U.S. patent application number 10/223650 was filed with the patent office on 2004-01-15 for compositions and methods utilizing dna polymerases.
Invention is credited to Hansen, Connie Jo, Hogrefe, Holly, Sorge, Joseph A..
Application Number | 20040009486 10/223650 |
Document ID | / |
Family ID | 46298810 |
Filed Date | 2004-01-15 |
United States Patent
Application |
20040009486 |
Kind Code |
A1 |
Sorge, Joseph A. ; et
al. |
January 15, 2004 |
Compositions and methods utilizing DNA polymerases
Abstract
The invention features a novel isolated Family B DNA polymerase,
a Thermococcus polymerase JDF-3, and mutant recombinant forms
thereof Mutant polymerases of the invention are deficient in 3' to
5' exonuclease activity and/or exhibit reduced discrimination
against non-conventional nucleotides relative to the wild-type form
of the polymerase.
Inventors: |
Sorge, Joseph A.; (Wilson,
WY) ; Hansen, Connie Jo; (San Diego, CA) ;
Hogrefe, Holly; (San Diego, CA) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS / STR
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Family ID: |
46298810 |
Appl. No.: |
10/223650 |
Filed: |
August 19, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10223650 |
Aug 19, 2002 |
|
|
|
09896923 |
Jun 29, 2001 |
|
|
|
09896923 |
Jun 29, 2001 |
|
|
|
09698341 |
Oct 27, 2000 |
|
|
|
60162600 |
Oct 29, 1999 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12 |
Current CPC
Class: |
B82Y 10/00 20130101;
C12N 9/1252 20130101; B82Y 5/00 20130101; C12N 9/1276 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 001/68 |
Claims
1. A composition for identifying a nucleotide at a given position
of a template DNA molecule, said composition comprising a Family B
DNA polymerase having reduced discrimination against
non-conventional nucleotides and a first primer, wherein said first
primer anneals to the immediate 3' of said nucleotide at the given
position of said template DNA molecule.
2. The composition of claim 1, wherein said Family B DNA polymerase
is a JDF-3 DNA polymerase.
3. The composition of claim 2, wherein said JDF-3 DNA polymerase
has a sequence of SEQ ID NO: 2 and further comprises one or more
amino acid mutations at D141, E143, A485, L408 or P410.
4. The composition of claim 3, wherein said JDF-3 DNA polymerase
has one or more amino acid mutations selected from the group
consisting of: D141A or D141T, E143A, L408H or L408F, A485T, and
P410L.
5. The composition of claim 3, wherein said JDF-3 DNA polymerase is
substituted at position P410 with an amino acid having a non polar
side chain.
6. The composition of claim 5, wherein said amino acid having a non
polar side chain is selected from the group of methionine, glycine,
alanine, valine, leucine, isoleucine, phenylalanine and
proline.
7. The composition of claim 4, wherein said JDF-3 DNA polymerase
comprises four amino acid mutations at D141A, E 143A, P410L and
A485T.
8. The composition of claim 1-6, wherein said Family B DNA
polymerase is deficient in 3' to 5' exonuclease activity.
9. The composition of claim 1, further comprising at least one
chain-terminating nucleotide analog, wherein said chain-terminating
nucleotide analog is incorporated into said first primer by said
Family B DNA polymerase in a template-dependent manner.
10. The composition of claim 1, wherein at least one
chain-terminating nucleotide analog is labeled with a first
detectable label.
11. The composition of claim 1, wherein more than one
chain-terminating nucleotide analog is labeled, each
chain-terminating nucleotide analog being labeled with a different
first detectable label.
12. The composition of claim 9, wherein said chain-terminating
nucleotide analog is a dideoxynucleotide.
13. The composition of claim 12, wherein said dideoxynucleotide is
selected from the group consisting of: ddATP, ddTTP, ddCTP and
ddGTP.
14. The composition of claim 9, wherein said first primer is
labeled with a second detectable label.
15. The composition of claim 14, wherein first and second
detectable labels generate a signal for identifying said nucleotide
at the given position of the template DNA molecule.
16. The composition of claim 1, further comprising a second
primer.
17. The composition of claim 16, wherein said first primer is
labeled with a second detectable label and said second primer is
labeled with a third detectable label, said second and third
detectable labels generate a signal for identifying said nucleotide
at the given position of the template DNA molecule.
18. The composition of claim 17, wherein said second primer anneals
to the immediate 5' of said nucleotide at the given position of
said template DNA molecule.
19. The composition of claim 18, further comprising a DNA
ligase.
20. The composition of claim 1, further comprising a reaction
buffer for said Family B DNA polymerase.
21. The composition of claim 1, wherein said template DNA molecule
is the product of a polymerase chain reaction or a plasmid DNA.
22. The composition of any one of claims 10, 14, or 17, wherein
said first or second or third detectable label is one selected from
the group consisting of: a fluorescent label, an isotope, a
chemiluminescent label, a quantum dot label, an antigen, or an
affinity moiety.
23. The composition of claim 22, wherein said first detectable
label is a rhodamine label or a cyanine label.
24. An isolated recombinant Family B DNA polymerase having reduced
discrimination against non-conventional nucleotides, wherein said
DNA polymerase comprises an amino acid mutation at a position
corresponding to P410 of SEQ ID NO:2.
25. The isolated recombinant Family B DNA polymerase of claim 24,
wherein said amino acid mutation substitution with an amino acid
having a non-polar side chain.
26. The isolated recombinant Family B DNA polymerase of claim 25,
wherein said amino acid having a non-polar side chain is selected
from the group of methionine, glycine, alanine, valine, leucine,
isoleucine, phenylalanine and proline.
27. An isolated recombinant Family B DNA polymerase having reduced
discrimination against non-conventional nucleotides, wherein said
DNA polymerase comprises amino acid mutations in the P Helix and at
a position corresponding to P410 of SEQ ID NO: 2.
28. The isolated recombinant Family B DNA polymerase of claim 27,
wherein said amino acid mutation in the P Helix is located at a
position corresponding to A485 of SEQ ID NO: 2.
29. The isolated recombinant Family B DNA polymerase of claim 28,
wherein said amino acid mutation at a position corresponding to
P410 of SEQ ID NO: 2 is a substitution with an amino acid having a
non-polar side chain.
30. The isolated recombinant Family B DNA polymerase of claim 29,
wherein said amino acid having a non-polar side chain is selected
from the group of methionine, glycine, alanine, valine, leucine,
isoleucine, phenylalanine and proline.
31. A kit for identifying a nucleotide at a given position of a
template DNA molecule, said kit comprising a Family B DNA
polymerase having reduced discrimination against non-conventional
nucleotides and a first primer, wherein said first primer anneals
to the immediate 3' of said nucleotide at the given position of
said template DNA molecule.
32. The kit of claim 31, wherein said Family B DNA polymerase is a
JDF-3 DNA polymerase.
33. The kit of claim 32, wherein said JDF-3 DNA polymerase has a
sequence of SEQ ID NO: 2 and further comprises one or more amino
acid mutations at D141, E143, A485, L408 or P410.
34. The kit of claim 32, wherein said JDF-3 DNA polymerase is
substituted at a position corresponding to P410 of SEQ ID No: 2
with an amino acid having a non-polar side chain.
35. The kit of claim 34, wherein said amino acid having a non-polar
side chain is selected from the group of methionine, glycine,
alanine, valine, leucine, isoleucine, phenylalanine and
proline.
36. The kit of claim 33, wherein said JDF-3 DNA polymerase has one
or more amino acid mutations selected from the group consisting of:
D141A or D141T, E143A, L408H or L408F, A485T, and P410L.
37. The kit of claim 36, wherein said JDF-3 DNA polymerase
comprises four amino acid mutations at D141A, E 143A, P410L and
A485T.
38. The kit of claim 31, wherein said Family B DNA polymerase is
deficient in 3' to 5' exonuclease activity.
39. The kit of claim 31, further comprising at least one
chain-terminating nucleotide analog, wherein said chain-terminating
nucleotide analog is incorporated into said first primer by said
Family B DNA polymerase in a template-dependent manner.
40. The kit of claim 39, wherein at least one chain-terminating
nucleotide analog is labeled with a first detectable label.
41. The kit of claim 39, wherein more than one chain-terminating
nucleotide analog is labeled, each chain-terminating nucleotide
analog being labeled with a different first detectable label.
42. The kit of claim 39, wherein said chain-terminating nucleotide
analog is a dideoxynucleotide.
43. The kit of claim 42, wherein said dideoxynucleotide is selected
from the group consisting of: ddATP, ddTTP, ddCTP and ddGTP.
44. The kit of claim 39, wherein said first primer is labeled with
a second detectable label.
45. The kit of claim 44, wherein first and second detectable labels
generate a signal for identifying said nucleotide at the given
position of the template DNA molecule.
46. The kit of claim 31, further comprising a second primer.
47. The kit of claim 46, wherein said first primer is labeled with
a second detectable label and said second primer is labeled with a
third detectable label, said second and third detectable labels
generate a signal for identifying said nucleotide at the given
position of the template DNA molecule.
48. The kit of claim 47, wherein said second primer anneals to the
immediate 5' of said nucleotide at the given position of said
template DNA molecule.
49. The kit of claim 48, further comprising a DNA ligase.
50. The kit of claim 31, further comprising a reaction buffer for
said Family B DNA polymerase.
51. The kit of claim 31, wherein said template DNA molecule is the
product of a polymerase chain reaction or a plasmid DNA.
52. The kit of claim 40, 44, or 47, wherein said first or second or
third detectable label is one selected from the group consisting
of: a fluorescent label, an isotope, a chemiluminescent label, a
quantum dot label, an antigen, or an affinity moiety.
53. The kit of claim 52, wherein said first detectable label is a
rhodamine label or a cyanine label.
54. The kit of claim 31, further comprising a control template
and/or at least one control primer.
55. The kit of claim 54, comprising a control template and four
control primers.
56. A kit for identifying a nucleotide at a given position of a
template DNA molecule, said kit comprising a Family B DNA
polymerase having reduced discrimination against non-conventional
nucleotides, wherein said DNA polymerase comprises an amino acid
mutation at a position corresponding to P410 of SEQ ID NO:2.
57. The kit of claim 56, wherein said amino acid mutation at a
position corresponding to P410 of SEQ ID NO:2 is an amino acid
substitution with an amino acid having a non polar side chain.
58. The kit of claim 57, wherein said amino acid having a non polar
side chain is selected from the group of methionine, glycine,
alanine, valine, leucine, isoleucine, phenylalanine and
proline.
59. A kit for identifying a nucleotide at a given position of a
template DNA molecule, said kit comprising a Family B DNA
polymerase having reduced discrimination against non-conventional
nucleotides, wherein said DNA polymerase comprises an amino acid
mutation in the P Helix and at a position corresponding to P410 of
SEQ ID NO: 2.
60. The kit of claim 59, wherein said amino acid mutation in the P
Helix is located at a position corresponding to A485 of SEQ ID NO:
2.
61. The kit of claim 59 wherein the mutation at a position
corresponding to P410 of SEQ ID NO: 2 is a substitution with an
amino acid with a non-polar side chain.
62. The kit of claim 61, wherein said amino acid having a non polar
side chain is selected from the group of amino acid selected from
the group of methionine, glycine, alanine, valine, leucine,
isoleucine, phenylalanine and proline.
63. A method of identifying a nucleotide at a given position of a
template DNA molecule in a sample, said method comprising: (a)
contacting a first primer with said template DNA molecule, wherein
said contacting allows said first primer to anneal to the immediate
3' of said nucleotide at the given position of said template DNA
molecule, so as to form a duplex between said first primer and said
template DNA molecule; (b) incubating said duplex from step (a), in
the presence of a Family B DNA polymerase and at least one
chain-terminating nucleotide analog, said Family B DNA polymerase
having reduced discrimination against non-conventional nucleotides
and said terminator is labeled with a first detectable label,
wherein said incubating allows the incorporation of a labeled
chain-terminating nucleotide analog into said first primer by said
DNA polymerase in a template-dependent manner; and (c) determining
the presence or identity of said duplex from step (b) by a signal
generated from said first detectable label.
64. The method of claim 63, wherein said Family B DNA polymerase is
a JDF-3 DNA polymerase.
65. The method of claim 64, wherein said JDF-3 DNA polymerase has a
sequence of SEQ ID NO: 2 and further comprises one or more amino
acid mutations at D141, E143, A485, L408 or P410.
66. The method of claim 64, wherein said JDF-3 DNA polymerase is
substituted at position P410 with an amino acid having a non polar
side chain.
67. The method of claim 66, wherein said amino acid having a non
polar side chain is methionine, glycine, alanine, valine, leucine,
isoleucine, phenylalanine and proline.
68. The method of claim 64, wherein said JDF-3 DNA polymerase has
one or more amino acid mutations selected from the group consisting
of: D141A or D141T, E143A, L408H or L408F, A485T, and P410L.
69. The method of claim 68, wherein said JDF-3 DNA polymerase
comprises four amino acid mutations at D141A, E 143A, P410L and
A485T.
70. The method of claim 63, wherein said Family B DNA polymerase is
deficient in 3' to 5' exonuclease activity.
71. The method of claim 63, wherein at least one chain-terminating
nucleotide analog is labeled with a first detectable label.
72. The method of claim 63, wherein more than one chain-terminating
nucleotide analog is labeled, each chain-terminating nucleotide
analog being labeled with a different first detectable label.
73. The method of claim 63, wherein said chain-terminating
nucleotide analog is a dideoxynucleotide.
74. The method of claim 73, wherein said dideoxynucleotide is
selected from the group consisting of: ddATP, ddTTP, ddCTP and
ddGTP.
75. The method of claim 63, wherein said first primer is labeled
with a second detectable label.
76. The method of claim 75, wherein first and second detectable
labels generate a signal for identifying said nucleotide at the
given position of the template DNA molecule.
77. The method of claim 63, wherein said template DNA molecule is
the product of a polymerase chain reaction or a plasmid.
78. The method of claim 77, further comprising removing PCR primers
and dNTPs from the PCR product before step (a).
79. A method of identifying a nucleotide at a given position of a
template DNA molecule in a sample, said method comprising: a)
contacting a first primer and s second primer with said template
DNA molecule, wherein said contacting allows said first primer to
anneal to the immediate 3' of said nucleotide at the given position
of said template DNA molecule and said second primer to anneal to
the immediate 5' of said nucleotide at the given position of said
template DNA molecule, so as to form a complex between said
template DNA molecule and said first and second primers, said first
primer being labeled with a second detectable label and said second
primer being labeled with a third detectable label. b) incubating
said complex from step (a), in the presence of a DNA ligase,
wherein said incubating allows the ligation between said first and
second primers so as to form a single molecule; and c) determining
the presence or identity of said single molecule from step (b) by a
signal generated from said second and third detectable labels.
80. The method of claim 63, 75, or 79, wherein said first or second
or third detectable label is one selected from the group consisting
of: a radiolabel, a fluorescent label, a chemiluminescent label, a
colorimetric label and an enzymatic label.
81. The method of claim 80, wherein said first detectable label is
a rhodamine label or a cyanine label.
82. A method of identifying a nucleotide at a given position of a
template DNA molecule in a sample, said method comprising: a)
contacting a first primer with said template DNA molecule, wherein
said contacting allows said first primer to anneal to the immediate
3' of said nucleotide at the given position of said template DNA
molecule, so as to form a duplex between said first primer and said
template DNA molecule; b) incubating said duplex from step (a), in
the presence of a Family B DNA polymerase and at least one
chain-terminating nucleotide analog, said Family B DNA polymerase
having reduced discrimination against non-conventional nucleotides,
wherein said DNA polymerase comprises an amino acid mutation in a
position corresponding to P410 of SEQ ID NO: 2 and said terminator
is labeled with a first detectable label, wherein said incubating
allows the incorporation of a labeled chain-terminating nucleotide
analog into said first primer by said DNA polymerase in a
template-dependent manner; and c) determining the presence or
identity of said duplex from step (b) by a signal generated from
said first detectable label.
83. The method of claim 82, wherein said amino acid mutation at a
position corresponding to P410 of SEQ ID NO:2 is an amino acid
substitution with an amino acid having a non polar side chain.
84. The method of claim 83, wherein said amino acid having a non
polar side chain is selected from the group of methionine, glycine,
alanine, valine, leucine, isoleucine, phenylalanine and
proline.
85. A method of identifying a nucleotide at a given position of a
template DNA molecule in a sample, said method comprising: (a)
contacting a first primer with said template DNA molecule, wherein
said contacting allows said first primer to anneal to the immediate
3' of said nucleotide at the given position of said template DNA
molecule, so as to form a duplex between said first primer and said
template DNA molecule; (b) incubating said duplex from step (a), in
the presence of a Family B DNA polymerase and at least one
chain-terminating nucleotide analog, said Family B DNA polymerase
having reduced discrimination against non-conventional nucleotides,
wherein said DNA polymerase comprises amino acid mutations in the P
Helix and at a position corresponding to P410 of SEQ ID NO:2 and
said terminator is labeled with a first detectable label, wherein
said incubating allows the incorporation of a labeled
chain-terminating nucleotide analog into said first primer by said
DNA polymerase in a template-dependent manner; and determining the
presence or identity of said duplex from step (b) by a signal
generated from said first detectable label.
86. The method of claim 85, wherein said amino acid mutation in the
P Helix is located at a position corresponding to position A485 of
SEQ ID NO: 2.
87. The method of claim 86, wherein said amino acid mutation at a
position corresponding to position P410 of SEQ ID NO: 2 is an amino
acid substitution with an amino acid having a non polar side
chain.
88. The method of claim 87, wherein said amino acid having a non
polar side chain is selected from the group of methionine, glycine,
alanine, valine, leucine, isoleucine, phenylalanine and proline.
Description
[0001] This application is a continuation-in-part of the pending
application, U.S. Ser. No. 09/896,923, which is a
continuation-in-part of the pending U.S. Ser. No. 09/698,341 patent
application, which claims priority to U.S. Ser. No. 60/162,000,
filed Oct. 29, 1999.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions and methods
utilizing DNA polymerase enzymes with reduced discrimination for
non-conventional nucleotides. The enzymes of the invention are
useful in many applications calling for the detectable labeling of
nucleic acids and are particularly useful in DNA sequencing
applications.
BACKGROUND OF THE INVENTION
[0003] Detectable labeling of nucleic acids is required for many
applications in molecular biology, including applications for
research as well as clinical diagnostic techniques. A commonly used
method of labeling nucleic acids uses one or more unconventional
nucleotides and a polymerase enzyme that catalyzes the
template-dependent incorporation of the unconventional
nucleotide(s) into the newly synthesized complementary strand.
[0004] The ability of a DNA polymerase to incorporate the correct
deoxynucleotide is the basis for high fidelity DNA replication in
vivo. Amino acids within the active site of polymerases form a
specific binding pocket that favors the placement of the correct
complementary nucleotide opposite the template nucleotide. If a
mismatched nucleotide, ribonucleotide, or nucleotide analog fills
that position, the precise alignment of the amino acids contacting
the incoming nucleotide may be distorted into a position
unfavorable for DNA polymerization. Because of this, the
unconventional nucleotides or nucleotide analogs used to label DNA
tend to be incorporated into the elongated strand less efficiently
than do the standard deoxynucleotide triphosphates (dNTPs; the
so-called "standard" dNTPs include deoxyadenosine triphosphate
(dATP), deoxycytosine triphosphate (dCTP), deoxyguanosine
triphosphate (dGTP), and thymidine triphosphate (TTP)).
[0005] The reduced efficiency with which unconventional nucleotides
are incorporated by the polymerase increases the amount of the
unconventional nucleotide necessary for DNA labeling. The reduced
efficiency of incorporation of a particular nucleotide can also
adversely affect the performance of techniques or assays, such as
DNA sequencing, that depend upon unbiased incorporation of
unconventional nucleotides for homogeneous signal strength.
[0006] The identity and exact arrangement of the amino acids of a
DNA polymerase that contact an incoming nucleotide triphosphate
determine the nature of the nucleotides, both conventional and
unconventional, that may be incorporated by that polymerase enzyme.
Changes in the exact placement of the amino acids that contact the
incoming nucleotide triphosphate at any stage of binding or chain
elongation can dramatically alter the polymerase's capacity for
utilization of unusual or unconventional nucleotides. Sometimes
changes in distant amino acids can influence the incorporation of
nucleotide analogs due to indirect global or structural effects.
Polymerases with increased capacity to incorporate nucleotide
analogs are useful for labeling DNA or RNA strands with nucleotides
modified with signal moieties such as dyes, reactive groups or
unstable isotopes.
[0007] In addition to labeled nucleotides, an extremely important
class of modified nucleotides is the dideoxynucleotides. The
so-called "Sanger" or "dideoxy" DNA sequencing method (Sanger et
al., 1977, Proc. Natl. Acad. Sci. USA 74: 5463, which is
incorporated herein by reference) relies upon the template-directed
incorporation of nucleotides onto an annealed primer by a DNA
polymerase from a mixture containing deoxy- and dideoxynucleotides.
The incorporation of a dideoxynucleotide results in chain
termination, the inability of the enzyme to catalyze further
extension of that strand. Electrophoretic separation of reaction
products results in a "ladder" of extension products wherein each
extension product ends in a particular dideoxynucleotide
complementary to the nucleotide opposite it in the template. The
distance of the dideoxynucleotide analog from the primer is
indicated by the length of the extension product. When four
reactions, each containing one of the four dideoxynucleotide
analogs ddA, ddC, ddG, or ddT (ddNTPs) are separated on the same
gel, the sequence of the template may be read directly from the
ladder patterns. Extension products may be detected in several
ways, including for example, the inclusion of isotopically- or
fluorescently-labeled primers, deoxynucleotide triphosphates or
dideoxynucleotide triphosphates in the reaction.
[0008] Fluorescent labeling has the advantages of faster data
collection, since detection may be performed while the gel is
running, and longer reads of sequence data from a single reaction
and gel. Further, fluorescent sequence detection has allowed
sequencing to be performed in a single reaction tube containing
four differentially-labeled fluorescent dye terminators (the
so-called dye-terminator method, Lee et al., 1992, Nucleic Acids
Res. 20: 2471, incorporated herein by reference).
[0009] A desirable quality of a polymerase useful for DNA
sequencing is improved incorporation of dideoxynucleotides.
Improved incorporation of dideoxynucleotides can make processes
such as DNA sequencing more cost effective by reducing the
requirement for expensive radioactive or fluorescent dye-labeled
dideoxynucleotides. Moreover, unbiased dideoxynucleotide
incorporation provides improved signal uniformity, leading to
increased accuracy of base determination. The even signal output
further allows subtle sequence differences caused by factors like
allelic variation to be detected. Allelic variation, which produces
two different half strength signals at the position of relevance,
can easily be concealed by the varied signal strengths caused by
polymerases with non-uniform ddNTP utilization.
[0010] Incorporation of ribonucleotides by the native form of DNA
polymerase is a rare event. Mutants that incorporate higher levels
of ribonucleotides can be used for application s such as sequencing
by partial ribosubstitution. In this system, a mixture of
ribonucleotides and deoxynucleotides corresponding to the same base
are incorporated by the mutant polymerase (Barnes, 1978 J. Mol.
Biol. 119:83-99). When the ribosequencing reactions are exposed to
alkaline conditions and heat, fragmentation of the extended strand
occurs. If the reactions for all four bases are separated on a
denaturing acrylamide gel, they produce a sequencing ladder. There
is a need in the art for polymerase mutants with higher utilization
of ribonucleotides for this alternative method of sequencing.
[0011] Alternatively, the incorporation of ribonucleotides followed
by alkaline hydrolysis could be utilized in a system that requires
random cleavage of DNA molecules such as DNA shuffling ((Stemmer,
1994, Nature, 370: 389-391) which has also been called molecular
breeding, sexual PCR and directed evolution).
[0012] Another desirable quality in a DNA labeling enzyme is
thermal stability. DNA polymerases exhibiting thermal stability
have revolutionized many aspects of molecular biology and clinical
diagnostics since the development of the polymerase chain reaction
(PCR), which uses cycles of thermal denaturation, primer annealing,
and enzymatic primer extension to amplify DNA templates. The
prototype thermostable DNA polymerase is Taq polymerase, originally
isolated from the thermophilic eubacterium Thermus aquaticus.
So-called "cycle sequencing" reactions using thermostable DNA
polymerases have the advantage of requiring smaller amounts of
starting template relative to conventional (i.e., non-cycle)
sequencing reactions.
[0013] There are three major families of DNA polymerases, termed
families A, B and C. The classification of a polymerase into one of
these three families is based on structural similarity of a given
polymerase to E. coli DNA polymerase I (Family A), II (Family B) or
III (family C). As examples, Family A DNA polymerases include, but
are not limited to Klenow DNA polymerase, Thermus aquaticus DNA
polymerase I (Taq polymerase) and bacteriophage T7 DNA polymerase;
Family B DNA polymerases, formerly known as .alpha.-family
polymerases (Braithwaite and Ito, 1991, Nuc. Acids Res. 19:4045),
include, but are not limited to human .alpha.,.delta. and .epsilon.
DNA polymerases, T4, RB69 and .phi.29 bacteriophage DNA
polymerases, and Pyrococcus furiosus DNA polymerase (Pfu
polymerase); and family C DNA polymerases include, but are not
limited to Bacillus subtilis DNA polymerase III, and E. coli DNA
polymerase III .alpha. and .epsilon. subunits (listed as products
of the dnaE and dnaQ genes, respectively, by Brathwaite and Ito,
1993, Nucleic Acids Res. 21: 787). An alignment of DNA polymerase
protein sequences of each family across a broad spectrum of
archaeal, bacterial, viral and eukaryotic organisms is presented in
Braithwaite and Ito (1993, supra), which is incorporated herein by
reference.
[0014] The term used to describe the tendency of DNA polymerases to
not to carry the incorporation of unnatural nucleotides into the
nascent DNA polymer is "discrimination". In Family A DNA
polymerases, the effective discrimination against incorporation of
dideoxynucleotide analogs is largely associated with a single amino
acid residue. The majority of enzymes from the Family A DNA
polymerases have a phenylalanine (phe or F) residue at the position
equivalent to F762 in E. coli Klenow fragment of DNA polymerase and
demonstrate a strong discrimination against dideoxynucleotides. A
few polymerases (e.g. T7 DNA polymerase) have a tyrosine (tyr or Y)
residue at the corresponding position and exhibit relatively weak
discrimination against dideoxynucleotides. Family A polymerases
with tyrosine at this position readily incorporate
dideoxynucleotides at levels equal to or only slightly different
from the levels at which they incorporate deoxynucleotides.
Conversion of the tyrosine or phenylalanine residues in the site
responsible for discrimination reverses the dideoxynucleotide
discrimination profile of the Family A enzymes (Tabor and
Richardson, 1995, Proc. Natl. Acad. Sci. USA 92:6449).
[0015] Among the thermostable DNA polymerases, a mutant form of the
Family A DNA polymerase from Thermus aqaticus, known as AmpliTaq
FS.RTM. (Perkin Elmer), contains a F667Y mutation at the position
equivalent to F762 of Klenow DNA polymerase and exhibits increased
dideoxynucleotide uptake (i.e., reduced discrimination against
ddNTPs) relative to the wild-type enzyme. The reduced
discrimination for dideoxynucleotide uptake makes it more useful
for fluorescent and labeled dideoxynucleotide sequencing than the
wild-type enzyme.
[0016] The F667Y mutant of Taq DNA polymerase is not suited,
however, for use with fluorescein-labeled dideoxynucleotides,
necessitating the use of rhodamine dye terminators. Rhodamine dye
terminators that are currently utilized with Taq sequencing
reactions, however, stabilize DNA secondary structure, causing
compression of signal. Efforts to eliminate compression problems
have resulted in systems that use high amounts of the nucleotide
analog deoxyinosine triphosphate (dITP) in place of deoxyguanosine
triphosphate. While incorporation of (dITP) reduces the compression
of the signal, the presence of dITP in the reaction produces
additional complications including lowered reaction temperatures
and increased reaction times. Additionally, the use of rhodamine
dyes in sequencing requires undesirable post-reaction purification
(Brandis, 1999 Nuc. Acid Res. 27:1912).
[0017] Family B DNA polymerases exhibit substantially different
structure compared to Family A DNA polymerases, with the exception
of the position of acidic residues involved in catalysis in the
so-called palm domain (Wang et al., 1997, Cell 89:1087; Hopfner et
al., 1999, Proc. Natl. Acad. Sci. USA 96:3600). The unique
structure of Family B DNA polymerases may permit a completely
different spectrum of interactions with nucleotide analogs, perhaps
allowing utilization of analogs which are unsuitable for use with
Family A DNA polymerases due to structural constraints.
Thermostable Family B DNA polymerases have been identified in
hyperthermophilic archaea. These organisms grow at temperatures
higher than 90.degree. C. and their enzymes demonstrate greater
themostability (Mathur et al., 1992, Stratagies 5:11) than the
thermophilic eubacterial Family A DNA polymerases. Family B
polymerases from hyperthermophilic archaea may be well suited
starting substrates for modification(s) to reduce discrimination
against non-conventional nucleotides.
[0018] Although the crystal structures of three Family B DNA
polymerases have been solved (Wang et al., 1997, supra; Hopfner, K.
-P. et al., 1999, Proc. Natl. Acad. Sci. 96: 3600; Zhao, 1999,
Structure Fold Des., 7:1189), the structures of DNA-polymerase or
dNTP-polymerase co-complexes have not yet been reported. At
present, identification of amino acid residues contributing to
nucleotide analog discrimination can only be inferred from
extrapolation to Family A-dNTP structures or from mutagenesis
studies carried out with related Family B DNA polymerases (e.g.,
human pol.alpha., phage T4, phage .phi.29, T. litoralis DNA
polymerase).
[0019] Sequence comparison of the Family B DNA polymerases indicate
six conserved regions numbered I-VI (Braithwaite and Ito, 1993,
supra; Wong et al., 1988). Designated conserved regions I-VI of the
Human DNA polymerase .alpha. and other DNA polymerases are defined
as follows: Region I of a Family B DNA polymerase corresponds to
amino acids 998-1005 of Human pol .alpha.; Region II corresponds to
amino acids 839-878 of human pol .alpha.; Region III corresponds to
amino acids 943-984 of human pol a; Region IV corresponds to amino
acids 609-650 of human pol .alpha.; Region V corresponds to amino
acids 1075-1081 of human pol .alpha.; and Region VI corresponds to
amino acids 909-926 of human pol .alpha.. The crystal structure of
bacteriophage RB69 DNA polymerase (Family B) proposed by Wang et
al. (Wang et al., 1997, supra) shows that Y416 in region II ( which
corresponds to Y409 in the Family B DNA polymerase of Thermococcus
species JDF-3) has the same position as Y115 in HIV reverse
transcriptase (RT) and E710 in the Klenow fragment (Family A
polymerases). Modeling of the dNTP and primer template complex in
RB69 was carried out using the atomic coordinates of the reverse
transcriptase-DNA cocrystal. This model predicts the RB69 Y416
packs under the deoxyribose portion of the dNTP. Tyrosine at this
position has been implicated in ribose selectivity, contributing to
polymerase discrimination between ribonucleotides and
deoxribonucleotides in mammalian reverse transcriptases (Y115) (Gao
et al., 1997, Proc. Natl. Acad. Sci. USA 94:407; Joyce, 1994, Proc.
Natl. Acad. Sci. USA 94:1619) and in Family A DNA polymerases where
modification of the corresponding invariable glutamate residue
(E710) reduces discrimination against ribonucleotides (Gelfand et
al., 1998, Pat. No. EPO823479; Astatke et al., 1998, Proc. Natl.
Acad. Sci. USA 96:3402).
[0020] Mutagenesis studies done in Family B DNA polymerases also
implicate the region containing the analogous Y in region II in
dNTP incorporation and ribose selectivity. Mutations at the
corresponding Y865 in human DNA polymerase .alpha. affect
polymerase fidelity and sensitivity to dNTP nucleotide inhibitors
such as AZT-TP, which has a bulky 3'-azido group in place of the
3'-OH group, BuPdGTP, which contains a butylphenyl group attached
to the amino group at the C-2 position in the guanine base of dGTP
(resulting in a bulkier and more hydrophobic purine base
nucleotide) and aphidicolin, a competitive inhibitor of pyrimidine
deoxynucleotide triphosphate. Interestingly, the mutants showed no
difference in their uptake of ddCTP (Dong et al., 1993, J. Biol.
Chem. 268: 26143). Additionally, mutants of bacteriophage T4 DNA
polymerase, which have converted L412 to methionine (M) or
isoleucine (I) just one amino acid before the analogous Y (Y411),
show extreme and mild sensitivity, respectively, to the inorganic
pyrophosphate analog phosphonoacetic acid (PAA). Alterations in PAA
sensitivity have been shown to predict polymerase interactions with
nucleotide analogs. L412 in T4 DNA polymerase corresponds to L410
in Thermococcus species JDF-3 DNA polymerase. The L412M T4 DNA
polymerase mutant was inhibited with 50-fold less ddGTP than
wild-type polymerase while the K.sub.ms for dGTP was similar. As
stated by the authors in that study, "[d]espite the sensitivity of
the L412M DNA polymerase to ddGTP, there was no difference found in
the incorporation of ddNTPs by wild-type and L412M DNA polymerase."
(Reha-Krantz et al., 1993, J. Virol. 67:60). In bacteriophage
.phi.29, mutations in region II (LYP where Y is analogous to
Thermococcus species JDF3 DNA polymerase Y409) produce mixed
results when challenged with PAA; P255S was hypersensitive to PAA
while L253V was shown to be less sensitive than the wild-type
enzyme (Blasco et al., 1993, J. Biol. Chem. 268: 24106). These data
support the role of the LYP region (region II) in
polymerase-nucleotide interactions, but improved incorporation of
ddNTPs was not achieved in these references.
[0021] In another study, extensive mutation of region II in the
archaeal Family B DNA polymerase from Thermococcus litoralis DNA
polymerase (VENT.TM. polymerase, New England Biolabs) was
performed. In that study, 26 different site-directed mutants were
made for the sole intent of examining nucleotide analog
discrimination (Gardner and Jack, 1999, Nucleic Acids Res. 27:
2545). Site-directed mutagenesis of VENT.TM. DNA polymerase
demonstrated that three mutations at Y412 (which corresponds to
JDF-3 DNA polymerase Y409) could alter nucleotide binding (Gardner
and Jack, 1999, supra). Y412V was most significant with a 2 fold
increase in dideoxynucleotide incorporation and a 200 fold increase
in the incorporation of ribonucleotide ATP. The mutation Y412F
showed no change in analog incorporation.
[0022] Region III of the Family B polymerases (also referred to as
motif B) has also been demonstrated to play a role in nucleotide
recognition. This region, which corresponds to AA 487 to 495 of
JDF-3 Family B DNA polymerase, has a consensus sequence
KX.sub.3NSXYG (Jung et al., 1990, supra; Blasco et al., 1992,
supra; Dong et al., 1993, J. Biol. Chem. 268:21163; Zhu et al.,
1994, Biochem. Biophys. Acta 1219:260; Dong and Wang, 1995, J.
Biol. Chem. 270:21563), and is functionally, but not structurally
(Wang et al., 1997, supra), analogous to KX.sub.3(F/Y)GX.sub.2YG in
helix O of the Family A DNA polymerases. In Family A DNA
polymerases, such as the Klenow fragment and Taq DNA polymerases,
the O helix contains amino acids that play a major role in dNTP
binding (Astatke et al., 1998, J. Mol. Biol. 278:147; Astatke et
al., 1995, J. Biol. Chem. 270:1945; Polesky et al., 1992, J. Biol.
Chem 267:8417; Polesky et al., 1990, J. Biol. Chem. 265:14579;
Pandey et al., 1994, J. Biol. Chem. 269:13259; Kaushik et al.,
1996, Biochem. 35:7256). Specifically, helix O contains the F (F763
in the Klenow fragment; F667 in Taq) which confers ddNTP
discrimination in Family A DNA polymerases
(KX.sub.3(F/Y)GX.sub.2YG) (Tabor and Richardson, 1995, supra).
[0023] Directed mutagenesis studies in region III of VENT.TM. DNA
polymerase also targeted an alanine analogous to A485 of the
Thermococcus species JDF-3 DNA polymerase (Jung et al., 1990,
supra). These mutants (A.fwdarw.C, A.fwdarw.S, A.fwdarw.L,
A.fwdarw.I, A.fwdarw.F and A.fwdarw.V) exhibited a range of
specific activities from 0.12 to 1.2 times the polymerase activity
of the progenitor enzyme (Gardner and Jack, 1999, Nucl. Acids Res.
27:2545). The dideoxynucleotide incorporation ranged from 4 to 15
times the unmutated enzyme. Interestingly, the mutant with the
highest dideoxynucleotide incorporation (15.times.) had a specific
activity of only 0.12.times. of the original enzyme.
[0024] Site-directed mutagenesis studies on the Family B DNA
polymerase from Thermococcus barossii modified each residue
independently in the sequence ILANSF, which corresponds to AA
residues 488-493 of the JDF-3 DNA polymerase, to tyrosine (Reidl et
al., U.S. Pat. No. 5,882,904). That study indicated that an L489Y
mutant exhibits approximately 3 times greater incorporation of
dideoxynucleotides relative to an enzyme bearing the wild-type
leucine residue at this site.
[0025] One area of active research involves the use of nucleic acid
arrays, often referred to as nucleic acid or DNA "chips", in the
simultaneous analyses of multiple different nucleic acid sequences.
Many of these applications, such as those described in U.S. Pat.
No. 5,882,904 (Reidl et al., issued March 16, 1999) will benefit
from DNA polymerases exhibiting reduced discrimination against
non-conventional nucleotides, particularly fluorescently-labeled
non-conventional nucleotides. Applications being addressed in the
chip format include DNA sequencing and mutation detection, among
others. For example, the "mini-sequencing" methods (e.g., Pastinen
et al., 1997, Genome Res. 7: 606; Syvanen, 1999, Human Mutation 13:
1-10) and the arrayed primer extension (APEX) mutation detection
method (Shumaker et al., 1996, Hum. Mutat. 7: 346) and methods like
them can benefit from DNA polymerases with reduced discrimination
against fluorescently-labeled or other non-conventional
nucleotides. There is a need in the art for a non-discriminating
DNA polymerase for use in chip or gel based mini-sequencing
systems. Such a system would advantageously permit detection of
multiplexed single nucleotide polymorphisms (SNPs) and allow for
quantitative genotyping. Identification of sequence variation
permits the diagnosis and treatment of genetic disorders,
predisposition to multifactorial diseases, and sensitivity to new
or existing pharmaceutical products.
[0026] With the completion of the human genome project,
considerable attention is now focused on analyzing genetic
variations between individuals, and specifically, single nucleotide
polymorphisms (SNPs) which have been estimated to occur one in
every 1000 bp (Halushka et al., 1999). The importance of SNPs is
that they serve as genetic markers that enable identification of
disease related loci (Lai et al., 1998). They can also be used to
investigate the underlying cause of genetic diseases and could
eventually help pave the way to personalized medicine.
[0027] Current assays used in SNP detection include hybridization
to allele-specific oligonucleotide (ASO) probes (Saiki et al.,
1989), oligonucleotide ligation assay (OLA) (Landegren et al.,
1988), restriction fragment length polymorphism (RFLP) (Shi et al.,
2001), TaqMan assay (Livak et al., 1995), molecular beacon assay
(Tyagi et al., 1998), and primer extension assay (Tyagi et al.,
1998; Gilles et al., 1999; Fu et al., 1998) on a variety of
platforms including gel electrophoresis (Chen et al., 1997),
MALDI-TOF mass spectrometry (Fu et al., 1998), solid phase
minisequencing (Syvanen et al., 1990), semiconductor microchips
(Gilles et al., 1999), and flow cytometric analysis (Taylor et al.,
2001).
[0028] The principle of minisequencing is to anneal primers
immediately adjacent to the SNP positions to be analyzed and to
extend these primers with ddNTPs complementary to the SNP (Syvanen
et al., 1990, hereby incorporated as reference) using a DNA
polymerase that readily incorporates ddNTPs. Minisequencing is
unique since it is based on the high accuracy (high specificity) of
polymerase mediated nucleotide incorporation reactions rather than
the thermostability of matched and mismatched species which affects
most other SNP detection methods. Thus, compared to
hybridization-based methods, minisequencing is insensitive to small
variations in reaction conditions, temperature, and to flanking DNA
sequence. Moreover, minisequencing allows discrimination between
homozygous and heterozygous genotypes (Chen et al., 1997). These
characteristics are important in multiplexing and/or high
throughput SNP detection. With the completion of the genome project
and considerable interest in high throughput SNP detection, a
significant market exists for enzymes that efficiently incorporate
ddNTPs and dye labeled-ddNTPs in single base extension assays (mini
sequencing).
[0029] DNA polymerases constitute a core component of
minisequencing protocols. Efficient ddNTP and dye-ddNTP
incorporation and high fidelity are essential characteristics of
minisequencing enzymes. Commercially available DNA polymerases that
are suitable for sequencing and minisequencing have been derived
from either Taq (Taq F667Y mutants such as ThermoSequenase and
AmpliTaqFS) or bacteriophage T7 DNA polymerase (Sequenase), which
are both family A DNA polymerases. A tyrosine (Y) residue in the
nucleotide binding pocket of T7 (native) or Taq (engineered F667Y
mutant) DNA polymerase confers efficient ddNTP incorporation (Tabor
et al., 1995). In two recent mutagenesis studies employing archaeal
(family B) DNA polymerases, mutations were identified that reduced
ddNTP discrimination; however, the archaeal DNA polymerase mutants
incorporated ddNTPs less efficiently than the Taq F667Y mutant
(Gardner et al., 1999; Evans et al., 2000).
[0030] There is a need in the art for DNA polymerases with reduced
discrimination against unconventional nucleotides. There is
particularly a need in the art for thermostable DNA polymerases
exhibiting reduced discrimination against dideoxynucleotides, and
further, for DNA polymerases exhibiting reduced discrimination
against fluorescently labeled dideoxynucleotides.
SUMMARY OF THE INVENTION
[0031] The present invention relates to compositions and methods
utilizing DNA polymerase enzymes exhibiting reduced discrimination
against non-conventional nucleotides. Enzymes with this quality are
useful in many applications calling for the detectable labeling of
nucleic acids and are particularly useful in DNA sequencing
applications.
[0032] The invention further relates to a Family B DNA polymerase
having one or more mutations at a site or sites corresponding to
L408, P410, S345, and/or A485 of SEQ ID NO: 2, or a fragment
thereof which retains the ability to direct the template-dependent
polymerization of nucleic acid. The invention also encompasses
mutants and modified versions (e.g., reversibly inactivated
versions of a Family B polymerase prepared, for example, by
chemical modification or antibody complexing) of a Family B
polymerase mutated at sites corresponding to L408, P410 and or A485
of SEQ ID NO: 2.
[0033] In one embodiment, the DNA polymerase has a dual mutation
comprising comprising a serine to proline mutation at a site
corresponding to S345 of SEQ ID NO: 2; and a proline to leucine
mutation at a site corresponding to P410 of SEQ ID NO: 2.
[0034] The invention encompasses purified thermostable DNA
polymerase having an amino acid sequence presented in SEQ ID NO: 2
from residue 1 to 776.
[0035] In one embodiment, the thermostable DNA polymerase is
isolated from Thermococcus species JDF-3.
[0036] In another embodiment, the thermostable polymerase is
isolated from a recombinant organism transformed with a vector that
codes for the expression of Thermococcus species JDF-3 DNA
polymerase.
[0037] The invention encompasses a composition for identifying a
nucleotide at a given position of a template DNA molecule, the
composition comprising a Family B DNA polymerase having reduced
discrimination against non-conventional nucleotides and a first
primer, wherein the first primer anneals to the immediate 3' of the
nucleotide at the given position of the template DNA molecule.
[0038] In one embodiment, the Family B DNA polymerase is a JDF-3
DNA polymerase. In a preferred embodiment, the JDF-3 DNA polymerase
has a sequence of SEQ ID NO: 2 and further comprises one or more
amino acid mutations at D141, E143, A485, L408 or P410. In a
further preferred embodiment, the JDF-3 DNA polymerase has one or
more amino acid mutations selected from the group consisting of:
D141A or D141T, E143A, L408H or L408F, A485T, and P410L.
[0039] In another embodiment, the JDF-3 DNA polymerase is
substituted at position P410 with an amino acid having a non polar
side chain.. It is preferred that the non polar side chain is
selected from the group of methionine, glycine, alanine, valine,
leucine, isoleucine, phenylalanine and proline.
[0040] In another embodiment, the JDF-3 DNA polymerase comprises
four amino acid mutations, at D141A, E 143A, P410L and A485T.
[0041] It is preferred that the above-described Family B DNA
polymerase is deficient in 3' to 5' exonuclease activity.
[0042] In another embodiment of the above compositions, the
composition further comprises at least one chain-terminating
nucleotide analog, wherein the chain-terminating nucleotide analog
is incorporated into the first primer by the Family B DNA
polymerase in a template-dependent manner. It is preferred that the
at least one chain-terminating nucleotide analog is labeled with a
first detectable label. In another embodiment, more than one
chain-terminating nucleotide analog is labeled, each
chain-terminating nucleotide analog being labeled with a different
first detectable label. It is preferred that the chain-terminating
nucleotide analog is a dideoxynucleotide, preferably one selected
from the group consisting of: ddATP, ddTTP, ddCTP and ddGTP.
[0043] In another embodiment, the first primer is labeled with a
second detectable label. It is preferred that the first and second
detectable labels generate a signal for identifying the nucleotide
at the given position of the template DNA molecule.
[0044] In another embodiment, the composition further comprises a
second primer. It is preferred that the first primer is labeled
with a second detectable label and the second primer is labeled
with a third detectable label, and that the second and third
detectable labels generate a signal for identifying the nucleotide
at the given position of the template DNA molecule. It is furhter
preferred that the second primer anneals to the immediate 5' of the
nucleotide at the given position of the template DNA molecule.
[0045] In one embodiment, the above-described composition further
comprises a DNA ligase and/or a reaction buffer for the Family B
DNA polymerase.
[0046] In another embodiment, the template DNA molecule is the
product of a polymerase chain reaction or a plasmid DNA.
[0047] In any of the preceding embodiments comprising a first,
second or third detectable label, the detectable label(s) is/are
preferably selected from the group consisting of: a fluorescent
label, an isotope, a chemiluminescent label, a quantum dot label,
an antigen, or an affinity moiety. It is preferred that the first
detectable label is a rhodamine label or a cyanine label.
[0048] The invention further encompasses an isolated recombinant
Family B DNA polymerase having reduced discrimination against
non-conventional nucleotides, wherein the DNA polymerase comprises
an amino acid mutation at a position corresponding to P410 of SEQ
ID NO: 2. In one embodiment, the amino acid mutation is a
substitution with an amino acid having a non-polar side chain. It
is preferred that the amino acid having a non-polar side chain is
selected from the group of methionine, glycine, alanine, valine,
leucine, isoleucine, phenylalanine and proline. It is further
preferred that the amino acid having a non-polar side chain is
selected from the group of glycine, leucine, isoleucine and
methionine.
[0049] The invention further encompasses an isolated recombinant
Family B DNA polymerase having reduced discrimination against
non-conventional nucleotides, wherein the DNA polymerase comprises
amino acid mutations in the P Helix and at a position corresponding
to P410 of SEQ ID NO: 2. In one embodiment, the amino acid mutation
in the P Helix is located at a position corresponding to A485 of
SEQ ID NO: 2. In another embodiment, the amino acid mutation at a
position corresponding to P410 of SEQ ID NO: 2 is a substitution
with an amino acid having a non-polar side chain. It is preferred
that the amino acid having a non-polar side chain is selected from
the group of methionine, glycine, alanine, valine, leucine,
isoleucine, phenylalanine and proline. It is further preferred that
the amino acid having a non-polar side chain is selected from the
group of glycine, leucine, isoleucine and methionine.
[0050] The invention further encompasses a kit for identifying a
nucleotide at a given position of a template DNA molecule, the kit
comprising a Family B DNA polymerase having reduced discrimination
against non-conventional nucleotides and a first primer, wherein
the first primer anneals to the immediate 3' of the nucleotide at
the given position of the template DNA molecule.
[0051] In one embodiment, the Family B DNA polymerase is a JDF-3
DNA polymerase. In a preferred embodiment, the JDF-3 DNA polymerase
has a sequence of SEQ ID NO: 2 and further comprises one or more
amino acid mutations at D141, E143, A485, L408 or P410. In a
further embodiment, the JDF-3 DNA polymerase is substituted at a
position corresponding to P410 of SEQ ID NO: 2 with an amino acid
having a non-polar side chain. It is preferred that the amino acid
having a non-polar side chain is selected from the group of
methionine, glycine, alanine, valine, leucine, isoleucine,
phenylalanine and proline. It is further preferred that the amino
acid having a non-polar side chain is selected from the group of
glycine, leucine, isoleucine and methionine.
[0052] In another embodiment of the kit, the JDF-3 DNA polymerase
has one or more amino acid mutations selected from the group
consisting of: D141A or D141T, E143A, L408H or L408F, A485T, and
P410L. In a preferred embodiment, the JDF-3 DNA polymerase
comprises four amino acid mutations at D141A, E 143A, P410L and
A485T.
[0053] In another embodiment of the kit, the Family B DNA
polymerase is deficient in 3' to 5' exonuclease activity.
[0054] In another embodiment, the kit further comprises at least
one chain-terminating nucleotide analog, wherein the
chain-terminating nucleotide analog is incorporated into the first
primer by the Family B DNA polymerase in a template-dependent
manner. In another embodiment, the at least one chain-terminating
nucleotide analog is labeled with a first detectable label. In
another embodiment, more than one chain-terminating nucleotide
analog is labeled, each chain-terminating nucleotide analog being
labeled with a different first detectable label. In a preferred
embodiment, the chain-terminating nucleotide analog is a
dideoxynucleotide. In a further preferred embodiment, the
dideoxynucleotide is selected from the group consisting of: ddATP,
ddTTP, ddCTP and ddGTP.
[0055] In another embodiment of the kit, the first primer is
labeled with a second detectable label. It is preferred that the
first and second detectable labels generate a signal for
identifying the nucleotide at the given position of the template
DNA molecule.
[0056] Another embodiment of the kit further comprises a second
primer. In one embodiment of this version of the kit, the first
primer is labeled with a second detectable label and the second
primer is labeled with a third detectable label, the second and
third detectable labels generate a signal for identifying the
nucleotide at the given position of the template DNA molecule. In
another embodiment, the second primer anneals to the immediate 5'
of the nucleotide at the given position of the template DNA
molecule.
[0057] Another embodiment of the kit further comprises a DNA ligase
and/or a reaction buffer for the Family B DNA polymerase.
[0058] In one embodiment of the kit, the template DNA molecule is
the product of a polymerase chain reaction or is a plasmid DNA.
[0059] In another embodiment of a kit comprising a first, and/or
second and/or third detectable label, the label(s) is/are selected
from the group consisting of: a fluorescent label, an isotope, a
chemiluminescent label, a quantum dot label, an antigen, or an
affinity moiety. In a preferred embodiment, the first detectable
label is a rhodamine label or a cyanine label.
[0060] In another embodiment of the kit, the kit further comprises
a control template and/or at least one control primer.
[0061] In another embodiment, the kit comprises a control template
and four control primers.
[0062] The invention further comprises a kit for identifying a
nucleotide at a given position of a template DNA molecule, the kit
comprising a Family B DNA polymerase having reduced discrimination
against non-conventional nucleotides, wherein the DNA polymerase
comprises an amino acid mutation at a position corresponding to
P410 of SEQ ID NO: 2. In one embodiment, the amino acid mutation at
a position corresponding to P410 of SEQ ID NO: 2 is an amino acid
substitution with an amino acid having a non polar side chain. In a
preferred embodiment, the amino acid having a non polar side chain
is selected from the group of methionine, glycine, alanine, valine,
leucine, isoleucine, phenylalanine and proline. It is further
preferred that the amino acid having a non polar side chain is
selected from the group of methionine, glycine, leucine and
isoleucine.
[0063] The invention further encompasses a kit for identifying a
nucleotide at a given position of a template DNA molecule, the kit
comprising a Family B DNA polymerase having reduced discrimination
against non-conventional nucleotides, wherein the DNA polymerase
comprises an amino acid mutation in the P Helix and at a position
corresponding to P410 of SEQ ID NO: 2. In one embodiment, the amino
acid mutation in the P Helix is located at a position corresponding
to A485 of SEQ ID NO: 2. In a preferred embodiment, the mutation at
a position corresponding to P410 of SEQ ID NO: 2 is a substitution
with an amino acid with a non-polar side chain. It is further
preferred that the amino acid having a non polar side chain is
selected from the group of amino acid selected from the group of
methionine, glycine, alanine, valine, leucine, isoleucine,
phenylalanine and proline. It is further preferred that the amino
acid having a non polar side chain is selected from the group of
methionine, glycine, leucine and isoleucine.
[0064] The invention further encompasses a method of identifying a
nucleotide at a given position of a template DNA molecule in a
sample, the method comprising: contacting a first primer with the
template DNA molecule, wherein the contacting allows the first
primer to anneal to the immediate 3' of the nucleotide at the given
position of the template DNA molecule, so as to form a duplex
between the first primer and the template DNA molecule; incubating
the duplex from step (a), in the presence of a Family B DNA
polymerase and at least one chain-terminating nucleotide analog,
the Family B DNA polymerase having reduced discrimination against
non-conventional nucleotides and the terminator is labeled with a
first detectable label, wherein the incubating allows the
incorporation of a labeled chain-terminating nucleotide analog into
the first primer by the DNA polymerase in a template-dependent
manner; and determining the presence or identity of the duplex from
step (b) by a signal generated from the first detectable label.
[0065] In one embodiment, the Family B DNA polymerase is a JDF-3
DNA polymerase. In a preferred embodiment, the JDF-3 DNA polymerase
has a sequence of SEQ ID NO: 2 and further comprises one or more
amino acid mutations at D141, E143, A485, L408 or P410. In a
further preferred embodiment, the JDF-3 DNA polymerase is
substituted at position P410 with an amino acid having a non polar
side chain. In a further preferred embodiment, the amino acid
having a non polar side chain is selected from the group consisting
of methionine, glycine, alanine, valine, leucine, isoleucine,
phenylalanine and proline.
[0066] In another embodiment, the JDF-3 DNA polymerase has one or
more amino acid mutations selected from the group consisting of:
D141A or D141T, E143A, L408H or L408F, A485T, and P410L. In a
preferred embodiment, the JDF-3 DNA polymerase comprises four amino
acid mutations: D141A, E143A, P410L and A485T.
[0067] In another embodiment of the method, the Family B DNA
polymerase is deficient in 3' to 5' exonuclease activity.
[0068] In another embodiment of the method, at least one
chain-terminating nucleotide analog is labeled with a first
detectable label. In another embodiment of the method, more than
one chain-terminating nucleotide analog is labeled, each
chain-terminating nucleotide analog being labeled with a different
first detectable label. It is preferred that the chain-terminating
nucleotide analog is a dideoxynucleotide. It is preferred that the
dideoxynucleotide is selected from the group consisting of: ddATP,
ddTTP, ddCTP and ddGTP.
[0069] In another embodiment of the method, the first primer is
labeled with a second detectable label.
[0070] In another embodiment of the method, first and second
detectable labels generate a signal for identifying the nucleotide
at the given position of the template DNA molecule.
[0071] In another embodiment of the method, the template DNA
molecule is the product of a polymerase chain reaction or a
plasmid. In another embodiment, the method further comprises
removing PCR primers and dNTPs from the PCR product before step
(a).
[0072] The invention further encompasses a method of identifying a
nucleotide at a given position of a template DNA molecule in a
sample, the method comprising: contacting a first primer and s
second primer with the template DNA molecule, wherein the
contacting allows the first primer to anneal to the immediate 3' of
the nucleotide at the given position of the template DNA molecule
and the second primer to anneal to the immediate 5' of the
nucleotide at the given position of the template DNA molecule, so
as to form a complex between the template DNA molecule and the
first and second primers, the first primer being labeled with a
second detectable label and the second primer being labeled with a
third detectable label; incubating the complex from step (a), in
the presence of a DNA ligase, wherein the incubating allows the
ligation between the first and second primers so as to form a
single molecule; and determining the presence or identity of the
single molecule from step (b) by a signal generated from the second
and third detectable labels.
[0073] In one embodiment of the method comprising a first and/or
second and/or third detectable label, the first or second or third
detectable label is/are selected from the group consisting of: a
radiolabel, a fluorescent label, a chemiluminescent label, a
colorimetric label and an enzymatic label. In a preferred
embodiment, the first detectable label is a rhodamine label or a
cyanine label.
[0074] The invention further encompasses a method of identifying a
nucleotide at a given position of a template DNA molecule in a
sample, the method comprising: contacting a first primer with the
template DNA molecule, wherein the contacting allows the first
primer to anneal to the immediate 3' of the nucleotide at the given
position of the template DNA molecule, so as to form a duplex
between the first primer and the template DNA molecule; incubating
the duplex from step (a), in the presence of a Family B DNA
polymerase and at least one chain-terminating nucleotide analog,
the Family B DNA polymerase having reduced discrimination against
non-conventional nucleotides, wherein the DNA polymerase comprises
an amino acid mutation in a position corresponding to P410 of SEQ
ID NO: 2 and the terminator is labeled with a first detectable
label, wherein the incubating allows the incorporation of a labeled
chain-terminating nucleotide analog into the first primer by the
DNA polymerase in a template-dependent manner; and determining the
presence or identity of the duplex from step (b) by a signal
generated from the first detectable label.
[0075] In one embodiment, the amino acid mutation at a position
corresponding to P410 of SEQ ID NO: 2 is an amino acid substitution
with an amino acid having a non polar side chain. In a preferred
embodiment, the amino acid having a non polar side chain is
selected from the group of methionine, glycine, alanine, valine,
leucine, isoleucine, phenylalanine and proline. In a further
preferred embodiment, the amino acid having a non polar side chain
is selected from the group of methionine, glycine, leucine and
isoleucine.
[0076] The invention further encompasses a method of identifying a
nucleotide at a given position of a template DNA molecule in a
sample, the method comprising: contacting a first primer with the
template DNA molecule, wherein the contacting allows the first
primer to anneal to the immediate 3' of the nucleotide at the given
position of the template DNA molecule, so as to form a duplex
between the first primer and the template DNA molecule; incubating
the duplex from step (a), in the presence of a Family B DNA
polymerase and at least one chain-terminating nucleotide analog,
the Family B DNA polymerase having reduced discrimination against
non-conventional nucleotides, wherein the DNA polymerase comprises
amino acid mutations in the P Helix and at a position corresponding
to P410 of SEQ ID NO: 2 and the terminator is labeled with a first
detectable label, wherein the incubating allows the incorporation
of a labeled chain-terminating nucleotide analog into the first
primer by the DNA polymerase in a template-dependent manner; and
determining the presence or identity of the duplex from step (b) by
a signal generated from the first detectable label.
[0077] In one embodiment, the amino acid mutation in the P Helix is
located at a position corresponding to position A485 of SEQ ID NO:
2.
[0078] In another embodiment, the amino acid mutation at a position
corresponding to position P410 of SEQ ID NO: 2 is an amino acid
substitution with an amino acid having a non polar side chain. In
one embodiment, the amino acid having a non polar side chain is
selected from the group of methionine, glycine, alanine, valine,
leucine, isoleucine, phenylalanine and proline. In a preferred
embodiment, the amino acid having a non polar side chain is
selected from the group of methionine, glycine, leucine and
isoleucine.
[0079] As used herein, "discrimination" refers to the tendency of
DNA polymerase to not incorporate non-conventional nucleotides into
a nascent DNA polymer. DNA polymerase has the ability to sense
nucleotide structure, including but not limited to nucleotide base
complementarity, and structural features of the sugar and
heterocyclic base, thereby allowing DNA polymerase to
preferentially utilize conventional deoxynucleotides rather than
non-conventional nucleotides for incorporation into a nascent
polymer. DNA polymerase strongly prefers to incorporate the
conventional deoxynucleotides dATP, dCTP, dGTP and dTTP into DNA
polymers; the polymerase is unlikely to progress with an
unconventional nucleotide in its binding pocket.
[0080] As used herein, "reduced discrimination" refers to a
reduction of at least 50% in the tendency of a DNA polymerase to
exclude a non-conventional nucleotide from (that is, to not
incorporate non-conventional nucleotides into) a nascent DNA
polymer, relative to a parental or wild type DNA polymerase which
does not exhibit reduced discrimination. The preference of DNA
polymerase to incorporate the conventional deoxynucleotides dATP,
dCTP, dGTP and TTP rather than non-conventional nucleotides into
DNA polymers is thereby reduced compared to the natural level of
preference, such that non-conventional nucleotides are more readily
incorporated into DNA polymers by DNA polymerase. According to the
invention, a polymerase exhibiting reduced discrimination will
exhibit reduced discrimination against at least one
non-conventional nucleotides, but may not exhibit reduced
discrimination against all non-conventional nucleotides.
[0081] According to the invention, discrimination is quantitated by
measuring the concentration of a non-conventional nucleotide
required to inhibit the incorporation of the corresponding
conventional nucleotide by 50%. This concentration is referred to
herein as the "I.sub.50%" for a non-conventional nucleotide.
Discrimination against a given non-conventional nucleotide is
"reduced" if the I.sub.50% for that non-conventional nucleotide is
reduced by at least two fold (50%) relative to an identical assay
containing, in place of the mutant DNA polymerase, a parental DNA
polymerase.
[0082] Alternatively, reduced discrimination may be quantitated by
determining the amount of a non-conventional nucleotide (for
example, a dideoxynucleotide, ribonucleotide, or cordycepin)
required in a reaction with a mutant polymerase having reduced
discrimination to generate a sequencing ladder identical to a
sequencing ladder produced using the wild-type or parental enzyme.
The sequencing ladder can be examined, for example, in the range of
1 to 400 bases from the primer terminus, and the ladders will be
identical in the number of extension products generated as well as
the lengths of extension products generated in the sequencing
reaction. For this type of assay, a constant amount of dNTPs and
varying amounts of non-conventional nucleotides are used to
generate a sequencing ladder with both the wild-type (or parental)
enzyme and the mutant poplymerase (for ribonucleotides, a
sequencing ladder is generated by alkali cleavage of the
polymerization products). See Gardner & Jack, 1999, supra. A
mutant exhibits reduced discrimination if it requires at least
two-fold (50%) less, five-fold (80%) less, ten-fold (100%) less,
etc. of the amount of the non-conventional nucleotide used by the
wild-type or parental polymerase to produce a sequencing ladder
identical (with respect to the number and length of extension
products generated) to that generated by the wild-type or parental
enzyme.
[0083] As used herein, the term "parental" or "progenitor" refers
to a polymerase used as the starting material in generating a
mutant polymerase having reduced discrimination. The term
"parental" is meant to encompass not only a so-called "wild-type"
enzyme as it occurs in nature, but also intermediate forms, for
example, an exonuclease deficient enzyme that is used as the
starting material for generating an enzyme with reduced
discrimination against non-conventional nucleotides.
[0084] As used herein, "non-conventional nucleotide" refers to a) a
nucleotide structure that is not one of the four conventional
deoxynucleotides dATP, dCTP, dGTP, and dTTP recognized by and
incorporated by a DNA polymerase, b) a synthetic nucleotide that is
not one of the four conventional deoxynucleotides in (a), c) a
modified conventional nucleotide, or d) a ribonucleotide (since
they are not normally recognized or incorporated by DNA
polymerases) and modified forms of a ribonucleotide.
Non-conventional nucleotides include but are not limited to those
listed in Table III, which are commercially available, for example,
from New England Nuclear. Any one of the above non-conventional
nucleotides may be a "conjugated nucleotide", which as used herein
refers to nucleotides bearing a detectable label, including but not
limited to a fluorescent label, isotope, chemiluminescent label,
quantum dot label, antigen, or affinity moiety.
[0085] As used herein, the term "cell", "cell line" and "cell
culture" can be used interchangeably and all such designations
include progeny. Thus, the words "transformants" or "transformed
cells" includes the primary subject cell and cultures derived
therefrom without regard for the number of transfers. It is also
understood that all progeny may not be precisely identical in DNA
content, due to deliberate or inadvertent mutations. Mutant progeny
that have the same functionality as screened for in the originally
transformed cell are included.
[0086] As used herein, the term "organism transformed with a
vector" refers to an organism carrying a recombinant gene
construct.
[0087] As used herein, "thermostable" refers to a property of a DNA
polymerase, such that the enzyme active at elevated temperatures
and is resistant to DNA duplex-denaturing temperatures in the range
of about 93.degree. C. to about 97.degree. C. "Active" means the
enzyme retains the ability to effect primer extension reactions
when subjected to elevated or denaturing temperatures for the time
necessary to effect denaturation of double-stranded nucleic acids.
Elevated temperatures as used herein refer to the range of about
70.degree. C. to about 75.degree. C., whereas non-elevated
temperatures as used herein refer to the range of about 35.degree.
C. to about 50.degree. C.
[0088] As used herein, "archaeal" refers to an organism or to a DNA
polymerase from an organism of the kingdom Archaea.
[0089] As used herein, "primer" refers to an oligonucleotide,
whether natural or synthetic, which is substancially complementary
(i.e., at least 7 out of 10, preferably 9 out of 10, more
preferably 9 out of 10 bases are fully complementary) and can
anneal to a complementary template DNA to form a duplex between the
primer and the template DNA. A primer may serve as a point of
initiation of nucleic acid synthesis by a polymerase following
annealing to a DNA strand to be sequenced. A primer is typically a
single-stranded oligodeoxyribonucleotide. The appropriate length of
a primer depends on the intended use of the primer, but for DNA
sequencing applications typically ranges from about 15 to about 40
nucleotides in length.
[0090] As used herein, "Family B DNA polymerase" refers to any DNA
polymerase that is classified as a member of the Family B DNA
polymerases, where the Family B classification is based on
structural similarity to E. coli DNA polymerase II. The Family B
DNA polymerases, formerly known as .alpha.-family polymerases,
include, but are not limited to those listed as such in Table
I.
[0091] Conserved regions I-VI of the Human DNA polymerase .alpha.
and other DNA polymerases are defined as follows: Region I of a
Family B DNA polymerase corresponds to amino acids 998-1005 of
Human pol .alpha.; Region II corresponds to amino acids 839-878 of
human pol .alpha.; Region III corresponds to amino acids 943-984 of
human pol .alpha.; Region IV corresponds to amino acids 609-650 of
human pol .alpha.; Region V corresponds to amino acids 1075-1081 of
human pol .alpha.; and Region VI corresponds to amino acids 909-926
of human pol .alpha.. Based on the Family B DNA polymerase sequence
alignments available in the art (e.g., Braoithwaite and Ito, 1991,
supra; Braithwaite and Ito, 1993, supra; Wang et al., 1997, Cell
89:1087 ) or created by one of skill in the art using available
software (e.g., the Needleman-Wunsch algorithm), one skilled in the
art can readily determine the limits of Regions I-VI of any given
Family B DNA polymerase.
[0092] As used herein, "Family A DNA polymerase" refers to any DNA
polymerase that is classified as a member of the Family A DNA
polymerases, where the Family A classification is based on
structural similarity to E. coli DNA polymerase I. Family A DNA
polymerases include, but are not limited to those listed as such in
Table I.
[0093] As used herein, "3' to 5' exonuclease deficient" or "3' to
5' exo.sup.-" refers to an enzyme that substantially lacks the
ability to remove incorporated nucleotides from the 3' end of a DNA
polymer. DNA polymerase exonuclease activities, such as the 3' to
5' exonuclease activity exemplified by members of the Family B
polymerases, can be lost through mutation, yielding an
exonuclease-deficient polymerase. As used herein, a DNA polymerase
that is deficient in 3' to 5' exonuclease activity substantially
lacks 3' to 5' exonuclease activity. "Substantially lacks"
encompasses a complete lack of activity, or a "substantial" lack of
activity. "Substantial" lack of activity means that the 3'
exonuclease activity of the mutant polymerase relative to the
parental polymerase is 0.03%, and also may be 0.05%, 0.1%, 1%, 5%,
10%, or 20%, but is not higher than 50% of the 3' exonuclease
activity of the parental or wild type polymerase.
[0094] As used herein, "mutation" refers to a change introduced
into a starting parental DNA sequence that changes the amino acid
sequence encoded by the DNA. The consequences of a mutation include
but are not limited to the creation of a new character, property,
function, or trait not found in the protein encoded by the parental
DNA.
[0095] As used herein, "wild-type" refers to the typical state of
an organism, strain, gene, protein or characteristic as it occurs
in nature. The wild-type is therefore the natural state that is
distinguished from a mutant, which was derived from the wild type
by introduction of change(s) to the wild-type.
[0096] As used herein, "corresponding" refers to sequence
similarity in a comparison of two or more nucleic acids or
polypeptides, where functionally equivalent domains or
sub-sequences are identified; such functionally equivalent domains
or sub-sequences or amino acids within such a domain or
sub-sequence are said to "correspond". That is, two or more
sequences are compared through a comparative alignment analysis in
which an entire sequence is examined for regions of sequence that
are similar or identical, and thus regions likely to be
functionally equivalent to regions from the other sequence(s) are
identified.
[0097] As used herein in reference to comparisons of an amino acid,
amino acid sequence, or protein domain, the term "similar" refers
to amino acids or domains that although not identical, represent
"conservative" differences. By "conservative" is meant that the
differing amino acid has like characteristics with the amino acid
in the corresponding or reference sequence. Typical conservative
substitutions are among Ala, Val, Leu and Ile; among Ser and Thr;
among the acidic residues Asp and Glu; among Asn and Gln; and among
the basic residues Lys and Arg; or aromatic residues Phe and Tyr.
In calculating the degree (most often as a percentage) of
similarity between two polypeptide sequences, one considers the
number of positions at which identity or similarity is observed
between corresponding amino acid residues in the two polypeptide
sequences in relation to the entire lengths of the two molecules
being compared.
[0098] As used herein, the tern "functionally equivalent" means
that a given motif, region, or amino acid within a motif or region
performs the same function with regard to the overall function of
the enzyme as a motif, region or amino acid within a motif or
region performs in another enzyme.
[0099] As used herein, "chain terminating nucleotide analog" refers
to a nucleotide analog that once incorporated cannot serve as a
substrate for subsequent extension by a DNA polymerase, thereby
terminating the elongation of a DNA polymer by a DNA polymerase.
Such a nucleotide analog typically lacks a hydroxyl group on its
sugar moiety to which DNA polymerase can synthesize a
phosphodiester bond with an incoming nucleotide. Chain terminating
nucleotide analogs are a subset of non-conventional nucleotides,
and include but are not limited to dideoxynucleotides.
[0100] As used herein, "detectably labeled" refers to a structural
modification that incorporates a functional group (label) that can
be readily detected by various means. Compounds that can be
detectably labeled include but are not limited to nucleotide
analogs. Detectable nucleotide analog labels include but are not
limited to fluorescent compounds, isotopic compounds,
chemiluminescent compound, quantum dot labels, biotin, enzymes,
electron-dense reagents, and haptens or proteins for which antisera
or monoclonal antibodies are available. The various means of
detection include but are not limited to spectroscopic,
photochemical, biochemical, immunochemical, or chemical means.
[0101] As used herein in reference to a polynucleotide or
polypeptide, the term "isolated" means that a naturally occurring
sequence has been removed from its normal cellular environment or
is synthesized in a non-natural environment (e.g., artificially
synthesized). Thus, the sequence may be in a cell-free solution or
placed in a different cellular environment. The term does not imply
that the sequence is the only nucleotide or polypeptide chain
present, but that it is essentially free (about 90-95% pure at
least) of non-nucleotide or non-polypeptide material, respectively,
naturally associated with it.
[0102] As used herein, the term "recombinant" refers to a
polynucleotide or polypeptide that is altered by genetic
engineering (i.e., by modification or manipulation of the genetic
material encoding that polynucleotide or polypeptide).
[0103] The invention encompasses full length mutant DNA
polymerases, as described herein, as well as a functional fragment
of a mutant polymerase, that is, a fragment of a DNA polymerase
that is less than the entire amino acid sequence of the mutant
polymerase and retains the ability, under at least one set of
conditions, to catalyze the polymerization of a polynucleotide.
Such a functional fragment may exist as a separate entity, or it
may be a constituent of a larger polypeptide, such as a fusion
protein.
[0104] As used herein, the term "complementary DNA strand" refers
to that DNA molecule synthesized from a template DNA molecule by a
DNA polymerase in a primer extension reaction.
[0105] As used herein, the term "template DNA molecule" refers to
that strand of a nucleic acid from which a complementary nucleic
acid strand is synthesized by a DNA polymerase, for example, in a
primer extension reaction. A "template DNA molecule", also refers
to a template DNA strand whose sequence needs to be identified. The
sequence may need to be identified for a single nucleotide at a
given position of the template DNA molecule (i.e., by
mini-sequencing) or for a fragment of or the whole DNA molecule
(i.e., by sequencing). The term "sequence", according to the
present invention, refers to the identification of a nucleotide at
a given position or at more than one position of a template DNA
molecule.
[0106] As used herein, the term "non polar amino acid" refers to
amino amino acids with non charged, aliphatic side chains. In a
preferred embodiment, "non polar amino acid" refers to the amino
acids alanine, glycine, valine, leucine or isoleucine.
[0107] As used herein, "P Helix" refers to the domain of archaeal
Family B DNA polymerases residing at the end of the "fingers"
domain. As the term is used herein, the P Helix of a Family B DNA
polymerase corresponds to amino acids 480 to 499 of the JDF-3
Family B DNA polymerase dislcosed herein. The sequence of the JDF-3
Family B DNA polymerase P Helix is as follows:
1 .sup.480DYRQRAIKILANSYYGYYGY.sup.499
[0108] The P Helix, along with the "palm" and "thumb" domains make
up the polymerase unit of the archaeal DNA polymerase. The P Helix
of archaeal DNA polymerases is described in Hopfner et al., (1999)
Proc. Natl. Acad. Sci. U.S.A. 96: 3600-3605, incorporated herein by
reference, which details the crystal structure of Thermococus
gorgonarius (Tgo) DNA polymerase and provides an alignment of nine
Family B DNA polymerases. The "fingers" domain of the Tgo DNA
polymerase is located at amino acids 450 to 499 of the Tgo DNA
polymerase (the palm domain is located at amino acids 369 to 449
and 500 to 585 of the Tgo DNA polymerase, and the thumb domain is
located at amino acids 586 to 773), and emerges from the palm
domain as an .alpha.-helix-rich insertion. The 50 residues of the
"fingers" domain are folded into two antiparallel coiled
.alpha.-helices of approximately equal size. One of these helices,
Helix P, consists of amino acids 480 to 499 of the Tgo DNA
polymerase (numbered as in Hopfner et al.) and corresponds to amino
acids 480 to 499 of the JDF-3 Family B DNA polymerase. That is, the
"P Helix" of JDF-3 Family B DNA polymerase consists of amino acids
480 to 499 as numbered herein. The D480 to Y499 P Helix sequence of
JDF-3 Family B DNA polymerase differs only at amino acid Y493 from
the P helix sequence of the Tgo DNA polymerase, which has
phenylalanine at position 493. A key feature of the P Helix is the
highly conserved KX.sub.3NSXYGX.sub.2G motif of B type polymerases
located at amino acids 487 to 498 of both the JDF-3 and Tgo Family
B DNA polymerases. The P Helix is also structurally related to the
O helix of Family A DNA polymerases.
[0109] The term "corresponds to," when used in the context of
similarity or homology between protein sequences or domains means
that an amino acid at a particular position in a first polypeptide
is identical or similar to a corresponding amino acid in a second
polypeptide that is in an optimal global sequence alignment with
the first polypeptide. An optimal global alignment is achieved
using, for example, the Needleman--Wunsch algorithm (Needleman and
Wunsch, 1970, J. Mol. Biol. 48:443-453). "Identity" means that an
amino acid at a particular position in a first polypeptide is
identical to a corresponding amino acid or nucleotide in a second
polypeptide that is in an optimal global alignment with the first
polypeptide or polynucleotide. In contrast to identity,
"similarity" encompasses amino acids that are conservative
substitutions. A "conservative" substitution is any substitution
that has a positive score in the blosum62 substitution matrix
(Hentikoff and Hentikoff, 1992, Proc. Natl. Acad. Sci. USA 89:
10915-10919). Typical conservative substitutions are among Met,
Val, Leu and Ile; among Ser and Thr; among the residues Asp, Glu
and Asn; among the residues Gln, Lys and Arg; or aromatic residues
Phe and Tyr.
[0110] An example of the parameters for optimal global sequence
alignment using the Needleman-Wunsch alignment algorithm for
polypeptide alignment useful to determine "corresponding" sequences
or domains are as follows: Substitution matrix: blosum62; Gap
scoring function: -A -B*LG, where A=11 (the gap penalty), B=1 (the
gap length penalty) and LG is the length of the gap. Using the
Needleman-Wunsch algorithm and these parameters, or using other
alignment software known in the art, one of skill in the art can
readily determine whether a given amino acid, sequence of amino
acids, or region of sequence in a given Family B DNA polymerase
"corresponds to" an amino acid, sequence of amino acids or region
of sequence in the JDF-3 Family B DNA polymerase disclosed herein.
Further features and advantages of the invention will become more
fully apparent in the following description of the embodiments and
drawings thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0111] FIG. 1 shows the DNA sequence encoding Thermococcus species
JDF-3 DNA polymerase (intein removed) (SEQ ID NO: 1).
[0112] FIG. 2 shows the amino sequence of Thermococcus species
JDF-3 DNA polymerase (intein removed) (SEQ ID NO: 2).
[0113] FIG. 3 shows the amino acid sequence of the genomic clone
encoding Thermococcus species JDF-3 DNA polymerase (SEQ ID NO: 3).
The position of an intein, removed by post-translational
processing, is shown.
[0114] FIG. 4 shows the DNA sequence of the genomic clone encoding
Thermococcus species JDF-3 DNA polymerase (SEQ ID NO: 4). DNA
sequences are shown which correspond to 5' and 3' untranslated
regions, polymerase-coding regions (exteins), and an intein-coding
region.
[0115] FIG. 5 shows nucleotide incorporation by JDF-3 mutants.
Lambda phage clones which incorporated .sup.33P-labeled ddNTPs in
the primary library screen were rescreened to assess .sup.33P-ddNTP
incorporation in the presence of: (panel 1) 0.5 mM MnCl.sub.2 or
(panel 2) 1.5 mM MgCl.sub.2. Polymerase activity was measured using
.sup.33P-dNTPs in the presence of 1.5 mM MgCl.sub.2 (panel 3).
Nucleotide utilization is shown for clones 1-18 and for the
parental #550 clone.
[0116] FIG. 6 shows .sup.33P-ddNTP cycle sequencing reactions
performed using JDF-3 polymerase mutants. Purified JDF-3 mutants
were substituted into the Thermo Sequenase radiolabeled terminator
cycle sequencing kit. DNA sequencing ladders were generated as per
the kit's instructions using the following polymerases: (A) Thermo
Sequenase (B) JDF-3 #550 clone (parental) (C) JDF-3 A485T mutant
(clone p12) (D) JDF-3 P410L mutant (clone p11) (E) JDF-3 P410L
mutant (clone p8). The top of the original sequencing gel is shown
on the side. The lanes are: (bottom) ddGTP, ddATP, ddTTP, ddCTP
(top). Clones p8, p11, and p12 contain ancillary mutations and an
amino-terminal tag.
[0117] FIG. 7 shows cycle sequencing reactions performed using
dye-labeled ddNTPs and JDF-3 polymerase mutants. DNA sequencing
ladders were generated using (1) 2.14 .mu.M dNTP: 0.0214 .mu.M
ddNTP; (2) 2.14 .mu.M dNTP: 0.214 .mu.M ddNTP; or (3) 2.14 .mu.M
dNTP: 2.14 .mu.M ddNTP. The following purified DNA polymerases were
used: (A) JDF-3 #550 clone (parental) (B) Thermo Sequenase (C)
JDF-3 P410L mutant (clone p8, contains ancillary mutations and an
amino tag) (E) JDF-3 L408H mutant (clone 1-1). The top of the
original sequencing gel is shown on the right hand side.
[0118] FIG. 8 shows cycle sequencing reactions performed using the
JDF-3 P410L/A485T double mutant and .alpha.-.sup.33P
Dideoxynucleotides. DNA sequencing ladders were generated using the
JDF-3 P410L/A485T double mutant at (A) 2 .mu.l (B) 1 .mu.l (C) 0.5
.mu.l, the JDF-3 P410L mutant (clone p8, contains ancillary
mutations and an amino-terminal tag)(D), or Thermo Sequenase (E).
The top of the original sequencing gel is shown on the left side.
The lanes are: (bottom) ddGTP, ddATP, ddTTP, ddCTP (top).
[0119] FIG. 9 shows the result of ribonucleotide incorporation
assays using exo JDF-3 (550) and mutants of this progenitor clone.
The ratios of ribonucleotide versus deoxynucleotide incorporation
are plotted for JDF-3 550, JDF-3 L408H, JDF-3 L408F and JDF-3
A485T.
[0120] FIG. 10 shows the traces of the sequence generated by four
versions of JDF-3 DNA polymerase and FAM ddCTP. Panel A shows the
minimal trace produced by the progenitor polymerase JDF-3 550,
Panel B demonstrates the slightly improved trace made by JDF-3
P410L, Panel C shows the sequence generated by the double mutant
S345P and P410L, and Panel D shows the trace created by JDF-3
S345P.
[0121] FIG. 11 shows the difference in peak uniformity demonstrated
by Thermo Sequenase in Panel A and the double mutant JDF-3
S345P+P410L in Panel B.
[0122] FIG. 12 shows the separated products of 3' extension of a
labeled oligonucleotide with the dideoxynucleotide thymidine
triphosphate of ROX-ddUTP (New England Nuclear (NEN) NEL476) or
Fluorescein-12-ddUTP (NEN NEL401). Mutant 4 is JDF-3 S345P, Mutant
2 is JDF-3 P410L, Mutant 3 is JDF-3 A485T and Mutant 5 is Y496N. F
indicates FLU ddUTP and R indicates ROX ddUTP.
[0123] FIG. 13 shows a graphic representation of the relative band
intensities form FIG. 12. The numerical values are generated by
dividing the intensity value of the ddTTP band into the intensity
value for the Fluroescein-12-ddUTP bands.
[0124] FIG. 14 shows the sequence alignment of
dye-dideoxynucleotide selected JDF-3 mutants (amino acids 301-480).
Nucleic acid residues highlighted by white boxes indicate the
location of a mutation. The mutation S345P is one of two mutations
present in mutant 28.
[0125] FIG. 15 shows the sequence alignment of
dye-dideoxynucleotide selected JDF-3 (amino acids 481-660). Nucleic
acid residues highlighted by white boxes indicate the location of a
mutation.
[0126] FIG. 16. Incorporation of rhodamine labeled-ddNTPs by JDF-3
P410L/A485T and ThermoSequenase (Taq F667Y). The JDF-3 P410L/A485T
and Taq F667Y mutants show slightly different incorporation rates
for each of the rhodamine-labeled-ddNTPs. Reactions in panels A and
B contained 0.05 .mu.M of either TAMRA- or R110-labeled-ddNTPs, 15
nM primer:template, and 1 unit of enzyme. Reactions were incubated
as described in the Experimental Protocol.
[0127] FIG. 17. Misinsertion of rhodamine labeled-ddNTPs by JDF-3
P410L/A485T and ThermoSequenase (Taq F667Y). JDF-3 P410L/A485T
shows higher fidelity compared to Taq F667Y when incorporating
certain ddNTPs. Reactions in panels A and B contained 1 unit of
either JDF-3 P410L/A485T or ThermoSequenase, 15 nM primer:template
(panel A: pBluescript:pBL34A; panel B:pBluescript:pBL31G), and 25
nM of unlabeled complementary ddNTP (panelA:ddATP; panel B:ddGTP)
and either 25, 100, 500, or 1000 nM of dye-labeled
non-complementary ddNTP (panel A:R110-ddGTP; panel B:R110-ddUTP) in
four separate reactions. Reactions were incubated and analyzed as
described in the Experimental Protocol. Panel C shows the
sequencing gel from which the data in panel A was derived.
[0128] FIG. 18. Incubation of PCR amplified fragments on Strataprep
columns with CIAP helps purify fragments prior to minisequencing. 1
unit of JDF-3 P410L/A485T was incubated in presence of 0.05 .mu.M
R6G-ddATP, 0.15 pmol pPC37A, and 0.02 pmol of a 4 kb PCR fragment
amplified from human genomic DNA. The PCR product was purified on a
StrataPrep column, either with (1) or without (2) CIAP treatment,
as described in the Experimental Protocol.
[0129] FIG. 19. Minisequencing using JDF-3 P410L/A485T and two
different primer:template systems. All reactions contained 1 unit
of JDF-3 P410L/A485T, 0.04 .mu.M R6G-ddA, R110-ddG, ROX-ddC, and
0.2 .mu.M TAM-ddU in 1.times. reaction buffer. Reactions 1 through
4 also contained 0.4 pmol pGEM and 1 .mu.l of p29A, p38G, p34T, and
p45C (ABI #4312166), respectively. Reactions 5 through 8 contained
0.02 pmol of 4 kb PCR product and 0.15 pmol pPC37A, pPC26G, pPC41T,
and pPC29C, respectively. Reactions were incubated as described in
the Experimental Protocol.
[0130] FIG. 20. Multiplexing does not affect the signal strength
generated by JDF-3 P410L/A485T. All reactions contained 1 unit of
JDF-3 P410L/A485T, 0.25 pmol pBluescript, 0.04 .mu.M R6G-ddA,
TAM-ddG, ROX-ddC, and 0.2 .mu.M R110-ddU in 1.times.reaction
buffer. Reactions 1, 2, 3, 4, contained 0.15 pmol pBL25C, pBL28T,
pBL31G, and pBL34A, respectively. Reaction 5 contained 0.15 pmol of
all four primers. Reactions were incubated as described in the
Experimental Protocol.
[0131] FIG. 21. Thermal cycling improves minisequencing signal
significantly. 1 unit of JDF-3 P410L/A485T was incubated in
presence of 15 nM pBL25C, 100 nM ROX-ddCTP, and 0.1, 1, 5, 10, or
50 nM pBluescript in five separate reactions. Incubations were
performed using a Perkin-Elmer 9600 for one cycle of 96.degree. C.
for 2 min, 50.degree. C. for 1 min, and 60.degree. C. for 10 min,
or 25 cycles of 96.degree. C. for 10 s, 50.degree. C. for 5 s, and
60.degree. C. or 72.degree. C. for 30 s. Reactions were purified
from unincorporated ROX-ddCTP using SAP treatment and the products
were analyzed and quantitated as described in the Experimental
Protocol.
[0132] FIG. 22. Performance comparison of our minisequencing kit
containing JDF-3 P410L/A485T to the SNaPshot kit from Applied
Biosystems. (A) Minisequencing reactions contained 1 unit of JDF-3
P410L/A485T, 0.25 pmol pBluescript, 0.04 .mu.M R6G-ddA, R110-ddG,
and ROX-ddC, 0.2 .mu.M TAMRA-ddU, and 0.15 pmol pBL34A, pBL31G,
pBL25C, or pBL28T, in four separate reactions respectively.
Reactions were incubated, purifed and analyzed (using a rhodamine
matrix) as described in the Experimental Protocol. (B) The SNaPshot
kit was used with the same amount of primer:template as above.
Since this kit utilizes dichloro-rhodamine labeled ddNTPs, a
dichloro-rhodamine matrix was installed for analysis of the
corresponding bands.
[0133] FIG. 23 shows the activity of JDF-3 DNA polymerase
containing amino acid substitutions at position P410. FIG. 23 A:
Polymerase activity was expressed as corrected cpms of 3H-TTP
incorporated into activated calf thymus DNA in 30 minutes in the
presence of 100 .mu.M each dNTP. FIG. 23B: ddNTP incorporation was
determined as percent activity in the presence of 20 .mu.M each
ddA, ddG, and ddC ("20"), as follows: (corrected cpms at 20 .mu.M
ddNTP)/(corrected cpms at 0 .mu.M ddNTP).
[0134] FIG. 24. Sequencing patterns generated with exonuclease
minus versions of wild type JDF-3 DNA polymerase, JDF-3 DNA
polymerase mutants, and Pfu DNA polymerase at the indicated
ddNTP:dNTP ratios. Dideoxy sequencing reactions were performed as
described in the Example 5.
[0135] FIG. 25. Insertion and misinsertion assays employing JDF3
P410L/A485T and Taq F667Y (Thermo Sequenase) DNA polymerases.
Assays were carried out as described under the Materials and
Methods. In panel A, the correct nucleotide (R6G-ddAMP) was
incorporated in the presence of R6G-ddATP at 0.0001, 0.001, 0.005,
0.01, 0.05, 0.1, 0.5 .mu.M, respectively, by JDF3 P410L/A485T
(lanes 1-7) and Taq F667Y (lanes 8-14). In panel B, the correct
nucleotide (TAMRA-ddAMP) was inserted at TAMRA-ddATP concentrations
of 0.001, 0.005, 0.01, 0.05, 0.1, 0.5 .mu.M, respectively, by JDF3
P410L/A485T (lanes 1-6) and Taq F667Y (lanes 7-12). In panel C,
incorrect TAMRA-ddGMP was incorporated into standing start
primer-template by incubating JDF3 P410L/A485T (lanes 1-8) or Taq
F667Y (lanes 9-16) DNA polymerases with TAMRA-ddGTP at
concentrations of 0.005, 0.01, 0.05, 0.1, 1, 5, 10 .mu.M,
respectively.
[0136] FIG. 26. Misinsertion of rhodamine labeled-ddNTPs by JDF-3
P410L/A485T and Taq F667Y (Thermo Sequenase) DNA polymerases.
Reactions in panels A and B contained 1 unit of JDF-3 P410L/A485T
or Taq F667Y, 15 nM primer:template (panel A: pBL34A:pBluescript
II; panel B:pBL31G:pBluescript II), 25 nM of unlabeled
complementary ddNTP (panelA:ddATP; panel B:ddGTP), and either 25,
100, 500, or 1000 nM of dye-labeled non-complementary ddNTP (panel
A:R110-ddGTP; panel B:R110-ddUTP) in four separate reactions.
Reactions were incubated and analyzed as described in the Example
5. Panel C shows the sequencing gel from which the data in panel A
was derived.
[0137] FIG. 27. Misinsertion of unlabeled ddNTPs by JDF-3
P410L/A485T and Taq F667Y (Thermo Sequenase) DNA polymerases.
Reactions in panel A contained 1 unit of either Taq F667Y or JDF-3
P410L/A485T, 2.5 nM primer-template (pFL35:pBluescript), and a
complementary (A) or non-complementary (G) ddNTP at concentrations
of 0, 1.25, 10, 50 or 100 nM. Reactions in panel B contained 1 unit
of either Taq F667Y or JDF-3 P410L/A485T, 2.5 nM primer-template
(pFL35:pBluescript A562G), and a complementary (G) or
non-complementary (T) ddNTP at concentrations of 0, 1.25, 10, 50,
or 100 nM. Reactions were incubated and analyzed as described in
Example 5.
DESCRIPTION
[0138] The invention is based on the discovery of Family B DNA
polymerases that bear one or more genetic alterations resulting in
reduced discrimination against non-conventional nucleotides
relative to their unmodified wild-type forms. All references
described herein are incorporated by reference herein in their
entirety.
[0139] Family B DNA Polymerase Exhibiting Reduced Discrimination
Against Non-Conventional Nucleotides:
[0140] A. DNA Polymerases Useful According to the Invention
[0141] According to the invention, DNA polymerases of Family B may
be mutated to generate enzymes exhibiting reduced discrimination
against non-conventional nucleotides. Table I includes a
non-limiting list of known DNA polymerases categorized by
family.
2TABLE I DNA POLYMERASES BY FAMILY Reference FAMILY A DNA
POLYMERASES Bacterial DNA Polymerases a) E. coli DNA polymerase I
(1) b) Streptococcus pneumoniae DNA polymerase I (2) c) Thermus
aquaticus DNA polymerase I (3) d) Thermus flavus DNA polymerase I
(4) e) Thermotoga maritima DNA polymerase I Bacteriophage DNA
Polymerases a) T5 DNA polymerase (5) b) T7 DNA polymerase (6) c)
Spo1 DNA polymerase (7) d) Spo2 DNA polymerase (8) Mitochondrial
DNA polymerase Yeast Mitochondrial DNA polymerase II (9, 10, 11)
FAMILY B DNA POLYMERASES Bacterial DNA polymerase E. coli DNA
polymerase II (15) Bacteriophage DNA polymerase a) PRD1 DNA
polymerase (16, 17) b) .omega.29 DNA polymerase (18) c) M2 DNA
polymerase (19) d) T4 DNA polymerase (20) Archaeal DNA polymerase
a) Thermococcus litoralis DNA polymerase (Vent) (21) b) Pyrococcus
furiosus DNA polymerase (22) c) Sulfolobus solfataricus DNA
polymerase (23) d) Thermococcus gorgonarius DNA polymerase (64) e)
Thermococcus species TY (65) f) Pyrococcus species strain KODI (66)
g) Sulfolobus acidocaldarius (67) h) Thermococcus species 9.degree.
N-7 (68) i) Pyrodictium occultum (69) j) Methanococcus voltae (70)
k) Desulfurococcus strain TOK (D. Tok Pol) (71) Eukaryotic Cell DNA
polymerase (1) DNA polymerase alpha a) Human DNA polymerase (alpha)
(24) b) S. cerevisiae DNA polymerase (alpha) (25) c) S. pombe DNA
polymerase I (alpha) (26) d) Drosophila melanogaster DNA polymerase
(alpha) (27) e) Trypanosoma brucei DNA polymerase (alpha) (28) (2)
DNA polymerase delta a) Human DNA polymerase (delta) (29, 30) b)
Bovine DNA polymerase (delta) (31) c) S. cerevisiae DNA polymerase
III (delta) (32) d) S. pombe DNA polymerase III (delta) (33) e)
Plasmodiun falciparum DNA polymerase (delta) (34) (3) DNA
polymerase epsilon S. cerevisiae DNA polymerase II (epsilon) (35)
(4) Other eukaryotic DNA polymerase S. cerevisiae DNA polymerase
Rev3 (36) Viral DNA polymerases a) Herpes Simplex virus type 1 DNA
polymerase (37) b) Equine herpes virus type 1 DNA polymerase (38)
c) Varicella-Zoster virus DNA polymerase (39) d) Epstein-Barr virus
DNA polymerase (40) e) Herpesvirus saimiri DNA polymerase (41) f)
Human cytomegalovirus DNA polymerase (42) g) Murine cytomegalovirus
DNA polymerase (43) h) Human herpes virus type 6 DNA polymerase
(44) i) Channel Catfish virus DNA polymerase (45) j) Chlorella
virus DNA polymerase (46) k) Fowlpox virus DNA polymerase (47) l)
Vaccinia virus DNA polymerase (48) m) Choristoneura biennis DNA
polymerase (49) n) Autographa california nuclear polymerase virus
(AcMNPV) DNA polymerase (50) o) Lymantria dispar nuclear
polyhedrosis virus DNA (51) polymerase p) Adenovirus-2 DNA
polymerase (52) q) Adenovirus-7 DNA polymerase (53) r)
Adenovirus-12 DNA polymerase (54) Eukaryotic linear DNA plasmid
encoded DNA polymerases a) S-1 Maize DNA polymerase (55) b) kalilo
neurospora intermedia DNA polymerase (56) c) pA12 ascobolus
immersus DNA polymerase (57) d) pCLK1 Claviceps purpurea DNA
polymerase (58) e) maranhar neurospora crassa DNA polymerase (59)
f) pEM Agaricus bitorquis DNA polymerase (60) g) pGKL1
Kluyveromyces lactis DNA polymerase (61) h) pGKL2 Kluyveromyces
lactis DNA polymerase (62) i) pSKL Saccharomyces kluyveri DNA
polymerase (63)
[0142] B. Plasmids
[0143] The starting sequences for the generation of Family B DNA
polymerases according to the invention may be contained in a
plasmid vector. A non-limiting list of cloned Family B DNA
polymerases and their GenBank Accession numbers are listed in Table
II.
3TABLE II Accession Information for Cloned Family B Polymerases
Vent Thermococcus litoralis ACCESSION AAA72101 PID g348689 VERSION
AAA72111.1 GI:348689 DBSOURCE locus THCVDPE accession M74198.1
THEST THERMOCOCCUS SP. (STRAIN TY) ACCESSION O33845 PID g3913524
VERSION O33845 GI:3913524 DBSOURCE swissprot: locus DPOL_THEST,
accession O33845 Pab Pyrococcus abyssi ACCESSION P77916 PID
g3913529 VERSION P77916 GI:3913529 DBSOURCE swissprot: locus
DPOL_PYRAB, accession P77916 PYRHO Pyrococcus horikoshii ACCESSION
O59610 PID g3913526 VERSION O59610 GI:3913526 DBSOURCE swissprot:
locus DPOL_PYRHO, accession O59610 PYRSE PYROCOCCUS SP. (STRAIN
GE23) ACCESSION P77932 PID g3913530 VERSION P77932 GI:3913530
DBSOURCE swissprot: locus DPOL_PYRSE, accession P77932 DeepVent
Pyrococcus sp. ACCESSION AAA67131 PID g436495 VERSION AAA67131.1
GI:436495 DBSOURCE locus PSU00707 accession U00707.1 Pfu Pyrococcus
furiosus ACCESSION P80061 PID g399403 VERSION P80061 GI:399403
DBSOURCE swissprot: locus DPOL_PYRFU, accession P80061 JDF-3
Thermococcus sp. Unpublished Baross
gi.vertline.2097756.vertline.pat.vertline.US.vertline.5602011.vertline.12
Sequence 12 from patent US 5602011 9degN THERMOCOCCUS SP. (STRAIN
9ON-7). ACCESSION Q56366 PID g3913540 VERSION Q56366 GI:3913540
DBSOURCE swissprot: locus DPOL_THES9, accession Q56366 KOD
Pyrococcus sp. ACCESSION BAA060142 PID g1620911 VERSION BAA06142.1
GI:1620911 DBSOURCE locus PYWKODPOL accession D29671.1 Tgo
Thermococcus gorgonarius. ACCESSION 4699806 PID g46998O6 VERSION
GI:4699806 DBSOURCE pdb: chain 65, release Feb. 23, 1999 THEFM
Thermococcus fumicolans ACCESSION P74918 PID g3913528 VERSION
P74918 GI:3913528 DBSOURCE swissprot: locus DPOL_THEFM, accession
P74918 METTH Methanobacterium thermoautotrophicum ACCESSION O27276
PID g3913522 VERSION O27276 GI:3913522 DBSOURCE swissprot: locus
DPOL_METTH, accession O27276 Metja Methanococcus jannaschii
ACCESSION Q58295 PID g3915679 VERSION Q58295 GI:3915679 DBSOURCE
swissprot: locus DPOL_METJA, accession Q58295 POC Pyrodictium
occultum ACCESSION B56277 PID g1363344 VERSION B56277 GI:1363344
DBSOURCE pir: locus B56277 ApeI Aeropyrum pernix ACCESSION BAA81109
PID g5105797 VERSION BAA81109.1 GI:5105797 DBSOURCE locus AP000063
accession AP000063.1 ARCFU Archacoglobus fulgidus ACCESSION O29753
PID g3122019 VERSION O29753 GI:3122019 DBSOURCE swissprot: locus
DPOL_ARCFU, accession O29753 Desulfurococcus sp. Tok. ACCESSION
6435708 PID g64357089 VERSION GT: 6435708 DBSOURCE pdb. chain 65,
release Jun. 2, 1999
[0144] Plasmids acceptable for the expression of modified forms of
Family B DNA polymerases may be selected from a large number known
in the art by one of skill in the art. A plasmid vector for
expression of a modified DNA polymerase according to the invention
will preferably comprise sequences directing high level expression
of a DNA polymerase, and will more preferably comprise sequences
directing inducible, high level expression of a DNA polymerase. As
one example of an inducible high level expression system, plasmids
placing a modified DNA polymerase coding sequence according to the
invention under the control of a bacteriophage T7 promoter may be
introduced to bacteria containing an inducible T7 RNA polymerase
gene within their chromosome. Induction of the T7 RNA polymerase
gene subsequently induces high level expression of the T7
promoter-driven modified DNA polymerase gene (see for example,
Gardner & Jack, Nucleic Acids Res. 27: 2545).
[0145] C. Mutagenesis
[0146] The cloned wild-type form of a Family B DNA polymerase may
be mutated to generate forms exhibiting reduced discrimination
against non-conventional nucleotides by a number of methods.
[0147] First, methods of random mutagenesis which will result in a
panel of mutants bearing one or more randomly-situated mutations
exist in the art. Such a panel of mutants may then be screened for
those exhibiting reduced discrimination relative to the wild-type
polymerase (see "Methods of Evaluating Mutants for Reduced
Discrimination", below). An example of a method for random
mutagenesis is the so-called "error-prone PCR method". As the name
implies, the method amplifies a given sequence under conditions in
which the DNA polymerase does not support high fidelity
incorporation. The conditions encouraging error-prone incorporation
for different DNA polymerases vary, however one skilled in the art
may determine such conditions for a given enzyme. A key variable
for many DNA polymerases in the fidelity of amplification is, for
example, the type and concentration of divalent metal ion in the
buffer. The use of manganese ion and/or variation of the magnesium
or manganese ion concentration may therefore be applied to
influence the error rate of the polymerase.
[0148] Second, there are a number of site-directed mutagenesis
methods known in the art which allow one to mutate a particular
site or region in a straightforward manner. There are a number of
kits available commercially for the performance of site-directed
mutagenesis, including both conventional and PCR-based methods.
Examples include the EXSITE.TM. PCR-Based Site-directed Mutagenesis
Kit available from Stratagene (Catalog No. 200502; PCR based) and
the QUIKCHANGE.TM. Site-directed mutagenesis Kit from Stratagene
(Catalog No. 200518; non-PCR-based), and the CHAMELEON.RTM.
double-stranded Site-directed mutagenesis kit, also from Stratagene
(Catalog No. 200509).
[0149] Older methods of site-directed mutagenesis known in the art
relied upon sub-cloning of the sequence to be mutated into a
vector, such as an M13 bacteriophage vector, that allows the
isolation of single-stranded DNA template. In these methods one
annealed a mutagenic primer (i.e., a primer capable of annealing to
the site to be mutated but bearing one or mismatched nucleotides at
the site to be mutated) to the single-stranded template and then
polymerized the complement of the template starting from the 3' end
of the mutagenic primer. The resulting duplexes were then
transformed into host bacteria and plaques were screened for the
desired mutation.
[0150] More recently, site-directed mutagenesis has employed PCR
methodologies, which have the advantage of not requiring a
single-stranded template. In addition, methods have been developed
that do not require sub-cloning. Several issues must be considered
when PCR-based site-directed mutagenesis is performed. First, in
these methods it is desirable to reduce the number of PCR cycles to
prevent expansion of undesired mutations introduced by the
polymerase. Second, a selection must be employed in order to reduce
the number of non-mutated parental molecules persisting in the
reaction. Third, an extended-length PCR method is preferred in
order to allow the use of a single PCR primer set. And fourth,
because of the non-template-dependent terminal extension activity
of some thermostable polymerases it is often necessary to
incorporate an end-polishing step into the procedure prior to
blunt-end ligation of the PCR-generated mutant product.
[0151] The protocol described below accommodates these
considerations through the following steps. First, the template
concentration used is approximately 1000-fold higher than that used
in conventional PCR reactions, allowing a reduction in the number
of cycles from 25-30 down to 5-10 without dramatically reducing
product yield. Second, the restriction endonuclease DpnI
(recognition target sequence: 5-Gm6ATC-3, where the A residue is
methylated) is used to select against parental DNA, since most
common strains of E. coli Dam methylate their DNA at the sequence
5-GATC-3. Third, Taq Extender is used in the PCR mix in order to
increase the proportion of long (i.e., full plasmid length) PCR
products. Finally, Pfu DNA polymerase is used to polish the ends of
the PCR product prior to intramolecular ligation using T4 DNA
ligase. The method is described in detail as follows:
[0152] PCR-based Site Directed Mutagenesis of the 3'-5' Exonuclease
domain
[0153] Plasmid template DNA (approximately 0.5 pmole) is added to a
PCR cocktail containing: 1.times. mutagenesis buffer (20 mM Tris
HCl, pH 7.5; 8 mM MgCl2; 40 ug/ml BSA); 12-20 pmole of each primer
(one of skill in the art may design a mutagenic primer as
necessary, giving consideration to those factors such as base
composition, primer length and intended buffer salt concentrations
that affect the annealing characteristics of oligonucleotide
primers; one primer must contain the desired mutation, and one (the
same or the other) must contain a 5' phosphate to facilitate later
ligation), 250 uM each dNTP, 2.5 U Taq DNA polymerase, and 2.5 U of
Taq Extender (Available from Stratagene; See Nielson et al. (1994)
Strategies 7: 27, and U.S. Pat. No. 5,556,772). The PCR cycling is
performed as follows: 1 cycle of 4 min at 94.degree. C., 2 min at
50.degree. C. and 2 min at 72.degree. C.; followed by 5-10 cycles
of 1 min at 94.degree. C., 2 min at 54.degree. C. and 1 min at
72.degree. C. The parental template DNA and the linear,
PCR-generated DNA incorporating the mutagenic primer are treated
with DpnI (10 U) and Pfu DNA polymerase (2.5U). This results in the
DpnI digestion of the in vivo methylated parental template and
hybrid DNA and the removal, by Pfu DNA polymerase, of the
non-template-directed Taq DNA polymerase-extended base(s) on the
linear PCR product. The reaction is incubated at 37.degree. C. for
30 min and then transferred to 72.degree. C. for an additional 30
min. Mutagenesis buffer (115 ul of 1.times.) containing 0.5 mM ATP
is added to the DpnI-digested, Pfu DNA polymerase-polished PCR
products. The solution is mixed and 10 ul are removed to a new
microfuge tube and T4 DNA ligase (2-4 U) is added. The ligation is
incubated for greater than 60 min at 37.degree. C. Finally, the
treated solution is transformed into competent E. coli according to
standard methods.
[0154] D. Non-Conventional Nucleotides Useful According to the
Invention.
[0155] There is a wide variety of non-conventional nucleotides
available in the art. Any or all of them are contemplated for use
with a DNA polymerase of the invention. A non-limiting list of such
non-conventional nucleotides is presented in Table III.
4TABLE III Non-Conventional Nucleotides DIDEOXYNUCLEOTIDE ANALOGS
Fluorescein Labeled Fluorophore Labeled Fluorescein-12-ddCTP
Eosin-6-ddCTP Fluorescein-12-ddUTP Coumarin-5-ddUTP
Fluorescein-12-ddATP Tetramethylrhodamine-6-ddUTP
Fluorescein-12-ddGTP Texas Red-5-ddATP Fluorescein-N6-ddATP
LISSAMINE .TM.-rhodamine-5-ddGTP FAM Labeled TAMRA Labeled
FAM-ddUTP TAMRA-ddUTP FAM-ddCTP TAMRA-ddCTP FAM-ddATP TAMRA-ddATP
FAM-ddGTP TAMRA-ddGTP ROX Labeled JOE Labeled ROX-ddUTP JOE-ddUTP
ROX-ddCTP JOE-ddCTP ROX-ddATP JOE-ddATP ROX-ddGTP JOE-ddGTP R6G
Labeled R110 Labeled R6G-ddUTP R110-ddUTP R6G-ddCTP R110-ddCTP
R6G-ddATP R110-ddATP R6G-ddGTP R110-ddGTP BIOTIN Labeled DNP
Labeled Biotin-N6-ATP DNP-N6-ddATP DEOXYNUCLEOTIDE ANALOGS TTP
Analogs dATP-Analogs Fluorescein-12-dUTP Coumarin-5-dATP
Coumarin-5-dUTP Diethylaminocoumarin-5-dATP
Tetramethylrhodamine-6-dUTP Fluorescein-12-dATP
Tetraethylrhodamine-6-dUTP Fluorescein Chlorotriazinyl-4-dATP Texas
Red-5-dUTP LISSAMINE .TM.-rhodamine-5-dATP LISSAMINE
.TM.-rhodamine-5- Naphthofluorescein-5-dATP dUTP
Naphthofluorescein-5-dUTP Pyrene-8-dATP Fluorescein
Chlorotriazinyl-4- Tetramethylrhodamine-6-dATP dUTP Pyrene-8-dUTP
Texas Red-5-dATP Diethylaminocoumarin-5-dUTP DNA-N6-dATP
Biotin-N6-dATP dCTP Analogs dGTP Analogs Coumarin-5-dCTP
Coumarin-5-dGTP Fluorescein-12-dCTP Fluorescein-12-dGTP
Tetramethylrhodamine-6-dCTP Tetramethylrhodamine-6-dGTP Texas
Red-5-dCTP Texas Red-5-dGTP LISSAMINE .TM.-rhodamine-5- LISSAMINE
.TM.-rhodamine-5-dGTP dCTP Naphthofluorescein-5-dCTP Fluorescein
Chlorotriazinyl-4- dCTP Pyrene-8-dCTP Diethylaminocoumarin-5-dCTP
Fluorescein-N4-dCTP Biotin-N4-dCTP DNP-N4-dCTP RIBONUCLEOTIDE
ANALOGS CTP Analogs UTP Analogs Coumarin-5-CTP Fluorescein-12-UTP
Fluorescein-12-CTP Coumarin-5-UTP Tetrainethylrhodainine-6-CTP
Tetramethylrhodamine-6-UTP Texas Red-5-CTP Texas Red-5-UTP
LISSAMINE .TM.-rhodamine-5-CTP LISSAMINE .TM.-5-UTP
Naphthofluorescein-5-CTP Naphthofluorescein-5-UTP Fluorescein
Chlorotriazinyl-4-CTP Fluorescein Chlorotriazinyl-4-UTP
Pyrene-8-CTP Pyrene-8-UTP Fluorescein-N4-CTP Biotin-N4-CTP ATP
Analogs Coumarin-5-ATP Fluorescein-12-ATP
Tetramethylrhodamine-6-ATP Texas Red-5-ATP LISSAMINE
.TM.-rhodamine-5-ATP Fluorescein-N6-ATP Biotin-N6-ATP
DNP-N6-ATP
[0156] Additional non-conventional nucleotides useful according to
the invention include, but are not limited to 7-deaza-dATP,
7-deaza-dGTP, 5'-methyl-2'-deoxycytidine-5'-triphosphate. Further
non-conventional nucleotides or variations on those listed above
are discussed by Wright & Brown, 1990, Pharmacol. Ther. 47:
447. It is specifically noted that ribonucleotides qualify as
non-conventional nucleotides, since ribonucleotides are not
generally incorporated by DNA polymerases. Modifications of Family
B DNA polymerases that result in the ability, or enhanced ability,
of the polymerase to incorporate labeled or unlabeled
ribonucleotides are specifically contemplated herein.
[0157] E. Methods of Evaluating Mutants for Reduced
Discrimination
[0158] Random or site-directed mutants generated as known in the
art or as described herein and expressed in bacteria may be
screened for reduced discrimination against non-conventional
nucleotides by several different assays. In one method, Family B
DNA polymerase proteins expressed in lytic lambda phage plaques
generated by infection of host bacteria with expression vectors
based on, for example, Lambda ZapII.RTM., are transferred to a
membrane support. The immobilized proteins are then assayed for
polymerase activity on the membrane by immersing the membranes in a
buffer containing a DNA template and the unconventional nucleotides
to be monitored for incorporation.
[0159] Mutant polymerase libraries may be screened using a
variation of the technique used by Sagner et al (Sagner, G., Ruger,
R., and Kessler, C. (1991) Gene 97:119-123). For this approach,
lambda phage clones are plated at a density of 10-20 plaques per
square centimeter. Proteins present in the plaques are transferred
to filters and moistened with polymerase screening buffer (50 mM
Tris (pH 8.0), 7 mM MgCl.sub.2, 3 mM .beta.-ME). The filters are
kept between layers of plastic wrap and glass while the host cell
proteins are heat-inactivated by incubation at 65.degree. C. for 30
minutes. The heat-treated filters are then transferred to fresh
plastic wrap and approximately 35 .mu.l of polymerase assay
cocktail are added for every square centimeter of filter. The assay
cocktail consists of 1.times. cloned Pfu (cPfu) magnesium free
buffer (1.times. buffer is 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10
mM (NH4).sub.2SO.sub.4, 100 ug/ml bovine serum albumin (BSA), and
0.1% Triton X-100; Pfu Magnesium-free buffer may be obtained from
Stratagene (Catalog No. 200534)), 125 ng/ml activated calf thymus
or salmon sperm DNA, 1.29 .mu.Ci/ml .alpha.-.sup.33P ddNTP or
dideoxynucleotides (at a dNTP:dye-ddNTP ratio of 1:15). Initial
screening was done in the presence of MnCl.sub.2, but the preferred
method was to screen in 1.times. Taq Polymerase buffer (1.5 mM
MgCl.sub.2) The filters are placed between plastic wrap and a glass
plate and then incubated at 65.degree. C. for one hour, and then at
70.degree. C. for one hour and fifteen minutes. Filters are then
washed three times in 2.times.SSC for five minutes per wash before
rinsing twice in 100% ethanol and vacuum drying. Filters are then
exposed to X-ray film (approximately 16 hours), and plaques that
incorporate label are identified by aligning the filters with the
original plate bearing the phage clones. Plaques identified in this
way are re-plated at more dilute concentrations and assayed under
similar conditions to allow the isolation of purified plaques.
[0160] In assays such as the one described above, the signal
generated by the label is a direct measure of the activity of the
polymerase with regard to that particular unconventional nucleotide
or combination of unconventional nucleotides used in the assay.
Unconventional nucleotides corresponding to all four conventional
nucleotides may be included in the reactions, or, alternatively,
only one unconventional nucleotide may be included to assess the
effect of the mutation(s) on utilization of a given unconventional
nucleotide. One approach is to use unconventional nucleotides
corresponding to all four nucleotides in a first screen to identify
clones that incorporate more than a reference wild-type clone, and
then to monitor the incorporation of individual unconventional
nucleotides in a subsequent screen. In the preferred screening
mode, only the dideoxynucleotides and dideoxynucleotide analogs of
ddATP, ddCTP, and ddTTP would be used since ddGTP is not
discriminated against by some DNA polymerases and increases the
background signal of any screen.
[0161] In order to screen for clones with enhanced ability to
incorporate dideoxynucleotides, clones identified in first screens
utilizing only dideoxynucleotides may then be characterized by
their sensitivity to low levels of each of the four
dideoxynucleotides in a DNA polymerase nucleotide incorporation
assay employing all four dNTPs, a .sup.3H-TTP tracer, and a low
level of each ddNTP. Since incorporation of dideoxynucleotides
stops DNA chain elongation, superior ability to incorporate
dideoxynucleotides diminishes the incorporation of tritium labeled
deoxynucleotides relative to wild-type DNA polymerase. Comparisons
of ddNTP concentrations that bring about 50% inhibition of
nucleotide incorporation (I.sub.50%) can be used to compare ddNTP
incorporation efficiency of different polymerases or polymerase
mutants. Comparisons of I.sub.50% values for ddATP, ddCTP, ddGTP,
and ddTTP can be used to identify mutants with reduced selectivity
for particular bases. Such mutants would be expected to produce
more uniform DNA sequencing ladders.
[0162] In order to measure incorporation of individual ddNTPs,
cocktails are prepared which consist of varying concentrations of
the ddNTP of interest, and a total of 200 .mu.M of each nucleotide
triphosphate. For example, the incorporation of ddATP by wild type
JDF-3 polymerase may be measured at 0, 40, 80, 120 and 160 .mu.M
ddATP. In these reactions, dATP concentrations would be adjusted to
200, 160, 120, 80, and 40 .mu.M, respectively, so that the total
amount of adenine nucleotide triphosphate is 200 .mu.M. In
comparison, mutants may be assayed using ddATP concentrations of 0,
5, 10, and 20 .mu.M ddATP, and adjusted dATP concentrations of 200,
195, 190, and 180 .mu.M, respectively (dATP+ddATP=200 .mu.M).
Additional cocktails are prepared to similarly measure ddCTP,
ddGTP, and ddTTP incorporation.
[0163] Incorporation of nucleotides under the concentration
parameters described above may be measured in extension reactions
by adding, for example, 1 .mu.l of appropriately diluted bacterial
extract (i.e., heat-treated and clarified extract of bacterial
cells (see Example 1, part M) expressing a cloned polymerase or
mutated cloned polymerase) to 10 .mu.l of each nucleotide cocktail,
followed by incubation at 72.degree. C. for 30 minutes. Extension
reactions are quenched on ice, and then 5 .mu.l aliquots are
spotted immediately onto DE81 ion-exchange filters (2.3 cm; Whatman
#3658323). Unincorporated label is removed by 6 washes with
2.times.SCC (0.3M NaCl, 30 mM sodium citrate, pH 7.0), followed by
a brief wash with 100% ethanol. Incorporated radioactivity is then
measured by scintillation counting. Reactions that lack enzyme are
also set up along with sample incubations to determine "total cpms"
(omit filter wash steps) and "minimum cpms" (wash filters as
above).
[0164] Cpms bound is proportional to the amount of polymerase
activity present per volume of bacterial extract. The volume of
bacterial extract (generally about 0.25-1 .mu.l) which brings about
incorporation of approximately 10,000 cpms is determined for use in
subsequent nucleotide analog incorporation testing.
[0165] Genes for mutant DNA polymerases generated by random
mutagenesis may be sequenced to identify the sites and number of
mutations. For those mutants comprising more than one mutation, the
effect of a given mutation may be evaluated by introduction of the
identified mutation to the exo.sup.- progenitor gene by
site-directed mutagenesis in isolation from the other mutations
borne by the particular mutant. Screening assays of the single
mutant thus produced will then allow the determination of the
effect of that mutation alone.
[0166] F. Expression of Mutated Family B DNA Polymerase According
to the Invention
[0167] Methods known in the art may be applied to express and
isolate the mutated forms of Family B DNA polymerase according to
the invention. Many bacterial expression vectors contain sequence
elements or combinations of sequence elements allowing high level
inducible expression of the protein encoded by a foreign sequence.
For example, as mentioned above, bacteria expressing an integrated
inducible form of the T7 RNA polymerase gene may be transformed
with an expression vector bearing a mutated DNA polymerase gene
linked to the T7 promoter. Induction of the T7 RNA polymerase by
addition of an appropriate inducer, for example,
isopropyl-.beta.-D-thiog- alactopyranoside (IPTG) for a
lac-inducible promoter, induces the high level expression of the
mutated gene from the T7 promoter (see Gardner & Jack, 1999,
supra).
[0168] Appropriate host strains of bacteria may be selected from
those available in the art by one of skill in the art. As a
non-limiting example, E. coli strain BL-21 is commonly used for
expression of exogenous proteins since it is protease deficient
relative to other strains of E. coli. BL-21 strains bearing an
inducible T7 RNA polymerase gene include WJ56 and ER2566 (Gardner
& Jack, 1999, supra). For situations in which codon usage for
the particular polymerase gene differs from that normally seen in
E. coli genes, there are strains of BL-21 that are modified to
carry tRNA genes encoding tRNAs with rarer anticodons (for example,
argU, ileY, leuW, and proL tRNA genes), allowing high efficiency
expression of cloned protein genes, for example, cloned archaeal
enzyme genes (several BL21-CODON PLUS.TM. cell strains carrying
rare-codon tRNAs are available from Stratagene, for example).
[0169] There are many methods known to those of skill in the art
that are suitable for the purification of a modified DNA polymerase
of the invention. For example, the method of Lawyer et al. (1993,
PCR Meth. & App. 2: 275) is well suited for the isolation of
thermostable DNA polymerases expressed in E. coli, as it was
designed originally for the isolation of Taq polymerase.
Alternatively, the method of Kong et al. (1993, J. Biol. Chem. 268:
1965, incorporated herein by reference) may be used, which employs
a heat denaturation step to destroy host proteins, and two column
purification steps (over DEAE-Sepharose and heparin-Sepharose
columns) to isolate highly active and approximately 80% pure
thermostable DNA polymerase. Further, as detailed in Example 1,
part N, below, DNA polymerase mutants may be isolated by an
ammonium sulfate fractionation, followed by Q Sepharose and DNA
cellulose columns, or by adsorption of contaminants on a HiTrap Q
column, followed by gradient elution from a HiTrap heparin
column.
[0170] G. Preparation of Thermococcus Species JDF-3 Thermostable
DNA Polymerase with Reduced Discrimination
[0171] To prepare thermostable Family B polymerases which exhibit
reduced discrimination for dideoxynucleotide triphosphates
(ddNTPs), the DNA sequence encoding a 3' to 5'
exonuclease-deficient (D141A) Family B polymerase from the
hyperthermophilic archaeon Thermococcus species JDF-3 was subjected
to random mutagenesis using "error-prone PCR" as described herein,
and cloned into the bacteriophage lambda Zap.RTM.II. The polymerase
from JDF-3 was chosen due to superior processivity, polymerization
rate and ddNTP incorporation relative to the Family B DNA
polymerase from Pyrococcus furiosus (Pfu) (see Table IV, below).
The library of mutants was plated on E. coli hosts and the proteins
present in the lytic plaques were transferred to a solid support
that was then immersed in a buffer containing DNA template and all
four .alpha.-.sup.33P labeled dideoxynucleotides. Mutants that
incorporated the labeled dideoxynucleotide produced signals that
corresponded to their ability to incorporate the .alpha.-.sup.33P
ddNTPs. Isolated clones were then characterized by their
sensitivity to low levels of each of the four dideoxynucleotides in
a DNA polymerase nucleotide incorporation assay employing all four
dNTPs and a .sup.3H-TTP tracer. Since incorporation of
dideoxynucleotides stops DNA chain elongation, superior ability to
incorporate dideoxynucleotides diminishes the incorporation of
tritium labeled deoxynucleotides. The unmutated progenitor DNA
polymerase rarely incorporates dideoxynucleotides and is only 50%
inhibited at high ddNTP levels (100-160 micromolar each ddNTP). The
mutant enzymes show 50% inhibition at 5 to 40 micromolar
concentrations of ddNTP and improved incorporation was observed for
all four ddNTPs (ddATP, ddCTP, ddTTP and ddGTP; see Tables V and VI
in Example 1, below).
[0172] The incorporation of non-conventional nucleotides was also
evaluated through use of purified mutant polymerases in cycle
sequencing, with .alpha.-.sup.33P labeled ddNTPs present at 0.021
.mu.M and dNTPs present at 2.1 .mu.M each. The mutants readily
utilized all four dideoxynucleotides and produced sequencing
ladders that compared favorably to Thermo Sequenase.RTM., which
uses an F667Y Taq DNA polymerase mutant (VanderHorn et al., 1997,
BioTechniques 22: 758).
[0173] The domains of relevance in 17 of the 40 purified mutants
were sequenced. Most randomly mutated clones contained more than
one mutation in the regions sequenced but all mutants contained
mutations at one of three sites. Mutations predicted to confer an
enhanced ddNTP uptake phenotype were introduced into the progenitor
exonuclease deficient DNA polymerase sequence by site-directed
mutagenesis to eliminate ancillary mutations which were not
expected to contribute to the improved dideoxynucleotide uptake
phenotype.
[0174] Sixteen of the seventeen JDF-3 DNA polymerase mutations were
found in region II (motif A) on either side of the tyrosine in the
consensus sequence 404 DxxSLYPSII 413. These mutations consisted of
DFRSLYLSII (P410L), DFRSHYPSII (L408H) and DFRSFYPSII (L408F).
Therefore, the LYP motif of region II appears to be important in
ddNTP discrimination in the JDF-3 Family B polymerase.
[0175] The prior art modification of the tyrosine corresponding to
Y409 in JDF3 Family B DNA polymerase is recognized for its
positioning in the nucleotide binding pocket. As shown herein,
however, modification of the residues neighboring Y409 (L408H or
L408F or P410L) had the unexpected effect of profoundly altering
nucleotide binding, particularly with respect to ddNTP
incorporation.
[0176] The only JDF-3 DNA polymerase mutation leading to enhanced
incorporation of non-conventional nucleotides occurring outside of
region II is an alanine (ala or A) to threonine (thr or T)
conversion at position 485 in region III (A485T). This site is two
residues upstream of KX.sub.3NSXYG (Jung et al., 1990, supra;
Blasco et al., 1992, supra; Dong et al., 1993, J. Biol. Chem.
268:21163; Zhu et al., 1994, Biochem. Biophys. Acta 1219:260; Dong
and Wang, 1995, J. Biol. Chem. 270:21563) (referred to as region
III or motif B) which is functionally, but not structurally (Wang
et al., 1997, supra), analogous to KX.sub.3(F/Y)GX.sub.2YG in helix
O of the Family A DNA polymerases. In Family A DNA polymerases,
such as the Klenow fragment and Taq DNA polymerases, the O helix
contains amino acids that play a major role in dNTP binding
(Astatke et al., 1998, J. Mol. Biol. 278:147; Astatke et al., 1995,
J. Biol. Chem. 270:1945; Polesky et al., 1992, J. Biol. Chem
267:8417; Polesky et al., 1990, J. Biol. Chem. 265:14579; Pandey et
al., 1994, J. Biol. Chem. 269:13259; Kaushik et al., 1996, Biochem.
35:7256). Specifically, helix O contains the F (F762 in the Klenow
fragment; F667 in Taq) which confers ddNTP discrimination in Family
A DNA polymerases (KX.sub.3(F/Y)GX.sub.2YG) (Tabor and Richardson,
1995, supra).
[0177] The effect of the A485T mutation on ddNTP incorporation in
the JDF-3 DNA polymerase is surprising since the RB69 and
Thermococcus gorgonarius crystal structures (Hopfner et al., 1999,
supra) show it facing away from the proposed active site of the
nucleotide binding surface. Moreover, the type of side chain
conferring ribose selectivity in archaeal Family B DNA polymerases
(A: small, non-polar) is different from that of the bulky, aromatic
Y and F residues that dictate ddNTP discrimination in Family A DNA
polymerases (Tabor and Richardson, 1995, supra). Additionally, this
position (A485) is not well conserved among either DNA polymerase
family and is not included in the consensus sequence for this
domain (Braithwaite and Ito, 1993, supra), implying a lack of
critical importance in dNTP recognition.
[0178] A JDF-3 double mutant was constructed that contains
mutations P410L and A485T. In dideoxynucleotide cycle sequencing,
the banding pattern intensity demonstrated by the double mutant was
extremely uniform, suggesting little if any preference for any dNTP
over its corresponding ddNTP (See FIG. 8 and Example 1Q). This
polymerase characteristic improves the accuracy of base calling in
automated sequencing. We presume that combinations of P410L and
A485 mutations, L408H and A485 mutations, and L408F and A485
mutations would result in enzymes that exhibit improved ddNTP
incorporation. The efficiency of dideoxynucleotide incorporation by
such double mutant enzymes may also be characterized or quantitated
by measurement of the 150% as described herein to determine the
relative degree of improvement in incorporation.
EXAMPLES
[0179] The following examples are offered by way of illustration
only and are by no means intended to limit the scope of the claimed
invention.
Example 1
[0180] A. Cloning a DNA Polymerase Gene from Thermococcus Species
JDF-3 DNA Polymerase.
[0181] A Thermococcus species was cultured from submarine samples
taken from the Juan de Fuca ridge. Genomic DNA was isolated and
used to prepare a genomic DNA library in ZAP II (Stratagene) using
standard procedures. The lambda library was plated on XL1-Blue MRF'
E. coli and screened for clones with DNA polymerase activity using
a variation of the method described by Sagner et al. (Sagner, G.,
Ruger, R., and Kessler, C. (1991) Gene 97:119-123). Plaques
containing active polymerase were cored and stored in SM buffer.
Positive primary plaques were re-plated and re-assayed to allow
purification of isolated clones. Secondary clones were excised
according to the instructions provided with the ZAP II system
(Stratagene), and the DNA sequence of the insert determined (FIG.
1).
[0182] The translated amino acid sequence of the JDF-3 DNA
polymerase is shown in FIG. 2. Amino acid sequence alignments show
that JDF-3 DNA polymerase exhibits homology to the class of DNA
polymerases referred to as Family B.
[0183] Recombinant JDF-3 DNA polymerase was purified as described
below (see "Purification of JDF-3" (method 1)). The biochemical
properties of JDF-3 DNA polymerase have been compared to those of
other commercially available archaeal DNA polymerases. The results
shown in Table IV and V indicated that, compared to other enzymes,
JDF-3 exhibits higher processivity, a faster polymerization rate
(K.sub.cat), and a greater tendency to utilize ddNTPs. JDF-3 DNA
polymerase was therefore chosen for development of a DNA sequencing
enzyme.
5TABLE IV Polymerase Activities of Archaeal Family B DNA
Polymerases Specific Activity (U/mg) .times. 10.sup.4 DNA dNTP
Polymerase Activated DNA Primed M13 (nM) (.mu.M each) Pfu 2.6 .+-.
.07 4.1 .+-. .07 2.0 .+-. .02 0.7 16 .+-. 2 exo.sup.- Pfu 2.3 0.5
12 JDF-3 1.2 .+-. .07 5.2 2.0 16 .+-. 2 Vent 1.8.sup.a 0.7.sup.a
0.1.sup.a 57.sup.a .sup.aH Kong, R. B. Kucera, and W. E Jack, J.
Biol. Chem. 268, 1965 (1993).
[0184] B. Intein Removal from the Gene Encoding JDF-3 DNA
Polymerase.
[0185] By alignment to Family B DNA polymerase sequences, the JDF-3
DNA polymerase clone was found to contain an intein sequence (FIGS.
3 and 4). To improve expression of recombinant JDF-3 polymerase,
the intein was removed by inverse PCR. PCR primers were designed to
prime immediately upstream and downstream to the sequence coding
for the intein termini, and were oriented such that the 3' ends of
the primers were pointed away from the intein. The primers were
also modified with 5'-phosphate groups to facilitate ligation. The
plasmid/insert sequence was PCR amplified and circularized by
standard methods.
[0186] C. Construction of a JDF-3 DNA Polymerase Mutant with
Diminished 3'-5' Exonuclease Activity.
[0187] DNA polymerases lacking 3'-5' exonuclease (proofreading)
activity are preferred for applications requiring nucleotide analog
incorporation (e.g., DNA sequencing) to prevent removal of
nucleotide analogs after incorporation. The 3'-5' exonuclease
activity associated with proofreading DNA polymerases can be
reduced or abolished by mutagenesis. Sequence comparisons have
identified three conserved motifs (exo I, II, III) in the 3'-5'
exonuclease domain of DNA polymerases (reviewed V. Derbyshire, J.
K. Pinsonneault, and C. M. Joyce, Methods Enzymol. 262, 363
(1995)). Replacement of any of the conserved aspartic or glutamic
acid residues with alanine has been shown to abolish the
exonuclease activity of numerous DNA polymerases, including
archaeal DNA polymerases such as Vent (H. Kong, R. B. Kucera, and
W. E. Jack, J. Biol. Chem. 268, 1965 (1993)) and Pfu (Stratagene,
unpublished). Conservative substitutions lead to reduced
exonuclease activity, as shown for mutants of the archaeal
9.degree. N-7 DNA polymerase (M. W. Southworth, H. Kong, R. B.
Kucera, J. Ware, H. Jannasch, and F. B. Perler, Proc. Natl. Acad.
Sci. 93, 5281 (1996)).
[0188] JDF-3 DNA polymerase mutants exhibiting substantially
reduced 3'-5' exonuclease activity were prepared by introducing
amino acid substitutions at the conserved 141D or 143E residues in
the exo I domain. Using the CHAMELEON.RTM. Double-Stranded,
Site-Directed Mutagenesis Kit (Stratagene), the following JDF-3
mutants were constructed: D141A, D141N, D141S, D141T, D141E and
E143A.
[0189] To analyze JDF-3 mutant proteins, the DNA sequence encoding
JDF-3 DNA polymerase was PCR amplified using primers GGG AAA CAT
ATG ATC CTT GAC GTT GAT TAC (where NdeI site in bold and start
codon underlined) and GGG AAA GGA TCC TCA CTT CTT CTT CCC CTT C
(where BamHI site shown in bold type). The PCR products were
digested, purified, and ligated into a high expression level vector
using standard methods. Plasmid clones were transformed into
BL21(DE3). Recombinant bacterial clones were grown using standard
procedures and JDF-3 polymerase mutants were expressed in the
absence of induction. The exonuclease and polymerase activities of
recombinant clones were assayed using bacterial lysates. Typically,
crude extracts were heated at 70.degree. C. for 15-30 minutes and
then centrifuged to obtain a cleared lysate.
[0190] There are several methods of measuring 3' to 5' exonuclease
activity known in the art, including that of Kong et al. (Kong et
al., 1993, J. Biol. Chem. 268: 1965) and that of Southworth et al.
(Southworth et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 93: 5281),
the full contents of both of which are hereby incorporated by
reference. The exonuclease activity of wild type and active mutant
polymerases as measured by the Kong et al. method were as
follows:
6 Exo activity (U/mg): Wt 915 D141A7 D141N953 D141S954 DI41T0.5
D141E940 E143A0.3
[0191] The combination exonuclease mutant D141A+E143A was made as
described in section L.
[0192] The E143A JDF-3 mutant (clone #550) exhibited significantly
reduced 3'-5' exo activity and was chosen for further mutagenesis
to improve incorporation of ddNTP and other nucleotide analogs.
Other JDF-3 mutants with substantially reduced exonuclease activity
could have been used for this purpose, such as the JDF-3 D141T
mutant. For experiment or applications requiring the absolute
elimination of 3' to 5' exonuclease activity, the double mutant
D141A+E143A was preferred.
[0193] D. Error-Prone PCR Amplification of the JDF-3 DNA Polymerase
Gene.
[0194] Random mutations were introduced into exo.sup.- JDF-3 by
amplifying the entire gene (clone #550) under conditions which did
not support high fidelity replication. To broaden the spectrum of
potential mutations, three different PCR enzymes were used under
error-prone conditions.
[0195] In the preferred mode, ten reactions of 100 .mu.l each were
amplified with each PCR enzyme.
[0196] i. Amplification with Taq DNA Polymerase:
7 Reaction Mixture 1x magnesium free Taq Buffer (Stratagene catalog
#200530) 1 mM each TTP and dCTP 0.2 mM each dGTP and dATP 2
ng/.mu.l Primer 923 (also called 490) 2 ng/.mu.l Primer 721 0.05
u/.mu.l Taq2000 (Stratagene catalog #600195) 1.5 mM MgCl.sub.2 0.5
mM MnCl.sub.2 0.1 pM plasmid DNA (clone #550)
[0197] Cycling Parameters
[0198] PCRs were carried out using Stratagene's ROBOCYCLER.TM.40
Temperature Cycler with a Hot Top assembly. The following cycling
conditions were used:
[0199] 1) 95.degree. C. for 1 minute
[0200] 2) 95.degree. C. for 1 minute
[0201] 3) 54.degree. C. for 1 minute
[0202] 4) 72.degree. C. for 2.5 minutes
[0203] 5) Repeat steps 2 to 4 thirty times.
[0204] ii. Amplification with Exo.sup.- JDF-3 DNA Polymerase
8 Reaction Mixture 1x magnesium free Taq Buffer (Stratagene catalog
#200530) 450 .mu.M each deoxynucleotide (dGTP, dATP, TTP and dCTP)
2 ng/.mu.l Primer 923 (also called 490) 2 ng/.mu.l Primer 721 .sup.
0.1 u/.mu.l exo.sup.- JDF-3 DNA polymerase .sup. 0.5 mM MnCl.sub.2
.sup. 0.1 pM plasmid DNA (clone #550)
[0205] Cycling Parameters
[0206] PCRs were carried out using Stratagene's ROBOCYCLER.TM.40
Temperature Cycler with a Hot Top assembly. The following cycling
conditions were used:
[0207] 1) 95.degree. C. for 1 minute
[0208] 2) 95.degree. C. for 1 minute
[0209] 3) 54.degree. C. for 1 minute
[0210] 4) 72.degree. C. for 2.5 minutes
[0211] 5) Repeat steps 2 through 4 thirty times.
[0212] iii. Amplification with Exo.sup.- Pfu DNA Polymerase
9 Reaction Mixture 1x TAQPLUS .RTM. Precision Buffer (Stratagene
catalog #600210) 200 .mu.M each deoxynucleotide (dGTP, dATP, TTP,
dCTP) 2 ng/.mu.l Primer 923 (also called 490) 2 ng/.mu.l Primer 721
0.05 u/.mu.l exo.sup.- Pfu DNA polymerase (Stratagene catalog
number 600163) 0.1 pM plasmid DNA (clone #550)
[0213] Cycling Parameters
[0214] PCRs were carried out using Perkin-Elmer's 9600 Temperature
Cycler. The following cycling conditions were used:
[0215] 1) 95.degree. C. for 1 minute
[0216] 2) 95.degree. C. for 1 minute
[0217] 3) 53.degree. C. for 1 minute
[0218] 4) 72.degree. C. for 5 minutes
[0219] 5) Repeat steps 2 through 4 thirty times.
[0220] Forward Primers
[0221] Earlier versions of the mutant libraries were made with the
forward primer 461, which contains an EcoR I site. When products
amplified with primers 461 and 923 were restriction digested and
cloned into the lambda vector as described in the following
section, JDF-3 DNA polymerase was synthesized as a fusion protein
with the first 39 amino acids of the vector-encoded
.beta.-galactosidase (lacZ) protein.
10 Primer 461 5'TCAGATGAATTCGATGATCCTTGACGTTGATTAC 3' EcoR I JDF-3
specific sequence
[0222] The clones isolated using primer 461 were designed as
p#.
[0223] The preferred mode of amplification and cloning utilizes the
forward primer 721, which also contains an EcoR I site followed by
three consecutive in-frame stop codons and a ribosome binding site.
This arrangement allows the JDF-3 DNA polymerase to be translated
without any vector-derived residues at the amino terminus. The
clones isolated from libraries constructed with the forward primer
721 were designated as 1-# to differentiate them from the p# series
of clones.
11 Primer 721
5'GAGAGAATTCATAATGATAAGGAGGAAAAAATTATGATCCTTGACGTTGAT- TAC3' EcoR I
3x STOP JDF-3 specific sequence Reverse Primers Primer 923 (490)
5'TCAGATCTCGAGTCACTTCTTCTTCCCCTTC 3' Xho I JDF-3 specific
sequence
[0224] E. Preparing PCR Products for Cloning.
[0225] PCR products were purified and concentrated with the
STRATAPREP.TM. PCR Purification kit (Stratagene catalog number
400771). The PCR products were then digested with 50 units of Xho I
and 50 units of EcoR I in 1.5.times. Universal buffer (10.times.
Universal Buffer: 1M KOAc, 250 mM Tris-Acetate (pH 7.6), 100 mM
MgOAc, 5 mM .beta.-mercaptoethanol and 100 .mu.g/ml BSA) for one
hour at 37.degree. C. The digested samples were run on a 1%
agarose, 1.times. TBE gel and visualized with ethidium bromide
staining. The 2.3 kb amplification product was gel isolated and
purified with the STRATAPREP.TM. DNA Gel Extraction Kit (Stratagene
catalog number 400766).
[0226] F. Cloning PCR Inserts into the Uni-Zap.RTM.XR Lambda
Vector.
[0227] 200 ng of purified amplification product was ligated with 1
.mu.g of UNI-ZAP.RTM.XR Lambda Vector (Stratagene catalog #239213),
which had been predigested with EcoR I and Xho I and then
dephosphorylated with alkaline phosphatase (Stratagene catalog
number 237211). The DNAs were ligated using 2 units of T4 DNA
ligase (Stratagene catalog number 600011) and 0.5 mM ATP in
1.times. ligase buffer (50 mM Tris-HCL (pH 7.5), 7 mM MgCl.sub.2, 1
mM DTT) in reaction volumes of 10 to 15 .mu.l. Ligations were
carried out at 16.degree. C. for a minimum of 16 hours.
[0228] G. Lambda Packaging and Bacterial Infection.
[0229] Two microliters of each ligation reaction were packaged with
GIGAPACK.RTM. III Gold Packaging extract (Stratagene catalog
#200201) for 90 minutes at room temperature before being stopped
with 500 .mu.l SM buffer (50 mM Tris pH 7.5, 100 mM NaCl, 8 mM
MgSO.sub.4 and 0.01% gelatin) and 20 .mu.l of chloroform. The
packaged lambda vectors were plated on E. coli XL1-Blue MRF' host
cells.
[0230] H. Dideoxynucleotide Screening.
[0231] Mutant polymerase libraries were screened using a variation
of the technique used by Sagner et al (Sagner, G., Ruger, R., and
Kessler, C. (1991) Gene 97:119-123). Lambda phage clones were
plated at a density of 10-20 plaques per square centimeter.
Proteins present in the plaques were transferred to filters and
moistened with polymerase screening buffer (50 mM Tris (pH 8.0), 7
mM MgCl.sub.2, 3 mM .beta.-ME). The filters were kept between
layers of plastic wrap and glass while the host cell proteins were
heat-inactivated by incubation at 65.degree. C. for 30 minutes. The
heat-treated filters were transferred to fresh plastic wrap and
approximately 35 .mu.l of the polymerase assay cocktail was added
for every square centimeter of filter. Polymerase assay cocktail
consisted of 1.times. cloned Pfu magnesium-free buffer (Stratagene
catalog #200534), 125 ng/ml activated calf thymus or salmon sperm
DNA, 1.29 .mu.Ci/ml .alpha.-.sup.33P ddNTP (Amersham), and 0.5 mM
MnCl.sub.2. Initial screening was done in the presence of
MnCl.sub.2, but the preferred method was to screen in 1.times. Taq
Polymerase buffer (1.5 mM MgCl.sub.2). The filters were sandwiched
between plastic wrap and glass again and incubated at 65.degree. C.
for one hour, and then at 70.degree. C. for one hour and 15
minutes. The filters were washed three times in 2.times.SSC for
five minutes each time before being rinsed twice in 100% ethanol
and dried on a vacuum dryer. The filters were exposed to X-ray film
for approximately 16 hours. Plaques corresponding to strong signals
were cored and placed in SM buffer. The positive primary plaques
were replated at more dilute concentrations and assayed under
essentially similar conditions to allow the purification of
isolated plaques.
[0232] Dye-dideoxynucleotide Screening
[0233] To detect mutant polymerases with improved capacity for
dye-deoxynucleotide and dye-dideoxynucleotide utilization, the
JDF-3 mutant DNA polymerase library was screened as described
previously with the following exceptions:
[0234] Polymerase Assay Cocktail for Flu-12-dUTP Screening:
[0235] 0.9.times. Taq Buffer (Stratagene Catalog #200435), 65 .mu.M
dATP, 65 .mu.M dCTP, 65 .mu.M dGTP, 65 .mu.M dTTP, 0.3 .mu.M
Fluoresceince-12-dUTP (Stratagene in-house production), 0.75
.mu.g/.mu.l activated calf thymus DNA.
[0236] Polymerase Assay Cocktail for ROX ddNTP
[0237] 1.times. Taq Buffer, 0.9 .mu.M dATP, 0.9 .mu.M dCTP, 0.9
.mu.M dGTP, 0.9 .mu.l TTP, 0.6 .mu.M ROX ddATP (New England Nuclear
(NEN) NEN478), 0.06 .mu.M ROX ddGTP (NEN NEL479), 0.06 .mu.M ROX
ddCTP (NEN NEL477), 0.06 .mu.M ROX ddUTP (NEN NEL476), 0.84
.mu.g/.mu.l activated calf thymus DNA. (Note: A screening system
without ROX ddGTP is the preferred method since DNA polymerases do
not discriminate against ddGTP).
[0238] Polymerase Assay Cocktail for Fluroesceine ddUTP
[0239] 1.times. Taq Buffer, 70 .mu.M dATP, 70 .mu.M dTTP, 70 .mu.M
dCTP, 15 .mu.M dTTP, 1 .mu.M Fluroesceine-12-ddUTP (NEN NEL401),
0.84 .mu.g/.mu.l activated calf thymus DNA.
[0240] Antibody Binding to Fluroesceine
[0241] The filters were blocked overnight with 1% non-fat dry milk
dissolved in TBST (50 mM Tris pH 8.0, 150 mM NaCl, 0.05% Tween-20)
at 4.degree. C. The filters were washed briefly in TBST before
alkaline phosphatase conjugated anti-fluoresceine antibody from the
Illuminator kit (Stratagene catalog #300360) was added at a
{fraction (1/10,000)} dilution in 50 ml TBST. The antibody was
detected with NBT/BCIP at concentrations of 0.3 mg/ml and 0.15
mg/ml respectively in a buffer composed of 100 mM Tris pH 9.5, 100
mM NaCl, and 5 mM MgCl.sub.2.
[0242] Antibody Binding to Rhodamine
[0243] Anti-ROX antibody (Zymed cat. no. 71-3600 rabbit Rhodamine
(5-ROX polyclonal, 1 mg/ml)) was diluted to 1:1000 in TBST. The
blocked filters were blotted briefly to remove excess moisture then
laid on plastic wrap and covered with 2.5 ml of the diluted
antibody solution. An additional sheet of plastic wrap was laid
over the filters before incubation at room temperature for 1 hour.
The filters were washed briefly three times with TBST, then washed
three times with gentle agitation for 15 minutes each time. The
washed filters were incubated with alkaline phosphatase conjugated
goat anti-rabbit antibodies diluted 1:5000 in TBST. The filters
were incubated with the antibody for one hour then detected with
NBT/BCIP as described previously.
[0244] I. Dideoxynucleotide Qualification
[0245] Lambda phage clones which incorporated .sup.33P-labeled
ddNTPs in the primary library screen were re-screened to verify
polymerase activity and to assess the contribution of the divalent
metal ion to .sup.33P-ddNTP incorporation. The clones selected
during this round of screening were designated as p#. These clones
all contained an amino-terminal tag, as discussed in the section
entitled "Forward Primers". FIG. 5 shows that clones p1, p2, p3,
p6, p7, p8, p9, p10, p11, p12, p14, p15, and p16 exhibited wild
type levels of DNA polymerase activity, based upon similarity in
signal strength to the parental #550 clone (FIG. 5, panel 3).
Although initial screening was carried out in the presence of 0.5
mM MnCl.sub.2, all of the clones except p9 and p10 were able to
incorporate .sup.33P-labeled ddNTPs to at least some extent in the
presence of 1.5 mM MgCl.sub.2 (panel 2), with clones p2, p4, p8,
p11, p12, p13, p14, p15, p17, and p18 producing the highest
signals.
[0246] Eighteen mutants were chosen for evaluation. One microliter
of phage isolated from each purified plaque was placed on each of
three E. coli XL1-Blue MRF' lawns. Phage containing a parental copy
of exo.sup.- JDF3 DNA (#550 clone) were also spotted on the grid.
The plaques formed by the phage were transferred to filters and
treated as described in the preceding screening section with the
exception of the final buffer composition. The buffers used for
each filter (filters 1-3) are as follows:
12 Filter 1: Dideoxynucleotide screen with manganese chloride 1x
Taq DNA polymerase magnesium-free buffer 1.28 .mu.Ci/ml .sup.33P
ddNTPs 0.5 .mu.g/.mu.l Activated Calf Thymus DNA (Sigma) 0.5 mM
MnCl.sub.2 Filter 2: Dideoxynucleotide screen with magnesium
chloride 1x Taq DNA polymerase buffer (containing 1.5 mM
MgCl.sub.2, catalog #200435) 1.28 .mu.Ci/ml .sup.33P ddNTP 0.5
.mu.g/.mu.l Activated Calf Thymus DNA (Sigma) Filter 3:
Deoxynucleotide screen with magnesium chloride 1x Taq DNA
polymerase buffer 0.072 mM dGTP, dCTP and TTP 40 .mu.M dATP 0.5
.mu.g/ml Activated Calf Thymus DNA (Sigma) 0.01 .mu.Ci
.alpha.-.sup.33P dATP.
[0247] Results are shown in FIG. 5.
[0248] Dye-dideoxynucleotide Qualification
[0249] As described in the previous segments, primary lambda clones
were spotted on an E. coli lawn and re-screened with the
appropriate antibody or antibodies.
[0250] J. Excision of Lambda Clones.
[0251] When incubated with helper phage under suitable conditions,
Lambda Zap.TM. vectors are designed to produce phagemid copies of
the part of the vector containing pBluescript (SK-) and the insert.
This process yields a plasmid (pBluescript SK-) vector carrying the
same insert that was contained in the lambda clone. Excision of
clones with the desired phenotype was carried out according to the
instructions in the EXASSIST.TM. system (Stratagene catalog
#200253).
[0252] K. Sequence Analysis of Mutants.
[0253] The mutants were sequenced by Sequetech Corporation
(Mountain View, Calif.) using the following primers:
13 Primer 3 5' CCAGCTTTCCAGACTAGTCGGCCAAGGCC 3' (or primer G)
Primer 5 5' AACTCTCGACCCGCTG 3' (or JDF3-1128)
[0254] L. Dideoxynucleotide Mutagenesis.
[0255] To conclusively identify the amino acids contributing to
reduced ddNTP discrimination, individual point mutations were
introduced into the exo.sup.- JDF-3 #550 clone using the
QUIKCHANGE.TM. Site-Directed Mutagenesis Kit (Stratagene catalog
#200518). The following mutants were prepared: L408H, L408F, P410L,
A485T, S345P, D373Y, A619V, and L631 V. In addition, a double
mutant (P410L/A485T) was constructed by introducing the A485T
mutation into the exo.sup.- JDF-3 P410L mutant clone. To completely
eliminate all 3' to 5' exonuclease activity, the mutation D141A was
added to all clones. A pre-existing 5' to 3' exonuclease mutation
(E143A) was present in the parental template JDF-3 550.
[0256] Dye-Dideoxynucleotide Mutagenesis
[0257] To conclusively identify amino acids responsible for
contributing to reduced discrimination of dye nucleotides, the
mutation S345P was generated alone and in combination with the
P410L and P410L+A485T.
[0258] M. Preparation of Heat-Treated Bacterial Extracts.
[0259] E. coli SOLR cells containing the excised plasmid were grown
overnight at 37.degree. C. The cells contained in 500 .mu.l of
culture were collected by microcentrifugation. The cell pellets
were resuspended in 50 .mu.l of 50 mM Tris (pH 8.0). Lysozyme was
added to a final concentration of 1 .mu.g/.mu.l, and the cells were
lysed during a 10 minute incubation at 37.degree. C., followed by
10 minutes at 65.degree. C. The heat-inactivated cell material was
collected by microcentrifugation and the supernatants were assayed
for dNTP and ddNTP incorporation as described below.
[0260] N. Purification of JDF-3 and JDF-3 Polymerase Mutants.
[0261] One method for purifying exo.sup.- JDF-3 DNA polymerase
involves ammonium sulfate fractionation, followed by Q Sepharose
and DNA cellulose columns. A second method has been developed to
allow rapid purification of JDF-3 polymerase mutants, and entails
adsorption of contaminants on a HiTrap Q column, followed by
gradient elution from a HiTrap heparin column (section iii).
[0262] i. Preparation of Bacterial Lysate.
[0263] Frozen cell paste (3-14 grams) was resuspended with 3.times.
volume of lysis buffer, consisting of 50 mM Tris-HCl (pH 8.0), 1 mM
EDTA, and 10 mM .beta.-mercaptoethanol. Lysozyme was added to 0.2
mg/ml and PMSF was added to 1 mM final concentration. The cells
were lysed on ice over a period of 1 hour. The lysate was then
sonicated for 2 minutes (90% duty, level of 2.times.2.5,
1.times.3.0). Following sonication, the lysate was heated at
65.degree. C. for 15 minutes to denature bacterial proteins. The
heated lysate was then centrifuged for 30 minutes at 14.5K rpm in a
Sorvall RC-2B centrifuge using a Sorvall SS-34 rotor, and the
supernatant was recovered.
[0264] ii. Ammonium Sulfate Fractionation and Q Sepharose/DNA
Cellulose Chromatography (Method 1)
[0265] Ammonium sulfate was added to the bacterial lysate to a
final concentration of 45%. The ammonium sulfate was added over a
period of 15 minutes, and the mixture was stirred for an additional
30 minutes. The mixture was centrifuged as described above, and the
supernatant was recovered. Additional ammonium sulfate was then
added to bring the final concentration to 65%. The mixture was
centrifuged as described above, and the supernatant removed. The
pellet was resuspended in 10 ml of buffer A consisting of 50 mM
Tris-HCl (pH 7.5), 1 mM EDTA, 10 mM .beta.-mercaptoethanol, 0.1%
(v/v) Tween 20, and 10% (v/v) glycerol. The supernatant was
dialyzed overnight against 2 changes of buffer A (3 liters
each).
[0266] The dialysate was loaded onto a 2.6.times.9.4 cm Q-Sepharose
Fast Flow column (50 mls), pre-equilibrated in buffer A. The column
was washed with buffer A until the absorbence (OD.sub.280)
approached baseline. The column was then eluted with a gradient
from 0 to 1M NaCl/buffer A. Fractions were collected, and analyzed
by SDS-PAGE and DNA polymerase activity assays (see below). Active
protein typically eluted between 130 and 240 mM NaCl. Active
fractions were pooled and dialyzed overnight against 2 changes of
buffer B (3 liters each), consisting of 50 mM Tris-HCl (pH 7.5), 1
mM EDTA, 10 mM .beta.-mercaptoethanol, 0.1% (v/v) Tween 20, 10%
(v/v) glycerol, and 50 mM NaCl.
[0267] The Q-Sepharose eluate was then loaded onto a 1.6.times.4.9
cm (10 mls) DNA cellulose column, equilibrated in buffer B. The
column was washed with buffer B until the absorbence (OD.sub.280)
approached baseline. The column was then eluted with a gradient
from 50 to 1000 mM NaCl/buffer A. Fractions were collected, and
analyzed by SDS-PAGE and DNA polymerase activity assays. Active
protein typically eluted between 280 and 360 mM NaCl. Active
fractions were pooled and dialyzed overnight against JDF-3 final
dialysis buffer, consisting of 25 mM Tris-HCl (pH 7.5), 100 mM KCl,
0.1 mM EDTA, 1 mM DTT, 0.1% (v/v) Tween 20, 0.1% (v/v) Igepal 630,
10 .mu.g/ml BSA, and 50% (v/v) glycerol.
[0268] iii. HiTrap Q/HiTrap Heparin Chromatography (Method 2)
[0269] The preferable method for rapid purification of multiple
mutants is as follows. Bacterial cell lysates were prepared as
described for method 1, except that Tween 20 and Igepal CA 630 were
added to a final concentration of 0.01% (v/v) just prior to the
heat denaturation step, and a heat denaturation temperature of
72.degree. C. was used.
[0270] The lysate was loaded onto a 1.6.times.2.5 cm (5 mls) HiTrap
Q column (pre-packed column from Pharmacia), pre-equilibrated in
buffer C consisting of 50 mM Tris-HCl (pH 8.2), 1 mM EDTA, 10 mM
.beta.-mercaptoethanol, 0.1% (v/v) Tween 20, and 0.1% (v/v) Igepal
CA 630. The column was washed with buffer C until the absorbence
(OD.sub.280) approached baseline. The flow through fractions
(OD.sub.280 absorbence above background) were collected and then
loaded onto a 1.6.times.2.5 cm (5 mls) HiTrap heparin column
(pre-packed column from Pharmacia), pre-equilibrated in buffer D
consisting of 50 mM Tris-HCl (pH 8.2), 1 mM EDTA, 1 mM DTT, 0.1%
(v/v) Tween 20, 0.1% (v/v) Igepal CA 630, and 10% glycerol (v/v).
The column was washed with buffer D until the absorbence
(OD.sub.280) approached baseline. The column was then eluted with a
gradient from 0 to 1M KCl/buffer D. Fractions were collected, and
analyzed by SDS-PAGE and DNA polymerase activity assays. Active
protein typically eluted between 390 and 560 mM NaCl. Active
fractions were pooled and dialyzed overnight against JDF-3 final
dialysis buffer (see above). Purified polymerases were stored at
-20.degree. C.
[0271] iv. Analysis of Purified Proteins
[0272] The concentrations of JDF-3 and mutant DNA polymerases were
determined relative to a BSA standard (Pierce), using Pierce's
Coumassie Blue Protein assay reagent. In addition, the purity and
relative protein concentrations of different polymerase
preparations were verified by SDS-PAGE. Polymerase samples were
electrophoresed on 4-20% Tris-glycine gels (Novex), and the gels
were silver-stained using standard procedures.
[0273] O. Nucleotide Incorporation Assay.
[0274] DNA polymerase activity was measured using purified JDF-3
polymerase mutants or heat-treated bacterial extracts prepared from
various mutant clones. DNA polymerase activity was measured by
monitoring the incorporation of .sup.3H-TTP into activated calf
thymus DNA. A typical DNA polymerase reaction cocktail
contained:
[0275] 10 mM Tris-HCl, pH 8.8
[0276] 1.5 mM MgCl.sub.2
[0277] 50 mM KCl
[0278] 0.001% gelatin
[0279] 200 .mu.M each dATP, dCTP, dGTP
[0280] 195 .mu.M TTP
[0281] 5 .mu.M [.sup.3H]TTP (NEN #NET-221H, 20.5 Ci/mmole;
partially evaporated to remove EtOH).
[0282] 250 .mu.g/ml of activated calf thymus DNA (e.g., Pharmacia
#27-4575-01)
[0283] Incorporation was measured by adding 1 .mu.l of polymerase
samples to 10 .mu.l aliquots of polymerase cocktail. DNA polymerase
samples were diluted in a suitable storage buffer (e.g., 25 mM
Tris-HCl (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.1% (v/v)
Tween 20, 0.1% (v/v) Igepal 630, 10 .mu.g/ml BSA, and 50% (v/v)
glycerol). Polymerization reactions were conducted for 30 minutes
at 72.degree. C. Extension reactions were quenched on ice, and then
5 .mu.l aliquots were spotted immediately onto DE81 ion-exchange
filters (2.3 cm; Whatman #3658323). Unincorporated [.sup.3H]TTP was
removed by 6 washes with 2.times.SCC (0.3M NaCl, 30 mM sodium
citrate, pH 7.0), followed by a brief wash with 100% ethanol.
Incorporated radioactivity was measured by scintillation counting.
Reactions that lacked enzyme were also set up along with sample
incubations to determine "total cpms" (omit filter wash steps) and
"minimum cpms" (wash filters as above).
[0284] Cpms bound is proportional to amount of polymerase activity
present per volume of bacterial extract. The volume of bacterial
extract (0.25-1 .mu.l) which brought about incorporation of
approximately 10,000 cpms was determined for use in subsequent
nucleotide analog incorporation testing.
[0285] P. Quantitating ddNTP Incorporation Efficiency.
[0286] JDF-3 polymerase mutants were evaluated to assess relative
ddNTP incorporation efficiency. Nucleotide incorporation was
measured in the presence of varying concentrations of each ddNTP
terminator (ddATP, ddCTP, ddGTP, and ddTTP). Since ddNTP
incorporation produces non-extendable termini, polymerization is
strongly inhibited for polymerases that incorporate ddNTPs
efficiently. Comparisons of ddNTP concentrations that bring about
50% inhibition of nucleotide incorporation (I.sub.50%) can be used
to compare ddNTP incorporation efficiency of different polymerases
or polymerase mutants. Comparisons of I.sub.50% values for ddATP,
ddCTP, ddGTP, and ddTTP can be used to identify mutants with
reduced selectivity for particular bases. Such mutants would be
expected to produce more uniform DNA sequencing ladders.
[0287] To measure incorporation of individual ddNTPs, cocktails
were prepared which consisted of varying concentrations of the
ddNTP of interest, and a total of 200 .mu.M of each nucleotide
triphosphate. For example, the incorporation of ddATP by wild type
JDF-3 polymerase was measured at 0, 40, 80, 120 and 160 .mu.M
ddATP. In these reactions, dATP concentrations were adjusted to
200, 160, 120, 80, and 40 .mu.M, respectively, so that the total
amount of adenine nucleotide triphosphate was 200 .mu.M. In
comparison, mutants were assayed using ddATP concentrations of 0,
5, 10, and 20 .mu.M ddATP, and adjusted dATP concentrations of 200,
195, 190, and 180 .mu.M, respectively (dATP+ddATP=200 .mu.M).
Additional cocktails were prepared to measure ddCTP, ddGTP, and
ddTTP incorporation. To assess ddNTP incorporation by JDF-3 mutants
at 3 different ddNTP concentrations, 12 reaction cocktails were
prepared consisting of:
[0288] 10 mM Tris-HCl, pH 8.8
[0289] 1.5 mM MgCl.sub.2
[0290] 50 mM KCl
[0291] 0.001% gelatin
[0292] 5 .mu.M [.sup.3H]TTP (NEN #NET-221H, 20.5 Ci/mmole;
partially evaporated to remove EtOH)
[0293] 250 .mu.g/ml of activated calf thymus DNA (e.g., Pharmacia
#27-4575-01)
[0294] To each of 12 reaction cocktails was added the appropriate
amounts of dNTPs and ddNTPs as summarized below:
14 Cocktail DGTP dDATP dCTP TTP ddGTP ddATP ddCTP ddTTP G-0 200
.mu.M 200 .mu.M 200 .mu.M 195 .mu.M 0 0 0 0 G-5 195 .mu.M 200 .mu.M
200 .mu.M 195 .mu.M 5 0 0 0 G-10 190 .mu.M 200 .mu.M 200 .mu.M 195
.mu.M 10 0 0 0 G-20 180 .mu.M 200 .mu.M 200 .mu.M 195 .mu.M 20 0 0
0 A-0 200 .mu.M 200 .mu.M 200 .mu.M 195 .mu.M 0 0 0 0 A-5 200 .mu.M
195 .mu.M 200 .mu.M 195 .mu.M 0 5 0 0 A-10 200 .mu.M 190 .mu.M 200
.mu.M 195 .mu.M 0 10 0 0 A-20 200 .mu.M 180 .mu.M 200 .mu.M 195
.mu.M 0 20 0 0 C-0 200 .mu.M 200 .mu.M 200 .mu.M 195 .mu.M 0 0 0 0
C-5 200 .mu.M 200 .mu.M 195 .mu.M 195 .mu.M 0 0 5 0 C-10 200 .mu.M
200 .mu.M 190 .mu.M 195 .mu.M 0 0 10 0 C-20 200 .mu.M 200 .mu.M 180
.mu.M 195 .mu.M 0 0 20 0 T-0 200 .mu.M 200 .mu.M 200 .mu.M 195
.mu.M 0 0 0 0 T-5 200 .mu.M 200 .mu.M 200 .mu.M 190 .mu.M 0 0 0 5
T-10 200 .mu.M 200 .mu.M 200 .mu.M 185 .mu.M 0 0 0 10 T-20 200
.mu.M 200 .mu.M 200 .mu.M 175 .mu.M 0 0 0 20
[0295] Incorporation was measured by adding 1 .mu.l of
appropriately diluted bacterial extract (10,000 cpms) to 10 .mu.l
of each polymerase cocktail. Polymerization reactions were
conducted for 30 minutes at 72.degree. C. The extension reactions
were counted as described above.
[0296] Reactions that lacked enzyme were also set up along with
sample incubations to determine "minimum cpms"(wash filters as
above). To determine % activity as a function of ddNTP
concentration, background ("minimum cpms" value) was first
subtracted from each of the sample cpms. "Total cpms", which are
equivalent to 100% activity (0 ddNTPs), are determined by averaging
the corrected cpms for the 4 reactions lacking ddNTPs (A-0, G-0,
C-0, and T-0). Percent remaining activity was then calculated by
dividing corrected sample cpms (with ddNTPs) by the corrected total
cpms (average 0 ddNTPs).
[0297] Percent activity was plotted as a function of ddNTP
concentration. I.sub.50% values for each ddNTP (ddNTP concentration
which inhibits nucleotide incorporation by 50%) were determined for
each mutant. Comparisons allowed the identification of mutants with
improved ddNTP incorporation relative to wild type JDF-3.
[0298] Initial studies used purified enzymes, and I.sub.50% values
were determined from inhibition plots employing 40-160 .mu.M
ddNTPs. The results in Table V show that mutants p8 (P41OL), p11
(P41OL), and p12(A485T) are inhibited by lower concentrations of
ddNTPs than the parental exo.sup.- JDF-3 polymerase. Greater
sensitivity indicates that the mutants incorporate all four ddNTPs
more efficiently than the original JDF-3 polymerase.
[0299] For enzymes which preferentially incorporate TTP over ddTTP
(exo.sup.- JDF-3, exo.sup.- Pfu), the use of increasingly higher
concentrations of ddTTP (80-160 .mu.M) and correspondingly lower
concentrations of TTP (115-35 .mu.M), in combination with a
constant amount of [.sup.3H]TTP (5 .mu.M), leads to an increase in
cpms incorporated with increasing ddNTP concentration. Therefore,
in these initial experiments (where ddTTP>120 .mu.M), I.sub.50%
values for TTP are artificially high. While they can be used to
compare ddTTP incorporation among different polymerase mutants,
they can not be used to assess reduced/enhanced preference for
ddTTP relative to ddCTP, ddGTP, or ddATP.
15TABLE V IC.sub.50% Values for Purified JDF-3 and JDF-3 Mutants.
Primary I.sub.50% Values (.mu.M) Purified Polymerase Mutation ddATP
ddGTP ddCTP dd Exo JDF-3 -- 160 110 >160 >>160 Exo Pfu --
>160 >160 >160 >>160 JDF-3 mutant p8 P410L 30 25 40
40 JDF-3 mutant p11 P410L 30 30 60 >160 JDF-3 mutant p12 A485T
40 25 25 150
[0300] To allow a larger number of mutant clones to be screened,
subsequent experiments employed bacterial extracts containing JDF-3
polymerase mutants. In addition, sensitivity was improved by using
lower concentrations of each ddNTP inhibitor (5-20 .mu.M). The
results in Table VI demonstrate that all of the mutants selected
from the primary filter screen exhibited improved incorporation of
ddNTPs. Improvements in ddNTP incorporation were as high as
>20-fold. All of the mutants containing a mutation at amino acid
408 (L408H/F), 410 (P410L), or 485 (A485T) (referred to as the
"primary mutation") exhibited reduced discrimination against all
four ddNTPs. Most, but not all, mutants with the L408H/F primary
mutation produced very similar I.sub.50% values (<2-fold
difference) for all four ddNTPs, indicating that base selectivity
is diminished or absent.
16TABLE VI IC.sub.50% Values for JDF-3 Mutants (Bacterial
Extracts). Primary I.sub.50% Values (.mu.M) JDF-3 mutant clones
mutation ddATP ddGTP ddCTP ddT Exo JDF-3 -- >80 >80 >80
>80 1-1, 1-4, 1-18 L408H 8 to 4 to 5 6 to 5.5 to >20 13 1-25,
1-28, 1-29, L408F 4.5 to 3.5 to 4 to 4 to 8 1-17 >20 10 6.5 p8
P410L 18.5 12 9.5 >20 1-5, 1-6, 1-17 P410L 10 to 3.5 to 16.5 to
11 to > >20 9 >20 5 to > 1-41, 1-38, 1-37, Not 7 to 3.5
to 4 to 1-3, 1-19, 1-30, determined >20 12 >20 1-27, 1,20
1-26, 1-32, 1-16, 1-12
[0301] Q. Sequencing with Purified JDF-3 Polymerase Mutants.
[0302] i. Sequencing with Radioactively Labeled
Dideoxynucleotides
[0303] 1 to 2 .mu.l of purified enzyme was substituted into the
Thermo Sequenase radiolabeled terminator cycle sequencing kit
(Amersham-Pharmacia #US79750). The samples were processed according
to the manufacturer's instructions using the control primer and
template provided with the kit. Three microliters of each
sequencing reaction were loaded onto a 6% acylamide-7M urea,
1.times.TBE CASTAWAY.TM. Precast gel (Stratagene catalog #s 401090
and 401094). When the bromophenol blue indicator dye reached the
end of the gel, the gel was fixed, dried and exposed to film for
24-72 hours (FIG. 6).
[0304] The results in FIG. 6 show that clones p 11 (panel D) and p8
(panel E) exhibit a dramatic improvement in the incorporation of
all four ddNTPs compared to the parental #550 clone (panel B).
Mutants p11 and p8 both contain the primary P410L mutation and an
amino tag, but differ with respect to the number and types of
ancillary mutations. Mutant p12 (panel C) produced a faint
sequencing ladder, presumably due to the use of an insufficient
amount of enzyme or the presence of ancillary mutations which
reduce thermal stability. There is evidence of termination products
in all lanes, suggesting an improvement in the incorporation of all
four ddNTPs relative to the parental clone. Mutant p12 contains the
primary mutation A485T in addition to ancillary mutations. In
contrast to JDF-3 mutants identified here, the parental clone shows
a strong preference to incorporate ddGTP, as evidenced both in
primer extension (FIG. 6) and ddNTP inhibition assays (Tables V and
VI).
[0305] ii. Sequencing with a Radioactively Labeled Primer and
Fluorescent Dideoxynucleotides
[0306] Different DNA polymerases and polymerase mutants will
exhibit varying degrees of discrimination against the dye moieties
on the dideoxynucleotide analogs. An assessment of usage of
dye-labeled dideoxynucleotide analogs by the JDF-3 polymerase
mutants was carried out. The procedure used was as follows:
[0307] a. Primer Labeling
[0308] The sequencing primer SK was radioactively labeled with the
KINACE-IT.TM. Kinasing Kit (Stratagene catalog #200390). The
incubation reaction (40 .mu.l) contained the following
components:
17 1X kinase buffer #1 0.75 .mu.Ci/.mu.l .gamma.-.sup.33P ATP 0.375
u/.mu.l T4 polynucleotide kinase 2.5 pmol/.mu.l SK primer
[0309] The reaction was incubated at 37.degree. C. for 45 minutes.
The primer was purified away from free nucleotides with a size
exclusion matrix (NUC TRAP.RTM. Stratagene catalog number
400701).
[0310] b. Dye Labeled-Dideoxynucleotide : dNTP Ratios
[0311] Fluorescent dideoxynucleotides were purchased from New
England Nuclear (NEN):
18 R6G-ddATP NEN catalog number NEL-490 R110-ddTP NEN catalog
number NEL-495 TAMRA-ddUTP NEN catalog number NEL-472 ROX-ddCTP NEN
catalog number NEL-477
[0312] Incorporation was measured using 3 different concentrations
of dye labeled dideoxynucleotides (ddNTPs) and a constant amount of
deoxynucleotides (dNTPs; 2.14 .mu.M):
19 Condition 3) 1:1 (2-14 .mu.M each dNTP: 2.14 .mu.M dye-labeled
ddNTP) Condition 2) 1:0.1 (2.14 .mu.M each dNTP: 0.214 .mu.M
dye-labeled ddNTP) Condition 1) 1:0.01 (2.14 .mu.M each dNTP:
0.0214 .mu.M dye-labeled ddNTP)
[0313] c. Preparation of the DNA Sequencing Reaction Mixtures
[0314] Four polymerases were tested for utilization of dye-labeled
ddNTPs, exo.sup.- JDF-3 (#550 clone), Thermo Sequenase (4 u/.mu.l),
JDF-3 P410L (clone p8 with ancillary mutations and an
amino-terminal tag) and JDF-3 L408H (clone 1-1). A mixture
containing the following reagents was assembled:
20 13.7 .mu.l H.sub.2O 1 .mu.l labeled SK primer (2 pmol/.mu.l) 1
.mu.l pBluescript KS (0.2 .mu.g/.mu.l) 1 .mu.l polymerase
(.about.1.5 u/.mu.l) 2 .mu.l 10x buffer (reaction buffer 1 for all
but L408H which uses 1.5 mM MgCl.sub.2, buffer (see below) 10X
Reaction Buffer 1 260 mM Tris pH 9.5 65 mM MgCl.sub.2 10X 1.5 mM
MgCl.sub.2 buffer 24 mM MgCl.sub.2 260 mM Tris pH 9.5
[0315] 2.5 .mu.l of each dye-labeled ddNTP terminator (ddGTP,
ddATP, ddTTP and ddGTP was aliquotted separately into one of four
tubes. 4.5 .mu.l of each polymerase reaction was added to each of
the four tubes, to give a final reaction volume of 7 .mu.l.
[0316] d. Cycle Sequencing Reactions
[0317] The samples were cycled in a RoboCycler.RTM.96 Temperature
Cycler with a Hot Top Assembly (Stratagene Catalog #400870 and
#400894) using the following conditions:
[0318] 1 minute at 95.degree. C.
[0319] 1 minute at 95.degree. C.
[0320] 3) 1 minute at 50.degree. C.
[0321] 4) 2 minutes at 72.degree. C.
[0322] 5) Repeat Steps 2-4 Thirty Times.
[0323] 4 .mu.l of stop solution (95% formamide, 20 mM EDTA, 0.05%
bromophenol blue, 0.05% xylene cyanol FF) was added to each of the
amplified reactions before heating them to 99.degree. C. for five
minutes. The samples were electrophoresed on a 6% CASTAWAY.TM. gel
as described above. The gels were dried and then exposed to film
for 72 hours (FIG. 7).
[0324] The results of studies designed to assess utilization of
dye-labeled ddNTPs by the different polymerase clones are shown in
FIG. 7. Clones p8 (panel C) and 1-1 (panel D) exhibited
significantly improved incorporation of R6G-ddATP and R110-ddGTP,
compared to the parental clone (panel A). Improvement was evidenced
by the synthesis of sequencing ladders at 0.01.times. (1) and
0.1.times. (2) dye-ddNTP/dNTP ratios. Optimization of reaction
conditions and/or dye moieties may be performed to realize
improvements in the incorporation of ddTTP and ddCTP.
[0325] iii. Sequencing with Double-Mutant exo.sup.- JDF-3 DNA
Polymerase.
[0326] To verify that changes at residues 408, 410, and 485 were
sufficient to improve ddNTP incorporation, individual mutations
were introduced into the parental 550 (JDF-3 exo.sup.- DNA
polymerase) clone by site-directed mutagenesis. In addition, point
mutations were combined to examine whether they resulted in further
improvements in dideoxynucleotide incorporation over polymerases
bearing single mutations.
[0327] DNA sequencing reactions consisting of 1.times. reaction
buffer, 0.15 pmol/.mu.l long -20 primer, and 10 ng/.mu.g
pBluescript KS were prepared as follows:
21 81 .mu.l H.sub.2O 9 .mu.l -20 long primer (2 pmol/.mu.l) 6 .mu.l
pBluescript KS (0.2 .mu.g/.mu.l) **.mu.l polymerase 12 .mu.l 10X
buffer (260 mM Tris pH 9.5, 65 mM MgCl.sub.2)
[0328] 18 .mu.l of the cocktail listed above was aliquotted into
the appropriate number of tubes (one per polymerase). Each
polymerase (2 .mu.l) was added to an aliquot of cocktail and the
tubes were mixed well. Each resulting polymerase mixture (4.5
.mu.l) was then added to each of four tubes, already containing
0.06 mM of one of the four --.sup.33P-dideoxynucleotides (ddATP,
ddTTP, ddGTP or ddTTP; 1500 Ci/mmol; 450 .mu.Ci/ml) and 6 mM each
deoxynucleotide in a volume of 2.5 .mu.l.
[0329] The sequencing reactions were cycled in a ROBOCYCLER.RTM.96
temperature cycler with a Hot Top Assembly using the following
conditions:
[0330] 1) 1 minute at 95.degree. C.
[0331] 2) 45 seconds at 95.degree. C.
[0332] 3) 45 seconds at 60.degree. C.
[0333] 4) 1.5 minutes at 72.degree. C
[0334] 5) Repeat steps 2-4 thirty times.
[0335] Stop solution (.mu.l; 95% formamide, 20 mM EDTA, 0.05%
bromophenol blue, 0.05% xylene cyanol FF) was added to each
reaction before heating to 99.degree. C. for five minutes. Each
sample (4 .mu.l) was loaded onto a 6% acrylamide denaturing
CastAway gel. The gel was run and treated as described
previously.
[0336] FIG. 8 shows that the P410L/A485T double mutant exhibits
exceptionally even signals. Band uniformity was improved compared
to mutant p8 (P410L mutation plus ancillary mutations that do not
include A485T) and mutant A485T (data not shown). Mutant p8
exhibited a tendency to preferentially incorporate ddGTP and ddCTP
in a sequence-dependent fashion. The optimal amount of enzyme may
be higher than the quantity tested in this experiment. Sequence
produced by the commercially available Family A DNA polymerase
mutant, Thermo Sequenase, is shown in panel E.
[0337] iv. Ribonucleotide Incorporation by JDF-3 Polymerase
Mutants.
[0338] A primer annealed to single stranded DNA template was
extended in a mixture containing all ribonucleotides or all
deoxynucleotides with the mutant and progenitor polymerases.
[0339] M13 mp18+ single stranded DNA was annealed to 95.times.
molar excess of the 38 mer primer by heating the mixture to
95.degree. C. and cooling slowly at room temperature.
22 38mer primer: 5' GGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA- GT 3'
[0340] Preliminary assays were carried out to determine what
dilutions of enzyme would be necessary to examine the incorporation
activity at non-maximal levels. The final assay solutions were
composed as described below:
23 Ribonucleotide mixture 20 ng/.mu.l annealed primer/template 1x
Cloned Pfu buffer (Stratagene catalog #200532) 200 .mu.M each GTP,
UTP, ATP 50 .mu.M CTP 1 .mu.M 5-.sup.3H CTP 20.2 Ci/mmole 0.05-0.3
units JDF-3 polymerase* Deoxyribonucleotide mixture 20 ng/.mu.l
annealed primer template 1x Cloned Pfu buffer 200 .mu.M each dGTP,
dATP, dCTP 50 .mu.M TTP (deoxyribonucleotide) 1 .mu.M Thymidine
5'-triphosphate, [methyl-.sup.3H] 20.5 Ci/mmole 0.05-0.3 units
JDF-3 polymerase* *Added separately
[0341] Nine microliters of the polymerase-free mixtures were placed
in 0.2 ml tubes before the polymerases were added. The samples were
incubated at 72.degree. C. in a ROBOCYCLER.RTM.96 temperature
cycler with Hot Top Assembly (Stratagene Catalog Nos. 400870 and
400894). The deoxyribonucleotide mixture was removed at 2 minutes
and placed at approximately 2.degree. C. The ribonucleotide mixture
was incubated for 30 minutes. Seven microliters of the assay
mixture were spotted onto DE81 filter circles (Whatmann) and dried
prior to being washed three times in 2.times.SSC (0.3M NaCl, 0.03M
sodium citrate) for five minutes each wash. The filters were rinsed
twice in ethanol and allowed to dry before being quantified with a
scintillation counter.
[0342] Background counts per minute (CPM) for the
deoxyribonucleotide and the ribonucleotide reactions were
subtracted from the respective averaged CPM value of duplicate
samples for each enzyme. The background-corrected ribonucleotide
CPM value was divided by the background-corrected
deoxyribonucleotide CPM value (FIG. 9).
24 Polymerase Ratio NTP/dNTP Relative to JDF-3 550 JDF-3 550
0.000165162 1 JDF-3 L408H 0.041087258 249 JDF-3 L408F 0.051703924
313 JDF-3 A485T 0.007628583 46
[0343] v. Ribonucleotide Sequencing with JDF-3 Polymerase
Mutants.
[0344] Ribonucleotides incorporated into a deoxyribonucleotide
polymer are susceptible to alkali hydrolysis which can produce a
sub-population of polymer lengths. When labeled primer is extended
in the presence of a particular ribonucleotide base (for example
ATP) and the four deoxyribonucleotide bases, the fragments
resulting from alkali hydrolysis create a population of different
lengths, which correspond to all the possible positions where ATP
was incorporated. When those fragments are size separated, their
migration pattern, with respect to other ribonucleotide base (CTP,
UTP and GTP) hydrolysis products allows the template sequence to be
read. As described previously, most DNA polymerases discriminate
against non-conventional deoxynucleotides. A subset of the JDF-3
DNA polymerase mutants which allow improved uptake of the
unconventional dideoxynucleotides also show improved tolerance for
ribonucleotide incorporation.
[0345] 100 ng of the 38 mer primer was kinased with
.alpha.-.sup.33P according to the instructions in the KINACE-IT.TM.
Kinasing Kit (Stratagene catalog #300390).
25 38mer primer: 5' GGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA- GT 3'
[0346] The labeled oligonucleotide was purified from contaminating
free nucleotides with a NUC TRAP.RTM. Probe Purification Column
(Statagene catalog #400701) in 10T.1E (10 mM Tris pH 8.0, 0.1 mM
EDTA). Labeled oligonucleotide (.about.7 picomoles) was annealed to
0.09 pmoles M13 mp18+ by heating to 95.degree. C. then cooling to
room temperature in the presence of 0.32 mM MgCl.sub.2.
26 Extension components 0.054 pM annealed primer/template 200
.mu.Meach dNTP 1x cPfu DNA polymerase buffer (Stratagene catalog
#200532) 4-200 ATP* 0.1-5 Units JDF-3 polymerase* *Added
separately
[0347] Eight microliters of a cocktail containing the first three
components listed above were aliquoted into a 0.2 ml tube. 1 .mu.l
of polymerase and 1 .mu.l of 2 mM, 0.2 mM or 0.4 mM ATP were added
and the reaction was incubated at 72.degree. C. for 15 minutes. The
reaction volume was brought to 100 .mu.l with 1.times. cPfu
polymerase buffer and transferred to a 1.5 ml tube. After heating
the reactions in the presence of 70 mM NaOH for 15 minutes at
100.degree. C., the reaction was neutralized with 70 mM HCl and
precipitated through the addition of 10 .mu.l 3M sodium acetate and
327.5 .mu.l of ethanol. The samples were microcentrifuged for 30
minutes at 14 krpm before the supernatant was removed and the
pellet washed in 80% ethanol. After vacuum drying, the samples were
resuspended in 5 .mu.l of sequencing stop solution (95% formamide,
20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF) and 2.5
.mu.l was loaded on a 6% acylamide-7M urea, 1.times.TBE
CASTAWAY.TM. Precast gel (Stratagene catalog numbers 401090 and
401094). The gels were run at 50 watts until the bromophenol blue
dye migrated past the bottom of the gel after which the gel was
fixed, dried and exposed to film for 72 hours.
[0348] Sequencing ladders for JDF-3 550 (wild-type nucleotide
incorporation) and all the mutants tested were visible at the 200
.mu.M and 20 .mu.M ATP level. At the 4 .mu.M level, only the L408H
and L408F mutants produced ladders (data not shown).
[0349] vi. Sequencing with Dye-Dideoxynucleotide Terminators
[0350] Primer was extended in the presence of FAM ddCTP
(NENNEL481). The sequence reactions were purified and run on an ABI
370.
[0351] Reaction conditions for cycle-sequencing were as described
below:
[0352] 1.times. cPFU buffer, 200 ng pBluescript II KS plasmid, 3
pmole T7 primer, 0.23 mM dCTP, 0.23 mM dATP, 0.23 mM dTTP, 0.23 mM
dGTP with 0.046 mM FAM ddCTP. The samples were cycled in a
Perkin-Elmer cycler in 10 .mu.l volumes for 25 cycles of the
temperatures and times described below:
27 95.degree. C. 30 s 55.degree. C. 30 s 72.degree. C. 2 min
[0353] The samples were purified using CentriSep columns according
to the manufacturer's instructions. After drying, the samples were
resuspended in 3 .mu.l of a loading dye comprised of 66.7%
deionized formamide, 16.7 mg/ml Blue Dextran, and 8.3 mM EDTA.
Samples were heated at 95.degree. C. for three minutes and loaded
on a 5% LongRangen gel in an ABI PRISM 377 DNA sequencer.
[0354] Data was processed in Gene Scan 2.1.
Example 2
[0355] Labeling of DNA.
[0356] The modified DNA polymerases of the invention are applicable
to labeling of DNA. It is known to those skilled in the art that
there are several means by which to label DNA, including the
incorporation of radiolabeled nucleotides. One such common means is
by random priming, which enables one of skill in the art to
generate labeled DNA fragments, typically about 50 to about 1000
bases long. The procedure described herein are adapted from F.
Ausubel et al., Short Protocols in Molecular Biology, Third
Edition, John Wiley and Sons, Inc., 1995.
[0357] As a first step toward random priming DNA, a reaction mix
containing 2.5 microliters 0.5 mM 3dNTP (dCTP, dGTP, TTP, each at
0.5 mM), 50 .mu.Ci [--.sup.32P]dATP, 1 microliter of 3 to 8
units/microliter DNA polymerase in 50 mM Tris-HCl, pH 7.5, 10 mM
MgCl.sub.2, 1 mM dithiothreitol, 0.05 mg/ml bovine serum albumin is
prepared in a total volume of 11 microliters and incubated on ice.
Next, about 30 to about 100 ng of DNA is mixed with about with 1 to
5 gg of random hexanucleotides in 14 microliters and boiled for 2
to 3 minutes and then placed on ice. The 11 microliter reaction mix
is then added to the DNA/random hexamer mix, and the random priming
reaction is incubated over 10 minutes to as much as 4 hours at room
temperature. To stop the reaction, 1 microliter 0.5 M EDTA, 3
microliters 10 mg/ml tRNA, and 100 microliters 10 mM Tris-HCl, pH
7.4 is added and the mixture is extracted with phenol. The labeled
DNA is then separated from unincorporated radioactive precursors by
chromatography.
[0358] R. Gel Assay for Dye-Dideoxynucleotide Incorporation.
[0359] A labeled oligonucleotide duplex was extended with a mixture
of dideoxynucleotides and dye-dideoxynucleotides. When the duplex
was separated on a denaturing 20% Acrylamide/7 M urea gel, labeled
oligonucleotides terminated with a dideoxynucleotide could be
resolved from oligonucleotides terminated with
dye-deoxynucleotides.
28 Oligonucleotides: 259C .sup.32P-TAACGTTGGGGGGGGGCA.fw- darw.
258C TGCAACCCCCCCCCGTAT
[0360] The 5' end of 259C was labeled and purified as described in
Section Q.ii.a except that .sup.32P.gamma.-ATP was used. The
labeled oligonucleotide 259C was at a concentration of
approximately 0.7 ng/.mu.l. The complimentary oligonucleotide
(258C) was added as an equal concentration, heated to 95.degree. C.
for three minutes, 50.degree. C. for 5 minutes and room temperature
for 20 minutes. Heat killed lysates of the relevant mutants were
prepared as described in Example section C. The reactions were
incubated in a 5 .mu.l volume composed of 30 mM Tris pH 8.0 and 3
mM MgCl.sub.2 with a nucleotide mixture totaling 0.1 mM. The ratio
of ddTTP to FLU ddUTP or ROXddUTP was 10:1. The dimer was present
at a concentration of 1.2 picomoles and 0.5 .mu.l of enzyme or
crude lysate or purified enzyme was added to the reaction before
incubation at 50.degree. C. in the RobeCycler.RTM. Gradient 96
Temperature Cycler with Hot Top. The samples were incubated for 20
s before 3 .mu.l of a formamide based loading dye was added and the
samples were heat-denatured at 95.degree. C. for 3 minutes then
loaded onto a 20% acrylamide/7 M urea gel and subjected to
electrophoresis at a constant 60 watts. The gel was exposed to
X-ray film and the film was analyzed in the EagleEye.RTM. Eagle
Sight software package.
Example 3
[0361] The modified DNA polymerases of the invention are also
applicable to identify a nucleotide at a given position of a
template DNA molecule, i.e., by mini-sequencing. For example, the
JDF-3 DNA polymerase P410L/A485T mutant (JDF-3
D141A/E143A/P410L/A485T) generates the longest and most uniform
radioactive DNA sequencing ladders using low ddNTP/dNTP ratios
(1/100), indicating efficient ddNTP incorporation, minimal base
selectivity, and high polymerase activity. This example describe
the properties of this JDF-3 DNA polymerase P410L/A485T mutant and
a procedure for optimizing the conditions for mini-sequencing using
the mutant polymerase.
[0362] A. Experimental Prptocol
[0363] i. Materials
[0364] StrataPrep PCR columns, StrataPrep DNA gel extraction
columns, cold ddNTPs, calf alkaline phosphatase and pBluescript II
were from Stratagene. Rhodamine labeled-ddNTPs were purchased from
NEN. EDTA/blue dextran, rhodamine dye-matrix standards, and the
SNaPshot ddNTP primer extension kit were purchased from Applied
Biosystems. ThermoSequenase (Taq F667Y mutant) was from Amersham
Pharmacia Biotech. Long Ranger polyacrylamide gels (6%) were
purchased from BMA. Shrimp alkaline phosphatase and exonuclease I
were from USB corporation. CENTRI-SEP spin columns were purchased
from Princeton Separations. Deionized formamide was from Sigma.
Oligonucleotides (PAGE purified) whose sequences are listed in
Table VII, were purchased from Genset oligos. All other reagents
were molecular biology grade.
[0365] ii. Primer:Template Formation:
[0366] Duplex primer template pairs were formed by annealing the
template with 10 fold excess of the appropriate primer in a
solution containing 10 mM Tris-HCl (pH 8) and 0.1 mM EDTA using the
following temperature regimen: 5 min at 95.degree. C. and then cool
slowly to room temperature. Concentrations of the primer:templates
are expressed as moles of single stranded templates.
[0367] iii. Product Analysis:
[0368] The dye labeled products were resolved on 6%
polyacrylamide/urea gels and visualized on a Applied Biosystems
model 377 DNA sequencer using 3.1.2 GeneScan fragment analysis
software for peak identification and fluorescence measurements. A
rhodamine dye-matrix was installed on the ABI 377 sequencer
according to the manufacturer's protocol.
29TABLE VII Synthetic oligonucleotides Temp-A
5'-CTCAACTTGGAGCGAACGACCTACACCGAA Temp-T
5'-CTCATCTTGGAGCGAACGACCTACACCGAA Temp-G
5'-CTCAGCTTGGAGCGAACGACCTACACCGAA Temp-C
5'-CTCACCTTGGAGCGAACGACCTACACCGAA *pBL-
5'-TTCGGTGTAGGTCGTTCGCTCCAAG 25C *pBL-
5'-AAGTGTAAAGCCTGGGGTGCCTAATGAG 28T *pBL-
5'-TTCAGCATCTTTTACTTTCACCAGCGTTTCT 31G *pBL-
5'-AGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT 34A *pPC-
5'-CGGTACCTCCTGGTGGATACACTGGTTCCTGTAAGCAGAAG 41T *pPC-
5'-GAGAGCTTGAGGAGAGCAGGAAAGGT 26G *pPC-
5'-GATCTCCCAGGGCGGCAGTAAGTCTTCAGCATCAGGC 37A *pPC-
5'-TCCTTTGGACAGGGATGAGGAATAACTGA 29C *The numbers indicate the
length of the primer before extension by one ddNTP and the
succeeding letters show the ddNTP that is incorporated.
[0369] iv. Purification and Optimal Reaction Buffer of JDF-3
P410L/A485T DNA Polymerase:
[0370] JDF-3 P410L/A485T was expressed in XL-10 Gold and purified
as described in the "Purification of JDF-3 P410L/A485T mutant"
Product Transfer Document by Brad Scott. One unit of enzyme is
defined as the amount that will catalyze the incorporation of 10
nmol of total nucleotide into acid insoluble form in 30 minutes at
72.degree. C. The 10.times. reaction buffer for JDF-3 P410L/A485T
contains: 200 mM Tris-HCl (pH 8.8), 100 mM KCl, 100 mM
(NH4).sub.2SO.sub.4, 20 mM MgSO.sub.4.
[0371] v. Enzyme Assays:
[0372] a. Kinetic Analysis of Rhodamine Labeled-ddNTP Incorporation
and Misincorporation:
[0373] K.sub.m and V.sub.max values for rhodamine labeled-ddNTP
incorporation were measured by incubating 50 nM primer: template
with limiting amounts of polymerase (0.1 units or 5 nM) and varying
concentrations of rhodamine labeled-ddNTP ranging from 0.1 nM to
500 nM. Samples were incubated at 60.degree. C. for 10 minutes. The
reactions were then quenched with ice-cold 0.2 M EDTA (final
concentration). Unincorporated rhodamine labeled ddNTPs were
removed by purifying the extended primer:templates on CENTRI-SEP
spin columns. Reactions were then dried, and the pellets dissolved
in 3:1 formamide:EDTA/blue dextran and analyzed by 6% denaturing
PAGE on an ABI 377 sequencer. All peak area quantitations were
performed using 3.1.2 GeneScan software and K.sub.m and V.sub.max
values were calculated using Lineweaver-Burk plots.
[0374] K.sub.m and V.sub.max values for primer:template were
measured with limiting amounts of enzyme (0.1 units or 5 nM) in the
presence of 100 nM of R110-ddGTP and varying concentrations of
primer:template (pBL31G:pBluescript II) ranging from 0.5 to 100 nM.
Samples were incubated for 10 minutes at 60.degree. C. The
reactions were then quenched, purified from unincorporated
rhodamine labeled-ddNTPs, and analyzed as described above.
[0375] To determine the kinetics of misinsertion, the steady state
Michaelis-Menten K.sub.m and V.sub.max parameters were calculated
by incubations of limiting amounts of enzyme (0.1 units or 5 nM) in
presence of 50 nM primer:template and varying concentrations of
non-complementary rhodamine labeled ddNTP (1 nM to 10,000 nM) for
10 minutes at 60.degree. C. Analysis and quantitations were
performed as above.
[0376] b. Screen for Fidelity:
[0377] Reactions (10 .mu.l) contained 1 unit of enzyme in 1.times.
reaction buffer, 15 nM primer template, 25 nM of unlabeled
complementary ddNTP, and 25, 100, 500, or 1000 nM of rhodamine
labeled non-complementary ddNTP in four separate reactions. The
reactions were incubated in a Perkin-Elmer 9600 for 25 cycles as
follows: 96.degree. C. for 10 s, 50.degree. C. for 5 s, and
60.degree. C. for 30 s. The reactions were then quenched with
ice-cold 0.2 M EDTA (final concentration) and the products were
purified from unincorporated rhodamine labeled ddNTPs and analyzed
as described above.
[0378] c. Assays for Rhodamine Labeled ddNTP Incorporation:
[0379] These experiments were performed using 1 unit of enzyme, 15
nM primer:template (pBL25C and Temp-A, Temp-T, Temp-C, or Temp-G in
four separate reactions), and 50 nM dye-ddNTP (TAMRA- or
R110-labeled). The reactions were incubated at 60.degree. C. for 10
minutes and then quenched with ice-cold 0.2 M EDTA (final
concentration). The products were purified from unincorporated
dye-labeled ddNTPs and analyzed as described above.
[0380] B. Optimization Procedures:
[0381] i. Preparation of DNA Templates for Minisequencing:
[0382] Fragments containing the SNP(s) of interest are amplified
from genomic DNA using standard PCR conditions. In this study, PCR
reactions were carried out using 2.5 units of TaqPlus Precision DNA
polymerase blend. A 4 kb fragment of the human alpha-1-antitrypsin
gene was amplified from 100 ng human genomic DNA using 10 pmol of
the pPC26G and pPC29C primers (Table VII). The following program
was used in a Robocycler: 1 cycle of 95.degree. C. for 2 min, 30
cycles of 95.degree. C. for 1 min, 58.degree. C. for 1 min, and
72.degree. C. for 4 min, followed by one cycle at 72.degree. for 7
min.
[0383] In order to purify the resulting 4 kb fragment from PCR
primers and unincorporated dNTPs, the fragment can be: (1) purified
using the StrataPrep DNA gel extraction kit; (2) treated with
exoI/SAP; or (3) incubated on StrataPrep columns with SAP or CIAP.
To treat the PCR fragment with exoI/SAP, 2 units of each enzyme was
added to 4 .mu.l of PCR product, and the mixture was incubated for
1 hour at 37.degree. C., followed by 15 minutes at 72.degree. C. to
inactivate the enzymes. To purify the PCR amplified fragment using
StrataPrep columns, a 50 .mu.l PCR reaction was loaded on a
StrataPrep column and processed as described in the StrataPrep
column manual, except that before elution, 1 unit of CIAP in 50
.mu.l 1.times. corresponding reaction buffer was added to the
column. The column was incubated at room temperature for 5 minutes,
washed, and the PCR fragment was eluted as described in the manual.
The eluate was incubated at 72.degree. C. for 15 minutes to
inactivate any remaining CIAP. All of these clean up methods
produced DNA templates that were pure enough for subsequent
minisequencing.
[0384] ii. Minisequencing Protocol using Plasmids or PCR Amplified
Fragments:
[0385] Minisequencing of pBluescript (0.25 pmol) was carried out
using 0.15 pmol of each primer (e.g. pBL25C), 1 unit enzyme, 0.04
.mu.M of R6G-ddA, R110-ddG, and ROX-ddC, and 0.2 .mu.M of
TAMRA-ddU. When using PCR amplified fragments, template
concentrations as low as 0.02 pmol/rxn were used. All reactions
were performed in 10 .mu.l volumes. The thermal cycling program
consisted of 25 cycles of 96.degree. C. for 10 s, 50.degree. C. for
5 s, and 60.degree. C. for 30 s in a Perkin-Elmer 9600 or 25 cycles
of 96.degree. C. for 50 s, 50.degree. C. for 50 s, and 60.degree.
C. for 50 s in a Robocycler.
[0386] In order to purify the labeled primers from unincorporated
dye-ddNTPs, samples were either treated with SAP or CIAP, or
purified using CENTRI-SEP columns according to manufacturers's
recommendations. 1 unit of CIAP or 0.5 unit of SAP was added to
each 10 .mu.l reaction and incubated at 37.degree. C. for 60 min,
followed by 15 minutes at 72.degree. C. to inactivate alkaline
phosphatase. Reactions were then dried and pellets were dissolved
in 10 .mu.l of 3:1 formamide:EDTA/blue dextran. 1 .mu.l of each
reaction was resolved by 6% denaturing PAGE on an ABI 377 sequencer
and analyzed using GeneScan 3.1.2 (Applied Biosystems).
[0387] C. Results
[0388] i. Buffer and Reaction Temperature Optimizations:
[0389] Since Thermococcus sp. JDF-3 DNA polymerase is closely
related to archaeal P. furiosus DNA polymerase (Pfu), cloned Pfu
buffer (10.times. buffer: 200 mM Tris-HCl (pH 8.8), 100 mM KCl, 100
mM (NH4).sub.2SO.sub.4, 20 mM MgSO.sub.4, 1% Triton X100, and 1
mg/ml BSA) was used as a starting point for buffer optimization.
Changes in enzyme activity due to buffer and reaction temperature
alterations were determined by measuring R6G-ddATP incorporation
using the pBL34A:pBluescript primer:template system. The presence
of Triton X-100 and BSA in this buffer was found to create an
artifact (double band effect) in sequencing gels (data not shown).
Enzyme activity was measured at pH 8.4 and 9.5, in the presence of
varying concentrations of KCl (20, 40 or 80 mM),
(NH.sub.4).sub.2SO.sub.4 (5 or 20 mM), and MgSO.sub.4 (4 or 8 mM),
respectively. None of these changes had a noticable effect on the
activity of JDF-3 P410L/A485T. Therefore, cloned Pfu buffer lacking
BSA and Triton was identified as the optimal reaction buffer for
minisequencing. Furthermnore, the activity vs. temperature profile
of JDF-3 P410L/A485T showed that nucleotide incorporation did not
increase significantly between 60.degree. C. and 72.degree. C.
(data not shown). To keep the extension temperature below the
melting temperatures of minisequencing primers, all subsequent
experiments were performed at 60.degree. C.
[0390] ii. Incorporation of Rhodamine-Dideoxyribonucleotides:
[0391] Relative incorporation of rhodamine labeled-ddNTPs by the
JDF-3 P410L/A485T and Taq F667Y mutants was determined. We used
both TAMRA- and R 110-labeled ddNTPs, and the amount of
incorporated dye-ddNTPs was measured in fluorescense units. These
experiments were performed using pBL25C as the primer, and Temp-A,
Temp-T, Temp-C, or Temp-G as the complementary template in four
separate reactions. The only difference between these four
primer:template systems is the SNP site, thereby eliminating the
possibility that primer:template sequence has an effect on
dye-ddNTP incorporation. FIG. 16 panel B shows that JDF-3
P410L/A485T incorporates TAMRA-ddGTP and TAMRA-ddCTP slightly more
efficiently compared to TAMRA-ddATP and TAMRA-ddUTP. ddCTP and
ddGTP are also incorporated more efficiently than ddATP and ddUTP
when R110 labeled ddNTPs are employed (FIG. 16 panel A). Gardner
and Jack had also observed variation in the incorporation of
ribonucleotides by the A488L mutant (equivalent to JDF-3 A485) of
Vent DNA polymerase (from archaeon Thermococcus litoralis).sup.15.
In fact, the Vent A488L mutant incorporated UMP .about.10 fold less
efficiently than CMP, GMP, and AMP, and the wild type Vent DNA
polymerase showed similar bias against dUMP incorporation.
[0392] We performed similar rhodamine labeled-ddNTP incorporation
experiments using the same number of units of Taq F667Y. As panels
A and B in FIG. 16 indicate, the JDF-3 P410L/A485T and Taq F667Y
mutants exhibit similar TAMRA- and R110-ddNTP incorporation
efficiencies and limited (<3-fold) base selectivity, with the
preference order of: G>C>A>T.
[0393] iii. Kinetic Parameters for Polymerization Reaction:
[0394] K.sub.m and V.sub.max values for primer:template and
rhodamine-ddNTPs were determined as described in the Experimental
Protocol. These values are reported in Table VIII, which compares
the kinetic properties of JDF-3 P410L/A485T and Taq F667Y. This
comparison establishes that the JDF-3 P410L/A485T and Taq F667
mutants exhibit similar steady-state kinetic parameters, and
therefore, have similar affinities for both primer:template and
rhodamine-ddNTP substrates.
[0395] Furthermore, kinetic parameters in Table VIII were used to
determine incorporation efficiency of TAMRA-ddCTP
(V.sub.max/K.sub.m=3.3/- 1=3.3) in comparison to TAMRA-ddATP
(V.sub.max/K.sub.m=1.9/0.9=2.1). Incorporation efficiency of
TAMRA-ddCTP is 1.5 fold more than TAMRA-ddATP, suggesting that
JDF-3 P410L/A485T mutant incorporates different ddNTPs at slightly
different rates, confirming the results obtained in FIG. 16.
30TABLE VIII Steady-state kinetic parameters.sup.a for rhodamine
labeled ddNTPs and primer:template. JDF-3 P410L/ ThermoSeq. A485T
mutant (Taq F667Y mutant) Substrate K.sub.m(nM) V.sub.max(fmol/min)
K.sub.m(nM) V.sub.max(fmol/min) Primer:template.sup.d 10 7.4 8 7.4
R6G-ddATP.sup.c 0.33 6 0.35 9 TAMRA-ddATP.sup.c 0.9 1.9 0.6 1.9
TAMRA-ddCTP.sup.b 1 3.3 0.3 2.3 .sup.aAll values have .+-.<30%
error and are obtained from at least two independent experiments.
.sup.bpBL25C:pBluescript .sup.cpBL34A:pBluescript
.sup.dpBL31G:pBluescript
[0396] iii. Fidelity:
[0397] Fidelity was determined as the tendency of a DNA polymerase
to incorporate the correct nucleotide in the presence of increasing
amounts of a non-complementary nucleotide. These assays employed
constant amounts of primer:template, an unlabeled complementary
ddNTP and DNA polymerase, and various concentrations of a
rhodamine-labeled non-complementary ddNTP, as described in the
Experimental Protocol. The amount of misextended primers is plotted
against the ratio of rhodamine-labeled incorrect ddNTP/unlabeled
correct ddNTP (FIG. 18 panels A and B). We performed similar assays
for all possible mispairs (Table IX).
31TABLE IX All possible mispairs. .sup. ddG:dT ddT:dC ddC:dA ddA:dG
ddT:dT ddC:dC ddA:dA ddG:dG
[0398] The two mispairs indicated in bold are formed more
efficiently by Taq F667Y DNA polymerase compared to JDF-3
P410L/A485T mutant.
[0399] The two mispairs, ddT:dC and ddG:dT, are formed at a
significantly higher frequency (3 or 20 fold) by Taq F667Y mutants
(ThermoSequenase and AmpliTaq FS) compared to JDF-3 P410L/A485T
(FIG. 18 panels A and B). The other mispairs are formed less
frequently and at a similar rate for JDF-3 P410L/A485T and Taq
F667Y.
[0400] Similar rates of ddG:dT mispair formation were obtained
using AmpliTaqFS (Taq F667Y mutant; ABI). AmpliTaqFS is only
available in a mixture containing dye-ddNTPs and reaction buffer
(SNaPshot kit; ABI). In order to test AmpliTaqFS, we removed
dye-ddNTPs by adding 0.5 unit of SAP to 5 .mu.l of the SnaPshot kit
mix, followed by incubations at 37.degree. C. for 30 minutes and at
72.degree. C. for 15 minutes. The resulting mix, free of
dye-ddNTPs, was then used in fidelity assays.
[0401] In order to establish that this difference in fidelity is
not sequence specific, we performed similar experiments with two
other primer:template systems (pBL25C:Temp-T and pPC34A:4 kb PCR
amplified fragment) and obtained similar misincorporation rates for
both enzymes (data not shown). We also obtained similar
misincorporation rates using TAMRA-labeled ddNTPs as the incorrect
ddNTP (data not shown). Therefore, the lower fidelity exhibited by
Taq F667Y DNA polymerase is neither sequence specific nor due to
increased misincorporation of R110 dyes.
[0402] To gain more insight into the mechanism of lower fidelity,
we determined the misinsertion frequency for the mispair ddG:dT,
which was evaluated in terms of relative K.sub.m and V.sub.max
values for the wrong versus correct dye-ddNTP. Efficiency of
nucleotide misinsertion was determined opposite a DNA template dT,
primed with a 34-nucleotide oligomer (pBL34A). Apparent Michaelis
constant (K.sub.m) and maximum velocity (V.sub.max) and relative
insertion frequencies were measured for ddATP and ddGTP (Table
X).
32TABLE X Kinetic Parameters.sup.a of TAMRA-ddATP insertion versus
TAMRA-ddGTP misinsertion. I.E..sup.b M.E..sup.b M.F..sup.b DNA
polymerase (V.sub.max/K.sub.m) (V.sub.max/K.sub.m) (M.E./I.E.)
JDF-3 1.9/0.9 = 2.1 4.7/700 = 0.0067 0.003 P410L/A485T
ThermoSequenase 1.9/0.6 = 3.2 16.9/100 = 0.169 0.053 (Taq F667Y)
.sup.aAll values have .+-.<30% error and are obtained from 3
independent experiments. .sup.bI.E., M.E. and M.F. are insertion
efficiency, misinsertion efficiency and misinsertion frequency,
respectively.
[0403] As shown in Table X, the misinsertion frequency of Taq F667Y
for ddG:dT is significantly (.about.17 fold) higher than that
exhibited by JDF-3 P410L/A485T. This difference is mostly due to
differences in K.sub.m for the wrong
dye-ddNTP.multidot.primer:template ternary complex. The Taq F667Y
mutant exhibits a 7-fold lower K.sub.m (higher binding affinity)
for wrong nucleotide (ddGTP) opposite dT, compared to the JDF-3
P410L/A485T mutant.
[0404] iv. Development of a Minisequencing Kit:
[0405] There are five major steps involved in SNP detection by
minisequencing and gel electrophoresis: (i) extraction of DNA from
blood or tissue samples; (ii) PCR amplification of specific
fragments of genomic DNA containing SNPs; (iii) treatment of PCR
products prior to minisequencing to remove unreacted PCR primers
and dNTPs; (iv) minisequencing of PCR products and purification of
extended primers; (v) analysis of fluorescent labeled primers using
gel electrophoresis and GeneScan software (ABI). Here, we have
optimized steps (iii) and (iv), and developed a minisequencing kit
containing enzyme, reaction buffer, rhodamine labeled-ddNTPs, and a
control primer:template system.
[0406] To optimize step iii, we used three different approaches to
purify PCR products from unreacted PCR primers and dNTPs prior to
minisequencing as described in the Experimental Protocol. We found
that DNA templates purified using StrataPrep columns without CIAP
treatment were contaminated with enough residual dNTPs to interfere
with subsequent minisequencing. In the presence of trace amounts of
contaminating dNTPs, sequencing ladders were produced instead of a
single extended primer (FIG. 18, lane 2). The same problem was also
observed using Qiagen's QIAquick PCR purification columns (data not
shown). However, adding CIA' directly to PCR products, bound to
StrataPrep columns, effectively removed residual dNTPs, and the
eluted DNA after heat treatment (15 minutes at 72.degree. C.) was
suitable for minisequencing applications (FIG. 18, lane 1).
[0407] Three different primer:template systems were used to
optimize the JDF-3 P410L/A485T minisequencing kit, including
pBluescript with primers pBL34A, pBL31G, pBL28T, and pBL25C (Table
VII) which will be used as the kit controls (FIG. 22); a 4 kb PCR
fragment with primers pPC37A, pPC41T, pPC26G, and pPC29C; and pGEM
with four control primers (ABI #4312166 ) (FIG. 19). Our kit
protocol employs four rhodamine-labeled ddNTPs in one reaction (see
Experimental Protocol section), although it could be adapted in the
future for customers interested in performing four separate
reactions, each with a different rhodamine labeled-ddNTP (plus
three unlabeled ddNTPs).
[0408] The concentrations of JDF-3 P410L/A485T, dye-ddNTPs, primer,
and template were optimized for minisequencing and fluorescence
detection by ABI 377 sequencer (see Experimental protocol for
optimized conditions). Higher concentrations of enzyme, dye-ddNTPs,
and primer:template will increase the fluorescent signal. However,
such increases in signal saturate the ABI 377 detector and result
in dye bleed-through (more than one color showing in one spot).
[0409] Different rhodamine dye/ddNTP combinations can be used with
JDF-3 P410L/A485T (FIG. 20; TAM-ddG and R110-ddU instead of R
110-ddG and TAM-ddUTP). However, the dye/base combination proposed
in the Experimental Protocol (R6G-ddATP, R110-ddGTP, ROX-ddCTP, and
TAMRA-ddUTP) exihibited the greatest signal uniformity with three
different sets of primer:templates. Since JDF-3 P410L/A485T
slightly discriminates against incorporation of ddUTP (FIG. 16
panels A and B), ddUTP is used at 5 times the concentration of
other ddNTPs. Moreover, preliminary data shows that JDF-3
P410L/A485T can incorporate dyes other than rhodamine (e.g.,
cyanine dyes). It is imperative to point out that primer:template
sequence could also affect the efficiency of dye-ddNTP
incorporation and therefore the signal uniformity.
[0410] .beta.-testing of JDF-3 P410L/A485T at Stanford genome
technology center was performed using Cy3-ddATP and Cy5-ddCTP, and
immobolized primers on Zyomyx aldehyde slides.
[0411] The following protocol (Applied Biosystems) should be used
in designing primers for minisequencing: (1) Since SNP validation
by minisequencing is not flexible with respect to the location of
the primer, the negative strand (-) of DNA can be used for primer
design if positive strand (+) is difficult to assay; (2) Design
primers of 18 nucleotides in length or greater with melting
temperatures of 45.degree. C. or greater; (3) Check primers for
extendable hairpin structures and primer dimer formation; (4)
Primers should be PAGE purified; (5) A negative control (lacking
DNA template) should be run when evaluating a new primer.
[0412] We also tested whether JDF-3 P410L/A485 could be used for
multiplexing (several primers with one template in a single
reaction) without the signal strength being affected. FIG. 20
indicates that the signal strength remained unaltered when four
primers were used to detect four SNPs in the same template DNA. It
should be pointed out that we did not optimize the kit for
multiplexing, but this application may be further developed in
future generations of the kit.
[0413] We then determined the amount of SAP or CIAP that can be
used to purify minisequencing products from unincorporated
rhodamine labeled-ddNTPs. 0.5 unit of SAP or 1 unit of CIAP in 10
.mu.l minisequencing reactions degrades all unincorporated
dye-ddNTPs. Using suboptimal units of alkaline phosphatase could
result in fluorescent signal from unincorporated dye-ddNTPs,
thereby masking the SNP signal.
[0414] In optimizing the kit cycling conditions, we evaluated
whether thermal cycling improved product yield. As FIG. 21
indicates, cycling with extension temperatures of 60.degree. C. or
72.degree. C. did not significantly alter enzyme activity. However,
thermal cycling did improve the minisequencing signal compared to a
single incubation at 60.degree. C. for 10 minutes. The improved
signal is expected when the concentration of DNA template is much
lower than minisequencing primer. However, as FIG. 21 indicates,
even when the minisequencing primer is saturated with DNA template,
thermal cycling seems to improve signal, presumably because the
minisequencing primer competes with the complementary strand of
double-stranded DNA when annealing to the DNA template.
[0415] FIG. 22 shows the performance of our minisequencing kit
compared to ABI's SNaPshot kit. Since our minisequencing kit
employs rhodamine-labeled ddNTPs, a rhodamine dye matrix had to be
installed on the ABI 377 sequencer to analyze product bands. In
contrast, the SNaPshot kit utilizes dichloro-rhodamine labeled
ddNTPs and a dichloro-rhodamine matrix was installed to analyze the
products generated with the SNaPshot kit. As discussed above, our
kit employs ROX-ddC and TAMRA-ddU instead of TAMRA-ddC and ROX-ddU
(SNaPshot dye-ddNTPs) to improve ddU incorporation by JDF-3
P410L/A485T. ABI does not disclose the concentrations of AmpliTaq
FS or dichloro-rhodamine labeled ddNTPs employed in the SNaPshot
reaction mixture, so comparisons were simply carried out using the
same primer:template amounts and each kit's recommended protocol.
As shown in FIG. 22, our kit produces more uniform signals compared
to the SnaPshot kit, which generated relatively low signals for ddC
and ddG compared to ddA and ddU.
Example 4
[0416] This example shows the identification of alternative side
chain substitutions at P410 that improve ddNTP incorporation.
[0417] Methods:
[0418] Mutagenesis. Site directed mutagenesis of JDF-3 DNA
polymerase P410 was carried out using JDF-3 141A/143A/pET plasmid
DNA and the QuikChange Multi Kit (Stratagene). Amino acid P410 was
randomized by incorporating the degenerate primer: 5'
pTTT-CGT-AGT-CTC-TAC-NNX-TCA-ATC-ATA-ATC-ACC (SEQ ID NO: ), where
N=25% each G, C, A, and T and X=50% G and T. Thirty-two clones were
randomly selected and plasmid DNA was prepared. The clones were
sequenced using JDF-3 primer #3 to identify the amino acid
substitution at 410. The following mutants were represented among
the 32 random clones: 2 Met (ATG), 2 His (CAT), 2 Gln (CAG), 3 Gly
(GGT), 1 Leu (CTG), 1 Trp (TGG), 1 Ser (TCT), 1 Thr (ACT), 1 Arg
(CGT), and 1 Ile (ATT).
[0419] Polymerase mutant preparation: Transformants were grown
overnight in 1.5 ml LB plus 100 .mu.g/ml ampicillin. The cells were
collected by centrifugation and the pellets were resuspended in 50
.mu.l of 50 mM Tris (pH 8.0). Lysozyme was added to a final
concentration of 1 .mu.g/ml, and the cells were lysed during a 10
minute incubation at 37.degree. C., followed by 65.degree. C. The
heat-inactivated cell material was removed by centrifugation and
the supernatants were assayed for dNTP and ddNTP incorporation.
[0420] ddNTP Incorporation Assay: Reaction cocktails were prepared
containing 1.times. cloned Pfu buffer, 250 .mu.g/ml activated calf
thymus DNA, 2.5 .mu.M 3H-TTP, and 100 .mu.M TTP. Four reaction
cocktails were prepared with different ddNTP concentrations (0, 20,
40, and 80 .mu.M each ddG, ddC, ddA) as follows:
33 0 20 40 80 dGTP, dCTP, dATP 100 .mu.M 80 .mu.M 60 .mu.M 20 .mu.M
ddGTP, ddCTP, ddATP 0 20 .mu.M 40 .mu.M 80 .mu.M
[0421] JDF-3 mutant extracts were diluted 1:1 in 1.times. cloned
Pfu buffer, and then 10 .mu.l aliquots of each sample were added to
20 .mu.l of each reaction cocktail (0, 20, 40, and 80). The
reactions were incubated at 72.degree. C. for 30 minutes.
Incorporated cpms were determined as described herein. Polymerase
activity was expressed as corrected cpms of 3H-TTP incorporated
into activated calf thymus DNA in 30 minutes in the presence of 100
.mu.M each dNTP ("0"; FIG. 23A). ddNTP incorporation was determined
as percent activity in the presence of 20 .mu.M each ddA, ddG, and
ddC ("20"), as follows: (corrected cpms at 20 .mu.M
ddNTP)/(corrected cpms at 0 .mu.M ddNTP) (FIG. 23B).
[0422] Results:
[0423] Substituting P410 with Leu, Met, Ile, Gly, His, Gln, Trp,
Ser, and Thr produced mutants that retained at least some
detectable DNA polymerase activity. In contrast, replacing P410
with Arg appeared to completely inactivate JDF-3 (FIG. 23).
[0424] The mutants that incorporate ddNTPs more efficiently than
the wild type JDF-3 D141A/E143A enzyme were P410L, P410M, P4101,
and P410G. The P410L mutation was identified, as previously
described herein, by random mutagenesis and plaque lift screening
with 33P-ddNTPs. There was little-to-no improvement in ddNTP
incorporation when P410 was replaced by His, Gln, Trp, Ser, or
Thr.
[0425] In general, replacing P410 with non-polar side chains
(M,G,L,I) improves ddNTP incorporation, while replacing P410 with
polar, uncharged (W, Q, S, T, C) has no affect whereas replacing
P410 with charged polar side chains inactivates the DNA polymerase
(R) or reduces ddNTP incorporation (H).
Example 5
[0426] Generation and Analysis of JDF-3 DNA Polymerase Double
Mutants
[0427] The entire gene encoding JDF-3 DNA polymerase was amplified
using primers 721 and 923 (Table 1) and subjected to random
mutagenesis as described herein. A 3'-5' exonuclease deficient
mutant (E143A) of JDF-3 DNA polymerase was used in these studies to
prevent removal of nucleotide analogs after incorporation. A lambda
phage library of JDF-3 DNA polymerase mutants was screened for
improved incorporation of .alpha..sup.33P-ddNTPs, and the most
active clones were isolated and sequenced. DNA sequence analysis
showed that the most active clones contained either a P410L or
A485T mutation, in addition to other mutations.
[0428] Partially-purified JDF-3 mutants were then analyzed with
respect to relative sensitivity (I.sub.50%) to low levels of each
of the four ddNTPs in a nucleotide incorporation assay employing
dNTPs (.sup.3H-TTP tracer). I.sub.50% values were determined as the
concentration of each ddNTP that inhibits DNA polymerase activity
by 50%. I.sub.50% values for wild type (3'-5' exo.sup.-) JDF-3 DNA
polymerase were 160 .mu.M, 110 .mu.M, and >160 .mu.M for ddA,
ddG, and ddC, respectively (ddT data omitted due to interference
from selective uptake of .sup.3H-TTP tracer in the presence of
ddTTP inhibitor). In comparison, I.sub.50% values for ddA, ddG, and
ddC were 30 .mu.M, 25 .mu.M, and 40 .mu.M for a P410L mutant and 40
.mu.M, 25 .mu.M, and 25 .mu.M for an A485T mutant, respectively.
Therefore, preliminary data indicated that separate mutations at
either P410 or A485 produces a modest (.gtoreq.4- to 6-fold)
reduction in discrimination against all four ddNTPs.
[0429] Since the JDF-3 mutants isolated from the random library
contained mutations other than P410L and A485T, that could affect
activity, stability, or ddNTP incorporation, each mutation was
introduced separately into a 3'-5' exonuclease minus (D141A/E143A)
version of JDF-3 DNA polymerase by site-directed mutagenesis. A
double mutant containing the P410L and A485T mutations was also
constructed. Preliminary testing (I.sub.50% ) of partially purified
mutants confirmed that the P410L and A485T mutations were
responsible for reduced ddNTP discrimination. No improvement in
ddNTP incorporation was observed using other JDF-3 DNA polymerase
point mutants (data not shown).
[0430] Relative Improvement in ddNTP Uptake by P410 and A485
Mutations:
[0431] Single (P410L, A485T) and double (P410/A485T) mutants were
purified (as described in Hansen, C. J. et al. (2001). Compositions
and methods utilizing DNA polymerases; WO 0132887 and relative
improvement in ddNTP incorporation was quantified in dye-primer
sequencing reactions. Relative ddNTP incorporation efficiencies
were determined by comparing sequencing ladders produced at varying
ddNTPs:dNTPs ratios, ranging from 10:1 to 1:25 (FIG. 24). The
ddNTP:dNTP ratios that give an equivalent banding pattern (in terms
of product length, signal strength, and lack of non-specific
termination) were compared between wild type and mutant
enzymes.
[0432] For the JDF-3 P410L/A485T mutant, sequencing ladders
produced at 1:25 ddNTP:dNTP are of similar pattern compared to
those generated with the JDF-3 P410L mutant at 1:5 ddNTP:dNTP and
the JDF-3 A485T mutant at 1:1 ddNTP:dNTP (FIG. 24). Therefore, the
double mutant incorporates ddNTPs 5- and 25-fold more efficiently
than the single P410L and A485T mutants, respectively, indicating
that the combination of mutations produces an additive effect. Wild
type (exo.sup.-) JDF-3 DNA polymerase and the P410L/A485T mutant
produced comparable sequencing patterns at 10:1 and 1:25 ddNTP:dNTP
ratios, respectively, indicating that the double mutant exhibits a
250-fold improvement in ddNTP incorporation compared to wild type.
Moreover, little non-specific termination was observed in ladders
produced with the JDF-3 P410L/A485T mutant. Additional experiments
showed that 3'-5' exo.sup.- Pfu DNA polymerase required a
ddNTP:dNTP ratio of >50:1 to produce comparable sequencing
ladders to exo.sup.- JDF-3 DNA polyrnerase at a 10:1 ddNTP:dNTP
ratio. These results indicate that wild type JDF-3 DNA polymerase
is inherently more efficient at incorporating ddNTPs compared to
Pfu DNA polymerase.
[0433] Kinetic Parameters for Dye-ddNTP Incorporation:
[0434] Vent A488.sup.7 and Pfu A486 mutations (Evans, S. J. et al.
(2000). Nucleic Acids Res. 28, 1059-66) provided moderate
improvements (15- and 150-fold, respectively, relative to wild
type) in ddNTP incorporation compared to the F667Y mutation in Taq
(3000-8000-fold improvement relative to wild type; Tabor, S. et al.
Proc. Natl. Acad. Sci. U S A 92, 6339-43). However, in the absence
of direct side-by-side comparisons, it was difficult to assess
relative affinities of Taq and archaeal DNA polymerase mutants for
ddNTPs. Moreover, the Vent and Pfu studies did not address
potential improvements in dye-labeled ddNTP incorporation, which is
relevant for fluorescent DNA sequencing applications.The kinetic
parameters of the Taq F667Y mutant were therefore compared with
those of the JDF-3 P410L/A485T in single-base extension assays
(FIG. 26 and Table 2).
[0435] K.sub.m and V.sub.max values were determined for
primer:template and rhodamine-ddNTPs as described previously for
dNTPs by Patel, P. H. et al. (2001). J. Biol. Chem. 276, 5044-51.
Incorporation was monitored at 60.degree. C. (.about.T.sub.m of
primers used in primer extension reactions) due to practical
limitations imposed by primer-template stability. Reaction time (10
min.) and enzyme amount (0.0U) were selected to ensure that
reactions were in the linear range over the range of
primer:template and dye-terminator concentrations tested (data not
shown). FIG. 26 (panels A and B) shows the incorporation of R6G-
and TAMRA-ddATP by 0.1 units of JDF-3P410L/A485T and Taq F667Y
mutants, respectively, while Table 2 compares the kinetic
properties of the two enzymes in single-base extension assays.
K.sub.m values for rhodamine-labeled ddNTPs ranged from 0.3 to 1 nM
for the JDF-3 P410L/A485T mutant and from 0.3 to 0.6 nM for the Taq
F667Y mutants, depending on the dye (R6G, TAMRA) or base (ddATP,
ddCTP) tested. This comparison establishes that the JDF-3
P410L/A485T and Taq F667 mutants exhibit similar steady-state
kinetic parameters for both primer:template and rhodamine-ddNTP
substrates.
[0436] Fidelity of ddNTP and Dye-ddNTP Incorporation:
[0437] Archaeal Family B DNA polymerases, such as Pfu and JDF-3,
are known to have higher replication fidelity than non-proofreading
eubacterial DNA polymerases such as Taq due the presence of an
associated 3'-5' exonuclease-dependent proofreading activity
(Cline, J. et al. (1996). Nucleic Acids Res. 24, 3546-51). However,
3'-5' exonuclease minus versions of Pfu and JDF-3 DNA polymerase
exhibit higher error rates than Taq DNA polymerase (Cline, J. et
al. (1996). Nucleic Acids Res. 24, 3546-51), suggesting that
misincorporation and/or mispair extension rates may be higher in
archaeal DNA polyrnerases, but compensated for by the associated
editing function. In addition to exhibiting potentially higher
misincorporation rates, mutations near the active site of exo.sup.-
JDF-3 DNA polymerase (P410L, A485T) could reduce insertion fidelity
with respect to unlabeled and/or dye-labeled ddNTPs.
[0438] To address these concerns, the insertion fidelity of the
JDF-3 P410L/A485T and Taq F667Y mutants was compared. In the first
set of fidelity assays, a constant amount of primer:template, an
unlabeled complementary ddNTP, and increasing concentrations of
R110-labeled non-complementary ddNTP was used (Materials and
Methods). The amount (1U) of JDF3 P410L/A485T and Taq F667Y DNA
polymerases used in these misincorporation assays gave equal rates
of incorporation for correct ddNTPs (data not shown), indicating
that misincorporation of incorrect ddNTPs is due to infidelity. The
amount of misextended primers was determined and plotted against
the ratio of R110-labeled incorrect ddNTP/unlabeled correct ddNTP
(FIG. 27, panels A and B). Similar assays for all 12 possible
mispairs was performed (ddG:dT, ddT:dG, ddT:dC, ddC:dT, ddC:dA,
ddA:dC, ddA:dG, ddG:dA, ddT:dT, ddC:dC, ddA:dA, ddG:dG). Two
mispairs, ddT:dC and ddG:dT, are formed at a significantly higher
frequency (3- and 20-fold, respectively) by Taq F667Y compared to
JDF-3 P410L/A485T (FIG. 27, panels A and B). The other mispairs are
formed less frequently, and at similar rates for the JDF-3
P410L/A485T and Taq F667Y mutants (data not shown).
[0439] In order to establish that this difference in fidelity is
not sequence specific, similar experiments with two other
primer:template systems (pBL25C:Temp-T and pBL25C:Temp-C) were
performed. In both cases, Taq exhibited a significantly greater
tendency to generate ddG:dT and ddT:dC mispairs compared to JDF-3
P410L/A485T (data not shown). Moreover, similar misincorporation
rates using TAMRA-labeled ddNTPs were obtained, instead of
R110-labeled ddNTPs as the incorrect ddNTP (data not shown),
indicating that misinsertion rates are unrelated to selective
misincorporation of R110 dye and/or R110-T/C combinations.
[0440] A second set of fidelity assays was conducted to address the
contribution of rhodamine dye to high ddG:dT and ddT:dC
misinsertion frequency. A fluorescently labeled primer (2.5 nM
pFL35) opposite dT in the template strand was extended, in
reactions containing either correct (ddA) or incorrect (ddG)
unlabeled ddNTPs (at concentrations of 1.25 nM to 10 nM) (FIG. 4
panel A). Similar experiments were performed in which primer
extension occured opposite dC in the template strand, in the
presence of correct (ddG) or incorrect (ddT) unlabeled ddNTPs (FIG.
28 panel B). Incorporation of ddNMP at the 3'-end of the primer was
detected as a shift in primer mobility. The amount (1U) of JDF3
P410L/A485T and Taq F667Y DNA polymerases used in these
misincorporation assays gave equal rates of incorporation for
correct ddNTPs (data not shown), indicating that observed
misincorporation of incorrect ddNTPs can be attributed to
infidelity. As shown previously with R110-labeled ddGTP and ddUTP
(FIG. 27), Taq F667Y exhibits a greater tendency to misincorporate
unlabeled ddG opposite dT, and unlabeled ddT opposite dC, compared
to JDF-3 P410L/A485T (FIG. 28). These results indicate that the
relatively high ddG:dT misinsertion rate (and ddT:dC to a lower
extent) exhibited by Taq F667Y DNA polymerase is unrelated to
selective misincorporation of rhodamine-labeled ddG or ddT, but
rather reflects the enzyme's greater inherent tendency to
misincorporate ddGTP opposite dT and ddT opposite dC.
[0441] In further studies, the misinsertion frequency for the
ddG:dT mispair was determined in terms of relative K.sub.m and
V.sub.max values for incorporation of wrong versus correct
dye-ddNTP. Extension from the pBL34A primer was measured opposite
dT in the template strand. FIG. 25 panels B and C compare the
incorporation of correct (TAMRA-ddA) and incorrect (TAMRA-ddG)
nucleotides by 0.1 units of JDF-3 P410L/A485T and Taq F667Y
mutants, respectively. Apparent Michaelis constant (K.sub.m),
maximum velocity (V.sub.max), and relative insertion frequencies
were measured for TAMRA-ddATP and TAMRA-ddGTP (Table 3). The
misinsertion frequency for the ddGTP:dT mispair is approximately
17-fold higher for the Taq F667Y mutant compared to the JDF-3
P410L/A485T mutant. Differences in ddGTP:dT misinsertion frequency
are attributed primarily to differences in K.sub.m for the wrong
dye-ddNTP (ddGTP).multidot.primer- :template ternary complex.
[0442] Materials and Methods
[0443] Rhodamine labeled-ddNTPs were purchased from NEN. EDTA/blue
dextran and rhodamine dye-matrix standards were purchased from
Applied Biosystems. Thermo Sequenase.TM. was from Amersham
Pharmacia Biotech. Long Ranger.RTM. polyacrylamide gels (6%) were
purchased from BMA. CENTRI-SEP spin columns were from Princeton
Separations. pBluescript.RTM. II was from Stratagene.
Oligonucleotides (PAGE purified) were purchased from Genset oligos
(Table 1). All other reagents were molecular biology grade. The
sequence of Thermococcus JDF-3 DNA polymerase has GenBank accession
no. AX135459].
[0444] Mutagenesis and Purification of JDF-3 DNA Polymerase:
[0445] Random mutations were introduced into a 3'-5' exonuclease
deficient JDF-3 (E143A) DNA polymerase mutant by amplifying the
entire gene (GenBank accession no. AX135459) with primers 721 and
923 (Table 1) using the GeneMorph PCR mutagenesis kit (Stratagene)
or Taq as described in Cadwell, R. C. & Joyce, G. F. (1994) PCR
Methods Appl. 3, S136-40, except that 1.5 mM MgCl.sub.2 was used.
The purified PCR products were ligated into the UNI-ZAP.RTM. XR
vector (Stratagene), and the lambda DNA was packaged with
Gigapak.RTM.III Gold packaging extract and plated on E.coli XL
1-Blue MRF' cells, as recommended by the manufacturer. The mutant
library was screened for clones with enhanced ddNTP incorporation
using the technique of Sagner et al. (1991) Gene 97, 119-23 with
minor modifications. Plaque lifts were incubated in polymerase
assay cocktail containing 125 ng/ml activated calf thymus DNA
(Sigma), 1.29 .mu.Ci/ml .alpha..sup.33PddNTP (Amersham), 10 mM Tris
(pH 8.8), 50 mM KCl, 1.5 mM MgCl.sub.2, and 0.001% gelatin. Plaques
producing the strongest signals were cored, and lambda phage clones
were excised (pBluescript.RTM.II SK.sup.-) using ExAssist.RTM.
Interference-Resistant helper phage (Stratagene), according to the
manufacturer's recommendations. Mutants were sequenced using
primers 3 and 5 (Table 1). Site-directed mutants were constructed
using the QuikChange.TM. Site-Directed Mutagenesis Kit
(Stratagene).
[0446] DNA polymerase mutants were expressed in XL10-Gold.RTM.
ultracompetent cells (Stratagene). Partially-purified protein
samples were prepared by heating (15 minutes @ 72.degree. C.) and
centrifuging (14,000 rpm, 5 minutes) resuspended bacterial cells.
JDF-3 DNA polymerase mutants were purified to >90% homogeneity
as described previously Hansen, et al. (2001) WO 0132887). DNA
polymerase activity was measured as described Hogrefe, H. H. et al.
(2001) In Methods Enzymol. (Adams, M. W. W. & Kelly, R. M.,
eds.), pp. 334, Academic Press, San Diego, where one unit of
polymerase activity is defined as the amount of enzyme that
catalyzes the incorporation of 10 nmoles of total nucleotide into
DE81 filter-bound form in 30 minutes at 72.degree. C.
[0447] I.sub.50% Assays:
[0448] ddNTP incorporation was expressed (I.sub.50% ) as the ddNTP
concentration that reduces dNTP incorporation by 50%. Polymerase
assays were performed with activated calf thymus DNA as described
by Hogrefe, H. H. et al.(2001). (Adams, M. W. W. & Kelly, R.
M., eds.), pp. 334, Academic Press, San Diego, except that each
reaction contained 0-20 .mu.M (mutants) or 160 .mu.M (exo JDF-3) of
one ddNTP (e.g., ddGTP), plus the amount of corresponding dNTP that
gives 200 .mu.M total nucleotide (e.g. [ddGTP]+[dGTP]=200 .mu.M).
The other three dNTPs were present at 200 .mu.M each (e.g., dCTP,
dATP, TTP). Reactions were carried out at 72.degree. C. using DNA
polymerase amounts that exhibited the same unit activity under
standard conditions (Hogrefe, H. H. et al. (2001). In Methods
Enzymol. (Adams, M. W. W. & Kelly, R. M., eds.), pp. 334,
Academic Press, San Diego). I.sub.50% values were extrapolated from
plots of % activity (background-corrected cpms incorporated in the
presence of ddNTP/background-corrected cpms incorporated in the
absence of ddNTPs) vs. ddNTP concentration.
[0449] Sequencing Assays:
[0450] Sequencing reactions (20 .mu.l) consisted of 0.5 pmol
fluorescein-labeled primer pF1-20 (Table 1), 1 pmol pBluescript II,
5 U DNA polymerase, all four dNTPs (each at 50 .mu.M) and varying
concentrations of only one ddNTP in 20 mM Tris pH 8.8, 10 mM
(NH.sub.4).sub.2SO.sub.4, and 2 mM MgSO.sub.4. Reactions were
incubated in a Perkin-Elmer 9600 for 25 cycles as follows:
95.degree. C. for 20 s, 50.degree. C. for 20 s and 72.degree. C.
for 4 min. The reactions were quenched with ice-cold 0.2 M EDTA
(final concentration), dried, and the pellets dissolved in 3:1
formamide:EDTA/blue dextran. Reactions were then analyzed by 6%
denaturing PAGE on an ABI 377 sequencer.
[0451] Kinetic Analysis of Rhodamine-ddNTP Incorporation and
Misincorporation:
[0452] Primer:template duplexes were formed by annealing templates
with a 10-fold excess of primer in 10 mM Tris-HCl (pH 8)/0.1 mM
EDTA using the following temperature regimen: 5 min at 95.degree.
C., followed by slow cooling to room temperature. Primer:template
concentrations are expressed as moles of single-stranded
template.
[0453] K.sub.m and V.sub.max values for rhodamine-ddNTP
incorporation were measured as described Patel, P. H. et al.
(2001). J. Biol. Chem. 276, 5044-51 by incubating 50 nM
primer:template with limiting amounts of DNA polymerase (0.1 units,
5 nM) and varying concentrations of rhodamine labeled-ddNTP (0.1 nM
to 500 nM). All single nucleotide incorporations with R6G-ddATP and
TAMRA-ddATP employed pBL34A:pBluescript II, while reactions with
TAMRA-ddCTP were performed with pBL25C:pBluescript II. The
10.times. reaction buffer used for JDF-3 DNA polymerase contained
200 mM Tris-HCl (pH 8.8), 100 mM KCl, 100 mM (NH4).sub.2SO.sub.4,
and 20 mM MgSO.sub.4, while the 10.times. reaction buffer employed
with the Taq F667Y mutant consisted of 260 mM Tris-HCl (pH 9.5) and
65 mM MgCl.sub.2. Samples were incubated at 60.degree. C. for 10
minutes, and the reactions were quenched with ice-cold 0.2 M EDTA
(final concentration). Unincorporated rhodamine-ddNTPs were removed
with CENTRI-SEP spin columns according to the manufacturer's
manual. Reactions were dried, and the pellets were dissolved in 3:1
formamide:EDTA/blue dextran and analyzed by 6% denaturing PAGE on
an ABI 377 sequencer. Peak area quantitations were performed using
3.1.2 GeneScan.RTM. software and K.sub.m and V.sub.max values were
calculated using Lineweaver-Burk plots.
[0454] K.sub.m and V.sub.max values for primer:template were
measured with limiting amounts of enzyme (0.1 units, 5 nM) in the
presence of 100 nM dye-ddNTP and varying concentrations of
primer:template (0.5-100 nM). Single nucleotide incorporations with
R110-ddGTP employed pBL31G:pBluescript II, while reactions with
ROX-ddCTP were carried out with pBL25C:pBluescript II. Samples were
incubated and analyzed as described above.
[0455] To determine the kinetics of misinsertion, K.sub.m and
V.sub.max values were calculated by incubating limiting amounts of
enzyme (0.1 units, 5 nM) in presence of 50 nM primer:template
(pBL34A:pBluescript II) and varying concentrations of
non-complementary rhodamine-ddGTP (1-10,000 nM) for 10 minutes at
60.degree. C. Analysis and quantitation were performed as
above.
[0456] ddNTP Misincorporation Assays:
[0457] Fidelity assays using labeled ddNTPs (10 .mu.l) contained 1
unit DNA polymerase in 1.times. reaction buffer, 15 nM primer:
template, 25 nM of unlabeled complementary ddNTP, and 25, 100, 500,
or 1000 nM of rhodamine-labeled non-complementary ddNTP in four
separate reactions. The reactions were incubated in a Perkin-Elmer
9600 for 25 cycles as follows: 96.degree. C. for 10 s, 50.degree.
C. for 5 s, and 60.degree. C. for 30 s. The reactions were quenched
and analyzed as above.
[0458] Fidelity assays using unlabeled ddNTPs (10 .mu.l) contained
2.5 nM primer:template (pFL-35:pBluescript), 1 U DNA polymerase,
and 1.times. reaction buffer. Complementary or non-complementary
ddNTP was added to the reaction at concentrations of 0, 1.25, 10,
50, or 100 nM. The reactions were incubated in a Perkin-Elmer 9600
for 25 cycles as follows: 96.degree. C. for 10 s, 50.degree. C. for
5 s, and 60.degree. C. for 30 s, and then analyzed as describe
above.
34TABLE 1 Synthetic oligonucleotides Temp-T
5'-CTCATCTTGGAGCGAACGACCTACACCGAA Temp-C
5'-CTCACCTTGGAGCGAACGACCTACACCGAA *pFL-20
5'-(F1)GGATGTGCTGCAAGGCGATT *pFL-35
5'-(F1)CAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT pBL25C
5'-TTCGGTGTAGGTCGTTCGCTCCAAG pBL31G
5'-TTCAGCATCTTTTACTTTCACCAGCGTTTCT pBL34A
5'-AGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT Primer 3
5'-CCAGCTTTCCAGACTAGTCGGCCAAGGCC Primer 5 5'-AACTCTCGACCCGCTG
Primer 5'-GAGAGAATTCATAATGATAAGGAGGAA- AAAATTATGATC 721
CTTGACGTTGATTAC Primer 5'-TCAGATCTCGAGTCACTTCTTCTTCCCCTTC 923
*pFl-20 and pFL-35 are labeled with fluorescein at their
5'-ends.
[0459]
35TABLE 2 Steady-state kinetic parameters* for rhodamine-tabeled
ddNTPs and primer:template. JDF-3 P410L/A485T Taq F667Y Substrate
K.sub.m(nM) V.sub.max(fmol/min) K.sub.m(nM) V.sub.max(fmol/min)
Primer:template.sup..dagger., .dagger-dbl. 10 7.4 8 7.4
R6G-ddATP.dagger-dbl. 0.33 6 0.35 9 TAMRA-ddATP.sup..dagger-dbl.
0.9 1.9 0.6 1.9 TAMRA-ddCTP.sup..dagger-dbl. 1 3.3 0.3 2.3 *All
values have .+-.<30% error and were obtained from three
independent experiments. .sup..dagger.Nmoles of template, in the
presence of 10-fold excess of annealed primer.
.sup..dagger-dbl.Primer:templa- te used for each experiment is
defined in the Materials and Methods section.
[0460]
36TABLE 3 Kinetic Parameters* for TAMRA-ddATP.sup..dagger.
insertion versus TAMRA-ddGTP.sup..dagger. misinsertion.
I.E..sup..dagger-dbl. M.E..sup..dagger-dbl. M.F..sup..dagger-dbl.
DNA polymerase (V.sub.max/K.sub.m) (V.sub.max/K.sub.m) (M.E./I.E.)
JDF-3 P410L/A485T 1.9/0.9 = 2.1 4.7/700 = 0.0067 0.003 Taq F667Y
1.9/0.6 = 3.2 16.9/100 = 0.169 0.053 *All values have .+-.<30%
error and were obtained from 3 independent experiments.
.sup..dagger.Primer:temp- late used for each experiment is defined
in the Materials and Methods section. .sup..dagger-dbl.I.E., M.E.
and M.F. are insertion efficiency, misinsertion efficiency and
misinsertion frequency, respectively.
[0461] References
[0462] 1. Joyce, C. M., Kelley, W. S. and Grindley N. D. F. (1982)
J. Biol. Chem. 257, 1958-1964.
[0463] 2. Lopes, P. Martinez, S., Diaz, A. Espinosa, M. And Lacks,
S.A. (1989) J. Biol. Chem. 264, 4255-4263.
[0464] 3. Lawyer, F. C., Stoffel, S., Saiki, R. K., Myambo, K.
Drummond, R. and Gelfand, D. H. (1989) J. Biol. Chem. 264,
6427-6437.
[0465] 4. Akhmetzjanov, A. A. and Vakhitov, V. A. (1992) Nucl.
Acids Res. 20, 5839.
[0466] 5. Leavitt, M. C. and Ito, J. (1989) Proc. Acad. Sci. U.S.A.
86, 4465-4469.
[0467] 6. Dunn, J. J. and Studier, F. W. (1983) J. Mol. Biol. 166,
477-535.
[0468] 7. Scarlato, V. And Gargano, S. (1992) Gene 118,
109-113.
[0469] 8. Raden, B. And Rutberg, L. (1984) J. Virol. 52, 9-15.
[0470] 9. Foury, F. (1989) J. Biol. Chem. 264, 20552-20560.
[0471] 10. Ito, J. And Braithwaite, D. K. (1990) Nucl. Acids Res.
18, 6716.
[0472] 11. Blanco, L. Bernad, A. And Salas, M. (1991) Nucl. Acids
res. 19,955.
[0473] 12. Hahn, S. And Ruger, W, (1989) Nucl. Acids Res. 17,
6729.
[0474] 13. Hollingsworth, H. C. and Nossal, N. G. (1991) J. Biol.
Chem. 266, 1888-1897.
[0475] 14. Kaliman, A. V., Krutilina, A. I., Kryukov, V, M. and
Bayev, A. A. (1986) FEBS Lett. 195, 61-64.
[0476] 15. Iwasaki, H. Ishino, Y., Toh, H. Nakata, A. and
Shinagawa, H. (1991) Mol. Gen Genet. 226, 24-33.
[0477] 16. Jung, G., Leavitt, M. C., Hsieh, J. -C. and Ito, J.
(1987) Proc. Natl. Acad. Sci. U.S.A. 84, 8287-8291.
[0478] 17. Savilahti, H. And Bamford D. H. (1987) Gene 57,
121-130.
[0479] 18. Yoshikawa, H. And Ito, J. (1982) Gene 17, 323-335.
[0480] 19. Matsumoto, K., Takano, H., Kim, C. I. and Hirokawa, H.
(1989) Gene 84, 247-255.
[0481] 20. Spicer, E. K., Rush, J. Fung, C., Reha-Krantz, L. J.,
Karam, J. D. and Konigsberg, W. H. (1988) J. Biol. Chem. 263,
7478-7486.
[0482] 21. Perler, F. B., Comb, D. G., Jack, W. E., Moran, L. S.,
Qiang, B., Kucera, R. B., Benner, J., Slatko, B. E., Nwankwo, D.
O., Hempstead, S. K., Carlow, C. K. S. and Jannasch, H. (1992)
Proc. Natl. Acad. Sci. USA 89, 5577-5581.
[0483] 22. Mathur, E. J., Adams, M. W., Callen, W. N. and Cline, J.
M. (1991) Nucleic. Acids Res. 19, 6952.
[0484] 23. Pisani, F. W., De Martino, C. and Rossi, M. (1992) Nucl.
Acids Res. 20, 2711-2716.
[0485] 24. Wong S., W. Wahl, A. F., Yuan, P. -M., Arai, N.,
Pearson, B. E., Arai, K, -i., Korn, D., Hunkapiller, M. W. and
Wang, T. S. -F. (1988) EMBO J. 7, 37-47.
[0486] 25. Pizzagalli, A., Valsasnini, P., Plevani, P. and
Lucchini, G. (1988) Porc. Natl.Acad. Sci. U.S.A. 85, 3772-3776.
[0487] 26. Damagnez, V., Tillit, J., deRecondo, A. -M. and
Baldacci, G. (1991) Mol. Gen. Genet. 226, 182-189.
[0488] 27. Hirose, F., Yamaguchi, M. Nishida, Y., Masutani, M.,
Miyazawa, H., Hanaoka, F. and Matsukage, A. (1991) Nucl. Acids Res.
19, 4991-4998.
[0489] 28. Leegwater, P. A. J., Strating, M., Murphy, N. B., Kooy,
R. F., van der Vliet, P. C. and Overdulve, J. P. (1991) Nucl. Acids
Res. 19, 6441-6447.
[0490] 29. Chung, D. W., Zhang, J., Tan C. -K., Davie, E. W., So,
A. G. and Downey, K. M. (1991) Proc. Natl. Acad. Sci. USA 88,
11197-11201.
[0491] 30. Yang, C. -L., Chang, L. S., Zhang, P., Hao, H., Zhu, L.,
Tommey, N.L. and Lee, M. Y. W. T. ( (1992) Nucl. Acids Res. 20,
735-745.
[0492] 31. Zhang, J. Chung, D. W., Tan, C. -K., Downey, K. M.,
Davie, E. W. and So, A. G. (1991) Biochemistry 30, 11742-11750.
[0493] 32. Morrison, A. and Sugino, A. (1992) Nucl. Acids Res. 20,
375.
[0494] 33. Pignde, G., Bouvier, D., deRecondo, A. -M. And Baldacci,
G. (1991) J. Mol. Biol. 222, 209-218.
[0495] 34. Ridley, R. G., White, J. H., McAleese, S. M., Gorman,
M., Alano, P., deVies, E. and Kilbey, B. J. (1991) Nucl. Acids Res.
19, 6731-6736.
[0496] 35. Morrison, A., Araki, H., Clark, A. B., Hamatake, R. K.
and Sugino, A. (1990) Cell 62, 1143-1151.
[0497] 36. Morrison, A., Christensen, R. B., Alley, J., Beck, A.
K., Bemstine, E. G., Lemontt, J. F. and Lawrence, C. W. (1989) J.
Bacteriol. 171, 5659-5667.
[0498] 37. Gibbs, J. S., Chiou, H. C., Hall, J. D., Mount, D. W.,
Retondo, M. J., Weller, S. K. and Coen, D. M. (1985) Proc. Natl.
Acad. Sci. U. S.A. 82, 7969-7973.
[0499] 38. Telford, E. A., Watson, M. S., McBride, K. and Davison,
A. J. (1992) Virology 189, 304-316.
[0500] 39. Davison, A. J. and Scott, J. E. (1986) J. Gen. Virol.
67, 1759-1816.
[0501] 40. Baer, R., Bankier, A. T. Biggin, M. D., Deininger, P.
L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S.,
Satchwell, S. C., Sguin, C., Tuffnell, P. S. and Barrell, B. G.
(1984) Nature 310,207-211.
[0502] 41. Albrecht, J. -C. and Fleckenstein, B. (1990) Virology
174, 533-542.
[0503] 42. Kouzarides, T. Bankier, A. T. , Satchwell, S. C.,
Weston, K., Tomlinson, P. and Barrell, B. G. (1987) J. Virol, 61,
125-133.
[0504] 43. Elliott, R., Clark, C. Jaquish, D. and Spector, D. H.
(1991) Virology nl85, 169-186.
[0505] 44. Teo, I. A., Griffin, B. E. and Jones, M. D. (1991) J.
Virol. 65, 4670-4680.
[0506] 45. Davison, A. J. (1992) Virology 186, 9-14.
[0507] 46. Grabherr, R., Strasser, P. and Van Etten, J. L. (1992)
Virology 188, 721-731.
[0508] 47. Binns, M. M., Stenzler, L. Tomley, F. M., Campbell, J.
and Broursnell, M. E. G. (1987) Nucl. Acids Res. 15, 6563-6573.
[0509] 48. Earl P. L., Jones, E. V. and Moss, B. (1986) Prov. Natl.
Acad. Sci. U. S. A. 83, 3659-3663.
[0510] 49. Mustafa, A. And Yuen, L. (1991) DNA Seq. 2, 39-45.
[0511] 50. Tomalski, M. D., Wu, J. and Miller, L. K. (1988)
Virology 167, 591-600.
[0512] 51. Bjornson, R. M. and Rohrmann, G. F. (1992) J. Gen. Virol
73, 1499-1504.
[0513] 52. Gingeras, T. R., Sciaky, D., Gelinas, R. E., Bing-Dong,
J., Yen, C. E., Kelly, M. M., Bullock, P. A. Parsons, B. L.,
O'Neill. K. E. and Roberts, R. J. (1982) J. Biol. Chem, 257,
13475-13491.
[0514] 53. Engler, J. A., Hoppe, M. S. and van Bree, M. P. (1983)
Gene 21, 145-159.
[0515] 54. Shu, L., Hing, J. S., Wei, Y. -f. and Engler, J. A.,
(1986) Gene 46, 187-195.
[0516] 55. Paillard, M., Sederoff, R. R. and Levings, C. S. III
(1985) EMBRO J. 4, 1125-1128.
[0517] 56. Chan, B. S. -S., Court, D. A., Vierula, P. J. and
Bertrand, H. (1991) Curr. Genet. 20, 225-237.
[0518] 57. Kempken, F., Meinhardt, F. and Esser, K. (1989) Mol.
Gen. Genet, 218, 623-530.
[0519] 58. Oester, B. And Tudzynski, P. (1989) Mol. Gen. Genet.
217, 132-140.
[0520] 59. Court D. A. and Bertrand, H. (1992) Curr. Genet. 22,
385-397.
[0521] 60. Robison, M. M., Royer, J. C. and Horgen, P. A. (1991)
Curr. Genet. 19, 495-502.
[0522] 61. Stark, M. J. R., Mileham, A. J., Romanos, M. A. and
Boyd, A. (1994) Nucl. Acids Res. 12, 6011-6030.
[0523] 62. Tommasino, M. Ricci, S. and Galeotti, C. L. (1988) Nucl.
Acids Res. 16, 5863-5878.
[0524] 63. Hishinuma, F. and Hirai, K. (1991) J. Gen. Genet. 226,
97-106.
[0525] 64. Hopfner, K. P. et al. (1999) Proc. Natl. Acad. Sci.
U.S.A. 96, 3600-3605.
[0526] 65. Niehaus, F. et al. (1997) Gene 204, 153-158.
[0527] 66. Tagaki et al. (1997) Appl. Environ. Microbiol. 63,
4504-4510.
[0528] 67. Datukishvili, N. et al. (1996) Gene 177, 271-273.
[0529] 68. Southworth, M. W. et al. (1996) Proc. Natl. Acad. Sci.
U.S.A. 93, 5281-5285.
[0530] 69. Uemori, T. et al. (1995) J. Bacteriol. 177,
2164-2177.
[0531] 70. Konisky, J. et al. (1994) J. Bacteriol. 176,
6402-6403.
[0532] 71. Zhao (1999) Structure Fold Des. 7, 1189.
[0533] 72. Lai, E., Riley, J., Purvis, I. & Roses, A. A 4-Mb
high-density single nucleotide polymorphism-based map around human
APOE. Genomics 54, 31-8. (1998).
[0534] 73. Saiki, R. K., Walsh, P. S., Levenson, C. H. &
Erlich, H. A. Genetic analysis of amplified DNA with immobilized
sequence-specific oligonucleotide probes. Proc Natl Acad Sci U S A
86, 6230-4. (1989).
[0535] 74. Landegren, U., Kaiser, R., Caskey, C. T. & Hood, L.
DNA diagnostics--molecular techniques and automation. Science 242,
229-37. (1988).
[0536] 75. Shi, M. M. Enabling large-scale pharmacogenetic studies
by high-throughput mutation detection and genotyping technologies.
Clin Chem 47, 164-72. (2001).
[0537] 76. Livak, K. J., Marmaro, J. & Todd, J. A. Towards
fully automated genome-wide polymorphism screening. Nat Genet 9,
341-2. (1995).
[0538] 77. Tyagi, S., Bratu, D. P. & Kramer, F. R. Multicolor
molecular beacons for allele discrimination. Nat Biotechnol 16,
49-53. (1998).
[0539] 78. Gilles, P. N., Wu, D. J., Foster, C. B., Dillon, P. J.
& Chanock, S. J. Single nucleotide polymorphic discrimination
by an electronic dot blot assay on semiconductor microchips. Nat
Biotechnol 17, 365-70. (1999).
[0540] 79. Fu, D. J. et al. Sequencing exons 5 to 8 of the p53 gene
by MALDI-TOF mass spectrometry. Nat Biotechnol 16,381-4.
(1998).
[0541] 80. Chen, X. & Kwok, P. Y. Template-directed
dye-terminator incorporation (TDI) assay: a homogeneous DNA
diagnostic method based on fluorescence resonance energy transfer.
Nucleic Acids Res 25, 347-53. (1997).
[0542] 81. Syvanen, A. C., Aalto-Setala, K., Harju, L., Kontula, K.
& Soderlund, H. A primer-guided nucleotide incorporation assay
in the genotyping of apolipoprotein E. Genomics 8, 684-92.
(1990).
[0543] 82. Taylor, J. D. et al. Flow cytometric platform for
high-throughput single nucleotide polymorphism analysis.
Biotechniques 30, 661-6, 668-9. (2001).
[0544] 83. Chen, X., Zehnbauer, B., Gnirke, A. & Kwok, P. Y.
Fluorescence energy transfer detection as a homogeneous DNA
diagnostic method. Proc Natl Acad Sci U S A 94, 10756-61.
(1997).
[0545] 84. Tabor, S. & Richardson, C. C. A single residue in
DNA polymerases of the Escherichia coli DNA polymerase I family is
critical for distinguishing between deoxy- and
dideoxyribonucleotides. Proc Natl Acad Sci U S A 92, 6339-43.
(1995).
[0546] 85. Gardner, A. F. & Jack, W. E. Determinants of
nucleotide sugar recognition in an archaeon DNA polymerase. Nucleic
Acids Res 27, 2545-53. (1999).
[0547] 86. Evans, S. J. et al. Improving
dideoxynucleotide-triphosphate utilisation by the
hyper-thermophilic DNA polymerase from the archaeon Pyrococcus
furiosus. Nucleic Acids Res 28, 1059-66. (2000).
Other Embodiments
[0548] Other embodiments will be evident to those of skill in the
art. It should be understood that the foregoing detailed
description is provided for clarity only and is merely exemplary.
The spirit and scope of the present invention are not limited to
the above examples, but are encompassed by the following
claims.
* * * * *