U.S. patent application number 10/384171 was filed with the patent office on 2004-01-22 for molecularly cloned acquired immunodeficiency syndrome polypeptides and their methods of use.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Berman, Phillip W., Capon, Daniel J., Lasky, Laurence A..
Application Number | 20040014172 10/384171 |
Document ID | / |
Family ID | 27574876 |
Filed Date | 2004-01-22 |
United States Patent
Application |
20040014172 |
Kind Code |
A1 |
Berman, Phillip W. ; et
al. |
January 22, 2004 |
Molecularly cloned acquired immunodeficiency syndrome polypeptides
and their methods of use
Abstract
Diagnostic product and vaccine for Acquired Immuno-deficiency
Syndrome (AIDS) and methods for making and using same, wherein
viral polypeptide sequences from an AIDS associated retrovirus are
expressed directly or as a fusion polypeptide in a prokaryotic or
mammalian cell expression host to produce a diagnostic product
which specifically binds complementary antibody produced by
individuals afflicted with AIDS or a vaccine against AIDS which
confers resistance to infection by AIDS associated retrovirus. The
reverse transcriptase of an AIDS associated retrovirus is used
separately or in a whole cell assay to identify compounds which
selectively inhibit retroviral reverse transcriptase.
Inventors: |
Berman, Phillip W.; (Portola
Valley, CA) ; Capon, Daniel J.; (San Mateo, CA)
; Lasky, Laurence A.; (San Francisco, CA) |
Correspondence
Address: |
QUINE INTELLECTUAL PROPERTY LAW GROUP, P.C.
P O BOX 458
ALAMEDA
CA
94501
US
|
Assignee: |
Genentech, Inc.
1 DNA Way
South San Francisco
CA
94080
|
Family ID: |
27574876 |
Appl. No.: |
10/384171 |
Filed: |
March 7, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10384171 |
Mar 7, 2003 |
|
|
|
09547692 |
Apr 12, 2000 |
|
|
|
6534285 |
|
|
|
|
09547692 |
Apr 12, 2000 |
|
|
|
09124596 |
Jul 29, 1998 |
|
|
|
09124596 |
Jul 29, 1998 |
|
|
|
08282857 |
Jul 29, 1994 |
|
|
|
5853978 |
|
|
|
|
08282857 |
Jul 29, 1994 |
|
|
|
08129009 |
Sep 29, 1993 |
|
|
|
08129009 |
Sep 29, 1993 |
|
|
|
07979391 |
Nov 19, 1992 |
|
|
|
07979391 |
Nov 19, 1992 |
|
|
|
07227568 |
Aug 2, 1988 |
|
|
|
07227568 |
Aug 2, 1988 |
|
|
|
06861016 |
May 8, 1986 |
|
|
|
06861016 |
May 8, 1986 |
|
|
|
06805069 |
Dec 4, 1985 |
|
|
|
06805069 |
Dec 4, 1985 |
|
|
|
06685272 |
Dec 24, 1984 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
424/184.1; 435/5 |
Current CPC
Class: |
C07K 2319/02 20130101;
C12N 15/62 20130101; C12N 2740/16122 20130101; C07K 14/005
20130101; C12N 2740/16222 20130101; A61K 39/00 20130101; C07K
14/245 20130101; C07K 2319/40 20130101; C12Q 1/48 20130101; C07K
2319/00 20130101 |
Class at
Publication: |
435/69.1 ;
424/184.1; 435/5 |
International
Class: |
C12P 021/06; C12Q
001/70; A61K 039/00; A61K 039/38 |
Claims
1. A composition comprising a predetermined polypeptide encoded by
the genome of an AIDS associated retrovirus which composition is
essentially free of other naturally occurring AIDS associated
polypeptides or human proteins from cells for which the
AID-associated retrovirus is naturally infective, said
predetermined polypeptide sequence having at least one antigenic
determinant capable of specifically binding complementary
antibody.
2. The composition of claim 1 wherein said predetermined
polypeptide sequence is a sequence encoded by the gag region of the
genome of an AIDS associated retrovirus.
3. The composition of claim 1 wherein said predetermined
polypeptide sequence is a fusion of the AIDS associated retroviral
polypeptide with a viral or bacterial polypeptide.
4. The composition of claim 1 wherein said predetermined
polypeptide sequence is derived from a sequence encoded by the env
region of the genome of an AIDS associated retrovirus.
5. The composition of claim 1 wherein said predetermined
polypeptide sequence is from gp-41, gp-65 or gp-120.
6. The composition of claim 1 wherein a normally glycosylated
predetermined polypeptide sequence of an AIDS associated retrovirus
is not glycosylated.
7. The composition of claim 1 wherein said predetermined
polypeptide sequence contains methionine or formylemethionine at
the N-terminus.
8. A process comprising isolating a predetermined Polypeptide
sequence of an AIDS associated retrovirus from a prokaryotic or
mammalian recombinant expression host containing DNA sequence
encoding said predetermined polypeptide sequence, wherein the
isolated predetermined polypeptide sequence contains at least one
antigenic determinant capable of specifically binding complementary
antibody.
9. The polypeptide product made by the process of claim 8.
10. A composition comprising a predetermined fragment of a
predetermined polypeptide sequence of an AIDS associated
retrovirus, said fragment containing at least one antigenic
determinant capable of specifically binding complementary
antibody.
11. The composition of claim 10 essentially free of other AIDS
associated viral polypeptides.
12. The composition of claim 10 wherein said polypeptide fragment
is the N-terminal sequence of a predetermined polypeptide sequence
of an AIDS associated retrovirus.
13. The composition of claim 10 wherein said polypeptide fragment
is the C-terminal sequence of a predetermined polypeptide sequence
of an AIDS associated retrovirus.
14. The composition of claim 13 wherein said polypeptide fragment
is a fragment of the AIDS associated gp120 env protein.
15. The composition of claim 10 wherein said polypeptide fragment
is from a sequence encoded by the gag region of the genome of an
AIDS associated retrovirus.
16. The composition of claim 10 wherein said polypeptide fragment
is from p-24.
17. The composition of claim 10 wherein said polypeptide fragment
is from a sequence encoded by the env region of the genome of an
AIDS associated retrovirus.
18. The composition of claim 10 wherein said polypeptide fragment
is from gp-41, gp-65 or p120.
19. A fusion polypeptide comprising (a) a first predetermined
polypeptide sequence or fragment thereof, of an AIDS associated
retrovirus having at least one antigenic determinant capable of
specifically binding complementary antibody and (b) a second
polypeptide sequence which is not immunologically cross-reactive
with antibodies normally present in a biologically derived
sample--which is to be assayed for the presence of said
complementary antibody.
20. The fusion polypeptide of claim 19 wherein said predetermined
polypeptide sequence is from a sequence encoded by the gag region
of the genome of an AIDS associated retrovirus.
21. The fusion polypeptide of claim 19 wherein said predetermined
polypeptide sequence is from p-24.
22. The fusion polypeptide of claim 19 wherein said predetermined
polypeptide sequence is from a sequence encoded by the env region
of a genome of an AIDS associated retrovirus.
23. The fusion polypeptide of claim 19 wherein said predetermined
polypeptide sequence is from gp-41, gp-65 or gp-120.
24. The fusion polypeptide of claim 19 wherein the first and second
polypeptide sequences are fused.
25. The fusion polypeptide of claim 24 wherein said fusion is by a
peptide bond.
26. The fusion polypeptide of claim 19 wherein the amino terminus
of the first polypeptide sequence is fused to the carboxyl terminus
of the second polypeptide sequence.
27. A composition comprising a variant polypeptide sequence, of an
AIDS associated retrovirus containing at least one antigenic
determinant capable of specifically binding complementary antibody
to an AIDS associated retrovirus.
28. The composition of claim 27 wherein said variant polypeptide
sequence is an insertion, deletion or substitution of an amino acid
residue of a polypeptide sequence of an AIDS associated
retrovirus.
29. The composition of claim 27 wherein said variant polypeptide
sequence is a labeled or bound derivative of a polypeptide sequence
of an AIDS associated retrovirus.
30. A diagnostic test kit comprising the composition of claims 1,
10, 19 or 27.
31. The composition of claims 1, 10, 19 or 27 which is immobilized
on a solid phase.
32. The composition of claims 1, 10, 19 or 27 which is labeled with
a detectable marker.
33. A vaccine comprising the composition of claims 1, 10, 19 or 27,
wherein said polypeptide is capable of inducing the production of
neutralizing antibodies which confer resistance to infection by
AIDS associated retrovirus.
34. The vaccine of claim 33 wherein the AIDS-associated polypeptide
is a fusion with a second polypeptide and said second Polypeptide
does not normally induce antibodies which cross-react with proteins
which are naturally occurring in the subject such vaccine is
directed to.
35. The vaccine of claim 34 wherein the second polypeptide is a
trpLE fusion.
36. The vaccine of claim 33 including a pharmaceutically acceptable
vehicle.
37. A method of vaccination against AIDS comprising the
administration of the vaccine of claim 33 at a dosage level which
is effective in raising antibodies in a human subject.
38. The DNA sequence encoding the composition of claim 19 or
27.
39. The DNA sequence encoding the fusion polypeptide of claims 1 or
10 wherein said DNA sequence is essentially free of DNA
complementary to the naturally occurring flanking RNA
sequences.
40. A replicable prokaryotic or mammalian cell expression vector
containing the DNA sequence of claims 38 or 39 which is capable of
transforming a host cell to expression of an AIDS associated
polypeptide.
41. A prokaryotic or mammalian cell culture containing the
expression vector of claim 40.
42. A method for the detection of antibody contained in a test
sample comprising: a) contacting said sample with the composition
of claims 31 or 32 to bind the diagnostic product with
complementary antibody in said sample; and b) detecting the amount
bound or unbound detectable marker.
43. The method of claim 42 wherein the test sample is urine, saliva
or a blood fluid.
44. A reverse transcriptase of an AIDS associated retrovirus which
is essentially free of other AIDS associated retrovirus
proteins.
45. A cell-free DNA sequence encoding the reverse transcriptase of
claim 44.
46. A replicable expression vector containing the DNA sequence of
claim 45, said vector being capable of expressing reverse
transcriptase when contained within a transformed cell.
47. A eukaryotic cell culture containing the expression vector of
claim 46.
48. The culture of claim 47 wherein the cells are those of a
mammalian cell line.
49. An assay for identifying compounds which inhibit reverse
transcriptase of an AIDS associated retrovirus comprising: a)
reacting the reverse transcriptase of claim 44 with a compound
which is suspected to be capable of inhibiting said reverse
transcriptase; and b) measuring the level of reverse transcriptase
activity of the reaction mixture of step (a).
50. The assay of claim 49 wherein the reverse transcriptase is
presen in a transformed recombinant mammalian host cell.
51. A composition comprising an AIDS-associated retroviral E'
polypeptide, which composition is free of proteins from
AIDS-associated retrovirus infected cells that are not encoded by
the AIDS-associated retrovirus and which is free of infectious
AIDS-associated retroviral virions.
52. The composition of claim 51 wherein the E' polypeptide has a
relative molecular weight on SDS PAGE of about 28,000 or about
26,500.
53. The composition of claim 51 wherein the E' polypeptide has the
amino acid sequence of the E' polypeptide of FIG. 2 or its
naturally-occurring alleles.
54. A composition comprising an E' polypeptide which is other than
the E' polypeptide of FIG. 2 or its naturally-occurring alleles but
which is immunologically cross-reactive with the E' polypeptide of
FIG. 2 or its naturally-occurring alleles.
55. The composition of claim 51 which is a vaccine.
56. The composition of claim 51 which is sterile, comprises a
pharmaceutically-acceptable carrier, and contains the E'
polypeptide in an amount sufficient upon administration to an
animal to elicit the formation of antibodies to the E'
polypeptide.
57. The composition of claim 51 which further contains known
amounts of other predetermined AIDS-associated retroviral
polypeptides.
58. A diagnostic test kit for AIDS-associated retroviral infection
comprising the composition of claim 51.
59. The composition of claim 51 wherein the E' polypeptide is
labelled with a detectable marker.
60. The composition of claim 59 wherein the detectable marker is an
enzyme, radioisotope or fluorescent substituent.
61. The composition of claim 58 wherein the test kit comprises an
immobilized antibody capable of binding the E' polypeptide, said
antibody being in a container separate from the E' polypeptide.
62. An antibody capable of binding an AIDS-associated retroviral E'
polypeptide which is free of antibody capable of binding any other
AIDS-associated retroviral-encoded polypeptide and which is free of
bound E' polypeptide.
63. The antibody of claim 62 which is immobilized.
64. The antibody of claim 63 which is immobilized by adsorption to
a polyolefin or to antibody capable of binding the constant region
of the antibody of claim 63.
65. A method for the early determination of the presence of an
AIDS-associated retroviral infection in a test subject comprising
(a) obtaining a sample from the test subject; (b) detecting the
presence in the test sample of a polypeptide encoded by the RNA of
the AIDS-associated retrovirus which is other than a polypeptide
component of the purified AIDS-associated retrovirus virion.
66. The method of claim 65 wherein the detected polypeptide is an
E' polypeptide.
67. The method of claim 65 further comprising additionally
detecting the presence of a predetermined polypeptide component of
the AIDS-associated retrovirus virion.
68. Nucleic acid encoding an AIDS-associated retroviral E'
polypeptide free of flanking proviral sequences encoding other
complete AIDS-associated retroviral polypeptides.
69. A replicable vector comprising the nucleic acid of claim
68.
70. The nucleic acid of claim 68 which is labelled with a
detectable substituent.
Description
[0001] This application is a continuation-in-part of U.S. S. No.
06/805.069, filed Dec. 4, 1985, which in turn is a
continuation-in-part of U.S. S. No. 06/685,272, filed Dec. 24,
1984.
FIELD OF THE INVENTION
[0002] The present invention relates to immunological products
derived from molecular cloning, and to their method of use. More
particularly, this invention relates to immunological polypeptides
useful as diagnostic products and vaccines in the detection of and
vaccination against viral etiological agents of acquired
immunodeficiency syndrome. This invention also relates to
polypeptides of AIDS retrovirus reverse transcriptase and to their
method of use.
BACKGROUND OF THE INVENTION
[0003] Analysis of the immune response to a variety of viral
infectious agents has been limited by the fact that it has often
proved difficult to culture such pathogens in quantities sufficient
to permit the isolation of viral polypeptides which may be used (a)
as a diagnostic product to detect an immune response to such
pathogens or (b) as a vaccine to confer resistance to infection by
such pathogens.
[0004] The advent of molecular cloning has overcome some of these
limitations by providing a means whereby gene products from
pathogenic agents can be expressed in virtually unlimited
quantities in a non-pathogenic form.
[0005] Although antigens from the viruses for influenza (1), foot
and mouth disease (2), hepatitis (3), vesicular stomatitis virus
(4) and rabies (5) have been reported to be expressed in E. coli,
several laboratories have reported that the surface antigen for
hepatitis B expressed in prokaryotes is not immunologically
reactive with antisera to the naturally occurring antigen (6).
[0006] Acquired immunodeficiency syndrome (hereinafter referred to
as AIDS) is a devastating disease of the adult immune system which
significantly affects cell-mediated immunity. The disease is
manifested by a profound lymphopenia which appears to be the result
of a loss of T-lymphocytes that have the helper/inducer phenotype
T4 as defined by the monoclonal antibody OKT4 (7). Other clinical
manifestations include opportunistic infections, predominantly
Pneumocystis carinii pneumonia, and Karposi's sarcoma (7).
[0007] Pre-AIDS, a syndrome that often precedes the onset of AIDS,
is characterized by chronic generalized lymphadenopathy. It has
been reported that about 10% of patients with pre-AIDS develop AIDS
(8).
[0008] The predominant risk group for AIDS includes homosexual and
bisexual males, intravenous drug abusers, recipients of blood
components (primarily hemophiliacs receiving treatment with Factor
VIII) and recipients of blood transfusions (7). The epidemiology of
this syndrome indicates that AIDS is caused by an infectious agent
which is transmitted by intimate contact or contact with blood or
blood products (7).
[0009] A human retrovirus related to the previously described human
T-lymphotropic viruses HTLV-I and HTLV-II, is the causative agent
for AIDS (8, 9, 10). Several laboratories originally isolated and
propagated retrovirus associated with AIDS patients (11) and
propagated in a permissive T-cell line (12). Similarly, Luc
Montagnier of the Pasteur Institut in Paris has found a virus in
AIDS patients designated LAV (lymphadenopathy associated virus).
Some authors have reported that LAV may be similar or identical to
HTLV-III (13, 14). A virus isolated from an AIDS patient,
designated ARV (AIDS Related Virus), was reported to have been
identified and cloned (15). These and other AIDS retroviruses are
hereinafter referred to as AIDS associated retrovirus.
[0010] HTLV-III is a retrovirus with a genome comprising
approximately 10 kb of RNA. The virus particle contains a capsid
consisting of a number of proteins. The primary core protein is
designated p-24 and has a corresponding molecular weight of about
24,000 daltons. The p-24 core protein is synthesized in vivo as
part of a precursor polypeptide encoded by the gag region of the
HTLV-III genome. This precursor polypeptide is processed in the
infected cell to form p-2.sup.4 and other viral proteins. In
addition, an envelope protein designated gp-41 (MW 41,000 daltons),
is also a constituent of the virus particle and is encoded in the
env region of the HTLV-III genome.
[0011] Antibodies to the envelope protein gp-41 of HTLV-III have
been detected in serum from AIDS and pre-AIDS patients.
Approximately 88% of AIDS and 79% of pre-AIDS patients have
detectable antibodies to HTLV-III envelope protein (16). One author
has reported that there is a 90-100% sero-conversion to such
antibodies (8). In addition to antibodies to the gp-41 envelope
protein, antibodies to the HTLV-III core protein p-24, and the
HTLV-III proteins designated p-55, p-60 as well as the
glycoproteins gp-65, gp-120 and gp-160 have been detected in
patients with AIDS (16, 17). The detection of antibodies to these
and other as yet unknown antigens is, therefore, a significant
indication of exposure to or productive infection by the agent
responsible for AIDS.
[0012] In addition, certain of these viral polypeptide sequences
may be used as a vaccine to induce the production of neutralizing
antibodies conferring resistance to AIDS infection. A need exists
for variant sequences such as fusions of the viral polypeptide with
highly immunogenic polypeptides, in order to facilitate induction
of a high titer immune response, as well as for deletions of
undesired viral sequences.
[0013] Accordingly, it is an object herein to express, in a
prokaryotic host, viral antigens of an AIDS associated retrovirus
which are non-pathogenic and which may be used as diagnostic
product to detect AIDS.
[0014] It is a further object of the present invention to
prokaryotically express a diagnostic product to detect AIDS
consisting of variant composite polypeptides of naturally occurring
AIDS related polypeptide sequences.
[0015] Further, an object of the present invention is to express in
mammalian cell culture AIDS associated polypeptides or variants,
including fusion polypeptides of an AIDS associated polypeptide
which may be used as a vaccine against AIDS.
[0016] Still further, an object of the present invention is to
express AIDS RNA dependent DNA polymerase (reverse transcriptase)
for use in an assay to identify transcriptase inhibitors.
SUMMARY OF THE INVENTION
[0017] In accordance with this invention, DNA encoding
AIDS-associated polypeptides is identified and employed in
recombinant prokaryotic or mammalian cell culture systems to
synthesize predetermined AIDS-associated polypeptides and
derivatives and amino acid sequence variants thereof. Derivatives
of AIDS-associated polypeptides include unglycosylated or variantly
glycosylated polypeptides, as well as formylmethionyl N-terminal
species.
[0018] Variants of normal AIDS-associated virus polypeptides are
provided wherein one or more amino acid residues of the normal
polypeptides have been deleted or substituted by other residues, or
one or more amino acid residues inserted. These variants include
predetermined fragments of normal polypeptides (deletion variants),
fusion polypeptides containing an AIDS-associated virus polypeptide
or fragment thereof with a second polypeptide which is not
AIDS-associated virus polypeptide or fragment thereof (fusion or
insertional variants), and all of the above in which an amino
residue has been substituted. Preferred deletion variants are gp41
or gp160 envelope proteins from which one or more hydrophobic
regions have been deleted.
[0019] DNA encoding the polypeptides of this invention are
provided, as well as vectors operably incorporating such DNA and
mammalian or prokaryotic cell cultures transformed therewith.
[0020] The predetermined polypeptide sequences of an
AIDS-associated retrovirus produced herein are essentially free of
other naturally occurring AIDS related polypeptides. These
polypeptides contain at least one antigenic determinant which is
capable of specifically binding complementary antibody. Specific
polypeptide sequences described herein are designated p-24, p-15,
E', reverse transcriptase and envelope (env) polypeptides. In
preferred embodiments, fragments and/or fusions of predetermined
polypeptide sequences of an AIDS associated retrovirus, containing
at least one antigenic determinant capable of specifically binding
complementary antibody, are provided. In one species of this
embodiment, a C-terminal portion of the p-24 and the entire p-15
sequence is removed. This truncated p-24, expressed in E. coli,
demonstrates an unexpected reactivity with antibody to an AIDS
associated retrovirus. Particularly preferred fragments are those
of the env protein gp120 which are able to bind normal host cell
receptors in competition with the intact virus, as well as E'
polypeptide fragments.
[0021] The fusion polypeptides comprise (a) a predetermined
polypeptide sequence of an AIDS associated retrovirus or fragment
thereof having at least one antigenic determinant capable of
specifically binding complementary antibody and (b) a second
polypeptide sequence which is not immunologically reactive with
antibodies normally present in a biologically derived sample which
is to be assayed for the presence of antibodies to AIDS associated
retro-virus. If the fusion polypeptide is to be used as a component
of a vaccine the second polypeptide sequence also should be
incapable of inducing antibodies which are cross-reactive with
polypeptides which are naturally occurring in the subject such
vaccine is directed to. In this case, polypeptides from lower
eukaryotes other than from yeast are useful.
[0022] In one species of a fusion polypeptide, DNA sequences
encoding a polypeptide sequence of human growth hormone (HGH) are
positioned five prime to a DNA sequence encoding the p-2.sup.4 and
p-15 polypeptide sequence of HTLV-III. This in expressed and
processed in E. coli as an HGH-p24 fusion polypeptide which
specifically binds complementary antibody. Similarly, fusions of E'
and env polypeptides such as gp41 and gp120 with viral, synthetic
or prokaryotic polypeptides are provided. A preferred fusion is the
fusion of a mature envelope polypeptide or fragment thereof with a
signal sequence heterologous to the HTLV-III retrovirus, typically
a eukaryotic or other viral polypeptide signal sequence. These
results demonstrate that viral antigens associated with AIDS may be
expressed as a fusion polypeptide to detect naturally occurring
antibodies produced by AIDS infected individuals.
[0023] The immunoprotective polypeptide sequences of this invention
are formulated into therapeutically effective dosages with a
pharmaceutically acceptable vehicle and administered to
AIDS-susceptible animals in order to induce the production of
antibodies to such polypeptide sequences.
[0024] In a contemplated embodiment, a polypeptide comprising or
consisting of a predetermined polypeptide sequence of RNA dependent
DNA polymerase (reverse transcriptase) from an AIDS associated
retrovirus is cloned and expressed for use in an assay system to
identify compounds which inhibit such AIDS associated reverse
transcriptase. Such compounds may be administered as a
pharmaceutical agent to inhibit infection by AIDS associated
retrovirus or dissemination of such retrovirus in infected
individuals.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows the amino terminal polypeptide sequence of p-24
core protein obtained from live HTLV-III retrovirus and the
corresponding DNA sequence deduced therefrom.
[0026] FIGS. 2a-2d show the DNA sequence, the putative polypeptide
sequence and a partial restriction map of the HTLV-III genome. The
terminal repeat ("R") and unique regions (US for 5' and U3 for 3')
are shown. The putative positions assigned to the gag region,
reverse transcriptase ("pol"), envelope ("env") and E' and P'
proteins are shown. The designations sd and sa are splice donor and
splice acceptor sites, respectively. Overlapping amino acid
sequences represent putative mRNA splicing phenomena. Alternative
bases indicate differences found among clones, indicative of
variation found among strains in the viral population.
[0027] FIG. 2e depicts a restriction enzyme map of the provirus DNA
and overlapping cDNA clones.
[0028] FIG. 2f shows the putative mRNA splicing activity of the
virus, the resulting messengers and the proteins thereby
encoded.
[0029] FIG. 3 depicts the strategy employed to subclone p7.11.
[0030] FIG. 4 depicts the construction of p-24 and truncated p-24
expression vectors.
[0031] FIG. 5 depicts the construction of expression vectors for a
p-24 composite polypeptide and a truncated p-24 composite
polypeptide.
[0032] FIG. 6 is a Western Blot of the polypeptide expressed by
pDE-24, pDE24.DELTA.HD3, pHGHp-24.DELTA.B and pHGHp-24.DELTA.HD3.
The blot was treated with rabbit anti-HTLV-III antibody.
[0033] FIG. 7 is a Western blot of the polypeptide expressed by
pDE-24. The blot was treated with human serum derived from an
individual with AIDS.
[0034] FIGS. 8a, 9a and 10a depict the structure of the plasmids
ptrpLE.gp41, ptrpLE.E' and pSVE.E'DHFR. These plasmids are used for
the expression, respectively, of fusions of the env and the E'
protein of HTLV-III in bacteria and of the unfused E' protein in
CHO cell culture.
[0035] FIGS. 8b, 9b and 10b show polyacrylamide gel electrophoresis
patterns demonstrating the synthesis, respectively, of the protein
fusions encoded by ptrpLE.gp41, ptrpLE.E' and unfused E' protein
encoded by pSVE.E'DHFR.
[0036] FIG. 11a shows the region of the HTLV-III genome used for
env protein preparation in recombinant higher eukaryotic cell
culture.
[0037] FIG. 11b depicts an expression plasmid for secreting an
HTLV-III envelope protein from cultured mammalian cell culture
transformants.
DETAILED DESCRIPTION
[0038] Applicants have demonstrated that viral protein from an AIDS
associated retrovirus can be expressed directly or as a variant
polypeptide in host cells and that such recombinant polypeptides
are capable of specifically binding antibody to an AIDS associated
retrovirus. Such variant polypeptides include viral polypeptides
fused with one or more second polypeptide sequences as well as
deletions, insertions, substitutions and derivatives of the viral
polypeptide. In addition, directly expressed and certain variant
polypeptides, each of which contain fragments of a predetermined
polypeptide sequence of an AIDS associated retrovirus, also react
with antibody to AIDS associated retrovirus. These results indicate
that such recombinant polypeptides may be used as diagnostic agents
to detect AIDS in individuals, donated blood and blood
products.
[0039] Further, such polypeptides may be used as immunogens to
induce the production of neutralizing antibodies which confer
resistance to infection by an AIDS associated retrovirus.
[0040] Still further, the reverse transcriptase of an AIDS
associated retrovirus may be used to identify compounds which may
inhibit infection by AIDS associated retrovirus or the
dissemination of such retrovirus in infected individuals.
[0041] The fusion polypeptides of the present invention comprise an
AIDS associated polypeptide sequence and a second polypeptide
sequence. These second polypeptide sequences may be used to: 1)
promote secretion of the fusion polypeptide from a bacterial host
into the extra-cellular environment or the periplasm of gram
negative bacteria, 2) facilitate the functional association of the
fusion polypeptide with the surface membrane of recombinant host
cells or 3) provide a polypeptide sequence which may be used to
purify the fusion polypeptide (e.g. purification of an HGH-AIDS
fusion polypeptide by fractionation on an immunoadsorbent specific
for HGH). Depending upon the particular applications, second
polypeptide sequences used to form a fusion polypeptide with an
AIDS associated retrovirus may be of prokaryotic or eukaryotic
origin and may be positioned at the amino terminus, carboxy
terminus, at both ends of the AIDS associated polypeptide sequence,
or inserted within the AIDS associated polypeptide sequence.
[0042] Examples of second polypeptide sequences which may be used
to promote secretion of the fusion polypeptide include (1) the
signal sequence of Herpes Simplex Virus gD protein disclosed in
copending U.S. patent application Ser. No. 527,917 filed. Aug. 30,
1983; (2) the signal sequence of E. coli alkaline phosphatase or E.
coli enterotoxin STII disclosed in copending U.S. application Ser.
No. 658,342, filed Oct. 5, 1984, and references disclosed therein,
and (3) pre-HGH disclosed in copending U.S. application Ser. No.
488,232 filed Apr. 25, 1984 or other higher eukaryotic signal
sequences such as that of gamma interferon.
[0043] An example of a second polypeptide sequence which
facilitates functional membrane association is the transmembrane
sequence of Herpes Simplex Virus disclosed in U.S. application Ser.
No. 527,917 filed Aug. 30, 1983.
[0044] Since many individuals at risk for AIDS also have antibodies
to E. coli and other enterobacteria, the second polypeptide must be
chosen to avoid false positive immunological reactivity with these
antibodies. Polypeptide sequences from enterobacteria should
therefore be used as a second polypeptide only if such sequences
the removed during processing or otherwise prevented from reacting
with the biologically derived samples to be assayed for the
presence of antibody produced in response to infection by an AIDS
associated virus, e.g. by recombinant expression such that the
bacterial protein epitopes are modified so as to no longer be
cross-reactive with the native protein (see the LE fusions
described below).
[0045] When the fusion polypeptide of the present invention is used
as a vaccine against AIDS infection, the second polypeptide
sequence must be chosen to avoid the production of antibodies to
polypeptides which are naturally occurring in the subject such
vaccine is directed to. For example, in a vaccine for humans the
second polypeptide sequence is preferably not HGH. Such vaccines,
however, may contain prokaryotic polypeptide sequences or
preferably eukaryotic polypeptide sequences other than those of
yeast and primates.
[0046] The present invention specifically discloses the cloning and
expression of certain HTLV-III-encoded polypeptides. However, the
present invention also contemplates the cloning and expression of
other HTLV-III polypeptides. HTLV-III polypeptides which possess
antigenic determinants to antibodies for AIDS and pre-AIDS patents
include gp-160,
[0047] gp-120, gp-65, gp-41, p-60/p-55. The gp-160 polypeptide
appears to be a precursor polypeptide for gp-120 and gp-41. These
particular HTLV-III polypeptides are illustrative and are not
intended to limit the scope of the invention.
[0048] In addition, the present invention contemplates the
generation of a library of products each containing different
antigenic determinants that may be used to determine which
antigenic determinants are best suited for detection of AIDS or
pre-AIDS. Such a library, for example, may be used to determine
which antigenic determinants are immunologically reactive to serum
derived from healthy individuals who are serologically positive for
AIDS. Those antigenic determinants which test positive to such
serum but negative to serum from AIDS patients may be prime
candidates for a vaccine to induce the production of neutralizing
antibodies. Further, diagnostic products containing such antigenic
determinants may be used to identify individuals with neutralizing
antibodies who are unlikely to develop the severe clinical
manifestations associated with AIDS.
[0049] Although the present invention is based on studies of
HTLV-III it is to be understood that HTLV-III may be similar or
identical to LAV or ARV. As so related, polypeptide products
derived from those retroviruses are within the scope of the present
invention. Accordingly, the designation AIDS associated retrovirus
refers to HTLV-III, LAV, ARV, and/or other retrovirus that may
cause AIDS or ARC (AIDS-associated complex).
[0050] As used herein, a polypeptide sequence of an AIDS associated
retrovirus is the full length native polypeptide sequence or the
predetermined sequence derived from genomic sequencing.
[0051] A naturally occurring (native) polypeptide sequence is the
polypeptide formed in virus infected cells or found in the culture
fluid of such cells.
[0052] Variant polypeptide sequences of an AIDS associated
retrovirus include: (1) fusions of viral polypeptide or fragments
thereof with second polypeptide sequences including N and C
terminal fusions and insertions; (2) deletions of the N-terminal,
C-terminal, or an internal region of the polypeptide sequence of
viral polypeptide to produce a fragment of a polypeptide sequence
of an AIDS associated retrovirus; (3) substitutions of one or more
amino acids in a polypeptide sequence of an AIDS associated
retrovirus and (4) derivatives such as labelled or bound viral
polypeptide sequences which may be labelled by well known
techniques or bound to a solid phase such as that disclosed in U.S.
Pat. No. 3,720,760 incorporated herein by reference.
[0053] "Second polypeptides" are sequences which are fused with a
polypeptide sequence of an AIDS associated retrovirus or fragment
thereof to form the fusion polypeptide sequences of the present
invention. These second polypeptides may be full length or partial
protein sequences of eukaryotic, non-AIDS viral or prokaryotic
origin and may be used to promote secretion of the fusion
polypeptide, facilitate association of the fusion polypeptide with
the surface membrane of an expression host or aid in the
purification of the fusion polypeptide. When used as a vaccine, the
second polypeptide of a fusion polypeptide is a sequence which is
not normally capable of inducing antibodies which are
cross-reactive with naturally occurring polypeptides, in the
subject such vaccine is directed to.
[0054] "Complementary antibody" refers to antibody raised against a
corresponding naturally occurring viral epitope or epitope encoded
by AIDS-associated retrovirus.
[0055] A DNA sequence of an AIDS associated retrovirus encodes the
polypeptide and variant polypeptide sequences of the present
invention described above.
[0056] "Biologically derived sample" includes any biological fluid
or tissue sample taken from a human or animal subject which may be
assayed to detect the presence of complementary antibody produced
in response to exposure to or infection by an AIDS associated
retrovirus. Such samples typically comprise blood, urine, semen,
and saliva but may include any biological material in which such
complementary antibody or AIDS associated retrovirus may be
found.
[0057] Prokaryotes are preferred for cloning and expressing DNA
sequences to produce the diagnostic product and vaccine of the
present invention. For example, E. coli K12 strain 294 (ATCC No.
31446) is particularly useful. Other microbial strains which may be
used include E. coli strains such as E. coli B, and E. coli X1776
(ATCC No. 31537), and E. coli c600 and c600hfl, E. coli W3110
(F.sup.-, .lambda..sup.-, prototrophic, ATTC No. 27325), bacilli
such as Bacillus subtilus, and other enterobacteriaceae such as
Salmonella typhimurium or Serratia marcesans, and various
pseudomonas species. When expressed in prokaryotes the polypeptides
of the present invention typically contain an N-terminal methionine
or a formyl methionine, and are not glcosylated. These examples
are, of course, intended to be illustrative rather than
limiting.
[0058] In general, plasmid vectors containing replication and
control sequences which are derived from species compatible with
the host cell are used in connection with these hosts. The vector
ordinarily carries a replication site, as well as sequences which
encode proteins that are capable of providing phenotypic selection
in transformed cells. For example, E. coli is typically transformed
using pBR322, a plasmid derived from an E. coli species (18).
Plasmid pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides easy means for identifying and
selecting transformed cells. The pBR322 plasmid, or microbial
plasmid must also contain, or be modified to contain, promoters
which can-be used by the microbial organism for an expression of
its own proteins. Those promoters most commonly used in recombinant
DNA construction include .beta.-lactamase (penicillinase) and
lactose promoter systems (19-21) and a tryptophan (trp) promoter
system (22, 23). While these are the most commonly used, other
microbial promoters have been discovered and utilized, and details
concerning the their nucleotide sequences have been published,
enabling a skilled worker to ligate them functionally with plasmid
vectors (24). In the specific embodiments disclosed, a trp promoter
(22, 23) was used to express the diagnostic product and vaccine of
the present invention.
[0059] In addition to prokaryotes, eukaryotic cells may be used to
express the AIDS associated virus polypeptides including
particularly the reverse transciptase of an AIDS associated
retrovirus. Saccharomyces cerevisiae, or common baker's yeast is
the most commonly used among eukaryotic microorganisms, although a
number of other strains are commonly available. For expression in
Saccharomyces, the plasmid YRp7, for example, (25-27) is commonly
used. The plasmid already contains the trpl gene which provides a
selection marker for a mutant strain of yeast lacking the ability
to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (28).
The presence of the trpl lesion as a characteristic of the yeast
host cell genome then provides an effective environment for
detecting transformation by growth in the absence of
tryptophan.
[0060] Suitable promoting sequences in yeast vectors include the
promoters for 3-phosphoglycerate kinase (29) or other glycolytic
enzymes (30, 31), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate, decarboxylase,
phosphofructokinase, glucose-6-phosphate, isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. In
constructing suitable expression plasmids, the
termination-sequences associated with these genes are also ligated
into the expression vector 3' of the sequence desired to be
expressed to provide polyadenylation of the mRNA termination. Other
promoters, which have the additional advantage of the transcription
controlled by growth conditions are the promoter regions for
alcohol dehydrogenase 2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism, and the
aforementioned glyceraldehyde-3-phosphate dehydrogenase, and the
enzymes responsible for maltose and galactose utilization. Any
plasmid vector containing yeast-compatible promoter, origin of
replication and termination sequences is suitable.
[0061] Cultures of cells derived from multicellular organisms also
are employed for expression of AIDS associated retrovirus
proteins.
[0062] Mammalian or vertebrate cells are of particular interest,
such as VERO and HELA cells, Chinese Hamster ovary (CHO) cell
lines, and WI38, BHK, COS-7 and MDCK cell lines. Expression vectors
for such cells ordinarily include an origin of replication, a
promoter for controlling expression of the DNA encoding the AIDS
associated retroviral polypeptide, along with a mammalian selection
marker, RNA splice site, polyadenylation site and transcriptional
terminator sequences as required.
[0063] Vectors capable of transforming mammalian host cells to
expression of AIDS associated polypeptides are preferably
introduced into host cells with a selection marker, e.g. the gene
encoding DHFR (dihydrofolate reductase) in known fashion and then
amplified by exposing the transformants to increasing
concentrations of selection agent, e.g. methotrexate. For example
see U.S. Pat. No. 4,399,216.
[0064] For use in mammalian cells, the transcriptional and
translational control functions are conventionally obtained from
viral sources. For example, commonly used promoters are derived
from polyoma, Simian Virus 40 (SV40) and most particularly
Adenovirus 2. The early and late promoters of SV40 virus are useful
as is the major late promoter of adenovirus as described above.
Further, it is also possible, and often desirable, to utilize
promoter or control sequences normally associated with the desired
gene sequence, provided such control sequences are compatible with
the host cell systems.
[0065] An origin of replication may be provided either by
construction of the vector to include an exogenous origin, such as
may be derived from adenovirus or other viral (e.g. Polyoma, SV40,
VSV, BPV, etc.) source, or may be provided by the host cell
chromosomal replication mechanism, if the vector is integrated into
the host cell chromosome.
[0066] For vectors of the invention which comprise DNA sequences
encoding both AIDS associated polypeptide and a cotransformation,
selection and amplification gene such as the DHFR enzyme, it is
appropriate to select the host according to the type of DHFR
protein employed. If wild type DHFR protein is employed, it is
preferable to select a host cell which is deficient in DHFR, thus
permitting the use of the DHFR coding sequence as a marker for
successful transfection in selective medium which lacks
hypoxanthine, glycine, and thymidine.
[0067] On the other hand, if DHFR protein with low binding affinity
for MTX is used as the controlling sequence, it is not necessary to
use DHFR resistant cells. Because the mutant DHFR is resistant to
methotrexate, MTX containing media can be used as means of
selection provided that host cells are themselves methotrexate
sensitive.
[0068] Alternatively, a wild type DHFR gene may be employed as an
amplification marker in a host cell which is not deficient in DHFR
provided that a second drug selectable marker is employed, such as
neomycin resistance.
[0069] An example, which is set forth hereinafter, contemplates the
use of CHO cells as host cells and an expression vector which
encodes the reverse transcriptase of an AIDS associated
retrovirus.
[0070] As more fully set out below, the diagnostic product of the
present invention is utilized in place of its counterpart derived
from a live pathogen in analogous immunoassays. In that regard, a
commercial diagnostic test kit would include the above diagnostic
products with a variety of other immunological products, at least
one of which is labeled, for detection of its complementary
antibody or the antigen. The system has been described with respect
to the molecular cloning and expression of specific proteins of
HTLV-III which possess sufficient antigenic determinants to render
them capable of specifically binding complementary antibody, namely
antibody to HTLV-III. The specific techniques for cloning and
expressing exemplary polypeptides are set forth in more detail in
the examples that follow.
[0071] There are a number of known techniques for the determination
of an unknown quantity of antigen or antibody in biological fluids
such as serum, urine, or saliva or from skin samples or the like.
In principle, the present invention utilizes such known techniques
but substitutes certain molecularly cloned diagnostic reagents of a
type set forth above in the otherwise known procedure.
[0072] Accordingly, the procedures themselves will be described
only generally with reference being made to conventional immunology
text for the details of the procedures. It would be well known to
skilled workers in the field how to utilize the novel diagnostic
products of the present invention in conventional immunological
techniques.
[0073] For simplicity of description, the general term "diagnostic
product" will be used in describing the antigen functional product
of the present invention. The term "diagnostic product" is defined
as a predetermined polypeptide sequence of an AIDS associated
retrovirus with one or more antigenic determinants capable of
specifically binding complementary antibody induced by a AIDS
associated retrovirus. The diagnostic product is formed in a
recombinant host cell capable of its production. The polypeptide
sequence may be either functionally associated with a surface
membrane of the recombinant cell or it may be recovered and used
free of the host cell membrane. Further, the antigenic polypeptide
sequence may be fused to a second polypeptide sequence.
[0074] The diagnostic methods used in assaying AIDS associated
retrovirus, its constituent polypeptides and complementary
antibodies are conventional. These include the competitive,
sandwich and steric inhibition techniques. The first two methods
employ a phase separation step as an integral part of the method
while steric inhibition assays are conducted in a single reaction
mixture. The methodology for assay of retrovirus or its
polypeptides on the one hand and for substances that bind
retrovirus or viral polypeptides on the other hand are essentially
the same, although certain methods will be favored depending upon
the size of the substance being assayed. Therefore the substance to
be tested is referred to herein as an analyte, irrespective of its
status otherwise as an antigen or antibody, and proteins which bind
to the analyte are denominated binding partners, whether they be
antibodies, cell surface receptors or antigens.
[0075] Analytical methods for AIDS associated retrovirus, its
polypeptides, complementary antibody or cell surface receptors all
use one or more of the following reagents: Labelled analyte
analogue, immobilized analyte analogue, labelled binding partner,
immobilized binding partner and steric conjugates. The labelled
reagents also are known as "tracers".
[0076] The label used is any detectable functionality which does
not interfere with the binding of analyte and it binding partner.
Numerous labels are known for use in immuno assay, examples
including enzymes such as horseradish peroxidase, radioisotopes
such as .sup.14C and .sup.131I, fluorophores such as rare earth
chelates or fluorescein, spin labels and the like. Conventional
methods are available to covalently bind these labels to proteins
or polypeptides. Such bonding methods are suitable for use with
AIDS associated retrovirus, viral polypeptides, complementary
antibody and retrovirus receptors, all of which are
proteinaceous.
[0077] Immobilization of reagents is required for certain assay
methods. Immobilization entails separating the binding partner from
any analyte which remains free in solution. This conventionally is
accomplished by either insolubilizing the binding partner or
analyte analogue before the assay procedure-, such as by adsorption
to a water insoluble matrix or surface (Bennich et al., U.S. Pat.
No. 3,720,760) or by covalent coupling (for example using
glutaraldehyde cross-linking), or by insolubilizing the partner or
analogue afterward, e.g., by immunoprecipitation.
[0078] Steric conjugates are used in the steric hinderance method
for homogeneous assay. These conjugates are synthesized by
covalently linking a low molecular weight hapten to a small analyte
so that antibody to hapten substantially is unable to bind the
conjugate at the same time as anti-analyte. Under this assay
procedure the analyte present in the test sample will bind
anti-analyte, thereby allowing anti-hapten to bind the conjugate
resulting in a change in flourescence when the the hapten is a
fluorophore.
[0079] Other assay methods, known as competitive or sandwich
assays, are well established and widely used in the commercial
diagnostics industry.
[0080] Competitive assays rely on the ability of a labelled
analogue (the "tracer") to compete with the-test sample analyte for
a limited number of binding sites on a common binding partner. The
binding partner is generally insolubilized before or after the
competition and then the tracer and analyte bound to the binding
partner are separated from the unbound tracer and analyte. This
separation is accomplished by decanting (where the binding partner
was preinsolubilized) or by centrifuging (where the binding partner
was precipitated after the competitive reaction). The amount of
test sample analyte is inversely proportional to the amount of
bound tracer as measured by the amount of marker substance.
Dose-response curves with known amounts of analyte are prepared and
compared with the test results in order to quantitatively determine
the amount of AIDS associated retrovirus, viral polypeptide or
complementary antibody present in the test sample. These
heterologous assays are called ELISA systems when enzymes are used
as the detectable markers.
[0081] Another species of competitive assay is a homogenous assay
which does not require a phase separation. Here, a conjugate of an
enzyme with the analyte is prepared so that when anti-analyte binds
to the analyte the presence of the anti-analyte modifies the enzyme
activity. In this case, a polypeptide of an AIDS associated
retrovirus or its immunologically active fragments are conjugated
with a bifunctional organic bridge to an enzyme such as peroxidase.
Conjugates are selected for use with complementary antibody so that
binding of the complementary antibody inhibits or potentiates
enzyme activity. This method per se is widely practiced under the
name EMIT.
[0082] Sandwich assays particularly are useful for the
determination of polypeptides of an AIDS associated retrovirus,
complementary antibody or retrovirus cell surface receptors, i.e.,
large molecules. In sequential sandwich assays an immobilized
binding partner is used to adsorb test sample analyte, the test
sample is removed by washing, the bound analyte is used to adsorb
labelled binding partner and bound material then separated from
residual tracer. The amount of bound tracer is directly
proportional to test sample analyte. In a "simultaneous" sandwich
assay, test sample is not separated before adding the labelled
binding partner.
[0083] The foregoing are merely exemplary assays for AIDS
associated retrovirus, polypeptides of an AIDS associated
retrovirus, complementary antibody and retrovirus cell surface
receptors. Other methods now or hereafter developed for the
determination of these analytes are included within the scope
hereof.
[0084] In order to simplify the examples certain frequently
occurring and well-known methods employed in recombinant
constructions will be referenced by shorthand phrases or
designations.
[0085] Plasmids are generally designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The starting
plasmids or sources of DNA herein are commercially available, are
publicly available on a restricted basis, or can be constructed
from available plasmids or polynucleotides in accord with published
procedures. In addition, other equivalent plasmids are known in the
art and will be apparent to the ordinary artisan since the plasmids
generally only function as replication vehicles for the preprotein
and its control sequences, or for elements thereof in intermediate
constructions.
[0086] "Digestion" of DNA refers to catalytic cleavage of the DNA
with an enzyme that acts only at certain locations in the DNA. Such
enzymes are called restriction enzymes, and the sites for which
each is specific is called a restriction site.
[0087] The various restriction enzymes used herein are commercially
available and their reaction conditions, cofactors and other
requirements as established by the enzyme suppliers were used.
Restriction enzymes commonly are designated by abbreviations
composed of a capital letter followed by other letters and then,
generally, a number representing the microorganism from which each
restriction enzyme originally was obtained. In general, about lug
or plasmid or DNA fragment is used with about 1 unit of enzyme in
about 20 ul of buffer solution. Appropriate buffers and substrate
amounts for particular restriction enzymes are specified by the
manufacturer. Incubation times of about 1 hour at 37.degree. C. are
ordinarily used, but may vary in accordance with the supplier's
instructions. After incubation, protein is removed by extraction
with phenol and chloroform, and the digested nucleaic acid is
recovered with aqueous fraction by precipitation with ethanol.
Digestion with a restriction enzyme infrequently is followed with
bacterial alkaline phosphatase hydrolysis of the terminal 5'
phosphates to prevent the two restriction cleaved ends of a DNA
fragment from circularizing or forming a closed loop upon ligation
(described below) that would impede insertion of another DNA
fragment at the restriction site. Unless otherwise stated,
digestion of plasmids is not followed by 5' terminal
dephosphorylation. Procedures and reagents for dephosphorylation
are conventional (32).
[0088] "Recovery" or "isolation" of a given fragment of DNA from a
restriction digest means separation of the digest by polyacrylamide
gel electrophoresis, identification of the fragment of interest by
comparison of its mobility versus that of marker DNA fragments of
known molecular weight, removal of the gel section containing the
desired fragment, and separation of the DNA from the gel, generally
by electroelution. This procedure is known generally.
[0089] A "Western Blot" is a method by which the presence of
polypeptide is confirmed by reaction with labelled complementary
antibody. The polypeptide is separated eletrophoretically on a
polyacrylamide gel and electrophoretically transferred to
nitrocellulose. The nitrocellulose is incubated with labelled
complementary antibody, unbound antibody removed and the location
of residual label is identified.
[0090] "Transformation" means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or chromosomal integrant. Unless otherwise provided, the method
used herein is the CaCl.sub.2 transformation method (33).
[0091] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic fragments (34). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units of T4 DNA ligase ("ligase")
per 0.5 .mu.g of approximately equimolar amounts of the DNA
fragments to be ligated.
[0092] "Fill in" or "blunting" refers to the repair of sticky ended
(overhanging) restriction enzyme fragments in order to create a
blunt end that will ligate to other blunt terminal DNA. Generally
2-15 .mu.g of DNA are incubated in 50 mM NaCl, 10 mM Tris (pH 7.5),
10 mM MgCl.sub.2, 1 mM dithiothreitol with 250 .mu.M of each of
four deoxynucleoside triphosphates and 8 units DNA polymerase
Klenow fragment at 20.degree. C. for 30 minutes. The reaction is
terminated by phenol and chloroform extraction and ethanol
precipitation.
[0093] "Preparation" of DNA from transformants means isolating
plasmid DNA from microbial culture. Unless otherwise provided, the
alkaline/SDS method was used (34).
[0094] "Oligonucleotides" are short length single or double
stranded polydeoxynucleotides which are made by chemically known
methods and then purified on polyacrylamide gels (35).
[0095] The following specific examples are intended to illustrate
more fully the nature of the present invention without acting as a
limitation upon its scope.
EXAMPLE 1
[0096] This example discloses plasmid construction and expression
of the p-24 core polypeptide of HTLV-III in a prokaryotic
expression host.
[0097] A. Virus Growth and Viral RNA Isolation
[0098] HTLV-III.sub.b/H9 cells (ATCC CRL 8543) were obtained from
Dr. B Larry Arthur, Frederick Cancer Research Facility, Frederick,
MD. Cultures were maintained in suspension and adapted to RPMI 1640
supplemented with 5% FBS, 2 mM L-glutamine, and 100 ug/ml
penicillin-strepomycin-mixture. Cells were seeded at a density of
3.times.10.sup.5 viable cells/ml in 10-liter volumes, and cultures
harvested at a density of 10-15.times.10.sup.5 viable cells/ml
approximately 96 hours after seeding.
[0099] Following clarification to remove cells, culture fluids were
concentrated by ultrafiltration. HTLV-III virus particles were
purified by banding of ultra-filtrate concentrate in a 20% to 60%
sucrose gradient in a Beckman SW27 rotor for 16 hr at 27,000 rpm
using a Beckman L8-M ultracentrige. Sucrose fractions between 30%
and 40% were pooled, diluted with TNE (10 mM tris pH 7.5, 0.1M
NaCl, 1 mM EDTA) and pelleted by differential ultracentrifugation
in a Beckman Type 50 rotor. Virus particles were resuspended in TNE
at a concentration approximately 2000 times greater than that of
the original medium. These concentrates contained 2.5 to 3.0 mg of
protein per ml.
[0100] Total RNA was extracted from HTLV-III.sub.3/H9 cells
(berger, et al., "Biochemistry" 18:5143 (1979)). PolyA containing
RNA was purified by fractionation on oligo dT cellulose (Aviv, et
al., "P.N.A.S. U.S.A." 74:5463 (1977)) and used for cDNA
synthesis.
[0101] B. Cloning of the p-24 Gene
DNA Synthesis
[0102] PolyA RNA was primed with oligo dT for reverse transcriptase
mediated cDNA synthesis (Capon, et al., "Nature" 304:507 (1983)).
Second strand DNA synthesis by DNA polyerase I was self-primed. The
resulting doubled stranded DNA was treated with S1 nuclease to nick
the resultant loop and to remove single stranded nucleotides. This
blunt ended double stranded DNA was used to construct an HTLV-III
phage library.
Phage Library Construction and Detection of HTLV-III Clones
[0103] The above double stranded DNA was blunt end ligated with T-4
ligase to R-1 linkers (37) which were synthesized by known
techniques (35). This R-I/cDNA was ligated into Eco R1 digested
.lambda. GT10 to generate an HTLV-III cDNA library as disclosed
(37).
[0104] Two copies of the phage library were replica plated onto
nitrocellulose filters where the DNA was fixed for in situ
hybridization (32). One set of filters was hybridized with .sup.32P
labelled cDNA prepared from the polyA positive RNA obtained from
HTLV-III infected T-cells which was used to generate the cDNA
library. The other set of filters was hybridized with .sup.32P
labelled cDNA obtained from the same cell line which was not
infected with HTLV-III. Differential phage hybridization, analogous
to the method employed for detecting bacterial cDNA clones (38),
allowed applicants to identify a number of HTLV-III positive
clones.
Subcloning and Sequencing of of HTLV-III Clones
[0105] The above-identified HTLV-III clones from the cDNA phage
library were digested with Eco RI. The cDNA inserts were isolated
and subcloned into the RI site of pBR322 (ATCC 37017) and
propagated in E. coli 294 (ATCC 31446).
[0106] A number of these subcloned R1 inserts were sequenced by the
dideoxy method (39), producing the proviral sequence shown in FIGS.
2a-2d.
Amino Terminal Sequencing
[0107] Live HTLV-III virus particles were purified as previously
described. The constituent proteins were fractionated on a 12%
polyacrylamide gel using Laemmeli buffer (42). Approximately 600 ug
of virus protein was loaded per lane under reducing conditions
(41). The gel was stained with Coomassie blue and a protein band
having a corresponding molecular weight of 24,000 daltons was cut
from the gel. The protein was electroeluted from the gel (41) for
amino terminal sequence analysis (42). The amino acid sequence for
the first 17 amino acids, excluding residue 16, is shown in FIG. 1.
The corresponding DNA sequence is shown directly below the amino
acid sequence. A comparison of this DNA sequence with that obtained
for the HTLV-III genome in FIG. 2 revealed one particular clone,
designated p 7.11 in FIG. 3, which contained a DNA sequence
encoding this peptide sequence. This approximately 2.2 kilobase
covers the precursor gag region and encodes, 5' to 3', p-12, p-15,
p-24 a second p-15 protein, and approximately 300 extra base pairs
3' to the gag region. The DNA sequence and corresponding amino acid
sequence of this precursor gag region is shown in FIG. 2. A partial
restriction map of the 220 amino acid p-24 core protein region
including an R-1 site 3' from the expected carboxy terminal amino
acid is depicted for p-7.11 in FIG. 3.
Subcloning of p 7.11
[0108] Plasmid 7.11 was digested with Eco R1. The 2.2 kilobase
insert was isolated and double digested with RsaI and PstI. The
RsaI-PstI and PstI-EcoR1 sequences were isolated. Plasmid UC9 (43)
was digested with SmaI and Eco R1. The large fragment comprising
most of pUC9 was isolated and hybridized with the Rsa-I PstI and
PstI-Eco-R1 fragments. The blunt RsaI and Sma I ends were ligated
with T-4 ligase. The resulting plasmid, designated pUCp-24, was
used to transform E. coli 294.
[0109] In constructing pUCp-24 the RsaI site of p-7.11 was used. In
so doing, the first ten N-terminal amino acids were excluded from
this construction. To incorporate these ten amino acids a synthetic
oligonucleotide was constructed (35). The DNA sequence of this
39-mer is
1 5' 3' p-GATCCCACCTATAGTGCAGAACATCCAGGGGCAAATGGT
GGTGGATATCACGTCTTGTAGGTCCCCGTTTACCA-p
[0110] The 5' end of this oligonucleotide contains a synthetic
BamH1 site for subsequent ligation. Both strands were
phosphorylated with polynucleotide kinase
[0111] Plasmid pUC-24 was digested with BamHI and SphI. The large
fragment containing most of the pUC plasmid and the 3' end of the
p-24 DNA sequence was isolated. Plasmid 7.11 was digested with RsaI
and SphI. The fragment containing p-24 DNA sequence 5' to the Sph I
site was isolated. This fragment and the synthetic 39-mer were
hybridized to the BamHI-SphI fragment obtained from pUC-24. The
blunt ends from the 39-mer and RsaI-SphI fragment were ligated with
T-4 ligase. This plasmid, designated pUCp24L, was used to transform
E. coli 294.
[0112] C. Expression Vectors for P-24 Core Protein and Truncated
P-24 Core Protein
[0113] The construction of a p-24 and a truncated p-24 expression
vector are depicted in FIG. 4.
Construction of pHGH-SRC-fsl-2
[0114] Plasmid pSRCex16 (44) contains pBR322 and a fusion of the
first 69 nucleotides of HGH with the DNA encoding the 60,000 MW
phosphoprotein of SRC, the fusion being under the control of the E.
coli trp promoter. It is not important that the plasmid encode any
protein. Instead, any pBR322 plasmid derivative which contains a
trp promoter is satisfactory (45).
[0115] Plasmid pSRCex 16 is partially digested with EcoRI and
filled using the Klenow fragment of DNA polymerase I in order to
destroy the EcoRI site in the trp promoter, thereby leaving an
EcoRI site at the beginning of the HGH fragment. The resulting
plasmid, pEARI5RCex16 was then digested with EcoRI in order to open
the plasmid, trimmed with SI nuclease to blunt the ends and ligated
to a linker (fsl-2) (46) having the following structure:
2 5' pAATTATGGAATTCCAT 3' TTAATACCTTAAGGTAp
[0116] Ligation with the fsl-2 linker recreates the EcoRI site
immediately after the ATG, which is underlined above, at the EcoRI
cleavage point indicated by an arrow. Accordingly, the first base
of the first codon of p24/p-15, as constructed below, is provided
by the vector. This plasmid is designated pHGH-SRC-fsl-2.
Construction of a Full Length p-24 Expression Vector
[0117] Plasmid .sub.pUCp24L was cleaved with BamHI. The cleaved
fragment was treated the Klenow fragment of DNA polymerase I in the
presence of 0.5 mM nucleotide triphosphates to fill in the BamHI
restriction site. This fragment was then digested with EcoRI. The
fragment containing the p-24 and p-15 (p-24/p-15) DNA sequence was
isolated.
[0118] Plasmid HGH-SRC-fsl-2 was cleaved with EcoRI and filled in
as previously described. The cleaved plasmid was subsequently
digested with BamHI. The fragment containing the trp promoter and
ATG initiation codon was isolated. This fragment was hybridized
with a fragment conferring tetracycline resistance derived from
digesting pBR322 by digestion with BamHI and EcoRI and with the
blunt ended BamHI-Eco-RI fragment obtained from pUCp24L. The blunt
ends were ligated with T-4 ligase. This plasmid, designated p24DE
was used to to transform E. coli 294. Transformants were selected
by their ability to resist tetracycline. Expression of this plasmid
was expected to produce a polypeptide consisting of the full length
p-24 core protein and the p-15 protein.
Construction of a p-24 Fragment Expression Vector
[0119] Plasmid p-24DE contains a HindIII restriction site located
in the vicinity of the DNA sequence encoding amino acids 178-179 of
the p-24 core protein. In addition, the p-24DE a HindIII site in
the tetracycline resistance gene derived from pBR322 located 3' to
the p-24 DNA sequence. Digestion of p-24DE with HindIII followed by
removal of the fragment encoding amino acids 179-200 and the p-15
protein and the religation of the fragment containing the 5' p-24
DNA sequence under control of the trp promoter produced the plasmid
designated p-DE-24.DELTA.HD3. A TAA stop codon within the pBR322
sequence 3' to the truncated p-24 DNA sequence results in the
expression of the first 178 amino acids of p-24 core protein and
eight amino acid residues encoded by the pBR322 DNA sequence.
EXAMPLE 2
[0120] This example discloses the construction and cloning of an
expression vector of p-24 core protein sequence of HTLV-III as a
fusion polypeptide in a prokaryotic host.
[0121] A. Expression Vectors for Fusion Polypeptides of p-24 Core
Protein and Truncated p-24 Core Protein
[0122] The construction of vectors for the expression of composite
polypeptides for the p-24 and a fragment of p-24 are depicted in
FIG. 5.
Construction of a p-24 Fusion Polypeptide Expression Vector
[0123] Plasmid UCp24L was cleaved with BamHI, blunt ended and
digested with EcoRI as described above. The fragment containing the
p-24/p15 DNA sequences was isolated.
[0124] Plasmid HGH 207-1 (45) was digested with Pst1 and Pvu2. The
sequence encoding HGH 3' from the Pst1 site to the PvuII site was
isolated. This sequence excludes DNA sequences 5' from the Pst1
site as well as the last 8 amino acid residues of mature HGH. These
two fragments were hybridized to a PstI-EcoRI fragment derived from
pBR322 which contains a gene conferring tetracycline resistance.
T-4 ligase was used to ligate the PvuII and blunt ended BamHI site
prior to transformation of E. coli 294 with this plasmid,
designated pHGH p-24-A.
[0125] Plasmid HGHp24-A does not encode the mature HGH amino acid
sequence 5' to the Pvu-2 site of pHGH 3'R. A DNA sequence encoding
such residues was inserted into the plasmid by the following
method.
[0126] Plasmid HGH 3'R was digested with BglII and ClaI. The
fragment containing the tac promoter and HGH 5' DNA sequences
encoding mature HGH to the BglII site was isolated.
[0127] Plasmid HGH 207-1 was digested with BglII and PstI. The
BglII-PstI fragment containing part of HGH and part of p-24 was
isolated. The same plasmid was digested with Pst1 and ClaI followed
by isolation of the fragment containing p-15 and part of p-24.
[0128] These three isolated fragments were ligated to produce
pHGHp24-B. This plasmid contains DNA sequences under control of the
tac promoter for expression of mature HGH, except for the
C-terminal 8 amino acids of HGH, fused to p-24 core protein and
p-15 protein.
Construction of a Truncated p-24 Fusion Polypeptide Expression
Vector
[0129] Digestion of pHGHp-24B with. HindIII followed by religation
results in the same deletion as that obtained for p24DE. The
resulting sequence, however, was expected to express a fusion
polypeptide of mature HGH (absent 9 C-terminal amino acids) fused
to the first 178 amino acids of p-24 and eight amino acid residues
from the expression plasmid 3' to the p-24 DNA sequence. This
plasmid is designated pHGHp-24ARD3.
EXAMPLE 2a
[0130] This Example describes the isolation of cDNA encoding the
gp41 envelope protein, its tailoring for expression in prokaryotes,
expression of a p41 fusion in E. coli and the in vitro
resolubilization of the expressed fusion.
[0131] Viral mRNA was isolated, cDNA prepared from the viral mRNA,
and the cDNA cloned into .lambda. GT10 phage as described in
Example 1 A and B above. A cDNA clone, H9c.53 was identified that
comprised cDNA encoding the complete p41 envelope region (bp 7336
to 8992, FIG. 2d). H9c.53 was digested with RsaI and HindIII and
the fragment I corresponding to nucleotides 7417-7722 of the
proviral genome was isolated. Fragment I encodes amino acid
residues being ValGlnAlaArg and the C-terminal residues being
AsnTyrThrSer). Fragment I was ligated to an excess of synthetic
EcoRI adaptor (having the sequence AATTCATGTCTTACGGTCAAGG) with a
phosphorylated blunt end and a 5' hydroxyl EcoRI end as described
above in Example 1B, digested with HindIII in order to cleave
ligation-formed dimers, and the resulting 326 bp EcoRI-HindIII
fragment isolated on a 6% polyacrylamide gel. Plasmid pNCV (55a)
was digested with EcoRI and HindIII and the vector fragment
recovered. The 326 bp, gp41-encoding fragment was ligated to the
pNCV fragment and the ligation mixture used to transform E. coli
(ATCC 31446) to tetracycline resistance. A tetracycline resistant
plasmid was recovered (ptrpLEgp41). This plasmid is shown in FIG.
8A. The open reading frame under the control of the trp promoter
encodes a gp41 fusion having at its amino terminus 190 residues
representing the combined sequence of the amino terminus of the E.
coli trp E gene product and its leader together with the amino acid
sequence encoded by the EcoRI adaptor, and at its c-terminus. 14
residues encoded by residual pBR322 sequence. The fusion contained
306 residues in total.
[0132] While the gp41 fusion represents a combined amino and
carboxyl fusion of prokaryotic peptides with a gp41 fragment, it
will be appreciated that, either or both of the prokaryotic
sequences may be deleted or substituted for by other prokaryotic,
eukaryotic or synthetic polypeptides. When direct expression of the
DNA encoding the gp41 fragment was attempted, rather than as an
amino terminal fusion, immunoreactive material could not be
identified in the cell culture extracts. The reasons for this are
unknown, but may involve instability of the unfused product in E.
coli. Accordingly gp41 or its fragments should be expressed in
prokaryotes as N-terminal fusions. Such fusions of course will
include fusions with the secretory leaders of E. coli periplasmic
or extracellular proteins, e.g. the ST-II heat stable enterotoxin
or alkaline phosphatase signals, among others. In this case gp41
will be secreted as a mature protein free of prokaryotic sequences.
Plasmids encoding fusions of signal peptides with the mature gp41
fragment are readily constructed by inserting synthetic DNA
encoding the known sequences of prokaryotic signals in place of the
trp LE-adaptor sequence in ptrpLEgp41 using appropriate flanking
restriction sites and adaptors or linkers as required. Any
remaining extraneous DNA is excised using M13 phage deletional
mutagenesis or other conventional method.
[0133] The gp42 DNA was truncated to the 102 residue fragment so as
to avoid including sequences near the amino and carboxyl terminus
that are particularly rich in hydrophobic residues, specifically
the two long hydrophobic stretches of 28 and 22 amino acids
contained within the putative transmembrane region of gp41.
Hydrophobic regions are known in some instances to be deleterious
to E. coli growth (56, 57). The region extending from residues
29-130 relative to the amino terminus of gp41 did not contain these
hydrophobic regions. Note, however, that other host cells such as
mammalian cells are suitable for expression of the intact gp41
protein or gp41 fragments containing one or both terminal
hydrophobic regions.
[0134] E. coli (ATCC 31446) was transformed with ptrpLEgp41 and
grown in M9 minimal media until values at A of 6.6, 9, 12, 17 and
21 were reached. Total cellular proteins were electrophoretically
separated on 10% SDS polyacrylamide gel and stained with Coomasie
blue. The results are shown in FIG. 8b, wherein lanes a-e
correspond to the above densities in ascending order, while lane f
depicts total cellular protein from a pBR322-transformed control (k
represents 1,000 daltons). E. coli transformants accumulated a
prominent protein (LEgp41, at about 10% by weight of the total
intracellular bacterial protein) with an apparent molecular weight
of 33,000 daltons, consistent with the predicted size of 306 amino
acids. Recombinant LEgp41 was purified from refractile bodies
enriched for the protein by gel filtration and ion-exchanged
chromatography using procedures similar to those previously
described for trpLE-foot and mouth disease virus polypeptide
fusions (55a). Specifically, cells were washed in 10 mM Tris-HC1, 1
mM EDTA, resuspended in 4 volumes of the same buffer, sonicated,
and the refractile bodies collected by centrifugation at 5,000 rpm
for 30 minutes in a Corvall GSA rotor. The particles were washed
twice and solubilized with 7M guanidine HCl, 0.1%
.beta.-mercaptioethanol (BME). The resulting extract was clarified
at 19,000 rpm for 4 hours in a Beckman Ti60 rotor. The high speed
supernatant was passed through a Sephacryl S-300 (Pharmacia)
column. Fractions from the included volume containing LEgp41 were
identified by electrophoresis on SDS-polyacrylamide gels, pooled
and dialysed extensively against 7.5M urea, 0.1% BME. This pool was
chromatographed on DEAE-52 cellulose (Whatman) in 7.5M urea, 0.1%
BME, 10 mM Tris-HCl pH 8.5. LEgp41 material that flowed through the
column was pooled and dialysed into 4M urea, 10 mM Tris HCl pH 8.5
at a concentration of 0.2 mgs/ml. The purified LEgp41 appeared
greater than 95% homogeneous on SDS-polyacrylamide gels by silver
staining. LEgp41 was not glycosylated.
[0135] This purification procedure eliminated the need to preadsorb
patient sera with E. coli proteins where the sera is destined for
assay of its anti-AIDS antibody level using the LEgp41 fusion;
apparently there are little or no pre-existing antibodies to the LE
portion in patient sera, at least no antibodies in the conformation
in which they exist in LEgp41. This also suggests that immunization
programs using fusions of bacterial proteins such as LE with
HTLV-III sequences presents a low risk of inducing a hyperimmune
response, notwithstanding the fact that humans are commonly exposed
to such proteins. Prokaryotic protein fusions for use in vaccines
are identified by screening pooled sera from normal individuals for
the presence of antibodies that cross-react with the candidate
fusion. Conventional methods such as Western Blotting or
radioimmunoassay are used for the screening, for example as shown
below in Example 2b.
EXAMPLE 2b
Enzyme-Linked Immunosorbent Assay (ELISA) for the Detection of
Antibodies to LEgp41
[0136] Purified LEgp41 (Example 2a) was coated in 96-well
microtiter plates in 0.05 M sodium carbonate pH 9.6 as described
(58). Sera were diluted 1:100 fold in TBS and incubated in coated
microtiter wells for 1 hour at room temperature. Following 3 washes
with TBS the plates were incubated for two hours at room
temperature with antibody-enzyme conjugate (mouse monoclonal
anti-human IgG F c-horseradish peroxidase, Travenol-Genentech
Diagnostics). Plates were again washed with TBS, developed with
3,3',5,5'-tetramethylbenzidine, and color development measured in a
plate reader (Dynatech) at 590 nm. Samples with absorbance values
greater than twice the mean of negative control sera were scored as
positive.
[0137] Significant antibody levels to purified LEgp41 were detected
in sera from 125 of 127 (98%) clinically diagnosed AIDS patients.
By comparison, none of 300 sera from random blood donors previously
shown to be seronegative for HTLV-III using a commercial whole
virus ELISA test kit were found to react with LEgp41 above the
cutoff absorbancy (OD590>0.12). The two AIDS patient sera which
did not react with LEgp41 were the only AIDS sera nonreactive by
commercial whole virus ELISA. One of these sera was found to react
with whole virus on Western Blots but this reactivity could be
attributable to p24 core antigen. The other LEgp41 negative AIDS
sera did not react with virus on Western Blots, although virus
could be cultured from this patient. The reactivity of LEgp41 with
the 125 positive AIDS sera was highly sensitive, ranging from
0.21-1.64 OD590 units, with only-3 sera giving OD590 values of
<0.4 units. Thus, recombinant LEgp41 shows excellent specificity
and sensitivity in detecting antibodies directed against the AIDS
retrovirus.
[0138] The purified LEgp41 ELISA similarly detected antibodies
found in sera from ARC (AIDS-related complex) patients and healthy
homosexual men. Sixty of 69 (86%) ARC patient sera reacted with
LEgp41, yielding essentially identical results as the commercial
whole virus ELISA. Of the 9 nonreactive ARC samples, Western blot
analysis with whole virus revealed that two of the sera were
positive for p24 only, while the remaining seven sera were
completely nonreactive although virus could be recovered from four
of these patients.
[0139] As expected, a small fraction of sera obtained from
asymptomatic homosexual men (26/75, 34%) was reactive in the LEgp41
ELISA. The 26 LEgp41 ELISA-positive sera from this cohort included
all 24 positive sera detected by the commerical whole virus ELISA
and were confirmed positive by Western Blots utilizing whole virus.
Significantly, two of the LEgp41 seropositive samples from healthy
gay men were found to be repeatably nonreactive in the commercial
whole virus ELISA.
[0140] There was no evidence of nonspecific reactivity in the
LEgp41 ELISA with sera from six patients with diseases that
characteristically give false-positive responses in other
serological tests (systematic lupus erythematosis, rheumatoid
arthritis, heterophile positive monomucleosis or Goodpasture's
syndrome). As an additional test of specificity, sera previously
giving false-positive reactions in a commercial whole virus ELISA
were examined by the LEgo41 ELISA. A group of 58 sera which had
given nonrepeatable positive results with the commerical whole
virus ELISA were found not to react in the LEgp41 ELISA.
Furthermore, 25 sera which gave repeatable positive results in the
commercial ELISA test, but which were negative in more accurate
Western Blot assays, also did not react in the LEgp41 ELISA.
EXAMPLE 3
[0141] Immunoassay of Expressed Recombinant Polypeptide
[0142] A. Expression of Full Length and Truncated p-24 and p-24
Fusion Polypeptide
[0143] E. coli 294 containing each of the Example 2 plasmids is
first grown in L broth which is rich in tryptophan. This medium
represses the trp promoter. Expression of recombinant polypeptide
is induced by transferring the culture to M-9 medium, which does
not contain tryptophan, after the L-broth culture has obtained an
O.D of approximately 0.5 at 550 nm. After about one hour, indole
acetic acid is added to the medium to produce a final concentration
of about 10 ug/ml to further induce expression. After an additional
5-6 hours at 37.degree. C. the cells are collected by
centrifugtation, lysea (47) and subjected to Western blot
analysis.
[0144] B. Immunological Assay of Expressed Polypeptides
Rabbit Anti-HTLV-III
[0145] The polypeptides expressed by the above-identified plasmids
were assayed for immunological reactivity with serum from rabbits
inoculated with Triton treated HTLV-III retrovirus and which were
subsequently boosted with live HTLV-III virus.
[0146] A Western blot of p24DE and p24DE.DELTA.HD3 polypeptides and
pHGHp24B and pHGHp24.DELTA.HD3 fusion polypeptides expressed in M-9
medium supplemented with indole acetic acid and reacted with
HTLV-III rabbit antiserum and .sup.125I labelled Protein A is shown
in FIG. 6. A number of immunologically reactive bands for the p24DE
polypeptide are apparent in lane 3. The band corresponding to a
molecular weight of about 44,000 daltons corresponds to an
expressed protein comprising p-24 and p-15. Surprisingly, two
doublets with molecular weights of approximately 24,000 and 15,000
were also observed. The cause of these doublet signals is not
presently understood. However, the detection of these doublet
signals with molecular weights which are consistent with the gag
proteins produced naturally from the polycistronic gag region
indicate that this strain of E. coli is capable of processing such
precursor polypeptide sequences to produce HTLV-III proteins which
may be detected by complementary antibody. A Western blot of
p-24DEAHD3 polypeptide is also shown in lane 4 of FIG. 6. Again, a
doublet having a molecular weight of about 20,000 daltons is
observed. The absence of a 44,000 dalton p-24/p-.sup.15 full length
HTLV-III protein and the 15,000 dalton doublet detected for p24DE
is consistent with the above interpretation of the p24DE Western
blot.
[0147] Lanes 5 and 6 of FIG. 6 contain respectively the
immunologically reactive proteins expressed by pHGHp24B and
pHGHp24.DELTA.HD3. The band in lane 5 having a molecular weight of
approximately 65,000 daltons is consistent with the expected
composite polypeptide constructed. Further, the band in lane 6 has
the expected molecular weight of about 45,000.
Assay with Human AIDS Serum
[0148] The polypeptide expressed by plasmid p24DE was assayed for
immunological reactivity with serum from an individual afflicted
with AIDS. In FIG. 7, strip 3 depicts the Western blot obtained
from p24DE polypeptide treated with human AIDS serum and .sup.125I
labelled Protein A. A diffuse band having a molecular weight of
approximately 24,000 daltons can be seen. Strip 2 is a control
which contains p-24DE polypeptide treated with normal human serum
and .sup.125I labelled protein A. Strip 1 contains size markers.
This assay indicates that polypeptides of the present invention can
be used to detect complementary antibody made in response to
exposure to or infection by an AIDS associated retrovirus.
Vaccine
[0149] The vaccines of the present invention are contemplated and
comprise the predetermined polypeptides and fusion polypeptides
previously described. The following examples disclose the use of
vaccines containing p-24 polypeptide sequences from HTLV-III.
However, any polypeptide sequence of an AIDS associated retrovirus,
especially those encoded by the env region of the retrovirus
genome, may be used.
EXAMPLE 3
[0150] Immunization of Mice
[0151] The polypeptides encoded by p-24DE and p-24DEAHD3 are used
to immunize BALB/C mice. Each mouse is immunized with 5-25 ug of
p-24DE or p-24DE.DELTA.HD3 polypeptide contained in 200 ul of an
emulsion consisting of 50% aqueous antigen and 50% complete
Freund's adjuvant. Each mouse is immunized at multiple intradermal
and subcutaneous sites as follows: 25 ul in each rear foot pad, 50
ul in the tail and 100 ul distributed among 3-5 intradermal sites
along the back. A control group is similarly injected with emulsion
which does not contain antigen. Four weeks after primary
immunization the mice are boosted with 5-25 ug of polypeptides as
above with the exception that the emulsion was prepared with
incomplete Freund's adjuvant. For the booster immunization each
mouse receives 200 ul of the antigen emulsion or emulsion lacking
antigen distributed as follows: 50 ul in the tail and 50 ul
distributed among intradermal sites along the back. Three weeks
after boosting approximately 500 ul of blood is collected from each
mouse by tail bleeding. The sera obtained from this blood is used
for in vitro neutralization studies.
[0152] In Vitro Neutralization Studies
[0153] Sera from mice immunized with p-24DE or p-24DEAHD3
polypeptide and from mice in the control group are tested for the
ability to neutralize HTLV-III in vitro. 25 ul of serially diluted
mouse serum (2-fold dilution: 1:8 to 1: 16384) is incubated with
175 ul of HTLV-III concentrate for one hour at 37.degree. in
Dulbecco's modified Eagle medium. After incubation, each dilution
is applied to approximately 40,000 HUT-78 T-cells (48) contained in
each well of a 96 well tissue culture plate. After 3-4 days
incubation, virus growth is determined by an immunofluoresence
assay for HTLV-III (49) or by a reverse transcriptase assay. The
absence of HTLV-III infection of HUT-78 T-cells indicates that the
polypeptide induces the production of neutralizing antibodies to
HTLV-III in mice.
[0154] Primate Assay for Neutralizing Antibodies
[0155] The polypeptides which raise neutralizing antibodies in mice
are used to immunize chimpanzees which are known to develop
generalized lymphadenopathy when infected by HTLV-III retrovirus.
Each chimpanzee in an experimental group is immunized with 50-100
ug of polypeptide contained in a 200 ul emulsion consisting of 50%
aqueous antigen and 50% complete Freund's adjuvant. Each chimpanzee
is immunized as follows at multiple intradermal sites. A control
group is injected with emulsion not containing antigen. After four
weeks the chimpanzees in each group are boosted with 200 ul of the
emulsion or antigen emulsion as above except that the emulsion is
prepared with incomplete Freund's adjuvant.
[0156] Five weeks after boosting, the chimpanzees in the
experimental and control group are challenged with various doses of
HTLV-III concentrate. Those polypeptides which prevent the
development of lymphadenopathy in the experimental group of
chimpanzees are candidates for a vaccine which is capable of
inducing the production of neutralizing antibodies in humans which
resist infection by AIDS associated retrovirus.
[0157] Because complete Freund's adjuvant is not acceptable for use
in humans, the above identified polypeptides which prevent
lymphadenopathy in chimpanzees challenged by HTLV-III are
formulated with an adjuvant suitable for human use. Such
formulation may comprise alum precipitated polypeptide complexes
(22) which are used to immunize chimpanzees in an experimental
group. A control group is vaccinated with adjuvant alone.
Formulations which prevent lymphadenopathy in the experimental
group comprise a polypeptide in admixture with a pharmaceutically
acceptable vehicle which may be used as a human vaccine.
EXAMPLE 5
[0158] The composite polypeptides encoded by pHGH p-24-B and
pHGHp24.DELTA.HD3 are used in a manner analgous to that disclosed
in Example 4 to determine which composite polypeptide confers
resistance to AIDS infection in chimpanzees as evidenced by the
absence of the development of lymphadenopathy in immunized
chimpanzees challenged with HTLV-III retrovirus. The use of HGH
polypeptide sequences in such composite polypeptides, however, is
not preferred for a human vaccine against infection by AIDS
associated retrovirus since such composite polypeptides may induce
an autoimmune response against HGH in human subjects. Accordingly,
a composite polypeptide vaccine to resist infection by an AIDS
associated retrovirus in humans should consist of a predetermined
sequence of an AIDS associated retrovirus or fragment thereof
expressed as a fusion polypeptide with a secondary polypeptide
sequence which is not capable of inducing a substantial autoimmune
response to polypeptides naturally occurring in humans.
AIDS Associated RNA Dependent DNA Polymerase
[0159] The polypeptide sequence of an AIDS associated RNA dependent
DNA polymerase (AIDS reverse transcriptase) is contemplated to be
used in an assay to identify compounds which inhibit such
transcriptase activity and which may be used as a pharmaceutical
agent to inhibit infection by AIDS associated retrovirus or
dissemination of such retrovirus in infected individuals. Suramin,
a known inhibitor of AIDS reverse transcriptase (53), is disclosed
in the following example. However, the assay of other compounds for
transcriptase inhibition is contemplated because of the severe
clinical side effects that Suramin elicits when administered to
humans (53). Examples of such selective inhibitors have been
disclosed by several laboratories (54).
EXAMPLE 6
A. Cloning and Expression of AIDS Reverse Transcriptase
[0160] The region of the viral genome encoding the AIDS associated
retrovirus reverse transcriptase of HTLV-III terminates at
nucleotide 4674. Its N-terminus is located within the region
extending from nucleotide 1639 to about nucleotide 1800. For the
purposes described below it is preferred to select an amino
terminus that is located within the gag region (1639-1769).,
thereby encompassing all optional amino terminii. The region
located proximate to nucleotide 1800 includes a number of suitable
met codons which are useful to the start codons for constructions
expressing the reverse transcriptase. However, it is not critical
that in situ met codons be selected. Instead, an exogenous,
vector-borne ATG codon is ligated to partial exonuclease digests or
M13 deletion mutants of the 5' region of the reverse transcriptase
gene. Constructions that are properly in-frame are easily
identified by the ability of transformant cell extracts to reverse
transcribe RNA. Alternatively, the normal in vivo N-terminus for
the reverse transcriptase as processed in a given host is
determined by purifying the enzyme from infected cells, sequencing
the amino terminus in accord with methods known per se and
identifying the cDNA nucleotide sequence encoding the amino acid
sequence of the amino terminus. Preferably, the cDNA of the figures
is digested with BglII, which cleaves at nucleotide 1642, and Sa1I
(5367). The 3725 bp fragment is recovered. N-terminal cleavage
sites other than BqlII are at 1738 (DdeI) and 1754 (AluI). However,
these. enzymes also cleave at points internal to the reverse
transcriptase gene. Thus, it would be necessary to conduct a
partial digest with DdeI or AluI in order to expect to recover a
full length gene. Another cleavage site other than SalI which is
located distal to the reverse transcriptase gene is that of StuI
(at 4987).
[0161] Having isolated DNA encoding the reverse transcriptase gene
which bears terminal ligation sites, the DNA is ligated into a
replicable vector. The vector will be selected depending upon the
intended host, and this in turn on whether the DNA is to be simply
replicated or whether it will be desired to use the vector for
expression of the enzyme. Ordinarily, the vector will contain a
bacterial origin of replication and an antibiotic selection gene,
e.g. for tetracycline resistance. These elements are available in a
large number of publicly known plasmids such as pBR322. Since it is
preferred to express the reverse transcriptase in higher eukaryotic
cells, the vector will also contain elements necessary for the
stable replication of the gene, for identification of
transformants, for promoting the transcription of the gene and for
properly terminating the transcribed mRNA in higher eukaryotes.
Typically, these will be respectively, the SV40 origin of
replication and a source of T antigen (such as supplied by
chromosomal integrants found in such cell lines as COS-1, available
from Cold Spring Harbor Laboratories), a gene encoding mouse
thymidine kinase, the SV40 early or late promoters and the
Hepatitis B surface antigen polyadenylation site. Such vectors are
known, for example, see EPA 73,656; 92,182 and 93,619 all of which
are incorporated by reference.
[0162] Known vectors may not contain convenient restriction sites
for direct insertion of the reverse transcriptase DNA obtained as
described above. This will not constitute an obstacle to those
skilled in the art since methods are known per se for introducing
new restriction sites or for converting cohesive-ended restriction
terminii into blunt ends. For example, the hepatitis surface
antigen gene in pHS94 of EPA 73,656 is excised by EcoRI and BamHI
digestion, EcoRI and BamHI linkers ligated to the BglII and SalI
sites of the cDNA fragment, respectively, and the modified cDNA
ligated into the vector fragment obtained from the pHS94 digestion.
Then the construction is completed in accord with-EPA 73,656.
[0163] The vector bearing the reverse transcriptase gene is
transfected into permissive hosts such as the COS-1 monkey kidney
cell lines or the CHO (Chinese hamster ovary) cell line. Other
stable eukaryotic cell lines may be employed as hosts, as well as
yeast and prokaryotes where appropriate origins of replication and
promoters are provided (for yeast, the two micron origin and a
promoter such as that of metallothionein, and for bacteria the
pBR322 origin and a promoter such as trp which is described
elsewhere herein in connection with expression of the gag and
envelope proteins of the AIDS associated retrovirus in
prokaryotes).
[0164] In this connection, other AIDS associated retroviral
proteins such as gag and envelope polypeptides may be expressed in
eukaryotic cells, whether yeast or mammalian, as such cells bear a
more immediate phylogenetic relationship to the normal retroviral
hosts than do prokaryotes.
[0165] The reverse transcriptase is preferably synthesized in
recombinant culture under the control of an inducible promoter so
that any toxic effects of the polymerase on the cell are minimized
until a generous amount of mRNA has accumulated. Alternatively, the
gene encoding the enzyme is ligated at its 5' end to a signal
sequence recognized and processed by the intended host, which in
the case of higher eukaryotes, for example, include the known
secretion signals for interferons, secreted hormones like insulin
or viral surface antigens.
[0166] B. Assay of Reverse Transcriptase Inhibition
[0167] A cell culture expressing AIDS reverse transcriptase is
lysed and divided into aliquots. Various amounts of the compound to
be assayed are added to each aliquot of lysate. An oligonucleotide
of polyA together with oligo dT primers and .sup.32P labelled TTP
is added to each aliquot. After incubation at 37.degree. C., the
amount of acid precipitated counts is determined. Those compounds
which inhibit AIDS reverse transcriptase but which do not
comparatively inhibit human DNA polymerase are then selected for
further in vitro toxicity and efficacy studies.
[0168] Alternatively, AIDS reverse transcriptase is recovered from
an expression host by methods known per se, including
immunoaffinity adsorption, Sephadex gel filtration, ion exchange
chromatography and electrofocusing on native polyacrylamide gels.
The recovered reverse transcriptase is then used to assay compounds
as described above.
EXAMPLE 7
Cloning and Expression of the E' Polypeptide
[0169] An E' polypeptide of AIDS-associated retrovirus is defined
as the 206 residue polypeptide designated "E'" in FIG. 2, its
naturally-occurring alleles, or its amino acid sequence variants
which are immunologically cross-reactive with antisera capable of
binding the E' polypeptide produced in cells infected with
AIDS-associated retrovirus. In addition to the C-terminal
deletional derivatives described below, other deletions, insertions
or substitutions that do not substantially change the
immunoreactivity of the peptide with sera from patients infected
with HTLV-III or other AIDS-associated retro viruses are included
within the scope of the term "E' polypeptide" or "E' protein" as
used herein. A further example of a deletional variant is E'
protein in which the first 19 residues, through Arg.sub.19, are
deleted. The trpLE fusion described below is an insertional
variant. Other variants will be apparent to the ordinary artisan.
They are readily produced by methods of recombinant synthesis or,
in the case of certain deletions, by proteolytic hydrolysis.
[0170] In accordance with this invention, E' polypeptides are
produced by recombinant methods so as to be free of proteins from
AIDS-associated retrovirus-infected cells that are not encoded by
the AIDS-associated retrovirus. Such polypeptides obviously are not
present in AIDS-associated retrovirus virions.
[0171] cDNA clone H9.c53 contained the E' sequence. The E' sequence
is shown in FIG. 2 commencing at nucleotide 8375. The first stop
codon in reading frame downstream from the ATG at 8375 is an OP
stop codon at nucleotide 8993. The Cys residue immediately
preceding this stop codon presumably is the C-terminus of the E'
polypeptide. However, other C-terminii upstream from this Cys
residue also are within the scope of this invention. E'
polypeptides include sequences that are C-terminated at any residue
within about the last 50 residues shown in FIG. 2, preferably
immediately adjacent and downstream from a lysinyl or argininyl
residue.
[0172] An expression plasmid for the synthesis of a fusion of the
E' polypeptide of FIG. 2 with a bacterial polypeptide is described
hereafter. One aliquot of H9.c53 was digested with HaeIII and XhoI
and the 62 bp fragment coding for E' residues 14-34 recovered
(fragment 1). Another aliquot was digested with XhoI and HindIII
and the 719 bp fragment was recovered which encodes amino acids
35-206 and contains the stop codon followed by untranslated 3'
sequence (fragment 2).
[0173] A synthetic oligonucleotide (fragment 3) was prepared (35)
having the following sequence encoding the first 13 residues of the
E'-polypeptide flanked at its 5' end by an EcoRI cohesive terminus
and ending with a 3"blunt end for ligation to the HaeIII-generated
blunt end of fragment 1.
3 PAATTCATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGG-OH
HO-GTACCCACCGTTCACCAGTTTTTCATCACACTAACCTACCP
[0174] pNCV (55a) was digested with EcoRI and HindIII, which are
unique sites in pNCV, and the vector fragment recovered. This
vector fragment was ligated simultaneously to fragments 1, 2 and 3,
the ligation mixture transformed into E. coli 294 and antibiotic
resistant colonies identified ptrpLE-E' was obtained form a
resistant colony by preparation of plasmid DNA. The structure of
this plasmid is shown in FIG. 9a.
[0175] ptrpLE-E' contains a continuous open reading frame encoding
a bacterial (E. coli) derived protein (LE) fused at its C-terminus
to the full E' sequence.
[0176] This plasmid was employed as follows to prepare the E'
protein fusion (LE-E'). ptrpLE-E' was transformed into E. coli
strain 294, grown overnight in LB broth (32) containing 5 mcg/ml
tetracycline, diluted 1:50 into M9 broth (32) containing
tetracycline and grown at 37.degree. C. to an absorbance of 0.5 at
550 nm. Total cell proteins were prepared from 25 ml of induced
cell culture. Cells were resuspended in 1/250 volume of 0.01 M
Tris-HCl pH 7.5, 0.001 M EDTA, 0.03 M mercaptoethanol- and 0.8%
SDS, boiled for 2 minutes and precipitated with 3 volumes of cold
acetone. The precipitated proteins were redissolved by boiling in
SDS-polyacrylamide gel loading buffer (40).
[0177] Initial attempts to directly express unmodified E' sequences
in E. coli were unsuccessful due to an apparent instability of the
protein. However, the foregoing method gave efficient expression of
the E' polypeptide in E. coli. LE is a protein of 190 residues
derived from translated sequences of the trp leader and trpE gene
product (55b), which forms stable, insoluble aggregates in vivo and
has been used successfully to stabilize synthesis of other foreign
proteins in E. coli (55c, 55a). Expression of the LE-E' fusion
protein from ptrpLE' is under the control of an E. coli trp
promoter and trp leader ribosome binding site (FIG. 9a). Cultures
of E. coli transformed with ptrpLE-E' were grown under conditions
of tryptophan depletion as described above to derepress the trp
promoter, and their proteins analysed by electrophoresis on 10%
SDS-polyacrylamide gel and staining with Coomassie blue. As shown
in FIG. 9b, cells containing plasmid ptrpLE-E' accumulate a
prominent protein of Mr 41,000 (lane b), which is not present in
cultures of E. coli transformed with pBR322 (lane c). The Mr 41,000
protein has two important characteristics of the expected LE-E'
fusion protein. First, this protein is seroreactive with antisera
to LE, and second, it has an Mr of 22,000 greater than LE (FIG. 9b,
lane a) consistent with the size predicted for a protein containing
206 additional amino acids.
[0178] To determine whether LE-E' exhibits antigenic sites
recognized-by human sera following exposure to the AIDS retrovirus,
total cell proteins extracted from E. coli transformed with
ptrpLE-E' were employed as an antigen in a Western blot assay. Note
that individual sera were first preadsorbed with a soluble extract
of E. coli proteins (blocking extract), although this was later
found to be unnecessary.
[0179] In the Western blot assay, total cellular proteins were
prepared from induced cultures of E. coli transformed with
ptrpLE-E' (FIG. 9a) or ptrpLE-gp41 (described above) and
electrophoresed on SDS-10% poylacrylamide gels as described above.
Proteins were electrophoretically transferred to nitrocellulose
sheets as described (55e). Individual blot strips were incubated
overnight at room temperature with a 1:200 dilution of the
indicated sera in TBS buffer (0.025 M Tris-HCl.pH 7.2, 0.15 M NaCl
and 0.05% Tween-20) containing 5% normal goat serum and 5 mcg/ml
protein blocking extract from E. coli transformed with pBR322.
Blocking extract was prepared by sonicating bacteria in 0.01 M
Tris-HCl pH 7.5, 0.15 M NaCl and 0.5% NP40, and removing the
insoluble residue by centrifugation at 10,000.times.g. Total cell
proteins prepared from E. coli transformed with pNCV or ptrpLE-E"
were employed for preadsorption of sera with LE or LE-E' proteins,
respectively. After extensive washing in TBS buffer, the strips
were successively incubated with biotinylated goat anti-human or
anti-rabbit IgG (Vector Labs), avidin conjugated horseradish
peroxidase (Miles-Yeda) and developed with peroxidase substrate
(0.5 ng/ml 4-chloro-1-napthol and 0.16% hydrogen peroxide in TBS).
Following each incubation, strips were washed extensively with TBS.
Sera from 37% of AIDS patients (17/46), 81% of ARC patients
(21/26), and 39% of healthy homosexual men (29/75) tested gave a
clear reaction with the LE-E' immunoblots, while none of 37 sera
from random blood donors was found to react (Table 1 below).
Identical results were obtained for a representative subset of
these sera in Western blot experiments in which total cell proteins
from E. coli transformed with plasmid ptrpLE17-E', a derivative of
ptrpLE', were utilized as the antigen. These cells express LE17-E',
a fusion protein that differs from LE-E' in that only residues 1-17
of the LE protein are present, indicating that the seroreactivity
detected between AIDS-related sera and LE-E' fusion proteins is
specific for epitopes associated with E' sequences.
4TABLE 1 Prevalence of antibodies to bacterial LE-E' in AIDS risk
groups Risk E'+/ E'+/ E'+/ E'+/ groups E'+ gp41+ gp41+ gp41- gp41+
gp41- WB+ WB+gp41+ AIDS 17/46 44/46 16/46 1/46 28/46 1/46.sup.(a)
45/45 44/46 ARC 21/26 22/26 19/26 2/26 3/26 2/26 22/26 22/26 HHM
29/75 24/75 18/75 11/75 6/75 40/75 24/75 24/75 cntrls 9/37 0/37
0/37 0/37 0/37 0/37 N.D..sup.(b) N.D. E', reactivity in LE-E'
western blot assay; gp41, reactivity in LE-gp41 western blot assay
(see Examples above); WB, reactivity in whole virus western blot
assay; HHM, healthy homosexual males; controls, random blood donor
samples. .sup.(a)This individual was positive in an HTLV-III
cultivation assay .sup.(b)All 37 control sera were seronegative in
a commercial whole virus ELISA (Abbott)
[0180] Two major points are evident from this comparison of LE-E'
and gp41 seroreactivity in different AIDS risk groups. First, LE-E'
seroreactivity is far less frequently detected than gp41
seroreactivity in AIDS patients (37% vs. 96%), but with roughly the
same frequency with sera from ARC patients (81% vs. 85%) and
healthy homosexual males (39% vs. 32%). Secondly, a significant
number of the healthy homosexual males were seropositive for LE-E'
but not gp41 (11/75). The fact that antibodies to E' are detectable
sooner than antibodies to env antigens in a statistically
significant number (11/75) of healthy homosexual males, a group at
high risk for developing AIDS and ARC, as well as a smaller number
of AIDS and ARC patients (3/72), was completely unexpected and
surprising particularly since no protein of the Mr of E' has been
identified as a virion component and, because E' contains no
apparent secretory leader, it would not be expected to find the
protein in the serum. Seroconversion to env antigens was monitored
by Western blots utilizing either whole HTLV-III virus (5Se) or a
recombinant LE-gp41 antigen (supra), each assay having a
reliability of >98% in detecting sera from clinically diagnosed
AIDS patients. Since many of the healthy homosexual mn studied here
were seronegative for E' as well as virus antigens and consequently
may not have been exposed to the virus, the actual frequency of
E'+gp41-individuals in this sample may be as high as 31% (11/35).
These results may be related to previous observations that HTLV-III
can be isolated from the lymphocytes of symptom-free seronegative
persons (55m), and have considerable practical importance for the
early clinical diagnosis of and screening for AIDS retrovirus
exposure.
[0181] In contrast to the situation found for asymptomatic
individuals with virus exposure and ARC patients, antibodies to E'
are detected at a much lower frequency than antibodies to gp41 env
in AIDS patients (37% vs. 96%). A similar pattern of less frequent
reactivity among AIDS patients has been previously noted for the
core protein p24gag relative to the major envelope protein gp120env
in radioimmo-precipitation analysis (55n). It is unclear whether
this phenomenon represents a differential susceptibility to
developing AIDS, but more likely reflects the selective loss of
antibody titers or lower titers to E' and p24gag than to viral
envelope antigens.
[0182] To obtain direct evidence for E' expression in
HTLV-III-infected cells, high titer antisera specific for E' were
prepared by immunizing rabbits with LE-E' isolated by preparative
SDS-polyacrylamide gel electrophoresis. The region of the gel
containing LE-E' (about 100 mcg) was excised, homogenized in
incomplete Freund's adjuvant and administered subcutaneously at two
week intervals. The rabbit sera were screened for the ability to
immunoprecipitate E'-related proteins from extracts of
HTLV-III-infected cells metabolically labelled with
.sup.35S-cysteine. The publicly available H9/HLV-IIIB cell line was
employed for this purpose, since we had previously observed that
these cells produce a high level of 1.7-1.9 kb mRNAs potentially
capable of encoding an E' translation product ({tilde over ()}1% of
polyA+ REM) (55e). Following four injections of antigen, sera
obtained from two rabbits were capable of immunoprecipitating 5-6
distinct proteins of Mr 23,500-28,000 from H9/HMLV-IIIB cells.
Preimmune sera from the same animals failed to immunoprecipitate
any one of these proteins. Furthermore, the immune sera did not
detect any of these proteins in uninfected H9 cells. The proteins
detected in H9/HTLV-IIIB cells by the immune sera included three
major proteins of Mr 28,000, 25,500 and 25,000 and two minor
proteins of Mr 26,500 and 23,500. In some experiments the Mr 23,500
protein could be resolved into two distinguishable species.
[0183] LE-E' positive sera from 3 AIDS patients and 1 ARC patient
were capable of imunoprecipitating proteins from the HTLV-III
infected cells of {tilde over ()}Mr 28,000 and 25,000 that were not
precipitated by sera from control donors the immmoprecipitation of
these proteins could be only partially displaced by LE-E' protein,
however, suggesting that the LE-E'+ AIDS and ARC sera recognize E'
determinant(s) not displayed by the recombinant protein.
[0184] This rabbit antiserum contained antibody capable of binding
AIDS-associated retroviral E' polypeptide but was free of any
antibody capable of binding any other AIDS-associated
retroviral-encoded polypeptide as well being free of bound E'
polypeptide. It conventionally is immobilized to facilitate
separations. For example, the antiserum or antibody is bound or
adsorbed to a polyolefin, e.g. polystyrene microtiter plate wells,
or to matrices to which anti-rabbit IgG (e.g. goat) has been
preadsorbed.
[0185] The E' protein next was expressed in recombinant mammalian
cell culture. Applicants' starting plasmid was obtained from pFD11
(EP 117,060A) by a complex procedure using certain plasmids
conveniently available to applicants. This procedure is not
preferred for use by the art. Instead, the starting plasmid is
preferably obtained from pFD11 by the following method. pFD11 is
digested with HindIII at its unique HindIII site and the vector
recovered. An adaptor having the sequence
5 AGCTTGGATCCTTTTTATCGATA ACCTAGGAAAAATAGCTATTCGA
[0186] is ligated to the vector fragment and transformed into E.
coli 294. pFD11d Is obtained from an ampicillin resistant colony.
The ligation of the adaptor into pED11 introduces BamH1 and Cla1
sites immediately upstream from the mouse DHFR gene. pFD11d is
digested with BamH1 and Clal and the vector fragment isolated.
[0187] H9C.53 was digested with BamH1 and TaqI and the fragment
(fragment 4) was isolated that contained the portion of the env
gene downstream from the BamH1 site at nucleotide 8053, the E'
coding region and its untranslated 3' region through to nucleotide
232. The untranslated 3' region included the 3' long terminal
repeat (LTR). The pFD11d vector fragment (supra) was ligated to
fragment 4 and E. coli 294 transfected. pSVE.E'DHFR was obtained
from an ampicillin resistant colony. The E'-encoding DNA thus was
placed under the transcriptional control of the SV40 early
promoter, while the LTR provided sequences for the cleavage and
polyadenylation of the E' gene transcripts together with sequences
for promoting transcription of the dhfr gene.
[0188] CHO dhfr-K1 DUX-B11 cells (5Sf) were grown on DMEM medium
containing 10% fetal bovine serum. Transfections with pSVE.E'DHMR
were performed by the calcium phosphate precipitation method (55g)
as described (55h). Following a 6 hour exposure to the vector, the
cells were shocked with 20% glycerol (v/v) in PBS (55i) and grown
for 11/2 days in nonselective medium. Cells were then passaged into
selective medium (F12 medium lacking glycine, hypoxanthine, and
thymidine and supplemented with 10% dialysed fetal bovine serum)
and refed every 2-3 days. A population of approximately 300
resistant colonies was massed after two weeks. Immunoprecipitation
analysis of a population of the initial dhfr+ colonies revealed a
barely detectable level of E'. This population was further
amplified for PSVE.E'DHFR by selection for growth in methotrexate
(55j, 55k). Approximately 2.times.10.sup.5 cells were seeded into a
100 m dish of selective medium containing 10 M methotrexate and the
media changed every 2 days. A population of approximately 50
resistant colonies arising after three weeks in this media
(CHO/E'.100) was massed and E' protein recovered as follows. The
cells were collected by centrifugation, washed with phosphate
buffered saline (PBS) and lysed in 2 ml of RIPA buffer (0.05M
Tris-HCl pH7.5, 0.15 M NaCl, 1% Triton X-100, 1% deoxycholate and
0.1% sodium dodecyl sulfate) containing 0.5% aprotinin. The extract
was preincubated for two hours with 10 mcl. of preimmune rabbit
sera at 4.degree. C., cleared twice with 50 mcl. of Pansorbin
(Calbiochem), and incubated overnight with 2 mcl. of rabbit
anti-LE-E' sera at 4.degree. C. The immunoprecipitate was incubated
for 30 minutes with 10 mcl. of Pansorbin, collected by
centrifugation and the pellet washed twice with RIPA buffer and
once with water. The immunoprecipitate is solubilized and E'
separated from the rabbit antibody by ultrafiltration,
electrophoresis or other conventional technique on a commercial
scale the antibody or antisera is preinsolubilized and E' eluted
from the immobilized immmoadsorbent using pH 3-5 buffer.
[0189] The population of colonies arising in 1.times.10.sup.-7 M
methotrexate (CHO/E'.100) produced significant amounts of two
E'-encoded proteins specifically immunoprecipitated by the rabbit
sera to LE-E' but not preimmune rabbit sera. Neither protein was
detectable in the parent CHO cells with the immune sera.
Furthermore, immunoprecipitation of both E'-related proteins
detected in CHO/E'.100 cells was readily competed by the LE-E'
protein but not the LE protein, demonstrating that the reaction was
specific for E' sequences.
[0190] A direct comparison shows that the two E'-related
polypeptides made in CHO/E'.100 cells have electrophoretic
mobilities identical with Mr 28,000 and 26,500 proteins observed in
H9/HTLV-IIIB cells. In addition, the relative amounts of these two
proteins in CHO/E'.100 and H9/HTLV-IIIB cells are essentially
identical. However, it is uncertain whether the 28,000 and
26,500H9/HTLV-IIIB cell proteins are chemically identical to the
E'-related recombinant polypeptides, produced herein.
Pulse-labeling studies indicated that neither protein in CHO cell
culture is the direct precursor of the other. Approximately 80-90%
of the Mr 28,000 and 26,500 E' protein was contained within the
cytosolic fraction of transfected CHO cells. Immunoprecipitation of
cell supernatants from CHO/E'.100 cultures did not reveal any
secreted E' proteins.
[0191] The recombinant E'-polypeptides are sterilized by passing a
solution of the polypeptides through a 0.22 micron filter in order
to remove bacteria. The filtrate is formulated into a vaccine by
further purifying the polypeptide, for example by gel filtration,
as desired and formulating the polypeptide into a
pharmaceutically-acceptable carrier such as isotonic saline, DSW
and the like. The amount of E' protein employed will be sufficient
upon S.C. injection, followed by i.v. boost, to generate a
detectable titer of anti-E' in the subject. This will necessarily
turn on the immunocompetence of the test subject, so the dose
frequency and route of administration of antigen must be determined
by the attending physician through monitoring of the serum anti-E'
levels. E'-containing vaccines optionally include other
predetermined AIDS-associated retroviral polypeptides such as gp41.
This will be helpful in ensuring a complete potentiation of the
immune response to a potential AIDS-associated retroviral
infection. The role of the E' gene protein in viral reproduction
and pathogenesis remains a major unanswered question raised by
these studies. Our ability to readily detect individuals who are
seroreactive with LE-E' but not with whole virus antigens on
immunoblots suggests that E' is not a virion component, but could
also be explained if E' were lost during virus purification. Others
have described unidentified proteins of Mr 25,000-28,000 in
HTLV-III-infected H9 cells immunoprecipitated by AIDS-related sera
(55o, 55n, 55p), which may correspond to E' proteins, but the same
polypeptides were not detected in HTLV-III virion preparations
(55o, 55p). In CHO/E'.100 cells most intracellular E' was found in
cytoplasmic rather than nuclear fractions, suggesting that E' does
not participate in a nuclear event such as transcription
initiation. These studies must be considered preliminary, however,
since they may not accurately reflect the location of E' in
infected cells.
[0192] Transcriptional mapping studies have suggested that E' may
be an abundantly expressed protein in infected cells. Approximately
20% of the viral RNA synthesized in H9/mLV-IIIB cells represents a
family of spliced, subgenomic 1.7-1.9 kb RNAs consisting of a 289
bp leader containing sequences 5 to gag, a middle exon located
upstream of env, and 1.3 kb of sequence from the 3' end of the
genome containing the E' gene (55e). Either of two additional short
untranslated leaders from the pol or P' regions may also be
present. Depending upon alternate utilization of two splice
acceptor sites (at nucleotides 5,359 and 5,558), a middle exon of
either 268 bp or 69 bp is generated (55e, 55q). The 268 bp exon
contains two AUG triplets not present in the 69 bp exon, one of
which may serve as the initiator codon for the tat reading frame
(5Sq). In 1.7-1.9 kb is that contain the 69 bp middle exon the
predicted E' ALG initiator codon is preceded by a single AUG
triplet, but we nonetheless expected it to be utilized efficiently
for translation initiation since the upstream AUG triplet is
flanked by unfavorable nucleotides (55r) and is followed by an
in-frame termination codon well upstream of the E' AUG initiator
(55s). Our ability to obtain efficient expression of E' proteins in
CHO cells with a plasmid containing the upstream AUG triplet
(pSVE.E'DHFR) confirmed our expectation. Alternative usage of the
two middle exons within the 4.3 kb viral mRNA class (55e),
similarly determines whether the tat reading frame precedes the env
gene. If differential splicing is the mechanism for generating
mRNAs encoding either the E' and env proteins or the tat reading
frame, it may represent a crucial regulatory event in the
reproduction of the AIDS retrovirus.
[0193] E' polypeptides or antibodies thereto are employed in
conventional assay procedures as are generally described above. For
assay of the E' polypeptide in the body fluids of test subjects
(serum, saliva, plasma, urine, etc.), a "competitive" type test kit
preferably will contain labeled (enzyme, radioisotope, fluorescent
group, etc.) E' polypeptide such as LE-E' or either species of E'
described above, antibody capable of binding E' polypeptide and,
optionally, other conventional reagents such as incubation and
washing buffers. This test kit is employed in methods known per se
for use with the selected label, e.g. ELISA, radioimmunoassay or
fluorescence polarization. Similarly, conventional "sandwich"
assays also are useful in determining the presence of E'
polypeptide or its antibody in test subject samples. Assays for the
E' protein are unusual for AIDS diagnosis because they are the
first known that are directed at determining a protein which is not
present in purified preparations of the AIDS virion but which are
encoded by the viral genome and apparently expressed by host cells
in the course of a viral infection and/or replication in vivo.
Detection of such proteins is a preferred diagnostic approach
because they are believed to constitute the first indicia of viral
infection, preceding the accumulation of virion antigens such as
env and the generation of host antibodies directed against
HTLV-III-encoded proteins.
[0194] It also is within the scope of this invention to assay body
fluids for DNA or RNA encoding the E' protein using standard
hybridization assays, e.g. Southern or Northern assays,
respectively. DNA or RNA is used in such assays that is merely
capable of hybridizing with the FIG. 2E'-encoding sequence; it need
not encode an E' protein. Such nucleic acids are readily
synthesized as oligonucleotides and then screened for the ability
to hybridize to the E'-polypeptide encoding DNA set forth in FIG.
2. The diagnostic nucleic acid is labelled in conventional fashion
using detectable tags such as radiophosphorus and the like.
EXAMPLE 8
[0195] Recombinant Synthesis of a Secreted Form of An HTLV-III
Retrovirus Envelope Proteins in Mammalian Cells
[0196] FIG. 11a illustrates the viral genome with the location of
each of the five major open reading frames of the virus. The env
reading frame encodes the viral envelope antigen utilized here. An
envelope fragment encoding amino acid residues 61-531 was used for
expression of a secreted envelope protein. This fragment was
ligated to a vector which contained the components necessary for
proper expression of this integrated envelope gene as well as for
selection in mammalian cells. "SV40 ori" contains an early promoter
from the SV40 virus ("E") which is utilized to drive transcription
of either the AIDS retrovirus envelope or the dihydrofolate
reductase (dhfr) gene. Transcription termination and message
polyadenylation are accomplished using signals derived from the 3'
non-translated region of the hepatitis B virus surface antigen gene
("HBV s Ag poly A signal"). Growth in E. coli is accomplished by
the inclusion of the ampicillin resistance gene ("Ap R") of pBR 322
as well as the origin of replication of this plasmid. Finally, the
murine dhfr gene is utilized as a selectable marker for
transfection and selection in chinese hamster ovary (CHO) cells
which lack this gene.
[0197] A. Construction of Expression Vector
[0198] The contemplated method for assembling this vector from
publicly available starting plasmids is as follows, this being a
modification of that method which was actually used. pE348HBV
E400D22 (also called pE342HBV E400D22, European patent application
117,058A) is digested with HpaI and the linearized plasmid
recovered (fragment 1). Those skilled in the art recognize that the
most efficient ligation in the next step is achieved when the
opened plasmid is treated with bacterial alkaline phosphatase. This
prevents insert-less recircularization of the plasmid. A
blunt-ended duplex stop linker having the coding sequence
TCTAGAGGATCCCCAACTAA-GTAAGATCTAG is ligated to vector fragment 1,
the ligation mixture transfected into E. coli 294 and the vector
recovered from an Amp.sup.r colony. Since the insert is blunted at
both ends it is conventional to confirm that the recovered plasmid
contains the insert in the correct orientation. The underlined
sequences represent stop codons in each of the three possible
reading frames. The inclusion of the stop linker introduces a
synthetic nine-residue polypeptide at the C terminus of the env
protein.
[0199] The stop-linkered vector is digested with XbaI, blunted with
Klenow, partially digested with EcoRI and a 5706 bp vector fragment
2 recovered. This digestion serves to remove the hepatitis B
surface antigen coding sequence.
[0200] Clone H9c.53 described above which contained HTLV-III
retroviral env cDNA is digested with HhaI, blunted with Klenow,
digested with EcoRI and the approximately 1.6 kB env-containing
fragment 3 ligated to vector fragment 2. A vector 4 containing the
complete envelope gene is recovered from an Amp.sup.r colony. This
vector is digested with NdeI, blunted with Klenow, and then
partially digested with PstI. Vector fragment 5 is recovered,
wherein the sequence located between a nucleotide located within
the Amp.sup.r gene in the 3' direction up to residue 61 of the env
protein is removed. This removes the 61 N-terminal residues of the
env protein, including the retroviral signal, the mature N-terminal
residue being at residue 31 of the gp 160 preprotein.
[0201] pgDtruncDHFR (EP 139,417A) is digested with PstI and PvuII
and 1514 bp fragment 6 recovered containing (a) the 3' portion of
the Amp.sup.r Amp.sup.r gene (corresponding to that part of the
sequence removed from vector 4 in the previous step), (b) an SV40
origin, (c) the 25 residue herpes gD protein signal and (d) the
first 25 N-terminal residues of the mature gD protein. Fragments 5
and 6 are ligated, the ligation mixture transformed into E. coli
294 and pAIDSenvtrDHFR was recovered from an Amp.sup.r colony.
[0202] In a closely related alternate method for constructing an
expression vector for gp120, pEH3Ba114 (also referred to as
pERBa114, EP 139,417A) was used in place of pE348HBV E400D22 and
constructed as described above except that the DHFR gene was
supplied by digesting pgDtruncDHFR with EcoRV and Sal and an
approximately 4 Kb fragment 7 recovered. The DHFR gene also can be
supplied from pE342 (EP 73,656A) or any other DHFR plasmid. Vector
5 was digested with EcoRV and Sal and vector fragment 8 recovered
containing the truncated env gene. Fragment 7 and 8 were ligated
and pgDHTLV3TRDHFR was recovered from an Amp.sup.r colony.
[0203] The skilled artisan will appreciate that the Above described
vectors for the expression of a gp120-viral protein fusion are
suitably modified for expression as fusions with other viral
polypeptides than those of herpes simplex. For example, a fusion
with hepatitis surface antigen is readily accomplished by inserting
DNA encoding the mature truncated or intact gp41 or gp120 protein
in place of the surface antigen stop codon, or vice versa, using
for example pE348 HBV as a starting plasmid. Selection of
appropriate restriction sites and synthetic adaptors as required
will be within the skill of the ordinary artisan.
[0204] Signal sequences other than the herpes gD signal are used as
well. Suitable signals include those of secreted eukaryotic
polypeptides or secreted polypeptides of mammalian host range
viruses which are known per se.
[0205] B. Transfection and Selection of Mammalian Cell Lines
[0206] On the day prior to transfection, cells from a confluent 10
cm.sup.2 dish of CHO DHFR.sup.- cells were split 1:10 into 2:10
cm.sup.2 dishes in F12/DMKM (Delbecco's modified Eagles medium),
10% FBS (fetal bovine serum)+GHT (glutamine, hypoxanthine,
thymidine)+penn-strep antibiotics and grown overnight at 37.degree.
C.
[0207] Preparation of Plasmid for Transfection
[0208] 75.lambda. 10 mM Tris, 1 mM EDTA 10 .lambda.g Plasmid DNA
(omitting DNA for mock transfection), 65.lambda. CaCl.sub.2 and
0.65 ml 2.times. hepes buffer, pH 7.1 were carefully mixed at room
temperature, and thereafter poured directly on the CHO cells with
media. Cells and DNA were incubated at 37.degree. C. for 3 hours.
The media were then aspirated and the CHO cell monolayers shocked
with 20% glycerol-PBS (2.5 ml) for 45 sec. The dishes were flooded
with 7.8 mls of F12/DMEM, aspirated and replaced with 12 ml
F12/DMEM. Cells were incubated at 37.degree. C. for 2 days and then
split 1:2 and 1:10 in F12 media containing 7% XDZ,FBS (extensively
dialyzed fetal bovine serum), with penn-strep. The cells were fed
again on day 4.
[0209] Selection and Amplification of New Cell Line
[0210] On day 7 the mock transfected cells were all dead. The
transfected CHO cells split 1:2 and grown to confluence. They were
split 1:3 into 310 cm.sub.2 dishes containing F12/DMEM, 7% XDZ, 50
nM MTX (Methotrexate)--100 nM MTX and 250 nM KTX. The dishes were
refed every 4 days until confluent monolayers had adapted to MTX.
The monolayers were then labelled in .sup.35S-met and assayed by
immunoprecipitation for the secreted env fusion.
[0211] Cells diluted 1:10 in selection media had 50-100 colonies at
day 10. The colonies were picked and clones grown up in F12/DMEM.
These clones were screened by radioimmunoprecipitation with
anti-env antisera. Positive clones were amplified in increasing
concentrations of MTX (500, 1000 and 3000 nM) until maximum
secretion of env fusion was observed.
[0212] C. Radioiimmunoprecipitation Analysis of Transfected CHO
Cells
[0213] Confluent 10 cm dishes were labelled with 66 .mu.C/ml of 35S
methionine for 4 hr at 37.degree. C. in RPMI 1640 medium lacking
methionine. The media were then collected and apoprotinin was added
(1%). Cells were removed by centrifugation. One ml of supernatant
was added to 100 .mu.L of 2.5 M NaCl, 2% Tween 80, 1-mg/ml BSA. Two
.mu.L of high titer human anti-AIDS antibody was added and
incubated 1 hr at room temp. Protein A Sepharose, pre-adsorbed with
non-transfected CHO protein lysates, was added (50 .mu.L) and the
mixture incubated 30 minutes at 37.degree. C. The Protein A
Sepharose beads were then washed by centrifugation 3 times in PBS,
0.2% deoxycholate, 0.2% Tween 20. A final water wash was followed
by resuspension of the Sepharose beads in a standard SDS PAGE
sample buffer. The samples were boiled 5 minutes, centrifuged, and
the supernatants were separated on SDS polyacrylamide gels. The
gels were then autoradiographed using Enlighten 30.
[0214] Cells producing large amounts of envelope synthesized a
120,000 Mr protein which was specifically immunoprecipitable by
anti HTLV-III retrovirus antibodies. This protein was found only in
plasmid transfected cells. The intracellular form of the antigen
was approximately 100,000 daltons in size, and it could be chased,
in a pulse-chase experiment, into 130,000 dalton, secreted protein.
This protein; was also found to react on Western blots when
incubated with anti-AIDS retrovirus antibodies.
[0215] D. Culture of Amplified Transformant CHO Cells
[0216] 1 confluent 10 cm.sup.2 dish of transformants from step B
was incubated with trypsin to free the cells and transferred to a
small roller bottle in 50 mls F12/DMEM 50:50 media w/o GHT, low
glucose, minus glycine+7% XDZ FBS. CO.sub.2 was introduced into the
bottle for 5 sec. and capped tightly. The bottle was rolled at
37.degree. C. and observed daily until confluent (.sup.-3
days).
[0217] The medium was decanted, cells rinsed once in 50 mls PBS,
and trypsinized for 5 min. at 37.degree. C. with 5 mls trypsin in
EDTA. Cells were suspended in 5 mls of F12/DMEM 50:50 plus 7% SDZ
FBS and the suspension placed into 850 cm.sup.2 roller bottles.
This procedure is continued until the desired number of bottles is
obtained. When the desired number of bottles reached about 85%
confluency, they were rinsed twice in 100 mls PBS and 125 mls
serum-free F12/DMEM 3:1 w/o GHT, low glucose, minus glycine added
to each bottle. The bottles were incubated at 37.degree. C. for 3
days. On the third day the media were poured off and retained. This
process was repeated twice. The 375 ml of medium collected from
each bottle was centrifuged at 2000 rpm for 5 min and Na Azide
added to inhibit any contaminant microbial growth.
[0218] E. Purification of Recombinant HTLV III Envelope Protein
[0219] E.I. Preparation of an Affinity Column for the Isolation of
Recombinant HTLV III Polypeptides
[0220] Sera from patients diagnosed with AIDS related complex
(ARC), were tested for the presence of antibodies reactive with
HTLV-III proteins by "Western" immunoblot analysis. Plasma from
individuals exhibiting a high titers to HTLV-III envelope protein
were collected, and immunoglobulins were purified by affinity
chromatography using Protein A-Sepharose CL-4B (Pharmacia Fine
Chemicals) according to the manufacturer's directions. The
purification procedure yielded material that was approximately 90%
pure as judged by polyacrylamide gel electrophoresis (PAGE)
visualized by silver staining. The purified immunoglobulins were
then covalently linked to Sepharose 4B (Pharmacia Fine Chemicals)
according to the manufacturer's instructions.
[0221] E.II Purification of Recombinant HTLV-III Envelope Protein
Fusion
[0222] Serum free cell culture medium from the method of step D was
harvested, clarified by passage through a 0.45 micron Nalgene
filter, and concentrated 50-fold by ultrafiltration using an Amicon
YM-10 ultrafiltration membrane. The concentrated medium was
dialyzed against phosphate buffered saline (PBS), and applied to an
affinity column of the type described above in E.I. After
application of the concentrated cell culture medium, the column
effluent was monitored spectroscopically at 280 nm and the column
was washed until the effluent was free of material adsorbing light
at this wavelength. Proteins retained on the affinity column were
eluted by treating the eluted from the column with 0.1 M acetic
acid, 0.5 M NaCl elution buffer. Material eluted from the column
was monitored spectroscopically, and was immediately treated with
114 Tris buffer to adjust the pH to near neutrality (pH 7-8). The
eluted protein was dialyzed against PBS and concentrated
approximately 5 fold by ultrafiltration with the use of an Amicon
YM-10 membrane. The resulting protein was analyzed by PAGE and
visualized by silver staining and "Western" immunoblotting. Based
on these analyses, the secreted truncated recombinant HTLV-III env
fusion exhibited a molecular weight of approximately 130 Kd, and
represented from 5-25% of the total protein eluted from the column,
depending on the preparation. Neuraminidase digestion of the fusion
reduced its size from 130 Kd to about 100 Kd, suggesting that the
secreted antigen possessed the complex form of N-linked
carbohydrate with terminal sialic acid residues (Hubbard et al.,
1981, "Ann. Rev. Biochem." 50: 555-583). The secreted fusion was
resistant to endoglycosidase H, but the intracellular 100 Kd form
was sensitive, generating a 69Kd species (Torentino et al., 1974,
"J. Biol. Chem." 249: 811-817). These results demonstrated that the
intracellular protein possessed the simple form of N-linked
carbohydrate (highmannose).
[0223] E.III. Immunization of Rabbits with Affinity Purified
Recombinant HTLV-III Envelope Protein Fusion
[0224] Rabbits were immunized with 30-50 micrograms of total
protein (prepared as described above) per immunization. For the
primary immunization, 30-50 micrograms of protein in 1 ml of PBS
was emulsified with an equal volume of complete Freund's adjuvant
and injected as follows: 0.5 ml in each rear footpad, 0.2 ml
injected at 5 intradermal sites along the back. The rabbits were
then boosted 14-21 days after the primary immunization. The antigen
emulsion for the booster immunizations was prepared the same way as
that for the primary immunization with the exception that
incomplete Freund's adjuvant replaced complete Freund's adjuvant.
For the booster immunizations each rabbit received a total of 2 ml
of antigen emulsion distributed as follows: 0.5 ml intramuscularly
in each thigh, and 1 ml distributed among 5 intradermal sites along
the back (0.2 ml per site). Animals were bled via the ear vein or
cardiac puncture 10 to 14 days after each boost. Antibodies
elicited against the recombinant HTLV-III envelope protein were
identified by "Western" immunoblot analysis using recombinant
HTLV-III 130K protein as the antigen. In the first experiment, one
of two rabbits formed antibodies reactive with the recombinant
HTLV-III protein after one booster immunization. The second rabbit
required additional booster immunizations to elicit the formation
of anti-rHTLV-III antibodies.
[0225] F. Neutralization of HTLV-III Retrovirus Infection
[0226] Various sera from either control rabbits, rabbits inoculated
with the recombinant envelope antigen, normal control patients, or
patients with known retrovirus neutralizing antibodies were heat
inactivated at 56.degree. C. for 30 minutes. The serum samples were
then mixed 1:1 with virus in wells containing RPMI 1640, 20% fetal
calf serum, penn-strep, and 2 .mu.g/ml polybrene. The wells were
incubated 1 hour at 4.degree. C., after which the plates were
returned to room temperature for 15 minutes. 1.times.10.sup.6 H9
human T cells were then added to each well, and the wells were
incubated in CO.sub.2 incubator. The cultures were split 1:1 on day
4. Cells were assayed for reverse transcriptase and
immunofluorescence on day 7 or 8. Immunofluorescence assays were
done on fixed cells using human antisera known to contain AIDS
retrovirus antibodies. The percentage of cells which were
fluorescent was a measure of the percentage of cells which were
infected by the virus. Reverse transcriptase assays of cell
supernatants were done as described. The reduction in reverse
transcriptase levels was indicative of virus neutralization. When
either control human or rabbit sera were mixed with the virus,
approximately 70-80% of the cells were fluorescent. Reverse
transcriptase assays gave approximately 1.6.times.10.sup.6 cpm
incorporated. When serum from a rabbit vaccinated with recombinant
envelope antigen was analyzed, the percentage of cells fluorescing
was 35% and the reverse transcriptase levels were 285,000 cpm.
Human serum known to neutralize the virus gave 0% fluorescence and
10,000 cpm reverse transcriptase. These results indicate
neutralization with the antiserum from rabbits vaccinated with the
recombinant antigen.
EXAMPLE 9
Construction and Expression of gp160, gp120 and Fusions and
Truncations Thereof
[0227] gp160 is the precursor to envelope proteins gp120 and gp41.
Infected cells express the intact gp160 molecule and then
proteolytically cleave it at a hydrophobic region starting at gp160
residue 517 in the amino terminus of gp41. The objective of this
example is to describe a method for preparing gp120, gp160 as well
as derivatives thereof containing varying selected gp41
sequences.
[0228] H9c.53, the HTLV-III proviral clone described above, was
digested with XhoI, the XhoI site filled, digested with EcoRI, and
the fragment spanning bp 5324 to 0.8476 was recovered (Fragment A),
This fragment contained the HTLV-III gp160 envelope gene.
[0229] pgDHTLV3FL+Pro, encoding the full gp160 sequence, was
prepared in the same way as a pgDHTLV3TRDHFR except that fragment A
(the full-length gene) was used in place of fragment 3 (the
truncated gene with its 3' end at the HhaI site).
[0230] pgDHTLV3FL+Pro was transfected into CHO DHFR.sup.- cells,
and pulse labelled with 35 S methionine in methotrexate in the same
fashion as described above in Example 8B.
[0231] Transformants were lysed in NP40 lysis buffer and the lysate
proteins separated by 7.5% SDS-PA reducing gels. A 160 kD band was
identified as gp160 by radioimmunoprecipitation. This gp160 species
contained the full length gp41 polypeptide, including the
hydrophobic regions having hydropathy hydrophobic levels in excess
of about +2 (on a scale of 4), in particular at about residues 512
to 538 and about 684 to 705, as well as all of gp120 except for the
61 amino terminal residues. These are readily inserted by replacing
the 25 residues of the gD mature sequence with the missing 61
residues of the gp160 amino terminus.
Additional gp160 Truncations
[0232] DNA encoding the truncated gp160 fusion in pgDHTLV3FL+Pro
was subjected to further manipulation in order to remove DNA
encoding gp41 or certain of its subsequences. The object was to
prepare envelope antigens containing gp120 and gp41 sequences, but
without hydrophobic gp41 regions spanning substantially all of
residues 512-538 and 684 to 705. Three expression plasmids were
constructed, pFB53, pFB58 and pFB56. pFB53 encodes a gp120 species
which is identical to gDtrunc (Example 8) except that the carboxyl
terminus is residue 514 rather than 531. This envelope protein also
is secreted.
[0233] pFB56 encodes a full length gp160 derivative from which
substantially the N-terminal hydrophobic domain of gp41 (residues
517 to 540) have been deleted.
[0234] pFB58 encodes the same derivative as pFB56 except that, in
addition, the carboxyl terminus of gp41 downstream from residue 614
is deleted.
[0235] Other envelope derivatives are within the scope hereof. For
example, full length gp41 is expressed as a fusion with a
heterologous signal (in this case heterologous meaning other than
the gp160 signal), and with or without either of the hydrophobic
regions described above. The hydrophobic regions are deleted or
substituted by hydrophilic domains, derived for example from other
AIDS-associated viral polypeptides.
[0236] The manipulations giving rise to pFB58. pFB53 and pFB56 will
be more readily understood by reference to the following Table and
chart. The chart depicts the flow scheme for plasmid construction
that led to each of the 3 final plasmids. 1
[0237] The following Table describes the construction of these
intermediate and final plasmids.
[0238] In general, each of the intermediate plasmids was
constructed by digesting a donor plasmid with restriction enzymes
as indicated and the desired fragment recovered. The recovered
fragment was then cloned into a designated recipient plasmid. The
recipient plasmids were digested with restriction enzymes as
indicated and the vector fragment recovered in each instance. In
the three instances where the recipient plasmid was digested with
BglII the vector fragment was treated with bacterial alkaline
phosphatase in order to prevent insert-less recircularization of
the plasmid during ligation. The donor plasmid fragment was cloned
into the recipient by ligating it to the recipient vector fragment
transforming E. coli 294 cells and recovering the product plasmid
from ampicillin resistant colonies. In those instances where the
insert contained BglII cohesive termini at both ends the product
plasmids having the correct orientation were identified by
restriction digest analysis.
[0239] For expression, each of pFB53, pFB56 and pFB58 were
transfected into CHO DHFR.sup.- cells and amplified as described in
Example 8B. Cell lysates and supernatants were analyzed by
radioimmuno-precipitation as described in Example 8C. The expected
product encoded by pFB53 was identified in culture fluid. The full
length gp160 derivative encoded by pFBS6 was identified in cell
lysates. The pFB5S embodiment of gp160 is secreted in two forms,
one corresponding to the unprocessed protein (unprocessed at the
gp120-gp41 processing site) and the other closely resembling gp120,
probably representing the gD-gp120 fusion having a C-terminus at
the normal gp120-gp41 processing site which is produced by
proteolytic removal of the truncated gp41 species encoded by
pFB58.
[0240] Obviously, the nonradioactive forms of the env proteins
described above are produced by culture without 35S methionine. The
embodiments of this Example are purified and analyzed for
neutralizing activity by the methods described in Example 8E.
6TABLE 2 Donor Donor Recipient Recipient Product Plasmid
Fragment(s)* Plasmid Fragment Plasmid gD HTLV-III AhaIII-BamHI pUC
13 SmaI-BamHI pFB40 FL + Pro (1228bp) pFB40 1. EcoRI-Alu pUC 13
EcoRI-BindIII pFB41 (525bp) (Fragment a) 2. MaoIII-BindIII (297bp)
pFB40 EcoRI-Alu pBR322 ClaI blunt- pFB42 (525bp) EcoRI pFB41
EcoRI-BindIII pUC 13 EcoRI-Sma pFB43 (822bp, Fragment b) gD
HTLV-III FL + Fro BindIII-EcoRV (977bp) pFB42 BglII-EcoRV gD
HTLV-III BglII-EcoRV pFB48 (314 bp, Fragment c) FL + Pro (Fragment
d) pFB43 PatI blunt- gD HTLV-III Fragment d pB50 .BglII FL + Pro gD
HTLV-III FL + Pro BglII pFB 48 BglII pFB53 (580bp, Fragment a)
pFB41 Fragment b pBR322 Fragment a pFB54 gD HTLV-III FL + Pro
Fragment a pFB 50 BglII pFB 56 pFB54 BglII-EcoRV gD HTLV-III
Fragment d pFB 57 (512bp) FL + Pro gD HTLV-III FL + Pro Fragment a
pFB 57 BglII pFB 58 *fragment lengths are approximate
[0241] Although the foregoing refers to particular preferred
embodiments, it will be understood that the present invention is
not so limited. It will occur to those ordinarily skilled in the
art that various modifications may be made to the disclosed
embodiments and that such modifications are intended to be within
the scope of the present invention.
[0242] The references cited herein or grouped in the following
bibliography and respectively cited parenthetically by number in
the foregoing text, are hereby incorporated by reference.
BIBLIOGRAPHY
[0243] 1. Emtage et al., Nature 283, 171 (1980); Davis, et al.
Proc. Natl. Acad. Sci. (USA), 5376 (1981); Weilanad, et al. Nature
292, 851 (1981).
[0244] 2. Kupper, et al., Nature 289, 555 (1981); Kleid et al.,
Science 214, 1125-(1981).
[0245] 3. Charnay et al., Nucleic Acids Research 7, 335 (1979);
Valenzuela et al., Nature 298, 247 (1982).
[0246] 4. Rose et al., PNAS 78, 6670 (1981).
[0247] 5. Yelverton et al., Science 219, 614 (1983).
[0248] 6. Burrell, C. et al., Nature 291, 503-506 (1981); Mackay et
al., PNAS 78, 4510-4514 (1981).
[0249] 7. Fauci, A. et al., Annals of Internal Medicine 100, 92
(1984).
[0250] 8. Marx, J. L., Science 224, 475 (1984).
[0251] 9. Groopman, J. E., Nature 308, 769 (1984).
[0252] 10. Wilson, T., Biotechnology p. 682 August (1984).
[0253] 11. Gallo, R. C. et al., Science 724, 500 (1984).
[0254] 12. Popovic, M. et al., Science 224, 497 (1984).
[0255] 13. Barre-Sinouss, F. et al., Science 220, 868 (1983).
[0256] 14. Vilmer, F. et al., Lancet 753, (1984).
[0257] 15. Chemical and Engineering News, 14 September (1984).
[0258] 16. Sarngadharen, M. G. et al., Science 224, 506 (1984).
[0259] 17. Kitchen, L. W. et al., Nature 312, 367 (1984).
[0260] 18. Bolivar et al., Gene 2, 95 (1977).
[0261] 19. Chang et al., Nature 275, 615 (1978).
[0262] 20. Itakura et al. Science 198, 1056 (1977).
[0263] 21. Goeddel et al., Nature 281, 544 (1979).
[0264] 22. Goeddel et al., Nucleic Acids Res. 8, 4057 (1980).
[0265] 23. European Patent Appln. Publ. No. 036776.
[0266] 24. Siebenlist et al., Cell 20, 269 (1980).
[0267] 25. Stinchcomb et al., Nature 282, 39 (1979).
[0268] 26. Kingsman et al. Gene 7, 141 (1979).
[0269] 27. Tschemper et al., Gene 10, 157 (1980).
[0270] 28. Jones, Genetics 85, 12 (1977).
[0271] 29. Hitzeman et al., J. Biol. Chem. 255, 2073 (1980).
[0272] 30. Hess et al. J. Adv. Enzyme Req. 7, 149 (1968).
[0273] 31. Holland et al. Biochemistry 17, 4900 (1978).
[0274] 32. T. Meniatis et al., Molecular Cloning (Cold Spring
Harbor Press. N.Y. 1982)
[0275] 33. Mandel et al. J. Mol. Biol.53, 154 (1970).
[0276] 34. R. Lawn et al. Nucleic Acids Res. 9, 6103-6114
(1981).
[0277] 35. Crea et al., Proc. Natl. Acad. Sci. USA 75(12), 5765
(1978).
[0278] 36. Deleted
[0279] 37. Wood, N. I., et al., Nature 312, 330 (1984).
[0280] 38. Gray, P. W. et al., Nature 295, 503 (1982).
[0281] 39. Messing, R. et al., Nucleic Acid Res. 9, 309-321
(1981).
[0282] 40. Laemelli, U. Nature 227, 680-685 (1970).
[0283] 41. Hunkapillar, M. et al. in Methods in Enzymology, 91,
227-231 (eds. Hirs, C. and Timasheff, S.) (Academic Press, N.Y.,
1983).
[0284] 42. Hewick, R. M. et al., J. Biol. Chem. 256:7990
(1981).
[0285] 43. Vieira, J. and Messing, J. GEM, 19, 259-268, (1982).
[0286] 44. McGrath et al., Nature 295, 423 (1982).
[0287] 45. DeBoer, H. et al. in Promoters, Structure and Function
(Praeger Scientific, 1982).
[0288] 46. Liu, C. et al., Nature 309, 82 (1984).
[0289] 47. Kirid, D., et al., Science, 214, 1125-1129 (1981).
[0290] 48. Gazdar, A. F. et al., Blood 55, 409 (1980).
[0291] 49. Gallo, R. et al., PNAS, 77, 7415 (1980).
[0292] 50. No reference
[0293] 51. No reference
[0294] 52. No reference
[0295] 53. Mitsua, H. et al., Science 226, 172 (1984).
[0296] 54. DeCiccio, J. Nat. Cancer Institute 61, 1187 (1978);
Verma, B. B. A. 473 (1974).
[0297] 55a. Kleid, D. et al., Science 214, 1125-1129 (1981).
[0298] 55b. Miozzaro, G. and Yanofsky, C., J. Bact. 133, 1457-1466
(1978).
[0299] 55c. Goeddel, D. et al., Proc. Natl. Acad. Sci. 76, 106-110
(1979).
[0300] 55d. Towbin, H., Staehlin, T. and Gordon, T., Proc. Natl.
Acad. Sci. 76, 4350-4353 (1979).
[0301] 55e. Muesing, M. et al., Nature 313, 450-458 (1985).
[0302] 55f. Urlaub, G. and Chasin, L., Proc. Natl. Acad. Sci. 77,
4216-4220 (1980).
[0303] 55g. Graham, F. and van der Eb, A., Virology 52, 456-467
(1977).
[0304] 55h. Wigler, M. et al., Proc. Natl. Acad. Sci. 76, 1373-1376
(1979).
[0305] 55i. Frost, E. and Williams J., Virology 91, 39-50
(1978).
[0306] 55j. Ringold, G., Dieckmann, B. and Lee, F., J. Mol. Appl.
Genet. 1, 165-175 (1981).
[0307] 55k. Kaufman, R. and Sharp, P., J. Mol. Biol. 159, 601-621
(1982).
[0308] 55l. Safai, B. et al., Lancet I:1438-1440 (1984).
[0309] 55m. Salahuddin, S. et al., Lancet II:1418-1420 (1984).
[0310] 55n. Barin, F. et al., Science 228, 1094-1096 (1985).
[0311] 55o. Veronese, F. et al., Science 229, 1402-1405 (1985).
[0312] 55p. Robey, W. et al., Science 228, 593-595 (1985).
[0313] 55q. Arya, S., Chan, G., Josephs, S. and Wong-Staal, F.,
Science 229, 69-73 (1985).
[0314] 55r. Kozak, M., Nucleic Acids Res. 9, 5233-5253 (1981).
[0315] 55s. Liu, C., Simonsen, C. and Levinson, A., Nature 309,
82-85 (1984).
[0316] 56. Rose, D. et al., Proc. Nat. Acad. Sci. USA, 78, 6670
(1981).
[0317] 57. Yelverton, E. et al., Science 219, 614 (1983).
[0318] 58. Voller, A. et al., Manual of Clinical Immunology 2d
(1980), American Society for Microbiology, pp. 359-371.
* * * * *