Nucleic acids involved in the responder phenotype and applications thereof

Abstract

The present invention relates to nucleic acid molecules encoding expression products involved in the Responder function, which contributes to the phenomenon of transmission ratio distortion. The present invention also relates to regulatory regions of the genes corresponding to said nucleic acid molecules. The present invention further relates to recombinant DNA molecules and vectors comprising said nucleic acid molecules and/or regulatory regions as well as to host cells transformed therewith. Additionally, the present invention relates to transgenic animals, comprising said nucleic acid molecules, recombinant DNA molecules or vectors stably integrated into their genome. The various embodiments of the invention have a significant impact on breeding strategies by allowing for the specific selection of genetic traits and in particular of sex. Further, the present invention finds applications in the development of contraceptiva.

Description

[0001] The present invention relates to nucleic acid molecules encoding expression products involved in the Responder function, which contributes to the phenomenon of transmission ratio distortion. The present invention also relates to regulatory regions of the genes corresponding to said nucleic acid molecules. The present invention further relates to recombinant DNA molecules and vectors comprising said nucleic acid molecules and/or regulatory regions as well as to host cells transformed therewith. Additionally, the present invention relates to transgenic animals, comprising said nucleic acid molecules, recombinant DNA molecules or vectors stably integrated into their genome. The various embodiments of the invention have a significant impact on breeding strategies by allowing for the specific selection of genetic traits and in particular of sex. Further, the present invention finds applications in the development of contraceptiva.

[0002] The mouse T/t-complex, a region of approximately 12 cM genetic distance on the proximal part of chromosome 17, contains several loci acting in concert to produce a phenomenon called transmission ratio distortion (TRD). The latter designation indicates the fact that the so-called t-haplotype form of this chromosomal region has a selective advantage over the wild type form in that it is transmitted to the offspring at non-mendelian ratios of up to 99%. This transmission at non-mendelian ratio is achieved by the concerted action of mainly four loci, the so-called Distorters Tcd-1 (D1), Tcd-2 (D2) and Tcd-3 (D3), and the Responder Tcr (R.sup.t)(Lyon 1984). Two more Distorters have been postulated by other authors (Silver and Remis 1987).

[0003] According to Lyon's model (Lyon 1986) which formally explains the genetic interactions of these loci, the Distorters D1, D2 and D3 act strongly and harmfully on the wild type allele of the Responder and weakly on the t form of the Responder (R.sup.t), leading to distortion in favor of R.sup.t. R.sup.t might protect sperm carrying it from this harmful action of the Distorters. The Distorters act in trans while the Responder acts in cis. This means that the chromosome which contains R.sup.t is transmitted at non-mendelian ratio to the offspring. If D2 or all the Distorters are present, the chromosome containing R.sup.t is transmitted at a frequency of more than 50% up to 99% to the offspring. If no Distorter or only D1 or D3 are present, however, the chromosome containing R.sup.t is transmitted at less than 50% to the offspring ("low" phenotype). The Distorters are only transmitted at ratios over 50% if they are located on the same chromosome as is R.sup.t. The cis-action of R.sup.t suggests that R.sup.t may be expressed at a stage of spermiogenesis when spermatids are no longer connected in a syncytium (Willison and Ashworth 1987). This would ensure that the product of R.sup.t would be restricted to the spermatozoon containing the t-haplotype form of the R locus. It is expected that expression in elongating spermatids or mature spermatozoa is compatible with this requirement. The trans-acting and cis-acting properties of the Distorters and the Responder, respectively, have been demonstrated by the transmission ratio properties of so-called partial t-haplotypes which carry only a subset of the above named loci (FIG. 1).

[0004] Genetic mapping of molecular markers on partial t-haplotypes allowed a more or less precise localization of D1, D2, D3 and R.sup.t to subregions of the T/t-complex and relative to these molecular markers (Lyon 1984; Fox et al. 1985; Herrmann et al. 1986; Silver and Remis 1987; Bullard et al. 1992). Only one locus, R.sup.t could be mapped fairly precisely to a region of appr. 200 kb, the so-called T66B region (Fox et al. 1985; Schimenti et al. 1987; Nadeau et al. 1989; Rosen et al. 1990; Bullard et al. 1992). The T66B region represents a chromosomal piece of the t-haplotype identified by a t-specific restriction fragment length polymorphism detected with the probe Tu66 (Fox et al. 1985). The T66B region is not present in the partial t-haplotypes t.sup.h44 and t.sup.h51, but is present in the partial t-haplotypes t.sup.low, t.sup.h2, t.sup.h49, t.sup.6, and in the complete t-haplotypes, e.g. t.sup.w5 or t.sup.w12 (FIG. 1). Another partial t-haplotype, t.sup.w71Jr1 (abbr. t.sup.Jr1) contains T66A and a part of T66B. The chromosomes t.sup.h44, t.sup.h51 and t.sup.Jr1 do not contain the R.sup.t function, whereas the other partial and complete t-haplotypes named above do. The t-haplotypes containing R.sup.t function must have the t-form of R, whereas the haplotypes t.sup.h44, t.sup.h51 and t.sup.Jr1 are expected to have the wild type form. The genomic region T66B has been cloned molecularly and analyzed. A partial restriction map covering appr. 145 kb of it has been published (Schimenti et al. 1987; Rosen et al. 1990; Bullard et al. 1992).

[0005] An extensive and careful search of this region for genes expressed during spermatogenesis has yielded a single gene, T66B-a or Tcp-10b.sup.t (Schimenti et al. 1988). Further mapping studies localized "sequences responsible for differential responder activity" to an interval of 40 kb at the telomeric end of the T66B region which includes Tcp-10b.sup.t (Bullard et al. 1992). No other transcription unit could be identified by these authors in the T66B region within the last 10 years. Tcp-10b.sup.t has been claimed to represent the candidate for R.sup.t, but a careful analysis showed that it does not encode Responder properties (Schimenti et al. 1988; Cebra-Thomas et al. 1991; Bullard and Schimenti 1990; Ewulonu et al. 1996).

[0006] The combined teachings of the prior art thus did not provide any clue how the genetic elements responsible for the Responder phenomenon might be identified. More importantly, the analyses referred to above questioned the prior art discussions that the Responder is a transcription unit. Accordingly, they taught away from the possibility that a transcription unit encoding the Responder might be located in the T66B region. The technical problem underlying the present invention was, accordingly, to overcome these long standing prior art difficulties and provide a genetic entity encoding the Responder function.

[0007] The solution to said technical problem is achieved by providing the embodiments characterized in the claims.

[0008] Accordingly, the present invention relates to a nucleic acid molecule comprising a transcription unit encoding in its 5' portion a kinase having a homology to the MARK2 kinase (Drewes et al., 1997) as well as to other kinases whereas the 3' portion of the nucleotide sequence has a high homology to the rsk3 kinase (Zhao et al., 1995) as well as to expression products thereof. The term "homology" as used in accordance with the present invention relates to more than 25% and preferably about 38% identity on the amino acid level. Thus, in accordance with the present invention, 38% identity was found in a region of 291 amino acids between MARK2 and the protein encoded by the nucleic acid molecule shown in FIG. 4a or 9. Preferably, the kinase gene encoded by the 5' portion lacks its 3' end which is preferably an untranslated region whereas the kinase gene encoded by the 3' portion lacks the 5' end and is preferably not translated.

[0009] Preferably or alternatively, the present invention relates to a nucleic acid molecule encoding an expression product involved in the Responder phenotype, which contributes to the phenomenon of transmission ratio distortion, selected from the group consisting of

[0010] (a) a nucleic acid molecule comprising the nucleic acid molecule as shown in FIG. 4a or 9, 7a, 7b, 7c, 7d or a fragment thereof;

[0011] (b) a nucleic acid molecule being an allelic variant or a homologue of the nucleic acid sequence of (a);

[0012] (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to a nucleic acid molecule of (a) or (b); and

[0013] (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code.

[0014] The term "Responder" or "R" as used in accordance with the present invention relates to mutant as well as wild type forms of the Responder locus.

[0015] The term "involved in the Responder phenotype", in accordance with the present invention relates to the fact that transcripts of all genes displayed on FIG. 4a or 9, 7a, 7b, 7d and the antisense transcript of 7c are detected in testis carrying complete t-haplotypes, whereas mapping of the genes displayed on FIG. 4a or 9 and 7a to the t-Responder region suggests that gene 4a or 9 and/or 7a is (are) the one(s) encoding t-Responder activity. In accordance with the further biological data described in this specification, in particular the data relating to the transgenic animals, it is proposed that pursuant to this invention, the gene displayed in FIG. 4a or 9 encodes t-Responder activity. The overall data suggest that several genes of the Responder (T66Bk) gene family may act in parallel within t-haplotype carrying spermatids and/or spermatozoa and are thus presumed to be involved in the Responder phenotype, whereby it is envisaged that t-Responder products may antagonize the negative effect of t-Distorter genes and antisense transcripts derived from Responder genes may reduce the activity of Responder genes encoding products with t-Responder as well as wild type or nearly wild-type Responder activity. The latter products may permit the negative action of t-Distorter genes.

[0016] It is, furthermore, envisaged in accordance with the present invention that alternative translation products from one mRNA-transcript may also be involved in the Responder phenotype (see, e.g., FIG. 13).

[0017] Specifically the cDNA sequence of T66Bk shown in FIG. 4a or 9 contains the MARK kinase and the rsk3 kinase homology regions. The cDNA sequence of T66Bk-2 shown in FIG. 7a contains only the MARK kinase homology region. The cDNA sequence of T66k-8 shown in FIG. 7b contains the complete sequence of T66Bk-2 except for a single base deleted between nucleotide position 1508 and 1509 resulting in a frame shift. The cDNA sequence of T66k-7as shown in FIG. 7c corresponds to an antisense transcript of a T66Bk family member. The cDNA sequence of T66k-20 shown in FIG. 7d shows a strong similarity to the above members of the T66Bk gene family.

[0018] The term "fragment" as used in connection with the nucleic acid molecule of the invention relates to a fragment that retains the Responder function. Preferably, said fragment comprises the portion of the nucleic acid molecule that has a homology to the MARK kinase referred to above or a part thereof.

[0019] As has been indicated above, in one embodiment of the nucleic acid molecule of the invention said expression product is an antisense RNA.

[0020] The term "an allelic variant or a homologue" comprises forms of the wild type or t-allele of the Responder "gene" which have been manipulated in vitro in order to achieve an optimal transmission ratio distortion effect and/or to adapt it to the specific requirements of the breeding scheme employed, thus improving the selectability of genetic traits. A number of standard manipulations known in the field are taken into consideration, such as those resulting in the exchange of phosphorylation sites (Ser, Thr, Tyr) on the Responder (poly)peptide for acidic or neutral (Ala) amino acid residues, mutagenesis of the active center, overexpression or knock out mutagenesis of said gene, construction of hypomorphic (poly)peptides by mutagenesis of ATP and/or GTP binding site(s), deletion of phosphorylation sites on said (poly)peptide, deletion of binding sites for other (poly)peptides involved in the Responder/Distorter signaling cascade, synthesis of antisense RNA, N-terminal or C-terminal truncations, introduction of frame shifts which alter part of the amino acid sequence of the protein, etc., resulting either in null, hypomorphic, constitutively active, antimorphic or dominant negative alleles. It is also envisaged that a distortion of the transmission ratio can be achieved with several, if not all, manipulated forms of the Responder gene suggested above. Thus, a manipulated Responder allele affecting the transmission ratio most effectively will have to be identified empirically by employing activity assays in cell culture systems and by employing transgenic animal systems.

[0021] It is also envisaged that one or several members of the T66Bk kinase gene family might function as Distorter(s), provided it is (they are) expressed during the diploid or early haploid phase of spermatogenesis allowing distribution of the gene products to all spermatozoa, or can be altered in vitro such as to function as Distorters. The latter may be achieved by in vitro manipulations such as those resulting in the exchange of phosphorylation sites (Ser, Thr, Tyr) on said Responder (poly)peptide for acidic or neutral (Ala) amino acid residues, N- or C-terminal truncation, frame shift, deletion of phosphorylation sites, deletion of binding sites for other (poly)peptides, mutagenesis of the active center, or overexpression of said gene or of antisense transcripts, resulting in constitutively active, hypomorphic, antimorphic or dominant negative gene products and expression of said gene products during the diploid or early haploid phase of spermatogenesis allowing distribution of the gene products to all spermatozoa, e.g. under the control of the Pgk2 promoter. These manipulations are envisaged to have a negative effect on sperm motility and/or fertilization capability. This negative effect may then be balanced by Responder constructs having the opposite effect. The latter could be restricted to those spermatozoa carrying the construct by expressing it under the control of the Responder gene promoter. It is envisaged that both types of spermatozoa would be negatively affected by the Distorter construct expressed in the diploid phase of spermatogenesis, whereas the sperm carrying, in addition, the Responder construct expressed in spermiogenesis would be partially or completely protected by the (poly)peptide expressed in it, and would thus gain an advantage in sperm motility and/or fertilization capability over the other sperm. This would lead to a transmission ratio distortion in favor of the "protected" spermatozoa. Preferably the Distorter construct expressed in both types of spermatozoa would encode a hypermorphic or constitutively active (poly)peptide, whereas the Responder construct expressed only in those spermatozoa carrying it should encode a hypomorphic, antimorphic or dominant negative (poly)peptide. Both constructs could be integrated on the same or on different chromosomes. Preferably both constructs would be integrated together on the X- or the Y-chromosome, resulting in the preferential or exclusive transmission of the X- or Y-chromosome and thus the preferential or exclusive fathering of female or male offspring, respectively.

[0022] The term "hybridizing" as used in connection with the present invention relates to stringent or nonstringent hybridization conditions. Preferably, it relates to stringent conditions. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory (1989) N.Y., Ausubel, "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley Interscience, N.Y. (1989), or Higgins and Hames (eds) "Nucleic acid hybridization, a practical approach" IRL Press oxford, Washington D.C., (1985). Stringent hybridization conditions are, for example, hybridization in 6.times.SSC, 5.times. Denhardt's reagent, 0.5% SDS, and 100 .mu.g/ml denatured DNA at 65.degree. C. and washing in 0.1.times.SSC, 0.1% SDS at 65.degree. C.

[0023] In accordance with the present invention and in contrast to the teachings of the prior art, it was surprisingly found that nucleic acid sequences responsible for the Responder phenotype are comprised at the centromere-close part of the T66 B region. It conforms with several criteria that would be expected for the Responder function:

[0024] a) it is located in the T66B region;

[0025] b) it is expressed in testis; and

[0026] c) it is expressed during spermatogenesis.

[0027] In accordance with the present invention, it is further envisaged that additional expression products may contribute to Responder function as has been indicated above which are not necessarily located in the B-region.

[0028] As has been indicated above, one of the transcription units (namely T66Bk) contributing to the Responder (R) phenotype apparently arises from two truncated genes. One of said genes has a high homology to the rsk3 gene, the second one has an homology to the MARK kinase recently identified (Drewes et al., 1997). Another transcription unit envisaged to contribute to the R phenotype, T66Bk-2, also has a homology to the MARK kinase, but lacks homology to the rsk3 gene as indicated above. The identification of the genetic basis underlying the R phenotype allows a number of genetic manipulations, in particular in connection with breeding schemes, to be conveniently carried out in the future. Such schemes will be addressed in more detail herein below.

[0029] In accordance with the present invention, it is envisaged that the expression products encoded by the nucleic acid sequences of the invention may contribute to the Responder phenotype in several different ways. Thus, in one embodiment one of the above indicated expression products are themselves sufficient to distort the transmission ratio. In another embodiment all of said expression products or combinations of them have to be provided in order to distort the transmission ratio, with certain combinations being more effective than others. In yet another embodiment of the present invention said expression products may work in an additive or synergistic manner. In a still further embodiment it is envisaged that antisense transcripts derived from one or several genes of the T66Bk gene family may contribute to the t-Responder function resulting in a lower level or abolishment of mRNA of one or several T66Bk genes and thus a lower level or abolishment of the corresponding (poly)peptides translated from said mRNA molecules. An example of such an antisense transcript is shown in FIG. 7c. Furthermore, it is suggested that the specifically identified nucleic acid sequences coding for expression products involved in the R phenotype may not be the only ones responsible for the Responder phenotype. Thus, it is envisaged that further nucleic acids encoding expression products that act in concert with the ones discussed above and that may contribute to the Responder phenotype are contained in the genome. Additionally, it is envisaged in accordance with the present invention that the nucleic acid molecules of the invention exert or enhance the Responder phenotype in conjunction with further sequences comprised, for example, in the T66A, T66B and T66C regions. Preferably, said additional regions encode MARK-related kinases.

[0030] Also, the person skilled in the art will, on the basis of the teachings of the present invention, be in a position to genetically manipulate the nucleic acid contributing to the Responder phenotype. He will further be in the position to screen the genome of an organism or cell of interest for additional nucleic acid sequences encoding Responder functions on the basis of the genetic organization of the Responder taught in accordance with the present invention. All these embodiments that are without further ado derivable from the specific teachings provided herein are also comprised by the present invention.

[0031] It is further envisaged in accordance with the present invention that the Responder may act as a component of a signaling cascade involved in sperm motility and/or the fertilization of oocytes. The t-Responder may act such as to protect the sperm carrying the t-form of the Responder from the negative actions of the t-Distorters whereas the sperm carrying the wild type form of the Responder is "poisoned" (see Lyon 1986). Therefore, the action of the t-form of the Responder somehow counteracts the t-Distorter function suggesting that the Distorters are part of the same signaling cascade. It is, thus, envisaged that the wild type gene or the products of any member of that signaling cascade, once molecularly known, can be manipulated such as to "poison" the sperm expressing either dominant active or dominant negative forms, or by overexpressing, reducing or abolishing the gene function of any member of said signaling cascade. Selection of genetic traits may then be easily achieved by manipulating the amino acid sequence, activity or expression level of any member of that signaling cascade and restricting the expression of the manipulated form preferentially or completely to those sperm carrying it, such as is the case for the Responder function. The promoter of the Responder or other promoters activating gene expression during the haploid phase of spermatogenesis would be a suitable means for achieving this restriction.

[0032] Accordingly, the present invention also relates to methods of influencing transmission ratio by manipulating the expression level or the protein activity of any other member of said signaling cascade. For the purposes of this invention, said cascade is termed "Responder/Distorter signal cascade". It is further envisaged in accordance with the present invention that other signaling cascades may exist besides the Responder/Distorter signaling cascade that may be involved in the motility and/or fertilization capability of spermatozoa. Thus, it is envisaged in accordance with the present invention that the expression level and/or activity of one or more of the proteins involved in said other signaling cascades may be also manipulated in order to influence the transmission ratio. Influencing transmission ratio implies that said ratio may be enhanced or reduced. Methods for manipulating said expression level or said protein activity are known in the art and comprise methods of manipulating amino acid sequences and/or, e.g., promoter strengths or expressing an inhibitor of any member of said signaling cascade. Alternatively, it is envisaged that the expression level may be modulated on the transcription level, the level of pre-mRNA processing, mRNA transport and/or stability, and/or the translation level. Preferably, the modification and/or replacement of elements does not alter the tissue specificity or the specificity for the developmental stage of the expression unit. It is also envisaged in accordance with the present invention that the genetic background of the host organism, the site of integration, and/or the number of integrated copies of a transgene construct may influence the expression efficiency of said transgene construct. Expression or activity of one or more of said members may (significantly) be altered or enhanced, (significantly) be reduced or abolished. Said members also include the Distorters. These methods of the invention can, either alone or in conjunction with other methods described below, advantageously be used for the generation of transgenic animals. Said transgenic animals provide a suitable assay system to test whether the above mentioned methods for manipulating said expression level or said protein activity were successful. Such a system is described in Example 6. Furthermore, said transgenic animals may be employed in any of the breeding schemes addressed below.

[0033] In another preferred embodiment of the invention, said nucleic acid molecule is a DNA molecule.

[0034] The deduction of the amino acid sequence from the nucleic acid sequence of the invention allows the conclusion that the polypeptide is the expression product that contributes to the Responder phenotype. However, it is not excluded that the mRNA contributes to or triggers said Responder phenotype. Also, it is envisaged in accordance with the present invention that the expression level, stage of expression during spermatogenesis or the copy number of said gene results in or contributes to the Responder phenotype. Therefore, in a preferred embodiment of the nucleic acid molecule of the invention said expression product is an RNA or a (poly)peptide.

[0035] A further preferred embodiment of the invention is a nucleic acid molecule, wherein said Responder function is the mouse-t-complex Responder function. Although it is easily possible to identify mutated or wild-type Responders in animals other than the mouse on the basis of the genetic structure of the Responder that is provided in accordance with the present invention, the mouse t-complex Responder may find applications, for example in breeding, also when introduced into other animals. Specific applications of the Responder function are addressed herein below.

[0036] The invention further relates to a regulatory region of the gene corresponding to the nucleic acid molecule of the invention being capable of controlling expression of said nucleic acid molecule.

[0037] The term "corresponding" as used in accordance with the present invention also means that the gene comprises the nucleic acid molecule of the invention or fragments thereof.

[0038] The term "regulatory region" in the present application refers to sequences which influence the specificity and/or level of expression, for example in the sense that they confer cell and/or tissue specificity. Such regions can be located upstream of the transcription initiation site, but can also be located downstream of it, e.g., in transcribed leader sequences or in an intron.

[0039] The term "a regulatory region of the gene corresponding to the nucleic acid molecule" refers to a region with the above mentioned capabilities that controls expression of the bipartite nucleic acid molecule referred to herein also as a "gene".

[0040] Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to those skilled in the art. They usually comprise promoters ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers.

[0041] Preferably, said regulatory region is a naturally occurring regulatory region or a genetically engineered derivative thereof.

[0042] More preferably, said regulatory region comprises or is a promoter. Said promoter is preferably tissue specific and confers expression, for example, during spermiogenesis.

[0043] The term "promoter" refers to the nucleotide sequences necessary for transcription initiation, i.e. RNA polymerase binding, and also includes, for example, the TATA box.

[0044] In one embodiment, said promoter is or comprises a minimal promoter.

[0045] According to the present invention, promoters from other species can be used that are functionally homologous to the regulatory sequences or the promoter of the murine gene, or promoters of genes that display an identical pattern of expression, in the sense of being expressed in sperm cells. As has been outlined above, it is possible for the person skilled in the art to isolate with the help of the known murine nucleic acid corresponding genes from other species, for example, human. This can be done by conventional techniques known in the art, for example, by using the nucleic acid molecule of the invention as a hybridization probe or by designing appropriate PCR primers. It is then possible to isolate the corresponding promoter region by conventional techniques and test it for its expression pattern. For this purpose, it is, for instance, possible to fuse the promoter to a reporter gene, such as the lacZ gene or green fluorescent protein (GFP) and assess the expression of the reporter gene in transgenic mice.

[0046] The present invention also relates to the use of promoter regions which are substantially identical to the murine promoter or to a promoter of a homologous gene or to parts thereof and which are able to confer specific expression in sperm cells.

[0047] Such promoters differ at one or more positions from the above-mentioned promoters but still have the same specificity, namely they comprise the same or similar sequence motifs responsible for the above described expression pattern. Preferably such promoters hybridize to one of the above-mentioned promoters, most preferably under stringent conditions. Particularly preferred are promoters which share at least 85%, more preferably 90-95%, and most preferably 96-99% sequence identity with one of the above-mentioned promoters and have the same specificity. Such promoters also comprise those which are altered, for example by deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s) and/or any other modification(s) known in the art either alone or in combination in comparison to the above-described nucleotide sequence. Methods for introducing such modifications in the nucleotide sequence of the promoter of the invention are well known to the person skilled in the art. It is also immediately evident to the person skilled in the art that further regulatory sequences may be added to the promoter of the invention. For example, transcriptional enhancers and/or sequences which allow for induced expression of the promoter of the invention may be employed. A suitable inducible system is for example tetracycline-regulated gene expression as described, e.g., by Gossen and Bujard (Proc. Natl. Acad. Sci. USA 89 (1992), 5547-5551) and Gossen et al. (Trends Biotech. 12 (1994), 58-62).

[0048] Most preferably, said regulatory region comprises the fragment from nucleotides 930 to 3576 of the sequence shown in FIG. 11.

[0049] Also comprised are fragments or variants of the above sequence wherein the regulatory function of said fragments or variants is essentially retained or even improved. This may be tested according to methods well known in the art in combination with the teaching of this specification.

[0050] The invention further relates to a recombinant DNA molecule comprising a nucleic acid molecule of the invention and/or a regulatory region of the invention and/or a regulatory region allowing expression during spermatogenesis/ spermiogenesis.

[0051] Accordingly, the regulatory region may control expression of the nucleic acid molecule contributing to the Responder function. Alternatively, said recombinant DNA molecule may comprise said regulatory region which controls expression of a heterologous nucleic acid or which is not operatively linked to any nucleic acid and, thus, may be used for cloning purposes. In the first alternative, said regulatory region is operatively linked to a heterologous DNA sequence. For example, said regulatory region may be operatively linked to a naturally occurring or in vitro engineered DNA encoding a member of the Responder/Distorter cascade, for example, a Distorter or a member of another signaling cascade involved in sperm motility and/or fertilization. Also, in this embodiment of the invention, the nucleic acid molecule of the invention may be operatively linked to a different or to no regulatory region. The regulatory region may be the original regulatory region of the gene corresponding to the nucleic acid molecule of the invention or may be derived from a different copy of said gene or from a different gene. Furthermore, the regulatory region may be derived from a copy of the homologous gene (in case more than one copy exists) from a different species or may be derived from a different gene from said different species. The above mentioned regulatory regions may also be modified in order to obtain optimum expression, which may be enhanced or reduced expression. Thus, it is envisaged in accordance with the present invention that e.g., the regulatory regions controlling expression of the gene comprising the T66k-20-cDNA (see FIG. 7d) or the cDNAs shown in FIG. 10 are used in unmodified or modified form in accordance with the present invention. Due to the teaching of the present invention, namely the cloning and the disclosure of the sequences of the cDNAs, it is routine experimentation for the person skilled in the art to clone and use said regulatory regions.

[0052] Advantageously, the recombinant DNA molecule of the invention may further comprise an expression unit encoding and expressing a desired genetic trait. Such a DNA molecule may be used to reduce, or enhance the inheritance of said desired genetic trait, provided that either the recombinant DNA molecule further comprises an expression unit encoding and expressing at least one Distorter or protein with Distorter activity, preferably D2, or the genetic background of the host provides such Distorter activity which may be naturally occurring in said host or which may have been introduced.

[0053] A particularly preferred embodiment of the invention relates to a recombinant DNA molecule, wherein said heterologous DNA sequence encodes a peptide, protein, antisense RNA, sense RNA and/or ribozyme.

[0054] As regards the antisense RNA, it may find applications in methods of antisense therapy or antisense knockout strategies. Antisense therapy may be carried out by administering to an animal or a human patient, a recombinant DNA containing the regulatory sequences of the invention operably linked to a DNA sequence, i.e., an antisense template which is transcribed into an antisense RNA. The antisense RNA may be a short (generally at least 10, preferably at least 14 nucleotides, and optionally up to 100 or more nucleotides) nucleotide sequence formulated to be complementary to a portion of a specific mRNA sequence. Standard methods relating to antisense technology have been described (Melani, Cancer Res. 51 (1991), 2897-2901). Following transcription of the DNA sequence into antisense RNA, the antisense RNA binds to its target mRNA molecules within a cell, thereby inhibiting translation of the mRNA and down-regulating expression of the protein expected to be encoded by the mRNA. For example, an antisense sequence will be complementary to a portion of or all of the mRNA. In addition, ribozymes may advantageously be employed to eliminate wild-type Responder transcripts from cells.

[0055] The invention further relates to a recombinant DNA molecule, wherein said peptide, protein, antisense RNA, sense RNA, a toxin and/or ribozyme is capable of causing cell death.

[0056] In this embodiment of the invention, sperm which do not carry the R related transgene can be genetically selected.

[0057] For example, the promoter of the R gene can be used for the expression of a gene product inducing the destruction or apoptosis of said spermatocytes carrying said construct. Integration of such a construct on the X- or Y-chromosome will result in the transmission of the respectively other sex chromosome. Integration of the construct on the X chromosome will lead to the neutral transmission of the construct in female animals. Integration in the Y chromosome should, preferably, be in an inactive state that can be activated along the rules that will be laid down herein below.

[0058] A recombinant DNA molecule which further comprises DNA encoding an effector polypeptide is a further preferred embodiment of the invention.

[0059] It is particularly preferred that said effector polypeptide is capable of sequestering an ion selectively binding to a solid support, or binding to a preselected antigenic determinant or is a toxin, an enzyme, a ribozyme, a label or a remotely detectable moiety.

[0060] In accordance with the invention, it is most preferred that said effector polypeptide is calmodulin, methallothionein, a fragment thereof, green fluorescent protein (GFP), .beta.-lactamase (Zlokarnik et al., 1998), hCD24, myc, FLAG, hemagglutinin or an amino acid sequence rich in at least one of glutamic acid, aspartic acid, lysine, histidine or arginine.

[0061] Accordingly and in other words, the above embodiments of the invention relate to the use of the R promoter for the expression of a (poly)peptide being or having a tag. Said tag may be expressed in the cytoplasm of sperm. An example of such a tag is GFP or .beta.-lactamase. Said tag is alternatively located on the surface of sperm and thus, may be recognized by specific antibodies. This enables the separation of sperm carrying a transgene expressed under the control of the R promoter from sperm not carrying said transgene. The person skilled in the art is familiar with a variety of methods for the separation of sperm carrying said tag on its surface. Preferably, said tag is selected by affinity chromatography or by using a cell sorter. After separation, sperm carrying the transgene or sperm without the transgene can be used for fertilization of eggs. This embodiment includes integration of transgene in either autosomes or sex chromosomes.

[0062] Advantageously, the solid support referred to above is a membrane or the surface of an ELISA plate.

[0063] Further, the invention relates to a vector comprising the nucleic acid molecule of the invention, the regulatory region of the invention or the recombinant DNA molecule of the invention.

[0064] The vector of the invention may simply be used for propagation of the genetic elements comprised therein. Advantageously, it is an expression vector and/or a targeting vector. Expression vectors such as Pichia pastoris derived vectors or vectors derived from viruses such as CMV, SV-40, baculovirus or retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the recombinant DNA molecule or vector of the invention into targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, loc. cit. and Ausubel, loc. cit. Alternatively, the recombinant DNA molecules and vectors of the invention can be reconstituted into liposomes for delivery to target cells.

[0065] It is preferred according to one further embodiment that said vector comprises a heterologous promoter.

[0066] Said heterologous promoter not naturally operatively linked with the nucleic acid contributing to the Responder function may be used to determine a certain time point of the onset of Responder expression. This time point may be the same or a different one that is set when the natural Responder transcription unit is employed. For example, said heterologous promoter may also be active in the early or late haploid phase of spermatogenesis.

[0067] It is particularly preferred that said heterologous promoter is controlling gene expression in spermatogenesis and/or in spermiogenesis.

[0068] Most preferably, said heterologous promoter is the testis promoter of c-kit or of Angiotensin-Converting-Enzyme (ACE), both of which are well known in the art.

[0069] The invention further relates to a host cell transformed or transfected with the nucleic acid molecule, the recombinant DNA molecule or the vector of the invention.

[0070] The host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell. Prokaryotic host cells will usually only be employed for the propagation of the nucleic acid molecule of the invention and sometimes for the production of the expression product. Suitable mammalian, fish or bird cell lines are well known or can easily be determined by the person skilled in the art and comprise COS cells, Hela cells, primary embryonic cell lines etc.

[0071] The term "transfected or transformed" is used herein in its broadest possible sense and also refers to techniques such as electroporation, infection or particle bombardment.

[0072] Furthermore, the invention relates to a method of recombinantly producing an expression product as defined herein above comprising the steps of culturing the host cell of the invention under conditions to cause expression of the protein and recovering said protein from the culture.

[0073] The method of the invention is most advantageously carried out along conventional protocols which have been described, for example, in Sambrook, loc. cit.

[0074] The invention further relates to an expression product encoded by the nucleic acid molecule of the invention or which is obtainable by the production method of the invention.

[0075] In accordance with the invention, said expression product may either be an mRNA or a polypeptide. Said expression product is, in accordance with the present invention, involved in the Responder phenotype and contributes to the phenomenon of transmission ratio distortion.

[0076] A further embodiment of the invention relates to an antibody specifically recognizing the expression product of the invention.

[0077] The antibody of the invention may be a monoclonal antibody or an antibody comprised in a polyclonal serum. Accordingly, the term "antibody" as used herein also relates to a polyclonal antiserum. In addition, said term relates to antibody fragments or fusion proteins comprising antibody binding sites such as Fab, Fv, scFv fragments etc. The antibody of the invention has a number of applicabilities including purification or diagnostic processes.

[0078] The invention additionally relates to a nucleic acid molecule specifically hybridizing with the nucleic acid molecule of the invention translatable into said MARK related kinase or to an intron of said nucleic acid molecule or with the regulatory region of the invention or with a complementing strand thereof.

[0079] Said nucleic acid molecules comprise at least 15 nucleotides in length and hybridize specifically with a nucleic acid or regulatory sequence as described above or with a complementary strand thereof. Specific hybridization occurs preferably under stringent conditions and implies no or very little cross-hybridization with nucleotide sequences having no or substantially different regulatory properties. Such nucleic acid molecules may be used as probes and/or for the control of gene expression. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary in length. Preferred are nucleic acid probes of 17 to 35 nucleotides in length. Of course, it may also be appropriate to use nucleic acids of up to 100 and more nucleotides in length. The nucleic acid probes of the invention are useful for various applications. On the one hand, they may be used as PCR primers for amplification of regulatory sequences according to the invention. In this embodiment, one of the primers may hybridize to the 3' portion of the Responder having a high homology to the rsk3 gene. Another application is the use as a hybridization probe to identify regulatory sequences hybridizing to the regulatory sequences of the invention by homology screening of genomic DNA libraries. Nucleic acid molecules according to this preferred embodiment of the invention which are complementary to a regulatory sequence as described above may also be used for repression of expression of a gene comprising such regulatory sequences, for example due to an antisense or triple helix effect or for the construction of appropriate ribozymes (see, e.g., EP-B1 0 291 533, EP-A1 0 321 201, EP-A2 0 360 257) which specifically cleave the (pre)-mRNA of a gene comprising a regulatory sequence of the invention. Selection of appropriate target sites and corresponding ribozymes can be done as described for example in Steinecke, Ribozymes, Methods in Cell Biology 50, Galbraith et al. eds Academic Press, Inc. (1995), 449-460. Furthermore, the person skilled in the art is well aware that it is also possible to label such a nucleic acid probe with an appropriate marker for specific applications, such as for the detection of the presence of a nucleic acid molecule of the invention in a sample derived from an organism.

[0080] The above described nucleic acid molecules may either be DNA or RNA or a hybrid thereof. Furthermore, said nucleic acid molecule may contain, for example, thioester bonds and/or nucleotide analogues, commonly used in oligonucleotide anti-sense approaches. Said modifications may be useful for the stabilization of the nucleic acid molecule against endo- and/or exonucleases in the cell. Said nucleic acid molecules may be transcribed by an appropriate vector containing a chimeric gene which allows for the transcription of said nucleic acid molecule in the cell. Such nucleic acid molecules may further contain ribozyme sequences which specifically cleave the (pre)-mRNA comprising the regulatory sequence of the invention. Furthermore, oligonucleotides can be designed which are complementary to a regulatory sequence of the invention (triple helix; see Lee, Nucl. Acids Res. 6 (1979), 3073; Cooney, Science 241 (1988), 456 and Dervan, Science 251 (1991), 1360), thereby preventing transcription and the production of the encoded mRNA and/or protein.

[0081] Furthermore, the invention relates to a pharmaceutical composition comprising the DNA molecule, the regulatory region, the recombinant DNA, the vector, the host cell, the expression product or the antibody of the invention.

[0082] Said pharmaceutical composition comprises at least one of the aforementioned compounds of the invention, either alone or in combination, and optionally a pharmaceutically acceptable carrier or excipient. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by conventional methods. These pharmaceutical compositions can be administered to subject in need thereof at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intradermal, intranasal or intrabronchial administration. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. A typical dose can be, for example, in the range of 0.001 to 1000 .mu.g (or of nucleic acid for expression or for inhibition of expression in this range); however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. Generally, the regimen as a regular administration of the pharmaceutical composition should be in the range of 1 .mu.g to 10 mg units per day. If the regimen is a continuous infusion, it should also be in the range of 1 .mu.g to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment. Dosages will vary but a preferred dosage for intravenous administration of DNA is from approximately 10.sup.6 to 10.sup.22 copies of the nucleic acid molecule. The compositions of the invention may be administered locally or systematically. Administration will generally be parenterally, e.g., intravenously; DNA may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Furthermore, the pharmaceutical composition of the invention may comprise further agents such as interleukins or interferons depending on the intended use of the pharmaceutical composition.

[0083] It is envisaged by the present invention that in particular the various recombinant nucleic acid/DNA molecules and vectors of the invention are administered either alone or in any combination using standard vectors and/or gene delivery systems, and optionally together with an appropriate compound and/or together with a pharmaceutically acceptable carrier or excipient. Subsequent to administration, said molecules may be stably integrated into the genome of the mammal, fish or bird. On the other hand, viral vectors may be used which are specific for certain cells or tissues, preferably for pancreatic cells and persist in said cells. Suitable pharmaceutical carriers and excipients are well known in the art.

[0084] The invention further relates to a diagnostic composition comprising the nucleic acid molecule, the regulatory region, the recombinant DNA molecule, the vector, the host cell, the expression product or a primer or an oligonucleotide hybridizing to the nucleic acid molecule or regulatory region of the invention or to a complementary strand thereof and preferably to the regions identified herein above or the antibody of the invention. Comprised by the above definition of the term "primer" are also pairs of primers such as forward and reverse primers that may be used for PCR. One of said primers of said pair of primers may hybridize in the region of the rsk-related nucleic acid sequence.

[0085] In one embodiment, said diagnostic composition is manufactured in the form of a kit. Said compositions may additionally contain further compounds such as plasmids, antibiotics and the like for screening animals or cells for the presence of nucleic acid sequences or regulatory elements corresponding to those identified in the appended examples or described herein above.

[0086] The components of the diagnostic composition and/or kit of the present invention may be packaged in containers such as vials, optionally in buffers and/or solutions. If appropriate, one or more of said components may be packaged in one and the same container. Additionally or alternatively, one or more of said components may be adsorbed to a solid support such as, e.g., a nitrocellulose filter or nylon membrane, or to the well of a microtiter plate.

[0087] The invention further relates to a method for the production of a transgenic non human mammal, fish or bird comprising introducing the nucleic acid molecule, the regulatory region, the recombinant DNA molecule or the vector of the invention into a cell, preferably germ cell, embryonic cell or an egg cell or a cell derived therefrom.

[0088] Methods for the generation of such transgenic animals are well known in the art and are described, for example, in "Guide to techniques in mouse development" (ed. Wassarman & DePamphilis) Methods in Enzymology Vol. 225 (Academic Press, 1993). The method of the invention also comprises embodiments related to the cloning of such animals. These embodiments include the steps of introducing said nucleic acid molecule, recombinant DNA molecule or vector of the invention into the nucleus of a cell, preferably an embryonic cell, replacing the nucleus of an oocyte, a zygote or an early embryo with said nucleus comprising said nucleic acid molecule, recombinant DNA molecule or vector of the invention, transferring either said ooyte, zygote or early embryo into a foster mother or first in vitro or in vivo culturing said oocyte, zygote or early embryo and subsequently transferring the resulting embryo into a foster mother and allowing the embryo to develop to term; see, for example, Wilmut I. et al. (1997) "Viable offspring derived from fetal and adult mammalian cells", Nature 385, 810-813.

[0089] In a preferred embodiment of the method of the invention, said chromosome is an X chromosome or the corresponding sex chromosome in birds or fish or an autosome.

[0090] In an alternative preferred embodiment of the method of the invention, said chromosome is a Y chromosome, or the corresponding sex chromosome in birds or fish.

[0091] It is particularly preferred that the nucleic acid molecule, the regulatory region, the recombinant DNA molecule or the vector of the invention, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined hereinabove alone or in combination is/are integrated in said Y chromosome in a reversible inactive state of expressibility.

[0092] In accordance with the method of the invention, it is most preferred that said nucleic acid molecule, regulatory region, recombinant DNA molecule, vector of the invention, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined hereinabove alone or in combination is/are flanked by lox P sites or FRT sites.

[0093] In all the above embodiments, at least one Distorter may be present on the same or on different chromosome.

[0094] An additional particularly preferred embodiment of the method of the invention further comprises introducing a nucleic acid molecule encoding at least one Distorter into the same or a different chromosome or introducing a chromosomal fragment comprising at least one Distorter into said cell.

[0095] Advantageously, said Distorters are the mouse t-complex Distorter loci.

[0096] It is most preferred that said Distorter is/are D2 and/or D1.

[0097] Said method of the invention and its various preferred embodiments provide a wide range of applications in particular in the breeding of animals. Thus, as has been outlined above, the nucleic acid sequence encoding a molecule contributing to the Responder and/or an effector (poly)peptide as defined hereinabove may be under the regulation of the promoter naturally associated with said nucleic acid sequence. Integration of such a construct into a chromosome will, in the absence of a Distorter function result in a disadvantage in a chromosome if it comes to transmission of said chromosome. This disadvantage may be in the range of 49 to 0% transmission ratio. In the case that the Responder effect results in a very low or no transmission of the corresponding chromosome and if, in addition, the above recited construct comprising the nucleic acid molecule of the invention or the effector (poly)peptide is integrated into the Y chromosomes, the Y chromosome and the Responder function would hardly or not be transmitted by male animals. In order to provide for male animals, the Y chromosome should advantageously comprise an inactive construct that can, however, be activated. Said inactive construct should be without influence on the transmission ratio. One embodiment of said construct comprises loxP or FRT sites which flank an intervening sequence located between said promoter or a heterologous promoter controlling expression in spermiogenesis and effector (poly)peptide encoding sequences and/or sequences conferring Responder activity. The intervening sequence would be designed in such a way as to prevent the expression of effector and/or Responder activity. Activation of the effector and/or Responder activity may be effected by excision of the intervening sequence due to activity of the Cre or flp protein comprised in the same cell. Another embodiment of said construct comprises loxP or FRT sites flanking said promoter or a heterologous promoter controlling expression in spermiogenesis whereby the promoter is oriented away from the construct comprising the nucleic acid of the invention or the effector sequences encoding the above mentioned (poly)peptides. The activity of Cre or flp would allow the promoter to be inverted resulting in the transcription of the effector sequences or the sequences contributing to Responder activity during spermiogenesis. Another embodiment of said construct comprises loxP or FRT sites flanking said nucleic acid sequences reversely oriented towards the promoter such that the antisense strand is transcribed during spermiogenesis. Activation may be effected by flipping the effector sequences or the sequences contributing to Responder activity due to the activity of Cre or flp comprised in the same cell. Expression of the Cre or flp protein would advantageously be effected prior to spermiogenesis. The activation of the Responder or effector function is in such cases effected during spermatogenesis under the control of the R promoter or another promoter controlling expression during spermatogenesis/spermiogenesis. Preferably, the Cre gene is integrated on an autosome and may be expressed under the control of one of the following promoters: cytomegalovirus immediate early enhancer-chicken beta-actin hybrid (CAG) promoter, wherein site specific recombination occurs in the zygote; adenovirus Ella promoter, wherein expression is triggered during early embryogenesis; CMV, wherein expression is triggered during embryogenesis; OCT4, wherein expression is also triggered during embryogenesis and in germ line cells; HSV-TK or Pgk, wherein expression is ubiquitous; or Pgk2, wherein the construct is expressed during spermatogenesis. In the above embodiment, the Responder and/or effector encoding construct is transmitted by male animals in an inactive state. Mating with a female carrier of the Cre construct will result in male progeny having their Responder and/or effector activated during spermatogenesis. Progeny of these male animals inherit predominantly or exclusively the X chromosome of the father and are accordingly female progeny. In the case that the X chromosome is exclusively transmitted, the Responder and/or effector function is not inherited by the progeny. However, in cases of a less strong effect of the Responder and/or effector (poly)peptide leading to, for example, 10 to 20% transmission, the inactivation of the construct is not necessary because this low transmission is sufficient for the generation of male carriers. The frequency of inheritance of the R gene of the mouse, without the interaction of t-Distorters, is naturally in the range of about 20%.

[0098] In an alternative preferred embodiment of the method of the invention that has been identified above, the Responder and/or effector is integrated on the X chromosome or on an autosome. In this case, no inactive construct is necessary, since the Responder and/or effector encoding construct is transmitted in female animals in a neutral state, because Responder function only acts during spermatogenesis. Mating with wild type male animals leads to the generation of male animals carrying an active R and/or effector encoding gene on the X chromosome or an autosome. The chromosome carrying the R and/or effector encoding gene has a disadvantage in transmission. This means less than 50% to 0% of the progeny inherit said chromosome. In the case that the R and/or effector encoding construct is integrated into the X chromosome, no female progeny or only a low percentage of female progeny will be generated.

[0099] Furthermore, the invention relates to a method for the production of a male transgenic non human mammal, fish or bird having integrated in its Y or corresponding sex chromosome the nucleic acid molecule, the regulatory region, the recombinant DNA molecule or the vector of the invention, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined hereinabove alone or in combination in an active state of expressibility, said method comprising in vitro fertilization or injection of spermatozoa into eggs using sperm from said male transgenic non human mammal, fish or bird. In a preferred embodiment of the present invention, said method prior to in vitro fertilization or injection further comprises allowing expression of said effector (poly)peptide and selecting for sperm expressing said effector (poly)peptide and, thus, containing said Y or corresponding sex chromosome. The above method is useful in case the transmission of the construct from male carriers by natural mating or artificial insemination is close to 0%. The production of transgenic male carriers can be achieved by the method of the invention using in vitro fertilization since it has been shown in mice that transmission ratio distortion of t/+ sperm does not occur during in vitro fertilization. The efficiency of the method of the invention can be,further enhanced by selection for sperm carrying a Y or corresponding sex chromosome prior to in vitro fertilization as described above. Selection can be effected, e.g., by cell sorting.

[0100] Alternatively, male carriers of the R and/or effector function which are used for the generation of predominantly female progeny result from mating of hemizygous male animals carrying an inactive R and/or effector encoding construct with hemizygous female animals carrying a locus encoding a site specific recombinase and preferably the Cre locus. Progeny of such matings may be used for the maintenance of the strain as well as for the generation of the desired female progeny. It is worthwhile noting that from a single male carrier of the R and/or effector encoding construct many female progeny can be obtained.

[0101] A further embodiment of the invention that has been referred to above relates to the use of the R gene in combination with Distorter 2 (D2) preferably in combination with Distorter 1 (D1). In this embodiment, the chromosome carrying the R construct is transmitted predominantly or exclusively.

[0102] Distorters D1 and D2 (and possibly D3 as well as further postulated Distorters) act in trans to the advantage of the chromosome carrying the R construct. Whereas the applicant does not wish to be bound by any scientific theory, it is presently assumed that D1 and D2 are expressed in the diploid phase of spermatogenesis. Whereas the Distorter genes have not yet been identified it is well known that their gene products lead to the predominant or exclusive transmission of the chromosome carrying the R function. The Distorter function can be provided, for example, by a chromosome carrying a partial t-haplotype containing, e.g., Distorter D1 or D2 or both. It is further presumed that the expression products of the Distorter genes exert a negative influence on sperm not carrying the R function. In contrast, the sperm carrying the R function are protected by the R function. It is also suggested that such sperm may have a selective advantage as regards motility and thus faster reach the egg cell to be fertilized.

[0103] It is envisaged in accordance with the present invention that D2, D1 and further Distorters are located on the same or one or more different chromosomes than that or those which carry/carries the R construct. If R is integrated on the Y chromosome, mating will predominantly result in male progeny. Integration on the X chromosome, in contrast, will yield predominantly or exclusively female progeny. Integration in an autosome will result in a high transmission of said chromosome and thus any trait linked to said R construct. The high transmission of the R construct guarantees the maintenance of the R function. A practical advantage of the embodiment, in the case that the R encoding construct is integrated in the X chromosome, is that only few male wild type animals are necessary for the maintenance of the Y chromosome, i.e., of the male sex. Said male wild type animals may be generated by mating transgenic hemizygous female animals, carrying both the Distorter(s) and the R function with wild type males.

[0104] The subject-matter of the invention relates also to a transgenic non human mammal, fish or bird having stably integrated in its genome the nucleic acid molecule, the regulatory region, the recombinant DNA molecule or the vector of the invention or which is regenerated from a host cell of the invention or which is obtainable by the method of the invention referred to above.

[0105] Said transgenic animal is advantageously mouse, cattle, sheep, pig, goat, rat, rabbit, horse, dog, cat, camel, chicken, duck, salmon or trout.

[0106] Said transgenic animals may be used for producing offspring at a non mendelian ratio comprising breeding, in vitro fertilization or artificial insemination.

[0107] The invention additionally relates to a pair of transgenic non human mammals, fish or bird, wherein the male is a transgenic animal having integrated in its Y chromosome the nucleic acid molecule, the regulatory region, the recombinant DNA molecule, or the vector of the invention in a reversible inactive state of expressibility and optionally at least one Distorter in its genome, and the female is a transgenic animal having stably integrated into its genomic DNA a nucleic acid molecule encoding a site specific DNA recombinase.

[0108] The pair of transgenic animals should of course be preferably of the same species in order to allow a successful mating.

[0109] Preferably, in said female of said pair of animals, said DNA recombinase is Cre or flp. Most advantageously, said DNA recombinase is controlled by regulatory elements that are active prior to spermiogenesis.

[0110] Further, the present invention relates to sperm obtainable from a male of the transgenic non-human mammal, fish or bird as defined herein before.

[0111] Said sperm may be comprised in a composition suitable, for example, for deep freezing.

[0112] The invention also relates to a method for the selection of the sperm of the invention comprising allowing expression of the effector (poly)peptide and selecting for the presence or absence of said (poly)peptide.

[0113] In accordance with this method of the invention, the effector (poly)peptide is preferably selected for by cell sorting or affinity chromatography. Sperm either carrying or not carrying the effector (poly)peptide and thus the nucleic acid molecule of the invention may then be used for the further desired purpose.

[0114] Additionally, the invention relates to a method for the selection against sperm of the invention comprising

[0115] (a) allowing expression of the recombinant DNA molecule defined herein above that is capable of causing cell death; and

[0116] (b) selecting for viable sperm.

[0117] Cell death can advantageously also be caused by the in vivo expression of an effector molecule comprising a tag and the addition of a specific antibody binding to the tag and of complement to sperm in vitro, resulting in the inactivation or lysis of the spermatozoa carrying the construct.

[0118] Said methods find applicability in cases where sperm carrying the R promoter function is to be selected against.

[0119] A further object of the invention is the use of the sperm for the production of offspring. Such a production may comprise breeding, in vitro fertilization or artificial insemination.

[0120] An additional object of the present invention relates to the use of the nucleic acid molecule of the invention, the regulatory region of the invention, the recombinant DNA of the invention, the vector of the invention, the host cell of the invention, the expression product of the invention or the antibody of the invention for the isolation of receptors on the surface of sperm recognizing attractants of the egg cell for the development and/or production of contraceptiva.

[0121] Further, the present invention relates to the use of the nucleic acid molecule of the invention, the regulatory region of the invention, the recombinant DNA of the invention, the vector of the invention, the host cell of the invention, the expression product of the invention or the antibody of the invention for the identification of chemicals or biological compounds able to trigger the (premature) activation or inhibition (repression) of the signaling cascade in which the Responder function is envisaged to be involved in. Such compounds could be applicable as potent contraceptiva since it is envisaged that the activation or inhibition (repression) of said signaling cascade may affect the motility of sperm, due to rapid exhaustion of their energy reserve, and/or by inhibiting sperm movement and/or affect the ability of sperm to fertilize ovulated eggs.

[0122] The identification of said chemical or biological compounds could be achieved by standard screening technology using the activation of the wild type Responder protein expressed in cell culture cells as an assay. It is e.g. envisaged that activation of said protein may trigger microtubule disruption in cell culture cells similar to the effect obtained by overexpression of the MARK kinase. Compounds triggering or inhibiting such an effect could then be tested for their effect on the motility and/or fertilization ability of sperm. Alternatively, a similar screening system for said compounds could also be envisaged for sperm without prior employment of a screening assay in cell culture cells.

[0123] Furthermore, the nucleic acid molecule of the invention, the regulatory region of the invention, the recombinant DNA of the invention, the vector of the invention, the host cell of the invention, the expression product of the invention or the antibody of the invention can be used for the isolation of receptor molecules and/or other members of the Responder/Distorter signaling cascade to which said expression product which would be expected to be a (poly)peptide may bind. Said signal transducing molecules may be identified by immunoprecipitation of protein complexes involving the Responder (poly)peptide and cloning of the corresponding genes encoding them, or by Two Hybrid Screening techniques in yeast employing standard technology. In particular, most preferably the Responder gene or (poly)peptide may be used to isolate the membrane receptor of the signaling molecule which is envisaged to activate said Responder/Distorter signaling cascade. Said membrane receptor is envisaged to be most preferable as a target for the development of novel contraceptives.

[0124] Additionally, the present invention relates to a method for the detection of the nucleic acid molecule, the regulatory region, the recombinant DNA molecule, the vector, or the expression product of the invention or a different heterologous expression product encoded by said DNA molecule or vector in the transgenic non human mammal, fish or bird of the invention or a part thereof comprising identifying said nucleic acid molecule, regulatory region, recombinant DNA molecule or vector of the invention or a portion thereof in said transgenic animal or said part thereof. The method of the invention allows the identification of animals of the invention on the basis of the genetic constructs they carry in accordance with the invention. Moreover, the method allows the identification of such animals e.g. after slaughtering by analyzing parts thereof. It should be noted that sperm, egg cells and embryos are also to be considered as parts of said animals. Detection may be effected by PCR using primers specified herein above. Nucleic acid hybridization with a detectably labeled probe constitutes a different method of detection. It is further most important to note that any portion or component of the nucleic acid, recombinant DNA molecule or vector may be identified in accordance with the method of the invention as long as it is indicative thereof. Thus, for example, the vector may comprise a nucleic acid sequence without any biological function that is nevertheless indicative of said vector and thus, of the invention. In another embodiment the effector (poly)peptide may be used for detection. Of course, the nucleic acid molecule of the invention or a portion thereof may itself be detected. All embodiments conceivable by the person skilled in the art that comprise the above step underfall the method of the invention as long as they allow the detection of the above mentioned genetic material.

[0125] Also, the present invention relates to a method of distorting the transmission ratio of genetic traits comprising manipulating the sequence or expression level of a different member of the Responder/Distorter signal cascade than the t-Responder, and restricting the expression of the manipulated form of said different member preferentially or completely to those sperm carrying it.

[0126] Preferred embodiments and various applications of this method as well as methods of manipulating said sequence or expression level have been addressed herein before.

[0127] The invention also relates to a transgenic animal having a recombinantly manipulated altered sequence or expression level of a member of the Responder/Distorter signal cascade, and wherein the expression of said member has been restricted preferentially or completely to those sperm carrying it.

[0128] Preferably, said member of said signal cascade is not the Responder.

[0129] In these embodiments of the invention, the sequence or expression level of a preferably different member of the cascade than the Responder is altered or abolished. Simultaneously, it is expected that the activity of the Responder and/or one or more of the Distorters is affected. Depending on the type of alteration/abolishment of Responder/Distorter functions, these transgenic animals may be used in breeding schemes corresponding to the ones addressed above.

[0130] Finally, the present invention relates to a method for the distortion, to a non-Mendelian ratio, of the transmission of a genetic trait from male mammals to their offspring comprising expressing during spermatogenesis/spermiogenesis a gene involved in sperm motility and/or fertilization.

[0131] In a preferred embodiment of the invention said genetic trait determines the sex.

[0132] In another preferred embodiment of the method of the invention said gene is under the control of a promoter that allows expression during spermatogenesis/spermiogenesis.

[0133] The promoter may be the original promoter of said gene or may be derived from a different copy of said gene or from a different gene. Furthermore, the promoter may be derived from a copy of the homologous gene (in case more than one exists) from a different species or may be derived from a different gene from said different species. The promoters may also be modified in order to obtain optimum expression, which may be enhanced or reduced expression.

[0134] In a particularly preferred embodiment of the method of the invention said promoter allows the preferential or exclusive expression of said gene in sperm carrying said gene.

[0135] In a further preferred embodiment of the method of the invention said gene is engineered such as to interfere with the function of its wild type allele or with the function of other genes involved in sperm motility and/or fertilization, wherein said gene inhibits the function of one or more genes involved in sperm motility and/or fertilization, and/or wherein said gene causes cell death in spermatocytes/spermatids expressing it, and/or wherein said gene encodes a tag allowing the in vitro selection of sperm carrying said tag.

[0136] In a further preferred embodiment of the method of the invention said gene encodes an inhibitor of cAMP dependent protein kinase A.

[0137] In a particularly preferred embodiment said inhibitor is PKI or a functionally active derivative or fragment thereof.

[0138] As used in accordance with the present invention the term "functionally active derivative or fragment" denotes molecules that deviate from PKI by one or more amino acid substitutions, deletions, and/or additions but essentially retain the biologically activity/activities of PKI, i.e. retain at least the inhibitory activity on cAMP dependent protein kinase A. Examples of functionally active derivatives or fragments of PKI are well known to the person skilled in the art and can be found, e.g., in catalogues of biotechnology companies (see, e.g., the Promega catalogue of 1998).

[0139] In another embodiment, the present invention relates to a transgenic animal comprising a gene as defined hereinabove.

[0140] Finally, the present invention relates to a sperm obtainable from the transgenic animal of the present invention.

[0141] The references cited in the present specification are herewith incorporated by reference.

[0142] The figures show:

[0143] FIG. 1:

[0144] (a) The upper panel shows a schematical drawing of the extend of the t-chromosome region (thick bars) of complete and partial t-haplotypes on chromosome 17 of the mouse, as well as the mapping positions of the Responder (R.sup.t) and two Distorters (D1, D2) contributing to the transmission ratio distortion phenomenon (TRD) in mice (Lyon 1984; Fox et al. 1985; Herrmann et al. 1986; Bullard et al. 1992). The Responder function maps to the T66B genomic region shown in more detail in the middle panel (Schimenti et al. 1987; Nadeau et al. 1989; Rosen et al. 1990; Bullard et al. 1992). The region carrying R is defined by the recombination breakpoints of the partial t-haplotypes t.sup.h44, t.sup.h51, t.sup.Jr1 which do not contain R.sup.t, and t.sup.h49 or t.sup.h2 which do contain R.sup.t. The breakpoints of t.sup.h2 and t.sup.h49 coincide (Bullard et al. 1992). The intervals within which the breakpoints must have occurred are not sharply defined (as indicated by broken lines); only t-haplotype DNA is indicated. The position of the marker Tu66 serves as an anchor point for correlating the mapping of the Responder with the genetic fine map shown on the lower panel. The genomic clones (cosmids cat.15, ct.184, ct.169, ct.195), restriction map and gene structure of the fusion of T66Bk and mouse rsk3 demonstrate that the Responder candidate T66Bk lies well within the region defined as carrying R.sup.t. The exon-intron structure of T66Bk has not been determined; black bars indicate restriction fragments containing exons of mouse rsk3 located in the T66B region (Kispert 1990). The fragments encoding T66Bk and T66Bk-2 sequences have been determined by hybridisation of .alpha.-.sup.32P labelled fragment pCRt.sup.h2-161/170 to cosmid DNA, restriction digested, electrophoresed and blotted onto Nylon membrane according to standard techniques and as described in figure legend 2, as well as by sequencing as described in figure legend 4.

[0145] (b) The analysis of the BamHI fragment B9.1 of cosmid cat.15 demonstrated that another T66Bk gene family member, T66Bk-2, is located on the centromere-close side of B9.1, whereas the telomere-close side contains the putative promoter and first exon of the T66Bk-rsk3 fusion gene. B9.1 contains the complete putative protein coding region on one exon and a single 3'-exon (indicated as 3') encoding untranslated sequences of T66Bk-2. The putative promoter region and first exon encoding untranslated sequences of T66Bk-2 is located at the centromere-close side of B9.1 probably within the 6.1 kb BamHI fragment of cat.15, but the exact position has not been determined.

[0146] Methods:

[0147] The cosmids cat.15, ct.169, ct.184 and ct.195 were isolated from a cosmid library constructed from t.sup.w12/t.sup.w12 genomic DNA prepared according to conventional techniques in the vector pcos2EMBL (Ehrich et al. 1987). Library screening and cosmid mapping were performed as described (Herrmann et al. 1987; Rackwitz et al. 1985; Kispert 1990). The restriction map as well as the structure and sequence of mouse rsk3 have been determined previously (mouse rsk3 was initially named Tck; Kispert, 1990). The chromosomal localization of genomic restriction fragments hybridizing to subfragments derived from cosmids or to cDNA probes was done by restriction fragment length polymorphism (RFLP) mapping (Fox et al. 1985; Herrmann et al. 1986). Polymorphic restriction fragments specific to t-haplotypes were assigned to the T66B region if present in genomic DNA from t.sup.h2, t.sup.h49, t.sup.low, t.sup.6, t.sup.w5 or other complete t-haplotypes, but not in DNA from t.sup.h44, t.sup.h51, or wild type inbred strains, according to previous characterizations of these t-haplotypes (Lyon 1984; Fox et al. 1985; Herrmann et al. 1986; Bullard et al. 1992).

[0148] FIG. 2:

[0149] Southern blot hybridization of genomic or cosmid DNA of various t-haplotype carrying mice, or wild type mouse strains. The DNA was digested with BamHI endonuclease, blotted on Nylon membrane and hybridized with the probe pCRt.sup.h2-161/170. Two fragments, B7.8 and B9.1 (marked by an asterisk), are visualized in t-haplotypes carrying the Responder, but are absent from t-haplotypes without R function as well as from wild type strains. Both fragments are present in the cosmid cat.15 and together contain the transcription unit of the gene T66Bk, as shown on FIG. 1 (bottom left). B9.1 additionally contains the protein coding and 3'-untranslated region of T66Bk-2. A third hybridizing fragment on cosmid cat.15 of about 6.1 kb is likely to contain part of the T66Bk-2 gene. The 6.1 kb BamHI fragment is located at the proximal (centromere close) end of cosmid cat.15; it is truncated by the cloning event and thus, it is not identical in size with and cannot be correlated to any of the fragments identified in the hybridizations of total genomic DNA.

[0150] Abbreviations: t.sup.Jr1=t.sup.w71Jr1; t.sup.low=t.sup.lowH; T.sup.Or=deletion chromosome T Oak Ridge 4. 129/Sv, C57BL/6 and DBA/2 are mouse inbred strains.

[0151] Methods:

[0152] Genomic DNA was prepared as described (Herrmann and Frischauf, 1987), digested with BamHI, blotted by an alkaline capillary transfer onto Hybond N+ membrane (Amersham) as described (Herrmann et al. 1986; Sambrook et al. 1989), UV treated in a UV Stratalinker 2400 (Stratagene) according to Church and Gilbert (1984), hybridized in 0.5M NaPi pH 6.8/7%SDS at 68.degree. C. over night with 2.times.10.sup.6 cpm/ml of probe, washed in 40 mM NaPi pH 6.8/1%SDS at 68.degree. C., and exposed on Kodak X-AR5 X-ray film and an intensifying screen at -80.degree. C. The probe was prepared by random primer extension using the T7 QuickPrime kit (Pharmacia Biotech), 50 ng of probe DNA and 5 .mu.l of .alpha.-.sup.32P dCTP (Amersham) at 3000 Ci/mmole according to the suppliers instructions.

[0153] The cDNA probe fragment pCRt.sup.h2-161/170 was prepared by standard PCR amplification in 20 mM Tris pH8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dATP/dCTP/dGTP/dTTP each, using 1 unit of the Taq DNA polymerase, approximately 50 ng of the cDNA pCRt.sup.h2-161/144 as template, 20 pmole of primer 161 and 170 each. 15 cycles of 30 seconds at 94.degree. C., 30 seconds at 50.degree. C. and 2 minutes at 72.degree. C. with a final extension of 5 min. at 72.degree. C. were performed, the product was loaded on a 1% agarose gel in TAE buffer (Sambrook et al. 1989), electrophoresed, the amplified fragment cut out under long wave length UV light (366 nm) and purified by centrifugation through an EZ Enzyme Removers column (Amicon) and ethanol precipitation (Sambrook et al. 1989). The DNA was dissolved in TE.

[0154] FIG. 3:

[0155] RT-PCR analyses verify that T66Bk maps to the Responder region and is transcribed during spermiogenesis. a) RT-PCR of testis RNA with the primer pair 181/144 which is specific for the T66Bk-rsk3 fusion gene amplifies a cDNA fragment of 821 bp from RNA of t-haplotypes carrying the t-Responder (for comparison see FIG. 1) confirming that this gene is present in the t-Responder carrying region and is expressed in testis (upper panel). The quality of the RNA and first strand cDNA used for the assay was confirmed by RT-PCR with the primer pair 145/146 which amplifies a cDNA fragment of 769 bp from the mouse rsk3 gene (Tck, see Kispert 1990). The latter RT-PCR also produces a smaller fragment in t-haplotypes containing the T66B region, but not in wild type or t-haplotypes which do not contain the T66B region. This smaller cDNA fragment is due to the deletion of an exon in the T66B-copy of rsk3. A substantial level of transcription of the T66Bk-rsk3 fusion gene is first detectable in 22 days p.p. testis (lower panel). At this stage haploid spermatids have formed and are undergoing the transformation process into spermatozoa called spermiogenesis (Rugh 1990). The primer pair 155/170 amplifies a cDNA fragment of 815 bp derived from T66Bk as well as related genes. The presence of RNA at all stages of spermatogenesis tested with the primer pair 155/170 suggests an early onset of the transcription of one or several members of the T66Bk gene family. A very low (basal) level of transcript from the T66Bk-rsk3 fusion gene is also detectable in early stages of spermatogenesis. b) Comparative RT-PCR of testis RNA with primer pairs specific for testis specific transcripts of angiotensin converting enzyme (ACE, Howard et al. 1990), c-kit (Rossi et al. 1992) and mouse protamine 1 (mP1, Peschon et al. 1987) allows a correlation of the transcription of the T66Bk-rsk3 fusion gene with that of known genes. The promoters of all three genes have been analyzed in transgenic mice (Langford et al. 1991; Albanesi et al. 1996; Peschon et al. 1987). mP1 is supposed to be transcribed in round, ACE and c-kit in elongating spermatids. Since, in our RT-PCR analysis the T66Bk-rsk3 fusion gene appears to be transcribed slightly later than ACE and c-kit we conclude that expression of the T66Bk-rsk3 fusion gene most likely commences in elongating spermatids.

[0156] Methods:

[0157] Total RNA of testis tissue was prepared following homogenization of the tissue in LiCl/urea according to a published procedure (Auffray and Rougeon 1979). After ethanol precipitation the RNA was dissolved in 50 .mu.l 10 mM Tris-HCl/1 mM EDTA pH7.6 (TE) per approximately 100 mg starting material. 2 .mu.l total RNA (appr. 6 .mu.g RNA) were used for cDNA synthesis with an oligo(dT) primer according to the instructions of the SuperScript plasmid cDNA synthesis kit of Gibco/BRL. After first strand synthesis the reaction was diluted to 50 .mu.l with TE. For PCR amplification 0.5 .mu.l of the first strand cDNA stock solution was added to 20 .mu.l of the reaction mix containing 20 pmole of each primer, 20 mM Tris pH8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dATP/dCTP/dGTP/dTTP each, and 1 unit Taq DNA polymerase. Reaction mixes were overlayed with mineral oil and 35 cycles of 30 seconds at 94.degree. C., 30 seconds at 50.degree. C. and 30 seconds at 72.degree. C. were performed using a PTC-100 thermocycler (MJ Research, Inc.). The reaction products were electrophoresed in 1% or 2% agarose gels, as applicable, containing 0.4 .mu.g/ml ethidium bromide in TAE buffer (Sambrook et al. 1989), and photographed on a UV light box. The 1 kb ladder of Gibco/BRL was used as marker, as shown on the left margin of each photograph.

[0158] FIG. 4:

[0159] a) Nucleic acid and amino acid sequence of pCRt.sup.h2-161/144, representing a partial cDNA of the T66Bk-rsk3 fusion gene encoding a putative protein of 484 amino acid residues. Several in frame stop codons 5' to the first methionine (start codon) and the stop codon at the end of the single long open reading frame suggest that the protein coding region of this cDNA is complete. However, the 5' and 3' non-coding sequences are most likely incomplete. An asterisk indicates the junction between the T66Bk gene and the truncated mouse rsk3 gene. Nucleic acid sequences of primers used for RT-PCR detection and cloning of T66Bk sequences are indicated. The primer number and 3' end are given.

[0160] b) Partial nucleic acid sequence of a cDNA fragment, ptlib0.7, consisting of a fragment from the 5' end of a T66Bk-related gene fused to part of a mouse rsk3-related gene. This partial cDNA was isolated by PCR amplification with a plasmid vector anchor primer (seq5lib) and primer 144, from clone pools of a total of approximately 200,000 clones of a cDNA plasmid library constructed with RNA extracted from testis of a t.sup.w5/t.sup.w12 adult male. Another 380,000 cDNA clones were screened by cDNA filter hybridization. From those clones another partial cDNA containing a sequence homologous to the one shown here, fused to rsk3 sequences, was obtained. A primer (161) located at the 5' end of the cDNA sequence shown was designed and used in combination with primer 144 (rsk3) to amplify the cDNA fragment of T66Bk shown on FIG. 4a, from testis cDNA of a t.sup.h2/t.sup.h2 adult mouse.

[0161] Methods:

[0162] A cDNA library of testis RNA of an adult male carrying the complete t-haplotypes t.sup.w5/t.sup.w12 was constructed in the plasmid vector pSV-Sport1 using the SuperScript Plasmid cDNA synthesis kit (Gibco/BRL) according to the suppliers instructions. RNA isolation was performed as described in the legend to FIG. 3, mRNA purification was done using Oligotex beads according to the supplier's instructions (Qiagen). DNA preparations of library pools of a total of appr. 200,000 clones were prepared with the Qiagen plasmid midi kit (Qiagen) and tested by PCR amplification as described in figure legend 3 using primer pair seq5lib/144. A fragment of 0.7 kb was obtained and cloned in the vector pCR2.1 using the TA cloning kit of Invitrogen according to the instruction manual. Another 380,000 cDNA clones were plated on filters and screened by hybridization as described (Herrmann et al. 1987).

[0163] The partial cDNA pCRt.sup.h2-161/144 was obtained by PCR amplification of cDNA, prepared and amplified as described in figure legend 3, except that the primer extension time at 72.degree. C. was 2 minutes per cycle, from testis RNA of an adult male homozygous for the t-haplotype t.sup.h2, with the primer pair 161/144. The cDNA fragment was purified from a 1% agarose gel as described in figure legend 3, and cloned in the plasmid vector pCR2.1.

[0164] Plasmid DNA was prepared with the Qiagen Plasmid Midi kit. Sequencing reactions were performed using the RR DyeDeoxy Terminator Cycle Sequencing kit (PE Applied Biosystems) according to the instructions and gene specific primers (MWG Biotech) designed with the OLIGO Primer Analysis Software (NBI), the reactions were purified by centrifugation through Centri-Sep columns (Princeton Separations) according to the instructions, and run on an automatic ABI Prism 310 Genetic Analyzer (PE Applied Biosystems). Sequences were evaluated with the MacMolly Tetra programs set (Soft Gene, Berlin) on a Power Macintosh computer.

[0165] FIG. 5:

[0166] Northern blot hybridization demonstrating the transcription of T66Bk-gene family members. Transcripts are detectable in adult testis from all t-haplotype or wild type strains tested, but not in RNA from any other organ tested. During spermatogenesis a detectable level of transcript first appears at 22 days p.p. For a control the blot was re-hybridized with a probe for GAPDH (Kispert 1990).

[0167] Methods:

[0168] RNA was extracted as described (Auffray and Rougeon 1979), 10 .mu.g per lane was loaded on a 1% agarose gel containing formaldehyde and electrophoresed in MOPS buffer according to standard techniques (Sambrook et al. 1989). The gel was washed twice for 20 minutes in 0.1M NH4-acetate, once in 50 mM NaPi buffer pH 6.8, in 2 gel volumes each, and blotted onto Hybond N+ membrane (Amersham) by capillary transfer (Sambrook et al. 1989) using a reservoir of 50 mM NaPi buffer pH 6.8. The filter was UV treated in a UV Stratalinker 2400 (Stratagene) according to Church and Gilbert (1984), hybridized with 2.times.10.sup.6 cpm/ml of the probe pCRt.sup.h2-161/170 in 0.5M NaPi buffer pH 6.8/7%SDS/25% formamide at 68.degree. C. over night, washed in 50 mM NaPi buffer pH 6.8/1%SDS at 68.degree. C. and exposed on Kodak X-AR5 film using an intensifying screen. The probe fragment was amplified by PCR with the primer pair 161/170 using the cDNA pCRt.sup.h2-161/144 as template and labeled as described in figure legend 2. To determine the relative amount of RNA in each lane the filter was re-hybridized as above with the cDNA clone pme66 containing a partial cDNA of the GAPDH gene (Kispert 1990).

[0169] FIG. 6:

[0170] Southern blot hybridization of DNA derived from several mammalian species and the chick, with the probe pCRt.sup.h2-161/144 demonstrates the presence of T66Bk-related genes in hamster, rabbit, pig, human and chick suggesting the conservation of this gene class during evolution. The DNA was digested with BamHI, blotted on Nylon filter, and hybridized and washed at reduced stringency (58.degree. C.).

[0171] Methods:

[0172] Genomic DNA was isolated from organs or blood cells (human) as described (Herrmann and Frischauf 1987), cut with BamHI endonuclease, electrophoresed in a 1% agarose gel in TBE buffer and blotted by alkaline capillary transfer as described (Sambrook et al. 1989; Herrmann et al. 1986) onto a Hybond N+ membrane (Amersham). The filter was UV treated in a UV Stratalinker 2400 (Stratagene) according to Church and Gilbert (1984), hybridized with 2.times.10.sup.6 cpm/ml of the probe pCRt.sup.h2-191/144 in 0.5M NaPi buffer pH 6.8/7%SDS at 58.degree. C. over night, washed in 100 mM NaPi buffer pH 6.8/1%SDS at 58.degree. C. and exposed on Kodak X-AR5 film using an intensifying screen. The probe fragment pCRt.sup.h2-161/144 was labeled as described in figure legend 2.

[0173] FIG. 7:

[0174] The mouse genome contains several members of the T66Bk gene family.

[0175] a) The protein coding exon of one member, T66Bk-2, is located in a tandem duplication arrangement on the centromere-close side of T66Bk, contained in the BamHI fragment B9.1 of the T66B region cosmid cat.15. The nucleotide and putative amino acid sequence of this exon are shown (FIG. 7a). The sequence of primer 232 and 237 used for cDNA detection, mapping and expression studies (see FIG. 8) are indicated by a dashed line. A single base which is deleted in the cDNA T66k-8 (T 1164) is underlined.

[0176] b) The cDNA T66k-8 was isolated from a testis cDNA library of the genotype t.sup.w5/t.sup.w12. Its nucleotide sequence is identical to that of T66Bk-2 in the region of overlap except for a single base deletion resulting in a shift of the open reading frame from amino acid residue 359 onwards (underlined). The sequences for primer 161 and 237 are indicated (see FIG. 8).

[0177] c) The cDNA T66k-7as is derived from an antisense transcript of a T66Bk family member. The 5' end of T66k-7as is closely related to sequences upstream of the T66Bk promoter. Its 3' end is very similar to the 5'intron near the protein coding exon of T66Bk/T66Bk-2 (see FIG. 7a). The location of T66k-7as in the genome has not been determined. Vector sequences are underlined by a dashed line, sequences with a high similarity to the exon encoding the large ORF of T66Bk/T66Bk-2 by a double dashed line, sequences with high similarity to intron sequences upstream or downstream of the protein coding and 3'-untranslated exon, respectively, of T66Bk/T66Bk-2 by """. The direction of transcription of the T66Bk/T66Bk-2 homology region is indicated.

[0178] d) The cDNA clone, T66k-20, was isolated from the t.sup.w5/t.sup.w12 testis cDNA library. The nucleotide and putative amino acid sequence shows a strong similarity to the above members of the T66Bk gene family.

[0179] e) Comparison of the putative amino acid sequences of the members of the T66Bk gene family. Amino acid residues identical to T66Bk are indicated by ". Gaps indicated by _ were introduced to allow optimal alignment. Note the strong similarity of all protein sequences as well as the altered protein tail in T66k-8. Note also the closer relationship of T66Bk-2 and T66k-20 compared to T66Bk, despite the fact that T66k-20 is longer at the N-terminus.

[0180] Methods:

[0181] The BamHI fragment B9.1 of cosmid cat.15 was isolated by restriction digestion and cloned in the vector pBluescript KS according to standard techniques. The DNA preparation and sequencing was carried out as described in Figure legend 4. The cDNA clones T66k-7as, T66k-8 and T66k-20 were isolated from a cDNA library constructed from testis of a t.sup.w5/t.sup.w12 male, the library plated and screened by hybridization with a cDNA fragment derived from PCR amplification of the cDNA pCRt.sup.h2-161/144 with the primer pair 155/170. Library screening, probe preparation, hybridization, plasmid preparation, sequencing etc. are described in figure legends 2, 3 and 4.

[0182] FIG. 8:

[0183] The T66Bk-2 gene is located in the T66B region and is expressed from 22 day p.p. in the testis.

[0184] A cDNA fragment of 951 bp derived by RT-PCR amplification of testis RNA and hybridization with a T66Bk-2/T66k-8 specific primer (232) is detectable in RNA derived from mice carrying the t-haplotypes t.sup.h2, t.sup.h49, t.sup.6 and t.sup.w5 but not in t.sup.h44, t.sup.h51 and t.sup.Jr1. Therefore it maps to the T66B region, in agreement with the mapping data of cosmid cat.15. The signal obtained from t.sup.h2/t.sup.h2 and t.sup.h49/t.sup.h49 is higher than that obtained from T.sup.Or/t.sup.6 or T.sup.Or/t.sup.w5 in agreement with the fact the former two are homozygous for T66Bk-2, while the latter are heterozygous. A faint signal is obtained in t-haplotypes carrying the T66A region only or in wild type (Balb/c). This is due to a reduced capability of binding of the oligonucleotide 232 to other members of the T66Bk gene family. In testis RNA derived from t.sup.6/+ males of different stages (lower panel) T66Bk-2 transcription is first detected at 22 days p.p. However, the signal is very weak, but is significantly increased at 24 days p.p. This suggests that T66Bk-2 may be expressed at a lower level or later than T66Bk. Overall, the transcription level of T66Bk-2 in each testis sample detected by RT-PCR and hybridization correlates well with the number of T66Bk-2 alleles present in each of the samples. This together with the sequence conservation further suggests that the cDNA clone T66k-8 is derived from the locus T66Bk-2 within the T66B region.

[0185] Methods:

[0186] RNA derived from testis was reverse transcribed, first strand cDNA was amplified by PCR using the primer pair 161/237 (see FIGS. 7a, b), and the products separated by electrophoresis on 1% agarose as described in figure legend 3. The cDNA was transferred to Hybond N+ filters as described in figure legend 2, and hybridized with oligonucleotide 232 labeled using the DIG Oligonucleotide Tailing Kit (Boehringer Mannheim) according to the instructions of the supplier. Hybridization was carried out in 0.5M NaPi pH 6.8/7% SDS at 37.degree. C. The filters were washed 4 times for 5 minutes in prewarmed 40 mM NaPi pH 6.8/1% SDS (37.degree. C.) at room temperature. Prehybridization and oligonucleotide detection were done according to the protocol from Boehringer (Mannheim).

[0187] FIG. 9:

[0188] Nucleic acid and amino acid sequence of a cDNA encoding the T66Bk gene.

[0189] The sequence extends the sequence of pCRt.sup.h2-161/144 shown on FIG. 4a, both at the 5'- and at the 3'-side, but is identical in the region of overlap. The 3'-end of the cDNA pSV-T66Bk ends in an intron of the mouse rsk3 gene and lacks a consensus polyadenylation signal suggesting that it was derived by oligo(dT) priming of incompletely spliced RNA. Asterisks indicate the positions of introns. The asterisk between position 2023 and 2024 indicates the fusion point between MARK- and rsk3-homology regions of T66Bk.

[0190] Methods:

[0191] Another cDNA library, in addition to the one used to isolate cDNAs presented on FIG. 7, was constructed from testis RNA of a male carrying the complete t-haplotypes t.sup.6/t.sup.w5 according to the methods described in figure legend 4 and screened as described in figure legends 7, 2, 3 and 4. A total of 500 000 cDNA clones contained in 10 pools were analysed by PCR for the presence of cDNA clones encoding the gene T66Bk using the primer pair 161/144. Four positive clones were identified and one, named pSV-T66Bk, was purified by colony hybridization screening using the cDNA pCRt.sup.h2-161/144 as probe, and sequenced.

[0192] FIG. 10:

[0193] Nucleic acid and putative amino acid sequences of wild type members of the T66Bk kinase gene family.

[0194] a) The cDNA pCR.Balb-66k was isolated by RT-PCR from testis RNA of the wild type inbred mouse strain Balb/c. The putative start codon of the open reading frame is located 20 amino acid residues further upstream from the translation start of the T66Bk gene, very similar to the situation observed in T66k-20. The ORF is equal in length to that of T66k-20. Since in both genes, pCR.Balb-66k and T66k-20, the putative translation start does not conform closely with Kozak's rules it is possible that this start codon of translation is not efficiently used. Thus, it might be that either this or the next 3'-located translation start codon or both are utilized.

[0195] b) The cDNA pCR.C3H-66k was isolated by RT-PCR from testis RNA of the wild type inbred mouse strain C3H/N using the primers 161/220. In contrast to the ORF of T66Bk, the ORF of this gene is shorter at the C-terminal end resulting in a putative protein of 433 amino acid residues.

[0196] c) This is also the case for the ORF encoded by the genomic clone fragment p.lambda.. 129-66k derived from the 129Sv wild type inbred mouse genome. The significance of this alteration of the ORF compared to the gene T66Bk is unclear. However, it is assumed that the length of the ORF and thus the resulting protein sequence may influence the properties of the protein.

[0197] FIG. 11:

[0198] Nucleic acid sequence of the putative promoter of the gene T66Bk. The BamHI fragment B9.1 of the cosmid cat.15 contains the protein coding region of T66Bk-2 (see FIGS. 2 and 7) as well as the putative transcription start site and upstream region of T66Bk. The sequence of 3641 bp presented here shows the intron and 3'-untranslated exon of T66Bk-2, located 3' of the T66Bk-2 sequence shown on FIG. 7, followed by the upstream region and putative first exon of T66Bk. Splice donor/acceptor sites are indicated by an asterisk (*). Exon sequences are underlined. The underlined exon sequence of T66Bk shown represents the sequence contained in the cDNA pSV-T66Bk; the transcription start site of T66Bk, however, may be located further upstream. Two consensus TATA boxes are shown in bold type and underlined. The transcription start site of T66Bk has not been determined, but is likely to be located 3' of either of the TATA boxes. It cannot be excluded that both TATA boxes are utilized alternatively for binding of the TATA binding protein complex. The restriction sites for KpnI and PmII used to isolate the putative promoter fragment utilized in the construction of tg5 are indicated in bold type. The sequence contains a number of potential binding sites for known transcription factors (Faisst and Meyer 1992). However, since none of them have been demonstrated to be functional, they have been omitted on the figure. Their positions can be readily identified by sequence analysis software such as MacMolly's Interpret program (Soft-gene, Berlin). Regulatory elements conferring tissue and stage specific regulation of transcription are often located just upstream of the transcription initiation sites, but may also be located in the first exon, intron or at a distance either far upstream or downstream. It is not known whether the sequence shown here contains all cis-regulatory elements or only a subset required for specific expression of T66Bk during spermiogenesis. It is also envisaged that the long 5'-untranslated region of T66Bk mostly comprised by exon 1 may have a function in regulating the onset and/or efficiency of translation.

[0199] Methods:

[0200] Cloning and sequencing of BamHI fragment B9.1 were done as described in figure legend 7.

[0201] FIG. 12:

[0202] The transgenes tg4 and tg5 are expressed during spermiogenesis.

[0203] To confirm that the transgenes tg4 and tg5 which showed distortion of their transmission from male carriers to their offspring are expressed in the testis, RT-PCR analysis was carried out using a transgene specific primer pair. For tg4 the primer pair 309/310 amplifying a junction fragment between the MARK- and rsk3 homology regions was used. For tg5, the primer pair 313/314 amplifies its 3'-end from hCD24 to the polyadenylation signal sequence. Various post partum stages of testis expected to be in the process of spermatid maturation were analyzed. mRNA was DNAsel treated before reverse transcription and 1 .mu.l of this solution was amplified by PCR (+DNAsel/-RT). After reverse transcription of the remainder, 1 .mu.l of it was amplified in parallel. Tg5-43 was tested with 313/314 except for tg5-43 stage 39 days p.p. which was control tested with the primer pair 309/310.

[0204] None of the control reactions showed a PCR product, whereas all samples subjected to reverse transcription yielded the expected fragment after PCR. This demonstrates the expression of tg4 and tg5, respectively, in the testes of male carriers. However, expression occurs earlier than expected from the analysis of c-kit and T66Bk shown on FIG. 3. This might be due to the sensitivity of the RT-PCR assay which might detect basal transcription of the transgenes, or to inappropriate control of transgene expression caused by the promoter fragment used in the construction or caused by influences of the integration sites. On the other hand, the adult male carrying tg4-3 and the tg5-43 39 day p.p. male showed a stronger fragment suggesting an increase of transgene expression during maturation or following mating to females. Abbreviations: ad, adult male (mated); M, marker (1 kb ladder (Gibco/BRL)

[0205] Methods:

[0206] RT-PCR was carried out essentially as described in figure legend 3 with the following exceptions. Before addition of Reverse Transcriptase to the reaction 1 .mu.l of DNAsel (RNAse free, 10 units/.mu.l) was added and the reaction was incubated at 37.degree. C. for 20 min. 1 .mu.l of the reaction was removed and kept on ice, to the remainder 1 .mu.l of Superscriptil Reverse Transcriptase (200 units/.mu.l, Gibco/BRL) was added and the reaction was incubated for a further 20 min. each at 37.degree. C. and 55.degree. C. All PCR reactions were set up with the same PCR stock solution to which 1 .mu.l of either the control reaction (+DNAsel/-RT) or the test reaction (+DNAsel/+RT) were added. PCR using the primer pair 309/310 was carried out as described in table 1 legend. The same conditions were used for the primer pair 313: 5'-ATGGGCAGAGCAATGGT-3' and 314: 5'-CAGGTTCAGGGGGAGGT-3'.

[0207] FIG. 13:

[0208] T66Bk contains a second ORF encoding an N-terminal polypeptide of mouse rsk3.

[0209] The figure shows the cDNA sequence of pSV-T66Bk emphasizing the ORF encoded by the rsk3 homology region. The putative translation start and stop codons of the MARK-homology region as well as two potential translation start codons of the rsk3 homology region are underlined. The amino acid sequence shown starts at an ATG codon located 3'of the stop codon of the MARK related kinase and 5'of the splice site, indicated by an *. Another potential translation start codon is located in the rsk3 homology region. Although unlikely, there are two possibilities that this ORF is translated. First, the ribosome might not fall off the mRNA after completing translation of the MARK-related kinase and re-start translation at the next ORF. Second, alternative splicing might skip the exon encoding the MARK-related kinase. This would result in a transcript in which the ATG at position 2107-2109 would be the first potential translation start site. The latter is the case observed in the partial cDNA sequence ptlib0.7 shown on FIG. 4b demonstrating that such transcripts exist. However, they are not observed in males carrying the t-haplotypes t.sup.h2 or t.sup.h49, but only in complete t-haplotypes sugging that they are derived from a gene located outside of the region carrying the t-Responder.

[0210] The examples illustrate the invention.

EXAMPLE 1

Cloning of a Novel Candidate Gene for the T Complex Responder

[0211] Cosmid clones from the T66B region were isolated and their genomic location within T66B verified by RFLP mapping (FIG. 1). In particular, the fragment pAK34 which is contained within the overlap of the cosmids ct.184 and cat.15 hybridizes to 3 genomic BamHI fragments in complete t-haplotypes, of which one, a 5.5 kb fragment, is located in the T66B region (Kispert 1990). The cosmids ct.184 and cat.15 contain the 5.5 kb BamHI fragment hybridizing to probe pAK34, thus confirming that they are derived from the T66B region. Likewise, the PCR fragment 161/170 derived from the cDNA described here hybridizes to the BamHI fragments B9.1 and B7.8 contained within cosmid cat.15, and both can be mapped to the T66B region (FIGS. 1 and 2).

[0212] A gene spanning at least 60 kb of the genomic region contained within the cosmid cluster isolated from the T66B region was identified. This gene is represented in 3 copies in t-haplotypes, one each in the regions T66A, T66B and T66C. The wild type form of it encodes the mouse homologue of human rsk3 (Zhao et al. 1995), a kinase of the pp90 ribosome S6 kinase family (called Tck in Kispert 1990). The gene copy located in the T66B region is altered compared to wild type (Kispert 1990). The 5' end is not contained within cosmid cat.15 and one additional exon is missing. The fact that one additional exon is missing was detected by RT-PCR of testis RNA derived from a panel of partial and complete t-haplotypes and wild type with the primer pair 145/146. In addition to the expected fragment of 769 bp a smaller fragment was obtained in the t-haplotypes containing the T66B region, but not in those containing only T66A nor in wild type. (FIG. 3a). This demonstrated that the T66B gene copy of rsk3 is expressed in testis. To identify the 5' sequence of this gene, a cDNA library was constructed from mRNA of the testis of a t.sup.w5/t.sup.w12 male mouse. Surprisingly, two clones were isolated from a total of approximately 580000 cDNA clones screened which contain heterologous sequences 5' to base 438 of wild type rsk3 (Kispert 1990). The partial sequence of one of these clones is shown on FIG. 4b. Primers for polymerase chain reaction (PCR) amplification were designed such that the forward primer (161) is located at the 5' end of this cDNA, that is within the novel sequence, and the reverse primer (144) is located in the rsk3 sequence. PCR amplification of testis cDNA prepared from RNA of the partial t-haplotypes t.sup.h2 and t.sup.h49 produced a fragment of 2.1 kb, whereas no band was detected in t.sup.h44, t.sup.h51, t.sup.Jr1 or BALB/c (wild type) cDNA. The fragment (pCRt.sup.h2-161/144) was isolated from t.sup.h2, cloned and sequenced (FIG. 4a). It comprises yet another novel gene located within the T66B region (see below).

[0213] A primer pair (181/144) designed on the basis of the sequence of pCRt.sup.h2-161/144 allows the amplification of a cDNA fragment of a testis expressed gene which is contained in t.sup.h2, t.sup.h49, t.sup.w5 and t.sup.6, but not t.sup.h44, t.sup.h51, t.sup.Jr1 or BALB/c (wild type) testis (FIG. 3a). Thus the corresponding transcript is t-specific and derived from a gene mapping to the T66B region. RT-PCR with the primer pair 145/146 for mouse rsk3 also confirmed the quality of the first strand cDNA synthesis. The cDNA-mapping by PCR confirms the genomic localization by Southern blot hybridization (see FIGS. 1 and 2).

EXAMPLE 2

The t Complex Responder Candidate Gene Encodes a Novel Kinase

[0214] The sequence of the 2.1 kb cDNA fragment pCRt.sup.h2-161/144 contains a single long open reading frame (ORF) encoding a protein of 484 amino acid residues (FIG. 4a). Several "in frame" stop codons upstream of the first potential translation start codon (bases 337-339) suggest that the N-terminal end of the putative protein is complete. The translation stop (bases 1789-1791) is still located within the "non-rsk3" sequence; the rsk3 sequence of the fusion transcript starts at base 1837.

[0215] Sequence comparisons with protein sequence databases revealed several known motifs within the ORF, most importantly a protein kinase domain and a consensus protein tyrosine kinase active site. However, the pattern of conserved residues is more strongly related to the consensus for serine/threonine kinases, suggesting that the isolated gene encodes a novel Serine/threonine kinase. However, the in vivo specificity remains to be determined experimentally. In accordance with the present invention, the gene is called T66Bk. The best match to known kinases was found to MARK, a recently published serine/threonine kinase which is involved in the regulation of the cytoskeleton (Drewes et al. 1997). The identity to MARK2 is more than 25% and approximately 38% at the amino acid level within the putative kinase domain. The putative protein contains 8 potential phosphorylation sites for casein kinase II, 5 for protein kinase C and 5 potential myristoylation sites.

[0216] The data explained above suggest that the T66Bk-rsk3 fusion gene arose by a rearrangement event resulting in the fusion of two gene parts, both derived from a kinase. The 5' region probably including the transcriptional control elements are derived from a MARK related kinase. The 3' end which is derived from the mouse rsk3 gene and may include most of its sequence and probably also its poly(A) addition signal might be around 5 kb long. The Southern blot hybridization data shown in FIG. 2 suggest that the genome may contain several gene family members of the MARK-related kinase.

EXAMPLE 3

Transcripts Derived from T66Bk-Gene Family Members Accumulate During Spermiogenesis

[0217] In a Northern blot hybridization assay transcripts derived from T66Bk related genes can be detected in 22 day post partum (p.p.) male t.sup.6/+ testis or later, using the cDNA fragment pCRt.sup.h2-161/170 as a probe (FIG. 5). Two transcripts of approximately 2.8 kb and 3.2 kb can be distinguished in T.sup.Or/t.sup.6 and T.sup.Or/t.sup.w5 testis RNA. Only the lower band is clearly detectable in BALB/c (wild type) testis RNA. This difference may be caused by differential splicing or different sequence of gene variants which distinguish, for example, t-haplotypes and wild type or various wild type strains. As the expected transcript size of the T66Bk-rsk3 fusion gene is appr. 7 kb, an assignment of one of the observed RNA bands to the T66Bk-rsk3 fusion gene is not possible. The Northern analysis showed that the members of the T66Bk gene family are fairly specifically expressed, and might even be restricted to the testis, as no transcripts were detected in RNA isolated from ovary, liver, spleen, kidney, lung or heart.

[0218] In a RT-PCR analysis of testis RNA using the primer pair 155/170, transcripts are detectable as early as day 7 p.p., the earliest stage of spermatogenesis tested (FIG. 3a). This suggests that low level transcription of one or several T66Bk-related kinase genes occurs early during spermatogenesis, but high level transcription detectable by Northern analysis occurs during spermiogenesis.

[0219] In agreement with this interpretation, very low (basal) levels of transcripts of the T66Bk-rsk3 fusion gene are detectable by RT-PCR at stage 7, 14 and 20 days p.p., but much higher levels can be seen only from stage 22 d.p.p. onwards (FIG. 3a). This suggests that the T66Bk-rsk3 fusion gene is up-regulated at about the stage when elongating spermatids appear (see below).

[0220] The genes mouse protamine 1 (mP1), angiotensin converting enzyme (ACE) and c-kit were analyzed in order to allow a staging of the onset of the T66Bk-rsk3 fusion gene expression during spermatogenesis (FIG. 3b). mP1 has been reported to be first expressed in round spermatids (Peschon et al. 1987), the testis specific promoters of ACE (Howard et al. 1990) and c-kit (Rossi et al. 1992) are first active in elongating spermatids of undefined stage and stage IX-XI, respectively. The analysis of all three promoters has been achieved using transgenic animals (Langford et al. 1991; Albanesi et al. 1996; Peschon et al. 1987). In the RT-PCR analysis shown here, mP1 transcripts were detected as early as day 14 p.p., but a strong band appeared at day 18 p.p. According to Rugh (1990), spermatids appear at day 17 p.p. in male pups. The ACE and c-kit testis transcripts were weakly detectable at 20 days p.p., but a signal comparable to the T66Bk-rsk3 fusion gene band 181/144 first appeared at 22 days p.p. An earlier expression of ACE was detected in day 7 and 14 p.p. testis. Thus, the RT-PCR data are in agreement with the published data showing that ACE and c-kit are expressed in elongating spermatids. This suggests that the expression of the T66Bk-rsk3 fusion gene in testis is up-regulated at about the same time or a little later than that of c-kit and ACE, in elongating spermatids, and that the promoter of the T66Bk-rsk3 fusion gene may be active late enough during spermiogenesis to exclude the distribution of the T66Bk-rsk3 fusion gene products to spermatocytes not containing the T66Bk-rsk3 fusion gene (Willison and Ashworth 1987), thus fulfilling an important criterion for the R function. The low level of expression found in day 7 and 14 p.p., but not in day 18 p.p. testis suggests that the transcripts might be degraded by the end of meiosis.

EXAMPLE 4

T66B-Related Genes Are Conserved During Evolution

[0221] Putative homologs of the T66Bk-related kinases also exist in other species (FIG. 6). A Southern blot hybridization assay at reduced stringency using the cDNA fragment 191/144 as a probe revealed cross-hybridizing fragments in hamster, rabbit, pig, chick and human. This suggests a conservation of the T66Bk-related kinases in other mammals as well as in birds.

EXAMPLE 5

The Mouse T/t-Complex Encodes Several Members of the T66Bk Gene Family

[0222] In a Southern blot hybridization of cosmid cat.15 with the probe pCRt.sup.h2-161/170 three hybridizing BamHI fragments, B7.8, B9.1 and a 6.1 kb BamHI fragment are detected (see FIG. 2). Sequencing of the T66Bk or related gene encoding parts of these genomic DNA fragments revealed that each of the BamHI fragments B7.8 and B9.1 contains a large open reading frame (ORF) encoding T66Bk and another member of the T66Bk gene family, respectively. The centromere farthest BamHI fragment (B7.8) contains the T66Bk ORF (FIGS. 1 and 4a). Its transcribed part (exon) differs from the corresponding exon contained in the cDNA pCRt.sup.h2-161/144 by a single point mutation (base 1490 C to T) probably due to an allelic variation between the t-haplotypes t.sup.h2, and t.sup.w12 from which cosmid cat.15 was derived, resulting in a single amino acid exchange (Pro to Leu).

[0223] The next centromere closer BamHI fragment (B9.1) contains 5'-noncoding sequence and most likely the promoter of T66Bk and, further upstream of it, an ORF encoding exon and a 3'-noncoding exon of another member of the T66Bk gene family, named here T66Bk-2. However, in this case the 3'-noncoding exon is not related to rsk3. The exon sequence of T66Bk-2 encoding a large ORF is shown on FIG. 7a. It differs from the ORF of T66Bk in a number of positions; nevertheless, it is very closely related to T66Bk. In the t.sup.6/+ testis cDNA panel, expression of T66Bk-2 is first detected at 22 days p.p. Considerably higher expression is observed from 24 days p.p. onwards (FIG. 8).

[0224] The mouse genome contains several more loci of the T66Bk gene family some of which are located in the region of the T/t-complex distal to T66B, probably in T66C. This is based on the observation of several BamHI fragments hybridizing to pCRt.sup.h2-161/170, other than those described above, contained in the genome of mice carrying partial t-haplotypes or wild type mice. Some of these BamHI fragments are polymorphic and specific to complete t-haplotypes, but are not present in the partial t-haplotypes t.sup.h44, t.sup.Jr1, t.sup.lowH, t.sup.h2 or t.sup.h49 nor in wild type (see FIG. 2). Therefore they must be contained in the T/t-complex region distal to T66B. To obtain coding sequences of T66Bk gene family members not contained in the T66B region several cDNA clones were isolated from a testis cDNA library constructed from male mice of the genotype t.sup.w5/t.sup.w12, by hybridization with the probe pCRt.sup.w5-155/170 derived from the T66Bk gene. Several cDNA clones were isolated. All of them have a high sequence similarity to T66Bk or T66Bk-2.

[0225] One of them, T66k-8 (FIG. 7b) is almost identical in sequence to T66Bk-2 as far as sequence is available for both genes, except that it contains a single base deletion leading to an alteration of the ORF C-terminally to the protein kinase domain. From the high sequence conservation of T66k-8 to T66Bk-2 it seems not unlikely that T66k-8 is derived from the T66Bk-2 locus. However, it is not clear how the single base change was introduced into the cDNA clone, whether by a mistake in the RNA transcription, processing, reverse transcription, or by another mechanism. For instance, it has been shown that RNA editing resulting in a change of the nucleotide sequence which can alter the ORF, can occur in lower and higher eukaryotes. At the moment, such a mechanism cannot be excluded as the cause of the observed alteration. Nor can it be excluded that T66k-8 derives from a duplicated T66Bk-2 locus. Alternatively, T66k-8 might be -derived from the t.sup.w5 allele of T66Bk-2. Another cDNA was found that also contains a single base deletion at a similar position as T66k-8. The genomic location of the corresponding gene has not been determined. The alteration predicted for the C-terminal tail of either gene product would be expected to result in a change of the regulation and/or level of their protein kinase activity and/or of the location of the protein within the cell.

[0226] Another cDNA clone, T66k-7as (FIG. 7c), also isolated from the cDNA library, has a very intriguing sequence and structure. It contains a sequence strongly related to T66Bk/T66Bk-2, including intron sequences from either side of the exon containing the single long ORF and additional sequences from further downstream, inserted in antisense orientation in the plasmid cDNA vector. Therefore T66k-7as must be derived from an antisense transcript of a T66Bk family gene. The predicted T66k-7as transcript does not contain a long ORF. The intron sequence 5' to the ORF encoding exon of T66Bk/T66Bk-2 is very A/T rich in antisense direction and apparently serves as transcription stop and polyadenylation signal during the synthesis of this antisense transcript. The sequences contained in the BamHI fragment B9.1 of cat.15 which are related by sequence to the 5'end of T66k-7as map to the vicinity of the promoter of T66Bk suggesting that the promoter region of T66Bk might contain elements controlling in cis the transcription of T66Bk sense RNA as well as the transcription of T66Bk-2 antisense RNA. If that were the case, antisense transcription might be achieved by the same cis-control elements and thus occur at the same stage as sense-RNA transcription. So far, no antisense transcript coming from that locus of the T66B region was identified. Nonetheless, the similarity of the structure and sequence of T66Bk-7as to the head-to-tail arrangement and sequence of T66Bk-2/T66Bk suggests that the T66Bk-2 gene of the T66B region might be transcribed in antisense direction. In addition, another T66Bk locus must exist which is transcribed in antisense direction, gave rise to the cDNA T66k-7as and might be located within the T66B region.

[0227] It is obvious that the expression of antisense transcript complementary to mRNA transcribed from members of the T66Bk gene family would be well suited to diminish the level of functional gene products derived from that gene family. This could influence the spermatozoa in two ways. If the antisense transcripts act in both types of spermatids, those carrying the t-Responder and those not carrying it, the former might be protected from that negative action of antisense transcripts by a higher activity of its T66Bk family gene products whereas the latter are not. In the alternative, more likely way the antisense RNA transcripts might be restricted to the former spermatids and lower the expression of T66Bk gene products expressed in them. This would help to protect the former from the negative action of hypermorphic Distorter gene products, whereas the latter would be "poisoned" by them. This "poisoning" would be caused by hyperactivation of the Responder/Distorter signaling cascade.

[0228] Antisense RNA derived from (a) T66Bk family member(s) would be expected to attenuate the negative effect of the Distorters and, in that way is envisaged to contribute to the transmission ratio distortion phenotype.

[0229] Another cDNA clone, T66k-20, isolated from the t.sup.w5/t.sup.w12 testis cDNA library encodes yet another member of the T66Bk gene family (FIG. 7d). Its ORF differs from T66Bk and T66Bk-2 in a number of amino acid residues and in particular at the N-terminal end which is 20 residues longer than that of T66Bk and T66Bk-2 (FIG. 7e). Most likely, T66k-20 is derived from a gene located in the T66A region, and thus may provide wild type Responder activity.

[0230] The analysis of the transmission ratios of t.sup.lowH or t.sup.low3H heterozygous with t.sup.h51t.sup.h18 by Lyon (1984), showed a strong difference between the transmission ratio of t.sup.lowH and t.sup.low3H. In addition, neither t-haplotype reached the high value of a complete t-haplotype heterozygous with a wild type chromosome. These data suggest the involvement of several loci in the t-Responder function. At the present level of analysis it is speculated that T66Bk, T66Bk-2, T66k-8, T66k-20 and T66k-7as may cooperatively contribute to the t-Responder function.

[0231] The testis cDNA library prepared from RNA of a male carrying the t-haplotypes t.sup.w5/t.sup.w12 did not contain a cDNA clone derived from the T66Bk gene. Therefore another testis cDNA library was constructed from RNA of a male carrying the t-haplotypes t.sup.6/t.sup.w5. Four clones containing a fragment of the size expected from PCR amplification with the primer pair 161/144 were identified and one of them was purified and sequenced (FIG. 9). The sequence is identical to that of the cDNA pCRt.sup.h2-161/144 (FIG. 4a) in the region of overlap and extends it at the 5' as well as the 3'-end. It is worth noting that the sequence ends in an intron of the rsk3 locus in the T66B region and has no consensus polyadenylation signal suggesting that the cDNA is not derived from a properly processed mRNA molecule, but from a, possibly rare, transcript which has not been spliced completely and may contain a dA-rich intron sequence. This finding leaves open the possibility that the T66Bk gene transcript might include the complete rsk3 locus in T66B from bp 438 of the coding region to the 3'-end.

[0232] In addition to the T66Bk family members encoded in the t-haplotype, three more family members derived from the wild type inbred strains Balb/c, C3H/N and 129/Sv were isolated either by RT-PCR or on a genomic clone (FIG. 10). Again, high sequence conservation to the t-haplotype family members was observed. The gene pCR.Balb-66k has the same feature as the gene T66k-20, namely a potential translation start site upstream of the one utilized by T66Bk coding for additional 20 amino acid residues. It is not clear, however, whether this translation start is efficiently used since it does not conform with Kozak's rules demanding an A or a G at position -3 upstream of the ATG codon.

[0233] In contrast, the genes pCR.C3H-66k and p.lambda.. 129-66k differ significantly from all other T66Bk family members at their C-terminus. Both genes contain a translation stop codon at triplet position 434 resulting in a truncated protein of only 433 amino acid residues whereas the remaining nucleic acid sequence is not significantly different from those of the other members. The truncation occurs outside the kinase domain suggesting that the protein migth still be able to function as a kinase. However, the alteration of the C-terminus might influence the regulation and/or level of kinase activity. In this context it is interesting to note that on the C3H background t-haplotypes are transmitted at a very high ratio, whereas e.g. t.sup.o is transmitted at a reduced ratio from males carrying the T/t-complex from Balb/c compared to the ratio obtained by males of the genotype t.sup.o/C3H (Bennett et al. 1983). The 129Sv background also enhances the transmission ratio of t-haplotypes similar to C3H (our observations). The shortened ORFs in pCR.C3H-66k and p.lambda.. 129-66k might have an influence on this behaviour. On the other hand, other T66Bk family members encoding proteins of the same length as T66Bk might exist in these strains in addition to the ones shown here.

[0234] Therefore, and in general, it is to be noted that the genetic background of the animal strain involved may significantly contribute to the expression of the phenotype in terms of the level of distortion of the transmission ratio.

EXAMPLE 6

Transmission Ratio Distortion in Males Carrying Transgene Insertions Encoding the T66Bk Kinase

[0235] To prove the involvement of T66Bk in the Responder phenotype transgene constructs were made expressing the kinase gene T66Bk (FIG. 4a) either under control of the testis promoter of c-kit (tg4-3; tg4-13) or of the putative endogenous promoter of T66Bk (FIG. 11) in transgenic mice (tg5-43; tg5-25). Mice carrying the trangene integration were mated to mice carrying either the t-haplotype t.sup.h51-t.sup.h18 expressing the t-Distorters D1 and D2 or the wild type chromosomes C57BL/6 or Ttf/+tf (Lyon 1984). Males of the appropriate genotype were mated to NMRI outbred females and their offspring tested for carriers of the transgene. The expectation based on the experiments of Lyon (1984) was that, if T66Bk encodes a protein involved in transmission ratio distortion the t-Distorters should enhance the transmission ratio of the transgene, as is the case in the genotype +t.sup.lowH+/t.sup.h51+t.sup.h18, whereas in males carrying wild type chromosomes the transmission ratio of the transgene should be lowered. Table 1 shows the data obtained so far. Interestingly, one of the transgene integrations (tg4-3) must have occured on the Y chromsome since it is only observed in males. In this case offspring were examined for external sexual characteristics after birth, the other transgene integrations were examined by PCR analysis. The data demonstrate a significant distortion of the transmission of the transgene confirming that T66Bk encodes t-Responder activity. The data also demonstrate the potential of the T66Bk gene in breeding strategies selecting for specific genetic traits, in particular sex. In addition the data show the usefulness of both promoters as control elements in achieving a Responder phenotype.

[0236] However, the transmission distortion effect obtained is considerably smaller than that observed with the genotype +t.sup.lowH+/t.sup.h51+t.sup.h18 or +t.sup.lowH+/++tf (Lyon 1984). This suggests that either the expression level of the T66Bk kinase from the transgene constructs is not adequate or that the expression of wild type Responder loci in spermatozoa carrying the transgene diminishes the effect of the T66Bk gene. It should be taken into consideration that the t.sup.lowH chromosome is carrying loci selected by nature for an optimal effect on transmission ratio distortion. In Lyon's analyses (1984) sperm carrying this chromosome compete with sperm carrying either a wild type chromosome or the t-Distorters t.sup.h51-t.sup.h18 probably in combination with (a) wild type Responder locus (loci). In contrast, the trangene integrations occurred outside of chromosome 17. Therefore, transgene expression always occurs in sperm expressing in addition (a) wild type Responder locus (loci). These sperm are competing with sperm carrying either a wild type chromosome or the t-Distorters t.sup.h51-t.sup.h18 probably in combination with (a) wild type Responder locus (loci). The combination of T66Bk expressed from the transgene with expression products from (a) wild type Responder locus (loci) might be less effective in distorting the transmission ratio than the combination of products expressed by members of the T66Bk gene family, in particular T66Bk and T66Bk-2, in the t.sup.lowH t-haplotype. Also, it has been demonstrated that the genetic background has a considerable effect on the ratio of transmission distortion achieved by various t-haplotypes (Bennett et al., 1983). It is quite clear that the expression level and/or activity of the T66Bk gene has to be optimized in future experiments in order to obtain a stronger transmission ratio distortion effect.

[0237] Also, control elements affecting the expression level such as elements regulating transcription efficiency, transcript processing and stability and translation efficiency, used for transgene expression have to be optimised to achieve a maximal effect. It would be convenient to select a tissue and stage specific promoter such as the one controlling the expression of T66k-20 preferably including its 5'-untranslated region, first intron and 3'-untranslated region. Alternatively, an 3'-untranslated region known to increase the stability of the corresponding mRNA could be used. We have noticed that transcripts derived from T66k-20 are respresented at a high ratio in cDNA isolated from a testis cDNA library constructed from RNA of mice carrying t.sup.w5/t.sup.w12. In contrast, cDNAs derived from T66Bk were not found and cDNAs derived from T66Bk-2 were highly underrepresented, suggesting that the transcription level of T66k-20 is considerably higher than that of the former loci.

[0238] However, transfer of this system for distortion of the transmission of genetic traits, in particular of sex, to farm animals might be achievable without a major effort since it is not expected that amplification of T66Bk related genes also occurred in farm animals which have not evolved transmission ratio distortion. Therefore, T66Bk might have a much stronger effect on transmission ratio when introduced into farm animals. The data presented here open the prospect of producing farm animals fathering preferentially or even exclusively offspring of the same sex, e.g. only or predominantly females.

EXAMPLE 7

Cloning of Wild Type Members of the T66Bk Kinase Gene Family

[0239] The cDNAs pCR.Balb-66k and pCR.C3H-66k were isolated by RT-PCR using the primer pairs 161/220 (220: 5'-CTTCCCCCTGGCTGGAC-3') from testis RNA of the inbred strain Balb/c and C3H/N, respectively, cloned in the plasmid vector pCR2.1 (Invitrogen) and analyzed using the methods described in figure legends 3 and 4. The extension step in the PCR was performed for 2 min. at 72.degree. C. The sequence of p.lambda.. 129-66k was derived from an EcoRI subclone in pBluescriptKS made from a lambda-FixII clone isolated from a genomic lambda-FixII library using a cDNA fragment of T66Bk as probe. The lambda-library was constructed from genomic DNA of the ES-cell line R1 (Nagy et al. 1993), according to the instructions of the supplier for the lambda cloning and packaging kits (Stratagene). Library construction, plating and screening by hybridization was according to standard techniques (Sambrook et al. 1989) and the methods described in figure legends 2, 3 and 4.

[0240] Primer sequences:

[0241] ACE

[0242] 5' GC CAA CCA GGG GAT A 3'; 5' CT GTC CGG TCA TAC TCT T 3'

[0243] c-kit

[0244] 5' CTT GTG TCC TTG GGA GAA 3'; 5' GGT GCC ATC CAC TTC AC 3'

[0245] mP1

[0246] 5' CGC AGC AAA AGC AGG AGC AG 3'; 5' CAT CGG ACG GTG GCA TTT TT 3'

[0247] mouse rsk3

1 mouse rsk3 144: 5' TGG TCA AGC GAA AAT CTG TG 3' 145: 5' ATG GCC TGG GGA TCA TCT AG 3' 146: 5' CAC CGC TTG CAC ACT GAG TA 3' cDNA pCRt.sup.h2-161/144 155: 5' ATC GAT GTG TGG GGT CTT 3' 161: 5' GTT TGG GAG GAG CTT GTG 3' 170: 5' CTA GTC GAG CCC TTG ATG 3' 181: 5' TGG CAT CTT ATT GTC TAC 3' 191: 5' CCA AGC CCC TTT TTC TGA 3'

[0248] pSV-Sport1

[0249] seq5lib: 5' ATTTAGGTGACACTATAGAAGGTA 3'

[0250] Oligonucleotide sequences:

2 232: 5' CCC CCT TTA TCT GAC 3' 237: 5' TAT GCT GGC AGC ATC AAA 3'

[0251]

3TABLE 1 tg4 males genotype # female # male % male 4-3/5 th51-th18/C57BL 42 71 62.8 4-3/36 th51-th18/C57BL 33 55 62.5 4-3/39 th51-th18/C57BL 50 67 57.2 total: 125 193 60.7% 4-3/37 +tf/C57BL 42 29 40.8 4-3/187 C57BL/C57BL 52 37 41.6 total: 94 66 41.2% tg4 males genotype # -tg # +tg % tg 4-13/80 th51-th18/C57BL 41 58 58.6 4-13/86 th51-th18/C57BL 45 55 55 4-13/97 th51-th18/C57BL 44 56 56 total: 130 169 56.5% 4-13/53 +tf/C57BL 56 47 45.6 4-13/96 +tf/C57BL 70 67 48.9 4-13/100 +tf/C57BL 53 47 47 total: 179 161 47.3% tg5 males genotype # -tg # +tg % tg 5-43/100 th51-th18/C57BL 13 29 69.0 5-43/101 th51-th18/C57BL 12 16 57.1 5-43/104 th51-th18/C57BL 26 28 51.8 5-43/105 th51-th18/C57BL 12 25 67.5 total: 63 98 60.8% 5-25/83 Ttf/C57BL 43 29 40.3 5-25/84 +tf/C57BL 37 24 39.3 total: 80 53 39.8%

[0252] Table 1:

[0253] Transmission ratio distortion in mice carrying transgenes encoding the kinase gene T66Bk.

[0254] Two transgene constructs, tg4 and tg5 containing the protein coding region of T66Bk were constructed in vitro and introduced into the germ line by injection of DNA into one pronucleus of fertilized eggs of the genotype ((C57BL/6.times.C3H/N)F1.times.C57BL/6) female X NMRI male and retransfer of the zygotes or 2-cell embryos into NMRI foster mothers. Male or female carriers of either transgene were mated to mice carrying either the t-Distorters D1 and D2 on a single t-haplotype chromosome (t.sup.h51-t.sup.h18) over Ttf, +tf or C57BL/6, or either the wild type genotype Ttf/+tf or C57BL/C57BL. Males carrying the appropriate genotype were identified by PCR analysis and set up for test matings with NMRI outbred females. In most cases, late embryonic stages were used as source of DNA for testing individual offspring for the presence or absence of the transgene, the remainder were tested using a tail piece as DNA source. A chromosome 17 marker locus was tested in parallel to control the quality of the DNA solution. The transgene tg4 of the line 4-3 segregates with the Y-chromosome, suggesting that tg4 is integrated on the Y chromosome. Therefore, in this case, offspring were examined after birth for their sex using external sexual characteristics. The breeding data demonstrate non-mendelian inheritance of the transgene and, in the case of tg4-3, of sex. The deviation from the expected 50% depends on the presence or absence of t-Distorter loci, being significantly higher than 50% in the presence and lower than 50% in the absence of t-Distorter loci, as expected from the t-haplotype Responder locus Tcr. This confirms the finding that T66Bk encodes t-Responder activity.

[0255] Methods:

[0256] Tg4 consists of the testis promoter of c-kit, base 45 to the StyI site at base 683 (Rossi et al. 1992; Albanesi et al. 1996), the cDNA t.sup.h2-161/144 and additional mouse rsk3 sequence comprising bp 438 up to bp 998 of rsk3 (Kispert, 1990), and IRES-.beta.geo containing the internal ribosome entry site IRES (Ghaftas et al. 1991) and the .beta.gal-neo fusion gene and SV40 polyadenylation signal (Friedrich and Soriano 1991). In brief, the testis promoter of c-kit was isolated by RT-PCR from testis RNA using the primer pair 5'-ATGTAAGTGGCATGGAGT-3' and 5'-GCACACCGAAAATAAAA-3' and cloned into the plasmid vector pCR2.1 (Invitrogen). A NotI-BstEII fragment comprising the cDNA t.sup.h2-161/144 from a vector NotI site at the 5'-end to a BstEII site in the rsk3 homology region was ligated to NotI and BstEII sites in the plasmid IRES-.beta.geo containing the rsk3 homology region from the BstEII site to bp 998, 5' of the IRES-.beta.geo gene. The 5'-end of the resulting construct containing an EcoRV site from the vector pCR2.1 just 3' of the NotI site was replaced by a NotI-StyI fragment containing the testis promoter of c-kit cloned in the vector pCR2.1 by ligation of the NotI-StyI(blunt; the StyI site was blunt-ended by treatment with the Klenow-fragment of E.coli DNA polymerase I) fragment comprising bp 45 to bp 683 of the c-kit promoter into the NotI and EcoRV sites of the construct. The final transgene construct was released from the vector by digestion with NotI and SaII.

[0257] Tg5 consists of 2637 bp (KpnI to PmII fragment) of the genomic region upstream of the putative transcription start site of T66Bk including most of the 5'-untranslated region and the putative promoter of T66Bk (FIG. 11), the cDNA t.sup.h2-161/144 from the HincII site (bp 293) to the EcoRI site in vector pCR2.1 including the complete protein coding region and a HA-tag constructed into the start site of translation, the IRES sequence and coding region of human CD24 (Kay et al. 1991), and the modified intron and polyadenylation signal of SV40-t (Huang and Gorman 1990). Tg5 was constructed in several steps. First, an HA-tag encoding the peptide sequence YPYDVPDYA was introduced at the translation start of the cDNA t.sup.h2-161/144. Second, the putative promoter of T66Bk was isolated as a 2.6 kb KpnI(blunt)-PmII fragment from the genomic BamHI fragment B9.1 of cosmid cat.15, and ligated into EcoRV and HincII sites of the vector containing the HA-tagged cDNA t.sup.h2-161/144. The EcoRV site stems from the vector pCR2.1 while the HincII site is contained in the 5'-untranslated region of the cDNA t.sup.h2-161/144. In the third step the IRES sequence and hCD24 coding sequence was cut as an EcoRI-EagI(blunted) fragment from the plasmid pSLV-1, the modified intron and polyadenylation signal of SV40-t were cut as a SnaBI-BamHI fragment from the Vector pSV-Sport1 (Gibco/BRL), and both fragments were ligated together into the previous construct opened at the vector sites EcoRI and BamHI located at the 3'-end of the insert. The construction of an HA-tag into the translation start site of T66Bk was done as follows. First, two fragments of the cDNA t.sup.h2-161/144 were amplified by PCR using the primer 5'-GGCGTAGTCTGGGACGTCGTATGGGTACATGTCAGAAAAAGG-3' and 5'-ATGTACCCATACGACGTCCCAGACTACGCCATGGAGAAATTTCAT-3', respectively, in combination with the upstream primer 161 or the downstream primer 188 (5'-ACCCTGGTTGTGGCAGTA-3'), respectively, creating an overlapping region encoding the HA-tag sequence coding for the peptide YPYDVPDYA, in frame with the translation start site of T66Bk. The PCR was performed as described in figure legend 3 except that 15 cycles were performed and 50 ng template were added. Then, both fragments were isolated from an agarose gel and used as template together in a second PCR. First 15 cycles of 30 sec. 94.degree. C., 2 min. 72.degree. C. were performed without primers, the flanking primers 161 and 188 were added and a further 25 cycles of 30 sec. 94.degree. C., 30 sec. 50.degree. C., 30 sec. 72.degree. C. were performed. The resulting fragment containing the HA-tag sequence was purified from an agarose gel, cut with HincII-EcoNI and ligated in place of the HincII-EcoNI fragment of the original cDNA clone t.sup.h2-161/144.

[0258] Testing of offspring for carriers of the transgene insertion was done by first digesting a tissue sample of individual embryos or mice in lysis buffer (100 mM Tris-HCl pH8.5/5 mM EDTA/0.2% SDS/200 mM NaCl/200 .mu.g/ml Proteinase K) over night at 55.degree. C., diluting an aliquot 20 fold in water followed by inactivation of the Proteinase K by incubation at 80.degree. C. for 30 min., and assaying 1 .mu.l in a 20 .mu.l PCR reaction as described in figure legend 3 using the primer pair 309: 5'-CAGCCCATGAATCCATC-3' and 310: 5'-TGCCTTCGGTCTGAAAG-3' and the cycling conditions 2 min. 94.degree. C., 35 cycles 30 sec. 94.degree. C., 30 sec. 50.degree. C., 1 min. 72.degree. C. A control PCR reaction assaying for the genotype at the locus Hba-4ps in the distal region of the mouse T/t-complex was performed where appropriate using the primer pair Hb.1/Hb.2 and conditions as published (Schimenti and Hammer 1990). This PCR reaction was also used to test for the presence of the distal t-haplotype region t.sup.h18 containing the t-Distorter D2. Likewise, presence of the proximal t-Distorter D1 in the t-haplotype t.sup.h51 was assayed by testing for the presence of a t-specific fragment at the Tcp1 locus. This was done by PCR using the primer pair 5'-AGGAAAGCTTGCCCAAGAGA- ATAGTTAATGC-3' and 5'-AGGCGAATTCCATATCATCMTGCCACCAG-3'. The cycling conditions were 40 sec. 94.degree. C., 40 sec. 60.degree. C., 1 min. 30 sec. 72.degree. C., 35 cycles. Different wild type alleles at the locus D17Mit46 from the middle of the T/t-complex were distinguished by PCR using the primers Left: 5'-TCCACCCCACTACCTGACTC-3' and Right: 5'-CCCTTCTGATGACCACAGGT-3'. Cycling conditions were 40 sec. 94.degree. C., 40 sec. 50.degree. C., 40 sec. 72.degree. C., 35 cycles. This marker allows to distinguish between the allelic variants of the strains C57BL/6, NMRI and Ttf/+tf.

[0259] All cloning procedures were performed according to standard techniques (Sambrook et al. 1989), the production of transgenic mice was done according to the methods described in Methods in Enzymology, Vol. 225, Guides to Techniques in Mouse Development, 1993 (ed. P. M. Wassarman and M. L. DePamphilis). Mice carrying the t-haplotype t.sup.h51-t.sup.h18 were obtained from Dr. M. F. Lyon (Harwell, England), mice with the genotype Ttf/+tf were a gift of Dr. K. Artzt (Austin, Tex.).

[0260] References:

[0261] Albanesi C., Geremia R., Giorgio M., Dolci S., Sette C., Rossi P. (1996) A cell- and developmental stage-specific promoter drives the expression of a truncated c-kit protein during mouse spermatid elongation. Development 122, 1291-1302

[0262] Auffray C., Rougeon F. (1979) Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107, 303-314

[0263] Bennett D., Alton A. K., and Artzt K. (1983) Genetic analysis of transmission ratio distortion by t-haplotypes in the mouse. Genet. Res. Camb. 41, 29-45

[0264] Bullard D. C., Ticknor C., Schimenti J. C. (1992) Functional analysis of a t complex Responder locus transgene in mice. Mammalian Genome 3, 579-587

[0265] Cebra-Thomas J. A., Decker C. L., Snyder L. C., Pilder S. H., Silver L. M. (1991) Allele- and haploid-specific product generated by alternative splicing from a mouse t complex Responder locus candidate. Nature 349, 239-241

[0266] Church G. M and Gilbert W. (1984) Genomic Sequencing. Proc. Natl. Acad. Sci. USA 81, 1991-1995

[0267] Drewes G., Ebneth A., Preuss U., Mandelkow E. M., Mandelkow E. (1997) MARK, a novel family or protein kinases that phosphorylate microtubule-associated proteins and trigger microtubule disruption. Cell 89, 297-308

[0268] Ehrich E., Craig A., Poustka A., Frischauf A. M., Lehrach H. (1987) A family of cosmid vectors with the multi-copy R6K replication origin. Gene 57, 229-237

[0269] Ewulonu U. K., Schimenti K., Kuemerle B., Magnuson T., Schimenti J. (1996) Targeted mutagenesis of a candidate t complex Responder gene in mouse t haplotypes does not eliminate transmission ration distortion. Genetics 144, 785-792

[0270] Faisst S., and Meyer S. (1992) Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res. 20, 3-26

[0271] Fox H. S., Martin G. R., Lyon M. F., Herrmann B. G., Frischauf A. M., Lehrach H., Silver L. M. (1985) Molecular Probes define different regions of the mouse t complex. Cell 40, 63-69

[0272] Friedrich G., and Soriano P. (1991) Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes. Dev. 5, 1513-1523

[0273] Ghattas I. R., Sanes J. R., Majors J. E. (1991) The encephalomyocarditis virus internal ribosome entry site allows efficient coexpression of two genes from a recombinant provirus in cultured cells and in embryos. Mol. Cell. Biol. 11, 2548-2559

[0274] Herrmann B. G., Bucan M., Mains P. E., Frischauf A. M., Silver L., Lehrach H. (1986) Genetic analysis of the proximal portion of the mouse t complex: evidence for a second inversion within t haplotypes. Cell 44, 469-476

[0275] Herrmann B. G., Barlow D. P., Lehrach H. (1987) A large inverted duplication allows homologous recombination between chromosomes heterozygous for the proximal t complex inversion. Cell 48, 813-825

[0276] Herrmann B. G. and Frischauf A. M. (1987) Isolation of Genomic DNA. Methods in Enzymology Vol. 152, 180-183 (ed. Berger and Kimmel)

[0277] Howard T. E., Shai S. Y., Langford K. G., Martin B. M., Bernstein K. E. (1990) Transcription of testicular angiotensin-converting enzyme (ACE) is initiated within the 12th intron of the somatic ACE gene. Mol. Cell. Biol. 10, 4294-4302

[0278] Huang M. T. F., and Gorman C. M. (1990) The Simian Virus 40 small-t intron, present in many common expression vectors, leads to aberrant splicing. Mol. Cell. Biol. 10, 1805-1810

[0279] Kay R., Rosten, P. M., and Humphries R. K. (1991) CD24, a signal transducer modulating B cell responses, is a very short peptide with a glycosyl phosphatidylinositol membrane anchor. J. Immunology 147,1412-1416

[0280] Kispert A. (1990) Isolierung und Charakterisierung eines S6 Kinase II-homologen Gens (Tck) aus dem T/t-Komplex der Maus. Diplomarbeit, Universitt Tubingen (Germany)

[0281] Langford K. G., Shai S. Y., Howard T. E., Kovac M. J., Overbeek P. A., Bernstein K. E. (1991) Transgenic mice demonstrate a testis-specific promoter for angiotensin-converting enzyme. J. Biol. Chem. 266, 15559-15562

[0282] Lyon M. F. (1984) Transmission ratio distortion in mouse t-haplotypes is due to multiple Distorter genes acting on a Responder locus. Cell 37, 621-628

[0283] Lyon M. F. (1986) Male sterility of the mouse t-complex is due to homozygosity of the Distorter genes. Cell 44, 357-363

[0284] Nadeau J. H., Varnum D., Burkart D. (1989) Genetic evidence for two t complex tail interaction (tct) loci in t haplotypes. Genetics 122, 895-903

[0285] Nagy A., Rossant J., Nagy R., Abramov-Newerly W., and Roder J. C. (1993) Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc .Natl. Acad. Sci. USA 90, 8424-8428

[0286] Peschon J. J., Behringer R. R., Brinster R. L., Palmiter R. D. (1987) Spermatid-specific expression of protamine 1 in transgenic mice. Proc. Natl. Acad. Sci. USA 84, 5316-5319

[0287] Rackwith H. R., Zehetner G., Murialdo H., Delius H., Chai C. H., Poustka A., Frischauf A., Lehrach H. (1985) Analysis of cosmids using linearization by phage lambda terminase. Gene 40, 259-266

[0288] Rosen L. L., Bullard D. C., Silver L. M., Schimenti J. C. (1990) Molecular cloning of the t complex Responder genetic locus. Genomics 8, 134-140

[0289] Rossi P., Marziali G., Albanesi C., Charlesworth A., Geremia R., Sorrentino V. (1992) A novel c-kit transcript, potentially encoding a truncated receptor, originates within a kit gene intron in mouse spermatids. Dev. Biol. 152, 203-207

[0290] Rugh R. (1990) The Mouse, Its Reproduction and Development (Oxford University Press, Oxford)

[0291] Sambrook J., Fritsch E. F., Maniatis T. (1989) Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press)

[0292] Schimenti J., and Hammer M. (1990) Rapid identification of mouse t-haplotypes by PCR polymorphism (PCRP). Mouse Genome 87, 108

[0293] Schimenti J., Vold L., Socolow D., Silver L. M. (1987) An unstable family of large DNA elements in the center of the mouse t complex. J. Mol. Biol. 194, 583-594

[0294] Schimenti J., Cebra-Thomas J. A., Decker C. L., Islam S. D., Pilder S. H., Silver L. M. (1988) A candidate gene family for the mouse t complex Responder (Tcr) locus responsible for haploid effects on sperm function. Cell 55, 71-78

[0295] Silver L. M. and Remis D. (1987) Five of nine genetically defined regions of mouse t haplotypes are involved in transmission ratio distortion. Genet. Res. Camb. 49, 51-56

[0296] Willison K., Ashworth A. (1987) Mammalian spermatogenic gene expression. Trends Genet. 3, 351-355

[0297] Zhao Y., Bjorbaek C., Weremowicz S., Morton C. C., Moller D. E. (1995) RSK3 encodes a novel pp90-rsk isoform with a unique N-terminal sequence: growth factor-stimulated kinase function and nuclear translocation. Mol. Cell. Biol. 15, 4353-4363.

[0298] Zlokarnik G., Negulescu P. A., Knapp T. E., Mere L., Burres N., Feng L., Whitney M., Roemer K., Tsien R. Y. (1998) Quantitation of transcription and clonal selection of single living cells with .beta.-lactamase as reporter. Science 279, 84-88.

Claims

1. A nucleic acid molecule comprising a transcription unit encoding in its 5'-portion a kinase having a homology to the MARK2 kinase whereas the 3'-portion of the nucleotide sequence has a high homology to the rsk3 kinase.

2. A nucleic acid molecule, preferably according to claim 1, encoding an expression product involved in the Responder phenotype, which contributes to the phenomenon of transmission ratio distortion, selected from the group consisting of (a) a nucleic acid molecule comprising the nucleic acid molecule as shown in FIGS. 4a, 9, 7a, 7b, 7c, 7d or a fragment thereof; (b) a nucleic acid molecule being an allelic variant or a homologue of the nucleic acid molecule of (a); (c) a nucleic acid molecule hybridizing to a nucleic acid molecule complementary to the nucleic acid molecule of (a) or (b); and (d) a nucleic acid molecule which is related to the nucleic acid molecule of (a), (b) or (c) by the degeneration of the genetic code.

3. The nucleic acid molecule of claim 1 or 2 which is a DNA molecule.

4. The nucleic acid molecule of any one of claims 1 to 3, wherein said expression product is an RNA or a (poly)peptide.

5. The nucleic acid molecule of any one of claims 1 to 4, wherein said Responder function is the mouse-t-complex Responder function.

6. A regulatory region of the gene corresponding to the nucleic acid molecule defined in any one of claims 1 to 5 being capable of controlling expression of said nucleic acid molecule.

7. The regulatory region of claim 6 which is a naturally occurring regulatory region or a genetically engineered derivative thereof.

8. The regulatory region of claim 6 or 7 which comprises or is a promoter.

9. The regulatory region of claim 8 which comprises the fragment from nucleotides 930 to 3576 of the sequence shown in FIG. 11.

10. A recombinant DNA molecule comprising the nucleic acid molecule of any one of claims 1 to 5 and/or the regulatory region of any one of claims 6 to 9, and/or a regulatory region allowing expression during spermatogenesis/spermiogenesis.

11. The recombinant DNA molecule of claim 10, wherein said regulatory region is operatively linked to a heterologous DNA molecule.

12. The recombinant DNA molecule of claim 11, wherein said heterologous DNA molecule encodes a peptide, a polypeptide, an antisense RNA, a sense RNA, a toxin and/or a ribozyme.

13. The recombinant DNA molecule of claim 12 wherein said peptide, polypeptide, antisense RNA, sense RNA, toxin and/or ribozyme is capable of causing cell death.

14. The recombinant DNA molecule of claim 12 wherein said or an additional peptide or polypeptide is an effector (poly)peptide.

15. The recombinant DNA of claim 14, wherein said effector (poly)peptide is capable of sequestering an ion selectively binding to a solid support, or binding to a preselected antigenic determinant or is a toxin, a ribozyme, an enzyme, a label or a remotely detectable moiety.

16. The recombinant DNA of claim 15, wherein said effector (poly)peptide is calmodulin, methallothionein, a fragment thereof, green fluorescent protein (GFP), .beta.-lactamase, hCD24, myc, FLAG, hemagglutinin or an amino acid sequence rich in at least one of glutamic acid, aspartic acid, lysine, histidine or arginine.

17. A vector comprising the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9 or the recombinant DNA molecule of any one of claims 10 to 16.

18. The vector of claim 17, comprising a heterologous promoter.

19. The vector of claim 18, wherein the heterologous promoter is controlling gene expression in spermatogenesis and/or in spermiogenesis.

20. The vector of claim 19, wherein the heterologous promoter is the testis promoter of c-kit or of ACE.

21. A host cell or organism transformed or transfected with the nucleic acid molecule of any one of claims 1 to 5, the recombinant DNA molecule of any one of claims 10 to 16 or the vector of any one of claims 17 to 20.

22. A method of recombinantly producing an expression product as defined in any one of claims 1 to 20 comprising the steps of culturing the host cell of claim 21 under conditions to cause expression of the protein and recovering said protein from the culture.

23. An expression product encoded by the nucleic acid molecule of any one of claims 1 to 20 or obtainable by the method of claim 22.

24. An antibody specifically recognizing the expression product of claim 23.

25. A nucleic acid molecule specifically hybridizing with the nucleic acid molecule of any one of claims 1 to 5 translatable into said MARK related kinase or to an intron of said nucleic acid molecule or with the regulatory region of any one of claims 6 to 9 or with a complementing strand thereof.

26. A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA of any one of claims 10 to 16, the vector of any one of claims 17 to 20, the host cell of claim 21, the expression product of claim 23, the antibody of claim 24 or the nucleic acid molecule of claim 25.

27. A diagnostic composition comprising the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA of any one of claims 10 to 16, the vector of any one of claims 17 to 20, the host cell of claim 21, the expression product of claim 23, the antibody of claim 24 or the nucleic acid molecule of claim 25 or a pair of primers wherein one of said primers is the nucleic acid molecule of claim 25.

28. A method for the production of a transgenic non human mammal, fish or bird comprising introducing the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16 or the vector of any one of claims 17 to 20 into the chromosome of a germ cell, embryonic cell or an egg cell or a cell derived therefrom.

29. The method of claim 28 wherein said chromosome is an X chromosome or the corresponding sex chromosome in birds or fish or an autosome.

30. The method of claim 28 wherein said chromosome is a Y chromosome or the corresponding sex chromosome in birds or fish.

31. The method of claim 30 wherein the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined in claim 14 or 15 is/are integrated in said Y chromosome in a reversible inactive state of expressibility.

32. The method of claim 31 wherein said nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined in claim 14 or 15 alone or in combination is/are flanked by lox P sites or FRT sites.

33. The method of any one of claims 28 to 32 further comprising introducing a nucleic acid molecule encoding at least one Distorter into the same or a different chromosome or introducing a chromosomal fragment comprising at least one Distorter into said cell.

34. The method of claim 33 wherein said Distorter is D2 and/or D1.

35. A method for the production of a male transgenic non human mammal, fish or bird having integrated in its Y chromosome the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20, a heterologous promoter controlling expression in spermiogenesis and/or a DNA sequence encoding an effector (poly)peptide as defined in any one of claims 14 to 16 in an active state of expressibility, said method comprising in vitro fertilisation using sperm from said male transgenic non human mammal, fish or bird.

36. The method of claim 35, prior to in vitro fertilisation further comprising allowing expression of said effector (poly)peptide and selecting for sperm expressing said effector (poly)peptide and, thus, containing said Y chromosome.

37. A transgenic non human mammal, fish or bird having stably integrated into its genome the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20 or which regenerated from a host cell of claim 21, or which is obtainable by the method of any one of claims 28 to 36.

38. A pair of transgenic non human mammals, fish or bird, wherein the male is a transgenic animal as defined in any one of claims 31 to 36, and the female is a transgenic animal having stably integrated into its genomic DNA a nucleic acid molecule encoding a site specific DNA recombinase.

39. The pair of animals of claim 38, wherein said DNA recombinase is Cre or flp.

40. The pair of animals of claim 38 or 39, wherein said DNA recombinase is controlled by regulatory elements that are active prior to spermiogenesis.

41. Sperm obtainable from a male of the transgenic non-human mammal, fish or bird as defined in any one of claims 37 to 40.

42. A method for the selection of sperm of claim 41 comprising allowing expression of the effector (poly)peptide and selecting for the presence or absence of said (poly)peptide.

43. A method for the selection against sperm of claim 42 comprising (a) allowing expression of the recombinant DNA molecule of claim 13; and (b) selecting for viable sperm.

44. Use of the sperm of claim 41 or of sperm obtainable by the method of claim 42 or 43 for the production of offspring.

45. Use of the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA of any one of claims 10 to 16, the vector of any one of claims 17 to 20, the host cell of claim 21 the expression product of claim 23, the antibody of claim 24 or the nucleic acid molecule of claim 25 for the isolation of receptors on the surface of sperm recognizing attractants of the egg cell for the development and/or production of contraceptiva.

46. Use of the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA of any one of claims 10 to 16, the vector of any one of claims 17 to 20, the host cell of claim 21, the expression product of claim 23, the antibody of claim 24 or the nucleic acid molecule of claim 25 for the identification of chemicals or biological compounds able to trigger the (premature) activation or inhibition of the Responder/Distorter signaling cascade.

47. Use of the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA of any one of claims 10 to 16, the vector of any one of claims 17 to 20, the host cell of claim 21, the expression product of claim 23, the antibody of claim 24 or the nucleic acid molecule of claim 25 for the isolation of receptor molecules and/or other members of the Responder/Distorter signaling cascade to which said expression product may bind.

48. A method for the detection of the nucleic acid molecule of any one of claims 1 to 5, the regulatory region of any one of claims 6 to 9, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20 the transgenic non human mammal, fish or bird of claim 37 or a part thereof comprising identifying the nucleic acid molecule of any one of claims 1 to 5, the recombinant DNA molecule of any one of claims 10 to 16, the vector of any one of claims 17 to 20 or a portion thereof, or the expression product of the invention or a different expression product encoded by said DNA molecule or vector in said transgenic animal or a part thereof.

49. A method of distorting the transmission ratio of genetic traits comprising manipulating the sequence or expression level of a different member of the Responder/Distorter signal cascade than the t-Responder, and restricting the expression of the manipulated form of said different member preferentially or completely to those sperm carrying it.

50. A transgenic animal having an recombinantly manipulated altered sequence or expression level of a member of the Responder/Distorter signal cascade, and wherein the expression of said member has been restricted preferentially or completely to those sperm carrying it.

51. The transgenic animal of claim 50 wherein said member is not the Responder.

52. A method for the distortion, to a non-Mendelian ratio, of the transmission of a genetic trait from male mammals to their offspring comprising expressing during spermatogenesis/spermiogenesis a gene involved in sperm motility and/or fertilization.

53. The method of claim 52, wherein said genetic trait determines the sex.

54. The method of claim 52 or 53, wherein said gene is under the control of a promoter that allows expression during spermatogenesis/spermiogenesi- s.

55. The method of claim 54, wherein said promoter allows the preferential or exclusive expression of said gene in sperm carrying said gene.

56. The method of any one of claims 52 to 55, wherein said gene is engineered such as to interfere with the function of its wild type allele or with the function of other genes involved in sperm motility and/or fertilization, wherein said gene inhibits the function of one or more genes involved in sperm motility and/or fertilization, and/or wherein said gene causes cell death in spermatocytes/spermatids expressing it, and/or wherein said gene encodes a tag allowing the in vitro selection of sperm carrying said tag.

57. The method of any one of claims 52 to 56, wherein said gene encodes an inhibitor of cAMP dependent protein kinase A.

58. The method of claim 57, wherein said inhibitor is PKI or a functionally active derivative or fragment thereof.

59. A transgenic animal comprising a gene as defined in any one of claims 52 to 58.

60. Sperm obtainable from the transgenic animal of claim 59.

61. An isolated nucleic acid molecule comprising a nucleotide sequence that hybridizes under stringent hybridization conditions to a complement of the nucleotide sequence as shown in FIG. 4a, wherein the nucleic acid molecule encodes an expression product having kinase activity.

62. A vector comprising the nucleic acid molecule of claim 61.

63. A recombinant DNA molecule comprising the nucleic acid molecule of claim 61.

64. A vector comprising the recombinant DNA molecule of claim 63.

65. The vector of claim 62 or 64 wherein the vector is an expression vector.

66. A host cell comprising the isolated nucleic acid molecule of claim 61.

67. A pharmaceutical composition comprising the isolated nucleic acid molecule of claim 61.

68. A method comprising culturing the host cell of claim 66 under conditions to cause expression of an expression product encoded by the isolated nucleic acid.

69. An expression product encoded by the isolated nucleic acid molecule of claim 61.

70. A host cell comprising the expression product of claim 69.

71. A pharmaceutical composition comprising the expression product of claim 69.