U.S. patent application number 10/462896 was filed with the patent office on 2004-01-08 for low oxygen culturing of central nervous system progenitor cells.
This patent application is currently assigned to California Institute of Technology. Invention is credited to Csete, Marie, Doyle, John, McKay, Ron, Studer, Lorenz, Wold, Barbara J..
Application Number | 20040005704 10/462896 |
Document ID | / |
Family ID | 26891094 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040005704 |
Kind Code |
A1 |
Csete, Marie ; et
al. |
January 8, 2004 |
Low oxygen culturing of central nervous system progenitor cells
Abstract
The present invention relates to the growth of cells in culture
under conditions that promote cell survival, proliferation, and/or
cellular differentiation. The present inventors have found that
proliferation was promoted and apoptosis reduced when cells were
grown in lowered oxygen as compared to environmental oxygen
conditions traditionally employed in cell culture techniques.
Further, the inventors found that differentiation of precursor
cells to specific fates also was enhanced in lowered oxygen where a
much greater number and fraction of dopaminergic neurons were
obtained when mesencephalic precursors were expanded and
differentiated in lowered oxygen conditions. Thus at more
physiological oxygen levels the proliferation and differentiation
of CNS precursors is enhanced, and lowered oxygen is a useful
adjunct for ex vivo generation of specific neuron types. Methods
and compositions exploiting these findings are described.
Inventors: |
Csete, Marie; (Ann Arbor,
MI) ; Doyle, John; (South Pasadena, CA) ;
Wold, Barbara J.; (San Marino, CA) ; McKay, Ron;
(Bethesda, MD) ; Studer, Lorenz; (New York,
NY) |
Correspondence
Address: |
K. Shannon Mrksich
BRINKS HOFER GILSON & LIONE
P.O. BOX 10395
CHICAGO
IL
60610
US
|
Assignee: |
California Institute of
Technology
National Institutes of Health
|
Family ID: |
26891094 |
Appl. No.: |
10/462896 |
Filed: |
June 13, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10462896 |
Jun 13, 2003 |
|
|
|
09425462 |
Oct 22, 1999 |
|
|
|
6610540 |
|
|
|
|
09425462 |
Oct 22, 1999 |
|
|
|
09195569 |
Nov 18, 1998 |
|
|
|
6184035 |
|
|
|
|
Current U.S.
Class: |
435/368 |
Current CPC
Class: |
A61P 25/16 20180101;
C12N 5/0619 20130101; C12N 2500/02 20130101; A61K 35/12 20130101;
C12N 2501/14 20130101; A61P 25/00 20180101; C12N 5/0623 20130101;
C12N 2503/02 20130101; A61K 38/1816 20130101; A61K 48/00 20130101;
C12N 5/0606 20130101; C12N 2501/115 20130101; C12N 5/0658 20130101;
C12N 2501/119 20130101 |
Class at
Publication: |
435/368 |
International
Class: |
C12N 005/08 |
Goverment Interests
[0002] The U.S. Government may have rights in the present invention
pursuant to the terms of grant numbers AR40780-8 and AR42671-05
awarded by the National Institutes of Health and DARPA/AFOSR grant
number F49620-98-1-0487.
Claims
1. A method of increasing cell differentiation comprising culturing
undifferentiated central nervous system (CNS) cells in low ambient
oxygen conditions, wherein said low ambient oxygen conditions
promotes the cellular differentiation of said neuronal cells.
2. The method of claim 1, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about
0.25% to about 18% oxygen.
3. The method of claim 1, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about
0.5% to about 15% oxygen.
4. The method of claim 1, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about 1%
to about 10% oxygen.
5. The method of claim 1, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about
1.5% to about 6% oxygen.
6. The method of claim 1, wherein said low ambient oxygen
conditions mimic physiological oxygen conditions for CNS cells.
7. The method of claim 1, wherein said cells are primary tissue
culture cells.
8. The method of claim 1, wherein said cells are derived from a
cell line.
9. The method of claim 1, wherein said cells are selected from the
group consisting of a central nervous system stem cells, spinal
cord-derived progenitor cells, glial cells, astrocytes, neuronal
stem cells, central nervous system neural crest-derived cells,
neuronal precursor cells, neuronal cells, hepatocytes, and bone
marrow derived cells.
10. The method of claim 9, wherein said cells are fetal cells.
11. The method of claim 9, wherein said cells are adult cells.
12. The method of claim 1, wherein said cells are selected from the
group consisting of mecencephalic progenitor cells, lateral
ganglion precursor cells, cortical precursor cells, astrocytes and
neuroblasts.
13. The method of claim 1, wherein said differentiation is
determined by monitoring a differentiation specific phenotype in
said cells.
14. The method of claim 13, wherein said differentiation specific
phenotype determined by monitoring message level, protein level,
subcellular localization, functional assays or morphological
changes.
15. The method of claim 14, wherein said message level is monitored
using PCR.TM., in situ hybridization, RNAse protection assay, or
single cell PCR.TM..
16. The method of claim 14, wherein said protein level is monitored
using antibody staining, HPLC, western blotting or
immunoprecipitation.
17. The method of claim 14 wherein said message level monitored is
the message for nestin, tyrosine hydroxylase, GAPDH; BDNF; GDNF;
FGFR3; En1; FGF8; SHH; Ptx3; Nurr1; VEGF; EPO; HIF1.alpha. or
VHL.
18. The method of claim 15 wherein said protein level monitored is
the level of nestin, tyrosine hydroxylase, dopamine
.beta.-hydroxylase or dopamine transporter.
19. The method of claim 14, wherein said functional assay monitors
the rate of dopamine production.
20. The method of claim 1, wherein said low oxygen conditions
produce a cell population that is enriched in dopaminergic neurons
as compared to a similar cell population that is grown in 20%
oxygen incubator conditions.
21. The method of claim 1, wherein said low oxygen conditions
produce a cell population that is enriched in serotoninergic
neurons as compared to a similar cell population that is grown in
20% oxygen incubator conditions.
22. The method of claim 1, wherein said low oxygen conditions
produce a cell population that is depleted in GABAnergic neurons as
compared to a similar cell population that is grown in 20% oxygen
incubator conditions.
23. The method of claim 1, wherein said low oxygen conditions
produce a cell population that is depleted in glutaminergic neurons
as compared to a similar cell population that is grown in 20%
oxygen incubator conditions.
24. The method of claim 1, further comprising growing said cells in
the presence of a neuronal growth stimulant, mitogen, cytokine,
neuroprotective factor or an anti-apoptotic agent.
25. The method of claim 1, wherein said differentiated phenotype is
retained after transfer of said cells from said low ambient oxygen
conditions to 20% oxygen culture conditions.
26. The method of claim 25, wherein said cells are grown in low
ambient oxygen conditions for multiple generations prior to
transfer to 20% oxygen culture conditions.
27. The method of claim 1, wherein said cells are continuously
maintained in low ambient oxygen conditions.
28. A method of inhibiting apoptosis of a CNS cell in culture
comprising growing said cell in low ambient oxygen conditions.
29. The method of claim 28, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about
0.25% to about 18% oxygen.
30. A method of increasing the expansion of a CNS cell in culture
comprising growing said cell in low ambient oxygen, wherein said
cell exhibit increased expansion in said low ambient oxygen as
compared to growing said cell in 20% oxygen incubator
conditions.
31. The method of claim 30, wherein said low ambient oxygen
conditions comprise an ambient oxygen condition of between about
0.25% to about 18% oxygen.
32. The method of claim 30, wherein said low ambient oxygen
conditions mimic physiological oxygen conditions for CNS cells.
33. The method of claim 30, wherein said cell is a primary tissue
culture cell.
34. The method of claim 30, wherein said cell is derived from a
cell line.
35. The method of claim 30, wherein said cell is a fetal cell.
36. The method of claim 30, wherein said cell is an adult cell.
37. A method of increasing cell proliferation in culture comprising
growing CNS cells in low ambient oxygen, wherein said growth in low
ambient oxygen increases cell proliferation compared to growing
said cells in 20% oxygen incubator conditions.
38. A method of preparing a cell for use against a
neurodegenerative disorder comprising a) obtaining a population of
CNS cells and b) growing said cells in low ambient oxygen
conditions wherein said low ambient oxygen conditions increases the
expression of a gene involved in said neurodegenerative
disease.
39. The method of claim 38, wherein said neurodegenerative disease
is Parkinson's Disease.
40. The method of claim 38 wherein said gene is tyrosine
hydroxylase (TH).
41. The method of claim 38, wherein said cell is a primary
cell.
42. The method of claim 38, wherein said cell is derived from a
cell line.
43. The method of claim 38, further comprising contacting said cell
with a first polynucleotide encoding a dopamine biosynthetic
protein under conditions suitable for the expression of said
protein wherein said polynucleotide is under the transcriptional
control of a promoter active in said cells.
44. The method of claim 38, further comprising contacting said cell
with a first polynucleotide encoding a dopamine releasing protein
under conditions suitable for the expression of said protein
wherein said polynucleotide is under the transcriptional control of
a promoter active in said cells.
45. The method of claim 43, further comprising contacting said cell
with a second polynucleotide encoding a dopamine releasing protein
under conditions suitable for the expression of said protein
wherein said polynucleotide is under the transcriptional control of
a promoter active in said cells.
46. The method of claim 44, further comprising contacting said cell
with a second polynucleotide encoding a dopamine biosynthetic
protein under conditions suitable for the expression of said
protein wherein said polynucleotide is under the transcriptional
control of a promoter active in said cells.
47. The method of claim 43, wherein said dopamine biosynthesis
protein is selected from the group consisting of TH; L-amino acid
decarboxylase (AADC) and erythropoietin.
48. The method of claim 44, wherein said dopamine releasing protein
is a vesicular monoamine transporter (VMAT).
49. The method of claim 45, wherein said first and second
polynucleotides are under control of different promoters.
50. The method of claim 46, wherein said first and second
polynucleotides are under control of different promoters.
51. The method of claim 43, wherein the promoter is selected from
the group consisting of CMV IE, SV40 E, .beta.-actin, TH promoter,
AADC promoter, and nestin promoter.
52. The method of claim 45, wherein said first and second
polynucleotides each are covalently linked to a polyadenylation
signal.
53. The method of claim 46, wherein said first and second
polynucleotides each are covalently linked to a polyadenylation
signal.
54. A cell produced according to the method comprising obtaining a
starting CNS cell and growing said cell in low ambient oxygen
conditions wherein said conditions produce a differentiated
neuronal cell.
55. The cell of claim 54, wherein said starting cell is a
nestin-positive cell.
56. The cell of claim 54, wherein said low ambient conditions
produce a nestin-negative cell.
57. The cell of claim 54, wherein said low ambient conditions
produce a TH positive cell.
58. The cell of claim 54, wherein said cell further comprises an
expression vector comprising a polynucleotide encoding an exogenous
gene wherein said polynucleotide is operatively linked to a
promoter.
59. A method of treating Parkinson's disease in a subject
comprising: a) obtaining cells suitable for transplanting to said
subject; b) growing said cells in low ambient oxygen conditions;
and c) implanting said cells grown from step (b) into said subject
wherein said implanted cells have an increased capacity to produce
dopamine in said subject as compared to similar cells grown in 20%
oxygen incubator conditions.
60. The method of claim 59, wherein said cells are from said
subject and have been transduced with a polynucleotide that
expresses a protein that increases dopamine production.
61. The method of claim 59, wherein said cells are CNS cells from a
source other than said subject.
62. The method of claim 59, wherein said cells are transduced with
a polynucleotide that expresses a protein that increases dopamine
production.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
application Ser. No. 09/195,569 filed Nov. 18, 1998. The entire
text of the above referenced application is incorporated herein by
reference without prejudice or disclaimer.
FIELD OF THE INVENTION
[0003] The present invention relates to the growth of cells in
culture. More particularly, the present invention provides methods
and compositions for increasing cell survival, cell proliferation
and/or cell differentiation along specific pathways by growing the
cells in low ambient oxygen conditions.
BACKGROUND OF THE INVENTION
[0004] In a time of critical shortages of donor organs, efforts to
bring cellular transplantation into the clinical arena are urgently
needed (Neelakanta & Csete, 1996). Indeed, cellular and tissue
transplantation is now well recognized as a desirable technique for
the therapeutic intervention of a variety of disorders including
cystic fibrosis (lungs), kidney failure, degenerative heart
diseases and neurodegenerative disease. However, although this may
be a desirable and much needed intervention, a major impediment to
this type of therapeutic intervention is the lack of an available
supply of viable, differentiated cells. Generally differentiated
cells cannot be readily expanded in culture. Thus, methods of
increasing the number and/or availability of differentiated, viable
cells are needed.
[0005] The central nervous system (CNS) (brain and spinal cord) has
poor regenerative capacity which is exemplified in a number of
neurodegenerative disorders, such as Parkinson's Disease. Although
such diseases can be somewhat controlled using pharmacological
intervention (L-dopa in the case of Parkinson's Disease), the
neuropathological damage and the debilitating progression is not
reversed. Cell transplantation offers a potential alternative for
reversing neuropathological damage as opposed to merely treating
the consequences of such damage.
[0006] Cultured CNS stem cells can self-renew, and after mitogen
withdrawal, have an intrinsic capacity to generate
oligodendrocytes, astrocytes, and neurons in predictable
proportions (Johe et al., 1996). Manipulation of this intrinsic
differentiation capacity in culture has been used to define a
complex array of factors that maintain, amplify, or diminish a
particular differentiated phenotype. Most such studies emphasize a
primary role for transcription factors in defining CNS lineage
identity, as well as growth and trophic factors acting locally and
over long distances (Johe et al., 1996, Panchinsion et al., 1998).
Dopaminergic neurons and their progenitors from these cultures are
of special interest as potential sources of replacement cellular
therapies for Parkinson's Disease patients (reviewed in Olanow et
al., 1996).
[0007] Ideally, ex vivo culture conditions should reproduce the in
vivo cellular environment with perfect fidelity. This ideal is
especially pertinent when explants are used to study development,
because conditions may be defined for cell fate choice and
differentiation. For CNS stem cell cultures, in particular,
maximizing survival, proliferation, and cell fate choice leading to
dopaminergic neurons is essential for future cellular transplant
therapies. Thus, understanding and control of the differentiation
of such cells is crucial for providing a viable, useful product
that can be used in transplantation or for studying the behavior of
CNS cells, in vitro, in response to various conditions.
[0008] In embryogenesis, each tissue and organ develops by an
exquisitely organized progression in which relatively unspecialized
or "undifferentiated" progenitor or stem cells give rise to progeny
that ultimately assume distinctive, differentiated identities and
functions. Mature tissues and organs are composed of many types of
differentiated cells, with each cell type expressing a particular
subset of genes that in turn specifies that cell's distinctive
structure, specialized function, and capacity to interact with and
respond to environmental signals and nutrients. These molecular,
structural and functional capacities and properties comprise the
cell phenotype. Similarly, coupled cell proliferation and/or
differentiation occurs, in the presence of changing local O.sub.2
supply, when an injured or degenerating adult tissue undergoes
repair and regeneration. The level of oxygen is especially
pertinent in many regeneration paradigms in which normal blood
supply is reduced or even transiently stopped by trauma or embolic
events (myocardial infarction, stroke and the like).
[0009] Therefore, in clinical settings, gases are appreciated as a
primary variable in organ survival, with oxygen as the critical gas
parameter. Virtually all modern cell culture is conducted at
37.degree. C. in a gas atmosphere of 5% CO.sub.2 and 95% air. These
conditions match core human body temperature and approximate quite
well physiologic CO.sub.2 concentrations. For example, mean brain
tissue CO.sub.2 is 60 mm Hg or about 7% (Hoffman et al., 1998).
However, in striking contract, oxygen in standard tissue culture
does not reflect physiologic tissue levels and is, in fact,
distinctly hyperoxic.
[0010] At sea level, (unhumidified) room air contains 21% O.sub.2
which translates into an oxygen partial pressure of 160 mm Hg
[0.21(760 mm Hg)]. However, the body mean tissue oxygen levels are
much lower than this level. Alveolar air contains 14% oxygen,
arterial oxygen concentration is 12%, venous oxygen levels are
5.3%, and mean tissue intracellular oxygen concentration is only 3%
(Guyton, and Hall, 1996). Furthermore, direct microelectrode
measurements of tissue O.sub.2 reveal that parts of the brain
normally experience O.sub.2 levels considerably lower than total
body mean tissue oxygen levels, reflecting the high oxygen
utilization in brain. These studies also highlight considerable
regional variation in average brain oxygen levels (Table 1) that
have been attributed to local differences in capillary density.
Mean brain tissue oxygen concentration in adult rates is 1.5%
(Silver and Erecinska, 1988), and mean fetal sheep brain oxygen
tension has also been estimated at 1.6% (Koos and Power, 1987).
1TABLE 1 Regional rat brain tissue partial pressures of oxygen
measured by microelectrode Brain area % O.sub.2 Cortex (gray)
2.5-5.3 Cortex (white) 0.8-2.1 Hypothalamus 1.4-2.1 Hippocampus
2.6-3.9 Pons, fomix 0.1-0.4
[0011] Adapted from Silver, L, Erecinska, M. Oxygen and ion
concentrations in normoxic and hypoxic brain cells. In Oxygen
Transport to Tissue XX, 7-15, edited by Hudetz and Bruley, Plenum
Press, New York (1988).
[0012] Thus, from the discussion above it is clear that under
standard culture conditions, the ambient oxygen levels are
distinctly hyperoxic, and not at all within physiologic ranges.
These conditions of cell growth are have been historically
inadequate for generating cells and tissues for transplantation
into the brain or other area of the body or for providing an
accurate in vitro model of what is occurring in vivo. Thus, there
remains a need for methods to produce differentiated cells which
can be used for therapeutic and research purposes. The present
invention is directed to providing such methods.
BRIEF SUMMARY OF THE INVENTION
[0013] The present invention is directed to growing cells in low
ambient oxygen conditions in order to mimic the physiological
oxygen conditions with greater fidelity. The growth of these cells
in such conditions provides certain surprising and unexpected
results. These results are exploited and described in further
detail herein. More particularly, the present invention describes
methods that may independently be useful in increasing cell
survival, cell proliferation and/or cell differentiation along
specific pathways.
[0014] In specific embodiments, the present invention describes a
method of increasing cell differentiation comprising culturing
undifferentiated central nervous system (CNS) cells in low ambient
oxygen conditions, wherein the low ambient oxygen conditions
promotes the cellular differentiation of the neuronal cells. The
definitions of low ambient oxygen conditions are described in depth
elsewhere in the specification. However, it is contemplated that in
specific embodiments the low ambient oxygen conditions comprise an
ambient oxygen condition of between about 0.25% to about 18%
oxygen. In other embodiments, the ambient oxygen conditions
comprise an ambient oxygen condition of between about 0.5% to about
15% oxygen. In still other embodiments, the low ambient oxygen
conditions comprise an ambient oxygen condition of between about 1%
to about 10% oxygen. In further embodiments, the low ambient oxygen
conditions comprise an ambient oxygen condition of between about
1.5% to about 6% oxygen. Of course, these are exemplary ranges of
ambient oxygen conditions to be used in culture and it should be
understood that those of skill in the art will be able to employ
oxygen conditions falling in any of these ranges generally or an
oxygen conditions between any of these ranges that mimics
physiological oxygen conditions for CNS cells. Thus, one of skill
in the art could set the oxygen culture conditions at 0.5%, 1%,
1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%,
8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%,
14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, or any
other oxygen condition between any of these figures.
[0015] The cells employed in the method described may be any cells
that are routinely used for CNS studies. As such, the cells may be
primary tissue culture cells or derived from a cell line. The cells
may be fetal cells or adult cells. In specific embodiments, it is
contemplated that the cells may be selected from the group
consisting of central nervous system stem cells, spinal
cord-derived progenitor cells, glial cells, astrocytes, neuronal
stem cells, central nervous system neural crest-derived cells,
neuronal precursor cells, neuronal cells, hepatocytes, and bone
marrow derived cells. In preferred embodiments, it is contemplated
that the cells may be mecencephalic progenitor cells, lateral
ganglion precursor cells, cortical precursor cells, astrocytes or
neuroblasts.
[0016] The method may comprise determining the amount, level or
degree of differentiation. Those of skill in the art are familiar
with technologies employed to determine cellular differentiation.
The differentiation may determined by monitoring a differentiation
specific phenotype in the cells. For example, the differentiation
specific phenotype determined may be by monitoring message level,
protein level, subcellular localization, functional assays or
morphological changes.
[0017] There are various techniques that may be employed for
determining message level including but not limited to PCR.TM., in
situ hybridization, RNAse protection assay, or single cell PCR.TM..
In specific embodiments, the present invention may monitor the
message level for nestin, tyrosine hydroxylase, GAPDH; BDNF; GDNF;
FGFR3; En1; FGF8; SHH; Ptx3; Nurr1; VEGF; EPO; HIF1.alpha. or VHL.
Of course these are exemplary differentiation markers for CNS cells
or markers of cellular responses to oxygen and it is contemplated
that those of skill in the art will be able to substitute
additional similar markers for the markers specifically described
herein without undue experimentation. Other embodiments monitor
protein level by, for example, using antibody staining, HPLC,
western blotting or immunoprecipitation. In more particular
embodiments, the protein level monitored is the level of nestin,
tyrosine hydroxylase, dopamine .beta.-hydroxylase or dopamine
transporter. The functional assay typically will be one that
monitors a particular function of the selected CNS cells. A
particularly useful functional assay may be one which monitors the
rate of dopamine production.
[0018] A preferred feature of the present invention is that the low
oxygen conditions produce a cell population that is enriched in
dopaminergic neurons as compared to a similar cell population that
is grown in 20% oxygen incubator conditions. Another preferred
embodiment is that the low oxygen conditions produce a cell
population that is enriched in serotoninergic neurons as compared
to a similar cell population that is grown in 20% oxygen incubator
conditions. In still additional embodiments, the low oxygen
conditions produce a cell population that is depleted in GABAnergic
neurons as compared to a similar cell population that is grown in
20% oxygen incubator conditions. Further, certain methods of the
present invention will provide low oxygen conditions to produce a
cell population that is depleted in glutaminergic neurons as
compared to a similar cell population that is grown in 20% oxygen
incubator conditions.
[0019] In preferred embodiments, the method may further comprise
growing the cells in the presence of a neuronal growth stimulant,
mitogen, cytokine, neuroprotective factor or an anti-apoptotic
agent. The inventors have found that there was a significant
increase in EPO expression as a result of lowered oxygen versus 20%
O.sub.2 In particular embodiments, the differentiated phenotype is
retained after transfer of the cells from the low ambient oxygen
conditions to 20% oxygen culture conditions. In specific
embodiments, it is contemplated that the cells may be grown in low
ambient oxygen conditions for multiple generations prior to
transfer to 20% oxygen culture conditions. In other embodiments,
the cells may be continuously maintained in low ambient oxygen
conditions.
[0020] Another aspect of the present invention provides a method of
inhibiting apoptosis of a CNS cell in culture comprising growing
the cell in low ambient oxygen conditions.
[0021] Yet another embodiment provides a method of increasing the
expansion of a CNS cell in culture comprising growing the cell in
low ambient oxygen, wherein the cells exhibit increased expansion
in the low ambient oxygen as compared to growing the cell in 20%
oxygen incubator conditions.
[0022] In an additional embodiment, the present invention further
contemplates a method of increasing cell proliferation in culture
comprising growing CNS cells in low ambient oxygen, wherein the
growth in low ambient oxygen increases cell proliferation compared
to growing the cells in 20% oxygen incubator conditions.
[0023] Also provided is a method of preparing a cell for use
against a neurodegenerative disorder comprising obtaining a
population of CNS cells and growing the cells in low ambient oxygen
conditions wherein the low ambient oxygen conditions increases the
expression of a gene involved in the neurodegenerative disease. In
specific embodiments, the neurodegenerative disease is Parkinson's
Disease and the gene is tyrosine hydroxylase (TH).
[0024] The method further may comprise contacting the cell(s) with
a first polynucleotide encoding a dopamine biosynthetic protein
under conditions suitable for the expression of the protein wherein
the polynucleotide is under the transcriptional control of a
promoter active in the cells. In addition, the method further may
comprise contacting the cell with a first polynucleotide encoding a
dopamine releasing protein under conditions suitable for the
expression of the protein wherein the polynucleotide is under the
transcriptional control of a promoter active in the cells. Also
contemplated is a method further comprising contacting the cell
with a second polynucleotide encoding a dopamine releasing protein
under conditions suitable for the expression of the protein wherein
the polynucleotide is under the transcriptional control of a
promoter active in the cells. Other embodiments involve contacting
the cell with a second polynucleotide encoding a dopamine
biosynthetic protein under conditions suitable for the expression
of the protein wherein the polynucleotide is under the
transcriptional control of a promoter active in the cells.
[0025] In more particular embodiments, the dopamine biosynthesis
protein may be TH; L-amino acid decarboxylase (AADC),
erythropoietin or any other protein directly or indirectly involved
in dopamine synthesis. The dopamine releasing protein is a
vesicular monoamine transporter (VMAT), which may be VMAT1 or
VMAT2. In specific embodiments, the first and second
polynucleotides are under control of different promoters. The
promoter may be any promoter known to those of skill in the art
that will be operative in the cells being used. For example, it is
contemplated that the promoter may be CMV IE, SV40 IE,
.beta.-actin, TH promoter, AADC promoter, and nestin promoter. It
is contemplated that the first and second polynucleotides each may
be covalently linked to a polyadenylation signal.
[0026] Also encompassed by the present invention is a cell produced
according to the method comprising obtaining a starting CNS cell
and growing the cell in low ambient oxygen conditions wherein the
conditions produce a differentiated neuronal cell. In specific
embodiments, the starting cell is a nestin-positive cell. More
particularly, the low ambient conditions produce a nestin-negative
differentiated cell more rapidly and in greater numbers than
traditional cell culture conditions. In specific embodiments, the
low ambient conditions produce a TH positive cell. In other
embodiments, the cell further comprises an expression vector
comprising a polynucleotide encoding an exogenous gene wherein the
polynucleotide is operatively linked to a promoter.
[0027] Another aspect of the present invention provides a method of
treating Parkinson's disease in a subject comprised of obtaining
cells suitable for transplanting in the subject; growing the cells
in low ambient oxygen conditions; and implanting the cells grown in
the low ambient oxygen conditions into the subject; wherein the
implanted cells have an increased capacity to produce dopamine in
the subject as compared to similar cells grown in 20% oxygen
incubator conditions. In specific embodiments, the cells are from
the subject and have been transduced with a polynucleotide that
expresses a protein that increases dopamine production and are
treated or expanded in lowered oxygen conditions. In other
preferred embodiments, the cells are CNS cells from a source other
than the subject. In preferred embodiments, the cells are
transduced with a polynucleotide that expresses a protein that
increases dopamine production and are treated or expanded in
lowered oxygen conditions.
[0028] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS
[0029] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0030] FIG. 1. Effect of lowered oxygen on precursor yield in vitro
at varying plating densities. Striatal cultures were expanded with
bFGF in lowered or ambient oxygen, and total cell numbers assessed
after 5 days of proliferation when over 95% of cells are nestin+
precursors. Significantly increased cell numbers were detected at
all densities in lowered O.sub.2 compared to ambient oxygen.
[0031] FIG. 2. Lowered oxygen culturing leads to increased
proliferation of CNS precursors. FIG. 2A. Mesencephalic precursors
were pulsed with 10 .mu.M BrdU for 60 minutes immediately before
fixation, then stained for BrdU uptake. More BrdU+ cells were seen
in lowered oxygen cultures during both proliferation and
differentiation. Scale bar=20 .mu.m. FIG. 2B. Mesencephalic
precursors in lowered O.sub.2 yielded an increased percentage of
BrdU+ cells and a greater absolute number of BrdU+ cells than
cultures maintained at 20% O.sub.2. Data are given as mean+/-SEM,
n=40. Differences between lowered and 20% O.sub.2 were
statistically significant at all time points and for all parameters
(n=8, p<0.05) except percentage of BrdU+ cells at day 4 of
expansion (n=8, p=0.10).
[0032] FIG. 3. CNS precursors cultured in lowered (vs. 20%) O.sub.2
have reduced rates of apoptosis. FIG. 3A. Apoptosis was assayed by
TUNEL labeling of mesencephalic precursors cultured in parallel at
either lowered or 20% O.sub.2 Representative figures of the
expansion phase (2 and 6 days of culture) and the differentiation
phase (4 days after bFGF withdrawal) are shown. Scale bar=20 .mu.m.
FIG. 3B. Precursors grown at lowered 2. showed a significant
decrease in the percentage of apoptotic cells (n=8, p<0.05)
compared to traditional cultures.
[0033] FIG. 4. Basic differentiation patterns of CNS stems in
lowered and 20% O.sub.2 cultures. FIG. 4A. Striatal cultures in
lowered or 20% O.sub.2 were assessed for the relative percentages
of precursor-derived neurons (by TUJ1 stain), astrocytes (GFAP) and
oligodendrocytes (Gal-C) after 5 days of bFGF proliferation
followed by four days of cell differentiation (for quantification
see text). FIG. 4B. Passaged mesencephalic precursors were
proliferated for 6 days and differentiated for 5 days in lowered or
20% O.sub.2 and analyzed for O4, a marker of oligodendrocyte
precursors. O4+ cells could be detected only in lowered oxygen
cultures. FIG. 4C. Nestin+ clones were derived from single passaged
mesencephalic precursor cells after 20 days of bFGF proliferation
(left panel). Clones in lowered oxygen differentiated into TUJ1+
neurons upon bFGF withdrawal (right panel). FIG. 4D. Lowered
O.sub.2 promotes clone formation efficiency. The yield of clones
derived from single precursors was 3-fold higher in lowered O.sub.2
compared to 20% O.sub.2 cultures (left panel). The majority of
clones derived from precursors in O.sub.2 oxygen cultures contained
50-500 cells whereas clone size in 20% O.sub.2 cultures was
generally 5-50 cells (right panel). Scale bar=20 .mu.m in all
panels.
[0034] FIG. 5. Lowered O.sub.2 culturing improves the yield of
functional precursor-derived dopaminergic neurons. FIG. 5A and FIG.
5B. Precursors from E12 mesencephalon were proliferated with bFGF
for 5 days followed by 5 days of differentiation, then stained for
the neuronal marker TUJ1 and for TH. A large increase in total
number (and percentage) of TH+ neurons was detected (p<0.001) in
lowered O.sub.2 compared to 20% O.sub.2 cultures. Scale bar=20
.mu.m. FIG. 5C. Quantification of TH protein level by Western blot
analysis revealed significantly more TH in samples from lowered
(vs. 20%) O.sub.2 cultures. Each lane was loaded with 2.5 m .mu.g
total protein. FIG. 5D. rp-HPLC with electrochemical detection was
used to quantify dopamine levels in conditioned medium (24 hrs), in
HBSS after 15 minutes of conditioning (basal release), and in
HBSS+56 mM KCl after 15 minutes (evoked release). Significantly
more dopamine was detected in cultures maintained at lowered
O.sub.2 compared to those grown at 20% O.sub.2 under all these
conditions (conditioned medium p<0.01; basal and evoked release
p<0.05). Inset shows typical chromatogram for dopamine detection
in lowered and 20% O.sub.2 cultures.
[0035] FIG. 6. Neuronal subtype differentiation from mesencephalic
precursors in lowered vs. 20% O.sub.2. Double immunocytochemical
labeling revealed that lowered O.sub.2 culturing markedly increased
the representation of dopaminergic and serotonergic neuronal
(Tuj1+) subtypes, but decreased the representation of GABA+ and
Glutamate+ neurons. Colony depicted in GABA stain at 20% O.sub.2 is
an unusual example of very high GABA expression under these
conditions. TH and GABA were not co-expressed as seen in some
developing neurons in vivo. Floor plate cells (FP4+) were more
numerous in lowered O.sub.2 cultures as was the percentage of
neurons expressing the midbrain transcription factor En1. Precursor
markers nestin and PSA-NCAM were both reduced in lowered O.sub.2
cultures after differentiation compared to 20% O.sub.2 conditions
(lower right panels). Scale bars=20 .mu.m.
[0036] FIG. 7. Differential gene expression in mesencephalic
precursors at lowered and 20% O.sub.2 assessed by RT-PCR. FIG. 7A.
Expression of genes involved in the physiological response to
changes in oxygen levels. The expression of HIF1.alpha., VHL, EPO
and VEGF was assessed after 2 or 6 days of expansion and after
differentiation (day 4 of differentiation=day 10 of culture) in
lowered and 20% O.sub.2. Data are normalized to GAPDH expression. A
significant increase in EPO expression was detected in lowered
oxygen versus 20% O.sub.2 mostly during cell differentiation,
whereas VEGF was upregulated during both expansion and
differentiation. Surprisingly, no major oxygen-dependent regulation
of HIF1.alpha. or VHL was observed. FIG. 7B. Candidate genes
involved in midbrain development were also tested for
O.sub.2-dependent differential expression. Increased expression of
TH and Ptx-3 during cell differentiation confirmed the larger
number of functional dopaminergic neurons in lowered oxygen
cultures (compare FIG. 5). Significant lowered O.sub.2-mediated
changes in expression levels of FGF8 and En1 were also
detected.
[0037] FIG. 8. EPO mimics the lowered oxygen effect on dopaminergic
differentiation. Saturating concentrations of EPO or EPO
neutralizing antibody were added to E12 mesencephalic precursor
cultures during both proliferation and differentiation phase (5
days each) in lowered or 20% O.sub.2. EPO supplementation
significantly increased TH+ cell numbers in 20% O.sub.2 cultures
(n=6, p<0.05). EPO neutralizing antibody decreased TH+ cell
numbers in both lowered oxygen (n=6, p<0.01) and 20% O.sub.2
cultures (n=6, p<0.05). Scale bar=20 .mu.m.
DETAILED DESCRIPTION OF THE INVENTION
[0038] In order for cell transplantation therapies to become widely
and universally used there is a need for availability of
appropriately differentiated, viable cells. Preferably, these cells
need to be resilient enough that they can be cryopreserved without
loss of phenotypic integrity. The high incubator O.sub.2 levels in
which the cells are grown at ambient air O.sub.2 levels (referred
to herein as traditional O.sub.2 conditions; or 20% O.sub.2 culture
conditions) do not facilitate the production of such cells. These
cells often do not survive, proliferate or differentiate in
sufficient numbers to be useful. As such expansion of these cells
in traditional culture yields a cell that is at best inadequate for
use in in vitro model assay studies let alone for use in
transplantation.
[0039] The present invention is directed towards providing methods
and compositions for producing cells that are differentiated,
viable, amenable to cryopreservation and provide an accurate
indication of how such cells behave biochemically in an in vivo
setting. As such, these methods will provide cells that can be used
in vitro to perform characterization studies or in vivo as
replacement therapies for cells that have been damaged by disease,
injury resulting from trauma, ischemia, or a drug-induced injury.
Further, it should be noted that the method leads to increased
survival of undifferentiated precursors that could also be used for
transplantation, which when placed in the appropriate environmental
conditions will differentiate down the appropriate pathway.
[0040] The present invention particularly contemplates the use of
culture conditions using subatmospheric/physiological oxygen to
culture or enrich a population of neuronal cells with cells that
are expanded and/or differentiated to express a particular neuronal
phenotype. The increase in cell differentiation may be such that
the process of a cell being converted from a primitive
undifferentiated state to one in which a particular cellular
phenotype (dopaminergic phenotype; GABAergic phenotype;
serotoninergic phenotype or the like) is expressed. Specifically,
it appears that growth in low O.sub.2 conditions results in an
enrichment in dopaminergic and serotinergic neuronal populations,
whereas GABAergic and glutaminergic neurons are relatively
decreased. These enriched populations may be subject to further
enrichment through such methods such as cell sorting.
[0041] Alternatively, it may be that the increase in
differentiation produced by this method is such that the relative
percentage of cells that go on to differentiate (as opposed to
remaining in an undifferentiated state) is increased in low oxygen.
However, incubation of a pluripotent cell line under low O.sub.2
incubation conditions in vitro, will allow the manipulation or
skewing of the direction of differentiation of the cell population.
Thus, the oxygen is used to control the number and percentage of
one type of cell in the population increased or decreased because
the differentiation pathway changes under influence of the gas.
Thus, enrichment of the CNS cells by physiologic or low levels of
oxygen may be the result of one or more mechanisms that include (1)
increase in the absolute number of CNS cells, (2) enrichment by
selective survival of CNS cells, (3) enrichment of CNS by their
selective proliferation or (4) enrichment of specific
differentiation pathways.
[0042] Any increase in the number of CNS cells is significant in
that more cells are then available to regenerate a greater volume
of new tissue. An enrichment, even without increase in number, is
important in applications where limitations on total cell number
are pertinent or when the effects of the non-CNS progenitor cell
contaminants are negative for the desired outcome or for defining
the material adequately. Any enhancement of survival of the CNS
cell, even without increase in cell number or any enrichment of
cell types is valuable in settings where culture is required (i.e.,
to handle tissue before administration of cell therapy, or to
permit any other procedure during which the cells must survive such
as transfection of genes, drug treatment, or enrichment by cell
sorting or other additional procedures).
[0043] A particular embodiment of the present invention
demonstrates that growth of CNS cells, or indeed any pluripotent
stem cell in subatmospheric culture conditions reduces the level of
apoptotic and non-apoptotic cell death. It is likely that the
increased survival of the cells may be due to both an inhibition of
apoptosis and non-apoptotic death. Apoptosis or programmed cell
death is a well known phenomenon and can be measured by techniques
well know to those of skill in the art.
[0044] A particular and novel aspect of the methods of the present
invention is that such methods all employ low ambient culture
growth conditions. By the term "low ambient oxygen conditions", the
present invention refers to any culturing conditions below
atmospheric oxygen. Thus in particular embodiments, low ambient
O.sub.2 conditions are defined as between about 0.5% and about 18%.
Ideally, the culture oxygen conditions are kept as close as
possible to the normal physiological oxygen conditions in which a
particular cell would be found in in vivo the better. Clearly, this
will mean that those conditions employed for cells will depend on
the regional origin of a particular cell. For example, cells from
an alveolar origin may prefer growth at about 14% O.sub.2; cells
from an arterial source will prefer an oxygen concentration of
about 12%; whereas those from certain regions of the brain may
prefer oxygen conditions as low as about 1.5%.
[0045] It should be noted that the low ambient oxygen conditions
are not to be considered the same as "hypoxic" conditions. The low
ambient oxygen conditions are intended to mimic physiological
conditions. As defined herein "hypoxic conditions" are those in
which the oxygen level is less than 0.1% O.sub.2 (Gross et al.,
1999).
[0046] The low ambient oxygen conditions thus will be used to
promote differentiation of CNS cells, inhibit apoptosis of cells in
culture, increase expansion of cells, and otherwise make such cells
amenable for use in transplantation. Such methods and compositions
are outlined in further detail below.
[0047] Definitions
[0048] The present section provides definitions of the terms used
in the present invention in order to facilitate a better
understanding of the invention.
[0049] A "stem cell" is a relatively undifferentiated cell that can
be induced to proliferate and that can produce progeny that
subsequently differentiate into one or more mature cell types,
while also retaining one or more cells with parental developmental
potential. In many biological instances, stem cells are also
"multipotent" because they can produce progeny of more than one
distinct cell type, but this is not required for "stem-ness."
Self-renewal is the other classical part of the stem cell
definition, and it is essential as used in this document. In
theory, self-renewal can occur by either of two major mechanisms.
Stem cells may divide asymmetrically, with one daughter retaining
the stem state and the other daughter expressing some distinct
other specific function and phenotype. Alternatively, some of the
stem cells in a population can divide symmetrically into two stems,
thus maintaining some stem cells in the population as a whole,
while other cells in the population give rise to differentiated
progeny only. Formally, it is possible that cells that begin as
stem cells might proceed toward a differentiated phenotype, but
then "reverse" and re-express the stem cell phenotype.
[0050] "Progenitor cells" have a cellular phenotype that is more
primitive (i.e., is at an earlier step along a developmental
pathway or progression than is a fully differentiated cell). Often,
progenitor cells also have significant or very high proliferative
potential. Progenitor cells may give rise to multiple distinct
differentiated cell types or to a single differentiated cell type,
depending on the developmental pathway and on the environment in
which the cells develop and differentiate. Like stem cells, it is
possible that cells that begin as progenitor cells might proceed
toward a differentiated phenotype, but then "reverse" and
re-express the progenitor cell phenotype.
[0051] "Differentiation" refers to the developmental process
whereby cells assume a specialized phenotype, i.e., acquire one or
more characteristics or functions distinct from other cell types.
In most uses, the differentiated phenotype refers to a cell
phenotype that is at the mature endpoint in some developmental
pathway. In many but not all tissues, the process of
differentiation is coupled with exit from the cell cycle-in these
cases, the cells lose or greatly restrict their capacity to
proliferate when they differentiate.
[0052] "Subatmospheric" conditions mean any oxygen concentration
below about 20%, preferably below about 15%, more preferably below
about 10%, at sea level. The term subatmoshpheric may be used
herein interchangeably with "low oxygen conditions" defined
above.
[0053] "Atmospheric O.sub.2 conditions" are those conditions found
in the air, i.e., 20-21% O.sub.2. As used herein this term is used
interchangeably with the term "traditional" O.sub.2 conditions as
traditional tissue culture incubators are kept at atmospheric
O.sub.2 conditions.
[0054] "Physiologic" oxygen levels are the range of oxygen levels
normally found in healthy tissues and organs. These levels vary
depending on tissue type (Table 1). However, it is of note that
this rate is below 15% in all tissues and below 8% in most tissues.
Thus the physiological oxygen levels can range from about 15% to
about 1.5% depending upon the region of the body being
measured.
[0055] "Hypoxia" occurs when the normal physiologic levels of
oxygen are not supplied to a cell or tissue. "Normoxia" refers to
normal physiologic levels of oxygen for the particular cell type,
cell state or tissue in question. "Anoxia" is the absence of
oxygen. "Hypoxic conditions" are those leading to cellular hypoxia.
These conditions depend on cell type, and on the specific
architecture or position of a cell within a tissue or organ, as
well as the metabolic status of the cell. A critical point is that
in most cell biology research of the past 25 years, ambient
atmospheric oxygen levels of 20-21% are routinely called and
experimentally taken to be "normoxic," but this assumption is
physiologically erroneous. In this historic context, much cell
culture literature refers to any condition with oxygen lower than
ambient atmospheric as "hypoxic," but this usage is also
physiologically incorrect.
[0056] "Acidosis" means that the pH is below normal physiologic
levels.
[0057] "Enriching" of cells means that the yield (fraction) of
cells of one type is increased over the fraction of cells in the
starting culture or preparation.
[0058] "Proliferation" refers to an increase in the number of cells
in a population (growth) by means of cell division. Cell
proliferation is generally understood to result from the
coordinated activation of multiple signal transduction pathways in
response to the environment, including growth factors and other
mitogens. Cell proliferation may also be promoted by release from
the actions of intra- or extracellular signals and mechanisms that
block or negatively affect cell proliferation.
[0059] "Regeneration" means re-growth of a cell population, organ
or tissue after disease or trauma.
[0060] Other terms used throughout the specification will have the
meaning commonly assigned by those of skill in the art unless
otherwise stated.
[0061] Central Nervous System Cells
[0062] As mentioned earlier, a particular advantage of the present
invention is that it can be used to generate viable cells or tissue
that can be used to ameliorate neurodegenerative disorders. Such
cells or tissue upon transplantation can be referred to as a graft.
The cells for transplantation can include but are not limited human
or animal neurons for stroke, brain and spinal cord injury,
Alzheimer's Disease, Huntington's Disease and other
neurodegenerative disorders; septal and GABAergic cells for
epilepsy; ventral mesencephalic or other CNS dopaminergic cells for
treatment of Parkinson's Disease; and trophic factor secreting
cells for neurological disorders, or even certain psychiatric
disorders. The cells to be used as grafts can be from primary
tissue or even from certain cell lines. Further it should be
understood that any of the cell types mentioned herein throughout
may be adult cells or from a fetal origin.
[0063] For treatment of neurological disorders, the present
invention will produce differentiated neural stem cells that
proliferate and differentiate. Undifferentiated neural progenitor
cells differentiate into neuroblasts and glioblasts which give rise
to neurons and glial cells. During development, cells that are
derived from the neural tube give rise to neurons and glia of the
CNS. Certain factors present during development, such as nerve
growth factor (NGF), promote the growth of neural cells. Methods of
isolating and culturing neural stem cells and progenitor cells are
well known to those of skill in the art (Hazel and Muller, 1997;
U.S. Pat. No. 5,750,376).
[0064] Suitable neural cells may be obtained from suitable solid
tissues these include any organ or tissue from adult, post-natal,
fetal or embryonic mammalian tissue. Any mammal can be used in this
invention, including mice, cattle, sheep, goat, pigs, dogs, rats,
rabbits, and primates (including human). Specific examples of
suitable solid tissues include neurons or central nervous system
supporting cells derived from brain tissue, germ cells or embryonic
stem cells. Stem cells and progenitor cells isolated from any other
solid organ (liver, pancreas, spleen, kidney, thyroid, etc.) or
those from marrow, spleen or blood are also amenable candidates for
culturing under physiologic or hypoxic conditions.
[0065] Hazel and Muller describe methods of isolating, culturing,
and differentiating rat brain neuroepithelial stem cells from both
fetal and adult rat brains. Briefly, neural precursors are removed
from desired regions of the fetal rat central nervous system by
dissection, dissociated to a single-cell suspension, and plated on
tissue culture dishes in medium containing the mitogen basic
fibroblast growth factor (bFGF). Initially, many of the
differentiated neurons die. Proliferating cells are then harvested
in a buffered solution. The passaged cells are relatively
homogenous for multipotent precursors. To induce differentiation to
neurons and glia, the media containing bFGF is removed and replaced
with media lacking bFGF.
[0066] Subatmospheric culturing conditions can be used in such a
protocol from the start of stem cell isolation, in order to enrich
the stem cell pool and enhance differentiation into a greater
number of cells. Subatmospheric/physiologic culture conditions can
also be used after initial plating and division, to up-regulate
certain gene products in the more differentiated brain cells.
Subatmospheric/physiologic culture conditions can also be used
throughout the process to enhance the function of the entire
population for transplantation.
[0067] Detection of neural stem cell derivatives can be determined
by antibody staining. For example, central nervous system
multipotential stems are marked by high level expression of the
intermediate filament, nestin (Hazel & Muller, 1997). The
differentiated neurons are marked by the antibody TUJ1 (O'Rourke et
al., 1997), oligodendrocytes by GalC (Bosio et al., 1996), and
astrocytes by GFAP antibodies (Rutka et al., 1997).
[0068] The methods of the present invention may be used to produce
neural cells containing a heterologous gene. Methods of producing
cells of neural origin comprising a heterologous gene and uses of
such cells are described in U.S. Pat. No. 5,750,376 (incorporated
herein by reference).
[0069] Culture Conditions
[0070] Suitable medium and conditions for generating primary
cultures are well known in the art and vary depending on cell type.
For example, skeletal muscle, bone, neurons, skin, liver, and
embryonic stem cells are all grown in media differing in their
specific contents. Furthermore, media for one cell type may differ
significantly from lab to lab and institution to institution. As a
general principle, when the goal of culturing is to keep cells
dividing, serum is added to the medium in relatively large
quantities (10-20% by volume). Specific purified growth factors or
cocktails of multiple growth factors can also be added or sometimes
used in lieu of serum. As a general principle, when the goal of
culturing is to reinforce differentiation, serum with its mitogens
is generally limited (serum about 1-2% by volume). Specific factors
or hormones that promote differentiation and/or promote cell cycle
arrest can also be used.
[0071] Physiologic oxygen and subatmospheric oxygen conditions can
be used at any time during the growth and differentiation of cells
in culture, as a critical adjunct to selection of specific cell
phenotypes, growth and proliferation of specific cell types, or
differentiation of specific cell types. In general, physiologic or
low oxygen-level culturing is accompanied by methods that limit
acidosis of the cultures, such as addition of strong buffer to
medium (such as Hepes), and frequent medium changes and changes in
CO.sub.2 concentration.
[0072] Cells can be exposed to the low oxygen conditions using a
variety of means. Specialized laboratory facilities may have
completely enclosed environments in which the oxygen levels are
controlled throughout a dedicated, isolated room. In such
specialized areas, low oxygen levels can be maintained throughout
the isolation, growth and differentiation of cells without
interruption. Very few laboratories have such specialized areas.
Physiologic or low oxygen culturing conditions also can be
maintained by using commercially-available chambers which are
flushed with a pre-determined gas mixture (e.g., as available from
Billups-Rothenberg, San Diego Calif.). As an adjunct, medium can be
flushed with the same gas mixture prior to cell feeding. In
general, it is not possible to maintain physiologic or low oxygen
conditions during cell feeding and passaging using these smaller
enclosed units, and so, the time for these manipulations should be
minimized as much as possible. Any sealed unit can be used for
physiologic oxygen or low oxygen level culturing provided that
adequate humidification, temperature, and carbon dioxide are
provided.
[0073] In addition to oxygen, the other gases for culture typically
are about 5% carbon dioxide and the remainder is nitrogen, but
optionally may contain varying amounts of nitric oxide (starting as
low as 3 ppm), carbon monoxide and other gases, both inert and
biologically active. Carbon dioxide concentrations typically range
around 5% as noted above, but may vary between 2-10%. Both nitric
oxide and carbon monoxide are typically administered in very small
amounts (i.e. in the ppm range), determined empirically or from the
literature.
[0074] The optimal physiologic or low oxygen level conditions for
any given cell type or any particular desired outcome will vary. A
skilled artisan could determine suitable subatmospheric conditions
by generating an oxygen dose response curve, in which carbon
dioxide is kept constant, and oxygen levels are varied (with
nitrogen as the remaining gas). For example, to determine the
optimal ambient oxygen culturing conditions for expansion of a CNS
cell, one would establish cultures from an organ system. The
initial culture is mixed, consisting of some differentiated cells,
cells of other developmental lineages or pathways, as well as CNS
cells. After exposure to the various oxygen levels (e.g. 1%, 2%,
5%, 10% and 15%), the number and function of CNS cells is assessed
by methods appropriate to the system. In some cases, a
constellation of molecular markers is available to rapidly identify
the cell population. But in other cases, a single marker coupled
with proliferation assays is appropriate, while in other cases
proliferation assays alone are appropriate. In some cases all or
some of the above assays are coupled with bioassays to follow the
differentiation potential of the presumed stem cells. Overall, the
precise assays used to determine stem cell and/or progenitor
response to oxygen levels are dependent on the nature of the system
examined as well as available markers and techniques specific to
that system.
[0075] The timing of physiologic or low oxygen conditions is also
part of the oxygen dose response curve. Some cells may be more or
less sensitive to oxygen during isolation or immediately after
isolation while some cells may respond only after some time in
culture. The timing of physiologic or low oxygen conditions
absolutely and in relation to other manipulations of the cultures
is part of assessing the optimal oxygen culturing conditions.
Furthermore, the mitogenic effects of other gases may be
synergistic with physiologic or low oxygen conditions. Different
gene regulatory networks may be induced by low/physiologic oxygen
culturing during different phases of culture. During expansion of
the cells, low oxygen may induce gene expression distinct from that
induced by low oxygen during differentiation.
[0076] The cells are typically exposed to low oxygen level
conditions for a time sufficient to enrich the population of
progenitor/stem cells compared to other cell types. Typically this
is for 1 or more hours, preferably 3 or more hours, more preferably
6 or more hours, and most preferably 12 or more hours, and may be
continuous. The temperature during the culture is typically
reflective of core body temperature, or about 37.degree. C., but
may vary between about 32.degree. C. and about 40.degree. C. Other
important embodiments may simply achieve an increase in cell
absolute number or promote the survival of cells.
[0077] Following an initial exposure to low or physiologic oxygen
culturing conditions, cells can be maintained in these conditions
or returned to normal laboratory oxygen conditions, depending on
the desired outcome.
[0078] It is understood that the initial medium for isolating the
CNS cells, the medium for proliferation of these cells, and the
medium for differentiation of these cells can be the same or
different. All can be used in conjunction with low or physiologic
oxygen level culturing. The medium can be supplemented with a
variety of growth factors, cytokines, serum, etc. Examples of
suitable growth factors are basic fibroblast growth factor (bFGF),
vascular endothelial growth factor (VEGF), epidermal growth factor
(EGF), transforming growth factors (TGF.alpha. and TGF.beta.),
platelet derived growth factors (PDGFs), hepatocyte growth factor
(HGF), insulin-like growth factor (IGF), insulin, erythropoietin
(EPO), and colony stimulating factor (CSF). Examples of suitable
hormone medium additives are estrogen, progesterone, testosterone
or glucocorticoids such as dexamethasone. Examples of cytokine
medium additives are interferons, interleukins, or tumor necrosis
factor-.alpha. (TNF.alpha.). One skilled in the art will test
additives and culture components at varied oxygen levels, as the
oxygen level may alter cell response to, active lifetime of
additives or other features affecting their bioactivity. In
addition, the surface on which the cells are grown can be plated
with a variety of substrates that contribute to survival, growth
and/or differentiation of the cells. These substrates include but
are not limited to laminin, poly-L-lysine, poly-D-lysine,
polyornithine and fibronectin.
[0079] Additional Factors for Promotion of Growth and
Differentiation
[0080] As described herein, the present invention provides methods
of increasing the survival, differentiation and phenotypic
integrity of CNS cells. This method generally involves growing
these cells in vitro within physiological oxygen parameters. There
is now a wealth of literature pointing to other factors that may
increase the survival of such cells. It is contemplated that the
use of some of these factors in combination with the growth
conditions of the present invention will be useful.
[0081] Much of this interest has focussed on finding trophic
factors These factors are able to increase the survival of
dopaminergic cells prepared for transplantation; maintain the in
situ survival post-transplantation of embryonic neurons
transplanted into the striatum; as well as increase graft volume,
and thereby re-innervate a larger part of the caudate and putamen
which has been shown to have effect both in vitro and in vivo.
[0082] Trophic factors such as NGF, bFGF, EGF, IGF I and II,
TGF.beta.1-3, PDGF, brain derived growth factor (BDNF), ganglion
derived growth (GDNF), neurotrophin (NT)-3, NT-4, and ciliary
neuronal trophic factor (CNTF), (Engele and Bohn, 1996; Mayer et
al., 1993a and 1993b; Knusel et al., 1990, 1991; Poulsen et al.,
1994; Nikkhah et al., 1993; Othberg et al., 1995; Hyman et al.,
1991) have been investigated and shown to have pronounced effects
in vitro.
[0083] MPTP and 6-OHDA lesions in primates are models of certain
neurodegenerative disorders. It has been shown that the effects of
such lesions can be reversed in primates and rats (Gash et al.,
1996) by the addition of NGF or bFGF to the cell suspension prior
to grafting. The same factors also have been shown to increase
graft survival, if added to the cell suspension prior to grafting
(Chen et al., 1996; Dunnett and Bjorkland., 1994). Additional
studies showed an increased graft survival rate in transplanted
neurons derived from a neural progenitor (CINP) cell line, that
were retrovirally transduced with NGF (Martinez-Serrano et al.,
1995) and astrocytes transduced with BDNF (Yoshimoto et al., 1995).
GDNF has been shown to increase graft survival, extend fiber
outgrowth and alleviate behavioral effects after 6-hydroxydopamine
lesions in the striatum of rats (Sauer et al., 1994; Bowenkamp et
al., 1995; Rosenblad et al., 1996; Olson, 1996).
[0084] Thus these and other factors that may prolong the survival
of the CNS cells either in vitro or in viva are contemplated for
use in the growth and maintenance conditions described in the
present invention.
[0085] Transplantation Methods
[0086] Laboratory and clinical studies have shown the
transplantation of cells into the CNS is a potentially significant
alternative therapeutic modality for neurodegenerative disorders
such as Parkinson's disease (Wictorin et al., 1990; Lindvall et al,
1990; Sanberg et al., 1994; Bjorklund and Stenevi, 1985; Freeman et
al., 1994). In some cases, transplanted neural tissue can survive
and form connections with the CNS of the recipient, i.e. the host
(Wictorin et al., 1990). When successfully accepted by the host,
the transplanted cells and/or tissue have been shown to ameliorate
the behavioral deficits associated with the disorder (Sanberg et
al., 1994). The obligatory step for the success of this kind of
treatment is to have enough viable cells available for the
transplant. The physiologic/subatmospheric culturing conditions
described herein can be used to differentiate specific populations
of CNS cells useful for transplantation, and to expand the number
of available CNS cells derived from a variety of culture
systems.
[0087] In addition to cell cultures described above, fetal neural
tissue is another important source for neural transplantation
(Lindvall et al., 1990; Bjorklund, 1992; Isacson et al., 1986;
Sanberg et al., 1994). Other viable graft sources include adrenal
cells and various cell types that secrete neural growth factors and
trophic factors. The field of neural tissue transplantation as a
productive treatment protocol for neurodegenerative disorders has
received much attention resulting in its progression to clinical
trials. To date the major problem with this filed has been the lack
of ability to obtain enough viable cells. The present invention
provides a method of maintaining such tissue in a state that will
prevent them from losing their ability to serve as an appropriate
graft for neurodegenerative diseases.
[0088] Methods of grafting cells are now well known to those of
skill in art (U.S. Pat. No. 5,762,926; U.S. Pat. No. 5,650,148;
U.S. Pat. No. 5,082,670). Neural transplantation or grafting
involves transplantation of cells into the central nervous system
or into the ventricular cavities or subdurally onto the surface of
a host brain. Conditions for successful transplantation include: 1)
viability of the implant; 2) retention of the graft at the site of
transplantation; and 3) minimum amount of pathological reaction at
the site of transplantation.
[0089] Methods for transplanting various nerve tissues, for example
embryonic brain tissue, into host brains have been described in
Neural Grafting in the Mammalian CNS, Bjorklund and Stenevi, eds.,
(1985) Das, Ch. 3 pp. 23-30; Freed, Ch. 4, pp. 31-40; Stenevi et
al., Ch. 5, pp. 41-50; Brundin et al., Ch. 6, pp. 51-60; David et
al., Ch. 7, pp. 61-70; Seiger, Ch. 8, pp. 71-77 (1985),
incorporated by reference herein. These procedures include
intraparenchymal transplantation, i.e. within the host brain (as
compared to outside the brain or extraparenchymal transplantation)
achieved by injection or deposition of tissue within the host brain
so as to be opposed to the brain parenchyma at the time of
transplantation (Das, supra).
[0090] The two main procedures for intraparenchymal transplantation
are: 1) injecting the donor cells within the host brain parenchyma
or 2) preparing a cavity by surgical means to expose the host brain
parenchyma and then depositing the graft into the cavity (Das,
supra). Both methods provide parenchymal apposition between the
graft and host brain tissue at the time of grafting, and both
facilitate anatomical integration between the graft and host brain
tissue. This is of importance if it is required that the graft
become an integral part of the host brain and to survive for the
life of the host.
[0091] Alternatively, the graft may be placed in a ventricle, e.g.
a cerebral ventricle or subdurally, i.e. on the surface of the host
brain where it is separated from the host brain parenchyma by the
intervening pia mater or arachnoid and pia mater. Grafting to the
ventricle may be accomplished by injection of the donor cells or by
growing the cells in a substrate such as 3% collagen to form a plug
of solid tissue which may then be implanted into the ventricle to
prevent dislocation of the graft. For subdural grafting, the cells
may be injected around the surface of the brain after making a slit
in the dura. Injections into selected regions of the host brain may
be made by drilling a hole and piercing the dura to permit the
needle of a microsyringe to be inserted. The microsyringe is
preferably mounted in a stereotaxic frame and three dimensional
stereotaxic coordinates are selected for placing the needle into
the desired location of the brain or spinal cord.
[0092] The donor cells may also be introduced into the putamen,
nucleus basalis, hippocampus cortex, striatum or caudate regions of
the brain, as well as the spinal cord.
[0093] For grafting, the cell suspension is drawn up into the
syringe and administered to anesthetized graft recipients. Multiple
injections may be made using this procedure. The age of the donor
tissue, i.e., the developmental stage, may affect the success of
cell survival after grafting.
[0094] The cellular suspension procedure thus permits grafting of
donor cells to any predetermined site in the brain or spinal cord,
is relatively non-traumatic, allows multiple grafting
simultaneously in several different sites or the same site using
the same cell suspension, and permits mixtures of cells from
different anatomical regions. Multiple grafts may consist of a
mixture of cell types, and/or a mixture of transgenes inserted into
the cells. Preferably from approximately 1 to approximately 108
cells are introduced per graft.
[0095] For transplantation into cavities, which may be preferred
for spinal cord grafting, tissue is removed from regions close to
the external surface of the CNS to form a transplantation cavity,
for example by removing bone overlying the brain and stopping
bleeding with a material such a gelfoam (Stenevi et al., Brain Res.
114:1-20 (1976)). Suction may be used to create the cavity. The
graft is then placed in the cavity. More than one transplant may be
placed in the same cavity using injection of cells or solid tissue
implants.
[0096] Grafting of donor cells into a traumatized brain will
require different procedures, for example, the site of injury must
be cleaned and bleeding stopped before attempting to graft. In
addition, the donor cells should possess sufficient growth
potential to fill any lesion or cavity in the host brain to prevent
isolation of the graft in the pathological environment of the
traumatized brain.
[0097] Measurement of Phenotype of Cells
[0098] In specific embodiments, it may be necessary to monitor the
phenotype of the cell that has been grown in the subatmospheric
oxygen conditions so as to determine whether differentiation or
other modification of the cell has occurred. Various methods may be
used to achieve this, including monitoring message level, protein
level, subcellular localization, functional assays or morphological
changes. The methods for monitoring message level include PCR.TM.
(U.S. Pat. No. 5,364,790; U.S. Pat. No. 4,800,159; U.S. Pat. No.
4,683,195), In situ hybridization (U.S. Pat. No. 4,888,278; U.S.
Pat. No. 4,886,741; U.S. Pat. No. 5,506,098; U.S. Pat. No.
5,225,326; U.S. Pat. No. 5,521,061; U.S. Pat. No. 5,538,869; U.S.
Pat. No. 5,665,540), RNAse protection assay, and single cell
PCR.TM.. The methods for monitoring protein level may use antibody
staining, HPLC, western blotting or immunoprecipitation. These
techniques are all well known to those of skill in the art.
[0099] The ability to detect genes that are differentially
expressed in two cell types or populations combined with advances
of rapid gene detection and sequencing technologies may be used to
compare gene expression in cells cultured under varying oxygen
concentrations.
[0100] Methods of differential display have been used to elucidate
the genes responsible for a difference in phenotypes between two
relatively similar cell types or during sequential changes of a
cell from one state to another. For example, using the differential
display technique, Kocher et al. (1995) selected for genes that
were up-regulated in renal cell carcinoma compared with normal
renal parenchyma. Through this method, Kocher et al. (1995) were
able to isolate a gene (DD96) that was rarely expressed in normal
epithelial cell populations, expressed diffusely in malignant
epithelial cells of the wide majority of carcinomas, and markedly
overexpressed in carcinomas originating from the colon, breast, and
lung. A similar technique can be used to compare gene expression in
cells incubated under traditional versus low oxygen level
conditions. Genes up-regulated in one population over the other
then may be used as a probe to screen for expression of that gene
in other cell populations or the same cell population under
different culturing conditions (i.e., in the presence of compounds
or environmental stimuli that may affect the expression of the
gene).
[0101] Kang et al. (1998) have developed a reciprocal subtraction
differential RNA display (RSDD) method that permits the rapid and
efficient identification and cloning of both abundant and rare
differentially expressed genes. The technology was used to analyze
gene expression alterations resulting during cancer progression as
adenovirus-transformed rodent cells developed an aggressive
transformed state (Kang et al., 1998). The approach resulted in the
identification and cloning of known and unknown sequences that
displayed expression as a function of progression and suppressed
expression as a function of progression (Kang et al., 1998). The
RSDD technique may be used to compare gene expression between cells
during maintenance, proliferation and/or differentiation of the
cells from progenitor or stem cells to fully differentiated cells
in room air versus subatmospheric conditions.
[0102] The methods of differential display may be used in
conjunction with rapid DNA sequencing and detection methods,
allowing for the ability to screen for or sequence a large number
of genes in a relatively short amount of time. U.S. Pat. No.
5,800,992 provides methods for detecting the differential
expression of a plurality of genes between two cell types using
complimentary polynucleotides in an array. Such technology is
commonly referred to as "DNA chip" technology because the
polynucleotides are deposited on a substrate that resemble computer
microprocessor chips. Also described are methods of sequencing
genes using DNA chips.
[0103] Additionally, similar techniques are described in U.S. Pat.
No. 5,834,181 which utilizes similar technology to detect minor
alterations in genes such as single nucleotide substitution,
allowing detection of mutations in genes that lead to a change in
the phenotype of a cell.
[0104] Single-cell reverse transcriptase-polymerase chain reaction
(RT-PCR) technique, also will be useful in monitoring the phenotype
of the cells grown in the present invention. Such a technique is
described by, for example, Cornelison and Wold (1997).
[0105] The single cell RT-PCR technique of Cornelison and Wold
allows determination of expression of a number of genes at one time
and may be used to identify skeletal muscle satellite cells and
determine their activation state when incubated in the
low/physiological oxygen conditions of the present invention.
[0106] Another detection method commonly used is an RNAse
protection assay in which a radiolabeled RNA probe is mixed with a
test RNA population, such as total cellular RNA from an individual,
under conditions where complementary segments of the RNA probe and
the test RNA will hybridize. RNAse is then added to the mixture to
destroy unprotected (unhybridized), single-stranded probe and test
RNA. When all single-stranded RNA has been destroyed, only short
fragments of protected RNA remains that can be analyzed
electrophoretically to diagnose the particular RNA composition of
the test RNA. The protected double-stranded RNA fragments are
denatured before analysis, to make available the detectable,
labeled single stranded RNA probe fragment.
[0107] Disease Models
[0108] Once a particular set of cells have been generated it will
of course be necessary to test that these cells would apply to a
disease model. Animal models of Parkinson's Disease and other
neurodegenerative diseases are now well known to those of skill in
the art.
[0109] For example, a rat model of Parkinson's disease can be
created by giving a unilateral injection of saline-ascorbate
6-hydroxy-dopamine (6-OHDA) into the medial forebrain bundle. This
produces a lesion that ultimately mimics Parkinsonian behavior.
Completeness of the lesion produced can by monitoring either
apomorphine or amphetamine induced rotational behavior (Ungerstedt
and Arbuthnott, 1970). Animals turning at a rate of more than 7
turns per minute (Schmidt et al., 1982) can be inferred to have the
appropriate lesion (at least 7 contralateral rotations/min
following apomorphine administration and at least 7 ipsilateral
rotations/min towards the side of the lesion following amphetamine
administration).
[0110] Using such a model a baseline rotation behavior can be
established. After that, the cells grown in the present invention
can then be transplanted into the rat model as described herein
above. Any decrease in the rotational behavior would be indicative
of the cellular transplant having an appropriate therapeutic
value.
[0111] Gene Replacement/Augmentation Applications
[0112] Optionally, the CNS cells obtained using the method of the
present invention can be manipulated to express desired gene
products. Gene therapy can be used to either modify a cell to
replace a gene product, to facilitate regeneration of tissue, to
treat disease, or to improve survival of the cells following
implantation into a patient (i.e. prevent rejection).
[0113] In this embodiment, the CNS cells are transfected prior to
expansion and differentiation. Techniques for transfecting cells
are known in the art.
[0114] A skilled artisan could envision a multitude of genes which
would convey beneficial properties to the transfected cell or, more
indirectly, to the recipient patient/animal. The added gene may
ultimately remain in the recipient cell and all its progeny, or may
only remain transiently, depending on the embodiment. For example,
genes encoding tyrosine hydroxylase, or a monoamine transporter
such as VMAT 1 or VMAT 2 could be transfected into certain CNS
cells to provide an appropriate therapeutic cell suitable for
grafting into a subject with Parkinson's disease. Other genes that
could be used include GABA-decarboxylase, enkephalin, dopa
decarboxylase (AADC), ciliary neuronal trophic factor (CNTF), brain
derived neurotrophic factor (BDNF), neurotrophin (NT)-3, NT-4, and
basic fibroblast growth factor (bFGF). In some situations, it may
be desirable to transfect the cell with more than one gene. Of
course the above therapeutic genes are only exemplary and those of
skill in the art will understand that any neurodegenerative
disorder that results from an aberration in gene expression and/or
function can be treated by gene replacement and/or augmentation.
Such disorders and their related genes are well known to those of
skill in the art.
[0115] In some instances, it is desirable to have the gene product
secreted. In such cases, the gene product preferably contains a
secretory signal sequence that facilitates secretion of the
protein.
[0116] The viral vectors used herein may be adenoviral (U.S. Pat.
No. 5,824,544; U.S. Pat. No. 5,707,618; U.S. Pat. No. 5,693,509;
U.S. Pat. No. 5,670,488; U.S. Pat. No. 5,585,362; each incorporated
herein by reference), retroviral (U.S. Pat. No. 5,888,502; U.S.
Pat. No. 5,830,725; U.S. Pat. No. 5,770,414; U.S. Pat. No.
5,686,278; U.S. Pat. No. 4,861,719 each incorporated herein by
reference), an adeno-associated viral (U.S. Pat. No. 5,474,935;
U.S. Pat. No. 5,139,941; U.S. Pat. No. 5,622,856; U.S. Pat. No.
5,658,776; U.S. Pat. No. 5,773,289; U.S. Pat. No. 5,789,390; U.S.
Pat. No. 5,834,441; U.S. Pat. No. 5,863,541; U.S. Pat. No.
5,851,521; U.S. Pat. No. 5,252,479; each incorporated herein by
reference), an adenoviral-adenoassociated viral hybrid (U.S. Pat.
No. 5,856,152 incorporated herein by reference), a lentiviral
vector, a vaccinia viral or a herpesviral (U.S. Pat. No. 5,879,934;
U.S. Pat. No. 5,849,571; U.S. Pat. No. 5,830,727; U.S. Pat. No.
5,661,033; U.S. Pat. No. 5,328,688; each incorporated herein by
reference) vector.
[0117] Delivery of the expression constructs through non-viral
vectors also is contemplated. Such delivery may employ
microinjection (U.S. Pat. No. 5,612,205), electroporation (U.S.
Pat. No. 5,507,724; U.S. Pat. No. 5,869,326; U.S. Pat. No.
5,824,547; U.S. Pat. No. 5,789,213; U.S. Pat. No. 5,749,847; U.S.
Pat. No. 5,019,034; Tur-Kaspa et al., 1986; Potter et al., 1984),
calcium phosphate coprecipitation (Graham and Van Der Eb, 1973;
Chen and Okayama, 1987; Rippe et al., 1990), DEAE dextran
introduction (Gopal, 1985), receptor mediated introduction (Wu and
Wu, 1987; Wu and Wu, 1988), liposome mediated introduction (U.S.
Pat. No. 5,631,018; U.S. Pat. No. 5,620,689; U.S. Pat. No.
5,861,314; U.S. Pat. No. 5,855,910; U.S. Pat. No. 5,851,818; U.S.
Pat. No. 5,827,703, U.S. Pat. No. 5,785,987; Nicolau and Sene,
1982; Fraley et al., 1979), dendrimer technology (U.S. Pat. No.
5,795,581; U.S. Pat. No. 5,714,166; U.S. Pat. No. 5,661,025), naked
DNA injection (Harland and Weintraub, 1985) and particle
bombardment (U.S. Pat. No. 5,836,905; U.S. Pat. No. 5,120,657; Yang
et al., 1990).
[0118] The desired gene is usually operably linked to its own
promoter or to a foreign promoter which, in either case, mediates
transcription of the gene product. Promoters are chosen based on
their ability to drive expression in restricted or in general
tissue types, or on the level of expression they promote, or how
they respond to added chemicals, drugs or hormones. Particularly
contemplated promoters include but are not limited to CMV E, SV40
IE, .beta.-actin, collagen promoter, TH promoter, AADC promoter and
the nestin promoter.
[0119] Other genetic regulatory sequences that alter expression of
a gene may be co-transfected. In some embodiments, the host cell
DNA may provide the promoter and/or additional regulatory
sequences.
[0120] Other elements that can enhance expression can also be
included such as an enhancer or a system that results in high
levels of expression.
[0121] Methods of targeting genes in mammalian cells are well known
to those of skill in the art (U.S. Pat. Nos. 5,830,698; 5,789,215;
5,721,367 and 5,612,205). By "targeting genes" it is meant that the
entire or a portion of a gene residing in the chromosome of a cell
is replaced by a heterologous nucleotide fragment. The fragment may
contain primary the targeted gene sequence with specific mutations
to the gene or may contain a second gene. The second gene may be
operably linked to a promoter or may be dependent for transcription
on a promoter contained within the genome of the cell. In a
preferred embodiment, the second gene confers resistance to a
compound that is toxic to cells lacking the gene. Such genes are
typically referred to as antibiotic-resistance genes. Cells
containing the gene may then be selected for by culturing the cells
in the presence of the toxic compound.
[0122] Application to Other Cell Types
[0123] Although the majority of the discussion above is focussed on
the growth and culturing of CNS cells, it should be appreciated
that techniques of the present invention also will be useful for
growth of other types of cells. As such it is contemplated that the
techniques provided herein will be useful for growing any cells
that are routinely used in transplant therapies. For example, such
cells may be islets cells for diabetes; myoblasts for muscular
dystrophy; hepatocytes for liver disease; skin grafts for wound
healing and/or burns, and bone marrow or stem cells for
hematopoietic and genetic disorders. In addition, the disclosure of
U.S. application Ser. No. 09/195,569 filed Nov. 18, 1998,
(specifically incorporated herein by reference) will provide
additional examples that may be useful in conjunction with the
present invention.
EXAMPLES
[0124] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Material and Methods
[0125] Culture of CNS Stem Cells. Animals were housed and treated
following NIH guidelines. Cells dissected from rat embryonic
lateral ganglionic eminence (E14) or mesencephalon (E12) were
mechanically dissociated, plated on plastic 24-well plates (Costar)
or 12 mm glass cover slips (Carolina Biologicals) precoated with
polyomithine/fibronecti- n, and grown in defined medium with bFGF
(Studer et al., 1998; Johe et al., 1996). In general, bFGF was
withdrawn from the medium after 4-6 days of culture. Clonal assays
were carried out in plastic 48-well plates (Costar). In some
studies, recombinant human (rh) EPO, rhVEGF.sub.165 or recombinant
mouse (rm) FGF8b, or their neutralizing antibodies (all from
R&D Systems) were added to cultures at the following
concentrations: EPO 0.5 .mu.g/ml, EPO neutralizing antibody 10
.mu.g/ml, FGF8250 ng/ml, FGF8b neutralizing antibody 5 .mu.g/ml,
VEGF 50 ng/ml, VEGF neutralizing antibody 0.5 .mu.g/ml. Dose
response for EPO was carried out at 0.05 U/ml, 0.5 U/ml, 5 U/ml and
15 U/ml; for anti-EPO at 10 .mu.g/ml and 100 .mu.g/ml. Results of
all experiments were confirmed by at least 2 independent culture
series.
[0126] Low oxygen culture. Cultures were placed in humidified
portable isolation chambers (Billups-Rothenberg, Del Mar Calif.),
flushed daily with a gas mixture 1% O.sub.2, 5% CO.sub.2+94%
N.sub.2. Precise O.sub.2 levels in the surrounding atmosphere
depended on the length of chamber flush (90 sec at 15 L/mm achieved
6% O.sub.2, 6 minutes of flush achieved 1.5% O.sub.2), which was
not standardized until availability of an O.sub.2-sensitive
electrode system (OS2000, Animus Corp., Frazer Pa.). Thus "lowered
O.sub.2" conditions represent a range of ambient O.sub.2 of
3.+-.2%, which approximates normal brain tissue levels (Table 1).
The entire chamber was housed in an incubator to maintain
temperature at 37.degree. C.
[0127] BrdU uptake and TUNEL analysis. Bromodeoxyuridine (10 .mu.M)
was added to cultures for exactly 60 minutes, just prior to
fixation. Anti-BrdU staining was performed according to the
manufacturer's protocol (Amersham Life Sciences). The TUNEL
reaction (Boehringer-Mannheim) was also performed according to
manufacturer's protocol. TUNEL+ cells were visualized by
metal-enhanced DAB reaction (Pierce) after peroxidase conversion of
the FITC label.
[0128] Immunohistochemistry. Cells were fixed in 4%
paraformaldehyde+0.15% picric acid/PBS. Standard
immunohistochemical protocols were followed. The following
antibodies were used: Stem celuprogenitor characterization: Nestin
polyclonal #130 1:500 (Martha Marvin & Ron McKay), PSA-NCAM,
En1 and FP4 (all monoclonal 1:2, Developmental Studies Hybridoma
Bank, provided by Tom Jessel). Stem cell differentiation:
.beta.-tubulin type III (Tuj1) monoclonal 1:500 and polyclonal
1:500 (both BabCO), O4 monoclonal 1:5 (Boehringer-Mannheim),
galactocerebroside (GalC) monoclonal 1:50 (Boehringer-Mannheim),
glial fibrillary acidic protein (GFAP) 1:100 (ICN Biochemicals).
Neuronal subtype differentiation: Tyrosine hydroxylase (TH)
polyclonal 1:200-1:500 (PelFreeze, Rogers AK) or monoclonal 1:2000
(Sigma), GABA polyclonal 1:500 (Sigma), glutamate 1:500 (Sigma),
dopamine-.beta.-hydroxylase (DBH) 1:100 (Protos Biotech Corp).
Appropriate fluorescence-tagged (Jackson Immunoresearch) or
biotinylated (Vector Laboratories) secondary antibodies followed by
metal-enhanced DAB reaction (Pierce) were used for
visualization.
[0129] Cell Counts and Statistical Procedures. Uniform random
sampling procedures were used for cell counts and quantified using
the fractionator technique (Gundersen, et al., 1988). Statistical
comparisons were made by ANOVA with posthoc Dunnett test when more
than 2 groups were involved. If data were not normally distributed,
a non-parametric test (Mann-Whitney U) was used to compare lowered
vs. 20% O.sub.2 results. Data are expressed as mean.+-.SEM.
[0130] Reverse-phase HPLC determinations of dopamine content.
Culture supernatants of medium, HBSS, and HBSS+56 mM KCl were
stabilized with orthophosphoric acid and metabisulfite, and stored
at -80.degree. C. until analysis. Stabilization, aluminum
adsorption, equipment, and elution of dopamine have been previously
described (Studer et al., 1998; Studer et al., 1996). Results were
normalized against dopamine standards at varying flow rates and
sensitivities.
[0131] Western blots. Cell pellets were stored at -80.degree. C.
Pellet was lysed in 20 mM Hepes, pH 7.6, 20% glycerol, 10 mM NaCl,
1.5 mM MgCl.sub.2, 0.2 mM EDTA, 0.1% Triton-X-100, with protease
inhibitors (Complete, Boehringer-Mannheim), homogenized, and
incubated on ice for 1 hr. After centrifugation, supernatant
protein concentration was assayed by BCA (Pierce). For western,
block was 5% milk in TBST, primary TH antibody (Pel-Freeze, Rogers,
Ak.) was used at 1:500, and secondary was HRP-conjugated goat
anti-rabbit (Pierce) at 1:5000. Signal was detected with
SuperSignal (Pierce).
[0132] RTPCR.TM.. Cultures were washed once in PBS before
solubilization in 2 ml (per 6 cm dish) Trizol (Life Technologies)
then stored at -80.degree. C. RNA extraction was carried out
according to manufacturer's recommendations (Gibco Life
Technologies) The Superscript kit (Gibco Life Technologies) was
used for reverse transcription of 10 .mu.g RNA per condition. PCR
conditions were optimized by varying MgCl concentration and cycle
number to determine linear amplification range. Amplification
products were identified by size and confirmed by DNA sequencing.
TH was kindly provided by Vera Vikodem, NIDDK, 30 cyc., 56.degree.
C., 300 bp. For the other products the primer sequences, cycle
numbers, and annealing temperatures were as shown in Table 2.
2TABLE 2 primer sequences, cycle numbers, and annealing
temperatures for PCR Identity Forward primer Reverse primer
Conditions GAPDH CTCGTCTCATAGACAAGATGGTGAAG
AGACTCCACGACATACTCAGCACC 28 cyc., 59.degree. C., 305 bp (SEQ ID
NO:1) (SEQ ID NO:2) VHL CCTCTCAGGTCATCTTCTGCAACC
AGGGATGGCACAAACAGTTCC 35 cyc., 60.degree. C., 208 bp (SEQ ID NO:3)
(SEQ ID NO:4) HIF1.alpha. GCAGCACGATCTCGGCGAAGCAAA
GCACCATAACAAAGCCATCCAGGG 30 cyc., 59.degree. C., 235 bp (SEQ ID
NO:5) (SEQ ID NO:6) EPO CGCTCCCCCACGCCTCATTTG
AGCGGCTTGGGTGGCGTCTGGA 30 cyc., 60.degree. C., 385 bp (SEQ ID NO:7)
(SEQ ID NO:8) VEGF GTGCACTGGACCCTGGCTTTACT CGCCTTGCAACGCGAGTCTGTGTT
30 cycles, 60.degree. C., 474 bp (SEQ ID NO:9) (SEQ ID NO:10)
(detects VEGF-1, VEGF-2 AND VEGF-3) Nurr1 TGAAGAGAGCGGAGAAGGAGATC
TCTGGAGTTAAGAAATCGGAGCTG 30 cyc., 55.degree. C., 255 bp (SEQ ID
NO:11) (SEQ ID NO:12) Ptx3 CGTGCGTGGTTGGTTCAAGAAC
GCGGTGAGAATACAGGTTGTGAAG 35 cyc., 600C, 257 Bp (SEQ ID NO:13) (SEQ
ID NO:14) SHH GGAAGATCACAAGAAACTCCGAAC GGATGCGAGCTTTGGATTCATAG 30
cyc., 59.degree. C., 354 bp (SEQ ID NO:15) (SEQ ID NO:16) FGF8
CATGTGAGGGACCAGAGCC GTAGTTGTTCTCCAGCAGGATC 35 cyc., 60.degree. C.,
312 bp (SEQ ID NO:17) (SEQ ID NO:18) En1 TCAAGACTGACTACAGCAACCCC
CTTTGTCCTGAACCGTGGTGGTAG 30 cyc., 60.degree. C., 381 bp (SEQ ID
NO:19) (SEQ ID NO:20) FGFR3 ATCCTCGGGAGATGACGAAGAC
GGATGCTGCCAAACTTGTTCTC 30 cyc., 55.degree. C., 326 bp (SEQ ID
NO:21) (SEQ ID NO:22) GDNF according to Moreau et al., 1998 BDNF
GTGACAGTATTAGCGAGTGGG GGGTAGTTCGGCATTGC 35 cycles, 56.degree. C.,
213 bp (SEQ ID NO:23) (SEQ ID NO:24)
Example 2
Results: Lowered O.sub.2 Augments Expansion of Striatal and
Mesencephalic Precursors
[0133] E14 rat striatum, widely used for derivation of CNS
precursors, cultured in lowered O.sub.2 yielded an average 2- to
3-fold more cells than 20% O.sub.2 cultures over a wide range of
plating densities in the presence of bFGF. (Basic FGF acts as
mitogen for stem cells obtained from many regions of the developing
brain. The withdrawal of bFGF initiates differentiation to neurons,
astrocytes and oligodendrocytes). (FIG. 1). Identical results were
obtained with E12 mesencephalic precursors. For all results, data
were verified by at least two independent culture series.
[0134] Effects on cell proliferation and cell death. To test
whether increased cell yield in lowered O.sub.2 is due to increased
proliferation, reduced cell death, or both, precursors were pulsed
with bromodeoxyuridine (BrdU) for 1 hr immediately before fixation
at multiple time points while precursor cells were proliferating or
differentiating. Both mesencephalic and striatal precursors showed
increased BrdU labeling indices when grown in lowered O.sub.2 as
compared to traditional cultures. Lowered O.sub.2 increased the
BrdU labeling index in the presence of bFGF and during cell
differentiation following mitogen withdrawal from mesencephalic
precursors (FIG. 2). BrdU incorporation rates for striatal
precursors showed similar patterns {Day 2 of expansion: 18.+-.6% in
lowered O.sub.2 VS. 11.+-.6% in 20% O.sub.2 (n=24, p<0.05). Day
6 of expansion: 30.+-.8% in lowered O.sub.2 Vs. 22.+-.5% in 20%
O.sub.2 (n=24, p<0.05). Day 4 of differentiation (10 days in
vitro): 12.+-.5% in lowered O.sub.2 vs. 3.+-.3% in 20% O.sub.2
(n=24, p<0.05)}.
[0135] In addition to this apparent increase in cell proliferation
in lowered O.sub.2 cultures, precursor cells were also less likely
to undergo apoptosis than CNS precursors grown in 20% O.sub.2. Both
mesencephalic and striatal precursors revealed significantly
reduced percentages of TUNEL-positive cells both during expansion
and after bFGF withdrawal. TUNEL data for mesencephalic precursors
are summarized in FIG. 3. Thus, both reduced apoptosis and
increased cell proliferation contribute to elevated yield of cells
at the end of the expansion phase. Cell death is reduced but not
entirely eliminated during the differentiation phase by lowering
the O.sub.2 levels.
[0136] Cell lineage and clonal growth. A series of molecular
markers were used, together with morphologic assessment in order to
characterize how lowered O.sub.2 culturing affects the choice of
differentiation pathways and the kinetics of differentiation.
Immunoreactivity for the intermediate filament nestin was used to
discriminate CNS stem and progenitor cells from more differentiated
progeny (Lendahl et al., 1990). Six days after bFGF withdrawal the
percentage of nestin-positive cells derived from expanded
precursors was grossly reduced in lowered O.sub.2 cultures compared
with 20% O.sub.2 cultures, suggesting that differentiation might
have been accelerated in lowered O.sub.2 (FIG. 4A and FIG. 6). The
sialic acid substituted form of NCAM (PSA-NCAM), a proposed marker
for committed neuronal progenitors (Mayer et al., 1997), was
conversely reduced in differentiated lowered O.sub.2 cultures (FIG.
6). The idea of accelerated progression to a more differentiated
phenotype was supported by the earlier appearance of neuronal and
glial markers in lowered O.sub.2. Neurons were assessed by
.beta.-tubulin III (TUJ1) staining, astrocytes by glial fibrillary
acidic protein (GFAP), oligodendrocyte precursors by O4, and
oligodendrocytes by GalC galactocerebroside staining (FIG. 4). Five
days after bFGF withdrawal striatal cultures held at low O.sub.2
contained 46% Tuj1-positive cells vs. 34% in 20% O.sub.2 (n=12,
p<0.05); Six percent were GFAP+ vs. 2% in 20% O.sub.2 (n=12,
p<0.05); and 4% were Gal-C+ vs. 5% in 20% O.sub.2 (p=n.s.). In
mesencephalic cultures held at lowered oxygen, 73% were Tuj1+ vs.
63% in 20% O.sub.2 (n=12, p=0.06); no GFAP+ cells were detected in
either oxygen conditions; 1% were O4+versus 0% in 20% O.sub.2
(n=12, p<0.01). (FIG. 4B).
[0137] To investigate O.sub.2 effects at clonal densities,
mesencephalic precursors were first expanded in bFGF for 6 days in
20% O.sub.2, replated at a density of 1-5 cells/well, then
maintained at either lowered or 20% O.sub.2. After 20 days, 20
ng/mL bFGF was withdrawn. Clonal cultures with typical
multi-lineage differentiation responses were observed in both
lowered and 20% O.sub.2 conditions. FIG. 4C illustrates a typical
nestin+ clone (left panel) and clonally derived cells undergoing
neuronal differentiation 4 days after mitogen withdrawal (right
panel). As expected of stem cells, all three lineages were
represented in the clones grown in low oxygen conditions. However,
the efficiency of clone formation was 3 times higher in lowered
O.sub.2 and the average clone size also increased from <50 cells
in 20% O.sub.2 to 50-500 cells in lowered O.sub.2 (FIG. 4D, FIG.
4F).
Example 3
Results: Neuronal Subtype Differentiation
[0138] The results above establish that lowered oxygen conditions
support stem cell proliferation and differentiation to neurons and
glia. The inventors' previous work has shown that nestin-positive
mesencephalic precursors differentiate into functional dopaminergic
neurons (Studer et al., 1998). Next it was determined whether this
specific neuronal fate was influenced by lowered O.sub.2.
Mesencephalic precursors in lowered oxygen displayed a striking
increase in both the absolute number and fraction of neurons
expressing TH (FIG. 5A, FIG. 5B). In lowered O.sub.2, large
neuronal clusters were seen in which virtually all neurons were
TH+. On average, 56% of neurons (marked by Tuj1 staining) generated
in lowered O.sub.2 were TH+ vs. 18% in traditional cultures (n=12,
p<0.001). Increased TH-immunoreactivity in lowered O.sub.2
cultures correlated with increased TH protein content in Western
blots (FIG. 5C). The functional dopaminergic capacity of the
TH-positive neurons was further assessed by reverse phase HPLC,
which showed significantly increased levels of dopamine in lowered
vs. 20% O.sub.2 cultures (FIG. 5D): Conditioned medium (24 hours)
showed a 5-fold increase in dopamine (n=5, p<0.01). Basal
release in HBSS revealed a 2- to 3-fold increase (n=5, p<0.05)
and evoked release was 3-fold increased (n=5, p<0.05). These
results confirm that lowered oxygen favors the differentiation of
functional dopaminergic neurons.
[0139] Mesencephalic precursors give rise to neurons with several
distinct neurotransmitter phenotypes in addition to dopaminergic
fate (Studer et al., 1998). Interestingly, the percentage of
serotonergic neurons was also increased in lowered O.sub.2,
3.2.+-.1.2% vs. 1.2.+-.0.3% in 20% O.sub.2 (n=12, p<0.05, FIG.
6). On the other hand GABA+ and Glutamate+ neurons were less likely
to be generated in lowered O.sub.2 (FIG. 6: GABA+ cells 6.6.+-.1.8%
in lowered O.sub.2 VS. 10.4.+-.1.5% n=12, p<0.05;
Glutamate+cells 12.8%.+-.3.8% in lowered O.sub.2 cultures vs.
23.6.+-.4.0% in 20% O.sub.2 (n=12, p<0.01). No double labeling
of TH with GABA was detected indicating that TH immunoreactivity
corresponded to differentiated dopaminergic neurons and was not a
transient developmental phenomenon seen in developing GABAergic
neurons (Max et al., 1996). Furthermore, the TH-positive neurons
were not fated to a noradrenergic phenotype, since no
dopamine-.beta.-hydroxylase staining could be demonstrated.
[0140] Since lowered O.sub.2 promoted differentiation of
dopaminergic and serotonergic neurons, both ventral neuronal
phenotypes (Yamada et al., 1991; Hynes et al., 1995; Ye et al.,
1998), it was determined whether these changes were associated with
an increase in floor plate cells. Immunohistochemistry revealed
expanded zones of FP4+ cells in lowered O.sub.2 (FIG. 6). A more
striking feature was the increased occurrence of neurons expressing
the transcription factor engrailed-1 (En 1) in lowered O.sub.2.
(FIG. 6). Engrailed-1 is critical for normal midbrain development
(Joyner, 1996; Danelian and McMahon 1996; Wurst et al., 1994) and
has been implicated in control of dopaminergic neuronal fate
(Simone et al., 1998).
[0141] It is important to establish whether the low oxygen
condition enhanced dopaminergic differentiation by acting during
the proliferation or differentiation phases of the culture system.
Mesencephalic precursors were expanded for 5 days in either lowered
or 20% O.sub.2. Each group was then subdivided for differentiation
in either lowered or 20% O.sub.2. Precursors expanded in lowered
O.sub.2 but differentiated in 20% O.sub.2 yielded 38.+-.6% TH+
neurons, similar to those maintained in lowered O.sub.2 throughout
(41.+-.7%, n=12, p=n.s.) but significantly higher than those
maintained in 20% O.sub.2 throughout (17.+-.4%, n=12, p<0.01).
Exposure to lowered O.sub.2 limited to the differentiation phase
did not significantly increase the yield of dopaminergic neurons
(21.+-.2%, n=12, p=n.s.) compared to cultures maintained in 20%
O.sub.2 throughout. From these data, it is shown that the major
effect of low O.sub.2 is during the expansion phase.
[0142] Semi-quantitative RT-PCR was used to assay RNA from cultures
at various time points for differential expression of candidate
genes involved in dopaminergic neuron development (FIG. 7). A small
increase in TH message was detected from lowered O.sub.2 cultures
after differentiation, compared to 20% O.sub.2. The Ptx3 homeobox
gene has also been implicated in dopamine neuron development (Smidt
et al., 1997) and was also expressed at increased levels in lowered
O.sub.2 suggesting that these conditions promoted the dopaminergic
phenotype, not simply upregulation of TH gene expression. Strong
evidence links sonic hedgehog (Echelard et al., 1993); and Nurri
(Saucedo-Cardenas et al., 1998) genes to the differentiation of
midbrain dopaminergic neurons but no O.sub.2-dependent changes in
expression were detected. However, engrailed-1 was upregulated in
lowered O.sub.2, paralleling the immunohistochemical results (FIG.
6). Fibroblast growth factor 8b (FGF8b) message was dramatically
upregulated in lowered O.sub.2, by the end of the expansion phase.
Messages for other regulators of dopaminergic differentiation did
not differ significantly between O.sub.2 conditions.
Example 4
Discussion: Lowered Oxygen Cultures Favor Proliferation and
Survival of CNS Stem Cells.
[0143] Standard conditions for the culture of mammalian cells are
37.degree. C. in a gas atmosphere of 5% CO.sub.2 and 95% air. Thus
ambient temperature is adjusted to reflect core mammalian body
temperature and CO.sub.2 is adjusted to reflect approximate venous
concentrations, while in striking contrast, O.sub.2 levels in
culture are not adjusted to reflect physiologic levels. At sea
level, unhumidified room air contains 21% O.sub.2, and a 95% air/5%
CO.sub.2 mixture contains 20% O.sub.2. Alveolar air contains 14%
O.sub.2, arterial O.sub.2 concentration is 12%, venous O.sub.2
levels are 5.3%, and mean tissue intracellular O.sub.2
concentration is 3% (Guyton, and Hall, 1996). Directly relating to
this study, mean brain O.sub.2 in the adult rat and in fetal sheep
have both been measured at 1.6% (Silver and Erecinska, 1988; Koos
and Power, 1987). Physiological tissue O.sub.2 levels in some brain
regions are even lower (Table 1). In this work the impact of
lowered, more physiologic oxygen levels on CNS stem cell culture
was analyzed and showed four major effects: 1) increased
proliferation of progenitors; 2) reduced apoptosis; 3) accelerated
progression to differentiated states; and 4) elevated absolute
number and proportion of TH+-neurons.
[0144] Lowered O.sub.2 culturing consistently enhanced
proliferation of CNS stem cells. A 2- to 4-fold increase in cell
number was observed during the proliferation phase when most of the
cells are nestin+ precursors. This increase in cell number was also
maintained after mitogen withdrawal when proliferation was vastly
reduced and differentiation takes place. Although more cells were
present in differentiated cultures in lowered O.sub.2, the
proportions of neurons and glia were similar in the two culture
conditions. In neural tissue, there is one supporting, though
specialized, precedent for mitogenic activity of lowered O.sub.2 in
neural crest-derived carotid body chromaffin cells (Nurse and
Vollmer, 1997). These dopaminergic glomus cells are functionally
specialized O.sub.2-sensitive chemoreceptors, and so would be
expected to be specifically responsive to changes in O.sub.2 levels
in the artery. The present results show that lowered oxygen
enhances the proliferation and survival of CNS stem cells.
[0145] Two specific signaling pathways, FGF8 and EPO, were
identified as candidates for significant roles in the lowered
O.sub.2 response and showed that each can recapitulate part of the
lowered O.sub.2 phenotype at 20% O.sub.2. Lowered O.sub.2 culturing
led to relative increases in RNAs encoding erythropoietin and FGF8.
In early midbrain development, FGF8 functions as a mitogen
(Danelian and McMahon 1996), but significant mitogenic or trophic
effects of FGF8 on CNS stem cell cultures have not been reported.
Here, the increased cell yield from mesencephalic precursors
maintained in 20% O.sub.2 and exposed to 250 ng/ml FGF8 partly
recapitulated the proliferation/trophic effects of lowered O.sub.2.
with a 30% increase in total number compared to a 200-400% increase
in lowered O.sub.2. In addition to increased proliferation, less
apoptosis occurs in CNS stem cells cultured in lowered O.sub.2.
There is a potential toxic role for reactive oxygen intermediates
(ROI) produced in room air cultures. However, it cannot simply be
assumed that 20% O.sub.2 cultures generate more oxidative stress
than lowered O.sub.2 cultures, since free radicals are generated in
ischemic conditions (Perez Velazquez et al., 1997).
[0146] In contrast to the increased cell number seen in lowered
O.sub.2, only minor effects were detected on the final ratio of
neurons to astrocytes to oligodendrocytes that were derived from
expanded striatal or mesencephalic precursors. This result together
with clonal analysis confirms that the nestin+ precursors expanded
in lowered oxygen have stem cell properties.
Example 5
Discussion: Dopaminergic Commitment and Differentiation
[0147] There is a great deal of evidence that CNS stem cells can
give rise to multiple neuron types (Johe et al., 1996; Gritti et
al., 1996; Kalyani et al., 1998). For several years the midbrain
has been studied as model for neuron subtype specification (Hynes
et al., 1995;Ye et al., 1998; Wang et al., 1995; Ericson et al.,
1995; (reviewed in Hynes and Rosenthal, 1999). Recently, conditions
have been established that allow midbrain precursor cells to
proliferate and differentiate to dopaminergic neurons in vitro
(Studer et al., 1998). In contrast to primary rat fetal
mesencephalic cultures where only 5% of the neurons are
immunoreactive for TH, this number was increased to 24% of neurons
in dissociated precursor cultures from E12 mesencephalon. Here it
is shown that 56% of neurons generated from mesencephalic
precursors are TH+, and this finding is associated with increased
dopamine production by HPLC Serotonergic neurons, another ventral
neuron type found in this region of the brain, were also generated
in increased numbers in lowered O.sub.2. In contrast the number of
GABAergic and Glutamatergic neurons were reduced. The lowered
oxygen conditions were most effective in generating dopaminergic
neurons during the phase of precursor cell expansion. These results
suggest that lowered oxygen conditions enhance the production of
ventral fates by a mechanism that acts prior to
differentiation.
[0148] Transcript levels of FGF8 and En1, accepted mediators of
midbrain dopaminergic neuron development (Ye et al., 1998; Simone
et al., 1998; Shamim et al., 1999), were upregulated in lowered vs.
20% O.sub.2 cultures. FGF8 has also been implicated in the
commitment of serotonergic neurons (Ye et al., 1998). These
findings are consistent with a role for FGF8 in the expansion of
dopaminergic and serotonergic neuronal subtypes seen in lowered
O.sub.2 cultures. However, addition of FGF8 to 20% O.sub.2 cultures
or neutralization of FGF8 in lowered O.sub.2 cultures did not
reproduce the O.sub.2-dependent neuronal subtype differentiation
patterns. The secreted morphogen sonic hedgehog (SHH) has been
shown to induce dopaminergic neuron differentiation in explants of
the early neural plate (Hynes et al., 1995; Ye et al., 1998; Wang
et al., 1995). Purified sonic hedgehog had no effect on expanded
mesencephalic precursors under both oxygen conditions.
[0149] Engrailed-1 mRNA and protein levels were increased in
lowered oxygen. Engrailed-1 is thought to act in a pathway with
pax2, wnt-1 and FGF8 to regulate the fate of midbrain neurons
(Joyner, 1996; Danelian and McMahon, 1996; Wurst et al., 1994;
Simone et al., 1998). The FGF8 gene contains a binding site for
engrailed (Gemel et al., 1999). In addition it was found that the
FGF8 5'-UTR sequence (accession #AF065607) contains a 9 base
sequence (CCTCCCTCA) that is also known to control oxygen
responsiveness in VEGF and EPO regulatory elements (Scandurro, and
Beckman, 1998). The inventors have not yet determined if En1 acts
as a direct upstream regulator of FGF8 in lowered O.sub.2 cultures,
or whether they act independently. Nonetheless, the prominent
expression of En1 in young neurons (FIG. 6) suggests it may be a
good candidate for regulating neuronal subtype differentiation.
[0150] EPO levels are known to be regulated by oxygen in the
erythropoietic system. EPO and its receptor are expressed in brain
from early development through adulthood (Juul et al., 1999), but
no specific role for EPO in CNS development has been described. In
the adult CNS, however, EPO has received attention as a
neuroprotective agent (Sakanaka et al., 1998), and EPO treatment of
PC12 cells has been demonstrated to increase intracellular
monoamine levels (Masuda et al., 1993). Here the results show that
at 20% O.sub.2, EPO can mimic part of the lowered O.sub.2 effect.
Increases in yield of dopaminergic neurons in 20% O.sub.2 cultures
was dose-dependent, but no additional increase in yield was
mediated by EPO in lowered oxygen, suggesting that the EPO levels
in lowered O.sub.2 were at maximal functional levels for this
response. Though EPO supplementation of 20% O.sub.2 cultures
significantly improves dopaminergic yield, the full effect of
lowered O.sub.2 could not be recapitulated, suggesting that
additional factors are involved in promoting dopaminergic
differentiation in lowered O.sub.2. Nonetheless, the finding that
EPO affects the differentiation patterns of expanded CNS precursors
is novel and identifies EPO as a component of increased
dopaminergic neuron yield in lowered oxygen conditions.
[0151] A recent report highlighted increased dopamine content after
differentiated dopaminergic mesencephalic neurons were exposed to
hypoxic conditions (0% O.sub.2 gas mixture) (Gross et al, 1999).
Another study described a relative increase in TH-expressing
neurons in primary neuronal cultures from E14 rats after exposure
to 5% O.sub.2 (Colton et al., 1995). It is also known that hypoxic
conditions favor expression of the TH gene (Czyzyk-Krzeska et al.,
1994; Paulding, and Czyzyk-Krzeska, 1999). However, this is the
first report that lowered oxygen conditions support CNS stem cells
during the expansion phase and enhance the production of ventral
neuronal subtypes.
[0152] Compared to 20% O.sub.2 the net expansion of dopaminergic
neurons in lowered O.sub.2 was at least 9-fold increased (a
three-fold increase in total cell numbers, and a 3-fold increase in
the percentage of TH+-neurons). HPLC shows that these neurons
produce dopamine. The present results show that oxygen levels much
lower than those traditionally used in culture may be useful in
mimicking in vivo phenomena. Lowered O.sub.2 culturing has the
practical implication of contributing to a more efficient
production of dopaminergic neurons for transplant therapy in
Parkinson's disease. Finally, effects of lowered, more
physiological O.sub.2 on cell cultures are not limited to the CNS,
and extend to the PNS and to other non-neuronal tissues.
[0153] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0154] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0155] Bjorklund and Stenevi, Intracerebral neural grafting in
animal models of aging brain: strategies, rationale and preliminary
results. Dan Med Bull. 32 Suppl 1:35-9 (1985).
[0156] Bjorklund, Dopaminergic transplants in experimental
parkinsonism: cellular mechanisms of graft-induced functional
recovery, Curr Opin Neurobiol. 2(5):683-9 (1992)
[0157] Bosio et al., Functional breakdown of the lipid bilayer of
the myelin membrane in central and peripheral nervous system by
disrupted galactocerebroside synthesis," Proc. Natl. Acad. Sci.
U.S.A. 93:13280-13285, 1996.
[0158] Bowenkamp et al., Glial cell line-derived neurotrophic
factor supports survival of injured midbrain dopaminergic neurons.
J Comp Neurol.; 355(4):479-89 (1995).
[0159] Chen and Okayama, High-efficiency transfection of mammalian
cells by plasmid DNA," Mol. Cell Biol., 7:2745-2752, (1987)
[0160] Chen et al., The effect of prior in vitro exposure of donor
cells to trophic factors in neuro transplantation. Exp. Neurol.,
138:64-72. (1996).
[0161] Colton et al., Protection from oxidation enhances the
survival of cultured mesencephalic neurons. Exper. Neurol. 132,
54-61(1995).
[0162] Cornelison & Wold, "Single-Cell analysis of Regulatory
Gene Expression in Quiescent and Activated Mouse Skeletal Muscle
Satellite Cells," Developmental Biology, 191:270-283, (1997).
[0163] Czyzyk-Krzeska et al., Hypoxia increases rate of
transcription and stability of tyrosine hydroxylase mRNA in
pheochromocytoma (PC 12) cells. J. Biol. Chem. 269, 760-764
(1994).
[0164] Danelian, P. S., McMahon, A. P. Engrailed-1 as a target of
the Wnt-1 signalling pathway in vertebrate midbrain development.
Nature 383, 332-334 (1996).
[0165] Dunnett and Bjorkland., in Functional Neural
Transplantation, Advances in Neuroscience, Volume 2, Raven Press,
New York (1994)
[0166] Echelard et al., Sonic hedgehog, a member of a family of
putative signaling molecules, is implicated in the regulation of
CNS polarity. Cell 75, 1417-1430, (1993).
[0167] Engele and Bohn, The neurotrophic effects of fibroblast
growth factor on dopaminergic neurons in vitro are mediated by
mesencephalic glia. J. Neurosci., 11:3070-3078 (1991).
[0168] Ericson et al., Sonic hedgehog induces the differentiation
of ventral forebrain neurons: A common signal for ventral
patterning within the neural tube. Cell 81, 747-756 (1995).
[0169] Fraley et al., "Entrapment of a bacterial plasmid in
phospholipid vesicles: Potential for gene transfer," Proc. Natl
Acad. Sci. USA, 76:3348-3352, (1979).
[0170] Freeman et al., The USF protocol for fetal nigral
transplantation in Parkinson's disease Experimental Neurology,
129:6-7(1994).
[0171] Gash et al., Functional recovery in Parkinsonian monkeys
treated with GDNF. Nature, 380:252-255. (1996).
[0172] Gemel et al., Fibroblast growth factor-8 expression is
regulated by intronic engrailed and Pbx1-binding sites. J. Biol.
Chem. 274, 6020-6026 (1999).
[0173] Gopal, "Gene transfer method for transient gene expression,
stable transfection, and cotransfection of suspension cell
cultures," Mol. Cell Biol., 5:1188-1190, (1985).
[0174] Graham and van der Eb, "A new technique for the assay of
infectivity of human adenovirus 5 DNA", Virology, 52:456467,
(1973).
[0175] Gritti et al., Multipotential stem cells from the adult
mouse brain proliferate and self-renew in response to basic
fibroblast growth factor. J. Neurosci. 16, 1091-1100 (1996).
[0176] Gross et al. Hypoxia during early developmental period
induces long-term changes in the dopamine content and release in a
mesencephalic cell culture. Neuroscience 92, 699-704 (1999).
[0177] Gundersen et al., Some new, simple and efficient
stereological methods and their use in pathological research and
diagnosis. APMIS 96, 379-394 (1988).
[0178] Guyton and Hall, "Transport of oxygen and carbon dioxide in
the blood and body fluids," In: Textbook of Medical Physiology, W B
Saunders Co., Philadephia, 1996, pp. 513-523.
[0179] Harland and Weintraub, "Translation of mammalian mRNA
injected into Xenopus oocytes is specifically inhibited by
antisense RNA," J. Cell Biol., 101:1094-1099, (1985).
[0180] Hazel & Muller, "Culture of Neuroepithelial Stem Cells,"
Current Protocols in Neuroscience, 3.1.1-3.1.6, (1997).
[0181] Hoffman et al., "Comparison of the effect of etomidate and
desflurane on brain tissue gases and pH during prolonged middle
cerebral artery occlusion." Anesthesiology 88, 1198-1194, 1998.
[0182] Hyman et al., BDNF is a neurotrophic factor for dopaminergic
neurons of the substantia nigra. Nature, 350:230-232 (1991).
[0183] Hynes and Rosenthal, Specification of dopaminergic and
serotonergic neurons in the vertebrate CNS. Curr. Opin. Neurobiol.
9, 26-36 (1999).
[0184] Hynes et al., Control of neuronal diversity by the floor
plate: Contact-mediated induction of midbrain dopaminergic neurons.
Cell 80, 95-101 (1995).
[0185] Isacson et al., Graft-induced behavioral recovery in an
animal model of Huntington's disease. Proc. Natl. Acad. Sci.,
83:2728-2732 (1986).
[0186] Johe et al., Single factors direct the differentiation of
stem cells from the fetal and adult central nervous system. Genes
Dev. 10, 3129-3140 (1996).
[0187] Joyner, A. L. Engrailed, Wnt, and Pax genes regulate
midbrain-hindbrain development. Trends Genet. 12, 15-20 (1996).
[0188] Juul et al., Immunohistochemical localization of
erythropoietin and its receptor in the developing human brain.
Pediatr. Dev. Pathol. 2, 148-158 (1999).
[0189] Kalyani et al., Spinal cord neuronal precursors generate
multiple neuronal phenotypes in culture. J. Neurosci. 18, 1856-1868
(1998).
[0190] Kang et al., Reciprocal subtraction differential RNA
display: an efficient and rapid procedure for isolating
differentially expressed gene sequences. Proc. Natl. Acad. Sci.
U.S.A., 95(23):13788-13793, 1998.
[0191] Knusel et al., Selective and nonselective stimulation of
central cholinergic and dopaminergic development in vitro by nerve
growth factor, basic fibroblast growth factor, epidermal growth
factor, insulin and the insulin-like growth factors I and II. J.
Neurosci., 10:558-567., (1990).
[0192] Knusel et al., Promotion of cholinergic and dopaminergic
neuron differentiation by brain-derived neurotrophic factor but not
neurotrophin-3. Proc. Natl. Acad. Sci. USA, 88:961-965(1991).
[0193] Kocher et al., Identification of a novel gene, selectively
up-regulated in human carcinomas, using the differential display
technique Clin. Cancer Res., 1(10):1209-1215, (1995).
[0194] Koos and Power, Predict fetal brain PO.sub.2 during
hypoxaemia and anemia in sheep. J. Develop. Physiol. 9, 517-726
(1987).
[0195] Lendahl et al., CNS stem cells express a new class of
intermediate filament protein. Cell 60, 585-595 (1990).
[0196] Lindvall et al., Grafts of fetal dopamine neurons survive
and improve motor function in Parkinson's disease. Science,
247:574-577(1990).
[0197] Martinez-Serrano et al. CNS-derived neural progenitor cells
for gene transfer of nerve growth factor to the adult brain:
complete rescue of axotomized cholinergic neurons after
transplantation into the septum. J. Neurosci.,
15:5668-5680(1996).
[0198] Masuda et al., Functional erythropoietin receptors of the
cells with neural characteristics--Comparison with receptor
properties of erythroid cells. J. Biol. Chem. 268, 11208-11216
(1993).
[0199] Max et al., Co-expression of tyrosine hydroxylase and
glutamic acid decarboxylase in dopamine differentiation
factor-treated striatal neurons in culture. Dev. Brain Res. 91,
140-142 (1996).
[0200] Maxwell et al., The tumour suppressor protein VHL targets
hypoxia-inducible factors for oxygen-dependent proteolysis. Nature
399, 271-275 (1999).
[0201] Mayer et al., Basic fibroblast growth factor promotes the
survival of embryonic ventral mesencephalic dopaminergic neurons-I.
Effects in vitro Neuroscience, 56:379-388 (1993a).
[0202] Mayer et al., Basic fibroblast growth factor promotes the
survival of embryonic ventral mesencephalic dopaminergic
neurons-.beta.. Effects on nigral trasnplants in vivo. Neurosci.,
56:389-398, (1993b).
[0203] Mayer-Proschel et al., Isolation of lineage-restricted
neuronal precursors from multipotent neuroepithelial stem cells.
Neuron 19, 773-785 (1997).
[0204] McKay, R. D. Stem cells in the central nervous system.
Science 276, 66-71 (1997).
[0205] Moreau et al., Regulation of c-ret expression by retinoic
acid in rat metanephros: implication in nephron mass control. Am.
J. Physiol. 44, F938-F945 (1998).
[0206] Neelakanta & Csete, "Efforts to overcome the liver donor
shortage," Chirurgia Internat., 1996.
[0207] Neural Grafting in the Mammalian CNS, Bjorklund and Stenevi,
eds., 1985 Das, Ch. 3 pp. 23-30; Freed, Ch. 4, pp. 3140; Stenevi et
al., Ch. 5, pp. 41-50; Brundin et al., Ch. 6, pp. 51-60; David et
al., Ch. 7, pp. 61-70; Seiger, Ch. 8, pp. 71-77, 1985
[0208] Nicolau and Sene, Liposome-mediated DNA transfer in
eukaryotic cells, Biochim. Biophys. Acta, 721:185-190, (1982).
[0209] Nikkhah et al., Platelet-derived growth factor promotes
survival of rat and human mesencephalic dopaminergic neurons in
culture. Exp. Brain Res., 92:516-523 (1993).
[0210] Nurse and Vollmer, Role of basic FGF and oxygen in control
of proliferation, survival, and neuronal differentiation in carotid
body chromaffin cells. Dev. Biol. 184, 197-206 (1997).
[0211] Olanow et al., Fetal nigral transplantation as a therapy for
Parkinson's disease. Trends Neurosci. 19, 102-109 (1996).
[0212] Olson Toward trophic treatment in parkinsonism: a primate
step. Nature Med., 2:400-401(1996).
[0213] O'Rourke et al., "Postmitotic neurons migrate tangentially
in the cortical ventricular zone," Development 124:997-1005,
(1997).
[0214] Othberg et al., Specific effects of platelet derived growth
factor (PDGF) on embryonic rat and human DA neurons in vitro. Exp.
Brain Res., 105:111-122 (1995).
[0215] Panchinsion et al., Plasticity and stem cells in the
vertebrate nervous system. Curr. Opin. Cell Biol. 10, 727-733
(1998).
[0216] Paulding and Czyzyk-Krzeska, Regulation of tyrosine
hydroxylase mRNA stability by protein binding, pyrimidine-rich
sequence in the 3'untranslated region. J. Biol. Chem. 274,
2532-2538 (1999).
[0217] Perez Velazquez et al., In vitro ischemia promotes
glutamate-mediated free radical generation and intracellular
calcium accumulation in hippocampal pyramidal neurons. J. Neurosci.
17, 9085-9094 (1997).
[0218] Potter et al., Enhancer-dependent expression of human k
immunoglobulin genes introduced into mouse pre-B lymphocytes by
electroporation, Proc. Nat'l Acad Sci. USA, 81:7161-7165, 1984.
[0219] Poulsen et al., TGF.beta.2 and TGF.beta.3 are potent
survival factors for midbrain dopaminergic neurons. Neuron,
13:1245(1994).
[0220] Rippe et at, DNA-mediated gene transfer into adult rat
hepatocytes in primary culture, Mol. Cell Biol., 10:689-695,
1990.
[0221] Rosenblad. Glial cell line-derived neurotrophic factor
increases survival, growth and function of intrastriatal fetal
nigral dopaminergic grafts. Neurosci. 75:979-985 (1996).
[0222] Rutka et at, Role of glial filaments in cells and tumors of
glial origin: a review J Neurosurg.; 87(3):420-30, (1997).
[0223] Sakanaka, et al. In vivo evidence that erythropoietin
protects neurons from ischemic damage. Proc. Natl. Acad. Sci. 95,
46354640 (1998).
[0224] Sanberg et al., Cell transplantation for Huntington's
disease R. G. Landes Co., Boca Raton, Fla., pp-19-21, (1994).
[0225] Saucedo-Cardenas et al., NurrI is essential for the
induction of the dopaminergic phenotype and the survival of ventral
mesencephalic late dopaminergic precursor neurons. Proc. Natl.
Acad. Sci. 95, 4013-4018, (1998).
[0226] Sauer et al., Glial cell line-derived neurotrophic factor
but not transforming growth factor .beta.3 prevents delayed
degeneration of nigral DA neurons following striatal
6-hydroxydopamine lesion. Proc. Natl. Acad. Sci. USA.,
92:8935-8939(1994).
[0227] Scandurro and Beckman, Common proteins bind mRNAs encoding
erythropoietin, tyrosine hydroxylase, and vascular endothelial
growth factor. Bioch. Biophys. Res. Comm. 246, 436-440 (1998).
[0228] Schmidt et al., Functional activity of substantia nigra
grafts reinnervating the striatum: neurotransmitter metabolism and
[14C]2-deoxy-D-glucose autoradiography J. Neurochem. 38:737-748,
(1982).
[0229] Shamim et al., Sequential roles for Fgf4, En1 and Fgf8 in
specilication and regionalisation of the midbrain. Development 126,
945-959 (1999).
[0230] Silver and Erecinska, Oxygen and ion concentrations in
normoxic and hypoxic brain cells. In Oxygen Transport to Tissue XX,
7-15, edited by Hudetz and Bruley, Plenum Press, New York
(1988).
[0231] Simone et al., En-1 and En-2 control the fate of the
dopaminergic neurons in the substantia nigra and ventral tegmentum.
Eur. J. Neurosci. 10, 389-399 (1998).
[0232] Smidt et al., A homeodomain gene Ptx 3 has highly restricted
brain expression in mesencephalic dopaminergic neurons. Proc. Natl.
Acad. Sci. 94, 13305-13310, (1997).
[0233] Stenevi et al., Transplantation of central and peripheral
monoamine neurons to the adult rat brain: techniques and conditions
for survival, Brain Res. 114:1-20 (1976)
[0234] Studer et al., Non-invasive dopamine determination by
reversed phase HPLC in the medium of free-floating roller tube
cultures of rat fetal ventral mesencephalon. A tool to assess
dopaminergic tissue prior to grafting. Brain Res. Bull. 41, 143-150
(1996).
[0235] Studer et al., Transplantation of expanded mesencephalic
precursors leads to recovery in parkinsonian rats. Nature Neurosci.
1, 290-295 (1998).
[0236] Tur-Kaspa et al., Use of electroporation to introduce
biologically active foreign genes into primary rat hepatocytes,
Mol. Cell Biol, 6:716-718, 1986.
[0237] U.S. Pat. No. 5,082,670
[0238] U.S. Pat. No. 5,650,148
[0239] U.S. Pat. No. 5,762,926
[0240] U.S. Pat. No. 4,683,195
[0241] U.S. Pat. No. 4,800,159
[0242] U.S. Pat. No. 4,861,719
[0243] U.S. Pat. No. 4,886,741
[0244] U.S. Pat. No. 4,888,278
[0245] U.S. Pat. No. 5,019,034
[0246] U.S. Pat. No. 5,120,657
[0247] U.S. Pat. No. 5,139,941
[0248] U.S. Pat. No. 5,225,326
[0249] U.S. Pat. No. 5,252,479
[0250] U.S. Pat. No. 5,328,688
[0251] U.S. Pat. No. 5,364,790
[0252] U.S. Pat. No. 5,474,935
[0253] U.S. Pat. No. 5,506,098
[0254] U.S. Pat. No. 5,507,724
[0255] U.S. Pat. No. 5,521,061
[0256] U.S. Pat. No. 5,538,869
[0257] U.S. Pat. No. 5,585,362
[0258] U.S. Pat. No. 5,612,205
[0259] U.S. Pat. No. 5,612,205
[0260] U.S. Pat. No. 5,620,689
[0261] U.S. Pat. No. 5,622,856
[0262] U.S. Pat. No. 5,631,018
[0263] U.S. Pat. No. 5,658,776
[0264] U.S. Pat. No. 5,661,025
[0265] U.S. Pat. No. 5,661,033
[0266] U.S. Pat. No. 5,665,540
[0267] U.S. Pat. No. 5,670,488
[0268] U.S. Pat. No. 5,686,278
[0269] U.S. Pat. No. 5,693,509
[0270] U.S. Pat. No. 5,707,618
[0271] U.S. Pat. No. 5,714,166
[0272] U.S. Pat. No. 5,721,367
[0273] U.S. Pat. No. 5,749,847
[0274] U.S. Pat. No. 5,750,376
[0275] U.S. Pat. No. 5,770,414
[0276] U.S. Pat. No. 5,773,289
[0277] U.S. Pat. No. 5,785,987
[0278] U.S. Pat. No. 5,789,213
[0279] U.S. Pat. No. 5,789,215
[0280] U.S. Pat. No. 5,789,390
[0281] U.S. Pat. No. 5,795,581
[0282] U.S. Pat. No. 5,800,992
[0283] U.S. Pat. No. 5,824,544
[0284] U.S. Pat. No. 5,824,547
[0285] U.S. Pat. No. 5,827,703
[0286] U.S. Pat. No. 5,830,698
[0287] U.S. Pat. No. 5,830,725
[0288] U.S. Pat. No. 5,830,727
[0289] U.S. Pat. No. 5,834,181
[0290] U.S. Pat. No. 5,834,441
[0291] U.S. Pat. No. 5,836,905
[0292] U.S. Pat. No. 5,849,571
[0293] U.S. Pat. No. 5,851,521
[0294] U.S. Pat. No. 5,851,818
[0295] U.S. Pat. No. 5,855,910
[0296] U.S. Pat. No. 5,856,152
[0297] U.S. Pat. No. 5,861,314
[0298] U.S. Pat. No. 5,863,541
[0299] U.S. Pat. No. 5,869,326
[0300] U.S. Pat. No. 5,879,934
[0301] U.S. Pat. No. 5,888,502
[0302] Ungerstedt and Arbuthnott, Quantitative recording of
rotational behavior in rats after 6-hydroxy-dopamine lesions of the
nigrostriatal dopamine system. Brain Res. 24:485-493, (1970).
[0303] Wang et al., Induction of dopaminergic neuron phenotype in
the midbrain by Sonic hedgehog protein. Nature Med. 1, 1184-1188
(1995).
[0304] Wictorin et al., Reformation of long axon pathways in adult
rat CNS by human forebrain neuroblasts. Nature, 347:556-558
(1990).
[0305] Wu and Wu, "Evidence for targeted gene delivery to RepG2
hepatoma cells in vitro," Biochemistry, 27:887-892, (1988).
[0306] Wu and Wu, Receptor-mediated in vitro gene transfections by
a soluble DNA carrier system, J. Biol. Chem., 262:44294432,
(1987).
[0307] Wurst et al., Multiple developmental defects in Engrailed-1
mutant mice: An early mid-hindbrain deletion and patterning defects
in forelimbs and sternum. Development 120, 2065-2075 (1994).
[0308] Yamada et al., Control of cell pattern in the developing
nervous system: polarizing activity of the floor plate and
notochord. Cell 64, 635-647, (1991).
[0309] Yang et al., "In vivo and in vitro gene transfer to
mammalian somatic cells by particle bombardment," Proc. Nat'l Acad.
Sci. USA, 87:9568-9572, 1990.
[0310] Ye et al., FGF and Shh signals control dopaminergic and
serotonergic cell fate in the anterior neural plate. Cell 93,
755-766 (1998).
[0311] Yoshimoto et al., Astrocytes retrovirally transduced with
BDNF elicit behavioral improvement in a rat model of Parkinson's
disease. Brain Res., 691:25-36, (1995).
[0312]
Sequence CWU 1
1
24 1 26 DNA Artificial Sequence Forward PCR primer for GAPDH 1
ctcgtctcat agacaagatg gtgaag 26 2 24 DNA Artificial Sequence
Reverse PCR primer for GAPDH 2 agactccacg acatactcag cacc 24 3 24
DNA Artificial Sequence Forward PCR primer for VHL 3 cctctcaggt
catcttctgc aacc 24 4 21 DNA Artificial Sequence Reverse PCR primer
for VHL 4 agggatggca caaacagttc c 21 5 24 DNA Artificial Sequence
Forward PCR primer for HIF1a 5 gcagcacgat ctcggcgaag caaa 24 6 24
DNA Artificial Sequence Reverse PCR primer for HIF1a 6 gcaccataac
aaagccatcc aggg 24 7 21 DNA Artificial Sequence Forward PCR primer
for EPO 7 cgctccccca cgcctcattt g 21 8 22 DNA Artificial Sequence
Reverse PCR primer for EPO 8 agcggcttgg gtggcgtctg ga 22 9 23 DNA
Artificial Sequence Forward PCR primer for VEGF 9 gtgcactgga
ccctggcttt act 23 10 24 DNA Artificial Sequence Reverse PCR primer
for VEGF 10 cgccttgcaa cgcgagtctg tgtt 24 11 23 DNA Artificial
Sequence Forward PCR primer for Nurr1 11 tgaagagagc ggagaaggag atc
23 12 24 DNA Artificial Sequence Reverse PCR primer for Nurr1 12
tctggagtta agaaatcgga gctg 24 13 22 DNA Artificial Sequence Forward
PCR primer for Ptx3 13 cgtgcgtggt tggttcaaga ac 22 14 24 DNA
Artificial Sequence Reverse PCR primer for Ptx3 14 gcggtgagaa
tacaggttgt gaag 24 15 24 DNA Artificial Sequence Forward PCR primer
for SHH 15 ggaagatcac aagaaactcc gaac 24 16 23 DNA Artificial
Sequence Reverse PCR primer for SHH 16 ggatgcgagc tttggattca tag 23
17 19 DNA Artificial Sequence Forward PCR primer for FGF8 17
catgtgaggg accagagcc 19 18 22 DNA Artificial Sequence Reverse PCR
primer for FGF8 18 gtagttgttc tccagcagga tc 22 19 23 DNA Artificial
Sequence Forward PCR primer for En1 19 tcaagactga ctacagcaac ccc 23
20 24 DNA Artificial Sequence Reverse PCR primer for En1 20
ctttgtcctg aaccgtggtg gtag 24 21 22 DNA Artificial Sequence Forward
PCR primer for FGFR3 21 atcctcggga gatgacgaag ac 22 22 22 DNA
Artificial Sequence Reverse PCR primer for FGFR3 22 ggatgctgcc
aaacttgttc tc 22 23 21 DNA Artificial Sequence Forward PCR primer
for BDNF 23 gtgacagtat tagcgagtgg g 21 24 17 DNA Artificial
Sequence Reverse PCR primer for BDNF 24 gggtagttcg gcattgc 17
* * * * *