 wherein the determining step comprises
comparing the neurological effects of the non-human mammal with a
referenced non-human mammal not administered the candidate
compound.
59. The method of claim 56 wherein the NSC activity is
proliferation, migration or survival.
60. The method of claim 56 wherein the S1P, LPA or EDG receptor
modulator is administered by injection.
61. The method of claim 60 wherein the injection is given
subcutaneously, intraperitoneally, intramuscluarly,
intracerebroventricularly, intraparenchymally, intrathecally or
intracranially.
62. The method of claim 56 wherein the S1P, LPA or EDG receptor
modulator is administered via peptide fusion or micelle
delivery.
63. A method for synergistically stimulating mammalian adult NSC
proliferation or neurogenesis comprising the step of contacting a
cell population comprising mammalian adult neural stem cells to a
growth factor and an agent selected from the group consisting of an
S1P, LPA and EDG receptor agonist.
64. The method of claim 63 wherein the stimulation of mammalian
adult NSC proliferation is greater than stimulation by the growth
factor or stimulation by the agent alone.
65. The method of claim 63 wherein the stimulation of mammalian
adult NSC proliferation is greater than the sum of stimulation by
growth factor and stimulation by the agent.
66. The method of claim 63 wherein the growth factor is EGF.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Ser. No.
60/379,114 filed May 8, 2002 and U.S. Ser. No. 60/393,159 filed
Jul. 2, 2002. The contents of these applications are incorporated
herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] The invention relates generally to methods of influencing
adult neural stem cells and neural progenitor cells to produce
progeny that can replace damaged or missing neurons or other
central nervous system (CNS) cell types. More specifically, the
invention includes methods of exposing a patient suffering from a
disorder to a reagent that regulates the differentiation,
proliferation, survival and migration of central nervous system
cells via modulation of sphingosine-1-phosphate (S1P) or
lysophosphatidic acid (LPA) signaling. These methods are useful for
reducing at least one symptom of a neurological disorder.
BACKGROUND OF THE INVENTION
[0003] Throughout this specification, various patents, published
patent applications and scientific references are cited to describe
the state and content of the art. Those disclosures, in their
entireties, are hereby incorporated into the present specification
by reference.
[0004] For several years, it has been known that neural stem cells
exist in the adult mammalian brain. This concept is of particular
importance since the adult brain was thought to have very limited
regenerative capacity. Moreover, the possibility to use
adult-derived stem cells for tissue repair may help to overcome the
ethical problems associated with embryonic cell research. Although
the generation of neurons and glia can be observed in the adult
brain, there is thus far only limited knowledge about stimulation
of human neural stem cells in vitro and in vivo.
[0005] The first suggestions that new neurons were born in the
adult mammalian brain came from studies performed in the 1960s
(Altman and Das 1965; Altman and Das 1967). It however took another
three decades and refined technical procedures to overthrow the
dogma that neurogenesis within the mammalian CNS is restricted to
embryogenesis and the perinatal period (for review see (Momma,
Johansson et al. 2000); (Kuhn and Svendsen 1999)). Treatment of
neural disease and injury traditionally focuses on keeping existing
neurons alive, but possibilities now arise for exploiting
neurogenesis for therapeutic treatments of neurological disorders
and diseases.
[0006] The source of new neurons is neural stem cells (NSCs),
located within the ependymal and/or subventricular zone (SVZ)
lining the lateral ventricle (Doetsch, Caille et al. 1999;
Johansson, Momma et al. 1999) and in the dentate gyrus of the
hippocampus formation (Gage, Kempermann et al. 1998). Recent
studies reveal the potential for several additional locations of
NSC within the adult CNS (Palmer, Markakis et al. 1999). Asymmetric
division of NSC maintain their number while generating a population
of rapidly dividing precursor or progenitor cells (Johansson, Momma
et al. 1999). The progenitors respond to a range of cues that
dictate the extent of their proliferation and their fate, both in
terms of the cell type that they differentiate into and the
position that they ultimately take up in the brain.
[0007] The NSCs of the ventricular system in the adult are likely
counterparts of the embryonic ventricular zone stem cells lining
the neural tube whose progeny migrate away to form the CNS as
differentiated neurons and glia (Jacobson 1991). NSCs persist in
the adult lateral ventricle wall (LVW), generating neuronal
progenitors which migrate down the rostral migratory stream to the
olfactory bulb, where they differentiate into granule cells and
periglomerular neurons (Lois and Alvarez-Buylla 1993). Substantial
neuronal death occurs in the olfactory bulb generating a need for
continuous replacement of lost neurons, a need satisfied by the
migrating progenitors derived from the LVW (Biebl, Cooper et al.
2000). Further to this ongoing repopulation of olfactory bulb
neurons, there are forceful indications that lost neurons from
other brain regions can be replaced by progenitors from the LVW
that differentiate into the lost neuron phenotype complete with
appropriate neuronal projections and synapses with the correct
target cell type (Snyder, Yoon et al. 1997; Magavi, Leavitt et al.
2000).
[0008] In vitro cultivation techniques have been established to
identify the external signals involved in the regulation of NSC
proliferation and differentiation (Johansson, Momma et al. 1999;
Johansson, Svensson et al. 1999). The mitogens EGF and basic FGF
allow neural progenitors, isolated from the ventricle wall and
hippocampus, to be greatly expanded in culture (McKay 1997;
Johansson, Svensson et al. 1999). The dividing progenitors remain
in an undifferentiated state growing into large balls of cells
known as neurospheres. Withdrawal of the mitogens combined with
addition of serum induces differentiation of the progenitors into
the three cell lineages of the brain: neurons, astrocytes and
oligodendrocytes (Doetsch, Caille et al. 1999; Johansson, Momma et
al. 1999). Application of specific growth factors can distort the
proportions of each cell type in one way or another. For example,
CNTF acts to direct the neural progenitors to an astrocytic fate
(Johe, Hazel et al. 1996; Rajan and McKay 1998), while the thyroid
hormone, triiodothyronine (T3) has been shown to promote
oligodendrocyte differentiation (Johe, Hazel et al. 1996).
Enhancement of neuronal differentiation of neural progenitors by
PDGF has also been documented (Johe, Hazel et al. 1996; Williams,
Park et al. 1997).
[0009] The ability to expand neural progenitor cells and then
manipulate their cell fate has also had enormous implications in
transplant therapies for neurological diseases in which specific
cell types are lost. The most obvious example is Parkinson's
Disease (PD) which is characterized by degeneration of dopaminergic
neurons in the substantia nigra. Previous transplantation
treatments for PD patients have used fetal tissue taken from the
ventral midbrain at a time when substantia nigral dopaminergic
neurons are undergoing terminal differentiation (Herman and Abrous
1994). The cells are grafted onto the striatum where they form
synaptic contacts with host striatal neurons, their normal synaptic
target, restoring dopamine turnover and release to normal levels
with significant functional benefits to the patient (Herman and
Abrous 1994) (for review see (Bjorklund and Lindvall 2000)).
Grafting of fetal tissue is hindered by lack of donor tissue. In
vitro expansion and manipulation of NSCs, however, can potentially
provide a range of well characterized cells for transplant-based
strategies for neurodegenerative diseases, such as dopaminergic
cells for PD. To this aim, the identification of factors and
pathways that govern the proliferation and differentiation of
neural cell types will prove fundamental.
[0010] Ultimately the identification of these proliferative and
differentiating factors is likely to provide insights into the
stimulation of endogenous neurogenesis for the treatment of
neurological diseases and disorders. Intraventricular infusion of
both EGF and basic FGF have been shown to proliferate the ventricle
wall cell population, and in the case of EGF, extensive migration
of progenitors into the neighbouring striatal parenchyma (Craig,
Tropepe et al. 1996; Kuhn, Winkler et al. 1997). The progenitors
differentiated predominantly into a glial lineage while reducing
the generation of neurons (Kuhn, Winkler et al. 1997). A recent
study found that intraventricular infusion of BDNF in adult rats
stimulates an increase in the number of newly generated neurons in
the olfactory bulb and rostral migratory stream, and in parenchymal
structures, including the striatum, septum, thalamus and
hypothalamus (Pencea, Bingaman et al. 2001). These studies
demonstrate that the proliferation of progenitors within the SVZ of
the LVW can be stimulated and that their lineage can be manipulated
to neuronal and glial fates. Currently the number of factors known
to affect neurogenesis in vivo is small and their effects are
either undesired or limited.
[0011] Therefore, there is a long felt need to identify other
factors that can selectively stimulate neural stem cell activity
through proliferation of neural progenitors and differentiation
into the desired neuronal cell type. This activity would be
beneficial for both stimulation of in vivo neurogenesis and culture
of cells for transplantation therapy. The present invention
demonstrates a role for S1P, LPA and their receptors in the
proliferation, differentiation, survival and migration of neural
stem cells in vitro and in vivo.
SUMMARY OF THE INVENTION
[0012] In one aspect, the invention includes a method of
alleviating a symptom of a disorder of the nervous system in a
patient comprising administering S1P, LPA or an EDG receptor
agonist or a combination thereof to modulate NSC activity in vivo
to a patient suffering from the disorder of the nervous system. In
this disclosure, a "disorder" shall have the same meaning as a
"disease."
[0013] In another aspect, the invention includes a method of
modulating the activity of a receptor for S1P, LPA, EDG receptor or
a combination thereof, on a NSC comprising the step of exposing the
cell expressing the receptor to a modulator agent, wherein the
exposure induces an NSC to proliferate, differentiate, migrate or
survive.
[0014] In another aspect, the invention includes a method for
stimulating mammalian adult NSC proliferation or neurogenesis
comprising the step of contacting a cell population comprising
mammalian adult NSC to a agent selected from the group consisting
of S1P, LPA or EDG receptor agonist to form a treated NSC, wherein
the treated NSC cell shows improved proliferation or neurogenesis
compared to untreated cells.
[0015] In another aspect, the invention includes a method for
stimulating primary adult mammalian NSC to proliferate to form
neurospheres comprising contacting the cell with an agent selected
from the group consisting of S1P, LPA or EDG receptor agonist to
produce a proliferating NSC.
[0016] In another aspect, the invention includes a method for
inducing the in situ proliferation, differentiation, migration or
survival of an NSC located in the neural tissue of a mammal, the
method comprising administering a therapeutically effective amount
of S1P, LPA or EDG receptor agonist to the neural tissue to induce
the proliferation, migration or survival of the cell.
[0017] In another aspect, the invention includes a method for
accelerating the growth of an NSC in a desired target tissue in a
subject, comprising: (a) transfecting the target tissue with an
expression vector containing an open reading frame encoding S1P,
LPA or EDG receptor gene in a therapeutically effective amount; (b)
expressing the open reading frame to produce a protein in the
target tissue.
[0018] In another aspect, the invention includes a method of
enhancing neurogenesis in a patient suffering from a central
nervous system disorder comprising the step of infusing S1P, LPA or
EDG receptor agonist thereof into the patient.
[0019] In another aspect, the invention includes a method of
alleviating a symptom of a central nervous system disorder in a
patient comprising the step of infusing S1P, LPA or EDG receptor
agonist into the patient.
[0020] In another aspect, the invention includes a method for
producing a cell population enriched for human NSC, comprising: (a)
contacting a cell population containing NSC with a reagent that
recognizes a determinant on a S1P, LPA or EDG receptor; (b)
selecting for cells in which there is contact between the reagent
and the determinant on the surface of the cells of step (a) to
produce a population highly enriched for central nervous system
stem cells.
[0021] In another aspect, the invention an in vitro cell culture
comprising a cell population generated by the method previously
described wherein the cell population is enriched for cells
expressing receptors selected from the group consisting of S1P, LPA
or EDG receptor.
[0022] In another aspect, the invention includes a method for
alleviating a symptom of a central nervous system disorder
comprising administering the population described above to a mammal
in need thereof.
[0023] In another aspect, the invention includes a method of
reducing a symptom of a central nervous system disorder in a
patient comprising the step of administering into the spinal cord
of the subject a composition comprising (a) a population of
isolated NSCs obtained from fetal or adult tissue; and (b) S1P, LPA
or EDG receptor agonist or a combination thereof; whereby the
symptom is reduced.
[0024] In another aspect, the invention includes a method of
reducing a symptom of a central nervous disorder in a patient
comprising the steps of: (a) introducing a viral vector into the
target cell, wherein the viral vector has at least one insertion
site containing a nucleic acid which encodes S1P, LPA or EDG
receptor agonist, the nucleic acid gene operably linked to a
promoter capable of expression in the host; (b) expressing the
nucleic acid to produce a protein in a target cell to reduce the
symptom.
[0025] In another aspect, the invention includes a method for
alleviating a symptom of a disorder of the nervous system in a
patient comprising the steps of: (a) providing a population of NSC;
(b) suspending the NSC in a solution comprising S1P, LPA or EDG
receptor agonist or a combination thereof to generate a cell
suspension; (c) delivering the cell suspension to an injection site
in the nervous system of the patient to alleviate the symptom.
[0026] In another aspect, the invention includes a method for
transplanting a population of cells enriched for human NSC,
comprising: (a) contacting a population containing NSC with a
reagent that recognizes a determinant on a S1P, LPA or EDG
receptor; (b) selecting for cells in which there is contact between
the reagent and the determinant on the surface of the cells of step
(a), to produce a population highly enriched for central nervous
system stem cells; and (c) implanting the selected cells of step
(b) into a non-human mammal.
[0027] In another aspect, the invention includes a method of
modulating a S1P, LPA or EDG receptor agonist on the surface of an
NSC comprising the step of contacting the cell expressing the
receptor to exogenous reagent, antibody, or affibody, wherein the
exposure induces the NSC to proliferate, migrate or survive.
[0028] In another aspect, the invention includes a method of
determining an isolated candidate S1P, LPA or EDG receptor
modulator compound for its ability to modulate NSC activity
comprising the steps of: (a) administering the isolated candidate
compound to a non-human mammal; and (b) determining if the
candidate compound has an effect on modulating the NSC activity in
the non-human mammal.
[0029] One embodiment of the invention is directed to a method of
alleviating a symptom of a disorder of the nervous system in a
patient. In the method, an S1P receptor agonist, LPA receptor
agonist or EDG receptor agonist is administered to a patient
suffering from the disorder of the nervous system to modulate NSC
activity in vivo in a target tissue. The activity to be modulated
may be proliferation, migration or survival. The S1P, LPA or EDG
receptor, referred to in any of the methods of the invention, may
be used in combination. In this method, the S1P, LPA or EDG
receptor (and combination thereof) may be administered in an amount
of 0.1 ng/kg/day to 10 mg/kg/day. In a more preferred embodiment,
the S1P, LPA or EDG receptor (and combination thereof) may be
administered in an amount of to achieve a target tissue
concentration of 0.1 nM to 10 .mu.M.
[0030] For any reference to EDG receptors in this disclosure, the
EDG receptor may be EDG2, EDG3, EDG4 or EDG5. Furthermore, in a
preferred embodiment, the EDG receptor, in any reference in this
disclosure, is EDG1 or EDG8. For example, a reference to an EDG
receptor agonist, would also mean an agonist of EDG1, EDG2, EDG3,
EDG4, EDG5 or EDG8.
[0031] The target tissue is selected from the group consisting of
the ventricular wall, the volume adjacent to the wall of the
ventricular system, hippocampus, piriform cortex, alveus, striatum,
substantia nigra, retina, nucleus basalis of Meynert, spinal cord,
thalamus, hypothalamus piriform cortex and cortex.
[0032] The administration methods, in any of the methods of this
disclosure, may be by any means. For example, the administration
may be by injection. The injection may be given subcutaneously,
intraperitoneally, intramusclularly, intracerebroventricularly,
intraparenchymally, intrathecally or intracranially. As another
example, the administration may be made orally.
[0033] The disorder whose symptoms may be treated by the method may
be any disease and includes, at least, a neurodegenerative
disorders, NSC disorders, neural progenitor disorders, ischemic
disorders, neurological traumas, affective disorders,
neuropsychiatric disorders, degenerative diseases of the retina,
retinal injury/trauma, cognitive performance and learning and
memory disorders.
[0034] Another embodiment of the invention is directed to a method
of modulating the activity of an S1P, LPA, EDG receptor or a
combination thereof, on a NSC. The method comprises contacting the
cell expressing the receptor to a modulator agent so that the
modulator agent induces the NSC to proliferate, differentiate,
migrate or survive. The modulator agent may be, for example, an
exogenous reagent, an antibody (including monoclonal, polyclonal
and engineered antibodies and fragments thereof), an affibody or a
combination of these agents. In a preferred embodiment, the
modulator agent could be S1P, LPA or a EDG receptor agonist. Also,
the modulator agent may be pegylated to enhance its half life after
administration. Methods of pegylating proteins and reagents are
well known to those of skill in the art and are described, for
example, in U.S. Pat. Nos. 5,166,322, 5,766,897, 6,420,339 and
6,552,170. The NSC of this method may be derived from fetal brain,
adult brain, neural cell culture or a neurosphere. For example, the
NSC can be derived from tissue enclosed by dura mater, peripheral
nerves or ganglia. As a further example, the NSC may be derived
from pancreas, skin, muscle, adult bone marrow, liver, umbilical
cord tissue and umbilical cord blood.
[0035] Another embodiment of the invention is directed to a method
for stimulating mammalian adult NSC proliferation or neurogenesis.
In the method, a cell population comprising mammalian adult NSC is
contacted to an agent such as an S1P receptor agonist, LPA receptor
agonist, or EDG receptor agonist to form a treated NSC. The treated
NSC will show improved proliferation or neurogenesis compared to
untreated cells. The NSC may be derived from lateral ventricle wall
of a mammalian brain. As another example, the NSC may be derived
from stem cells originating from a tissue such as pancreas, skin,
muscle, adult bone marrow, liver, umbilical cord tissue and
umbilical cord blood. The NSC, after the application of the method,
will show an improved characteristic such as survival,
proliferation or migration compared to untreated cells.
[0036] Another embodiment of the invention is directed to a method
for stimulating primary adult mammalian NSC to proliferate to form
neurospheres. In the method, the primary adult mammalian NSC is
contacted with an agent. The agent may be an S1P receptor agonist,
LPA receptor agonist, or EDG receptor agonist. The contact will
produce a proliferating NSC.
[0037] Another embodiment of the invention is directed to a method
of inducing the in situ proliferation, migration or survival of an
NSC located in the neural tissue of a mammal. The method comprise
administering a therapeutically effective amount of an an S1P
receptor agonist, LPA receptor agonist, or EDG receptor agonist to
the neural tissue to induce the proliferation, migration or
survival of the cell.
[0038] Another embodiment of the invention is directed to a method
of enhancing neurogenesis in a patient suffering from a central
nervous system disorder. The method comprise infusing an an S1P
receptor agonist, LPA receptor agonist, or EDG receptor agonist
thereof into the patient. The infusion may be intraventricular,
intravenous, sublingual, subcutaneous or intraarterial
infusion.
[0039] Another embodiment of the invention is directed to a method
of alleviating a symptom of a central nervous system disorder in a
patient. In the method, a S1P receptor agonist, LPA receptor
agonist, or EDG receptor agonist is infused into the patient.
[0040] Another embodiment of the invention is directed to a method
for producing a cell population enriched for human NSC. The method
comprises contacting a cell population containing NSC with a
reagent that recognizes a determinant on an S1P, LPA or EDG
receptor; and selecting for cells in which there is contact between
the reagent and the determinant on the surface of the cells to
produce a population highly enriched for central nervous system
stem cells. The reagent may be, for example, a small molecule, a
peptide, an antibody and an affibody. The cell population
containing NSC may be obtained from neural tissue, such as, for
example, from whole mammalian fetal brain or whole mammalian adult
brain. The human NSCs may be derived from stem cells originating
from a tissue such as pancreas, skin, muscle, adult bone marrow,
liver, umbilical cord tissue or umbilical cord blood. An in vitro
cell culture derived from the method is also a part of the present
invention. In a preferred embodiment, the cell population of the
cell culture is enriched for cells expressing receptors selected
from the group consisting of an an S1P receptor agonist, LPA
receptor agonist, or EDG receptor agonist.
[0041] Another embodiment of the invention is directed to a method
for alleviating a symptom of a central nervous system disorder by
administering a cell population of the invention (e.g., a cell
culture of the previous paragraph) to a mammal in need thereof.
[0042] Another embodiment of the invention is directed to a method
of reducing a symptom of a central nervous system disorder in a
patient using the step of administering into the spinal cord of the
subject a composition comprising a population of isolated NSCs
obtained from fetal or adult tissue; and an S1P receptor agonist,
LPA receptor agonist, or EDG receptor agonist or a combination
thereof so that the symptom is reduced.
[0043] Another embodiment of the invention is directed to a method
of reducing a symptom of a central nervous disorder in a patient.
In the method, a a viral vector is introduced into the target cell.
The viral vector has at least one insertion site containing a
nucleic acid which encodes an an S1P receptor agonist, LPA receptor
agonist, or EDG receptor agonist, the nucleic acid gene being
operably linked to a promoter capable of expression in the host.
Then the nucleic acid is expressed to produce a protein in a target
cell to reduce the symptom.
[0044] Another embodiment of the invention is directed to a method
for alleviating a symptom of a disorder of the nervous system in a
patient. In the method, a population of NSC is provided and
suspended in a solution comprising an an S1P receptor agonist, LPA
receptor agonist, or EDG receptor agonist or a combination thereof
to generate a cell suspension. Then the cell suspension is
delivered to an injection site in the nervous system of the patient
to alleviate the symptom. Further, in an optional step, a growth
may be administered to the injection site for a period of time
before the step of delivering the cell suspension. In another
optional step, the growth factor may be administered to the
injection site a growth factor after the delivering step.
[0045] Another embodiment of the invention is directed to a method
for transplanting a population of cells enriched for human NSC.
First, a population of cells containing NSC is contacted with a
reagent that recognizes a determinant on an S1P receptor, LPA
receptor or EDG receptor. Then cells in which there is contact
between the reagent and the determinant on the surface of the cells
is selected to produce a population highly enriched for central
nervous system stem cells. Finally, the selected cells are
inplanted into a non-human mammal.
[0046] Another embodiment of the invention is directed to a method
of modulating an S1P receptor agonist, LPA receptor agonist or EDG
receptor agonist on the surface of an NSC with the step of
contacting the cell expressing the receptor to exogenous reagent,
antibody, or affibody, so that the exposure induces the NSC to
proliferate, migrate or survive. In this method, the the NSC is
derived from fetal brain, adult brain, neural cell culture or a
neurosphere.
[0047] Another embodiment of the invention is directed to a method
of determining an isolated candidate S1P receptor, LPA receptor aor
EDG receptor modulator compound for its ability to modulate NSC
activity. In the method a candidate compound is administered to a
non-human mammal. Then it is determined if the candidate compound
has an effect on modulating the NSC activity in the non-human
mammal. The determining step may involve comprises comparing the
neurological effects of the non-human mammal with a referenced
non-human mammal not administered the candidate compound. The NSC
activity may be proliferation, migration or survival.
Administration may be by injection and the injection may be given
subcutaneously, intraperitoneally, intramuscluarly,
intracerebroventricularly, intraparenchymally, intrathecally or
intracranially. Another preferreed method of delivery is
administered via peptide fusion or micelle delivery.
[0048] Another embodiment of the invention is directed to a method
for synergistically stimulating mammalian adult NSC proliferation
or neurogenesis. In the method, a cell population comprising
mammalian adult neural stem cells is contacted to a growth factor
and contacted to an agent selected from the group consisting of an
S1P receptor agonist, LPA receptor agonist and EDG receptor
agonist. The stimulation is synergistic, which means that the
stimulation of mammalian adult NSC proliferation is greater than
stimulation by the growth factor or stimulation by the agent alone.
It also means that the stimulation of mammalian adult NSC
proliferation is greater than the sum of stimulation by growth
factor and stimulation by the agent. The preferred growth factor
for this method is EGF.
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] FIG. 1 shows EDG receptor mRNAs are expressed in adult mouse
lateral ventricle wall tissue and cultured adult mouse neural stem
cells.
[0050] FIG. 2 shows brightfield and darkfield micrographs of edg1
mRNA positive cells in sagittal sections of adult mouse brain.
[0051] FIG. 3 shows low magnification microphotographs of edg8 mRNA
expression in sections of the adult mouse brain.
[0052] FIG. 4 shows that S1P stimulates in vitro proliferation of
adult mouse NSC.
[0053] FIG. 5 shows that LPA stimulates in vitro proliferation of
adult mouse NSC.
[0054] FIG. 6 shows that the effect of S1P on adult mouse NSC
proliferation is inhibited by pertussis toxin (PTX).
[0055] FIG. 7 shows that the effect of LPA on adult mouse NSC
proliferation is inhibited by pertussis toxin (PTX).
[0056] FIG. 8 shows that S1P and EGF synergistically proliferate
adult mouse NSC in vitro.
[0057] FIG. 9 shows LPA stimulates primary adult mouse NSC
proliferation and neurosphere formation in vitro
[0058] FIG. 10 shows that S1P increases the number of newborn cells
in the caudate putamen of adult rats
[0059] FIG. 11 shows that S1P increases the number of BrdU positive
cells in the caudate putamen.
DETAILED DESCRIPTION OF THE INVENTION
[0060] It has been discovered that certain reagents are capable of
modulating the differentiation, migration, proliferation and
survival of neural stem/progenitor cells both in vitro and in vivo.
As used herein, the term "modulate" refers to having an affect in
such a way as to alter the differentiation, migration,
proliferation and survival of neural stem cell (NSC) or neural
progenitor cell (NPC) activity. Since undifferentiated, pluripotent
stem cells can proliferate in culture for a year or more, the
invention described in this disclosure provides an almost limitless
supply of neural precursors.
[0061] Throughout this disclosure, the term "neural stem cells"
(NSCs) includes "neural progenitor cell," "neuronal progenitor
cell," "neural precursor cell," and "neuronal precursor cell" (all
referred to herein as NPCs). These cells can be identified by their
ability to undergo continuous cellular proliferation, to regenerate
exact copies of themselves (self-renew), to generate a large number
of regional cellular progeny, and to elaborate new cells in
response to injury or disease. The term NPCs mean cells that can
generate progeny that are either neuronal cells (such as neuronal
precursors or mature neurons) or glial cells (such as glial
precursors, mature astrocytes, or mature oligodendrocytes).
Typically, the cells express some of the phenotypic markers that
are characteristic of the neural lineage. They also do not usually
produce progeny of other embryonic germ layers when cultured by
themselves in vitro unless dedifferentiated or reprogrammed in some
fashion. As used herein, the term "neurosphere" refers to the ball
of cells consisting of NSCs.
[0062] As used herein, the term "reagent" refers to any substance
that is chemically and biologically capable of activating a
receptor, including peptides, small molecules, antibodies (or
fragments thereof), affibodies and any molecule that dimerizes or
multimerizes the receptors or replaces the need for activation of
the extracellular domains. In one embodiment, the reagent is a
small molecule.
[0063] As used herein, the term "antibody" or "immunoglobulin" as
used in this disclosure refers to both polyclonal and monoclonal
antibody and functional derivatives (i.e., engineered antibody)
thereof. Antibodies can be whole immunoglobulin of any class, e.g.,
IgG, IgM, IgA, IgD, IgE, or hybrid antibodies with dual or multiple
antigen or epitope specificities, or fragments, e.g., F(ab')2,
F(ab)2, Fab', Fab1 and the like, including hybrid fragments.
Functional derivatives include engineered antibodies. The ambit of
the term deliberately encompasses not only intact immunoglobulin
molecules, but also such fragments and derivatives of
immunoglobulin molecules (such as single chain Fv constructs,
diabodies and fusion constructs) as may be prepared by techniques
known in the art, and retaining a desired antibody binding
specificity. The term "affibody" (U.S. Pat. No. 5,831,012) refers
to highly specific affinity proteins that can be designed to bind
to any desired target molecule. These antibody mimics can be
manufactured to have the desired properties (specificity and
affinity), while also being highly robust to withstand a broad
range of analytical conditions, including pH and elevated
temperature. The specific binding properties that can be engineered
into each capture protein allow it to have very high specificity
and the desired affinity for a corresponding target protein. A
specific target protein will thus bind only to its corresponding
capture protein. The small size (only 58 amino acids), high
solubility, ease of further engineering into multifunctional
constructs, excellent folding and absence of cysteines, as well as
a stable scaffold that can be produced in large quantities using
low cost bacterial expression systems, make affibodies superior
capture molecules to antibodies or antibody fragments, such as Fab
or single chain Fv (scFv) fragments, in a variety of Life Science
applications. The term antibodies also encompasses engineered
antibodies.
[0064] As used herein, the term "engineered antibody" encompasses
all biochemically or recombinately produced functional derivatives
of antibodies. A protein is a functional derivative of an antibody
if it has at least one antigen binding site (ABS) or a
complementarity-determining region (CDR) that when combined with
other CDR regions (on the same polypeptide chain or on a different
polypeptide chain) can form an ABS. The definition of engineered
antibody would include, at least, recombinant antibodies, tagged
antibodies, labeled antibodies, Fv fragments, Fab fragments,
recombinant (as opposed to natural) multimeric antibodies, single
chain antibodies, diabodies, triabodies, tetravalent multimers
(dimer of diabodies), pentavalent multimers (dimer of diabody and
triabody), hexavalent multimers (dimer of triabodies) and other
higher multimeric forms of antibodies.
[0065] The terms "recombinant nucleic acid" or "recombinantly
produced nucleic acid" refer to nucleic acids such as DNA or RNA
which has been isolated from its native or endogenous source and
modified either chemically or enzymatically by adding, deleting or
altering naturally-occurring flanking or internal nucleotides.
Flanking nucleotides are those nucleotides which are either
upstream or downstream from the described sequence or sub-sequence
of nucleotides, while internal nucleotides are those nucleotides
which occur within the described sequence or subsequence.
[0066] The term "recombinant means" refers to techniques where
proteins are isolated, the cDNA sequence coding the protein
identified and inserted into an expression vector. The vector is
then introduced into a cell and the cell expresses the protein.
Recombinant means also encompasses the ligation of coding or
promoter DNA from different sources into one vector for expression
of a PPC, constitutive expression of a protein, or inducible
expression of a protein.
[0067] The term "promoter" refers to a DNA sequence which directs
the transcription of a structural gene to produce mRNA. Typically,
a promoter is located in the 5' region of a gene, proximal to the
start codon of a structural gene. If a promoter is an inducible
promoter, then the rate of transcription increases in response to
an inducing agent. In contrast, the rate of transcription is not
regulated by an inducing agent if the promoter is a constitutive
promoter.
[0068] The term "enhancer" refers to a promoter element. An
enhancer can increase the efficiency with which a particular gene
is transcribed into mRNA irrespective of the distance or
orientation of the enhancer relative to the start site of
transcription.
[0069] "Complementary DNA (cDNA)" refers to a single-stranded DNA
molecule that is formed from an mRNA template by the enzyme reverse
transcriptase. Typically, a primer complementary to portions of
mRNA is employed for the initiation of reverse transcription. Those
skilled in the art also use the term "cDNA" to refer to a
double-stranded DNA molecule consisting of such a single-stranded
DNA molecule and its complement.
[0070] "Expression" refers to the process by which a polypeptide is
produced from a structural gene. The process involves transcription
of the gene into mRNA and the translation of such mRNA into
polypeptide(s).
[0071] "Cloning vector" refers to a DNA molecule, such as a
plasmid, cosmid, phagemid, or bacteriophage, which has the
capability of replicating autonomously in a host cell and which is
used to transform cells for gene manipulation. Cloning vectors
typically contain one or a small number of restriction endonuclease
recognition sites at which foreign DNA sequences may be inserted in
a determinable fashion without loss of an essential biological
function of the vector, as well as a marker gene which is suitable
for use in the identification and selection of cells transformed
with the cloning vector. Marker genes typically include genes that
provide tetracycline resistance or ampicillin resistance.
[0072] "Expression vector" refers to a DNA molecule comprising a
cloned structural gene encoding a foreign protein which provides
the expression of the foreign protein in a recombinant host.
Typically, the expression of the cloned gene is placed under the
control of (i.e., operably linked to) certain regulatory sequences
such as promoter and enhancer sequences. Promoter sequences may be
either constitutive or inducible.
[0073] "Recombinant Host" refers to a prokaryotic or eukaryotic
cell which contains either a cloning vector or expression vector.
This term is also meant to include those prokaryotic or eukaryotic
cells that have been genetically engineered to contain the cloned
gene(s) in the chromosome or genome of the host cell. The host cell
is not limited to a unicellular organism. Multicellular organisms
such as mammals, insects, and plants are also contemplated as host
cells in the context of this invention. For examples of suitable
hosts, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL,
Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y. (1989).
[0074] The term "treating" in its various grammatical forms in
relation to the present invention refers to preventing, curing,
reversing, attenuating, alleviating, minimizing, suppressing or
halting the deleterious effects of a disease state, disease
progression, disease causative agent (e.g., bacteria or viruses) or
other abnormal condition. Because some of the inventive methods
involve the physical removal of the etiological agent, the artisan
will recognize that they are equally effective in situations where
the inventive compound is administered prior to, or simultaneous
with, exposure to the etiological agent (prophylactic treatment)
and situations where the inventive compounds are administered after
(even well after) exposure to the etiological agent.
[0075] The terms "recombinant protein," "recombinantly produced
protein" refer to a peptide or protein produced using non-native
cells that do not have an endogenous copy of DNA able to express
the protein. The cells produce the protein because they have been
genetically altered by the introduction of the appropriate nucleic
acid sequence. The recombinant protein will not be found in
association with proteins and other subcellular components normally
associated with the cells producing the protein.
[0076] According to the specific case, the "therapeutically
effective amount" of an agent should be determined as being the
amount sufficient to improve the symptoms of the patient in need of
treatment or at least to partially arrest the disease and its
complications. Amounts effective for such use will depend on the
severity of the disease and the general state of the patient's
health. Single or multiple administrations may be required
depending on the dosage and frequency as required and tolerated by
the patient.
[0077] As used herein, the term "a method to detect" refers to any
assay (including immunoassays and colorimetric assays) known in the
art for the measurement of a detectable label. These assays
include, at least, assays utilizing biotin and avidin (including
streptavidin), ELISA's and immunoprecipitation, immunohistochemical
techniques and agglutination assays. A detailed description of
these assays is given in WO 96/13590 to Maertens & Stuyver. The
term "biological sample" relates to any possible sample taken from
an animal (including humans), such as blood (which also encompasses
serum and plasma samples), sputum, cerebrospinal fluid, urine,
lymph or any possible histological section, and other body fluid.
Detection may also include methods of imaging a lesion, such as
with immunoscintigraphy, computed tomography (CT), ultrasonography,
X-rays, and the like.
[0078] The terms "binding specificity," "specifically binds to" or
"specifically immunoreactive with," when referring to a protein,
antibody, or antibody binding site (ABS) of the invention, refers
to a binding reaction which is determinative of the presence of the
protein or carbohydrate in the presence of a heterogeneous
population of proteins and other biologics. A variety of
immunoassay formats may be used to determine binding. For example,
solid-phase ELISA immunoassays are routinely used to select
antibodies specifically immunoreactive with a protein or
carbohydrate. See Harlow & Lane, Antibodies, A Laboratory
Manual, Cold Spring Harbor Publication, New York (1988) for a
description of immunoassay formats and conditions that can be used
to determine specific immunoreactivity.
[0079] The terms "isolated" or "substantially purified," when
applied to a nucleic acid or protein, denotes that the nucleic acid
or protein is essentially free of other cellular components with
which it is associated in the natural state. It is preferably in a
homogeneous state, although it can be in either a dry or aqueous
solution. Purity and homogeneity are typically determined using
analytical chemistry techniques such as polyacrylamide gel
electrophoresis or high performance liquid chromatography. A
protein which is the predominant species present in a preparation
is substantially purified.
[0080] The terms "nucleic acid encoding" or "nucleic acid sequence
encoding" refer to a nucleic acid which directs the expression of a
specific protein or peptide. The nucleic acid sequences include
both the DNA strand sequence that is transcribed into RNA and the
RNA sequence that is translated into protein. The nucleic acid
sequences include both full length nucleic acid sequences as well
as shorter sequences derived from the full length sequences. It is
understood that a particular nucleic acid sequence includes the
degenerate codons of the native sequence or sequences which may be
introduced to provide codon preference in a specific host cell. The
nucleic acid includes both the sense and antisense strands as
either individual single strands or in the duplex form.
[0081] "Pharmaceutical composition" refers to formulations of
various preparations. Parenteral formulations are known and are
preferred for use in the invention. The formulations containing
therapeutically effective amounts of the immunotoxins are either
sterile liquid solutions, liquid suspensions or lyophilized
versions and optionally contain stabilizers or excipients.
Lyophilized compositions are reconstituted with suitable diluents,
e.g., water for injection, saline, 0.3% glycine and the like, at a
level of about from 0.01 mg/kg of host body weight to 10 mg/kg or
more.
EDG Receptors and Their Ligands
[0082] The lysosphingolipid, sphingosine-1-phosphate (S1P) and the
structurally related lipid lysophosphatidic acid (LPA) elicit a
wide spectrum of biological responses. The principal effects of LPA
and S1P are growth related, including induction of cellular
proliferation, alterations in differentiation and survival, and
suppression of apoptosis. LPA and S1P also evoke cellular effector
functions, which are dependent on cytoskeletal responses such as
contraction, secretion, adhesion, and chemotaxis (for reviews see
[Goetzl and An, 1998; Pyne and Pyne 2000; (Fukushima and Chun
2001)).
[0083] LPA and S1P both may be biosynthesized by cells either de
novo through pathways of intermediate lipid metabolism or through
stimulus-coupled liberation of the respective precursor
glycerophospholipids and sphingolipids and subsequent enzymatic
conversions (for review see (Goetzl and An 1998)).
[0084] The activation of enzymes involved in the degradation of
sphingomyelin to sphingosine (sphingomyelinases, ceramidases) or
the phosphorylation of sphingosine to S1P (such as SPHK1 or 2),
leading to increased production of S1P, are alternative routes
considered to increase the S1P concentration to achieve
proliferation or neurogenesis. Likewise, blocking the degradation
of S1P thru the S1P phosphatase (SGPP1 or 2) or S1P lyase (SPGL1)
will increase the concentration of S1P, and is considered another
way to increase signalling thru the EDG receptors. For references,
see Spiegel & Kolesnick, Nature (2002) vol 16 no9, p
1596-1602.
[0085] Other enzymes that regulate levels of phospholipid of
phosphatidic acid are phosphatases which catalyze the
dephosphorylation of phosphatidic acid. They have a role in
metabolic pathways controlling the synthesis of
glycerophospholipids and triacylglycerols, and in
receptor-activated signal transduction mediated by phospholipase D.
Examples are PPAP2A and PPAP2B, which hydrolyze LPA, ceramide
1-phosphate, or S1P.
[0086] S1P and LPA have been proposed to act both as extracellular
mediators and as intracellular second messengers (Tigyi, Dyer et
al. 1994; Pyne and Pyne 2000). Extracellular effects are mediated
via a recently identified family of plasma membrane G
protein-coupled receptors (GPCRs), known as the Endothelial
Differentiation Gene (EDG) receptors, whereas specific
intracellular effects of S1P and LPA are attributable to
modifications in the content and/or activity of a major functional
protein. Examples are increases in nuclear levels of transcription
factors that regulate the serum response element, suppression of
death caspase activities in apoptosis, and elevation of membrane
content of heparin binding-epidermal growth factor-like growth
factor, which serves as an autocrine and juxtacrine stimulus of
proliferation (Goetzl and An 1998). Additional receptors that can
mediate the effects of S1P or LPA have been described, such as
GPR4, GPR68, G2A, GPR45 (psp24), GPR63, GPR3, GPR6, GPR12 (see
Uhlenbrock et al., Cellular Signaling 14 (2002) 941-53; Niederberg
et al., Cell Signal 2003 Apr;15(4):435-46).
[0087] Many of the effects of LPA and S1P are abolished by
Pertussis Toxin (PTX). PTX specifically inactivates G.sub.i and
G.sub.o proteins by ADP-ribosylation of .alpha.i subunit,
uncoupling the GPCRs from their effector mechanisms. This finding
indicated that LPA and S1P could also evoke cellular responses
through GPCRs. The first breakthrough in discovery receptors for
these ligands came in 1996. Hecht et al. (1996) identified LPA as a
ligand for a GPCR they isolated from the ventricular zone of the
developing mouse brain (Hecht, Weiner et al. 1996). The cloned and
overexpressed vzg-1 gene mediated serum-induced retraction of
neurites in cortical neurons, a characteristic response elicited by
LPA application in neuroblastoma cells (Jalink, Eichholtz et al.
1993). Vzg-1 was later named EDG2 (Contos, Fukushima et al. 2000)
because it was shown to be highly homologous to a family of GPCR
orphan receptors. The first member of the family was cloned by Hla
and Maciag (1990) as a phorbol ester-induced early response gene in
vascular endothelial cells (Hla and Maciag 1990); hence it was
named EDG1 for endothelial differentiation gene-1. In 1998 Lee, et
al. reported that S1P was an endogenous ligand for EDG1 (Lee, Van
Brocklyn et al. 1998). After this report, several groups have
identified other members of this family, including the genes for
the LPA-specific EDG4 (An, Bleu et al. 1998) and EDG7 (Aoki, Bandoh
et al. 2000) receptors and the S1P-specific EDG3 (An, Bleu et al.
1997), EDG5 (An, Bleu et al. 1997), EDG6 (Graler, Bernhardt et al.
1998) and EDG8 (Im, Heise et al. 2000) receptors.
[0088] EDG proteins are developmentally regulated and differ in
tissue distribution, but couple similarly to multiple types of
G-proteins to signal through ras and mitogen-activated protein
kinase, rho, phospholipase C, and several protein tyrosine kinases.
Furthermore, the EDG receptors are thought to cross-talk with
receptor tyrosine kinases to elicit cellular responses. This may
allow receptor tyrosine kinase receptors to signal more efficiently
and could provide the basis for co-mitogenicity. The best example
of this is LPA which stimulate tyrosine phosphorylation and
transactivation of the EGF receptor (Zwick, Hackel et al.
1999).
[0089] The first suggestion for involvement in the EDG receptors in
neurogenesis came with the cloning of EDG2. EDG2 was identified to
have enriched expression in proliferating regions of the embryonic
cerebral cortex and developing olfactory bulb (Hecht, Weiner et al.
1996; Weiner, Hecht et al. 1998), leading to a proposal for a role
of this receptor in cortical neurogenesis. Cell lines derived from
this region respond to LPA with morphological changes including
neurite retraction/cell rounding, a feature characteristic of
cortical neuroblasts during cortical development (Hecht, Weiner et
al. 1996). Another prominent feature of ventricular zone
neuroblasts, which may be related to LPA signaling, was cell
proliferation. Treatment of clusters with LPA for one day resulted
in the increase in the proliferative population, as determined by
5-bromo-2'-deoxyuridine-5'-monophosphate incorporation. This
increase was inhibited by the pretreatment with PTX suggesting the
involvement of G.sub.i/o pathway (Contos, Fukushima et al.
2000).
[0090] The effects of S1P and its receptors on cellular function in
the brain are less well characterised than for LPA. However, recent
evidence has implicated a role for S1P in astrocyte proliferation
(Pebay, Toutant et al. 2001). S1P evoked ERK phosphorylation and
subsequent DNA synthesis when applied to astrocytes. The
stimulatory effect of S1P on astrocyte proliferation was totally
blocked by PTX, indicating that these effects are mediated through
GPCRs coupled to Gi/Go proteins, a criteria fulfilled by the S1P
EDG receptors. Additional neurobiological effects of S1P include
morphological changes, such as neurite retraction (Postma, Jalink
et al. 1996) and neural differentiation (Rius, Edsall et al.
1997).
[0091] In a recent paper the expression pattern of LPA and S1P EDG
receptors has been analysed and compared in the embryonic brain by
in situ hybridization (McGiffert, Contos et al. 2002). Their data
demonstrated prominent expression of EDG1 adjacent to the lateral
ventricle in a manner both spacially and temporarily coincident
with neurogenesis. EDG1 expressing cells were found to label
positively for BrdU, a thymidine analog incorporated into dividing
cells upon application, in the ventricular zone of the cerebral
cortex and ganglionic eminence and the hippocampal primordial,
indicating that EDG1 expression is coincident with proliferating
cells in the developing brain. Expression of EDG1, EDG3 and EDG5
was also observed to exist in a punctuate pattern, colocalising
with vascular endothelial markers. These results suggest that EDG1
influences neurogenesis and EDG1, EDG3 and EDG5 in angiogenesis in
the developing brain.
[0092] Evidence has also come to light on expression of the LPA
receptors, EDG2, EDG4 and EDG7 in hepatic oval stem/progenitor
cells, suggesting that the expression of these receptors and their
regulation may play an important role in the mechanism of
activation of hepatic oval stem/progenitor cells (Sautin, Jorgensen
et al. 2002). Furthermore, the investigators suggest that LPA and
its analogs may represent important endogenous mediators,
regulating functions such as survival, motility, proliferation and
differentiation of hepatocyte progenitors in liver.
[0093] Neurogenesis has recently been observed in the piriform
cortex in the adult monkey (Bernier, Bedard et al. 2002),
confirming evidence from a study performed on rats (Bayer 1986).
These investigations suggest that neurogenesis may be more
widespread than has first thought.
Production of Reagents
[0094] Reagents for treatment of patients are recombinantly
produced, purified and formulated according to well-known
methods.
[0095] Reagents of the invention and individual moieties or analogs
and derivatives thereof, can be chemically synthesized. A variety
of protein synthesis methods are common in the art, including
synthesis using a peptide synthesizer. See, e.g., Peptide
Chemistry, A Practical Textbook, Bodasnsky, Ed. Springer-Verlag,
1988; Merrifield, Science 232: 241-247 (1986); Barany, et al, Intl.
J. Peptide Protein Res. 30: 705-739 (1987); Kent, Ann. Rev.
Biochem. 57:957-989 (1988), and Kaiser, et al, Science 243: 187-198
(1989). The peptides are purified so that they are substantially
free of chemical precursors or other chemicals using standard
peptide purification techniques. The language "substantially free
of chemical precursors or other chemicals" includes preparations of
peptide in which the peptide is separated from chemical precursors
or other chemicals that are involved in the synthesis of the
peptide. In one embodiment, the language "substantially free of
chemical precursors or other chemicals" includes preparations of
peptide having less than about 30% (by dry weight) of chemical
precursors or non-peptide chemicals, more preferably less than
about 20% chemical precursors or non-peptide chemicals, still more
preferably less than about 10% chemical precursors or non-peptide
chemicals, and most preferably less than about 5% chemical
precursors or non-peptide chemicals.
[0096] Chemical synthesis of peptides facilitates the incorporation
of modified or unnatural amino acids, including D-amino acids and
other small organic molecules. Replacement of one or more L-amino
acids in a peptide with the corresponding D-amino acid isoforms can
be used to increase the resistance of peptides to enzymatic
hydrolysis, and to enhance one or more properties of biologically
active peptides, e.g., receptor binding, functional potency or
duration of action. See, e.g., Doherty, et al., 1993. J. Med. Chem.
36: 2585-2594; Kirby, et al., 1993, J. Med. Chem. 36:3802-3808;
Morita, et al., 1994, FEBS Lett. 353: 84-88; Wang, et al., 1993
Int. J. Pept. Protein Res. 42: 392-399; Fauchere and Thiunieau,
1992. Adv. Drug Res. 23: 127-159.
[0097] Introduction of covalent cross-links into a peptide sequence
can conformationally and topographically constrain the peptide
backbone. This strategy can be used to develop peptide analogs of
reagents with increased potency, selectivity and stability. A
number of other methods have been used successfully to introduce
conformational constraints into peptide sequences in order to
improve their potency, receptor selectivity and biological
half-life. These include the use of (i) C.sub..alpha.-methylamino
acids (see, e.g., Rose, et al., Adv. Protein Chem. 37: 1-109
(1985); Prasad and Balaram, CRC Crit. Rev. Biochem., 16: 307-348
(1984)); (ii) N.sub..alpha.-methylamino acids (see, e.g., Aubry, et
al., Int. J. Pept. Protein Res., 18: 195-202 (1981); Manavalan and
Momany, Biopolymers, 19: 1943-1973 (1980)); and (iii)
.alpha.,.beta.-unsaturated amino acids (see, e.g., Bach and
Gierasch, Biopolymers, 25: 5175-S192 (1986); Singh, et al.,
Biopolymers, 26: 819-829 (1987)). These and many other amino acid
analogs are commercially available, or can be easily prepared.
Additionally, replacement of the C-terminal acid with an amide can
be used to enhance the solubility and clearance of a peptide.
[0098] Alternatively, a reagent may be obtained by methods
well-known in the art for recombinant peptide expression and
purification. A DNA molecule encoding the protein reagent can be
generated. The DNA sequence is known or can be deduced from the
protein sequence based on known codon usage. See, e.g., Old and
Primrose, Principles of Gene Manipulation 3.sup.rd ed., Blackwell
Scientific Publications, 1985; Wada et al., Nucleic Acids Res. 20:
2111-2118(1992). Preferably, the DNA molecule includes additional
sequence, e.g., recognition sites for restriction enzymes which
facilitate its cloning into a suitable cloning vector, such as a
plasmid. Nucleic acids may be DNA, RNA, or a combination thereof.
Nucleic acids encoding the reagent may be obtained by any method
known within the art (e.g., by PCR amplification using synthetic
primers hybridizable to the 3'- and 5'-termini of the sequence
and/or by cloning from a cDNA or genomic library using an
oligonucleotide sequence specific for the given gene sequence, or
the like). Nucleic acids can also be generated by chemical
synthesis.
[0099] Any of the methodologies known within the relevant art
regarding the insertion of nucleic acid fragments into a vector may
be used to construct expression vectors that contain a chimeric
gene comprised of the appropriate transcriptional/translational
control signals and reagent-coding sequences. Promoter/enhancer
sequences within expression vectors may use plant, animal, insect,
or fungus regulatory sequences, as provided in the invention.
[0100] A host cell can be any prokaryotic or eukaryotic cell. For
example, the peptide can be expressed in bacterial cells such as E.
coli, insect cells, fungi or mammalian cells (such as Chinese
hamsterovary cells (CHO) or COS cells). Other suitable host cells
are known to those skilled in the art. In one embodiment, a nucleic
acid encoding a reagent is expressed in mammalian cells using a
mammalian expression vector. Examples of mammalian expression
vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC
(Kaufman et al. (1987) EMBO J 6: 187-195).
[0101] The host cells, can be used to produce (e.g., overexpress)
peptide in culture. Accordingly, the invention further provides
methods for producing the peptide using the host cells of the
invention. In one embodiment, the method comprises culturing the
host cell of invention (into which a recombinant expression vector
encoding the peptide has been introduced) in a suitable medium such
that peptide is produced. The method further involves isolating
peptide from the medium or the host cell. Ausubel et al., (Eds).
In: Current Protocols in Molecular Biology. J. Wiley and Sons, New
York, N.Y. 1998.
[0102] An "isolated" or "purified" recombinant peptide or
biologically active portion thereof is substantially free of
cellular material or other contaminating proteins from the cell or
tissue source from which the peptide of interest is derived. The
language "substantially free of cellular material" includes
preparations in which the peptide is separated from cellular
components of the cells from which it is isolated or recombinantly
produced. In one embodiment, the language "substantially free of
cellular material" includes preparations of peptide having less
than about 30% (by dry weight) of peptide other than the desired
peptide (also referred to herein as a "contaminating protein"),
more preferably less than about 20% of contaminating protein, still
more preferably less than about 10% of contaminating protein, and
most preferably less than about 5% contaminating protein. When the
peptide or biologically active portion thereof is recombinantly
produced, it is also preferably substantially free of culture
medium, e.g., culture medium represents less than about 20%, more
preferably less than about 10%, and most preferably less than about
5% of the volume of the peptide preparation.
[0103] The invention also pertains to variants of a reagent that
function as either agonists (mimetics) or as antagonists. Variants
of a reagent can be generated by mutagenesis, e.g., discrete point
mutations. An agonist of a reagent can retain substantially the
same, or a subset of, the biological activities of the naturally
occurring form of the reagent. An antagonist of the reagent can
inhibit one or more of the activities of the naturally occurring
form of the reagent by, for example, competitively binding to the
receptor. Thus, specific biological effects can be elicited by
treatment with a variant with a limited function. In one
embodiment, treatment of a subject with a variant having a subset
of the biological activities of the naturally occurring form of the
reagent has fewer side effects in a subject relative to treatment
with the naturally occurring form of the reagent.
[0104] Preferably, the analog, variant, or derivative reagent is
functionally active. As utilized herein, the term "functionally
active" refers to species displaying one or more known functional
attributes of a full-length reagent. "Variant" refers to a reagent
differing from naturally occurring reagent, but retaining essential
properties thereof. Generally, variants are overall closely
similar, and in many regions, identical to the naturally occurring
reagent.
[0105] Variants of the reagent that function as either agonists
(mimetics) or as antagonists can be identified by screening
combinatorial libraries of mutants of the reagent for peptide
agonist or antagonist activity. In one embodiment, a variegated
library of variants is generated by combinatorial mutagenesis at
the nucleic acid level and is encoded by a variegated gene library.
A variegated library of variants can be produced by, for example,
enzymatically ligating a mixture of synthetic oligonucleotides into
gene sequences such that a degenerate set of potential sequences is
expressible as individual peptides, or alternatively, as a set of
larger fusion proteins (e.g., for phage display) containing the set
of sequences therein. There are a variety of methods which can be
used to produce libraries of potential variants from a degenerate
oligonucleotide sequence. Chemical synthesis of a degenerate gene
sequence can be performed in an automatic DNA synthesizer, and the
synthetic gene then ligated into an appropriate expression vector.
Use of a degenerate set of genes allows for the provision, in one
mixture, of all of the sequences encoding the desired set of
potential sequences. Methods for synthesizing degenerate
oligonucleotides are known in the art (see, e.g., Narang (1983)
Tetrahedron 39:3; Itakura et al. (1984) Annu Rev Biochem 53:323;
Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucl.
Acids Res. 11:477.
[0106] Derivatives and analogs of the reagent or individual
moieties can be produced by various methods known within the art.
For example, the polypeptide sequences may be modified by any
number of methods known within the art. See e.g., Sambrook, et al.,
1990. Molecular Cloning: A Laboratory Manual, 2nd ed., (Cold Spring
Harbor Laboratory Press; Cold Spring Harbor, N.Y.). Modifications
include: glycosylation, acetylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, linkage to an
antibody molecule or other cellular reagent, and the like. Any of
the numerous chemical modification methodologies known within the
art may be utilized including, but not limited to, specific
chemical cleavage by cyanogen bromide, trypsin, chymotrypsin,
papain, V8 protease, NaBH.sub.4, acetylation, formylation,
oxidation, reduction, metabolic synthesis in the presence of
tunicamycin, etc.
[0107] Derivatives and analogs may be full length or other than
full length, if said derivative or analog contains a modified
nucleic acid or amino acid, as described infra. Derivatives or
analogs of the reagent include, but are not limited to, molecules
comprising regions that are substantially homologous in various
embodiments, of at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or
preferably 95% amino acid identity when: (i) compared to an amino
acid sequence of identical size; (ii) compared to an aligned
sequence in that the alignment is done by a computer homology
program known within the art (e.g., Wisconsin GCG software) or
(iii) the encoding nucleic acid is capable of hybridizing to a
sequence encoding the aforementioned peptides under stringent
(preferred), moderately stringent, or non-stringent conditions.
See, e.g., Ausubel, et al., Current Protocols in Molecular Biology,
John Wiley and Sons, New York, N.Y., 1993.
[0108] Derivatives of the reagent may be produced by alteration of
their sequences by substitutions, additions or deletions that
result in functionally-equivalent molecules. One or more amino acid
residues within the reagent may be substituted by another amino
acid of a similar polarity and net charge, thus resulting in a
silent alteration. Conservative substitutes for an amino acid
within the sequence may be selected from other members of the class
to which the amino acid belongs. For example, nonpolar
(hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline, phenylalanine, tryptophan and methionine. Polar
neutral amino acids include glycine, serine, threonine, cysteine,
tyrosine, asparagine, and glutamine. Positively charged (basic)
amino acids include arginine, lysine and histidine. Negatively
charged (acidic) amino acids include aspartic acid and glutamic
acid.
[0109] The reagent can be administered locally to any loci
implicated in the CNS disorder pathology, e.g. any loci deficient
in neural cells as a cause of the disease. For example, the reagent
can be administered locally to the ventricle of the brain,
substantia nigra, striatum, locus ceruleous, nucleus basalis of
Meynert, pedunculopontine nucleus, cerebral cortex, spinal cord and
retina.
[0110] Neural stem cells and their progeny can be induced to
proliferate, differentiate, survive or migrate in vivo by
administering to the host a reagent, alone or in combination with
other agents, or by administering a pharmaceutical composition
containing the reagent that will induce proliferation and
differentiation of the cells. Pharmaceutical compositions include
any substance that blocks the inhibitory influence and/or
stimulates neural stem cells and stem cell progeny to proliferate,
differentiate, migrate and/or survive. Such in vivo manipulation
and modification of these cells allows cells lost, due to injury or
disease, to be endogenously replaced, thus obviating the need for
transplanting foreign cells into a patient.
Antibodies
[0111] Included in the invention are antibodies to be used as
reagents. The term "antibody" as used herein refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin (Ig) molecules, e.g., molecules that contain an
antigen binding site that specifically binds (immunoreacts with) an
antigen. Such antibodies include, but are not limited to,
polyclonal, monoclonal, chimeric, single chain, F.sub.ab, F.sub.ab'
and F.sub.(ab')2 fragments, and an F.sub.ab expression library. In
general, antibody molecules obtained from humans relates to any of
the classes IgG, IgM, IgA, IgE and IgD, which differ from one
another by the nature of the heavy chain present in the molecule.
Certain classes have subclasses as well, such as IgG.sub.1,
IgG.sub.2, and others. Furthermore, in humans, the light chain may
be a kappa chain or a lambda chain. Reference herein to antibodies
includes a reference to all such classes, subclasses and types of
human antibody species.
[0112] An isolated protein of the invention intended to serve as an
antigen, or a portion or fragment thereof, can be used as an
immunogen to generate antibodies that immunospecifically bind the
antigen, using standard techniques for polyclonal and monoclonal
antibody preparation. The full-length protein can be used or,
alternatively, the invention provides antigenic peptide fragments
of the antigen for use as immunogens. An antigenic peptide fragment
comprises at least 6 amino acid residues of the amino acid sequence
of the full length protein and encompasses an epitope thereof such
that an antibody raised against the peptide forms a specific immune
complex with the full length protein or with any fragment that
contains the epitope. Preferably, the antigenic peptide comprises
at least 10 amino acid residues, or at least 15 amino acid
residues, or at least 20 amino acid residues, or at least 30 amino
acid residues. Preferred epitopes encompassed by the antigenic
peptide are regions of the protein that are located on its surface;
commonly these are hydrophilic regions.
[0113] In certain embodiments of the invention, at least one
epitope encompassed by the antigenic peptide is a region of an EDG
receptor that is located on the surface of the protein, e.g., a
hydrophilic region. A hydrophobicity analysis of the human those
protein sequences will indicate which regions of the polypeptide
are particularly hydrophilic and, therefore, are likely to encode
surface residues useful for targeting antibody production. As a
means for targeting antibody production, hydropathy plots showing
regions of hydrophilicity and hydrophobicity may be generated by
any method well known in the art, including, for example, the Kyte
Doolittle or the Hopp Woods methods, either with or without Fourier
transformation. See, e.g., Hopp and Woods, 1981, Proc. Nat. Acad.
Sci. USA 78: 3824-3828; Kyte and Doolittle 1982, J. Mol. Biol. 157:
105-142, each incorporated herein by reference in their entirety.
Antibodies that are specific for one or more domains within an
antigenic protein, or derivatives, fragments, analogs or homologs
thereof, are also provided herein.
[0114] The term "epitope" includes any protein determinant capable
of specific binding to an immunoglobulin or T-cell receptor.
Epitopic determinants usually consist of chemically active surface
groupings of molecules such as amino acids or sugar side chains and
usually have specific three-dimensional structural characteristics,
as well as specific charge characteristics. A receptor polypeptide
or a fragment thereof comprises at least one antigenic epitope.
[0115] Various procedures known within the art may be used for the
production of polyclonal or monoclonal antibodies directed against
a protein of the invention, or against derivatives, fragments,
analogs homologs or orthologs thereof (see, for example,
Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
incorporated herein by reference). Some of these antibodies are
discussed below.
Polyclonal Antibodies
[0116] For the production of polyclonal antibodies, various
suitable host animals (e.g., rabbit, goat, mouse or other mammal)
may be immunized by one or more injections with the native protein,
a synthetic variant thereof, or a derivative of the foregoing. An
appropriate immunogenic preparation can contain, for example, the
naturally occurring immunogenic protein, a chemically synthesized
polypeptide representing the immunogenic protein, or a
recombinantly expressed immunogenic protein. Furthermore, the
protein may be conjugated to a second protein known to be
immunogenic in the mammal being immunized. Examples of such
immunogenic proteins include but are not limited to keyhole limpet
hemocyanin, serum albumin, bovine thyroglobulin, and soybean
trypsin inhibitor. The preparation can further include an adjuvant.
Various adjuvants used to increase the immunological response
include, but are not limited to, Freund's (complete and
incomplete), mineral gels (e.g., aluminum hydroxide), surface
active substances (e.g., lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, dinitrophenol, etc.),
adjuvants usable in humans such as Bacille Calmette-Guerin and
Corynebacterium parvum, or similar immunostimulatory agents.
Additional examples of adjuvants which can be employed include
MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose
dicorynomycolate).
[0117] The polyclonal antibody molecules directed against the
immunogenic protein can be isolated from the mammal (e.g., from the
blood) and further purified by well known techniques, such as
affinity chromatography using protein A or protein G, which provide
primarily the IgG fraction of immune serum. Subsequently, or
alternatively, the specific antigen which is the target of the
immunoglobulin sought, or an epitope thereof, may be immobilized on
a column to purify the immune specific antibody by immunoaffinity
chromatography. Purification of immunoglobulins is discussed, for
example, by D. Wilkinson (The Scientist, published by The
Scientist, Inc., Philadelphia Pa., Vol. 14, No. 8 (Apr. 17, 2000),
pp. 25-28).
Monoclonal Antibodies
[0118] The term "monoclonal antibody" (MAb) or "monoclonal antibody
composition," as used herein, refers to a population of antibody
molecules that contain only one molecular species of antibody
molecule consisting of a unique light chain gene product and a
unique heavy chain gene product. In particular, the complementarity
determining regions (CDRs) of the monoclonal antibody are identical
in all the molecules of the population. MAbs thus contain an
antigen binding site capable of immunoreacting with a particular
epitope of the antigen characterized by a unique binding affinity
for it.
[0119] Monoclonal antibodies can be prepared using hybridoma
methods, such as those described by Kohler and Milstein, Nature,
256:495 (1975). In a hybridoma method, a mouse, hamster, or other
appropriate host animal, is typically immunized with an immunizing
agent to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically bind to the immunizing
agent. Alternatively, the lymphocytes can be immunized in
vitro.
[0120] The immunizing agent will typically include the protein
antigen, a fragment thereof or a fusion protein thereof Generally,
either peripheral blood lymphocytes are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell (Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986) pp. 59-103). Immortalized cell lines are usually
tranrsformed mammalian cells, particularly myeloma cells of rodent,
bovine and human origin. Usually, rat or mouse myeloma cell lines
are employed. The hybridoma cells can be cultured in a suitable
culture medium that preferably contains one or more substances that
inhibit the growth or survival of the unfused, immortalized cells.
For example, if the parental cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture
medium for the hybridomas typically will include hypoxanthine,
aminopterin, and thymidine ("HAT medium"), which substances prevent
the growth of HGPRT-deficient cells.
[0121] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Manassas, Virginia. Human
myeloma and mouse-human heteromyeloma cell lines also have been
described for the production of human monoclonal antibodies
(Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal
Antibody Production Techniques and Applications, Marcel Dekker,
Inc., New York, (1987) pp. 51-63).
[0122] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the antigen. Preferably, the binding specificity
of monoclonal antibodies produced by the hybridoma cells is
determined by immunoprecipitation or by an in vitro binding assay,
such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent
assay (ELISA). Such techniques and assays are known in the art. The
binding affinity of the monoclonal antibody can, for example, be
determined by the Scatchard analysis of Munson and Pollard, Anal.
Biochem., 107:220 (1980). It is an objective, especially important
in therapeutic applications of monoclonal antibodies, to identify
antibodies having a high degree of specificity and a high binding
affinity for the target antigen.
[0123] After the desired hybridoma cells are identified, the clones
can be subcloned by limiting dilution procedures and grown by
standard methods (Goding, 1986). Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells can be
grown in vivo as ascites in a mammal.
[0124] The monoclonal antibodies secreted by the subclones can be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0125] The monoclonal antibodies can also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA can be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also can be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences (U.S.
Pat. No. 4,816,567; Morrison, Nature 368, 812-13 (1994)) or by
covalently joining to the immunoglobulin coding sequence all or
part of the coding sequence for a non-immunoglobulin polypeptide.
Such a non-immunoglobulin polypeptide can be substituted for the
constant domains of an antibody of the invention, or can be
substituted for the variable domains of one antigen-combining site
of an antibody of the invention to create a chimeric bivalent
antibody.
Humanized Antibodies
[0126] The antibodies directed against the protein antigens of the
invention can further comprise humanized antibodies or human
antibodies. These antibodies are suitable for administration to
humans without engendering an immune response by the human against
the administered immunoglobulin. Humanized forms of antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) that are principally
comprised of the sequence of a human immunoglobulin and contain
minimal sequence derived from a non-human immunoglobulin.
Humanization can be performed following the method of Winter and
co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et
al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences
for the corresponding sequences of a human antibody. (See also U.S.
Pat. No. 5,225,539.) In some instances, Fv framework residues of
the human immunoglobulin are replaced by corresponding non-human
residues. Humanized antibodies can also comprise residues which are
found neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the framework regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fe), typically that of a human immunoglobulin (Jones et
al., 1986; Riechmann et al., 1988; and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)).
[0127] Human Antibodies
[0128] Fully human antibodies essentially relate to antibody
molecules in which the entire sequence of both the light chain and
the heavy chain, including the CDRs, arise from human genes. Such
antibodies are termed "human antibodies", or "fully human
antibodies" herein. Human monoclonal antibodies can be prepared by
the trioma technique; the human B-cell hybridoma technique (see
Kozbor, et al., 1983 Immunol Today 4: 72) and the EBV hybridoma
technique to produce human monoclonal antibodies (see Cole, et al.,
1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss,
Inc., pp. 77-96). Human monoclonal antibodies may be utilized in
the practice of the present invention and may be produced by using
human hybridomas (see Cote, et al., 1983. Proc Natl Acad Sci USA
80: 2026-2030) or by transforming human B-cells with Epstein Barr
Virus in vitro (see Cole, et al., 1985 In: MONOCLONAL ANTIBODIES
AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).
[0129] In addition, human antibodies can also be produced using
additional techniques, including phage display libraries
(Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)). Similarly, human antibodies
can be made by introducing human immunoglobulin loci into
transgenic animals, e.g., mice in which the endogenous
immunoglobulin genes have been partially or completely inactivated.
Upon challenge, human antibody production is observed, which
closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This
approach is described, for example, in U.S. Pat. Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in Marks
et al. (Bio/Technology 10, 779-783 (1992)); Lonberg et al. (Nature
368 856-859 (1994)); Morrison (Nature 368, 812-13 (1994)); Fishwild
et al,(Nature Biotechnology 14, 845-51 (1996)); Neuberger (Nature
Biotechnology 14, 826 (1996)); and Lonberg and Huszar (Intern. Rev.
Immunol. 13 65-93 (1995)).
[0130] Human antibodies may additionally be produced using
transgenic nonhuman animals which are modified so as to produce
fully human antibodies rather than the animal's endogenous
antibodies in response to challenge by an antigen. (See PCT
publication WO94/02602). The endogenous genes encoding the heavy
and light immunoglobulin chains in the nonhuman host have been
incapacitated, and active loci encoding human heavy and light chain
immunoglobulins are inserted into the host's genome. The human
genes are incorporated, for example, using yeast artificial
chromosomes containing the requisite human DNA segments. An animal
which provides all the desired modifications is then obtained as
progeny by crossbreeding intermediate transgenic animals containing
fewer than the full complement of the modifications. The preferred
embodiment of such a nonhuman animal is a mouse, and is termed the
Xenomouse.TM. as disclosed in PCT publications WO 96/33735 and WO
96/34096. This animal produces B cells that secrete fully human
immunoglobulins. The antibodies can be obtained directly from the
animal after immunization with an immunogen of interest, as, for
example, a preparation of a polyclonal antibody, or alternatively
from immortalized B cells derived from the animal, such as
hybridomas producing monoclonal antibodies. Additionally, the genes
encoding the immunoglobulins with human variable regions can be
recovered and expressed to obtain the antibodies directly, or can
be further modified to obtain analogs of antibodies such as, for
example, single chain Fv molecules.
[0131] An example of a method of producing a nonhuman host,
exemplified as a mouse, lacking expression of an endogenous
immunoglobulin heavy chain is disclosed in U.S. Pat. No. 5,939,598.
It can be obtained by a method including deleting the J segment
genes from at least one endogenous heavy chain locus in an
embryonic stem cell to prevent rearrangement of the locus and to
prevent formation of a transcript of a rearranged immunoglobulin
heavy chain locus, the deletion being effected by a targeting
vector containing a gene encoding a selectable marker; and
producing from the embryonic stem cell a transgenic mouse whose
somatic and germ cells contain the gene encoding the selectable
marker.
[0132] A method for producing an antibody of interest, such as a
human antibody, is disclosed in U.S. Pat. No. 5,916,771. It
includes introducing an expression vector that contains a
nucleotide sequence encoding a heavy chain into one mammalian host
cell in culture, introducing an expression vector containing a
nucleotide sequence encoding a light chain into another mammalian
host cell, and fusing the two cells to form a hybrid cell. The
hybrid cell expresses an antibody containing the heavy chain and
the light chain.
[0133] In a further improvement on this procedure, a method for
identifying a clinically relevant epitope on an immunogen, and a
correlative method for selecting an antibody that binds
immunospecifically to the relevant epitope with high affinity, are
disclosed in PCT publication WO 99/53049.
FAB Fragments and Single Chain Antibodies
[0134] According to the invention, techniques can be adapted for
the production of single-chain antibodies specific to an antigenic
protein of the invention (see e.g., U.S. Pat. No. 4,946,778). In
addition, methods can be adapted for the construction of Fab
expression libraries (see e.g., Huse, et al., 1989 Science 246:
1275-1281) to allow rapid and effective identification of
monoclonal F.sub.ab fragments with the desired specificity for a
protein or derivatives, fragments, analogs or homologs thereof.
Antibody fragments that contain the idiotypes to a protein antigen
may be produced by techniques known in the art including, but not
limited to: (i) an F.sub.(ab')2 fragment produced by pepsin
digestion of an antibody molecule; (ii) an F.sub.ab fragment
generated by reducing the disulfide bridges of an F.sub.(ab')2
fragment; (iii) an F.sub.ab fragment generated by the treatment of
the antibody molecule with papain and a reducing agent and (iv)
F.sub.v fragments.
Bispecific Antibodies
[0135] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for an antigenic protein of the invention. The
second binding target is any other antigen, and advantageously is a
cell-surface protein or receptor or receptor subunit.
[0136] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
(1983)). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published May 13
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0137] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0138] According to another approach described in WO 96/27011, the
interface between a pair of antibody molecules can be engineered to
maximize the percentage of heterodimers which are recovered from
recombinant cell culture. The preferred interface comprises at
least a part of the CH3 region of an antibody constant domain. In
this method, one or more small amino acid side chains from the
interface of the first antibody molecule are replaced with larger
side chains (e.g. tyrosine or tryptophan). Compensatory "cavities"
of identical or similar size to the large side chain(s) are created
on the interface of the second antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or
threonine). This provides a mechanism for increasing the yield of
the heterodimer over other unwanted end-products such as
homodimers.
[0139] Bispecific antibodies can be prepared as full length
antibodies or antibody fragments (e.g. F(ab').sub.2 bispecific
antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been described in the literature. For
example, bispecific antibodies can be prepared using chemical
linkage. Brennan et al., Science 229:81 (1985) describe a procedure
wherein intact antibodies are proteolytically cleaved to generate
F(ab').sub.2 fragments. These fragments are reduced in the presence
of the dithiol complexing agent sodium arsenite to stabilize
vicinal dithiols and prevent intermolecular disulfide formation.
The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bispecific antibody. The
bispecific antibodies produced can be used as agents for the
selective immobilization of enzymes.
[0140] Additionally, Fab' fragments can be directly recovered from
E. coli and chemically coupled to form bispecific antibodies.
Shalaby et al., J. Exp. Med. 175:217-225 (1992) describe the
production of a fully humanized bispecific antibody F(ab').sub.2
molecule. Each Fab' fragment was separately secreted from E. coli
and subjected to directed chemical coupling in vitro to form the
bispecific antibody. The bispecific antibody thus formed was able
to bind to cells overexpressing the ErbB2 receptor and normal human
T cells, as well as trigger the lytic activity of human cytotoxic
lymphocytes against human breast tumor targets.
[0141] Various techniques for making and isolating bispecific
antibody fragments directly from recombinant cell culture have also
been described. For example, bispecific antibodies have been
produced using leucine zippers. Kostelny et al., J. Immunol.
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. This method can also be utilized for the
production of antibody homodimers. The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA
90:6444-6448 (1993) has provided an alternative mechanism for
making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain (V.sub.H) connected to a light-chain
variable domain (V.sub.L) by a linker which is too short to allow
pairing between the two domains on the same chain. Accordingly, the
V.sub.H and V.sub.L domains of one fragment are forced to pair with
the complementary V.sub.L and V.sub.H domains of another fragment,
thereby forming two antigen-binding sites. Another strategy for
making bispecific antibody fragments by the use of single-chain Fv
(sFv) dimers has also been reported. See, Gruber et al., J.
Immunol. 152:5368 (1994). Antibodies with more than two valencies
are contemplated. For example, trispecific antibodies can be
prepared. Tutt et al., J. Immunol. 147:60 (1991).
[0142] Exemplary bispecific antibodies can bind to two different
epitopes, at least one of which originates in the protein antigen
of the invention. Alternatively, an anti-antigenic arm of an
immunoglobulin molecule can be combined with an arm which binds to
a triggering molecule on a leukocyte such as a T-cell receptor
molecule (e.g. CD2, CD3, CD28, or B7), or Fe receptors for IgG
(Fc.gamma.R), such as Fc.gamma.RI (CD64), Fce.gamma.RII (CD32) and
Fc.gamma.RIII (CD16) so as to focus cellular defense mechanisms to
the cell expressing the particular antigen. Bispecific antibodies
can also be used to direct cytotoxic agents to cells which express
a particular antigen. These antibodies possess an antigen-binding
arm and an arm which binds a cytotoxic agent or a radionuclide
chelator, such as EOTUBE, DPTA, DOTA or TETA. Another bispecific
antibody of interest binds the protein antigen described herein and
further binds tissue factor (TF).
Immunoliposomes
[0143] The antibodies disclosed herein can also be formulated as
immunoliposomes. Liposomes containing the antibody are prepared by
methods known in the art, such as described in Epstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc.
Natl Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045
and 4,544,545. Liposomes with enhanced circulation time are
disclosed in U.S. Pat. No. 5,013,556.
[0144] Particularly useful liposomes can be generated by the
reverse-phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al .,
J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange
reaction.
Antibody Therapeutics
[0145] Antibodies of the invention, including polyclonal,
monoclonal, humanized and fully human antibodies, may be used as
therapeutic agents such as one of this invention. Such agents will
generally be employed to treat or prevent a disease or pathology,
specifically neurological disease, in a subject. An antibody
preparation, preferably one having high specificity and high
affinity for its target antigen, is administered to the subject and
will generally have an effect due to its binding with the target.
Such an effect may be one of two kinds, depending on the specific
nature of the interaction between the given antibody molecule and
the target antigen in question. In the first instance,
administration of the antibody may abrogate or inhibit the binding
of the target with an endogenous S1P or LPA ligand to which it
naturally binds. In this case, the antibody binds to the target and
masks a binding site of the naturally occurring ligand, wherein the
ligand serves as an effector molecule. Thus, the receptor mediates
a signal transduction pathway for which ligand is responsible.
[0146] Alternatively, the effect may be one in which the antibody
elicits a physiological result by virtue of binding to an effector
binding site on the target molecule. In this case the target, an
EDG receptor having an endogenous ligand which needs to be
modulated, binds the antibody as a surrogate effector ligand,
initiating a receptor-based signal transduction event by the
receptor.
[0147] A therapeutically effective amount of an antibody of the
invention relates generally to the amount needed to achieve a
therapeutic objective. As noted above, this may be a binding
interaction between the antibody and its target antigen that, in
certain cases, interferes with the functioning of the target, and
in other cases, promotes a physiological response. The amount
required to be administered will furthermore depend on the binding
affinity of the antibody for its specific antigen and the rate at
which an administered antibody is depleted from the free volume of
the subject to which it is administered.
Diseases and Disorders
[0148] Diseases and disorders that are characterized by altered
(relative to a subject not suffering from the disorder) levels or
biological activity may be treated with therapeutics that
antagonize (e.g., reduce or inhibit) or activate S1P or LPA
activity. Therapeutics that antagonize activity may be administered
in a therapeutic or prophylactic manner. Therapeutics that may be
utilized include, but are not limited to: (i) an aforementioned
peptide, analog, derivatives, fragments or homologs thereof; (ii)
antibodies to an aforementioned peptide; (iii) nucleic acids
encoding an aforementioned peptide; (iv) administration of
antisense nucleic acid and nucleic acids that are "dysfunctional"
(e.g., due to a heterologous insertion within the coding sequences
of coding sequences to an aforementioned peptide) that are utilized
to "knockout" endogenous function of an aforementioned peptide by
homologous recombination (see, e.g., Capecchi, 1989. Science 244:
1288-1292); or (v) modulators (e.g., inhibitors, agonists and
antagonists, including additional peptide mimetic of the invention
or antibodies specific to a peptide of the invention) that alter
the interaction between an aforementioned peptide and its binding
partner.
[0149] Disorders that are characterized by altered (relative to a
subject not suffering from the disease or disorder) levels or
biological activity may be treated with therapeutics that increase
(e.g., are agonists to) activity. In a preferred embodiment, the
diseases to be treated include Alzheimer's disease, stroke,
Parkinson's disease. Therapeutics that upregulate activity may be
administered in a therapeutic or prophylactic manner. Therapeutics
that may be utilized include, but are not limited to, an
aforementioned peptide, analog, derivatives, fragments or homologs
thereof; or an agonist that increases bioavailability.
[0150] Increased or decreased levels can be detected by quantifying
peptide and/or RNA, by obtaining a patient tissue sample (e.g.,
from biopsy tissue) and assaying it in vitro for RNA or peptide
levels, structure and/or activity of the expressed peptides (or
mRNAs of an aforementioned peptide). Methods that are well-known
within the art include, but are not limited to, immunoassays (e.g.,
by Western blot analysis, immunoprecipitation followed by sodium
dodecyl sulfate (SDS) polyacrylamide gel electrophoresis,
immunocytochemistry, etc.) and/or hybridization assays to detect
expression of mRNAs (e.g., Northern assays, dot blots, in situ
hybridization, and the like).
Therapeutic Methods
[0151] Another aspect of the invention pertains to methods of
modulating S1P or LPA levels or activity for therapeutic purposes.
In one embodiment, the modulatory method of the invention involves
contacting a cell with an agent that modulates one or more of the
activities of S1P or LPA. An agent that modulates this activity can
be an agent as described herein, such as a naturally-occurring
cognate ligand of an EDG receptor, or other small molecule. In one
embodiment, the agent stimulates the activity of the S1P or LPA
signaling pathway. Examples of such stimulatory agents include
active S1P or LPA or other ligands of the EDG receptors. These
modulatory methods can be performed in vitro (e.g., by culturing
the cell with the agent) or, alternatively, in vivo (e.g., by
administering the agent to a subject). As such, the invention
provides methods of treating an individual afflicted with a
disorder, specifically a neurological disorder. In one embodiment,
the method involves administering a reagent (e.g., an reagent
identified by a screening assay described herein), or combination
of reagents that modulate (e.g., up-regulates or down-regulates)
S1P or LPA expression or activity. In another embodiment, the
method involves administering S1P or LPA as therapy to modulate
proliferation, differentiation, migration and/or survival of
NSCs/NPCs.
[0152] Stimulation of S1P or LPA activity is desirable in
situations in which S1P or LPA are abnormally downregulated and/or
in which increased S1P or LPA levels or activity is likely to have
a beneficial effect. One example of such a situation is where a
subject has a disorder characterized by aberrant cell proliferation
and/or differentiation (e.g., Parkinson's disease and Alzheimer's
disease).
Determination of the Biological Effect of the Therapeutic
[0153] In various embodiments of the invention, suitable in vitro
or in vivo assays are performed to determine the effect of a
specific therapeutic and whether its administration is indicated
for treatment of the affected tissue.
[0154] In various specific embodiments, in vitro assays may be
performed with representative stem cells or newly differentiated
cells involved in the patient's disorder, to determine if a given
therapeutic exerts the desired effect upon the cell type(s).
Compounds for use in therapy may be tested in suitable animal model
systems including, but not limited to rats, mice, chicken, cows,
monkeys, rabbits, and the like, prior to testing in human subjects.
Similarly, for in vivo testing, any of the animal model system
known in the art may be used prior to administration to human
subjects.
Pharmaceutical Compositions
[0155] The invention provides methods of influencing central
nervous system cells to produce progeny that can replace damaged or
missing neurons in the central nervous system or other central
nervous system cell types by exposing a patient, suffering from a
neurological disorder, to a reagent (e.g. S1P, LPA) in a suitable
formulation through a suitable route of administration, that
modulates NSC or NPC activity in vivo. In all embodiment of the
inventions, the reference to disorder of the nervous system may
include any disorder and, for example, at least the following
disorders: neurodegenerative disorders, neural stem cell disorders,
neural progenitor disorders, ischemic disorders, neurological
traumas, affective disorders, neuropsychiatric disorders,
degenerative diseases of the retina, retinal injury/trauma and
learning and memory disorders. In one embodiment of the invention,
the disorder of the nervous system is selected from the group
consisting of Parkinson's disease and Parkinsonian disorders,
Huntington's disease, Alzheimer's disease, Amyotrophic Lateral
Sclerosis, spinal ischemia, ischemic stroke, spinal cord injury and
cancer-related brain/spinal cord injury. In a further embodiment of
the invention, the disorder of the nervous system is selected from
the group consisting of schizophrenia and other psychoses,
lissencephaly syndrome, depression, bipolar depression/disorder,
anxiety syndromes/disorders, phobias, stress and related syndromes,
cognitive function disorders, aggression, drug and alcohol abuse,
obsessive compulsive behaviour syndromes, seasonal mood disorder,
borderline personality disorder, cerebral palsy, life style drug,
multi-infarct dementia, Lewy body dementia, age related/geriatric
dementia, epilepsy and injury related to epilepsy, temporal lobe
epilepsy, spinal cord injury, brain injury, brain surgery, trauma
related brain/spinal cord injury, anti-cancer treatment related
brain/spinal cord tissue injury, infection and inflammation related
brain/spinal cord injury, environmental toxin related brain/spinal
cord injury, multiple sclerosis, autism, attention deficit
disorders, narcolepsy, sleep disorders, and disorders of cognitive
performance or memory.
[0156] This invention provides a method of treating a neurological
disorder comprising administering a reagent that modulates neural
stem cell or neural progenitor cell activity in vivo to a mammal.
The term "mammal" refers to any mammal classified as a mammal,
including humans, cows, horses, dogs, sheep and cats. In one
embodiment, the mammal is a human.
[0157] The invention provides a regenerative cure for
neurodegenerative diseases by stimulating ependymal cells and
subventricular zone cells to proliferate, migrate, differentiate
and survive into the desired neural phenotype targeting loci where
cells are damaged or missing. In vivo stimulation of ependymal stem
cells is accomplished by locally administering a reagent to the
cells in an appropriate formulation. By increasing neurogenesis,
damaged or missing neurons can be replaced in order to enhance
brain function in diseased states.
[0158] A pharmaceutical composition useful as a therapeutic agent
for the treatment of central nervous system disorders is provided.
For example, the composition includes a reagent of the invention,
which can be administered alone or in combination with the systemic
or local co-administration of one or more additional agents. Such
agents include preservatives, ventricle wall permeability
increasing factors, stem cell mitogens, survival factors, glial
lineage preventing agents, anti-apoptotic agents, anti-stress
medications, neuroprotectants, and anti-pyrogenics. The
pharmaceutical composition preferentially treats CNS diseases by
stimulating cells (e.g., ependymal cells and subventricular zone
cells) to proliferate, migrate and differentiate into the desired
neural phenotype, targeting loci where cells are damaged or
missing.
[0159] A method for treating a subject suffering from a CNS
disorder is also provided. This method comprises administering to
the subject an effective amount of a pharmaceutical composition
containing a reagent (1) alone in a dosage range of 0.001 ng/kg/day
to 10 mg/kg/day, preferably in a dosage range of 0.01 ng/kg/day to
5 mg/kg/day, more preferably in a dosage range of 0.1 ng/kg/day to
1 mg/kg/day, most preferably in a dosage range of 100 ng/kg/day to
1 mg/kg/day, (2) in a combination with a ventricle wall
permeability increasing factor, or (3) in combination with a
locally or systemically co-administered agent.
[0160] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or
subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates, and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
The pH can be adjusted with acids or bases, such as hydrochloric
acid or sodium hydroxide. The parenteral preparation can be
enclosed in ampoules, disposable syringes or multiple dose vials
made of glass or plastic.
[0161] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof. The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0162] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g., chimeric peptide) in the
required amount in an appropriate solvent with one or a combination
of ingredients enumerated above, as required, followed by filtered
sterilization. Generally, dispersions are prepared by incorporating
the active compound into a sterile vehicle that contains a basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, methods of preparation
are vacuum drying and freeze-drying that yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0163] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0164] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0165] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0166] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0167] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0168] Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils, such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate,
triglycerides, or liposomes. Non-lipid polycationic amino polymers
may also be used for delivery. Optionally, the suspension may also
contain suitable stabilizers or agents to increase the solubility
of the compounds and allow for the preparation of highly
concentrated solutions.
[0169] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0170] Nucleic acid molecules encoding a proteinaceous agent can be
inserted into vectors and used as gene therapy vectors. Gene
therapy vectors can be delivered to a subject by, for example,
intravenous injection, local administration (see U.S. Pat. No.
5,328,470) or by stereotactic injection (see e.g., Chen et al.
(1994) PNAS 91:3054-3057). The pharmaceutical preparation of the
gene therapy vector can include the gene therapy vector in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery vector can be produced intact from
recombinant cells, e.g., retroviral vectors, the pharmaceutical
preparation can include one or more cells that produce the gene
delivery system.
[0171] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0172] In another embodiments, the reagent is administered in a
composition comprising at least 90% pure reagent. The reagent can
be, for example, S1P or LPA.
[0173] Preferably the reagent is formulated in a medium providing
maximum stability and the least formulation-related side-effects.
In addition to the reagent, the composition of the invention will
typically include one or more protein carrier, buffer, isotonic
salt and stabilizer.
[0174] In some instances, the reagent can be administered by a
surgical procedure implanting a catheter coupled to a pump device.
The pump device can also be implanted or be extracorporally
positioned. Administration of the reagent can be in intermittent
pulses or as a continuous infusion. Devices for injection to
discrete areas of the brain are known in the art (see, e.g., U.S.
Pat. Nos. 6,042,579; 5,832,932; and 4,692,147).
[0175] Reagents containing compositions can be administered in any
conventional form for administration of a protein. A reagent can be
administered in any manner known in the art in which it may either
pass through or by-pass the blood-brain barrier. Methods for
allowing factors to pass through the blood-brain barrier include
minimizing the size of the factor, providing hydrophobic factors
which may pass through more easily, conjugating the protein reagent
or other agent to a carrier molecule that has a substantial
permeability coefficient across the blood brain barrier (see, e.g.,
U.S. Pat. No. 5,670,477).
[0176] Reagents, derivatives, and co-administered agents can be
incorporated into pharmaceutical compositions suitable for
administration. Such compositions typically comprise the agent and
a pharmaceutically acceptable carrier. As used herein,
"pharmaceutically acceptable carrier" is intended to include any
and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like, compatible with pharmaceutical administration. The use of
such media and agents for pharmaceutically active substances is
well known in the art. Except insofar as any conventional media or
agent is incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions. Modifications can be
made to the agents to affect solubility or clearance of the
peptide. Peptidic molecules may also be synthesized with D-amino
acids to increase resistance to enzymatic degradation. In some
cases, the composition can be co-administered with one or more
solubilizing agents, preservatives, and permeation enhancing
agents. Examples of pharmaceutically acceptable carriers include
lactose, glucose, sucrose, sorbitol, mannitol, corn starch,
crystalline cellulose, gum arabic, calcium phosphate, alginates,
calcium silicate, microcrystalline cellulose, polyvinyl
pyrrolidone, tragacanth gum, gelatin, syrum, methyl cellulose,
carboxymethyl cellulose, methylhydroxybenzoic acid esters,
propylhydroxybenzoic acid esters, talc, magnesium stearates, inert
polymers, water and mineral oils.
[0177] For example, the composition can include a preservative or a
carrier such as proteins, carbohydrates, and compounds to increase
the density of the pharmaceutical composition. The composition can
also include isotonic salts and redox-control agents.
[0178] In some embodiments, the composition administered includes
the reagent and one or more agents that increase the permeability
of the ventricle wall, e.g. "ventricle wall permeability
enhancers." Such a composition can help an injected composition
penetrate deeper than the ventricle wall. Examples of suitable
ventricle wall permeability enhancers include, for example,
liposomes, VEGF (vascular endothelial growth factor), IL-s,
TNF.alpha., polyoxyethylene, polyoxyethylene ethers of fatty acids,
sorbitan monooleate, sorbitan monolaurate, polyoxyethylene
monolaurate, polyoxyethylene sorbitan monolaurate, fusidic acid and
derivatives thereof, EDTA, disodium EDTA, cholic acid and
derivatives, deoxycholic acid, glycocholic acid, glycodeoxycholic
acid, taurocholic acid, taurodeoxycholic acid, sodium cholate,
sodium glycocholate, glycocholate, sodium deoxycholate, sodium
taurocholate, sodium glycodeoxycholate, sodium taurodeoxycholate,
chenodeoxycholic acid, urosdeoxycholic acid, saponins, glycyrrhizic
acid, ammonium glycyrrhizide, decamethonium, decamethonium bromide,
dodecyltrimethylammonium bromide, and dimethyl-p-cyclodextrin or
other cyclodextrins.
Drug Screening
[0179] The invention also provides a method of using the receptors
or receptor/reagent complexes for analyzing or purifying certain
stem or progenitor cell populations, using e.g. antibodies, against
the receptors or receptor/reagent complexes.
[0180] In another aspect, the invention provides a method for
screening for reagents that influence stem and progenitor cells. In
some applications, neural cells (undifferentiated or
differentiated) are used to screen factors that promote maturation
into neural cells, or promote proliferation and maintenance of such
cells in long-term culture. For example, candidate reagents are
tested by adding them to cells in culture at varying dosages, and
then determining any changes that result, according to desirable
criteria for further culture and use of the cells. Physical
characteristics of the cells can be analyzed by observing cell and
neurite growth with microscopy. The induction of expression of
increased levels of proliferation, differentiation and migration
can be analyzed with any technique known in the art which can
identify proliferation and differentiation. Such techniques include
RT-PCR, in situ hybridization, and ELISA.
[0181] In one aspect, novel receptor/reagents in undifferentiated
neurospheres was examined using RT-PCR techniques. In particular,
genes that are up-regulated in these undifferentiated neurospheres
were identified. As used herein, the term "up-regulation" refers to
a process that increases reagent/receptor interactions due to an
increase in the number of available receptors. The presence of
these genes suggests a potential role in the mediation of signal
transduction pathways in the regulation of NSC/NPC function.
Furthermore, by knowing the levels of expression of the receptors
or their various reagents, it is possible to diagnose disease or
determine the role of stem and progenitor cells in the disease. By
analyzing the genetic or amino-acid sequence variations in these
genes or gene products, it is possible to diagnose or predict the
development of certain diseases. Such analysis will provide the
necessary information to determine the usefulness of using stem or
progenitor cell based treatments for disease.
[0182] In another aspect, in situ hybridization is performed on
adult mouse brain sections to determine which cells in the adult
brain express these signaling pathways. This data is helpful in
determining treatment options for various neurological
diseases.
[0183] To determine the effect of a potential reagent on neural
cells, a culture of NSCs/NPCs derived from multipotent stem cells
can be obtained from normal neural tissue or, alternatively, from a
host afflicted with a CNS disorder. The choice of culture will
depend upon the particular agent being tested and the effects one
wishes to achieve. Once the cells are obtained from the desired
donor tissue, they are proliferated in vitro in the presence of a
proliferation-inducing reagent.
[0184] The ability of various biological agents to increase,
decrease or modify in some other way the number and nature of the
stem cell progeny proliferated in the presence of the proliferative
factor can be screened on cells proliferated by the methods
previously discussed. For example, it is possible to screen for
reagents that increase or decrease the proliferative ability of
NSCs/NPCs which would be useful for generating large numbers of
cells for transplantable purposes. In these studies precursor cells
are plated in the presence of the reagent in question and assayed
for the degree of proliferation and survival or progenitor cells
and their progeny can be determined. It is possible to screen
neural cells which have already been induced to differentiate prior
to the screening. It is also possible to determnine the effects of
the reagent on the differentiation process by applying them to
precursors cells prior to differentiation. Generally, the reagent
will be solubilized and added to the culture medium at varying
concentrations to determine the effect of the agent at each dose.
The culture medium may be replenished with the reagent every couple
of days in amounts so as to keep the concentration of the reagent
somewhat constant.
[0185] Changes in proliferation are observed by an increase or
decrease in the number of neurospheres that form and/or an increase
or decrease in the size of the neurospheres, which is a reflection
of the rate of proliferation and is determined by the numbers of
precursor cells per neurosphere.
[0186] Using these screening methods, it is possible to screen for
potential drug side-effects on prenatal and postnatal CNS cells by
testing for the effects of the biological agents on stem cell and
progenitor cell proliferation and on progenitor cell
differentiation or the survival and function of differentiated CNS
cells.
[0187] Other screening applications of this invention relate to the
testing of pharmaceutical compounds for their effect on neural
tissue. Screening may be done either because the compound is
designed to have a pharmacological effect on neural cells, or
because a compound designed to have effects elsewhere may have
unintended side effects on the nervous system. The screening can be
conducted using any of the neural precursor cells or terminally
differentiated cells of the invention.
[0188] Effect of cell function can be assessed using any standard
assay to observe phenotype or activity of neural cells, such as
receptor binding, proliferation, differentiation, survival-either
in cell culture or in an appropriate model.
Therapeutic Uses
[0189] The fact that neural stem cells are located in the tissues
lining ventricles of mature brains offers several advantages for
the modification and manipulation of these cells in vivo and the
ultimate treatment of various neurological diseases, disorders, and
injury that affect different regions of the CNS. Therapy for these
diseases can be tailored accordingly so that stem cells surrounding
ventricles near the affected region would be manipulated or
modified in vivo using the methods described herein. The
ventricular system is found in nearly all brain regions and thus
allows easier access to the affected areas. In order to modify the
stem cells in vivo by exposing them to a composition comprising a
reagent, it is relatively easy to implant a device that administers
the composition to the ventricle and thus, to the neural stem
cells. For example, a cannula attached to an osmotic pump may be
used to deliver the composition. Alternatively, the composition may
be injected directly into the ventricles. The neural stem cell
progeny can migrate into regions that have been damaged as a result
of injury or disease. Furthermore, the close proximity of the
ventricles to many brain regions would allow for the diffusion of a
secreted neurological agent by the stem cells or their progeny.
[0190] In an additional embodiment, a reagent of the invention is
administered locally, as described above, in combination with an
agent administered locally or systemically. Such agents include,
for example, one or more stem cell mitogens, survival factors,
glial-lineage preventing agents, anti-apoptotic agents, anti-stress
medications, neuroprotectants, and anti-pyrogenics, or any
combination thereof.
[0191] The agent is administered systemically before, during, or
after administration of the reagent of the invention. The locally
administered agent can be administered before, during, or after the
reagent administration.
[0192] For treatment of Huntington's Disease, Alzheimer's Disease,
Parkinson's Disease, and other neurological disorders affecting
primarily the forebrain, a reagent alone or with an additional
agent or agents is delivered to the ventricles of the forebrain to
affect in vivo modification or manipulation of the stem cells. For
example, Parkinson's Disease is the result of low levels of
dopamine in the brain, particularly the striatum. It is therefore
advantageous to induce a patient's own quiescent stem cells to
begin to divide in vivo and to induce the progeny of these cells to
differentiate into dopaminergic cells in the affected region of the
striatum, thus locally raising the levels of dopamine.
[0193] Normally the cell bodies of dopaminergic neurons are located
in the substantia nigra and adjacent regions of the mesencephalon,
with the axons projecting to the striatum. The methods and
compositions of the invention provide an alternative to the use of
drugs and the controversial use of large quantities of embryonic
tissue for treatment of Parkinson's disease. Dopamine cells can be
generated in the striatum by the administration of a composition
comprising a reagent of the invention to the lateral ventricle.
[0194] For the treatment of MS and other demyclinating or
hypomyelinating disorders, and for the treatment of Amyotrophic
Lateral Sclerosis or other motor neuron diseases, a reagent of the
invention, alone or with an additional agent or agents is delivered
to the central canal.
[0195] In addition to treating CNS tissue immediately surrounding a
ventricle, a reagent of the invention, alone or with an additional
agent or agents can be administered to the lumbar cistern for
circulation throughout the CNS.
[0196] In other aspects, neuroprotectants can also be
co-administered systemically or locally before, during and/or after
infusion of a regent of the invention. Neuroprotectants include
antioxidants (agents with reducing activity, e.g., selenium,
vitamin E, vitamin C, glutathione, cysteine, flavinoids,
quinolines, enzymes with reducing activity, etc), Ca-channel
modulators, Na-channel modulators, glutamate receptor modulators,
serotonin receptor agonists, phospholipids, unsaturated- and
polyunsaturated fatty acids, estrogens and selective estrogen
receptor modulators (SERMS), progestins, thyroid hormone and
thyroid hormone-mimicking compounds, cyclosporin A and derivatives,
thalidomide and derivatives, methylxanthines, MAO inhibitors;
serotonin-, noradrenaline and dopamine uptake blockers; dopamine
agonists, L-DOPA, nicotine and derivatives, and NO synthase
modulators.
[0197] Certain reagents of the invention may be pyrogenic following
IV injection (in rats; Am. J. Physiol. Regul. Integr. Comp.
Physiol. 2000 278:R1275-81). Thus, in some aspects of the
invention, antipyrogenic agents like cox2 inhibitors, indomethacin,
salisylic acid derivatives and other general
anti-inflammatory/anti-pyrogenic compounds can be systemically or
locally administered before, during and/or after administration of
the reagent of the invention.
[0198] In another aspect of the invention, anti-apoptotic agents
including caspase inhibitors and agents useful for
antisense-modulation of apoptotic enzymes and factors can be
administered before, during, or after administration of the reagent
of the invention.
[0199] Stress syndromes lower neurogenesis, therefore in some
aspects, it may be desirable to treat a subject with anti-stress
medications such as, e.g., anti-glucocorticoids (e.g., RU486) and
beta-blockers, administered systemically or locally before, during
and/or after infusion of the reagent of the invention.
[0200] Methods for preparing the reagent dosage forms are known, or
will be apparent, to those skilled in this art.
[0201] The amount of reagent to be administered will depend upon
the exact size and condition of the patient, but will be from 0.5
ng/kg/day to 10 mg/kg/day in a volume of 0.001 to 10 ml.
[0202] The duration of treatment and time period of administration
of reagent will also vary according to the size and condition of
the patient, the severity of the illness and the specific
composition and method being used.
[0203] The effectiveness of each of the foregoing methods for
treating a patient with a CNS disorder is assessed by any known
standardized test for evaluating the disease.
EXAMPLES
Example 1
Expression of EDG Receptor Genes in Adult Mouse NSC and Lateral
Ventricle Wall Tissue
Methods
Mouse & Human Cultures
[0204] Mouse Neurosphere Cultures
[0205] The anterior lateral wall of the lateral ventricle of 5-6
week old mice was enzymatically dissociated in 0.8mg/ml
hyaluronidase and 0.5 mg/ml trypsin in DMEM containing 4.5 mg/ml
glucose and 80units/ml DNase at 37.degree. C. for 20 min. The cells
were gently triturated and mixed with three volumes of Neurosphere
medium (DMEM/F12, B27 supplement, 12.5 mM HEPES pH7.4) containing
20 ng/ml EGF (unless otherwise stated), 100units/ml penicillin and
100 .mu.g/ml streptomycin. After passing through a 70 .mu.m
strainer, the cells were pelleted at 160.times.g for 5 min. The
supernatant was subsequently removed and the cells resuspended in
Neurosphere medium supplemented as above, plated out in culture
dishes and incubated at 37.degree. C. Neurospheres were ready to be
split approximately 7 days after plating.
[0206] To split neurosphere cultures, neurospheres were collected
by centrifugation at 160.times.g for 5 min. The neurospheres were
resuspended in 0.5 ml Trypsin/EDTA in HBSS (1.times.), incubated at
37.degree. C. for 2 min and triturated gently to aid dissociation.
Following a further 3 min incubation at 37.degree. C. and
trituration, 3 volumes of ice cold NSPH-media-EGF were added to
stop further trypsin activity. The cells were pelleted at
220.times.g for 4 min, resuspended in fresh Neurosphere medium
supplemented with 20 ng/ml EGF and 1 nM bFGF plated out and
incubated at 37.degree. C.
[0207] RT-PCR
[0208] The following primer pairs were designed to specifically
identify the presence of edg1, edg2, edg3, edg4, edg5, edg6, edg7
and edg8 gene expression in neurospheres, lateral venticle wall
(LVW), and the rest of the brain (ROB) following LVW dissection.
Primers are written 5'.fwdarw.3'. Estimated band sizes for each
primer pair are given below:
1 Band size (base pairs) Edg1 Fw: 639 AAAACCAAGAAGTTCCACCGGCCC (SEQ
ID NO:1) Rev: CGCCTTGCAGCCCACATCTAACAGT (SEQ ID NO:2) Edg2 Fw: 509
CAGCTGCCTCTACTTCCAGCCCTGTAATTT (SEQ ID NO:3) Rev:
GATGACTACAATCACCACCACCACGCG A (SEQ ID NO:4) Edg3 Fw: 635
TTTCATCGGCAACTTGGCTCTCTGC (SEQ ID NO:5) Rev:
GGACAGCCAGCATGATGAACCACTG (SEQ ID NO:6) Edg4 Fw: 509
ATGGGCCAGTGCTACTACAACGAGACCA (SEQ ID NO:7) Rev:
CAGAGGCAGTGCCAGAAGTGTGCAGGTA (SEQ ID NO:8) Edg5 Fw: 629
GGCCTTCGTGGCCAACACCTTACT (SEQ ID NO:9) Rev:
CCCGGCTACGCCACGTATAGATGAC (SEQ ID NO:10) Edg6 Fw: 513
ATGAACATCAGTACCTGGTCCACGCTGG (SEQ ID NO:11) Rev:
GCACAGACCGATGCAGCCATACACA- C (SEQ ID NO:12) Edg7 Fw: 515
TGAATGAGTGTCACTATGACAAGCGCATGG (SEQ ID NO:13) Rev:
GTTGCAGAGGCAATTCCATCCCAGC (SEQ ID NO:14) Edg8 Fw: 514
CGGCGCCGGTGAGTGAGGTTATTGT (SEQ ID NO:15) Rev:
AGGCGTCCTAAGCAGTTCCAGCCCA (SEQ ID NO:16) Actin Fw: 360
ATGGATGACGATATCGCTGCGCTGG (SEQ ID NO:17) Rev:
GGTCATCTTTTCACGGTTGGCCTTAGGGT (SEQ ID NO:18)
[0209] Neurospheres were prepared from the LVW as stated above. 3
days after the first split, the neurospheres were harvested and
total RNA isolated using Qiagen's RNeasy Mini Kit according to the
manufacturer's instructions. LVW and ROB total RNA was prepared in
identical fashion to that of neurosphere total RNA. Prior to the
RT-PCR, total RNA was DNase (Ambion) treated (1 unit/5 .mu.g total
RNA) at 37.degree. C. for 15min, followed by heat inactivation at
75.degree. C. for 10 min. Invitrogen's One-Step RT-PCR Kit was used
to detect the presence of mRNA corresponding to the eight EDG
receptors. Briefly, 12.5 ng of total RNA was used in each reaction,
with an annealing temperature of 58.degree. C. To further ensure
that genomic contamination of the total RNA did not give rise to
false positive results, an identical reaction in which the RT-taq
polymerase mix was replaced by Taq polymerase alone was run in
parallel with the experimental RT-PCR. The reactions were
electrophoresed on a 1.0% agarose gel containing ethidium bromide
and the bands visualised under UV light. Bands corresponding to the
estimated length of PCR products of the desired genes were cloned
into the cloning vector pGEM-Teasy and sequenced to verify their
identity.
[0210] Results
[0211] To determine whether the EDG receptors are expressed in the
LVW and neural stem cells of adult mice, LVW tissue was harvested
from adult mice and either used to prepare total RNA or to
cultivate neurospheres from which RNA was then extracted. RT-PCR,
using the prepared RNA, was performed, indicating gene expression
of edg], edg3 and edg8 in LVW, and edg1, edg3 and edg5 in
neurospheres, of the S1P subclass EDG receptors (FIG. 1A). Of the
LPA subclass of EDG receptors, edg2, edg4 and edg7 were present in
LVW and edg2 and edg4 in neurospheres (FIG. 1B).
Example 2
EDG Receptors 1 & 8 are Expressed in Neurogenic Regions in the
Adult Mouse Brain
Methods
[0212] Radioactive in situ Hybridization
[0213] Whole brain from 6 weeks old mice were dissected out and
frozen at -80.degree. C. Sections (14 .mu.m) of whole mouse brain
were cut on a cryostat at -17.degree. C., thawed onto microscope
slides (Superfrost Plus, BDH, UK) and fixed in 4% formaldehyde for
5 min, deproteinated for 15 min in 0.2 M HCl, treated in 0.25%
acetic anhydride in 0.1 M triethanolamine buffer, pH 8.0 for 20 min
and dehydrated in an ascending series of ethanol concentrations
including a 5 min chloroformn step prior to hybridization. To
detect Edg1, 8 mRNA, antisense cRNA probes were transcribed from
plasmids (pGEM-Teasy) containing Edg1 and Edg8 cDNA (172 bp
corresponding to bases 936 to 1107 of the coding sequence of mouse
Edg1 gene, 294 bp corresponding to bases 55 to 384 of the coding
sequence of mouse Edg8 gene) and concurrently
[.alpha.-.sup.35S]UTP-labeled. The sections were incubated with the
probe at 55.degree. C. for 16 h in a hybridization buffer
containing 52% formamide, 10% Dextran Sulfate, 208 mM NaCl, 2%
50.times.Denhardt's solution (1% Ficoll, 1% polyvinylpyrrolidene,
1% BSA) 10 mM Tris pH 8.0, 1 mM EDTA, 500 ng/ml yeast tRNA, 10 mM
dithiothreitol (DTT) and 20.times.10.sup.6 cpm probe per ml buffer.
After hybridization, the sections were treated with RNase A, 10
.mu.g/ml in 0.5 M NaCl, at 37.degree. C. for 30 min and washed in
4.times.saline sodium citrate (SSC; 1.times.SSC is 0.15 M sodium
chloride, 0.015 M trisodium citrate pH 7.0) for 20 min, 2.times.SSC
for 10 min., 1.times.SSC for 10 min. and 0.5.times.SSC for 10 min.
at room temperature. A high stringency wash was carried out at
70.degree. C. for 30 min in 0.1.times.SSC. All wash steps included
the addition of 1 mM DTT. The sections were dehydrated in an
ascending series of ethanol concentrations, dried over night and
mounted in cassettes with autoradiographic films (Beta-max,
Amersham) placed on top for 3 weeks. The films were developed in
Kodak D-19 developer, fixed in Kodak RA-3000 diluted 1:3, rinsed
and dried. The sections were then dipped in Kodak NTB-2 nuclear
track emulsion diluted 1:1, exposed for six weeks, developed in
Kodak D-19 for 3 min, fixed in Kodak RA-3000 fixer and
counterstained with cresyl violet. The specificity of the
hybridization was tested using a sense probe transcribed from the
same plasmid. No hybridization signal was obtained under this
condition. The emulsion dipped sections were analysed manually
using a Nikon E600 microscope.
[0214] Results
[0215] FIG. 2 represents brightfield and darkfield micrographs of
edg1 mRNA positive cells in sagittal sections of adult mouse brain
using an edg1 specific probe. FIG. 2A is a low magnification
photograph showing edg1 expression in the lateral ventricle wall
and the rostral migratory stream. FIG. 2B & C shows higher
magnification of the lateral ventricle wall. Note the positively
labelled cells in the subventricular zone of the lateral ventricle
wall. Abbreviations: LV, lateral ventricle; LVW, lateral ventricle
wall; RMS, rostral migratory stream; Str, striatum; SVZ,
subventricular zone.
[0216] FIG. 3 shows low magnification microphotographs of edg8 mRNA
expression in sections of adult mouse brain using an edg1 specific
probe. FIGS. 3A & B show edg8 expression in the dentate gyrus
and CA1-3 regions of the hippocampus. FIG. 3B also shows expression
in the of edg8 in the piriform cortex. higher magnification of the
lateral ventricle wall. Abbreviations: hp, hippocampus; pc,
piriform cortex.
Example 3
S1P and LPA Stimulate Adult Mouse NSC Proliferation in Vitro
Methods
[0217] Mouse Neurosphere Cultures
[0218] The anterior lateral wall of the lateral ventricle of 5-6
week old mice was enzymatically dissociated in 0.8 mg/ml
hyaluronidase and 0.5 mg/ml trypsin in DMEM containing 4.5 mg/ml
glucose and 80 units/ml DNase at 37.degree. C. for 20 min. The
cells were gently triturated and mixed with three volumes of
Neurosphere medium (DMEM/F12, B27 supplement, 12.5 mM HEPES pH7.4)
containing 20 ng/ml EGF (unless otherwise stated), 100 units/ml
penicillin and 100 .mu.g/ml streptomycin. After passing through a
70 1m strainer, the cells were pelleted at 160.times.g for 5 min.
The supernatant was subsequently removed and the cells resuspended
in Neurosphere medium supplemented as above, plated out in culture
dishes and incubated at 37.degree. C. Neurospheres were ready to be
split approximately 7 days after plating.
[0219] To split neurosphere cultures, neurospheres were collected
by centrifugation at 160.times.g for 5 min. The neurospheres were
resuspended in 0.5 ml Trypsin/EDTA in HBSS (1.times.), incubated at
37.degree. C. for 2 min and triturated gently to aid dissociation.
Following a further 3 min incubation at 37.degree. C. and
trituration, 3 volumes of ice cold NSPH-media-EGF were added to
stop further trypsin activity. The cells were pelleted at
220.times.g for 4 min, resuspended in fresh Neurosphere medium
supplemented with 20 ng/ml EGF and 1 nM bFGF plated out and
incubated at 37.degree. C.
[0220] Chemicals for dissociation of tissue; Trypsin, Hyaluronidase
and DNase were from SIGMA. Medium (DMEM 4,5 mg/ml glucose, and
DMEM/F12), B27 supplement and Trypsin/EDTA were from GIBCO. All
plastic ware were purchased from CorningCostar. EGF for cell
cultures was from BD Biosciences.
[0221] Where stated, a minimal Neurosphere medium was used
containing BIT supplement in place of B27 supplement.
[0222] Intracellular ATP Assay
[0223] Intracellular ATP levels have previously been shown to
correlate to cell number (Crouch, Kozlowski et al. 1993). Mouse
neurospheres, cultured as described above, from passage 2, were
seeded in DMEM/F12 supplemented with B27 into a 96-well plate as
single cells (10000 cells/well) to the substances to be measured
were added at the concentrations indicated. After 3 days
incubation, intracellular ATP was measured using the ViaLight kit
(BioWhittaker) according to the manufacturer's instructions. S1P
and LPA were purchased from Avanti Polar Lipids, Inc.
[0224] In assays including pertussis toxin, the toxin was added at
100 ng/ml 24 hours prior to the second passaging. New toxin was
added at the same dose in combination with S1P or LPA to the cells
and assayed as decribed above.
[0225] In the experiment analysing the combinatory effect of S1P
and EGF, S1P at 100 nM was co-incubated with 0.1 nM EGF for 3
days.
[0226] Thymidine Incorporation
[0227] To determine thymidine incorporation into DNA, neurospheres
were split and seeded in Neurosphere medium as single cells in
96-well plates, 10 000 cells/well. Substances to be measured were
added in quadruplicates and cells were incubated at 37.degree. C.
for 3 days. 3H-thymidine, 10 uCi/ml, was present the last 24 hours.
Cells were harvested on to a filter paper and radioactivity was
measured. 3H-thymidine (6,7 Ci/mmol) was from PerkinElmer.
[0228] Results
[0229] S1P Stimulates Adult Mouse NSC Proliferation in Vitro
[0230] To determine the effect of S1P on neural stem cells in
culture, mouse adult neural stem cells derived from the lateral
ventricle wall of the brain, expanded in EGF as neurospheres
followed by enzymatic dissociation using trypsin, were cultured in
Neurosphere medium supplemented with varying concentrations of S1P,
under non-adherent conditions, for 3 days. To ascertain whether
there was an increase in cell number of S1P treated cells relative
to control cells, an assay measuring intracellular ATP levels,
shown previously to correlate with cell number (Crouch, Kozlowski
et al. 1993), was employed. FIG. 4A shows a statistically
significant increase in intracellular ATP levels, and hence cell
number, in response to S1P at nanomolar (1-100 nM) concentrations.
To ascertain whether the effect of S1P is through proliferation,
incorporation of tritiated thymidine was used to assess DNA
synthesis in NSC. Greater incorporation of tritiated thymidine was
observed with S1P between 1-100 nM concentrations relative to
control, indicating that S1P is eliciting a proliferating response
in NSC under non-adherent conditions (FIG. 4B). The increase in
cell number, however, does not rule out an additional survival
effect of S1P on NSC. Data shown in FIG. 4 are from experiments
performed in sextuplicate (A) and octuplicate (B). Bars represent
.+-.SEM. Levels of significance of increases above control were
determined by a paired Student t test; * P<0.05, **
P<0.005.
[0231] LPA Stimulates Adult Mouse NSC Proliferation in Vitro
[0232] To determine the effect of LPA on neural stem cells in
culture, mouse adult neural stem cells derived from the lateral
ventricle wall of the brain, expanded in EGF as neurospheres
followed by enzymatic dissociation using trypsin, were cultured in
Neurosphere medium supplemented with varying concentrations of LPA,
under non-adherent conditions, for 3 days. To ascertain whether
there was an increase in cell number of LPA treated cells relative
to control cells, an assay measuring intracellular ATP levels,
shown previously to correlate with cell number (Crouch, Kozlowski
et al. 1993), was employed. FIG. 5A shows statistically significant
increases in intracellular ATP levels, and hence cell number, in
response to LPA, but that this response is entirely dependent on
the concentration of LPA. The concentration dependent effect of LPA
on NSC can be divided into two distinct phases, one at low
concentration (1-10 nM), and the other at higher concentrations
(0,11-10 .mu.M). This biphasic response could teflect the nature of
the ligand, signalling through the receptors at low concentration
and functioning as an intracellular signalling molecule, after
diffusing through the cell plasma membrane at higher
concentration.
[0233] To ascertain whether the effect of LPA is through
proliferation, incorporation of tritiated thymidine was used to
assess DNA synthesis in NSC. Greater incorporation of tritiated
thymidine was observed with LPA at 4 nM and 10 .mu.M concentrations
relative to control, however, no significant incorporation occurred
at 10 nM (FIG. 5B).
[0234] Data shown in FIG. 5 are from experiments performed in
sextuplicate (A) and octuplicate (B). Bars represent .+-.SEM.
Levels of significance of increases above control were determined
by a paired Student t test; * P<0.05, ** P<0.005.
[0235] The Proliferating Effect of S1P on NSC is Mediated Through G
Protein-Coupled Receptors
[0236] Five high affinity receptors for S1P have been described,
EDG1, EDG3, EDG5, EDG6 and EDG8, within the EDG family, which in
turn is categorised within the G protein-coupled receptor (GPCR)
superfamily (Pyne and Pyne 2000). Pertussis toxin (PTX)
specifically inactivates G.sub.i and G.sub.o proteins by
ADP-ribosylation of .alpha.i subunit, uncoupling the GPCRs from
their effector mechanisms. Mitogenic effects of S1P interaction
with its receptors have previously been shown to be inhibited by
PTX (Goetzl, Dolezalova et al. 1999; An, Zheng et al. 2000; Pyne
and Pyne 2000; Yamazaki, Kon et al. 2000; Kluk and Hla 2001).
[0237] To investigate whether PTX abolishes the proliferating
effect of S1P on NSC, incorporation of 3-H thymidine was assayed.
PTX completely inhibited the proliferating effect of S1P at both
low and high doses (FIG. 6). These data indicate that S1P's
proliferating effect is mediated through GPCRs coupled to G.sub.i
and G.sub.o proteins, a criteria fulfilled by S1P's receptors.
[0238] Data shown are from experiments performed in octuplicate.
Bars represent.+-.SEM. Levels of significance of increases above
control were determined by a paired Student t test; *
P<0.06.
[0239] The Proliferating Effect of LPA on NSC is Mediated Through G
Protein-Coupled Receptors at Low Concentration
[0240] Three high affinity receptors for LPA have been described,
EDG2, EDG4 and EDG7, within the EDG family, which in turn is
categorised within the G protein-coupled receptor (GPCR)
superfamily (Fukushima and Chun 2001). Pertussis toxin (PTX)
specifically inactivates G.sub.i and G.sub.o proteins by
ADP-ribosylation of (i subunit, uncoupling the GPCRs from their
effector mechanisms. Mitogenic effects of LPA interaction with its
receptors have previously been shown to be inhibited by PTX
(Goetzl, Dolezalova et al. 1999; Grey, Banovic et al. 2001).
[0241] To investigate whether PTX abolishes the proliferating
effect of LPA on NSC, incorporation of 3-H thymidine was assayed.
PTX abolished the proliferating effect of LPA at low concentration
(4 nM), however, at high concentration (10 .mu.M) PTX had no
significant inhibitory effect (FIG. 7). These data indicate that
LPA's proliferating effect at low concentration is mediated through
GPCRs coupled to G.sub.i and G.sub.o proteins, a criteria fulfilled
by LPA's receptors. At high LPA concentration, proliferation of NSC
appears to be, at least partly, a non-GPCR mediated event. This
conclusion is not at odds with the hypothesis that at high
concentration the dominant effect of LPA is as an intracellular
signalling molecule rather than a ligand of the EDG receptors.
Alternatively, the effect of LPA could be as a consequence of
altered membrane fluidity, or functioning as a modulator of
ligand/hormone affinity for their receptors (eg nuclear
receptor).
[0242] Data shown are from experiments performed in octuplicate.
Bars represent .+-.SEM. Levels of significance relative to control
(*), or level of significance comparing PTX with and without LPA
(#) were determined by a paired Student t test; * P<0.05; #
P<0.05.
[0243] S1P and EGF Synergistically Proliferate Adult Mouse NSC in
Vitro
[0244] NSC were treated with S1P, EGF or a combination of the two.
While either of the two factors alone increased intracellular ATP
levels, and hence NSC number, when combined, there was a further
elevation the values of which are indicative of a synergistic
effect between the two factors (FIG. 8). Data shown are from
experiments performed in quadruplet. Bars represent.+-.SEM. Levels
of significance of increases above control were determined by a
paired Student t test; * P<0.05.
[0245] LPA Stimulates Primary Adult Mouse NSC to Proliferate,
Forming Neurospheres, in the Absence of Growth Factors
[0246] Anterior lateral wall of the lateral ventricle was
dissociated as described in the Methods above (Method A), and the
cells resuspended in Neurosphere medium without EGF. The cell
suspension was divided into a 24-well plate with triplicates of
control (no addition), LPA treated and EGF (1 nM) treated cells.
The final concentration of LPA was 10 EM. After 7 days the spheres
were counted, inspected for growth and morphology and photographed
using a Nikon Eclipse TE300 microscope and Nikon Spot Insight
camera. FIG. 9 shows NSC treated with LPA growing in a neurosphere
formation, the sizes and number of which were observably greater
than that of the control.
Example 4
S1P Increases the Number of New-Born Cells in the Caudate Putamen
of Adult Rats
Methods
[0247] Animals
[0248] Arrival of animals: 06.1102 (30 animals), 13.11.02 (30
animals) and 20.11.02 (10 animals): Male Wistar rats, ca.270 g,
Harlan-Winkelmann Germany;
[0249] Animal housing: 12 hours light /dark regime; feeding:
standard pellets; feeding and drinking ad libitum; 5 animals in
standard cage (Macrolon typeM4)
[0250] Preparation of Pump
[0251] Brain infusion kit II; Alzet osmotic mini-pump model 2002
(volume of pump: 200 .mu.l, plus ca. 30-50 .mu.l volume in
tubing/flow-moderator; pumping rate: 0.5 .mu.l/h (=12 .mu./d) for
14 days; vehicle solution aCSF (artificial cerebrospinal fluid: 148
mM NaCl, 3 mM KCl, 1.4 mM CaCl.sub.2, 0.8 mM MgCl.sub.2, 1.5 mM
Na.sub.2HPO.sub.4, 0.2 mM NaH.sub.2PO.sub.4, pH 7.4, steril
filtration; stored at -20.degree. C.
[0252] Handling of Substances:
2 group cmp stock in vitro no provided as compound stock in conc,
mM EC50, nM 1 solid S1P DMSO 10 30 2 n.a. control 2/0, n.a. 1% DMSO
final pump Mol stock pump conc, microM weight solution prep
solution prep compound 10 379 1 mg/0.264 ml S1P S1P provided as 1
mg solid, dissolved in DMSO, aliquoted and ketp in freeser, thawed
and added aCSF to make pump solution, 0.1% DMSO maximum.
[0253] Before filling pump the following was added: 50 .mu.g/ml
Gentamycin (Sigma) and BrdU (1 mg/BrdU/ml) at 37.degree. C. and
ultra-sonication, pump filled with 200 .mu.l of aforementioned
solution, connected via tubing to flow moderator (also filled with
aforementioned solution); put in NaCl (0.9%) solution in water bath
(37.degree. C.) for 2-5 hrs before implantation (note time
point).
[0254] For control animals pumps were filled with vehicle only
(vehicle I: aCSF/Gentamycin/BrdU; vehicle II:
aCSF/Gentamycin/BrdU/DMSO0.1%).
[0255] Operation:
[0256] Starting in week 48/2002; narcosis (inhalation) initially:
halothane (4%) in 02/N20 (50:50); animals fixed in stoelting
stereotaxic frame, halothane adapted to 2-3%; cut skin and remove
from skull; left posterior quadrant of skull: drill hole for screw
(not touching dura); drill hole for cannula: 0.08 cm posterior to
bregma; 0.17 cm lateral from satura sagittalis; insertion of
canula: 0.45 cm below skull; fixation with dental cement (Paladur).
Length of tubing: ca 10 cm. Storage of pump subcutaneously in
midscapular region.
[0257] Animals put in cage (one animal/cage: Macrolon typeM3) and
after recovery from anaesthesia back to animal housing.
[0258] Removal of Pumps:
[0259] 14 days after insertion of pump: anaesthesia of animals with
halothane (initially: 4%; operation performed at 2.0 -2.5%) in
N.sub.2O/O.sub.2 (50:50). Opening of suture. Cut tubing, removal of
pump. Note time point of removal and suck rest of solution out of
pump with syringe.
[0260] Decapitation:
[0261] Narcosis of animals with chloralhydrate (4 g/100 ml; 6
ml/animal); transcardial perfusion with NaCl for ca 3-5 minutes (ca
60 ml); perfusion with paraformaldehyd (4%) solution (3-5 min, ca
60 ml), decapitation; removal of brain stored in paraformaldehyd
(4%) solution over night; transfer in 30% sucrose solution (in
refrigerator) until brain sinks to bottom (ca. 3 days); freezing
via -80.degree. C. Methylbutan and storage in -80.degree. C.
freezer. Mark contralateral side with a notch
[0262] Treatment:
[0263] (randomized, placebo-controlled)
[0264] group 1: BrdU/aCSF/Gentamycin/DMSO0.1%/SlP; 10 .mu.M (0.12
nmol/d; 8 animals)
[0265] group 2: control-BrdU/aCSF/Gentamycin/DMSO 0.1% (12
animals)
[0266] decapitation 14 days after insertion of pump
[0267] Slicing:
[0268] Cutting of rest of brain coronally 40 .mu.m, (free floating)
until level where ventricle is fully developed (bregma +0.7-0.5 mm
(first signs of ventricle approximately +1.6 -1.2 mm) slices
between bregma +2.7 mm and ca. +0.7 mm will be lost). 10 slices
will be taken in 4 tubes with CPS (250 ml Ethylenglycol, 250 ml
Glycerol, PBS ad 1000 ml); (cannula track can not be checked. Store
at 4.degree. C.
[0269] Immunohistochemistry:
[0270] DAB (diaminobenzidine) staining:
[0271] (with two slices: one from beginning, one from end of
slice-collection)
[0272] slices in PBS 0.1M
[0273] inactivate endogenous peroxidase for 30 min(solution freshly
prepared):
[0274] 50% Methanol
[0275] 50% PBS 0.1M
[0276] 3% H.sub.2O.sub.2
[0277] washing in PBS: 3.times.5 min
[0278] washing in PBS: 3.times.5 min
[0279] incubation in 2N HCl for 30 min (37.degree. C.)
[0280] washing in PBS: 4.times.5 min
[0281] Incubation in blocking-serum for 60 min at RT:
[0282] 300 .mu.l donkey normal serum (DNS)
[0283] 2700 .mu.l PBS 0.1 M/TritonX100 0.5%
[0284] primary antibody at 4.degree. C. over night: incubation with
rat anti BrdU (1:500):
[0285] 988 .mu.l PBS 0.1M
[0286] 10 .mu.l DNS
[0287] 2 .mu.l rat anti BrdU
[0288] washing in PBS: 3.times.10 min
[0289] secondary antibody for 1 h at RT (prepared 30 min before
using)
[0290] 988 .mu.l PBS 0.1M
[0291] 2 .mu.l donkey anti rat biotinylated
[0292] washing in PBS: 3.times.5 min
[0293] incubation with Vector Elite Kit 1 h at RT (prepared 30 min
before using)
[0294] 4000 .mu.l PBS 0.1M
[0295] 10 .mu.l sol. A
[0296] 10 .mu.l sol. B
[0297] washing in PBS: 3.times.5min
[0298] Incubation for ca 5-10 min in:
[0299] 5 mg DAB
[0300] 10 ml PBS 0.1M
[0301] 2 .mu.l H.sub.2O.sub.2 (30%)
[0302] washing in PBS: 3.times.5 min
[0303] microscope slide, drying, EtOH, Xylol, glascoverslips
[0304] Quantification:
[0305] Quantification in ipsilateral hemisphere: two slices (see
point "Immunohistochemistry") counting 2.times.one box
(0.25mm.sup.2) in caudate putamen on each section.
[0306] Results
[0307] S1P Increases the Number of New Born Cells in the Caudate
Putamen
[0308] S1P (10 .mu.M pump concentration) or vehicle, and BrdU (1
mg/ml pump concentration) was infused into the lateral ventricle of
adult male Wistar rats at a rate of 0.5 .mu.g/hr for 14 days. BrdU
incorporation into the nuclei of dividing cells is a standard
method of labeling proliferating populations of cells, and has
become a well used marker for dividing stem cells and their progeny
(Zhang, Zhang et al. 2001). BrdU incorporated into the nuclei of
proliferating cells was detected by DAB-immunohistochemistry.
Coronal sections through the caudate putamen showed BrdU labeling
of a substantially greater number of cells in S1P treated rats
relative to rats treated with vehicle. For quantification (FIG.
10), sections were taken in duplicate for each animal and counted
manually (see above Methods). Results are expressed as the mean
.+-.SEM number of BrdU positive cells/0.25 mm, (S1P n=8) (Vehicle
n=12) (**p<0.005 relative to Vehicle). The quantitative data
show a significant increase in the number new born cells in the
caudate putamen upon S1P treatment relative to vehicle.
Example 5
Biopolymer Sequences
[0309] The DNA and protein sequences referenced in this patent are
as listed below.
3 GenBank Accession Number Description A. EDG1 Locus Link ID: 1901
(human); 13609 (mouse) NM_001400 Homo sapiens endothelial
differentiation, sphingolipid G-protein-coupled receptor, 1, mRNA
(EDG1) NM_007901 Mus musculus endothelial differentiation,
sphingolipid G-protein-coupled receptor, 1, mRNA (Edg1) NP_001391
Homo sapiens endothelial differentiation, sphingolipid
G-protein-coupled receptor, 1, (EDG1) NP_031927 Mus musculus
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 1, (Edg1) B. EDG2 Locus Link ID: 1902 (human); 14745
(mouse) NM_001401 Homo sapiens endothelial differentiation,
NM_057159 sphingolipid G-protein-coupled receptor, 2, mRNA (EDG2)
NM_010336 Mus musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 2, mRNA (Edg2) NP_001392 Homo sapiens
endothelial differentiation, NP_476500 sphingolipid
G-protein-coupled receptor, 2, (EDG2) NP_14745 Mus musculus
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 2, (Edg2) C. EDG3 Locus Link ID: 1903 (human); 13610
(mouse) NM_005226 Homo sapiens endothelial differentiation,
sphingolipid G-protein-coupled receptor, 3, mRNA (EDG3) NM_010101
Mus musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 3, mRNA (Edg3) NP_005217 Homo sapiens
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 3, (EDG3) NP_034231 Mus musculus endothelial
differentiation, sphingolipid G-protein-coupled receptor, 3, (Edg3)
D. EDG4 Locus Link ID: 9170 (human); 53978 (mouse) NM_004720 Homo
sapiens endothelial differentiation, sphingolipid G-protein-coupled
receptor, 4, mRNA (EDG4) NM_020028 Mus musculus endothelial
differentiation, sphingolipid G-protein-coupled receptor, 4, mRNA
(Edg4) NP_004711 Homo sapiens endothelial differentiation,
sphingolipid G-protein-coupled receptor, 4, (EDG4) NP_064412 Mus
musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 4, (Edg4) E. EDG5 Locus Link ID: 9294
(human); 14739 (mouse) NM_004230 Homo sapiens endothelial
differentiation, sphingolipid G-protein-coupled receptor, 5, mRNA
(EDG5) XM_134731 Mus musculus endothelial differentiation,
sphingolipid G-protein-coupled receptor, 5, mRNA (Edg5) NP_004221
Homo sapiens endothelial differentiation, sphingolipid
G-protein-coupled receptor, 5, (EDG5) XP_134731 Mus musculus
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 5, (Edg5) F. EDG6 Locus Link ID: 8698 (human); 13611
(mouse) NM_003775 Homo sapiens endothelial differentiation,
sphingolipid G-protein-coupled receptor, 6, mRNA (EDG6) NM_010102
Mus musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 6, mRNA (Edg6) NP_003766 Homo sapiens
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 6, (EDG6) NP_034232 Mus musculus endothelial
differentiation, sphingolipid G-protein-coupled receptor, 6, (Edg6)
G. EDG7 Locus Link ID: 23566 (human); 65086 (mouse) NM_012152 Homo
sapiens endothelial differentiation, sphingolipid G-protein-coupled
receptor, 7, mRNA (EDG7) NM_022983 Mus musculus endothelial
differentiation, sphingolipid G-protein-coupled receptor, 7, mRNA
(Edg7) NP_036284 Homo sapiens endothelial differentiation,
sphingolipid G-protein-coupled receptor, 7, (EDG7) NP_075359 Mus
musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 7, (Edg7) Splice Variant Fitzgerald L
R, Dytko G M, Sarau H M, Mannan I J, Ellis C, Lane P A, Tan K B,
Murdock P R, Wilson S, Bergsma D J, Ames R S, Foley J J, Campbell D
A, McMillan L, Evans N, Elshourbagy N A, Minehart H, Tsui P.
Identification of an EDG7 variant, HOFNH30, a G-protein-coupled
receptor for lysophosphatidic acid. Biochem Biophys Res Commun.
2000 Jul 14; 273(3): 805-10. H. EDG8 Locus Link ID: 53637 (human);
94226 (mouse) NM_030760 Homo sapiens endothelial differentiation,
sphingolipid G-protein-coupled receptor, 8, mRNA (EDG8) NM_053190
Mus musculus endothelial differentiation, sphingolipid
G-protein-coupled receptor, 8, mRNA (Edg8) NP_110387 Homo sapiens
endothelial differentiation, sphingolipid G-protein-coupled
receptor, 8, (EDG8) NP_444420 Mus musculus endothelial
differentiation, sphingolipid G-protein-coupled receptor, 8,
(Edg8)
[0310] References:
[0311] Altman, J. and G. Das (1965). "Autoradiographic and
histological evidence of postnatal hippocampal neurogenesis in
rats." J Comp Neurol 124: 319-335.
[0312] Altman, J. and G. Das (1967). "Postnatal neurogenesis in the
guinea-pig." Nature 214: 1098-1101.
[0313] An, S., T. Bleu, et al. (1998). "Characterization of a novel
subtype of human G protein-coupled receptor for lysophosphatidic
acid." J Biol Chem 273(14): 7906-10.
[0314] An, S., T. Bleu, et al. (1997). "Identification of cDNAs
encoding two G proteiri-coupled receptors for lysosphingolipids."
FEBS Lett 417(3): 279-82.
[0315] An, S., Y. Zheng, et al. (2000). "Sphingosine
1-phosphate-induced cell proliferation, survival, and related
signaling events mediated by G protein-coupled receptors Edg3 and
Edg5." J Biol Chem 275(1): 288-96.
[0316] Aoki, J., K. Bandoh, et al. (2000). "A novel human
G-protein-coupled receptor, EDG7, for lysophosphatidic acid with
unsaturated fatty-acid moiety." Ann NY Acad Sci 905: 263-6.
[0317] Bayer, S. A. (1986). "Neurogenesis in the rat primary
olfactory cortex." Int J Dev Neurosci 4(3): 251-71.
[0318] Bernier, P. J., A. Bedard, et al. (2002). "Newly generated
neurons in the amygdala and adjoining cortex of adult primates."
Proc Natl Acad Sci USA 99(17): 11464-9.
[0319] Biebl, M., C. M. Cooper, et al. (2000). "Analysis of
neurogenesis and programmed cell death reveals a self-renewing
capacity in the adult rat brain." Neurosci Lett 291(1): 17-20.
[0320] Bjorklund, A. and 0. Lindvall (2000). "Cell replacement
therapies for central nervous system disorders." Nat Neurosci 3(6):
537-44.
[0321] Contos, J. J., N. Fukushima, et al. (2000). "Requirement for
the IpA1 lysophosphatidic acid receptor gene in normal suckling
behavior." Proc Natl Acad Sci USA 97(24): 13384-9.
[0322] Craig, C. G., V. Tropepe, et al. (1996). "In vivo growth
factor expansion of endogenous subependymal neural precursor cell
populations in the adult mouse brain." J Neurosci 16(8):
2649-58.
[0323] Crouch, S. P., R. Kozlowski, et al. (1993). "The use of ATP
bioluminescence as a measure of cell proliferation and
cytotoxicity." J Immunol Methods 160(1): 81-8.
[0324] Doetsch, F., I. Caille, et al. (1999). "Subventricular zone
astrocytes are neural stem cells in the adult mammalian brain."
Cell 97(6): 703-16.
[0325] Fukushima, N. and J. Chun (2001). "The LPA receptors."
Prostailandins 64(1-4): 21-32.
[0326] Gage, F. H., G. Kempermann, et al. (1998). "Multipotent
progenitor cells in the adult dentate gyrus." J Neurobiol 36(2):
249-66.
[0327] Goetzl, E. J. and S. An (1998). "Diversity of cellular
receptors and functions for the lysophospholipid growth factors
lysophosphatidic acid and sphingosine 1-phosphate." Faseb J 12(15):
1589-98.
[0328] Goetzl, E. J., H. Dolezalova, et al. (1999). "Dual
mechanisms for lysophospholipid induction of proliferation of human
breast carcinoma cells." Cancer Res 59(18): 4732-7.
[0329] Graler, M. H., G. Bernhardt, et al. (1998). "EDG6, a novel
G-protein-coupled receptor related to receptors for bioactive
lysophospholipids, is specifically expressed in lymphoid tissue."
Genomics 53(2): 164-9.
[0330] Grey, A., T. Banovic, et al. (200 1). "Lysophosphatidic acid
is an osteoblast mitogen whose proliferative actions involve G(i)
proteins and protein kinase C, but not P42/44 mitogen-activated
protein kinases." Endocrinology 142(3): 1098-106.
[0331] Hecht, J. H., J. A. Weiner, et al. (1996). "Ventricular zone
gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed
in neurogenic regions of the developing cerebral cortex." J Cell
Biol 135(4): 1071-83.
[0332] Herman, J. P. and N. D. Abrous (1994). "Dopaminergic neural
grafts after fifteen years: results and perspectives." Prog
Neurobiol 44(1): 1-35.
[0333] Hla, T. and T. Maciag (1990). "An abundant transcript
induced in differentiating human endothelial cells encodes a
polypeptide with structural similarities to G-protein-coupled
receptors." J Biol Chem 265(16): 9308-13.
[0334] Im, D. S., C. E. Heise, et al. (2000). "Characterization of
a novel sphingosine 1-phosphate receptor, Edg-8." J Biol Chem
275(19): 14281-6.
[0335] Jacobson, M. (1991). Histosenesis and morphogenesis of
cortical structures. Developmental Neurobiology, Plenum Press, New
York: 401-451.
[0336] Jalink, K., T. Eichholtz, et al. (1993). "Lysophosphatidic
acid induces neuronal shape changes via a novel, receptor-mediated
signaling pathway: similarity to thrombin action." Cell Growth
Differ 4(4): 247-55.
[0337] Johansson, C. B., S. Momma, et al. (1999). "Identification
of a neural stem cell in the adult mammalian central nervous
system." Cell 96(1): 25-34.
[0338] Johansson, C. B., M. Svensson, et al. (1999). "Neural stem
cells in the adult human brain."Exp Cell Res 253(2): 733-6.
[0339] Johe, K. K., T. G. Hazel, et al. (1996). "Single factors
direct the differentiation of stem cells from the fetal and adult
central nervous system." Genes Dev 10(24): 3129-40.
[0340] Kiuk, M. J. and T. Hla (2001). "Role of the sphingosine 1
-phosphate receptor EDG-1 in vascular smooth muscle cell
proliferation and migration." Circ Res 89(6): 496-502.
[0341] Kuhn, H. G. and C. N. Svendsen (1999). "Origins, functions,
and potential of adult neural stem cells." Bioessays 21(8):
625-30.
[0342] Kuhn, H. G., J. Winkler, et al. (1997). "Epidermal growth
factor and fibroblast growth factor-2 have different effects on
neural progenitors in the adult rat brain." J Neurosci 17(15):
5820-9.
[0343] Lee, M. J., J. R. Van Brocklyn, et al. (1998).
"Sphingosine-1-phosphate as a ligand for the G protein-coupled
receptor EDG-1." Science 279(5356): 1552-5.
[0344] Lois, C. and A. Alvarez-Buylla (1993). "Proliferating
subventricular zone cells in the adult mammalian forebrain can
differentiate into neurons and glia." Proc Natl Acad Sci USA 90(5):
2074-7.
[0345] Magavi, S. S., B. R. Leavitt, et al. (2000). "Induction of
neurogenesis in the neocortex of adult mice [see comments]." Nature
405(6789): 951-5.
[0346] McGiffert, C., J. J. Contos, et al. (2002). "Embryonic brain
expression analysis of lysophospholipid receptor genes suggests
roles for s1p(1) in neurogenesis and s1p(1-3) in angiogenesis."
FEBS Lett 531(1): 103-8.
[0347] McKay, R. (1997). "Stem cells in the central nervous
system." Science 276(5309): 66-71.
[0348] Momma, S., C. B. Johansson, et al. (2000). "Get to know your
stem cells." Curr Opin Neurobiol 10(1): 45-9.
[0349] Palmer, T. D., E. A. Markakis, et al. (1999). "Fibroblast
growth factor-2 activates a latent neurogenic program in neural
stem cells from diverse regions of the adult CNS." J Neurosci
19(19): 8487-97.
[0350] Pebay, A., M. Toutant, et al. (2001).
"Sphingosine-l-phosphate induces proliferation of astrocytes:
regulation by intracellular signalling cascades." Fur J Neurosci
13(12): 2067-76.
[0351] Pencea, V., K. D. Bingaman, et al. (2001). "Infusion of
Brain-Derived Neurotrophic Factor into the Lateral Ventricle of the
Adult Rat Leads to New Neurons in the Parenchyma of the Striatum,
Septum, Thalamus, and Hypothalamus." J Neurosci 21(17):
6706-17.
[0352] Postma, F. R., K. Jalink, et al. (1996).
"Sphingosine-l-phosphate rapidly induces Rho-dependent neurite
retraction: action through a specific cell surface receptor." Embo
J 15(10): 2388-92.
[0353] Pyne, S. and N. Pyne (2000). "Sphingosine I-phosphate
signalling via the endothelial differentiation gene family of
G-protein-coupled receptors." Pharmacol Ther 88(2): 115-31.
[0354] Pyne, S. and N. J. Pyne (2000). "Sphingosine 1-phosphate
signalling in mammalian cells." Biochem J 349(Pt 2): 385-402.
[0355] Rajan, P. and R. D. McKay (1998). "Multiple routes to
astrocytic differentiation in the CNS." J Neurosci 18(10):
3620-9.
[0356] Rius, R. A., L. C. Edsall, et al. (1997). "Activation of
sphingosine kinase in pheochromocytoma PC12 neuronal cells in
response to trophic factors." FEBS Lett 417(2): 173-6.
[0357] Sautin, Y. Y., M. Jorgensen, et al. (2002). "Hepatic oval
(stem) cell expression of endothelial differentiation gene
receptors for lysophosphatidic acid in mouse chronic liver injury."
J Hematotber Stem Cell Res 11(4): 643-9.
[0358] Snyder, E. Y., C. Yoon, et al. (1997). "Multipotent neural
precursors can differentiate toward replacement of neurons
undergoing targeted apoptotic degeneration in adult mouse
neocortex." Proc Natl Acad Sci USA 94(21): 11663-8.
[0359] Tigyi, G., D. L. Dyer, et al. (1994). "Lysophosphatidic acid
possesses dual action in cell proliferation." Proc Natl Acad Sci
USA 91(5): 1908-12.
[0360] Weiner, J. A., J. H. Hecht, et al. (1998). "Lysophosphatidic
acid receptor gene vzg-1/1pA1/edg-2 is expressed by mature
oligodendrocytes during myelination in the postnatal murine brain."
J Comp Neurol 398(4): 587-98.
[0361] Williams, B. P., J. K. Park, et al. (1997). "A
PDGF-regulated immediate early gene response initiates neuronal
differentiation in ventricular zone progenitor cells." Neuron
18(4): 553-62.
[0362] Yamazaki, Y., J. Kon, et al. (2000). "Edg-6 as a putative
sphingosine 1-phosphate receptor coupling to Ca(2+) signaling
pathway." Biochem Biophys Res Commun 268(2): 583-9.
[0363] Zhang, R. L., Z. G. Zhang, et al. (2001). "Proliferation and
differentiation of progenitor cells in the cortex and the
subventricular zone in the adult rat after focal cerebral
ischemia." Neuroscience 105(1): 33-41.
[0364] Zwick, E., P. O. Hackel, et al. (1999). "The EGF receptor as
central transducer of heterologous signalling systems." Trends
Pharmacol Sci 20(10): 408-12.
* * * * *