U.S. patent application number 09/012904 was filed with the patent office on 2004-01-08 for transgenic production of antibodies in milk.
This patent application is currently assigned to Genzyme Transgenics Corporation. Invention is credited to DITULLIO, PAUL, MEADE, HARRY, POLLOCK, DANIEL.
Application Number | 20040006776 09/012904 |
Document ID | / |
Family ID | 22620446 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040006776 |
Kind Code |
A1 |
MEADE, HARRY ; et
al. |
January 8, 2004 |
TRANSGENIC PRODUCTION OF ANTIBODIES IN MILK
Abstract
A method for the production of monoclonal antibodies in mammal's
milk, through the creation of transgenic animals that selectively
express foreign antibody genes in mammary epithelial cells.
Inventors: |
MEADE, HARRY; (NEWTON,
MA) ; DITULLIO, PAUL; (FRAMINGHAM, MA) ;
POLLOCK, DANIEL; (MEDWAY, MA) |
Correspondence
Address: |
FISH & RICHARDSON
225 FRANKLIN STREET
BOSTON
MA
021102804
|
Assignee: |
Genzyme Transgenics
Corporation
|
Family ID: |
22620446 |
Appl. No.: |
09/012904 |
Filed: |
January 23, 1998 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09012904 |
Jan 23, 1998 |
|
|
|
08170579 |
Dec 20, 1993 |
|
|
|
Current U.S.
Class: |
800/4 ;
435/320.1; 435/455; 514/44R; 536/23.1; 536/23.5; 536/23.53;
536/24.1; 800/7 |
Current CPC
Class: |
C07K 2317/21 20130101;
A01K 67/0278 20130101; A01K 2217/00 20130101; A01K 2207/15
20130101; C07K 16/04 20130101; Y10S 530/867 20130101; C07K 16/3046
20130101; A01K 2217/05 20130101; C12N 15/8509 20130101; A01K
2267/01 20130101; A01K 2227/105 20130101 |
Class at
Publication: |
800/4 ;
435/320.1; 435/455; 514/44; 800/7; 536/23.1; 536/23.5; 536/23.53;
536/24.1 |
International
Class: |
C07H 021/04; C12P
021/00; C12N 015/87; A61K 048/00 |
Claims
What is claimed is:
1. A method for obtaining heterologous immunoglobulin from the milk
of a transgenic mammal comprising the steps of: a. introducing into
the germline of said mammal DNA comprising the protein-coding
sequences of said immunoglobulin, said DNA operatively linked at
its 5' terminus to a promoter sequence that supports the
preferential expression of said genes in mammary gland epithelial
cells, and said DNA operatively linked at its 3' terminus to a
sequence containing a polyadenylation site, and b. obtaining milk
from said mammal.
2. The method of claim 1 wherein said mammal is selected from the
group consisting of mice, cows, sheep, goats, oxen, camels, and
pigs
3. The method of claim 1 wherein said promoter is selected from the
group consisting of the casein promoter, the beta lactoglobulin
promoter, the whey acid protein promoter, and the lactalbumin
promoter.
4. The method of claim 1 wherein said immunoglobulin comprises
heavy and light chains.
5. The method of claim 1 wherein said immunoglobulin comprises a
single polypeptide chain.
6. The method of claim 1 wherein said immunoglobulin is of human
origin.
7. The method of claim 1 wherein said immunoglobulin is purified
from the milk of said mammal.
8. A transgenic non-human mammal all of whose germ cells and
somatic cells contain recombinant DNA sequences encoding
immunoglobulin heavy and light chains, wherein said sequences are
operatively linked at their 5' termini to a promoter sequence that
supports the preferential expression of said genes in mammary gland
epithelial cells, and operatively linked at their 3' termini to a
sequence containing a polyadenylation site.
9. The transgenic mammal of claim 8 wherein said mammal is selected
from the group consisting of mice, cows, sheep, goats, oxen,
camels, and pigs.
10. The transgenic mammal of claim 8 wherein said promoter is
selected from the group consisting of the casein promoter, the beta
lactoglobulin promoter, the whey acid protein promoter, and the
lactalbumin promoter.
11. The transgenic mammal of claim 8 wherein said immunoglobulin
comprises heavy and light chains.
12. The transgenic mammal of claim 8 wherein said immunoglobulin
comprises a single polypeptide chain.
13. The transgenic mammal of claim 8 wherein said immunoglobulin is
of human origin.
14. An isolated purified DNA comprising in the 5' to 3' direction
a) 5' promoter sequences from the beta casein gene, b) a unique Xho
I restriction site, and c) 3' untranslated sequences from the goat
beta casein gene, wherein a) comprises nucleotides -6168 to -1 of
the goat beta casein, wherein nucleotide 1 is the first nucleotide
of the beta casein translation initation codon, b) comprises the
sequence CGCGGATCCTCGAGGACC, and c) comprises the sequence starting
at the PpuMI site found at bp648 of the beta casein cDNA sequence,
and continuing for 7.1 kb downstream, termininating in the
sequence
4 TAAGGTCCAGAGACCGAGACCCACTCACTAGGCAACTGGTCCGRCCAGCTGTTAAGTGA.
15. The DNA of claim 14 wherein an immunoglobulin cDNA is inserted
into b), said DNA directing the mammary-gland-specific expression
of said immunoglobulin in transgenic animals.
16. The DNA of claim 15 wherein said immunoglobulin comprises heavy
and light chains.
17. The DNA of claim 15 wherein said immunoglobulin comprises a
single polypeptide chain.
18. The DNA of claim 15 wherein said immunoglobulin is of human
origin.
Description
FIELD OF THE INVENTION
[0001] This invention pertains to a method for the production of
monoclonal antibodies in mammal's milk, specifically through the
creation of transgenic animals that selectively express foreign
antibody genes in mammary epithelial cells.
BACKGROUND OF THE INVENTION
[0002] Immunoglobulins are heteropolymeric proteins that are
normally synthesized, modified, assembled, and secreted from
circulating B lymphocytes. Using recombinant DNA technology, it is
possible to program cells other than B-lymphocytes to express
immunoglobulin genes. The difficulties encountered in this effort
stem from several factors: 1) Both heavy and light chains of
immunoglobulins must be co-expressed at appropriate levels; 2)
Nascent immunoglobulin polypeptides undergo a variety of co- and
post-translational modifications that may not occur with sufficient
fidelity or efficiency in heterologous cells; 3) Immunoglobulins
require accessory chaperone proteins for their assembly; 4) The
synthetic and secretory capacity of the cell may be inadequate to
secrete large amounts of heterologous proteins; and 5) The secreted
immunoglobulins may be unstable in the extracellular milieu of a
foreign cell.
[0003] Because immunoglobulins have many therapeutic, diagnostic
and industrial applications, there is a need in the art for
expression systems in which these proteins can be reproducibly
manufactured at a high level, in a functional configuration, and in
a form that allows them to be easily harvested and purified The
development of transgenic animal technology has raised the
possibility of using large animals as genetically programmed
protein factories. P.C.T. application WO 90/04036 (published Ap.
19, 1990) discloses the use of transgenic technology for
immunoglobulin expression. WO 92/03918 (Mar. 19, 1992) and WO
93/12227 (Jun. 24, 1993) teach the introduction of unrearranged
immunoglobulin genes into the germline of transgenic animals. The
use of intact immunoglobulin genes (including their respective
promoter regions) will result in their expression in lymphocytes
and secretion into the bloodstream of the host animal; this
necessitates a strategy for suppressing the expression of the
host's endogenous immunoglobulins, and raises the problem of
purifying the immunoglobulins from serum, which contains many other
proteins, including proteolytic enzymes. Furthermore, if the
transgenic approach is chosen, heavy and light chain genes must
both be incorporated into the host genome, in a manner that enables
their comcomittant expression.
[0004] Another option in creating transgenic animals is to link the
gene of interest to a heterologous transcriptional promoter that
only functions in a defined cell type within the host. In this
manner, tissue-specific expression of the transgene may be
programmed. U.S. Pat. No. 4,873,316 (issued Oct. 10, 1989)
discloses the production of recombinant tissue plasminogen
activator (TPA) in the milk of transgenic mice in which the TPA
gene is linked to the promoter of the milk protein casein. Other
proteins that have been expressed in a similar fashion include
cystic fibrosis transmembrane conductance regulator (DiTullio et
al., Bio/Technology 10:74, 1992), urokinase (Meade et al.,
Bio/Technology 8: 443, 1990), interleukin-2 (Buhler et al.,
Bio/Technology 8:140, 1990), and antihemophilic factor IX (Clark et
al., Bio/Technology 7:487, 1989). Notably, these proteins are all
simple single-chain polypeptides that do not require
multimerization or assembly prior to secretion.
[0005] It has now been found that when a transgenic mammal is
created carrying paired immunoglobulin light and heavy chain genes
under the control of the casein promoter, such an animal produces
large amounts of assembled immunoglobulins which are secreted in
its milk. Using the DNA constructs of the present invention, a
surprisingly high efficiency of co-integration of heavy and light
chain genes is observed. Using the method and constructs of the
present invention, it is possible for the first time to program a
mammary epithelial cell to produce and assemble complex tetrameric
glycoproteins and secrete them in high quantities.
[0006] Accordingly, it is an object of the, present, invention to
provide methods for the large-scale production of immunoglobulins
in the milk of transgenic mammals.
[0007] Another object of the invention is to provide methods for
the design of synthetic immunoglobulins that can be produced in
large quantities in milk.
[0008] Yet another object of the invention is to provide methods
for administering therapeutically beneficial antibodies to suckling
young, by creating female mammals that excrete such antibodies into
their milk.
[0009] A further object of the invention is a transgenic non-human
mammal having germ and somatic cells with recombinant DNA sequences
encoding immunoglobulin light and heavy chains, where said
sequences are operatively linked at their 5' termini to a mammary
specific promoter and at their 3' end to a sequence comprising a
polyadenylation site.
[0010] A further object of the invention is a casein promoter
cassette comprising in the 5' to 3' direction:
[0011] a) 5' promoter sequences from the beta casein gene,
[0012] b) an XhoI restriction site, and
[0013] c) 3' untranslated sequences from the goat beta casein
gene.
[0014] These and other objects of the present invention will be
apparent to those of ordinary skill in the art in light of the
present specification, drawings, and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 is a schematic representation of the Bc62 plasmid,
which contains a 13.9 kb Sal I fragment that comprises cDNA
encoding immunoglobulin light chain, flanked on its 5' and 3'
termini by goat beta casein sequences.
[0016] FIG. 2 is a schematic representation of the Bc61 plasmid,
which contains a 14.6 kb Sal I fragment that comprises cDNA
encoding immunoglobulin heavy chain, flanked on its 5' and 3'
termini by goat beta casein sequences.
[0017] FIG. 3 depicts the immunoblot detection of human
immunoglobulin heavy chain in the milk, of transgenic mice that
were created using the beta casein promoter-linked immunoglobulin
genes shown in FIGS. 1 and 2.
[0018] FIG. 4 depicts the immunoblot detection of human
immunoglobulin light chain in the milk of transgenic mice that were
created using the beta casein promoter-linked immunoglobulin genes
shown in FIGS. 1 and 2.
SUMMARY OF THE INVENTION
[0019] In one aspect, this invention comprises a method for
obtaining heterologous immunoglobulins from the milk of transgenic
mammals. Another aspect of the prevent invention comprises the
method for creating transgenic mammals by introducing into their
germline immunoglobulin cDNA linked to a milk-specific
promoter.
[0020] In another aspect, the present invention comprises
transgenic mammals having germ cells and somatic cells having
recombinant DNA sequences comprising immunoglobulin cDNA linked to
a milk-specific promoter.
[0021] In still another aspect, the present invention comprises an
isolated DNA comprising an expression cassette having 5' and 3'
non-coding sequences derived from the goat beta casein gene linked
via a unique restriction site that serves as a convenient cloning
site for immunoglobulin coding sequences.
DETAILED DESCRIPTION OF THE INVENTION
[0022] All patent applications, patents and literature cited in
this specification are hereby incorporated by reference in their
entirety. In the case of inconsistencies, the present disclosure
will prevail.
[0023] The present invention pertains to a method for the
production of monoclonal antibodies that are excreted into the milk
of transgenic animals and the method for production of such
animals. This is achieved by engineering DNA construct's in which
DNA segments encoding specific paired immunoglobulin heavy and
preferentially expressed in mammary epithelial cells. The
recombinant DNAs containing the promoter-linked heavy and light
chain genes are then coinjected into preimplantation embryos. The a
progeny are screened for the presence of both transgenes.
[0024] Representative females from these lines are then milked, and
the milk is analyzed for the presence of the monoclonal antibody.
In order for the antibody to be present, both heavy and light chain
genes must be expressed concurrently in the same cell. The
antibodies may be purified from the milk, or the milk itself,
comprising the immunoglobulins, may be used to deliver the
antibodies to a recipient. This is discussed below.
[0025] The immunoglobulin genes useful in the present invention may
be obtained from natural sources e.g. individual B cell clones or
hybridomas derived therefrom. Alternately, they may comprise
synthetic single-chain antibodies in which the light and heavy
variable regions are expressed as part of a single polypeptide.
Furthermore, recombinant antibody genes may be used that have been
predictively altered by nucleotide substitutions that do or do not
change the amino acid sequence, by addition or deletion of
sequences, or by creation of hybrid genes in which different
regions of the polypeptide are derived from different sources.
Antibody genes by their nature are extremely diverse, and thus
naturally tolerate a great deal of variation. It will be
appreciated by those skilled in the art that the only limitation
for producing an antibody by the method of the present invention is
that it must assemble into a functional configuration and be
secreted in a stable form into the milk.
[0026] The transcriptional promoters useful in practicing the
present invention are those promoters that are preferentially
activated in mammary epithelial cells, including promoters that
control the genes encoding milk proteins such as caseins, beta
lactoglobulin (Clark et al., (1989) Bio/Technolog 7: 487-492), whey
acid protein (Gordon et al., (1987) Bio/Technology 5: 1183-1187),
and lactalbumin (Soulier et al., (1992) FEBS Letts. 297: 13,)
Casein promoters may be derived from the alpha, beta, or kappa
casein genes of any mammalian species; a preferred promoter is
derived from the goat beta casein gene (DiTullio, (1992)
Bio/Technology 10:74-77).
[0027] For use in the present invention, a unique XhoI restriction
site is introduced at the 3' terminus of the promoter sequence to
allow the routine insertion of immunoglobulin coding sequences.
Preferably, the inserted immunoglobulin gene is flanked on its 3'
side by cognate genomic sequences from a mammary-specific gene, to
provide a polyadenylation site and transcript-stabilizing
sequences. Transcription of the construct in vivo results in the
production of a stable mRNA containing casein-derived 5'
untranslated sequences upstream of the translational initiator
codon of the immunoglobulin gene and 3' untranslated sequences
downstream of the translational termination codon of the
immunoglobulin gene. Finally, the entire cassette (i.e.
promoter-immunoglobulin-3' region) is flanked by restriction sites
that enable the promoter-cDNA cassette to be easily excised as a
single fragment. This facilitates the removal of unwanted
prokaryotic vector-derived DNA sequences prior to injection into
fertilized eggs.
[0028] The promoter-linked immunoglobulin heavy and light chain
DNAs are then introduced into the germ line of a mammal e.g. cow,
sheep, goat, mouse, oxen, camel or pig. Mammals are defined herein
as all animals, excluding humans, that have mammary glands and
produce milk. Mammalian species that produce milk in large amounts
over long periods of time are preferred. Typically, the DNA is
injected into the pronuclei of fertilized eggs, which are then
implanted into the uterus of a recipient female and allowed to
gestate. After birth, the putative transgenic animals are tested
for the presence of the introduced DNA This is easily achieved by
Southern blot hybridization of DNA extracted from blood cells or
other available tissue, using as a probe a segment of the injected
gene that shows no cross hybridization with the DNA of the
recipient species. Progeny that show evidence of at least one copy
of both heavy and light-chain immunoglobulin genes are selected for
further analysis.
[0029] Transgenic females may be tested for immunoglobulin
secretion into milk, using any of the immunological techniques that
are standard in the art (e.g. Western blot, radioimmunoassay,
ELISA) The anti-immunoglobulin antibodies used in this analysis may
be polyclonal or monoclonal antibodies that detect isolated heavy
or light chains or others that react only with fully assembled
(H2L2) immunoglobulins.
[0030] The recombinant immunoglobulins are also characterized with
respect to their functionality, i.e. binding specificity and
affinity for a particular antigen. This is achieved using
immunological methods that are standard in the art, such as
Scatchard analysis, binding to immobilized antigen., etc. The
stability characteristics of an immunoglobulin in the milk of a
given species are also assayed, by applying the above-described
detection methods to milk that has been incubated for increasing
times after recovery from the animal.
[0031] The immunoglobulins produced by the methods of the present
invention may be purified from milk, using adsorption to
immobilized Protein G, column chromatography, and other methods
known to those of ordinary skill in the art of antibody
purification.
[0032] The level of production of recombinant immunoglobulins in is
an individual transgenic mammal is primarily determined by the site
and manner of integration of the transgene after injection into the
fertilized egg. Thus, transgenic progeny derived from different
injected eggs may vary with respect to this parameter. The amount
of recombinant immunoglobulin in milk is therefore monitored in
representative progeny, and the highest-producing females are
preferred.
[0033] Those skilled in the art will recognize that the methods of
the present invention can be used to optimize the production of
natural and synthetic immunoglobulins. The steps of creating
transgenic animal, testing for the presence of both heavy and the
milk of female progeny, and, finally, assessing the quality of the
resulting antibodies, can be repeated sequentially, without undue
experimentation, to establish preferred constructs for different
applications.
[0034] According to the present invention, the nature of the
recombinant immunoglobulins and their specific mode of use can
vary. In one embodiment, the present invention encompasses
high-level expression of antibodies that are harvested and purified
from milk and used in purified form. High-level expression is
defined herein as the production of about 1 mg/ml of protein. In
another embodiment, antibodies are engineered that provide
protection to humans against infectious diseases; therapeutic
administration is then achieved by drinking the milk. In a still
further embodiment, lactating animals are engineered to produce
antibodies specifically beneficial to their offspring, which
acquire them through suckling. In a still further embodiment,
animals produce an antibody that protects the lactating mammal
itself against breast pathogens e.g. bacteria that produce
mastitis.
[0035] The unexpectedly high-volume expression of immunoglobulins
using the method and constructs of the present invention also
allows the use of such immunoglobulins in pharmaceutical and
chemical settings. By way of non-limiting example the method of the
present invention can be used to produce high levels of tetrameric
antibodies directed against various pathogens (e.g. E. coli,
Salmonella, hepatitis B virus), biologically active peptides (e.g.
erythropoietin, tissue plasminogen activator, gamma interferon) and
for use in chemical reactions directed against various enzymes.
Monoclonal antibodies that bind to the transition state of a
chemical reaction can be used in industrial-scale production.
Furthermore, monoclonal antibodies are often immobilized on columns
for use in the purification of biopharmaceuticals; in such cases,
production of the antibodies represents a significant fraction of
the cost of purification. The methods of the present
invention-facilitate the production of high volume, low cost
antibody stocks for use in these types of applications.
[0036] The present invention is further described in the following
working examples, which are intended to illustrate the invention
without limiting its scope.
EXAMPLE 1
Construction of a Milk-Specific Promoter Cassette
[0037] The present invention encompasses a recipient vector into
which many different immunoglobulin genes can be interchangeably
inserted. The vector contains 5' milk-specific promoter sequences
and 3' untranslated genomic sequences that flank an XhoI cloning
site. This cloning is unique because it is the only one present in
the vector. Preferably, the entire expression cassette should be
flanked by restriction sites that allow the easy excision of the
promoter-linked immunoglobulin gene.
[0038] In this Example, the promoter and 3' genomic sequences were
derived from the goat beta casein gene. The gene was cloned and
characterized as described by Roberts et al., 1992, Gene
121:255-262, which is hereby incorporated by reference.
[0039] The expression cassette, prior to insertion of
immunoglobulin genes, consists of 6.2 kb upstream of the
translational start of the beta casein coding sequence and 7.1 kb
of genomic sequence downstream of the translational stop of the
beta casein gene. The TaqI site just upstream of the translational
start codon was changed to an XhoI site. This unique XhoI cloning
site is at the junction of the upstream and downstream
sequences.
[0040] It is this XhoI site, included in the sequence
CGCGGATCCTCGAGGACC, into which recombinant immunoglobulin genes are
inserted. (D. Tullio, (1992) Bio/Technology 10:74-77)
[0041] The 3' beta casein region begins at the PpuMI site found in
Exon 7 and continues for 7.1 kb downstream. Included in this
sequence are the remaining 18 bp of Exon 7, and all of Exon 8 and
Exon 9. These encode the 3' untranslated regions of the goat beta
casein gene, and terminate with the sequence:
1 TAAGGTCCACAGACCGAGACCCACTCACTAGGCAACTGGTCCGTCCAGCTGTTAAGTGA.
[0042] To engineer restriction sites flanking the casein cassette,
the goat beta casein control sequences were first cloned into the
SuperCosl vector (#251301, Stratagene, La Jolla, Calif.) with
flanking NotI and SaII sites. This plasmid was then modified by
changing the NotI site to a SaII site. This created a 13.3 kb SaIII
fragment containing the beta casein expression cassette within the
gbc163 vector.
EXAMPLE 2
Construction of Promoter-linked Monclonal Antibody Genes
[0043] In this Example, the genes encoding a human monoclonal
antibody directed against a colon cancer cell-surface marker were
linked to the casein promoter. cDNAs encoding the light and heavy
chains of this antibody were cloned from an antibody-secreting
hybridoma cell line into a pUC19-derived vector. The light and
heavy chain cDNAs were present on HindIII/EcoRI fragments of 702 bp
and 1416 bp, respectively.
[0044] To adapt the genes for insertion into the casein promoter
cassette, XhoI restriction sites were engineered at both ends of
each DNA segment as detailed below. In the same step, the region
upstream of the immunoglobulin translation initiation codon was
modified so that it contained sequences similar to those in the
analogous region of the beta casein gene.
[0045] Light chain gene: The pUC19 plasmid containing the light
chain cDNA insert was digested with HindIII, blunt-ended by
treatment with the Klenow fragment of DNA Polymerase I, and ligated
to an oligonucleotide containing an XhoI recognition sequence
(#1030, New England Biolabs, Beverly, Mass.).
[0046] The region immediately upstream of the initiating ATG was
then mutagenized using an oligonucleotide with the following
sequence: 5' AGT GAA TTC ATG CTC GAG AGC CAT GGC CTG GATC 3'.
Digestion of the final plasmid with XhoI produced the modified
light chain cDNA that was flanked by Xhol cohesive ends
[0047] The light chain cDNA was then inserted into the unique XhoI
cloning site of the gbc163 expression vector described in Example
1, yielding plasmid Bc62 (FIG. 1).
[0048] Heavy chain gene: The pUC19 plasmid containing the heavy
chain cDNA was mutagenized using an oligonucleotide with the
following sequence: 5'
2 5' AGT GAA TTC ATG CTC GAG AGC CAT GGC CTG GATC 3'.
[0049] 3.' The resulting plasmid contains an XhoI site upstream of
the heavy chain translation initiation codon.
[0050] The downstream HindIII site was converted to an Xhol site
using a synthetic adapter with the sequence 5' AGC TCC TCG AGG CC
3.' Digestion of the modified plasmid with XhoI produced the the
1.4 kb modified heavy chain cDNA flanked by XhoI cohesive ends.
This fragment was then inserted into the unique XhoI cloning site
of gbc163 to yield Bc61 (FIG. 2).
[0051] Prior to injection, promoter-linked light and heavy chain
genes were isolated from Bc61 and Bc62, respectively, by digestion
with SalI. The fragments were then purified by gel electrophoresis
followed by CsCl equilibrium gradient centrifugation The DNA was
dialyzed extensively against distilled water prior to
quantitation.
EXAMPLE 3
Production of Transgenic Mice
[0052] The casein promoter-linked DNA fragments encoding the
immunoglobulin heavy and light chains, obtained as described in
Example 2, were injected into fertilized mouse eggs using
procedures that are standard in the art, as described in Hogan, B.,
Constantini, F., and Lacey, E., Manipulating the Mouse Embryo: A
Laboratory Manual (Cold Spring Harbor Laboratories, 1986). The
resulting progeny were then analyzed for the presence of both
antibody gene sequences. DNA was extracted from tail biopsy
material and probed using Southern blot analysis. The probes used
in the hybridization were the original cDNAs encoding the heavy and
light chains. As seen in Table 1, most of the first generation
transgenic progeny had incorporated both transgenes.
3TABLE 1 Summary of Bc61-Bc62 Mice Founder Sex Bc61 Bc62 Expression
1-2 M Pos. Pos. 1-3 M Pos. Pos. light chain only 1-9 M Pos. Pos.
1-15 F Neg. Pos. Low level lambda chain 1-16 F Pos. Neg. 1-19 F
Pos. Pos. N.D 1-23 F Pos. Pos. 1-3 mg/ml 1-24 F Pos. Pos. low level
1-25 M Pos. Neg. 1-39 M Pos. Pos. 1-13 F Pos. Pos. N.D. 1-56 F Pos.
Pos. N.D. 1-64 M Pos. Pos. 2-76 F Pos. Pos. 1-3 mg/ml 2-82 F Pos.
Pos. 1-3 mg/ml 1-72 M Pos. Pos. 2-92 F Pos. Pos. 0.2-0.5 mg/ml 2-95
F Pos. Pos. 0.2-0.5 mg/ml N.D. = not detected
EXAMPLE 4
Analysis of Recombinant Immunoglobulins in Milk
[0053] Samples of milk from the transgenic mice obtained as
described in Example 3 were analyzed for the presence of the
heterologous immunoglobulin by Western blot. The heavy chain of the
antibody was detected using a horseradish peroxide-linked
polyclonal antibody directed against human gamma heavy chain
(Antibody #62-8420, Zymed, South San Francisco, Calif.) as shown in
FIG. 3. The light chain was detected using antibodies to the human
lambda light chain, (Antibody #05-4120, Zymed, South San Francisco,
Calif.) shown in FIG. 4. In these Figures, it can be seen that
immunoreactive heavy and light chains can be detected in the milk
of several animals, but not in the negative control animal CD-1.
Human immunolglobulin can be detected in milk from founder 1-23 and
from the progeny of the 1-76 and 1-72 founders. These animals are
the second-generation females, 2-76, 2-82, 2-92, and 2-95. The
levels of expression range between 0.2 mg/ml to over 1 mg/ml (Table
1).
Sequence CWU 1
1
* * * * *