U.S. patent application number 10/272351 was filed with the patent office on 2004-01-08 for system for manipulating nucleic acids.
Invention is credited to Jarrell, Kevin, Turczyk, Brian.
Application Number | 20040005673 10/272351 |
Document ID | / |
Family ID | 30002841 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040005673 |
Kind Code |
A1 |
Jarrell, Kevin ; et
al. |
January 8, 2004 |
System for manipulating nucleic acids
Abstract
The present invention provides an improved system for linking
nucleic acids to one another. In particular, the present invention
provides techniques for producing DNA product molecules that may be
easily and directly ligated to recipient molecules. The product
molecules need not be cleaved with restriction enzymes in order to
undergo such ligation. In preferred embodiments of the invention,
the DNA product molecules are produced through iterative DNA
synthesis reactions, so that the product molecules are amplified
products. The invention further provides methods for directed
ligation of product molecules (i.e., for selective ligation of
certain molecules within a collection of molecules), and also for
methods of exon shuffling, in which multiple different product
molecules are produced in a single ligation reaction. Preferred
embodiments of the invention involve ligation of product molecules
encoding functional protein domains, particularly domains naturally
found in conserved gene families. The inventive DNA manipulation
system is readily integrated with other nucleic acid manipulation
systems, such as ribozyme-mediated systems, and also is susceptible
to automation.
Inventors: |
Jarrell, Kevin; (Lincoln,
MA) ; Turczyk, Brian; (Peabody, MA) |
Correspondence
Address: |
Choate, Hall & Stewart
Exchange Place
53 State Street
Boston
MA
02109
US
|
Family ID: |
30002841 |
Appl. No.: |
10/272351 |
Filed: |
October 15, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10272351 |
Oct 15, 2002 |
|
|
|
09897712 |
Jun 29, 2001 |
|
|
|
60329246 |
Oct 12, 2001 |
|
|
|
Current U.S.
Class: |
435/91.2 ;
435/183; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C07K 14/805 20130101;
C12N 15/102 20130101; C12N 15/66 20130101; C07K 14/70571
20130101 |
Class at
Publication: |
435/91.2 ;
435/69.1; 435/320.1; 435/325; 435/183; 536/23.2 |
International
Class: |
C12P 019/34; C12N
009/00; C07H 021/04; C12P 021/02; C12N 005/06 |
Goverment Interests
[0004] Some or all of the work described herein may have been
supported by grant number RO1 AI48665 from the National Institutes
of Health; the United States Government may have certain rights in
this invention.
Claims
We claim:
1. A method for introducing sequence changes into a nucleic acid
molecule, the method comprising steps of: contacting the nucleic
acid molecule with a first primer containing a first portion that
hybridizes with the template, a second portion that includes a
residue that renders the primer susceptible to cleavage, and a
third portion that contains the sequence changes as compared with
the template complement; contacting the nucleic acid molecule with
a second primer that hybridizes thereto; extending the first and
second primers; and cleaving the first primer at the susceptibility
residue so that a double-stranded product molecule having a
single-stranded overhang, and having the sequence changes
introduced, is produced.
2. A method for introducing sequence changes into a nucleic acid
molecule, the method comprising steps of: contacting the nucleic
acid molecule with a first primer containing a first portion that
hybridizes with the template, a second portion that includes at
least one terminating residue that does not serve as a template for
at least one polymerase, and a third portion that contains the
sequence changes as compared with the template complement;
extending the first primer to produce a first modified strand; and
contacting the first modified strand with a second primer that
hydbridizes thereto; extending the second primer with the
polymerase, so that a double-stranded product molecule is
generating containing a 5'overhang due to failure of the polymerase
to template the terminating residue.
3. The method of claim 1 or claim 2, wherein the sequence changes
are selected from the group consisting of: changes that alter gene
product function; changes that adjust for codon bias; changes that
introduce at least one restriction site; and combinations
thereof.
4. The method of claim 1 or claim 2, wherein the template molecule
comprises a protein-coding gene, and the sequence changes alter the
encoded protein's amino-acid sequence.
5. The method of claim 1 or claim 2, wherein the template molecule
comprises a protein-coding gene, and the sequence changes do not
alter the encoded protein's amino-acid sequence.
6. The method of claim 1 or claim 2, wherein the template molecule
comprises vector sequence.
7. The method of claim 1 or claim 2, wherein the product molecule
comprises vector sequence.
8. The method of claim 1 or claim 2, further comprises ligating the
product molecule with another nucleic acid molecule.
9. The method of claim 8, wherein the ligating occurs in vitro.
10. The method of claim 9, wherein the ligating occurs in vivo.
11. The method of claim 1 or claim 2, further comprising
introducing the product molecule into a host cell.
12. The method of claim 11, wherein, prior to its introduction into
a host cell, the product molecule is ligated with or linked to at
least one other nucleic acid molecule.
13. The method of claim 1 or claim 2, further comprising isolating
the product molecule.
14. The method of claim 1 or claim 2, further comprising treating
the product molecule to remove template molecules or strands.
15. The method of claim 14, wherein the treating comprises
digesting methylated nucleic acids.
16. The method of claim 11, wherein the product molecule is not
treated with ligase enzyme in vitro prior to being introduced into
the host cell.
17. The method of claim 11, wherein the sequence changes are
introduced into a gene that is expressed in the host cell.
18. The method of claim 17, wherein the gene encodes an enzyme.
19. The method of claim 18, wherein the enzyme catalyzes production
or breakdown of a chemical product.
20. A mutagenized nucleic acid molecule generated by the process of
claim 1 or claim 2.
Description
[0001] The present application is a Continuation-in-part of
co-pending U.S. national patent application Ser. No. 09/897,712,
filed Jun. 29, 2001, the entire contents of which are incorporated
herein by reference. The present application also claims priority
to co-pending U.S. Provisional Application Serial No. 60/329,246,
filed Oct. 12, 2001, the entire contents of which are incorporated
herein by reference. Applicant notes that, because Oct. 12, 2002
fell on a Saturday and the following Monday, Oct. 14, 2002 was a
federal holiday, U.S. Provisional Patent Application Serial No.
60/329,246 remained in force through Oct. 15, 2002.
[0002] Applicant also notes that U.S. national patent application
Ser. No. 09/897,712 was is a Continuation-in-part of U.S. national
patent application Ser. No. 09/225,990, filed Jan. 5, 1999, and was
also a United States National Application PCT/US00/00189 filed Jan.
5, 2000 under 35 USC .sctn.271. That application also claimed
priority to U.S. Provisional Patent Application Serial No.
60/114,909, filed on Jan. 5, 1999. Each of U.S. Ser. No.
09/225,990, PCT/US00/00189, and No. 60/114,909 is also incorporated
herein by reference in its entirety.
[0003] Also, various inventive techniques and reagents for
modifying or manipulating nucleic acid molecules may be
particularly useful as combined with or applied to methods,
systems, or applications described in one or more of the following
U.S. national or Provisional Patent Applications: Nos. 60/114,909;
60/219,820; Ser. Nos. 09/478,263; 09/897,712; 09/910,345; each of
these patent applications is incorporated herein by reference in
its entirety.
BACKGROUND
[0005] The Molecular Biology revolution began with the discovery of
enzymes that were capable of cleaving double stranded DNA, so that
DNA fragments were produced that could be ligated to one another to
generate new, so-called "recombinant" molecules (see, for example,
Cohen et al., Proc. Natl. Acad. Sci. USA 70:1293, 1973; Cohen et
al., Proc. Natl. Acad. Sci. USA 70:3274, 1973; see also U.S. Pat.
Nos. 4,740,470; 4,468,464; 4,237,224). The revolution was extended
by the discovery of the polymerase chain reaction (PCR), which
allowed rapid amplification of particular DNA segments, producing
large amounts of material that could subsequently be cleaved and
ligated to other DNA molecules (see, for example, U.S. Pat. Nos.
4,683,195; 4,683,202; 5,333,675).
[0006] Despite the power of these digestion and amplification
techniques, however, there remains substantial room for
improvement. Reliance on digesting enzymes, called "restriction
enzymes", can render molecular biological experiments quite
expensive. Moreover, many of the enzymes are inefficient or are
only available in crude preparations that may be contaminated with
undesirable entities.
[0007] At first, it seemed that PCR amplification might itself
avoid many of the difficulties associated with traditional
cut-and-paste cloning methods since it was thought that PCR would
generate DNA molecules that could be directly ligated to other
molecules, without first being cleaved with a restriction enzyme.
However, experience indicates that most PCR products are refractory
to direct cloning. One possible explanation for this observation
has come from research revealing that many thermophilic DNA
polymerases (including Taq, the most commonly used enzyme) add
terminal 3'-dAMP residues to the products they amplify. Invitrogen
(Carlsbad, Calif.) has recently developed a system for direct
cloning of such terminally-dAMP-tagged products (TA Cloning
Kit.RTM.; see U.S. Pat. No. 5,487,993) if the molecule to which
they are to be ligated is processed to contain a single unpaired
3'-dTMP residue. While the Invitrogen system has proven to be very
useful, it is itself limited in application by being restricted to
ligation of products with only a single nucleotide overhang (an A
residue), and is further restricted in that the overhang must be
present at the 3' end of the DNA molecule to be ligated.
[0008] There is a need for the development of improved systems for
nucleic acid cloning. Particularly desirable systems would allow
DNA ligation with minimal reliance on restriction enzymes, would
provide for efficient ligation, and would be generally useful for
the ligation of DNAs having a wide variety of chemical structures.
Optimal systems would even provide for directional ligation (i.e.,
ligation in which the DNA molecules to be linked together will only
connect to one another in one orientation).
SUMMARY OF THE INVENTION
[0009] The present invention provides an improved system for
linking nucleic acids to one another. In particular, the present
invention provides techniques for producing DNA product molecules
that may be easily and directly ligated to recipient molecules. The
product molecules need not be cleaved with restriction enzymes in
order to undergo such ligation. In preferred embodiments of the
invention, the DNA product molecules are produced through iterative
DNA synthesis reactions, so that the product molecules are
amplified products.
[0010] The inventive system provides techniques and reagents for
generating product molecules with 3' overhangs, 5' overhangs, or no
overhangs, and further provides tools for ligating those product
molecules with recipient molecules. Where overhangs are employed,
the length and sequence of the overhang may be varied according to
the desires of the practitioner. Overhang-containing products may
be linked to one another by any available means including, for
example, enzymatic ligation or transformation into a host cell. For
example, molecules containing at least 12 nt overhangs may be
annealed to one another and linked together by transformation into
E. coli without first being ligated (see, for Example, Rashtchian,
et al. Analytical Biochemistry 206:91, 1992).
[0011] The inventive system further provides methods for directed
ligation of product molecules (i.e., for selective ligation of
certain molecules within a collection of molecules), and also for
methods of exon shuffling, in which multiple different product
molecules are produced in a single ligation reaction. Preferred
embodiments of the invention involve ligation of product molecules
encoding functional protein domains, particularly domains naturally
found in conserved gene families. Alternative or additional
preferred embodiments of the invention involve multi-component
ligation reactions, in which three or more nucleic acid molecules
are ligated together. In some embodiments, these multiple molecules
are linked in only a single arrangement; in others, multiple
arrangements can be achieved.
[0012] The present invention further provides systems and reagents
for introducing sequence changes, or mutations, into nuclei acid
molecules. Any change may be made. Changes may include, for
example, introduction of removal of restriction sites or other
modification sites, alteration of protein coding or expression
sequences, e.g., to increase or reduce expression in a relevant
host and/or to alter functionality, etc.
[0013] The inventive DNA manipulation system is readily integrated
with other nucleic acid manipulation systems, such as
ribozyme-mediated systems, and also is susceptible to
automation.
[0014] In one specific aspect, the present invention provides a
double stranded DNA molecule with a single stranded overhang
comprised of RNA. In another aspect, the invention provides a
library of nucleic acid molecules wherein each member of the
library comprises 1) at least one nucleic acid portion that is
common to all members of the library; and 2) at least two nucleic
acid portions that differ in different members of the library, is
also provided by the present invention. In a preferred embodiment,
each of the nucleic acid portions in the library comprises
protein-coding sequence and each library member encodes a
continuous polypeptide. In yet another particularly preferred
embodiment, each of the variable nucleic acid portions encodes a
functional domain of a protein. This functional domain is
preferably one that is naturally found in a gene family selected
from the group consisting of the tissue plasminogen activator gene
family, the animal fatty acid synthase gene family, the polyketide
synthase gene family, the peptide synthetase gene family, and the
terpene synthase gene family.
[0015] In yet another aspect of the present invention, a method of
generating a hybrid double-stranded DNA molecule is provided. This
method comprises steps of 1) providing a first double-stranded DNA
molecule, which double-stranded DNA molecule contains at least one
single stranded overhang comprised of RNA; 2) providing a second
double-stranded DNA molecule containing at least one single-strand
overhang that is complementary to the RNA overhang on the first
double-stranded DNA molecule; and 3) ligating the first and second
double-stranded DNA molecules to one another so that a hybrid
double-stranded DNA molecule is produced. In certain preferred
embodiments, the method comprises providing and ligating at least
three double-stranded DNA molecules.
[0016] A further aspect of the present invention includes a method
of generating a hybrid double-stranded DNA molecule, the method
comprising 1) generating a first double-stranded DNA molecule by
extension of first and second primers, at least one of which
includes at least one base that is not copied during the extension
reaction so that the extension reaction produces a product molecule
containing a first overhang; 2) providing a second double-stranded
DNA molecule containing a second overhang complementary to the
first overhang; and 3) ligating the first and second
double-stranded DNA molecules to one another, so that a hybrid
double-stranded DNA molecule is produced. In certain preferred
embodiments, the method comprises providing and ligating at least
three double-stranded DNA molecules.
[0017] In still a further aspect of the present invention, a method
of generating a hybrid double-stranded DNA molecule is provided,
the method comprising: 1) generating a first double-stranded DNA
molecule by extension of first and second primers, at least one of
which includes at least one potential point of cleavage; 2)
exposing the first double-stranded DNA molecule to conditions that
result in cleavage of the cleavable primer at the potential point
of cleavage, so that a first overhang is generated on the first DNA
molecule; 3) providing a second double-stranded DNA molecule
containing a second overhang complementary to the first overhang;
and 4) ligating the first and second double-stranded DNA molecules
to one another, so that a hybrid double-stranded DNA molecule is
produced. In certain preferred embodiments, the method comprises
providing and ligating at least three double-stranded DNA
molecules.
DESCRIPTION OF THE DRAWING
[0018] FIG. 1 depicts an inventive process for generating DNA
product molecules with 3' overhangs.
[0019] FIG. 2 depicts a process for producing 5' overhangs by
hybridizing a template molecule with one or more primers including
at least one ribonucleotide primer.
[0020] FIG. 3 depicts an inventive process for generating DNA
product molecules with one or more 5' overhangs.
[0021] FIG. 4 depicts an alternative inventive process for
generating DNA product molecules with one (FIG. 4A) or more (FIG.
4B) 5' overhangs.
[0022] FIG. 5 presents a process that allows ligation of
blunt-ended molecules.
[0023] FIG. 6 shows members of the tissue plasminogen activator
gene family.
[0024] FIG. 7 presents a list of certain polyketide compounds that
are currently used as pharmaceutical drugs for the treatment of
human and animal disorders.
[0025] FIG. 8 depicts the different functional domains of bacterial
polyketide synthase genes responsible for the production of
erythromycin and rapamycin.
[0026] FIG. 9 depicts the different functional domains of bacterial
polyketide synthase genes responsible for the production of
erythromycin and rapamycin.
[0027] FIG. 10 depicts the protein functional domains of certain
modular polyketide synthase genes.
[0028] FIG. 11 presents a list of products generated by peptide
synthetases that are currently used as pharmacologic agents.
[0029] FIG. 12 depicts the protein functional domains of certain
modular peptide synthetase genes.
[0030] FIG. 13 depicts the structure of the srfA peptide synthetase
operon.
[0031] FIG. 14 depicts the synthesis of isoprenoids through the
polymerization of isoprene building blocks.
[0032] FIG. 15 depicts certain cyclization and intermolecular bond
formation reactions catalyzed by isoprenoid, or terpene
synthases.
[0033] FIG. 16 presents a schematic illustration of the
correspondence between natural exons and functional domains within
isoprenoid synthases.
[0034] FIG. 17 depicts one generic example of a directional
ligation reaction.
[0035] FIG. 18 presents a schematic representation of an inventive
specific directional ligation reaction.
[0036] FIG. 19A depicts the nucleotide sequence of the glutamate
receptor exons known as Flip (GenBank accession number X64829).
[0037] FIG. 19B depicts the nucleotide sequence of the glutamate
receptor exons utilized are known as Flop (GenBank accession number
X64830).
[0038] FIG. 20 shows the amplified hybrid molecules produced in an
inventive directional ligation reaction.
[0039] FIG. 21 presents the nucleotide sequence of the ligation
junction in the hybrid molecules of FIG. 20.
[0040] FIG. 22 presents the nucleotide sequence of the human
.beta.-globin gene.
[0041] FIG. 23 shows an inventive identity exon shuffling
reaction.
[0042] FIG. 24 shows an inventive positional exon shuffling
reaction.
[0043] FIG. 25 shows the combinatorial potential of certain
inventive directed ligation techniques.
[0044] FIG. 26 presents one version of a combined
primer-based/ribozyme-me- diated nucleic acid manipulation scheme
according to the present invention.
[0045] FIG. 27 depicts a robotic system that could be utilized in
the practice of certain inventive methods.
[0046] FIG. 28 depicts a schematic representation of a directional
ligation reaction employing inventive product molecules containing
3' overhangs.
[0047] FIG. 29 presents a schematic of certain bioassay techniques
that can be employed to determine the success of primer copying
and/or ligation in inventive reactions.
[0048] FIG. 30 shows a ribozyme mediated directional ligation
reaction.
[0049] FIG. 31 shows constructs employed in the reaction of FIG.
30.
[0050] FIGS. 32 and 33 show products of the reaction of FIG.
30.
[0051] FIG. 34 shows a variety of chimeras generated using
DNA-Overhang Cloning ("DOC"). The parental genes are shown in lines
1 and 2. The five chimeric genes are shown below the parental
genes. Jagged edges indicate that only a portion of introns 13 and
15 were amplified. Lengths of chimeric genes (in basepairs) are
indicated.
[0052] FIG. 35 presents a schematic representation of an inventive
method for introducing sequence modifications into a nucleic acid
molecule.
[0053] FIG. 36 depicts two different strategies for introducing
sequence modifications according to the present invention.
[0054] FIG. 37 illustrates application of an inventive mutagenesis
strategy to the mutation of a gene in a vector.
[0055] FIG. 38 presents the nucleotide sequence of the
pCR-T7/CT-TOPO construct, including an OPD gene lacking its leader
sequence.
[0056] FIG. 39 shows various mutagene primers used to introduce
sequence changes into the OPD gene.
[0057] FIG. 40 shows the sequence of various generated OPD
mutants.
DEFINITIONS
[0058] "Cloning"--The term "cloning", when used herein, means the
production of a new nucleic acid molecule through the ligation of
previously unlinked nucleic acid pieces to one another. A molecule
produced by such ligation is considered a "clone" for the purposes
of the present application, even before it has been replicated.
[0059] "Direct ligation"--The term "direct ligation", as applied to
product molecules herein, means that a product molecule may be
ligated to one or more recipient molecules without first being
cleaved with a restriction enzyme. Preferably, no processing of the
product molecule is required at all prior to ligation.
[0060] "Expression"--"Expression" of nucleic acid sequences, as
that term is used herein, means that one or more of (i) production
of an RNA template from a DNA sequence; (ii) processing (e.g.,
splicing and/or 3' end formation) of a pre-mRNA to produce an mRNA;
and (iii) translation of an mRNA has occurred.
[0061] "Gene"--For the purposes of the present invention, the term
"gene" has its art understood meaning. However, it will be
appreciated by those of ordinary skill in the art that the term
"gene" has a variety of meanings in the art, some of which include
gene regulatory sequences (e.g., promoters, enhancers, etc.) and/or
intron sequences, and others of which are limited to coding
sequences. It will further be appreciated that art definitions of
"gene" include references to nucleic acids that do not encode
proteins but rather encode functional RNA molecules, such as tRNAs.
For the purpose of clarity, we note that, as used in the present
application, the term "gene" generally refers to a portion of a
nucleic acid that encodes a protein; the term may optionally
encompass regulatory sequences. This definition is not intended to
exclude application of the term "gene" to non-protein-coding
expression units, but rather to clarify that, in most cases, the
term as used in this document happens to be applied to a
protein-coding nucleic acid.
[0062] "Gene fragment"--A "gene fragment", as that term is used
herein, means a piece of a protein-coding DNA molecule that is
shorter than the complete protein-coding molecule. Preferably, the
fragment is at least about 12 bases long, more preferably at least
about 15-20 bases long, and may be several hundred or thousands of
base pairs long. It should be understood that the fragment need not
include protein-coding sequence, but rather may represent a
non-coding portion of the original gene.
[0063] "Hybrid nucleic acid"--A "hybrid nucleic acid", as that term
is used herein, means a nucleic acid molecule comprising at least a
first segment and a second segment, each of which occurs in nature,
or occurs prior to performance or application of inventive methods,
but is not linked directly with the other in its prior state, the
first and second segments being directly linked to one another in
the hybrid nucleic acid.
[0064] "Ligation"--The term "ligation", as used herein, refers to
the formation of at least one covalent bond, typically a
phospodiester bond, between separate nucleic acid residues in the
same or different nucleic acid molecules. In many preferred
embodiments of the invention, product molecules are or become
ligated to other molecules; in other preferred embodiments,
intramolecular ligations occur, e.g., so that a single circular
molecule is generated. As discussed herein, when such ligation
occurs, it may be in vivo or in vitro, contemporaneous with or
separate from production of product molecules.
[0065] "Modified residues"--The term "modified residues", is used
herein with reference to natural DNA residues and includes any
nucleotide or nucleoside residue other than adenodine, ("A"),
thymine ("T"), quanisine ("G"), and cytosine ("C"). It will be
appreciated, therefore, that the term is used herein to refer to
residues that in fact occur in nature, and further is used to
describe the relevant chemical entity whether or not any
modification step has been performed during the use or practice of
inventive methods. For instance, a residue is referred to as
modified whether it is incorporated into a primer (or product
molecule) in its modified form, or whether it is first incorporated
as a natural residue (i.e., A, G, T, or C), and then modified after
incorporation. It is particularly noted that all ribonucleotides
are included within the present definition of "modified
residues".
[0066] "Overhang sequence"--An "overhang sequence", as that term is
used herein, means a single stranded region of nucleic acid
extending from a double stranded region.
[0067] "Primer"--The term "primer", as used herein, refers to a
polynucleotide molecule that is characterized by an ability to be
extended against a template nucleic acid molecule, so that a
polynucleotide molecule whose sequence is complementary to that of
at least a portion of the template molecule, is linked to the
primer. Preferred primers are at least approximately 15 nt long.
Particularly preferred primers have a length within the range of
about 18-30, preferably longer than approximately 20
nucleotides
[0068] "Product molecule"--A "product molecule", as that term is
used herein, is a nucleic acid molecule produced as described
herein. Preferably, the product molecule is produced by extension
of an oligonucleotide primer according to the present invention. A
product molecule may be single stranded or double stranded. In
certain preferred embodiments of the invention, a product molecule
that includes a double-stranded portion also includes a
single-stranded 3'- or 5'-overhang. In other preferred embodiments,
the product molecule is blunt-ended. Where a product molecule is
produced in an iterative DNA synthesis reaction (e.g., a PCR
reaction), it is referred to as an "amplified product".
[0069] "Recipient molecule"--A "recipient molecule", as that term
is used herein, is a nucleic acid molecule to which a product
molecule is to be ligated or otherwise further as associated. The
recipient molecule may be, but is not required to be, a vector. In
general, the recipient molecule can be any molecule selected by the
practitioner. In these cases where intramolecular ligature is
preferred the product molecule is also the recipient molecule.
[0070] "Vector"--A "vector", as that term is used herein, is a
nucleic acid molecule that includes sequences sufficient to direct
in vivo or in vitro replication of the molecule. Where the vector
includes in vivo replication sequences, these sequences may be
self-replication sequences, or sequences sufficient to direct
integration of the vector into another nucleic acid already present
in the cell, so that the vector sequences are replicated during
replication of the already-present nucleic acid. Such
already-present nucleic acid may be endogenous to the cell, or may
have been introduced into the cell through experimental
manipulation. Preferred vectors include a cloning site, at which
foreign nucleic acid molecules, preferably inventive product
molecules, may be introduced and ligated to the vectors.
Particularly preferred vectors further include control sequences
selected for their ability to direct in vivo or in vitro expression
of nucleic acid sequences introduced into the vector. Such control
sequences may include, for example, transcriptional control
sequences (e.g., one or more promoters, regulator binding sites,
enhancers, terminators, etc.), splicing control sequences (e.g.,
one or more splice donor sites, splice acceptor sites, splicing
enhancers, etc.), and translational control sequences (e.g., a
Shine Dalgarno sequence, a start codon, a termination codon, etc.).
Vectors may also include some coding sequence, so that
transcription and translation of sequences introduced into the
vector results in production of a fusion protein.
DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS
[0071] Product Molecules with 3' Overhangs
[0072] In one aspect, the present invention provides reagents and
methods for generating product molecules with 3' overhangs that can
be directly ligated to recipient molecules. The length and sequence
of the 3' overhang may be determined by the user. In general,
preferred embodiments of this method of the invention involve 1)
providing a nucleic acid primer that is at least partly
complementary with a target nucleic acid and that also includes at
least one residue (natural or modified) that renders the primer
(and/or a resulting product molecule) susceptible to cleavage); 2)
extending the primer so that a double-stranded product molecule is
generated whose double-stranded portion includes the residue; and
3) cleaving the product molecule at the susceptibility residue so
that a 3' overhang is generated. Of course, those of ordinary skill
in the art will appreciate that the susceptibility residue cold be
incorporated during extension. However, it is expected that it will
usually be introduced into the primer.
[0073] FIG. 1 depicts one particular embodiment of this aspect of
the invention. As shown in that Figure, first and second primers
are provided that flank a target region of a template nucleic acid
molecule. At least one of the primers includes one or more
ribonucleotides at its 5' end. These ribonucleotides act as
susceptibility residues. Specifically, if primer 1 is x nucleotides
long and primer 2 is y nucleotides long, then n1=a whole number
(including 0) from 0 to x and n2=a whole number (including 0) from
0 to y except that (i) n1 and n2 cannot both be 0; and (ii) n1 can
only be x (or n2 can only be y) if the DNA polymerase employed in
the extension reaction is capable of extending an RNA primer. The
characteristics (e.g., ability to extend an RNA primer, ability to
copy RNA into DNA [whether the RNA is presented alone or as part of
a hybrid RNA/DNA molecule) of a wide variety of DNA polymerases are
well known in the art (see, for example, manufacturer's catalogs,
Myers et al., Biochem. 6:7661, 1991), and where such
characteristics are not known for a particular DNA polymerase,
routine assays are available for determining them (see, for
example, Bebenek et al., Met. Enzymol. 262:217, 1995; see also
Example 3).
[0074] In certain preferred embodiments of the invention, each of
primers 1 and 2 includes at least one 5'-terminal ribonucleotide
(or other susceptibility) residue. In other preferred embodiments,
at least one primer includes at least two susceptibility residues,
one of which is the 5'-terminal residue. The primer may include at
least 3, 4, 5, 6-10, or more susceptibility residues and even, as
mentioned above, may be entirely made up of cleavable residues.
Preferably, the susceptibility residues are contiguous with one
another. Also, it is not necessary that the susceptibility
residue(s) be located at the 5'-terminus, so long as cleavage will
generate a new 5' end.
[0075] The nucleotide sequence of each of primer 1 and primer 2 is
selected by the practitioner and need not be fully complementary
with the sequence of the target nucleic acid. As is known in the
art, perfect complementarity is not required for successful DNA
synthesis, though it is generally desired that at least the
3'-terminal nucleotide of the primer be perfectly paired with the
template. The 5' end of the primer, however, need not be paired at
all, and it is common in the art to add additional sequences to a
target sequence by including them in the primer. Of course, it is
also acceptable for the primer to include a portion, 5' of the
extendible 3' terminus, that does not hybridize with the template,
and also to include a yet more 5' portion that does hybridize with
the template. For the purposes of the present invention, any such
variation on primer sequence, or any other available variation, is
acceptable, so long as (i) at least one primer includes a
susceptibility residue that either is present at the 5' end of the
primer or will generate a new 5' end of the primer upon being
removed from the primer (e.g., by alkaline treatment, preferably
followed by kinase treatment; and (ii) each primer hybridizes
sufficiently well and sufficiently specifically under the
conditions of the reaction that a product molecule is produced.
[0076] Other considerations of primer design are well known in the
art (see, for example, Newton et al., (eds), PCR: Essential Data
Series, John Wiley & Sons, New York, N.Y., 1995; Dieffenbach
(ed), PCR Primer: a Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1995; White et al.
(eds), PCR Protocols: Current Methods and Applications; Methods in
Molecular Biology, The Humana Press, Totowa, N.J., 1993; Innis et
al., PCR Protocols: A Guide to Methods and Applications, Academic
Press, San Diego, Calif., 1990; Griffin et al. (eds), PCR
Technology, Current Innovations, CRC Press, Boca Raton, Fla. 1994,
each of which is incorporated herein by reference). For instance,
it is often desirable for approximately 50% of the hybridizing
residues to be Gs or Cs; and may be desirable, for optimal
extension, for the 3'-terminal residue to also be a G or a C.
[0077] Primers such as those depicted in FIG. 1, that contain at
least one ribonucleotide residue as their 5' terminal residue (or
as a residue whose removal will create a new 5'-terminal primer
residue), may be prepared by any technique available in the art.
For example, such primers may be chemically synthesized. Companies
(e.g., Oligos, Etc., Inc., Bethel, Me.) that supply oligonucleotide
reagents will typically prepare hybrid RNA/DNA oligonucleotides, or
RNA only nucleotides, as preferred by the practitioner.
Alternatively, RNA sequences may be ligated to DNA sequences using
standard techniques (see, for example, Moore et al., Science
256:992, 1992; Smith (ed), RNA: Protein Interactions, A Practical
Approach, Oxford University Press, 1998, which particularly
discusses construction of RNA molecules containing site-specific
modifications by RNA ligation; each of these references is
incorporated herein by reference).
[0078] As shown in FIG. 1, an extension reaction is performed so
that DNA synthesis is primed from each of the first and second
primers, and a double stranded hybrid DNA/RNA molecule is created
with at least one ribonucleotide residue at the 5' end of at least
one strand. Preferably, but not essentially, the DNA polymerase
utilized in the extension reaction is one that does not add
extraneous 3' nucleotides. Also, as mentioned above, if one or both
of the primers has a ribonucleotide as its 3' residue, the DNA
polymerase utilized in the extension step must be one that is
capable of extending from a ribonucleotide primer.
[0079] FIG. 1 shows that the hybrid molecule is then exposed to a
treatment that removes the ribonucleotide residues. As depicted in
FIG. 1, that treatment is exposure to elevated pH (e.g., treatment
with a base such as sodium hydroxide [NaOH]). Any other treatment
that removes RNA residues without disturbing DNA residues (e.g.,
exposure to RNase, etc.) could alternatively be employed at this
step.
[0080] Those of ordinary skill in the art will appreciate that
different cleavage conditions will be appropriate for different
types of susceptibility residues. Furthermore, in some cases, it
may be useful or desirable to initially incorporate (into a primer
or a product molecule strand) a first form of a susceptibility
residue, different from its final susceptibility form, which first
form may or may not be susceptible to cleavage under the relevant
conditions. This first form can later be converted into the
susceptibility form, as desired. Example 7 describes various
well-known chemistries useful in the practice of such an embodiment
of the present invention.
[0081] When the ribonucleotide residues are removed from the hybrid
molecule, the resultant molecule is left with a double stranded
portion and a single stranded 3' overhang on at least one of its
ends. FIG. 1 depicts a product molecule with single-stranded 3'
overhangs at both ends. The sequence and length of the overhang was
determined by the sequence and length of RNA present at the 5' end
of the primers. Clearly, any sequence and length of overhang can be
selected. In certain preferred embodiments of the invention, the
sequence and length of the overhang corresponds with that produced
by cleavage of double-stranded DNA by a commercially available
restriction enzyme, so that the product molecule can be ligated to
recipient molecules that have been cut with that enzyme. A variety
of enzymes that leave 3' overhangs are known in the art, including
but not limited to AatII, AlwnI, NsiI, SphI, etc.
[0082] In other preferred embodiments, the 3' overhang sequence and
length is selected to base pair with a 3' overhang generated in
another inventive product molecule, so that the two molecules may
readily be ligated together (see, for example, Example 1).
[0083] Furthermore, it will be appreciated that the 3' overhangs at
the two ends of the product molecule need not have the same
sequence or length (see, for example, Example 1). It is often
desirable to generate a nucleic acid molecule that can be ligated
to a recipient molecule in only one orientation, or that can be
ligated to two different recipient nucleic acid molecules (e.g., a
three-way ligation) in a particular arrangement. Accordingly, it is
quite valuable to be able to engineer the sequence and length of
the 3' overhangs of the inventive product molecule.
[0084] As can be seen with reference to FIG. 1, the nature of the
ends left by the ribonucleotide-removal treatment can affect the
behavior of the product molecule in subsequent ligation reactions.
In particular, alkaline hydrolysis of ribonucleotides leaves 5'-OH
groups rather than 5'-phosphate groups. As is known in the art, at
least one terminal phosphate group is typically required for
successful ligation of nucleic acid molecules. Thus, if the product
molecule depicted in FIG. 1 is to be ligated to a recipient
molecule that lacks the appropriate terminal phosphate groups
(e.g., because of exposure to treatment with a phosphatase), it
will be desirable to add 5' phosphate groups to the recipient
molecule prior to ligation. Any available technique may be utilized
to achieve such phosphate group addition; most commonly, the
phosphate groups will be added by treatment with polynucleotide
kinase.
[0085] The product molecules depicted in FIG. 1 may be ligated to
any desired recipient molecule. Preferably, the recipient molecule
has at least one 3' overhang that is complementary to at least a
portion of the at least one 3' overhang on the product molecule. It
will be appreciated that, if the recipient molecule has a 3'
overhang whose 3' terminal portion is complementary to the 3'
terminal portion of the product molecule 3' overhang, but is not
otherwise complementary to the product molecule 3' overhang, then
one or more gaps will be present after hybridization, which gaps
can be filled in with DNA polymerase prior to ligation. Since the
sequence and length of the product molecule 3' overhang is selected
by the practitioner, this approach may be employed to add sequence
to the recombinant molecule that would not be present if complete
3' overhang hybridization had occurred. For the purposes of the
present invention, the complementary 3'-terminal portions of the
product and recipient molecules should be at least one nucleotide
long, and can be 2, 3, 4, 5, 6-10 nucleotides long, or longer. In
certain preferred embodiments, the complementary 3'-terminal
portions are less than about 6 nucleotides long, so that efficiency
of ligation (usually performed at 4.degree. C. or 14.degree. C.) is
preserved and complications associated with annealing longer
sequences are avoided.
[0086] Preferred recipient molecules include, but are not limited
to, linearized vectors. Such vectors may be linearized, for example
by digestion with a restriction enzyme that produces a 3' overhang
complementary to that present on the product molecule.
Alternatively, such linearized vectors may be prepared as product
molecules as described herein, containing one or more 3' overhangs
selected by the practitioner to be compatible with the 3' overhangs
present on other product molecules.
[0087] Those of ordinary skill in the art will appreciate that
product molecules can readily be generated according to the present
invention so that each end of a given product molecule has a
different 3' overhang. Such molecules can be used in directional
cloning experiments, where they can be ligated to one or more other
molecules in only a single orientation. Such directional ligation
strategies are particularly useful where three or more molecules
are desired to be linked to one another. In such multi-component
ligation reactions, it is often useful to minimize the possibility
of self-ligation by individual molecules, and also to reduce the
chance that the molecules will link together with one or more
molecule being in an improper orientation.
[0088] Product Molecules with 5' Overhangs
[0089] FIGS. 2-4 depict certain inventive strategies for producing
product molecules with 5' overhangs. In general, such strategies
involve 1) providing a primer including at least one residue that
does not get copied under the relevant experimental conditions; and
2) extending and copying the primer under conditions that generate
product molecule containing a 5' overhang.
[0090] For example, as shown in FIG. 2, a template molecule may be
hybridized with one or more primers including at least one
ribonucleotide. For this embodiment of the present invention, it is
not required that the ribonucleotide be located at the 5' end of
the oligonucleotide, though such is acceptable. The primer may
contain 2, 3, 4, 5, 6-10, or more ribonucleotides, and may be
wholly ribonucleotides if the DNA polymerase utilized in the
extension reaction will extend a ribonucleotide primer. That is, in
FIG. 2, at least one of n1 and n2 is a whole number greater than or
equal to 1, and n3 and n4 are each a whole number greater than or
equal to zero. The particular inventive embodiment depicted in FIG.
3 utilizes two primers. Those of ordinary skill in the art will
appreciate that each primer includes a portion, terminating with
the 3'-terminal residue of the primer, that hybridizes sufficiently
well with the template molecule to allow extension. The sequence of
the remainder of the primer, however, need not be complementary to
that of the template molecule. Furthermore, those of ordinary skill
in the art will also appreciate that if the DNA polymerase being
employed includes a 3'.fwdarw.5' exonuclease activity, it is not
even essential that the 3'-most residue in the primer hybridize
with the template, so long as the exonuclease activity is allowed
to chew back to a point in the primer from which extension can
occur.
[0091] After hybridization with the primer(s), an extension
reaction is performed with a DNA polymerase that does not copy
ribonucleotides. For example, we have found that Vent.sub.R.RTM.
and Vent.sub.R.RTM. (exo.sup.-) do not use ribonucleotide bases as
a template (see Example 1); Tth and Taq polymerases, by contrast,
are reported to be able to replicate ribonucleotides (Myers et al.,
Biochem. 6:7661, 1991), as, of course, are reverse transcriptases.
Other DNA polymerases may be tested for their ability to copy
ribonucleotides according to standard techniques or, for example,
as described in Example 3.
[0092] The extension reaction shown in FIG. 2 may be iterated as an
amplification reaction, if desired. The embodiment depicted in FIG.
2 illustrates such an amplification, from which the product is a
double stranded molecule with two 5' overhangs, each of which
includes at least one ribonucleotide residue. Those of ordinary
skill in the art will appreciate that the sequence and length of
each 5' overhang (as well as is ribonucleotide composition) is
selected by the practitioner, and that the two product molecule
overhangs depicted may be the same or different.
[0093] This product molecule may then be hybridized with one or
more recipient molecules containing a 5' overhang that is
complementary to at least the 5'-terminal residue of the product
molecule. If gaps remain after hybridization, they may be filled in
with DNA polymerase according to known techniques. If the gaps
encompass a ribonucleotide residue, it may be preferable to employ
a DNA polymerase that will copy RNA in order to ensure that the gap
is filled. As mentioned above, such DNA polymerases include, for
example, Tth, Taq, and reverse transcriptase. Other DNA polymerases
may be tested for their ability to copy RNA according to known
techniques or, for example, as described in Example 3.
[0094] Once any gaps are filled, the product and recipient
molecules may be ligated together. DNA ligase is known to close
nicks (i) between adjacent deoxyribonucleotides; (ii) between a
deoxyribonucleotide and a ribonucleotide; or (iii) between adjacent
ribonucleotides. Thus, a hybrid molecule can be produced containing
both DNA and RNA residues. This molecule can be copied into DNA,
either in vitro according to standard techniques, or in vivo after
introduction in to a host cell capable of copying such a molecule
(Escherichia coli, for example, have been reported to be able to
remove and replace ribonucleotides that are base-paired with
deoxyribonucleotides--see Sancar, Science 266:1954, 1994).
Alternatively, it may be desirable to replicate the hybridized
compound into DNA rather than performing a ligation (e.g., by PCR
with DNA primers or with a DNA polymerase that can copy
ribonucleotides). Also, it should be mentioned that, in some cases,
ligation may be accomplished in vivo rather than in vitro, as is
known in the art for example for co-transformation of yeast
cells.
[0095] In the particular embodiment depicted in FIG. 2, the product
molecule is ligated with only a single recipient molecule and at
only one end. Those of ordinary skill in the art will appreciate
that a product molecule may alternatively be ligated at both of its
ends, either to a single recipient molecule or to two different
recipient molecules. Those of ordinary skill in the art will
further appreciate that, in some embodiments, the product molecule
may be ligated to itself (e.g., to form a circle).
[0096] FIG. 3 presents an alternative approach to generating
product molecules with one or more 5' overhangs. In this
embodiment, instead of employing ribonucleotide primer residues and
a DNA polymerase that cannot copy RNA, we utilize a modified
residue in the primer, which modified residue is not copied by the
DNA polymerase. A wide variety of modified nucleotides are known in
the art (see, for example, U.S. Pat. No. 5,660,985; see also
various catalogs such as that provided by Oligos, Etc. [Bethel,
Me.]); those that are not copied by particular DNA polymerases may
be identified, for example, by reference to the manufacturer's
catalog, by routine screening according to known techniques, or as
described, for example, in Example 3.
[0097] As discussed elsewhere herein, modified bases may be
incorporated into primers or product molecules in their final,
applicable form (e.g., the form not copied under the relevant
experimental conditions) or, alternatively, may be incorporated in
a different form and then subsequently be modified into the
relevant "active" form. (see, for instance, Example 7).
[0098] Modified bases may be removed from a product molecule,
before or after its ligation to a recipient molecule, either by DNA
replication in vitro or in vivo with a DNA polymerase that will
copy the modified base or by removal of the base followed by gap
repair, according to standard techniques (see, for example, Sancar,
Science 266:1954, 1994).
[0099] FIG. 4 presents an inventive embodiment for generating a
product molecule with at least one 5' overhang. In the particular
embodiment depicted in FIG. 4, the inventive strategy is applied to
a starting molecule containing one (FIG. 4A) or two (FIG. 4B) 3'
overhangs, so that the starting molecule is converted from a
3'-overhang-containing compound to a 5'-overhang-containing
molecule. However, those of ordinary skill in the art will
appreciate that the same approach could equally well be applied to
add one or two 5' overhangs to a starting molecule that is either
blunt ended, or contains one or two 3' or 5' overhangs.
[0100] The starting molecule depicted in FIG. 4 may be obtained by
any available means. The molecule may have one or two 3' overhangs
(meaning that at least one of R1 and R2 is at least one nucleotide
long) and may be produced, for example, by restriction endonuclease
cleavage of a precursor fragment, by polymerase chain
amplification, or by any other means. In certain preferred
embodiments of the invention, the starting molecule is produced by
PCR and contains a single 3' dATP at each end, as described above.
FIG. 4A depicts the application of the inventive method to a
starting molecule having only one 3' overhang; FIG. 4B depicts the
application of the inventive method to a starting molecule having
two 3' overhangs.
[0101] With reference to FIG. 4A, the starting molecule is
hybridized with at least one primer containing a first portion that
hybridizes with a first sequence in the starting molecule that is
substantially adjacent to the starting molecule 3' overhang
residue, a second portion that aligns with and fails to hybridize
to at least one residue of the starting molecule 3' overhang, and a
third portion that does not align with the starting molecule but
rather extends past (5' in the primer) the last residue of the
starting molecule 3' overhang.
[0102] The length and sequence of the first portion of the primer
is determined by the sequence of the starting molecule adjacent the
starting molecule 3' overhang. Hybridization by the first portion
of the primer may extend into the 3' overhang, so long as at least
one residue of the 3' overhang is aligned with and fails to
hybridize with the second portion of the primer. The length and
sequence of the second portion of the primer is determined to some
degree by the length and sequence of the starting molecule 3'
overhang in that the second portion must fail to hybridize with at
least one residue of the 3' overhang, preferably but not
essentially at least the 3'-terminal residue. So long as such
hybridization is avoided, the precise sequence of this second
portion of the primer may be selected by the practitioner. The
length (i.e., the value of n in FIG. 4A, which must be a whole
number greater than or equal to 1) and sequence (i.e., the
identities of N in FIG. 4A) of the third portion of the primer is
also determined by the practitioner. This third portion will become
a 5' overhang in the product molecule.
[0103] As depicted in FIG. 4A, single or multiple rounds of
extension from the inventive primer may be performed. It will be
appreciated by those of ordinary skill in the art that, due to the
absence of a second primer (and the mismatch between the primer and
the starting molecule 3' overhang, which prevents extension of the
3' end of that strand of the starting molecule) only linear, and
not exponential, extension is accomplished. Of course, if the DNA
polymerase employed in the extension reaction is one that adds one
or more terminal 3' residues, the product molecule may have a 3'
overhang as well as a 5' overhang.
[0104] Once the product molecule with a 5' overhang is produced, it
may be hybridized with any recipient molecule that also contains a
5' overhang, at least part of which is complementary to part of the
product molecule 5' overhang. The hybridized compound contains a
nick on each strand (or may even contain a gap if the 5' overhangs
of the product and recipient molecules are imperfectly matched in
length) and at least one mismatch immediately prior to the product
molecule 5' overhang. This hybridized compound is then exposed to a
3'.fwdarw.5' exonuclease activity to remove the mismatched base(s)
(that correspond to the portion of the starting molecule 3'
overhang that did not hybridize with the second portion of the
primer). The digested compound is then exposed to a DNA polymerase
to fill in the gap created by exonuclease digestion, and
subsequently to ligase to heal any remaining nicks. Enzymes having
3'.fwdarw.5' exonuclease activity are well known in the art
(including, for example, E. coli DNA polymerase I, Pfu,
Vent.sub.R.RTM., Deep Vent.sub.R.RTM., etc.); other enzymes may be
tested for this ability according to standard techniques.
[0105] Those of ordinary skill in the art will appreciate that the
method depicted in FIG. 4A may be applied to either strand of a
starting molecule, depending on where the 3' overhang is located.
As depicted in FIG. 4B, the method may even be applied to both
strands simultaneously, although it is important for such an
embodiment to perform only a single round extension reaction or to
perform independent extension reactions for each strand.
Amplification (i.e., multiple rounds of denaturation and extension)
is not performed because such amplification would result in the
production of a blunt-ended molecule (or one with 3' overhangs if a
DNA polymerase that adds 3' nucleotides were employed), having the
sequence dictated by the primers, rather than a molecule with a 5'
overhang and a mismatch immediately 3' of the 5' overhang.
[0106] As shown in FIG. 4B, a starting molecule containing two 3'
overhangs is converted to a product molecule containing two 5'
overhangs by application of the inventive method. The starting
molecule is hybridized with two inventive primers containing first,
second, and third portions as described above in the discussion of
FIG. 4A. Each primer is then extended in single-round (or
independent) extension reactions. It will be understood by those of
ordinary skill in the art that both extension reactions need not be
performed simultaneously, or on the same exact starting molecule.
Extensions of each primer can even be performed in different
reaction vesicles.
[0107] Each of the double-stranded molecules produced in the
extension reaction has a single 5' overhang, whose sequence and
length corresponds to that of the third primer portion. The strands
of these double stranded molecules are then separated from one
another. Individual strands may be separately purified if desired,
but such is not required. Strands are then mixed together (if they
are not already together) and annealed, so that the two new strands
synthesized by extension of the primers have the opportunity to
anneal to one another. The product of this annealing reaction is an
inventive product molecule with two 5' overhangs. As will be
appreciated, these overhangs may be the same or different in length
and/or sequence.
[0108] This product molecule may be hybridized with one or more
recipient molecules, each of which has a 5' overhang whose
5'-terminal portion (at least one nucleotide in length) is
complementary with a 5'-terminal portion (of the same length) of
the product molecule 5' overhang. Any gaps remaining after
hybridization may be filled in with a DNA polymerase; the product
and recipient molecules may then be ligated together.
[0109] Blunt-Ended Product Molecules
[0110] FIG. 5 presents an inventive embodiment that allows ligation
of blunt-ended molecules. As shown, blunt ended starting molecules
are provided that are to be linked together. Such molecules may be
prepared by any available technique including, for example,
digestion of a precursor with one or more restriction enzymes
(optionally followed by a fill-in or chew-back of any overhanging
ends), PCR (e.g., with a DNA polymerase that does not add
extraneous 3' nucleotides--reference can be made to manufacturer's
catalogs to determine the characteristics of a particular DNA
polymerase. For example, Vent.sub.R.RTM. is reported to generate
>95% blunt ends; Vent.sub.R.RTM. (exo.sup.-) is reported to
generate about 70% blunt ends and 30% single nucleotide 3'
overhangs, of any nucleotide; Pfu is reported to produce only
blunt-ended molecules), chemical synthesis, etc. The starting
molecules may be double stranded or single stranded. As depicted in
FIG. 5, the starting molecules are double stranded.
[0111] The starting molecules are hybridized to bridging molecules,
each of which hybridizes to at least one terminal residue of two
different starting molecules that are to be linked together.
Clearly, if the starting molecules are double stranded, they should
be denatured prior to exposure to the bridging molecules, so that
successful hybridization with the bridging molecules may occur. The
bridging molecules may hybridize to more than one residue of each
starting molecule, and/or may contain non-hybridizing portions
between the portions that hybridize to the two starting molecules.
Also, the bridging molecules may have sufficient length that they
abut one another after hybridization, or may be short enough that
gaps are present in the hybridized compound between the individual
bridging molecules. Preferably, at least one primer hybridizes to
the 3'-terminus of the 3'-most starting molecule in the hybridized
compound. This primer may extend past the terminus if desired, so
that a 5' overhang is created. No such overhang is depicted in FIG.
5.
[0112] The hybridized compound is then converted into a
double-stranded DNA molecule by any collection of available
techniques. For example, gaps may be filled with DNA polymerase and
any remaining nicks sealed with DNA ligase. Or, if no gaps are
present in one strand, that strand may first be ligated and DNA
polymerase subsequently applied, in vitro or in vivo to seal gaps
in the other strand or to synthesize a replacement strand (e.g.,
primed from the bridging molecule hybridized at the most 3'
location with respect to the starting molecules). In one preferred
embodiment of the invention, gaps are filled and nicks sealed and
the entire recombinant molecule is then replicated by PCR
amplification. If desired, a DNA polymerase that adds one or more
3'-terminal residues may be employed, so that the resultant
amplified product is likely to have one or more 3' overhangs. As
described above, such a product may readily be ligated to another
molecule with complementary 3' overhangs, such as occurs in the use
of the Invitrogen TA Cloning Kit.RTM. system.
[0113] Applications
[0114] The product molecules and ligation strategies provided above
are useful in any of a variety of contexts. For the purposes of
clarification only, and not for limitation, we discuss certain of
these contexts in more detail here.
[0115] As described above, the present invention provides
techniques and reagents for providing nucleic acid molecules that
can be directly ligated (i.e., without first being digested with a
restriction enzyme) to other molecules. The invention also provides
techniques for accomplishing such ligation (e.g., in vitro or in
vivo). The present invention may be used to link nucleic acid
molecules of any sequence to one another and therefore has the
broadest possible application in the field of genetic cloning.
[0116] Those of ordinary skill in the art will appreciate that the
inventive techniques and reagents may be employed to link any DNA
molecule to any other DNA molecule, regardless of the particular
sequences of the DNA molecules, their protein-coding capacities, or
any other characteristics. This feature distinguishes the present
system from traditional, restriction-endonuclease-reliant cloning
systems, for which the precise sequences of the molecules being
linked can often affect the design of the cloning strategy, as it
may be desirable, for example, to avoid cleaving one fragment with
a particular enzyme that produces an undesired cleavage in another
fragment, or to make other adjustments to accommodate the behavior
of the protein enzymes being employed.
[0117] Production of Protein-Coding Genes
[0118] In certain preferred embodiments of the present invention,
one or more of the DNA molecules included in an inventive ligation
reaction includes open reading frame, i.e., a protein-coding
sequence. In particularly preferred embodiments, at least two DNA
molecules to be ligated together include open reading frame
sequences, and their ligation produces a hybrid DNA containing both
open reading frames linked together so that a single polypeptide is
encoded. Where ligation of two or more DNA molecules, according to
the present invention, generates at least one open reading frame
that spans at least one ligation junction, the ligation is
considered to have generated a new, hybrid protein-coding gene.
[0119] In but one embodiment of the inventive system used to
produce protein-coding genes, the DNA molecules to be ligated to
one another are selected to encode one or more discrete functional
domains of known biological activity, so that the ligation of two
or more such DNA molecules produces a hybrid gene encoding a bi- or
multi-functional polypeptide. It is well known in the art that many
proteins have discrete functional domains (see, for example, Traut,
Mol. Cell. Biochem. 70:3, 1986; Go et al., Adv. Biophys. 19:91,
1985). It is also well known that such domains may often be
separated from one another and ligated with other discrete
functional domains in a manner that preserves the activity of each
individual functional domain.
[0120] Those of ordinary skill in the art will appreciate that some
flexibility is allowed in the selection of precise DNA sequences
encoding functional protein domains. For example, it is often not
desirable to limit the DNA sequences to only those that encode for
exactly the amino acid residues contained in a functional domain of
a naturally-occurring protein. Additional DNA sequences may be
included, for example, encoding linker sequences that can provide
flexibility between the particular selected functional domain and
any other functional domain to which it is to be linked.
[0121] Alternatively or additionally, in some contexts researchers
have found that it is useful to select DNA sequences encoding less
than all of the amino acids comprising a particular functional
domain (see, for example, WO 98/01546); in such cases, the other
amino acids can be added back as a result of the subsequent
ligation (i.e., can be encoded by an adjacently-ligated DNA
molecule), or can be left out completely. Those of ordinary skill
in the art will readily be able to familiarize themselves with the
application of these basic principles to their particular
experimental question after appropriate consultation with the
literature describing the protein domains in which they are
interested.
[0122] To give but a few examples of the types of functional
protein domains that could be encoded by individual DNA molecules,
or combinations of DNA molecules, to be ligated according to the
present invention, well known modular domains include, for example
DNA binding domains (such as zinc fingers, homeodomains,
helix-turn-helix motifs, etc.), ATP or GTP binding domains,
transmembrane spanning domains, protein-protein interaction domains
(such as leucine sippers, TPR repeats, WD repeats, STYX domains
[see, for example, Wishart et al., Trends Biochem. Sci. 23:301,
1998], etc.), G-protein domains, tyrosine kinase domains (see, for
example, Shokat, Chem. Biol. 2:509, 1995), SRC homology domains
(see, for example, Sudol, Oncogene 17:1469, 1998), SH2 domains
(see, for example, Schaffhausen, Biochim. Biophys. Acta 28:61,
1995), PTB domains (see, for example, van der Greer et al., Trends
Biochem Sci 20:277, 2995), the PH domain (see, for example,
Musacchio et al., Trends Biochem Scie 18:343, 1993), certain
catalytic domains, cell surface receptor domains (see, for example,
Campbell et al., Immunol. Rev. 163:11, 1998), carbohydrate
recognition domains (see, for example, Kishore et al., Matrix Biol.
15:583, 1997), immunoglobulin domains (see, for example, Rapley,
Mol. Biotechnol. 3:139, 1995), etc. (see also, Hegyi et al., J.
Protein. Chem. 16:545, 1997; Baron et al., Trends Biochem. Sci.
16:13, 1997).
[0123] Typically, such domains are identified by homology
comparisons that identify regions of sequence similarity within
proteins of known biological activity (at least as relates to the
portion of the protein showing the homology). The spatial coherence
of any particular functional domain is often confirmed by
structural studies such as X-ray crystallography, NMR, etc.
[0124] According to the present invention, a useful "functional
domain" of a protein is any portion of that protein that has a
known biological activity that is preserved with the portion is
separated from the rest of the protein, even if the portion must
continue to be embedded within a larger polypeptide molecule in
order to maintain its activity. The relevant biological activity
need not, and typically will not, constitute the complete
biological activity of a particular protein in which the domain is
naturally found, but rather will usually represent only a portion
of that activity (e.g., will represent an ability to bind to a
particular other molecule but will not include a further activity
to cleave or modify the bound molecule). As noted, many such
domains have already been described in the literature; others can
be identified by homology search, preferably in combination with
mutational studies as is known in the art to define sequences that
participate in biological activity.
[0125] The present invention encompasses the recognition, now
virtually universally accepted, that the production of new genes
during evolution has often involved the novel combination of DNA
sequences encoding two or more already-existing functional protein
domains (see, for example, Gilbert et al., Proc Natl Acad Sci USA,
94:7698, 1997; Strelets, et al., Biosystems, 36:37, 1995). In fact,
protein "families" are often defined by their common employment of
particular functional domains, even though the overall biological
roles played by different family members may be quite unrelated
(see further discussion of such families below, in section
discussing exon shuffling). The present invention therefore
provides techniques and reagents that can be used to mimic an
evolutionary process in the laboratory. The universality and
experimental simplicity of the system provide researchers, who may
select particular DNA modules to link to one another in desired
orders, with significant advantages over Mother Nature, who must
wait for stochastic processes to produce interesting new
results.
[0126] Accordingly, preferred protein functional domains to be
employed in accordance with the present invention include those
that have been re-used through evolution to generate gene families
(i.e., collections of genes that encode different members of
protein families). Exemplary gene families created by re-use of
particular protein domains include, for example, the tissue
plasminogen activator gene family (see, for example FIG. 6); the
family of voltage-gated sodium channels (see, for example, Marban
et al., J. Physiol. 508:647, 1998); certain families of adhesion
molecules (see, for example, Taylor et al., Curr. Top. Microbiol.
Imunol. 228:135, 1998); various extracellular domain protein
families (see, for example, Engel, Matrix Biol. 15:295, 1996; Bork,
FEBS Lett. 307:49, 1992; Engel, Curr. Opin. Cell. Biol. 3:779,
1991); the protein kinase C family (see, for example, Dekker et
al., Curr. Op. Struct. Biol. 5:396, 1995); the tumor necrosis
factor receptor superfamily (see, for example, Naismith et al., J.
Inflamm 47:1, 1995); the lysin family (see, for example, Lopez et
al., Microb. Drug Resist. 3:199, 1997); the nuclear hormone
receptor gene superfamily (see, for example, Ribeiro et al., Annu.
Rev. Med. 46:443, 1995; Carson-Jurica et al., Endocr. Rev. 11:201,
1990); the neurexin family (see, for example, Missler et al., J.
Neurochem. 71:1339, 1998); the thioredoxin gene family (see, for
example, Sahrawy et al., J. Mol. Evol., 42:422, 1996); the
phosphoryl transfer protein family (see, for example, Reizer et
al., Curr. Op. Struct. Biol. 7:407, 1997); the cell wall hydrolase
family (see, for example, Hazlewood et al., Prog. Nuc. Acid Res.
Mol. Biol. 61:211, 1998); as well as certain families of synthetic
proteins (e.g., fatty acid synthases, polyketide synthases [see,
for example, WO 98/01546; U.S. Pat. No. 5,252,474; U.S. Pat. No.
5,098,837; EP Patent Application Number 791,655; EP Patent
Application Number 791,656], peptide synthetases [see, for example,
Mootz et al., Curr. Op. Chem. Biol. 1:543, 1997; Stachelhaus et
al., FEMS Microbiol. Lett 125:3, 1995], and terpene synthases).
[0127] The present invention allows DNA molecules encoding
different functional domains present in these families to be linked
to one another to generate in-frame fusions, so that hybrid genes
are produced that encode polypeptides containing different
arrangements of the selected functional domains. It will be
appreciated that experiments can be performed in which (i) only the
domains utilized in a particular gene family in nature are linked
to one another (in new arrangements), or in which (ii) domains
naturally utilized in different gene families are linked to one
another.
[0128] In one particularly preferred embodiment of the present
invention, the DNA modules selected to be ligated together comprise
modules encoding at least one functional domain, or portion of a
functional domain, of a member of a synthetic enzyme family. As
mentioned above, a variety of enzyme families are known whose
members are responsible for the synthesis of related biologically
active compounds. Families of particular interest include the fatty
acid synthase family, the polyketide synthase family, the peptide
synthetase family, and the terpene synthase family (sometimes
called the terpenoid synthase family, or the isoprenoid synthase
family). The individual members of these enzyme families are
multi-domain proteins that catalyze the synthesis of particular
biologically active chemical compounds. For any particular family
member, different protein domains catalyze different steps in the
overall synthesis reaction. Each family member catalyzes the
synthesis of a different chemical compound because each contains a
different collection or arrangement of protein functional domains.
As will be understood in the context of the present application,
the instant invention provides a system by which the various
protein domains utilized in these gene families may be linked to
one another in new ways, to generate novel synthase enzymes that
will catalyze the production of new chemical entities expected to
have biological activities related to those produced by
naturally-occurring members of the gene family from which the
functional domains were selected.
[0129] In order to more clearly exemplify this aspect of the
present invention, we discuss below certain characteristics and
attributes of each of the above-mentioned particularly preferred
synthetic enzyme protein families:
[0130] Animal Fatty Acid Synthase Family
[0131] The aminal fatty acid synthase comprises two multifunctional
polypeptide chains, each of which contains seven discrete
functional domains. Fatty acid molecules are synthesized at the
interface between the two polypeptide chains, in a reaction that
involves the iterative condensation of an acetyl moiety with
successive malonyl moieties (see, for example, Smith, FASEB J.
8:1248, 1994; Wakil, Biochemistry 28:4523, 1989, each of which is
incorporated herein by reference). Most commonly, the .beta.-keto
intermediate produced in this condensation reaction is completely
reduced to produce palmitic acid; in certain instances, however,
alternative substrates or alternative chain-terminating mechanisms
are employed so that a range of products, including branched-chain,
odd carbon-numbered, and shorter-chain-length fatty acid molecules.
These molecules have a range of roles in biological systems,
including (i) acting as precursors in the production of a variety
of singalling molecules, such as steroids, as well as (ii)
participating in the regulation of cholesterol metabolism.
[0132] Those of ordinary skill in the art, considering the present
disclosure, will readily recognize that the techniques and reagents
described herein can desirably be applied to DNA molecules encoding
one or more of the functional domains of a fatty acid synthase
molecule, so that the molecules may be linked to other DNA
molecules to create interesting new hybrid DNAs, preferably
encoding hybrid animal fatty acid synthase genes that may have
novel synthetic capabilities.
[0133] Polyketide Synthase Family
[0134] Polyketides represent a large and structurally diverse class
of natural products that includes many important antibiotic,
antifungal, anticancer, antihelminthic, and immunosuppressant
compounds such as erythromycins, tetracylcines, amphotericins,
daunorubicins, avernectins, and rapamycins. For example, FIG. 7
presents a list of certain polyketide compounds that are currently
used as pharmaceutical drugs in the treatment of human and animal
disorders.
[0135] Polyketides are synthesized by protein enzymes, aptly named
polyketide synthases, that catalyze the repeated stepwise
condensation of acylthioesters in a manner somewhat analogous to
that employed by the fatty acid synthases. Structural diversity
among polyketides is generated both through the selection of
particular "starter" or "extender" units (usually acetate or
proprionate units) employed in the condensation reactions, and
through differing degrees of processing of the .beta.-keto groups
observed after condensation. For example, some .beta.-keto groups
are reduced to .beta.-hydroxyacyl-groups; others are both reduced
to this point, and are subsequently dehydrated to 2-enoyl groups;
still others are reduced all the way to the saturated
acylthioester.
[0136] Polyketide synthases (PKSs) are modular proteins in which
different functional domains catalyze different steps of the
synthesis reactions (see, for example, Cortes et al., Nature
348:176, 1990; MacNeil et al., Gene 115:119, 1992; Schwecke et al.,
Proc. Natl. Acad. Sci. USA 92:7839, 1995). For example, FIGS. 8 and
9 (from WO 98/01546) depict the different functional domains of
bacterial polyketide synthase genes responsible for the production
of erythromycin and rapamycin, respectively (see also FIG. 10).
Each of these genes is an example of a so-called "class I"
bacterial PKS gene. As shown, each cycle of polyketide chain
extension is accomplished by a catalytic unit comprising a
collection of functional domains including a .beta.-ketoacyl ACP
synthase domain (KS) at one end and an acyl carrier protein (ACP)
domain at the other end, with one or more other functional domains
(selected from the group consisting of an acyl transferase [AT]
domain, a .beta.-ketoacyl reductase [KR] domain, an enoyl reductase
[ER] domain, a dehydratase [DH] domain, and a thioesterase [TE]
domain).
[0137] Class II bacterial PKS genes are also modular, but encode
only a single set of functional domains responsible for catalyzing
chain extension to produce aromatic polyketides; these domains are
re-used as appropriate in successive extension cycles (see, for
example, Bibb et al., EMBO J. 8:2727, 1989; Sherman et al., EMBO J.
8:2717, 1989; Fernandez-Moreno et al., J. Biol. Chem. 267:19278,
1992; Hutchinson et al., Annu. Rev. Microbiol. 49:201, 1995).
Diversity is generated primarily by the selection of particular
extension units (usually acetate units) and the presence of
specific cyclases (encoded by different genes) that catalyze the
cyclization of the completed chain into an aromatic product.
[0138] It is known that various alterations in and substitutions of
class I PKS functional domains can alter the chemical composition
of the polyketide product produced by the synthetic enzyme (see,
for example, Cortes et al., Science 268:1487, 1995; Kao et al., J.
Am. Chem. Soc. 117:9105, 1995; Donadio et al., Science 252:675,
1991; WO 93/1363). For class II PKSs, it is known that introduction
of a PKS gene from one microbial strain into a different microbial
strain, in the context of a different class II PKS gene cluster
(e.g., different cyclases) can result in the production of novel
polyketide compounds (see, for example, Bartel et al., J.
Bacteriol. 172:4816, 1990; WO 95/08548).
[0139] The present invention provides a new system for generating
altered PKS genes in which the arrangement and/or number of
functional domains encoded by the altered gene differs from that
found in any naturally-occurring PKS gene. Any PKS gene fragment
can be used in accordance with the present invention. Preferably,
the fragment encodes a PKS functional domain that can be linked to
at least one other PKS functional domain to generate a novel PKS
enzyme. A variety of different polyketide synthase genes have been
cloned (see, for example, Schwecke et al., Proc. Natl. Acad. Sci.
USA 92:7839, 1995; U.S. Pat. No. 5,252,474; U.S. Pat. No.
5,098,837; EP Patent Application Number 791,655; EP Patent
Application Number 791,656, each of which is incorporated herein by
reference; see also WO 98/51695, WO 98/49315, and references cited
therein, also incorporated by reference.), primarily from bacterial
or fungal organisms that are prodigious producers of polyketides.
Fragments of any such genes may be utilized in the practice of the
present invention.
[0140] Peptide Synthetase Family
[0141] Peptide synthetases are complexes of polypeptide enzymes
that catalyze the non-ribosomal production of a variety of peptides
(see, for example, Kleinkauf et al., Annu. Rev. Microbiol. 41:259,
1987; see also U.S. Pat. No. 5,652,116; U.S. Pat. No. 5,795,738).
These complexes include one or more activation domains (DDA) that
recognize specific amino acids and are responsible for catalyzing
addition of the amino acid to the polypeptide chain. DDA that
catalyze the addition of D-amino acids also have the ability to
catalyze the recemization of L-amino acids to D-amino acids. The
complexes also include a conserved thioesterase domain that
terminates the growing amino acid chain and releases the product.
FIG. 11 presents an exemplary list of products generated by peptide
synthetases that are currently being used as pharmacologic
agents.
[0142] The genes that encode peptide synthetases have a modular
structure that parallels the funcitonal domain structure of the
enzymes (see, for example, Cosmina et al., Mol. Microbiol. 8:821,
1993; Kratzxchmar et al., J. Bacteriol. 171:5422, 1989; Weckermann
et al., Nuc. Acids res. 16:11841, 1988; Smith et al., EMBO J.
9:741, 1990; Smith et al., EMBO J. 9:2743, 1990; MacCabe et al., J.
Biol. Chem. 266:12646, 1991; Coque et al., Mol. Microbiol. 5:1125,
1991; Diez et al., J. Biol. Chem. 265:16358, 1990; see also FIG.
12). For example, FIG. 13 (from U.S. Pat. No. 5,652,116) presents
the structure of one exemplary peptide synthetase gene operon, the
srfA operon.
[0143] The sequence of the peptide produced by a particular peptide
synthetase is determined by the collection of functional domains
present in the synthetase. The present invention, by providing a
system that allows ready linkage of particular peptide synthetase
functional domains to one another, therefore provides a mechanism
by which new peptide synthase genes can be produced, in which the
arrangement and/or number of functional domains is varied as
compared with naturally-occurring peptide synthase genes. The
peptide synthase enzymes encoded by such new genes are expected to
produce new peptide products. The present invention therefore
provides a system for the production of novel peptides, through the
action of hybrid peptide synthase genes.
[0144] Terpene Synthase Family
[0145] Isoprenoids are chemical compounds whose structure
represents a modification of an isoprene building block. The
isoprenoid family includes a wide range of structurally diverse
compounds that can be divided into classes of primary (e.g.,
sterols, carotenoids, growth regulators, and the polyprebol
substitutents of dolichols, quinones, and proteins) and secondary
(e.g., monoterpenes, sesquiterpenes, and diterpenes) metabolites.
The primary metabolites are important for biological phenomena such
as the preservation of membrane integrity, photoprotection,
orchestration of developmental programs, and anchoring of essential
biochemical activities to specific membrane systems; the secondary
metabolites participate in processes involving inter-cellular
communication, and appear to mediate interactions between plants
and their environment (see, for example, Stevens, in Isopentoids in
Plants [Nes et al., eds], Macel Dekker et al., New York, pp. 65-80,
1984; Gibson et al., Nature 302:608, 1983; and Stoessl et al.,
Phytochemistry 15:855, 1976).
[0146] Isoprenoids are synthesized through the polymerization of
isoprene building blocks, combined with cyclization (or other
intramolecular bond formation) within intermediate or final product
molecules. The polymerization reactions are catalyzed by
prenyltransferases that direct the attack of an electron deficient
carbon on the electron-rich carbon atom in the double bond on the
isoprene unit (see FIG. 14, from U.S. Pat. No. 5,824,774).
Cyclizations and other intramolecular bond formation reactions are
catalyzed by isoprenoid, or terpene, synthases (see FIG. 15, from
U.S. Pat. No. 5,824,774).
[0147] The terpene synthase proteins are modular proteins in which
functional domains tend to correspond with natural exons (see, for
example, U.S. Pat. No. 5,824,774, incorporated herein by
reference). FIG. 16, from U.S. Pat. No. 5,824,774, presents a
schematic illustration of the correspondence between natural exons
and funcitonal domains within isoprenoid synthases. The upper
diagram represents the organization of exons within the TEAS gene,
which is nearly identical to that of the HVS and casbene synthase
genes; the lower diagram shows the alignment of functional domains
to the exonic organization of the TEAS and HVS genes.
[0148] As will be appreciated in light of the present application,
the instant invention provides a system by which DNA molecules
encoding isoprenoid synthase functional domains may be linked to
one another to generate novel hybrid isoprenoid synthase genes in
which the arrangement and/or number of functional domains is varied
as compared with those observed in naturally-occurring isoprenoid
synthase genes. These novel hybrid genes will encode novel hybrid
proteins that are expected to catalyze the synthesis of new
isoprenoid compounds.
[0149] As mentioned above, in some embodiments of the invention,
DNA molecules encoding functional domains from one protein family
are linked to DNA molecules encoding functional domains from a
different protein family. Of particular interest in accordance with
the present invention are reactions in which DNAs encoding
polyketide synthase functional domains are linked with DNAs
encoding peptide synthetase functional domains. Alternative
preferred embodiments involve linkage of fatty acid synthase
functional domains with either or both of polyketide synthase
functional domains and peptide synthetase functional domains. The
hybrid genes created by such inter-family ligation reactions can
then be tested according to known techniques to determine their
ability to encode proteins that catalyze the synthesis of novel
chemical compounds related to polyketides, fatty acids, and/or
peptides.
[0150] As also mentioned above, it will be appreciated that the DNA
molecules selected to be linked to one another in a particular
experiment are not limited to molecules encoding functional domains
or portions thereof; molecules encoding "linker" amino acids may
additionally or alternatively be employed, as can non-coding
molecules, depending on the desired final product.
[0151] To give but one example, it may sometimes be desirable to
include in a final ligated molecule certain control sequences that
will regulate expression of other DNA sequences to which the
control sequences are linked when the ligated molecule is
introduced into a host cell or an in vitro expression system. For
example, transcriptional control sequences, RNA splicing control
sequences, other RNA modification control sequences, and/or
translational control sequences may be included in one or more of
the DNA molecules to be linked together. A wide variety of such
expression control sequences are well known in the art (see, for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989,
incorporated herein by reference); those of ordinary skill in the
art will be familiar with considerations relevant to selecting
desirable control sequences for use in their particular
application. In general, so long as such control sequences direct
expression of other DNA sequences to which they are linked when
those DNA sequences are introduced into a cell or an in vitro
expression system, they are appropriate for use in accordance with
the present invention.
[0152] Other DNA modules that could desirably be used in accordance
with the present invention include, for example, modules encoding a
detectable protein moiety (e.g., an enzyme moiety that catalyzes a
detectable reaction such as a color change or induction of
fluorescence or luminescence, or a moiety that interacts with a
known monoclonal antibody, etc), modules encoding a moiety that
allows ready purification of any polypeptide encoded by the ligated
product DNA molecule (e.g., a GST domain, a copper chelate domain,
etc.), or any other module desired by the researcher.
[0153] Directional Ligation
[0154] As discussed herein, one particularly valuable application
of the inventive techniques is for the linkage of multiple
different nucleic acid molecules to one another. Because the
embodiments of the invention that provide product molecules with 3'
or 5' overhangs allow the sequence and length of those overhangs to
be selected at the practitioner's discretion, molecules can readily
be prepared for ligation only to certain designated partners, in
certain designated orders, so that multi-member ligation reactions
can be performed with only minimal generation of spurious or
undesired ligation products.
[0155] FIG. 17 presents a schematic depiction of one generic
example of such a directional ligation reaction according to the
present invention (FIGS. 18-22 and Example 1 describe a specific
example). As shown, a first nucleic acid molecule, designated "A",
contains a first overhang, designated "overhang 1" on one end. A
second nucleic acid molecule, "B" is flanked by a second overhang,
"overhang 1'", that is complementary to overhang 1, and a third
overhang, "overhang 2", that is preferably unrelated to, and
certainly not identical with, overhang 1. A third nucleic acid
molecule, "C", contains a fourth overhang, "overhang 2'", that is
complementary with overhang 2. As will be appreciated by those of
ordinary skill in the art, a ligation reaction including all three
of these nucleic acid molecules will produce only a single reaction
product, "ABC", and will not produce "AC" or circular "B" products
due to the incompatibility of the ends that would have to be
ligated together to generate such products.
[0156] Mutagenesis
[0157] In another particularly useful application, the inventive
techniques and reagents may be utilized to alter the nucleotide
sequence of nucleic acid molecules. A separate mutagenesis reaction
is not required. Rather, primers and/or overhangs whose sequence
and length may be selected by the practitioner are utilized to
create single-stranded regions between molecules (or strands) to be
ligated, which single-stranded regions include new or altered
sequences as desired. These single-stranded regions can
subsequently be filled in with a polymerase that will synthesize a
strand complementary to the new sequence. Alternatively or
additionally, primers may be employed that add sequence to a
particular product molecule strand that will be copied in an
extension or amplification reaction. Those of ordinary skill in the
art will appreciate that sequence alterations may be introduced
into primers on either side of any terminating susceptibility
residue, and/or may include the terminating or susceptibility
residue.
[0158] FIGS. 35-37 depict inventive strategies that can be used to
introduce sequence modifications into nucleic acid molecules;
Example 8 describes the application of such strategies to
mutagenize the paraoxanase gene (also known as the
organophosphorous hydrolase ("OPH") gene ("OPD")) from bacteria in
the Pseudomonas family.
[0159] In the particular inventive embodiment depicted in FIG. 37,
a gene of interest is mutagenized in the context of a vector (e.g.,
an expression vector). Inventive primers are designed to introduce
desired mutations, and a single product molecule is generated
containing both the mutagenized gene and the vector sequences.
Those of ordinary skill in the art will appreciate, of course, that
gene and vector pieces can alternatively be produced separately,
however it is often useful in the practice of the present invention
to generate a single product molecule with both kinds of sequences.
As further shown in FIG. 37, remaining template molecules and/or
strands may optionally be removed prior to ligation or other
processing of the mutagenized product molecule. For example,
template molecules or strands will often contain methylated
residues (e.g., as a result of being produced in
methylated-competent host cells), and can be digested by enzymes
(e.g., DphI) that target methylated residues. Other strategies that
can be employed to target template molecules or strands for
digestion will be apparent to those of ordinary skill in the art.
The product molecule may then be linked to one or more other
molecules and/or be closed in vitro or in vivo. In certain
preferred embodiments of this aspect of the invention, the product
molecule, containing both mutagenized gene sequences and vector
sequences, is introduced directly into host cells.
[0160] In certain embodiments of this aspect of the invention, it
may be desirable to introduce gene sequence alterations that allow
ready identification and/or expression of the mutagenized
sequences. For instance, one or more restriction sites may be
introduced to allow ready mapping of product molecules (before or
after optional linkage with other molecules). Alternatively or
additionally, the introduced sequence alterations may adjust codon
use to reflect a bias present in a desired host cell. Of course,
the gene sequence alterations may alternatively or additionally be
intended to produce functional effects on a gene product (e.g., and
encoded protein). Those of ordinary skill in the art will be a
aware of a wide range of gene sequence alterations that can
desirably be introduced according to the present invention.
[0161] Exon Shuffling
[0162] One particular application of the techniques and reagents
described herein is in the production of libraries of hybrid
nucleic acid molecules in which particular collections of DNA
molecules, or "exons" have been linked to one another. That is, an
"exon shuffling" reaction is one in which a single reaction mixture
(e.g., a ligation mixture or a splicing reaction--discussed further
below) generates at least two, and preferably at least 10, 100,
1000, 10,000, 100,000, or 1,000,000 different product
molecules.
[0163] As used herein, the term "exon" refers to any DNA molecule
that is to be ligated to another DNA molecule. An exon may include
protein-coding sequence, may be exclusively protein-coding, or may
not include protein-coding sequence at all. The term "exon
shuffling" is intended to indicate that, using the techniques and
reagents of the present invention, collections of exons can be
produced that can be ligated to one another in more than one
possible arrangement. For example, as depicted in FIG. 23, the
inventive techniques and reagents may be employed in a ligation
reaction in which a single upstream exon, A, can be ligated to any
one of a collection of different internal exons (B1-B4 in FIG. 23),
which in turn is further ligated to a downstream exon, C.
[0164] Those of ordinary skill in the art will readily appreciate
that FIG. 23 presents just one particular embodiment of an
"identity exon shuffling" reaction (i.e., one in which the identity
of a particular exon is different in different products of the
shuffling reaction) according to the present invention. A wide
array of related reactions is included within the inventive "exon
shuffling" concept, and particularly within the concept of
"identity exon shuffling". For example, more than one exon may be
varied in a particular shuffling reaction. In fact, it is not
necessary to have upstream and downstream terminal exons that are
uniform among shuffling products, as is depicted in FIG. 23. Such
consistency may provide certain advantages, however, including an
ability to amplify all shuffling products with a single set of
amplification primers (discussed in more detail below). Even if
invariant flanking exons are preserved, however, more than one
internal exon may be varied; even if additional invariant internal
exons are also provided.
[0165] FIG. 24 presents an embodiment of a different sort of exon
shuffling reaction that may be performed according to the present
invention. In the particular embodiment shown in FIG. 24, upstream
(A) and downstream (H) exons are provided in combination with a
wide variety of possible internal exons (B-G). All exons have
compatible overhangs. In such a reaction, the possibilities for
internal exons arrangements to be found in product molecules are
infinite. Also, because no exons (other than the optional flanking
exons) are restricted to a particular position in the exon chain,
this type of shuffling is referred to as "positional
shuffling".
[0166] Of course, those of ordinary skill in the art will
appreciate that FIG. 24 is but an exemplary embodiment of inventive
positional shuffling systems. For example, it may well be desirable
to employ at least two sets of compatible overhangs and to ensure
that potential internal exons are not flanked by compatible ends;
otherwise, intramolecular circularization can present serious
complications as a competing reaction in inventive ligations. Also,
it is possible to perform an exon shuffling reaction that
represents a compromise between the extremes of allowing identity
shuffling at a single position while holding all other positions
fixed (e.g., FIG. 17) and allowing complete shuffling at all
positions. Merely by selecting the compatibility of the overhangs,
the practitioner may limit the number of exons able to incorporate
at a particular chain site, while allowing more variability at a
different site.
[0167] One of the advantages of the present invention is that it
allows simultaneous multi-site variation, optionally in combination
with positional variation (i.e., the possibility that a particular
exon sequence could end up in different positions in different
product molecules. To give but one example of the significance of
this phenomenon, FIG. 25 shows that other techniques might allow
production of libraries in which a single position in an exon chain
can be varied at one time. For a three-exon chain in which 10
different exons could be employed at each of the positions, 30
different variants can be produced (A1BC, A2BC, A3BC, . . . A10BC,
AB1C, AB2C, . . . AB10C, ABC1, ABC2, . . . ABC 10). By contrast, if
all three positions can be varied simultaneously, as is possible in
accordance with the present invention, 1000 different variants can
be produced.
[0168] As discussed above, it is now accepted that the evolutionary
process often produces new genes by re-sorting existing exons.
Large gene families have apparently been produced by exon
shuffling. According to the present invention, it is desirable to
employ the inventive techniques both to link particular selected
functional domains to one another (see above) and to shuffle exons
found in those gene families, so that a library of (at least two)
product genes is generated.
[0169] The inventive exon shuffling techniques may be applied to
any desired collection of exons. Preferably, they are applied to
exons including protein-coding sequences. More preferably, they are
applied to protein-coding exons that have been re-used in evolution
in different members of gene families (see discussion above). In
one particularly preferred embodiment of the exon shuffling system
of the present invention, the exons to be shuffled represent
functional domains of synthetic enzymes. As discussed above with
respect to ligation, re-sort exons from within family or between or
among families.
[0170] Particularly preferred gene families to which inventive exon
shuffling techniques may be applied include, but are not limited
to, the tissue plasminogen activator gene family, the animal fatty
acid synthase gene family, the polyketide synthase gene family, the
peptide synthetase gene family, and the terpene synthase gene
family. The class I bacterial polyketide synthase gene family
presents a particularly attractive target for application of the
inventive exon shuffling techniques in that the co-linearity of
functional domains and catalytic capabilities is so well
established for this family.
[0171] Also, the close mechanistic relationship between class I
polyketide synthases and animal fatty acid synthases, class II
polyketide synthases, and/or intermediate class polyketide
synthases (e.g., fungal polyketide synthases, whose funcitonal
organization and catalytic characteristics are apparently
intermediate between those of the bacterial class I and class II
polyketide synthases) renders shuffling reactions that admix DNAs
encoding functional domains of two or more of these different
families particularly intriguing. Such reactions will generate
libraries of new synthetic enzymes, which in turn will generate
libraries of new chemical compounds that can be assayed according
to any available technique to determine whether they have
interesting or desirable biological activities.
[0172] Integration with Existing Technologies
[0173] It will be appreciated that the present invention does not
describe the only available method for linking selected nucleic
acid molecules to one another. For example, the established
restriction-enzyme-based technology clearly allows cleavage and
ligation of nucleic acid molecules, albeit without the convenience
and other advantages of the inventive system. Also, techniques have
been developed by which ribozymes can be employed to mediate
cleavage and ligation of nucleic acids at the RNA or DNA level
(see, for example, U.S. Pat. No. 5,498,531; U.S. Pat. No.
5,780,272; WO 9507351; WO 9840519, and U.S. Patent Application
Serial No. 60/101,328, filed Sep. 21, 1998, each of which is
incorporated herein by reference; see also Example 4).
[0174] Each of these different systems for nucleic acid
manipulation offers certain advantages and disadvantages. For
example, ribozyme-mediated systems offer the distinct advantage
that shuffling reactions may be performed in vivo if desired (see,
for example, U.S. Patent Application Serial No. 60/101,328, filed
Sep. 21, 1998). Furthermore, once a shuffling cassette is generated
in which an exon of interest is linked to a first trans-splicing
ribozyme component, that exon may be ligated to any other exon that
is linked to a second trans-splicing component that is compatible
with the first trans-splicing component in a simple trans-splicing
reaction. Thus, the more the ribozyme-mediated system is utilized,
and the larger the number of shuffling cassettes generated by its
use, the more powerful it becomes.
[0175] Ribozyme-mediated nucleic acid manipulation, like the
techniques described herein, can be used for exon shuffling, and
can be engineered to direct seamless ligation of any selected
nucleic acid molecules. Furthermore, like the inventive system, the
ribozyme-mediated system may be engineered so that the agents that
mediate ligation (the ribozyme components in the ribozyme-mediated
system; the overhangs in the inventive system) are only compatible
with certain selected other ligation-mediating agents. This ability
allows one to perform directed ligation reactions analogous to
those depicted in FIG. 17, in which a collection of exons is
incubated together but only certain selected exons can become
ligated to one another (see, for example, Example 4 and FIG.
29).
[0176] One particularly preferred embodiment of the present
invention represents an integration of the primer-based
manipulation techniques described herein with the ribozyme-mediated
techniques described in the above-referenced patents and patent
applications. Specifically, the primer-based nucleic acid
manipulation techniques described herein are utilized to construct
ribozyme-associated shuffling cassettes that are then employed in
splicing reactions to generate hybrid nucleic acid molecules that
can subsequently be cloned and manipulated using inventive
primer-based strategies.
[0177] FIG. 26 presents one version of such a combined
primer-based/ribozyme-mediated nucleic acid manipulation scheme. As
depicted, nine different product molecules are produced using
inventive primer-based nucleic acid manipulation strategies. These
molecules are designed to be ligated together to produce three
different shuffling cassettes. The first shuffling cassette
comprises (i) a promoter that will direct transcription of the
cassette; (ii) a first tag sequence; (iii) an upstream terminal
exon; and (iv) a first ribozyme component. The second shuffling
cassette comprises (i) a promoter that will direct transcription of
the cassette; (ii) a second ribozyme component, compatible with the
first ribozyme component; (iii) an internal exon; and (iv) a third
ribozyme component (optionally not compatible with the second
ribozyme component). The third shuffling cassette comprises (i) a
promoter that will direct transcription of the cassette; (ii) a
fourth ribozyme component that is compatible with the third
ribozyme component (and optionally not with the first ribozyme
component); (iii) a downstream terminal exon; and (iv) a second tag
sequence.
[0178] Given the ease with which shuffling cassettes may be
generated using the inventive primer-based technology, there is no
need for shuffling cassettes to be introduced into vectors; they
may be transcribed directly. Of course, they may be introduced into
vectors if so desired, preferably by means of the inventive
primer-based nucleic acid manipulation techniques. Each cassette is
transcribed and the transcription products are incubated with one
another under splicing conditions, either in vitro or in vivo, to
produce a hybrid molecule containing each of the three exons. The
hybrid molecule may then be introduced into a vector or further
manipulated, again preferably using the inventive primer-based
manipulation technology.
[0179] Those of ordinary skill in the art will appreciate that more
than one internal cassette may be employed in the system of FIG.
26, either in an exon shuffling (involving positional and/or
identity shuffling) reaction or in a directed ligation reaction in
which only one copy of each exon will be introduced into the hybrid
molecule, in a pre-determined order. Alternatively or additionally,
multiple alternative upstream or downstream exons may be employed,
or such terminal exons may be left out. In a particularly preferred
embodiment of an identity exon shuffling reaction, multiple
alternative exons are provided, and are simultaneously shuffled,
for at least two positions (e.g., one internal position and one
terminal position, two internal positions, or two terminal
positions) in the hybrid molecule.
[0180] One advantage of the combined primer-based/ribozyme-mediated
system depicted in FIG. 26 can be appreciated through consideration
of the number of primers required to generate the indicated
molecules, and/or to clone them into vectors or other desirable
locales, according to the inventive methods. For example,
sixty-seven primers are required to generate the initial product
molecules if 10 different possible exon product molecules are
produced for each of the "A", "B", and "C" exons. This is a
relatively large number of primers, but is justified by the ease
with which the product molecules are generated and ligated together
using the inventive system, as compared with alternative methods
(e.g., standard restriction-enzyme-based cloning techniques)
available for the production of the shuffling cassettes. Only four
primers are required to amplify the resulting shuffling cassettes,
or to ligate them to other DNA molecules (e.g., a vector). Most
importantly, only two primers are required to amplify (or ligate)
assembled genes. Particularly where exon shuffling reactions have
been performed, and a library of assembled genes is generated, it
is valuable to be able to amplify all members of the library with
the same two primers.
[0181] Automation
[0182] One particularly attractive feature of the inventive
techniques and reagents is their susceptibility to automation. In
particular, where large libraries of novel hybrid nucleic acids are
being produced in inventive exon shuffling reactions, it may be
desirable to employ an automated system (e.g., the Beckman 2000
Laboratory Automation Work Station) to accomplish the simultaneous
manipulation of a large number of different samples.
[0183] To give but one example of a preferred automated application
of the present inventive methods, FIG. 27 depicts a robotic system
that could be utilized, for example, to accomplish exon shuffling
as depicted in FIG. 27 and further to screen the products of the
shuffling reaction for desired activities. For example, the product
molecules depicted in the first column of FIG. 26 could be
generated by PCR in 96 well plates using a Biomek 2000 system in
combination with a multimek 96 automated 96-channel pipetter and a
PTC-225 DNA engine (MJ Research), relying on the ORCA robot arm to
move the plates from one location to another as necessary.
[0184] Preferably, multiple alternatives are simultaneously
prepared of each exon product molecule (e.g., n "A" exons, A1-An,
are prepared; as are x "B" exons, B1-Bx; and y "C" exons, C1-Cy),
along with T7/X, 1-4', T7/5,6, and Y products. As discussed above,
67 different primers are required to produce these product
molecules according to the inventive methodologies described
herein.
[0185] The automated system is then programmed to pipette the
appropriate product molecules together, along with desired ligation
reagents, to produce 30 shuffling cassettes of the types depicted
in the second column of FIG. 26. The system is then programmed to
generate RNA from these shuffling cassettes using T7 RNA
polymerase. The "A"-type, "B"-type, and "C"-type transcripts are
then mixed together in all possible combinations, and are incubated
(still in the robotic system) under trans-splicing conditions. All
together, 1000 different splicing reactions will be performed.
[0186] A small aliquot of each splicing reaction is then removed
and amplified with inventive primers so that the amplification
products can readily be ligated with a recipient molecule such as a
vector. The resulting plasmids may then be introduced into host
cells (e.g., bacterial cells) for further amplification, or
alternatively may be introduced into an in vivo or in vitro
expression system so that any protein products encoded by the
assembled shuffled genes may be assayed. Desirable expression
systems will depend on the nature of the nucleic acid sequences
that were shuffled. To give but one example, if fungal polyketide
synthase gene fragments (e.g., encoding functional domains of
fungal polyketide synthase proteins) were shuffled according to
this approach, it may be desirable to express the hybrid proteins
thereby generated in one or more fungal or mammalian cells types in
order to assess their synthetic capabilities.
[0187] Kits
[0188] Reagents useful for the practice of the present invention
may desirably be provided together, assembled in a kit. Certain
preferred kits will include reagents useful for both
primer-mediated and ribozyme-mediated nucleic acid manipulation
reactions.
EXAMPLES
Example 1
Preparation and Ligation of Product Molecules with 5' Overhang
Sequences
[0189] This Example describes the preparation and ligation of
product molecules having 5' overhangs, using hybrid primers
containing deoxyribonucleotides at their 3' ends and
ribonucleotides at their 5' ends.
[0190] FIG. 18 presents a schematic of the particular experiment
that was performed. As shown, three different product molecules
were generated, two of which correspond to exons of the gene for
subunit B of the human glutamate receptor, and one of which
corresponds to an intron from the unrelated human .beta.-globin
gene. The particular glutamate receptor exons we utilized are known
as Flip and Flop, and are indicated in FIGS. 19A and 19B, which
present the nucleotide sequences of each of these exons (GenBank
accession numbers X64829 and X64830, respectively).
[0191] We prepared each of our three product molecules by PCR,
using Vent.RTM. DNA polymerase and plasmids Human GluR-B #7 (a
cloned genomic fragment containing exons 13-16 of the human
glutamate receptor B subunit) or H.beta.T7 (a cloned genomic
fragment containing exons 1-2 of the human .beta.-globin gene).
[0192] The Flop exon was amplified with a 5' primer (primer 1 in
FIG. 18; 5'-AAATGCGGTTAACCTCGCAG, SEQ ID NO 1) that is entirely DNA
and corresponds to the first 20 bases of the Flop exon, in
combination with a 3' primer (primer 2 in FIG. 18;
5'-accuTGGAATCACCTCCCCC SEQ ID NO 2) whose 5'-most four residues
are RNA, as indicated by lower case letters in FIG. 18. This primer
corresponds to the last 18 bases of the Flop exon plus 2 bases of
intron. Together, these primers amplify a fragment corresponding to
all of the human glutamate receptor Flop exon (115 basepairs) plus
the first two residues at the 5' end of the intron.
[0193] Intron 1 was amplified with a 5' primer (primer 3 in FIG.
18; 5'-agguTGGTATCAAGGTTACA, SEQ ID NO 3) whose sequence
corresponds to the first 18 bases of the human .beta.-globin intron
1, and whose 5'-most four residues are RNA, and are complementary
to the four RNA residues at the 5' end of primer 2; in combination
with a 3' primer (primer 4 in FIG. 18, 5'-cuAAGGGTGGGAAAATAGAC, SEQ
ID NO 5) corresponding to the last 20 bases of the human
.beta.-globin intron 1, whose 5'-most two residues are RNA. These
primers together amplify a fragment corresponding to the entire
intron (129 bp), and 2 add two residues corresponding to the last
two residues at the 3' end of the Flop exon.
[0194] The Flip exon was amplified with a 5' primer (primer 5 in
FIG. 18, 5'-agAACCCCAGTAAATCTTGC, SEQ ID NO 4) corresponding to the
first 18 bases of the human glutamate receptor Flip exon, whose
5'-most two residues are RNA and are complementary to the two RNA
residues at the 5'-end of primer 4; in combination with a 3' primer
(primer 6 in FIG. 18, 5'-CTTACTTCCCGAGTCCTTGG, SEQ ID NO 6)
corresponding to the last 20 exon bases, that was entirely DNA.
These primers together amplify a fragment corresponding to the
entire Flip exon (115 bp) and the last two nucleotides at the 3'
end of the intron.
[0195] Each amplification reaction included 400 .mu.mole of each
primer, kinased (using T4 polynucleotide kinase in 100 .mu.l
1.times.NEB T4 ligase buffer [50 mM Tris-HCl pH 7.8, 10 mM
MgCl.sub.2, 10 mM DTT, 1 mM ATP, 25 .mu.g/ml BSA] for 30 minutes at
37.degree. C., followed by dilution to 10 pmol/.mu.l with 200 .mu.l
nuclease-free dH.sub.2O); 2 units Vent.sub.R.RTM. (exo.sup.-)
polymerase (NEB, Beverly, Mass.), 100 .mu.l 1.times. Vent buffer
(10 mM KCl, 10 mM (NH.sub.4).sub.2SO.sub.4, 20 mM Tris, 2 mM
MgSO.sub.4, 0.1% Triton X-100); 200 .mu.M dNTPs; and 5 ng of
template plasmid. One cycle of (i) 95.degree. C., 3 minutes; (ii)
60.degree. C., 3 minutes; (iii) 72.degree. C., 3 minutes was
followed by 35 cycles of (i) 95.degree. C., 15 seconds; (ii)
60.degree. C., 15 seconds; (iii) 72.degree. C., 30 seconds, in a
Robocycler.RTM. gradient 40 (Stratagene, La Jolla, Calif.)
thermalcycler.
[0196] We found that Vent.sub.R.RTM. and Vent.sub.R.RTM. (exo-) did
not copy the ribonucleotides in our primers, so that, after
amplification, each product molecule contained a 5' ribonucleotide
overhang at one or both ends (4 nucleotides at the 3'-end of the
Flop product; 4 nucleotides at the 5'-end of the .beta.-globin
intron product; 2 nucleotides at the 3'-end of the .beta.-globin
intron product; and 2 nucleotides at the 5'-end of the Flip
product).
[0197] Each amplified product was precipitated with ethanol (EtOH)
and was resuspended in 10 .mu.L, 2 of which were run on a 6%
polyacrylamide gel in order to verify the presence of all three
amplification products. Aliquots (2-4 .mu.L each) containing
approximately equimolar quantities of each fragment were then
combined in a ligation reaction containing 1.times. New England
Biolabs (NEB) T4 ligase buffer (50 mM Tris, pH 7.8, 10 mM
MgCl.sub.2, 10 mM DTT, 1 mM ATP, 25 .mu.g/ml BSA) and 0.5 U of T4
DNA ligase (NEB, Beverly, Mass.). The 20 .mu.L reaction was
incubated overnight at 4.degree. C. to allow ligation to occur.
Products of ligation were then amplified using primers 1 and 3 and
Taq polymerase, which does copy RNA (Myers et al., Biochem. 6:7661,
1991). The amplification reaction contained 1.times.Taq buffer (20
mM Tris, pH 9.0, 50 mM KCl, 0.1% Triton X-100), 200 .mu.M dNTPs, 5
Units of Taq polymerase (Promega, Madison, Wis.), 2 .mu.L of the
ligation mix, and 400 .mu.mol of each primer.
[0198] The product of the Taq amplification is shown in FIG. 20,
and was ligated into the PCR 2.1 vector (Invitrogen, Carlsbad,
Calif.) using the TA Cloning Kit according to manufacturer's
instructions. Sequence analysis (using standard dideoxy sequencing
methods, and Universal and Reverse primers from United States
Biochemical, Cleveland, Ohio) of multiple (9) clones confirmed that
all ligation junctions were correct (see FIGS. 21 and 22). Because
this strategy ligated product molecules with rubonucleotide
overhangs, it is sometimes referred to as Ribonucleotide overhang
cloning (ROC).
Example 2
Preparation and Ligation of Product Molecules with 3' Overhang
Sequences
[0199] This Example describes the preparation and ligation of
product molecules having 3' overhangs, using hybrid primers
containing deoxyribonucleotides at their 3' ends and
ribonucleotides at their 5' ends.
[0200] FIG. 28 presents a schematic of the particular experiment
that was performed. As shown, three different product molecules
were generated, two of which correspond to the Flip and Flop exons
of the gene for subunit B of the human glutamate receptor, and one
of which corresponds to an intron from the unrelated human
.beta.-globin gene (see Example 1).
[0201] Each of the three product molecules was prepared by PCR,
using a Pfu polymerase which copies RNA nucleotides, and either
human genomic DNA or HBT7 (see Example 1). The Flop exon was
amplified with primers 1 and 2 from Example 1; intron 1 was
amplified either with primers 3 and 4 from Example 1 or with primer
3 and an alternative primer 4 (5'uucuAAGGGTGGGAAAATAG-3'; SEQ ID NO
24); the Flip exon was amplified either with primers 5 and 6 or
with an alternative primer 5 (5'agaaCCCAGTAAATCTTGC; SEQ ID NO 25);
and primer 6.
[0202] Each 100 .mu.L reaction contained 2.5 U of Pfu Turbo.RTM.
polymerase (Stratagene), 1.times. Cloned Pfu buffer (10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris pH=8.8, 2 mM Mg SO.sub.4, 10
mM KCl, 0.1% Triton X-100 and 0.1 mg/ml BSA), 200 .mu.M of each
dNTP, 1 mM MgSO.sub.4, and primers at a final concentration of 0.5
.mu.M each. The Flop and Flip reactions contained 375 ng of human
genomic DNA, while the .beta.-globin reaction contained 5 ng of
HBT7 DNA. The PCR step program was one cycle of 95.degree. C., 5
min; 50.degree. C., 3 min; 72.degree. C. 3 min; followed by 40
cycles of 95.degree. C., 30 sec; 50.degree. C., 30 sec; 72.degree.
C., 45 sec; followed by one cycle of 72.degree. C., 5 min in
Robocycler gradient 40 for the Flip and Flop fragments. The same
program was used to amplify .beta.-globin intron 1, except the
annealing temperature was 46.degree. C. Since Pfu polymerase does
not copy RNA (stratagene product literature), the PCR product
literature), the PCR products contained 5' overhangs. These
overhangs were filled in during an incubatioin at 72.degree. C. for
30 minutes with 5 U of Tth polymerase (Epicentre Technolgies,
Madison, Wis.), to fill in the 5'-RNA overhangs (Note, in more
recent experiments, M-MLV RT was used, rather than Tth, to fill in
the overhangs. When M-MLV RT was used, the fragments were separated
on agarose gels prior to treatment with 200 U of M-MLV RT in
1.times. First strand buffer (50 mM Tris pH=8.3, 75 mM KCl, 3 mM
MgCl.sub.2), 10 mM DTT and 0.5 mM dNTP in 20 .mu.L.). This strategy
allowed us to use Pfu polymerase, which has the highest fidelity of
available thermostable DNA polymerases, during the amplification
reaction but still generate blunt-ended reaction products.
[0203] The amplified parental PCR products were excised from an
agarose gel and purified. Five .mu.l of each purified sample were
fractionated on an agarose gel for quantitation. We then converted
the blunt-ended products to products containing 3' overhangs by
removing the ribonucleotides through exposure to mild base. NaOH (1
N) was added to 8 .mu.l of each of the gel isolated fragments to a
final concentration of 0.2 N and the samples were incubated at
45.degree. C. for 30 min. The base was neutralized by addition of 2
.mu.l of 1 N HCl. Since NaOH hydrolysis generates a 3'-phosphate
and a 5'-OH, we had to phosphoylate the products to be able to
ligate them. The DNA fragments were phosphorylated in 1.times.T4
ligase buffer (USB) in a total of 20 .mu.l for 30 min at 37.degree.
C. using 10 U of PNK (USB). Approximately 25 ng (3-6 .mu.l) of each
phosphorylated product were combined in a final volume of 20 .mu.l
and ligated for 16 hours at 14 .mu.C in 1.times.T4 ligase buffer
with 5 Weiss U of T4 DNA ligase (USB).
[0204] To produce the chimeric Flop-.beta.-Flip product, a
secondary PCR amplication was performed as described above for the
primary PCRs using 1 .mu.l of ligation reaction as template,
primers 1 and 6, and an annealing temperature of 58.degree. C. A
chimeric product of the expected size (360 bp) was observed. This
product was cloned and sequenced; both ligation junctions were
correct in 6 of 8 clones that were sequenced. Two clones each had
an error at one of the ligation sites. In one clone, three base
pairs were lost at the boundary between the .beta.-globin intron
and Flip. In the other clone, an A was changed to a T (data not
shown). We suspect that Tth polymerase introduced these errors
during the fill in step of the procedure. Because the strategy
described here involved ligation of molecules containing DNA
overhangs, it is sometimes referred to as DNA Overhang Cloning
(DOC).
Example 3
Bioassays for Determining Success of Primer Copying and/or
Ligation
[0205] The present Example describes techniques that could be used
to evaluate the ability of a particular DNA polymerase to copy
(i.e., to use as a template) a particular modified oligonucleotide
primer. For example, the techniques described herein might be
useful to determine whether a particular modified nucleotide or
ribonucleotide (or collection thereof) can be replicated by one or
more DNA polymerases.
[0206] FIG. 29 presents one embodiment of the present bioassay
techniques. As shown, two primers are provided that hybridize with
a template molecule. The first primer is known to be extendible by
a particular DNA polymerase; the second primer includes one or more
modified nucleotides or ribonucleotides whose ability to block
replication by the DNA polymerase is unknown. Any nucleotide
modification may be studied in the system.
[0207] As shown in FIG. 29, both primers are extended, so that, if
replication is blocked, a product molecule with a 5' overhang is
produced; a blunt-ended product molecule (or a molecule containing
a single-nucleotide 3'-overhang, depending on the DNA polymerase
employed) is generated if replication is not blocked.
[0208] The product molecule is then incubated with a vector
containing a complementary 5' overhang and carrying a selectable
marker (or a marker identifiable by screening). Only if replication
was blocked will hybridization occur. Ligation is then attempted
and should succeed unless the particular modification interferes
with ligation of a nick on the complementary strand (unlikely) or
the modification is present at the 5' end of the overhang and is of
a character that interferes with ligation to an adjacent 3' end. In
order to simplify the experiment and minimize the number of
variables in any particular reaction, it is expected that
modifications will only be incorporated at the very 5' end of a
primer if their ability to block replication is already known and
the desire is to asses only their ability to interfere with
ligation.
[0209] The ligation product is then introduced into host cells,
preferably bacteria. Selectable (or otherwise identifiable) cells
will grow and proliferate only if the modification in question did
block replication and either (i) did not block ligation on the
complementary strand; or (ii) did block ligation on the
complementary strand but did not block in vivo nick repair. If the
modification were at the 5' end of the primer, cells will only grow
if the modification did block replication and did not block
ligation of both strands.
[0210] Of course, where the modification constitutes one or more
ribonucleotides, or other removable nucleotides, absence of
colonies due to inability to block replication can be distinguished
from other absence of colony results by treating the original
product molecule with an agent that will remove the modified
nucleotide(s), along with any more 5' nucleotides, and then
incubating the resulting secondary product molecule, which contains
a 3' overhang complementary to the modified nucleotide and any more
5' nucleotides, with a vector containing a compatible 3'
overhang.
Example 4
Directional Ligation of Multiple Nucleic Acid Molecules by
Engineered Selective Compatibility of Catalytic Ribozyme
Elements
[0211] FIG. 30 shows a directional ligation reaction that allowed
selective ligation of particular exons through use of incompatible
ribozyme components. As indicated, transcripts were generated in
which (i) a first exon (A) was linked to a first ribozyme component
from the aI5.gamma. group II intron; (ii) a second exon (B) was
flanked by (a) a second ribozyme component, also from the
aI5.gamma. group II intron, that is compatible with the first
ribozyme component, and (b) a third ribozyme component, from the
LTRB intron of Lactococus lacti, that is not compatible with the
second intron component; and (iii) a third exon was linked to a
fourth ribozyme component, also from the LTRB intron, that is
compatible with the third intron component but not with the first
intron component. These three transcripts were incubated together
under splicing conditions and, as shown, only the ABC product (and
not the AC nor the circular B product) was produced.
[0212] In all, nine plasmids were used in the study: pJD20,
pB.E5.D4, pD4.E3(dC).B(2), pLE12, pB.5'Lac, p3'Lac.B,
pD4.E3(dC)B(2).5'Lac, and p3'Lac.B.E5.D4. Two PCR amplifications
were performed using plasmid pJD20, which contains the full-length
aI5.gamma. intron (Jarrell et al., Mol. Cell. Biol. 8:2361, 1988),
as a template. The first reaction amplified part of the intron
(domains 1-3 and 73 nt of domain 4), along with part (27 nt) of the
5' exon. The primers utilized, BamHI.E5
(5'-ACGGGATCCATACTTACTACGTGGTGGGAC; SEQ ID NO 7) and D4.SalI
(5'-ACGGTCGACCCTCCTATCTTTTTTAATTTTTTTTT; SEQ ID NO 8), were
designed so that the PCR product had unique BamHI and SalI sites at
its ends. The PCR product was digested with BamHI and SalI, and was
ligated into the PBS-vector (Stratagene), digested with the same
enzymes, so that it was positioned downstream of the T7 promoter.
The resulting plasmid was designated pB.E5.D4, and encodes the
B.5'.gamma. shuffling cassette (see FIG. 31).
[0213] The second PCR reaction that utilized pJD20 as a template
amplified a different part of the intron (the remaining 65 nt of
domain 4 plus domains 5-6), along with part (29 nt) of the 3' exon.
The primers utilized, KpnI.D4
(5'-ACGGGTACCTTTATATATAACTGATAAATATTTATT; SEQ ID NO 9) and E3.BamHI
(5'-ACGGGATCCAGAAAATAGCACCCATTGATAA; SEQ ID NO 10), were designed
so that the PCR product had unique KpnI and BamHI sites at its
ends. The PCR product was digested with KpnI and BamHI, and was
ligated into the PBS-vector, digested with the same enzymes, so
that it was positioned downstream of the T7 promoter. The resulting
plasmid was called pD4.E3(dC).B (see FIG. 31).
[0214] Sequence analysis of the pD4.E3(dC).B plasmid revealed an
unexpected point mutation in the 3' exon sequence. The expected
sequence was ACTATGTATTATCAATGGGTGCTATTTTCT (SEQ ID NO 11); the
observed sequence was ACTATGTATTATAATGGGTGCTATTTTCT (SEQ ID NO
12).
[0215] A site directed mutagenesis reaction was then performed,
using the QuickChange.RTM. Site-Directed Mutagenesis Kit
(Stratagene, catalog number 200518) to insert an additional BamHI
site into the 3' exon sequence. The primers utilized were
designated E3.BamHI(2)
(5'-CTCTAGAGGATCCAGAAAATAGGATCCATTATAATACATAGTATCCCG; SEQ ID NO 13)
and E3.BamHI(2) complement
(5'-CGGGATACTATGTATTATAATGGATCCTATTTTCTGGATCCTCTAG- AG; SEQ ID NO
14). The plasmid generated as a result of the site-directed
mutagenesis reaction was designated pD4.E3.(dC).B(2), and encoded
the 3'.gamma..B shuffling cassette (see FIG. 31), in which the
length of the 3' exon was shortened to 13 nt.
[0216] Two additional PCR reactions were performed, in which the
plasmid pLE12, which encodes the full-length LTRB intron flanked by
its natural 5' and 3' exons (Mills et al., J Bacteriol. 178:3531,
1996), was used as a template. In the first reaction, primers
5'transM.E.5' (5'-CACGGGATCCGAACACATCCATAACGTGC; SEQ ID NO 15) and
5'sht3' (5'-CAGCGTCGACGTACCCCTTTGCCATGT; SEQ ID NO 16) were used to
amplify part of the LTRB intron (domains 1-3), and part (15 nt) of
the 5' exon. The PCR product was generated with Taq polymerase and
was cloned into the PCR2.1 Topo vector (Invitrogen) using the
Topo.RTM. TA Cloning.RTM. kit (Invitrogen). The resulting plasmid
was designated pB.5'Lac, and encodes the B.5'Lac shuffling cassette
(see FIG. 31).
[0217] The same PCR product was also digested with BamHI and SalI,
and was ligated into pD4.E3(dC).B(2), cut with the same enzymes, to
produce pD4.E3(dC)B(2).5'Lac, which encodes the 3'.gamma..B.5'Lac
shuffling cassette (see FIG. 31).
[0218] Additionally, plasmid pB.5'Lac was digested with SpeI and
Asp718 to remove some unwanted restriction sites. Overhangs were
filled in with Klenow fragment, and the resulting blunt ends were
ligated to reseal the vector. The plasmid thereby produced was
designated pB.5'Lac(K) (see FIG. 31).
[0219] The second PCR reaction that utilized pLE12 as a template
involved the use of primers 3'transM.E.5'
(5'-CACGGAGCTCTTATTGTGTACTAAAATTAAAAATTG- ATTAGGG; SEQ ID NO 17)
and 3'transM.E.3' (5'-CAGCGGATCCCGTAGAATTAAAAATGATA- TGGTGAAGTAG;
SEQ ID NO 18) to amplify part of the PTRB intron (domains 4-6),
attached to part (21 nt) of the 3' exon. The primers were designed
so that the PCR product had unique SacI and BamHI sites at its
ends. The PCR products was generated with Taq polymerase and was
cloned into the pCR2.1 Topo vector. The resulting plasmid was
designated 3'Lac.B, and encoded the 3'Lac.B shuffling cassette (see
FIG. 31).
[0220] Plasmid p3'Lac.B was digested with SacI and BamHI, and the
1993 bp band thereby generated was purified from an agarose gel
using the Geneclean II kit (BIO 101). The purified fragment was
then ligated into pE5.D4, digested with the same enzymes, to
produce plasmid p3'Lac.B.E5.D4, encoding the 3'Lac.B.5'.gamma.
shuffling cassette (see FIG. 31).
[0221] Plasmids pB.E5.D4, pD4.E3(dC).B(2), pB.5'Lac, p3'Lac, B, and
pD4.E3(dC)B(2).5'Lac were linearized with HindIII and were
transcribed in vitro with T7 RNA polymerase (Stratagene, catalog
number 600123) at 40.degree. C. for 1 hour in 100 .mu.L reactions
containing 6 .mu.g of linearized template DNA and 0.5 mM unlabeled
ATP, CTP, GTP, and UTP. The RNAs produced in these transcription
reactions were treated with 1 U of RQ1 RNase-free DNase, were
extracted with phenol-chloroform, were desalted on a Sephadex G25
column, and were precipitated with EtOH. Precipitates were
subsequently resuspended in 6 .mu.L water.
[0222] One .mu.L of each resuspended RNA transcript was then used
in a trans-splicing reaction carried out at 45.degree. C. for 60
minutes, in 40 mM Tris-HCl, pH 7.6, 100 mM MgCl.sub.2, and either
0.5 M NH.sub.4Cl or 0.5M (NH.sub.4).sub.2SO.sub.4.
[0223] After the trans-splicing reaction, a reverse
transcription/PCR reaction was performed to identify ligated
splicing products. The detected products were: (i) ligated
aI.gamma.5 exons E5 and E3 produced by trans-splicing of B.E5.D4
and D4.E3(dC).B(2) (lane 1, FIG. 32); (ii) ligated LTRB 5' and 3'
exons produced by trans-splicing of 3'Lac.B and 3'Lac.B (lane 2,
FIG. 33); and (iii) the three-molecule ligation product produced by
trans-splicing of B.E5.D4, D4.E3(dC).B(2).5'Lac, and 3'Lac.B (lanes
2 and 3, FIG. 33).
Example 5
Cloning Products of 3'-Overhang Product Ligation Without
Amplification of Chimeric Product
[0224] We found that the products of a DOC ligation reaction could
be cloned directly into a vector for replication in bacteria
without a chimeric amplification step. As was described above in
Example 2, we designed chimeric primers that, when used in a DOC
experiment, generated Flop, intron 1, and Flip PCR products that
could be ligated directionally. In addition, the primers were
designed such that NaOH treatment of the PCR products creates an
upstream overhang on the Flop exon that is compatible with an Apa I
overhang, and a downstream overhang on the Flip exon that is
compatible with a Pst I overhang. All three fragments were
incubated together in the presence of ligase and pBluescript II SK
(-) that had been digested with ApaI and PstI. An aliquot of the
ligation mixture was transformed directly into E. coli, and the
expected chimeric clone was readily isolated, sequenced, and found
to be perfect (data not shown).
Example 6
Construction of Multiple Chimeric Products by DNA-Overhang
Cloning
[0225] To demonstrate the generality of the procedures described
herein, we applied the techniques of Example 2 and to a variety of
different molecules and produced five different chimeras, shown in
FIG. 35. All five chimeras were generated by directional
three-molecule ligation. Note that these chimeras were generated
using M-MLV reverse transcriptase, rather than Tth, to fill in 5'
RNA overhangs. When M-MLV RT was used, no errors were detected at
any of the ligation points.
Example 7
Modifying Natural DNA Residues
[0226] Those of ordinary skill in the art appreciate that
technologies are available for modifying natural DNA residues,
before or after their incorporation into a nucleic acid primer or
strand. For example, Maxam and Gilbert described several protocols
for modifying the purine or pyrimidine portion of a deoxynucleotide
within a strand of NDA. These base-modification methods include
methylation, reaction with the nucleophile hydrazine, reaction with
methylene blue, reaction with osmium tetroxide, and treatment with
both acid and base (e.g., NaOH). These modifications then make the
purine or pyrimidine moiety an amenable leaving group upon
treatment with heat, lowered pH, or nucleophilic attack by, e.g.,
piperidine, at the 1' carbon of the ribose moiety.
[0227] Table 1 below summarizes a variety of known chemical
reactions for modifying DNA residues:
1TABLE 1 BASE STRAND RESIDUE(S) MODIFICATION DISPLACEMENT CLEAVAGE
MODIFIED CONDITIONS CONDITIONS CONDITIONS REFERENCE(S) G > A
Dimethyl sulfate Base (results in Sodium hydroxide Maxam &
Gilbert, (methylates G at ring-opening Met. Enxymol. N-7 and A at
N-3) attack on C-8 of 65:499, 1980; the purine ring, Maxan &
Gilbert, cleavage of C-8/N- Proc. Natl Acad. 9 bond) Sci. USA
74:560, Heat at pH 7 1972 A > G Dimethyl sulfate Dilute acid
Base Maxam & Gilbert, (methylates G at (preferentially Met.
Enxymol. N-7, A at N-3) cleaves adenine) 65:499, 1980; Maxan &
Gilbert, Proc. Natl Acad. Sci. USA 74:560, 1972 G > A Dimethyl
sulfate Base (results in Base + piperidine Maxam & Gilbert,
(methylates G at ring-opening (beta-elimination Met. Enxymol. N-7,
A at N-3) attack on C-8 of of both phosphates 65:499, 1980; the
purine ring, from the 3' and 5' Maxan & Gilbert, cleavage of
C-8/N- carbons of the Proc. Natl Acad. 9 bond) ribose moiety). Sci.
USA 74:560, 1972 Piperidme (ring- opened 7- methylguanine displaced
by nucleophilic attack at the ribose 1' carbon T & C Hydrazine
(opens Piperidine (reacts Base + iperidine Maxam & Gilbert,
pyrimidine ring via with 1' carbon, Met. Enxymol. attack as C-4 and
displacing 65:499, 1980; C-6; recyclizes to hydrazone moiety) Maxan
& Gilbert, form new 5- Proc. Natl Acad. membered ring. Sci. USA
74:560, New ring and N2- 1972 C-2-N-3 urea fragment of original
pyrimidine released; ribose reacts with hydrazone at 1' carbon to
open ribose ring and give hydrazone) C Hydrazine + NaCl Piperidme
Piperidine Maxam & Gilbert, Met Enxytnol 65:499, 1980; Maxan
& Gilbert, Proc. Natl Acad. Sci. USA 74:560, 1972 G Dimethyl
sulfate Piperidine Piperidine Maxam & Gilbert, Met. Enzymol.
65:499, 1980 G + A Acid Acid Piperidine Maxam & Gilbert, Met.
Enzymol. 65:499, 1980 A > C Sodium hydroxide Piperidine
Piperidine Maxam & Gilbert, Met. Enzymol. 65:499, 1980 G > A
Dimethyl sulfate Heat at pH7 Piperidine Maxam & Gilbert, Met.
Enzymol. 65:499, 1980 G Methylene blue Piperidine Piperidine
Friedman & Brown Nuc. Aud. Res. 15:9109, 1987 T Osmium
tetroxide Piperidine Piperidine Friedman & Brown Nuc. Aud. Res.
15:9109, 1987
[0228] As the intent of Maxam and Gilbert was to create DNA strands
suitable for sequencing, their choice of a displacing moiety for
the purines and pyrimidines was with an eye toward subsequent
cleavage of the phosphate-ribose backbone in an efficient manner.
For stable modification of nucleotides that can pause or terminate
replication of the modified single strand, different chemistries
may be utilized. For example, Table 2 below presents a summary of
certain agents that can be used to modify ribonucleotides in a way
that can prevent reverse transcriptase from copying them.
2TABLE 2 RIBONUCLEOTIDE TARGETED ACTIVITY ON MODIFYING AGENT
RIBONUCLEOTIDE ssRNA/DsRNA REFERENCES Dimethyl sulfate A (at N-1),
C (at N-3) ssRNA Ehresmann, Nuc. Acid Res. 15:9109, 1987 Ajuh et
at., Biochim. Biophys. Acta 1219:89, 1994 Kumar et al., Biochem.
33:583, 1994 Mandiyan et at., Nuc. Acids Res. 18:7055, 1990 Rairkar
et al., Biochem 27:582, 1988 Stern et al., J. Mol. Biol. 192:101,
1986 Moazed et al., J. Mol. Biol. 187:399, 1986 Lempereur et al.,
Nuc. Acids Res 12:8339, 1985 1-cyclo-hexyl-3-(2- U (at N-3), G (at
N-1) ssRNA Ajuh et al., Biochim. morpholinoethyl)- Biophys. Acta
1219:89, carbodimide metho-p- 1994 toluene sulfonate Kumar et al.,
Biochem. (CMCT) 33:583, 1994 Mandiyan et al., Nuc. Acids Res.
18:7055, 1990 Moazed et al., J Mol. Biol. 187:399, 1986 DMS
NaBH.sub.4 + aniline G (at N-7) ssRNA Kumar et al., Biochem.
33:583, 1994 Kethoxal G (N-1 & N-2) ssRNA Mandiyan et al., Nuc.
Acids Res. 18:7055, 1990 Stern et al., J. Mol. Biol. 192:101, 1986
Moazed et al., J. Mol. Biol. 187:399, 1986 Diethyl pyrocarbonate A
ssRNA Rairkar et al., Biochem. 27:582, 1988 Cobra venom (V1)
[hehcal A, C, U, G] + ss/dsRNA Mandiyan et al., Nuc. ribonuclease
unpaired G Acids Res. 18:7055, 1990 Stern et al., J. Mol. Biol.
192:101, 1986 RNase T1 [hehcal A, C, U, G] + ss/dsRNA Mandiyan et
al., Nuc. unpaired G Acids Res. 18:7055, 1990
[0229] Other strategies that can be used to residues present in DNA
polymers so that they cannot be copied by a polymerase and/or
render a strand susceptible to cleavage include, for example, those
described in U.S. Pat. No. 5,965,408, the entire contents of which
are incorporated herein by reference. Such methods include, for
example, the use of UV light, DNA adducts, and/or DNA binding
proteins. Particular examples utilize, for instance, (+)-CC-1065;
(+)-CC-1065-(N-3-Adenin); an N-acylated or deacetylated
4-aminobiphenyl adduct; trivalent chromium, or a salt thereof; a
polycyclic aromatic hydrocarbon adduct;
7-bromomethyl-benz[a]anthracene ("BMA");
tris(2,3-dibromopropyl)phosphate ("Tris-BP");
1,2-dibromo-3-chloropropane ("DBCP"); 2-bromoacelein (2BA);
benso[a]pyren-7,8-dihydrodiol-9-10-epoxide ("BPDE"); a platinum(II)
halogen salt; N-hydroxy-2-amino-3-methylimidazol[4,5-fl-quinoline
("N-hydroxy-IQ") and
N-hydroxy-2-amino-1-methyl-6-phenylimidazo[4,5-f]-py- rine
("N-hydroxy-PhIP"); triple-helix-forming agents, polymerase
inihbitors, single-strand DNA binding proteins (SSB's),
double-strand DNA binding proteins, competing transcription
(polymerase), transcription activating factors, histones, gamma
radiation, and/or X-ray radiation.
Example 8
Mutagenesis of a Pseudomonas OPD Gene
[0230] The structure of the Pseudomonas paraoxonase suggests that
its substrate binding site distribution is spread along the entire
coding sequence in a disconnected manner. We designed primers that
allowed us to introduce sequence variations only at relevant
disconnected positions, thereby improving the possibility that we
could preserve overall protein structure and enzyme activity. The
altered genes we generated encode proteins that may have altered
substrate specificity as compared with the wild-type protein.
[0231] FIG. 38 presents the sequence of the starting construct
(pCR-T7/CT-TOPO) that we employed, which contains the OPD gene
sequence, lacking its leader sequence, in a CT-TOPO vector from
Invitrogen. We designed a series of primers (shown in FIG. 39) with
complementary 15 bp 5' overhangs (1 bp-2'-OMeRNA followed by 14 bp
DNA). Mutations were introduced in the first 3 bp of the annealing
portion of the primer, and a restriction recognition sequence was
introduced by silent mutation into the overhang portion of the
primer. Primers were optimized to minimize stem-loop structures and
homodimerization. Each 100 .mu.l PCR reaction contained 50 pMol of
each of two primers, 1.times.Pfu Buffer (10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris (pH 8.8), 2 mM MgSO.sub.4, 10
mM KC], 0.1% Triton X-100 and 1 mg/ml bovine serum albumin), 1 mM
additional MgSO.sub.4, 10 mM KCl, 0.3 mM of each dNTP, 5-10 ng of
plasmid template, and 1.25-1.85 units each of cloned Pfu and Pfu
TURBO.RTM. polymerases (Stratagene, La Jolla, Calif.). A typical
PCR program included: 3' 95.degree. C.; 2' 58.degree. C.; 5'
72.degree. C. for 1 cycle followed by 30" 95.degree. C.; 30"
58.degree. C.; 4' 72.degree. C. for 30 cycles. 20 .mu.l of each PCR
reaction was removed and treated with 1 ml DpnI (New England
Biolabs) for 1 hour at 37.degree. C. Product molecules were
purified using Qiaquick spin columns as directed by the
manufacturer (Qiagen). To anneal PCR product overhangs, 4.5 .mu.l
purified product molecule was added to 0.5 .mu.l 10.times.T4 DNA
Ligase Buffer and incubated at 70.degree. C. for 10' in a heating
block. The heat block was then set on the benchtop and allowed to
cool to 37.degree. C.
[0232] 50 .mu.l competent DH5.alpha. competent cells were
transformed with 2 .mu.l annealed reaction. The transformation was
plated on LB agar plates containing 100 .mu.g/ml ampicillin.
Plasmid DNA was isolated from transformants and verified by
restriction digestion using the introduced restriction site and by
sequencing.
[0233] Without DpnI treatment, 26 of 36 clones selected on LB
plates with 100 .mu.g/ml ampicillin were verified to be correct by
restriction digestion and selected sequencing. With DpnI treatment,
102 of 103 clones selected on LB plates with 100 .mu.g/ml
ampicillin were verified to be correct. FIG. 40 presents the
sequences of mutations introduced into the paraoxonase gene.
OTHER EMBODIMENTS
[0234] Those of ordinary skill in the art will appreciate that the
foregoing has been a description merely of certain preferred
embodiments of the present invention; this description is not
intended to limit the scope of the invention, which is defined with
reference to the following claims:
Sequence CWU 1
1
43 1 20 DNA Artificial Sequence Description of Artificial
SequenceThe flop exon was amplified with a 5' primer that is
entirely DNA and corresponds to the first 20 bases of the flop exon
1 aaatgcggtt aacctcgcag 20 2 20 DNA Artificial Sequence Description
of Combined DNA/RNA Molecule Together, these primers amplify a
fragment corresponding to all of the human glutamate receptor Flog
exon, plus the first two residues at the 5' end of the i. 2
accutggaat cacctccccc 20 3 20 DNA Artificial Sequence Description
of Combined DNA/RNA MoleculeIntron 1 was amplified with a 5'
primer. 3 aggutggtat caaggttaca 20 4 20 DNA Artificial Sequence
Description of Combined DNA/RNA MoleculeThe Flip exon was amplified
with a 5' primer. 4 agaaccccag taaatcttgc 20 5 20 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule5'- most four
residues are RNA, and are complementary to the four RNA residues at
the 5' end of primer 2. 5 cuaagggtgg gaaaatagac 20 6 20 DNA
Artificial Sequence Description of Artificial Sequence3' primer
corresponding to the last 20 exon bases, that was entirely DNA 6
cttacttccc gagtccttgg 20 7 30 DNA Artificial Sequence Description
of Artificial Sequence The first reaction amplified part of the
intron along with part of the 5' exon. The primers utilized,
BamHI.E5 and D4.Sall were designed so that the PCR product ha. 7
acgggatcca tacttactac gtggtgggac 30 8 35 DNA Artificial Sequence
Description of Artificial SequenceThe first reaction amplified part
of the intron along with part of the 5' exon. The primers utilized,
BamHI.E5 and D4.SalI were designed so that the PCR product ha. 8
acggtcgacc ctcctatctt ttttaatttt ttttt 35 9 36 DNA Artificial
Sequence Description of Artificial SequenceThe second PCR reaction
that utilized pJD20 as a template amplified a different part of the
intron along with part of the 3' exon. 9 acgggtacct ttatatataa
ctgataaata tttatt 36 10 31 DNA Artificial Sequence Description of
Artificial Sequence The second PCR reaction that utilized pJD20 as
a template amplified a different part of the intron along with part
of the 3'exon. 10 acgggatcca gaaaatagca cccattgata a 31 11 30 DNA
Artificial Sequence Description of Artificial SequenceSequence
analysis of the pD4.E3 (dC) B plasmid revealed an unexpected point
mutation in the 3' exon sequence. 11 actatgtatt atcaatgggt
gctattttct 30 12 29 DNA Artificial Sequence Description of
Artificial SequenceObserved sequence. 12 actatgtatt ataatgggtg
ctattttct 29 13 48 DNA Artificial Sequence Description of
Artificial Sequence Exon Sequence 13 ctctagagga tccagaaaat
aggatccatt ataatacata gtatcccg 48 14 48 DNA Artificial Sequence
Description of Artificial SequenceExon sequence. 14 cgggatacta
tgtattataa tggatcctat tttctggatc ctctagag 48 15 29 DNA Artificial
Sequence Description of Artificial Sequence Primers 5'transM.E.5'
was used to amplify part of the LTRB intron and part of th 5' exon.
15 cacgggatcc gaacacatcc ataacgtgc 29 16 27 DNA Artificial Sequence
Description of Artificial Sequence Primers 5'sht3' were used to
amplify part of the LTRB intron and part of the 5' exon. 16
cagcgtcgac gtaccccttt gccatgt 27 17 43 DNA Artificial Sequence
Description of Artificial SequenceThe second PCR reaction that
utilized pLE12 as a template involved the use of primers
3'transM.E.5'. 17 cacggagctc ttattgtgta ctaaaattaa aaattgatta ggg
43 18 40 DNA Artificial Sequence Description of Artificial
SequenceThe second PCR reaction that utilized pLE12 as a template
involved the use of primers 3'transM.E.3' 18 cagcggatcc cgtagaatta
aaaatgatat ggtgaagtag 40 19 188 DNA Artificial Sequence Description
of Artificial SequenceDepicts the nucleotide sequence of the
glutamate receptor exons utilized are known as Flip. 19 tcattaggaa
ccccagtaaa tcttgcagta ttgaaactca gtgagcaagg cgtcttagac 60
aagctgaaaa acaaatggtg gtacgataaa ggtgaatgtg gagccaagga ctctggaagt
120 aagaaaagac cagtgccctc agtctgagca acgttgctgg agtattctac
atccttgtcg 180 ggggcctt 188 20 189 DNA Artificial Sequence
Description of Artificial Sequence Depicts the nucleotide sequence
of the glutamate receptor exons utilized are know as Flop. 20
tcattaggaa atgcggttaa cctcgcagta ctaaaactga atgaacaagg cctgttggac
60 aaattgaaaa acaaatggtg gtacgacaaa ggagagtgcg gcagcggggg
aggtgattcc 120 aagggaaaag accagtgccc tcagtctgag caacgttgct
ggagtattat acatcttgtc 180 gggggcctt 189 21 13 DNA Artificial
Sequence Description of Artificial SequencePresents the nucleotide
sequence of the ligation junction in the hybrid molecules. 21
gggaatcttg ggg 13 22 11 DNA Artificial Sequence Description of
Artificial SequencePresents the nucleotide sequence of the ligation
junction in the hybrid molecules. 22 tggttggaac c 11 23 90 DNA
Artificial Sequence Description of Artificial SequenceShows an
inventive identity exon shuffling reaction. 23 aaatgcggtt
aacctcgcag tactaaaact gaatgaacaa ggcctaagga gagtgcggca 60
gcgggggagg tgattccaag gttggtatca 90 24 20 DNA Artificial Sequence
Description of Combined DNA/RNA MoleculeThe flop exon was amplified
either with primers 3 and 4 from Example 1 or with primer 3 and an
alternative primer 4; the flip exon was amplified either with p. 24
uucuaagggt gggaaaatag 20 25 19 DNA Artificial Sequence Description
of Combined DNA/RNA MoleculeThe flop exon was amplified with
primers 1 and 2 from Example 1; intron 1 was amplified either with
primers 3 and 4 from Example 1 or with primer 3 and an alt. 25
agaacccagt aaatcttgc 19 26 70 DNA Artificial Sequence Description
of Artificial SequencePresents one version of a combined
primer-based/ribozyme-mediated nucleic acid manipulation scheme
according to the present invention. 26 gttggacaaa ttgaaaaaca
aatggtggta cgacaaggtt acaagacagg tttaaggaga 60 ccaatagaaa 70 27 130
DNA Artificial Sequence Description of Artificial SequenceDepicts a
robotic system that could be utilized in the practice of certain
inventive methods. 27 ctgggcatgt ggagacagag aagactcttg ggtttctgat
aggcacttag aaccccagta 60 aatcttgcag tattgaaact cagtgagcaa
cgataaaggt gaatgtggag ccaaggactc 120 gggaagtaag 130 28 70 DNA
Artificial Sequence Description of Artificial SequenceDepicts a
schematic representation of a directional ligation reaction
employing inventive product molecules containing 3' overhangs. 28
ctgactctct ctgcctattg gtctattttc ccaccggcgt cttagacaag ctgaaaaaca
60 aatggtggta 70 29 3713 DNA Artificial Sequence Description of
Artificial SequencePresents the nucleotide sequence. 29 ggatctcgat
cccgcgaaat taatacgact cactataggg agaccacaac ggtttccctc 60
tagaaataat tttgtttaac tttaagaagg aattgccctt atgtcgatcg gcacaggcga
120 tcggatcaat accgtgcgcg gtcctatcac aatctctgaa gcgggtttca
cactgactca 180 cgagcacatc tgcggcagct cggcaggatt cttgcgtgct
tggccagagt tcttcggtag 240 ccgcaaagct ctagcggaaa aggctgtgag
aggattgcgc cgcgccagag cggctggcgt 300 gcgaacgatt gtcgatgtgt
cgactttcga tatcggtcgc gacgtcagtt tattggccga 360 ggtttcgcgg
gctgccgacg ttcatatcgt ggcggcgacc ggcttgtggt tcgacccgcc 420
actttcgatg cgattgagga gtgtagagga actcacacag ttcttcctgc gtgagattca
480 atatggcatc gaagacaccg gaattagggc gggcattatc aaggtcgcga
ccacaggcaa 540 ggcgaccccc tttcaggagt tagtgttaaa ggcggccgcc
cgggccagct tggccaccgg 600 tgttccggta accactcaca cggcagcaag
tcagcgcgat ggtgagcagc aggccgccat 660 ttttgagtcc gaaggcttga
gcccctcacg ggtttgtatt ggtcacagcg atgatactga 720 cgatttgagc
tatctcaccg ccctcgctgc gcgcggatac ctcatcggtc tagaccacat 780
cccgcacagt gcgattggtc tagaagataa tgcgtcagca tctgccctcc tgggcatccg
840 ttcgtggcaa acacgggctc tcttgatcaa ggcgctcatc gaccaaggct
acatgaaaca 900 aatcctcgtt tcgaatgact ggctgttcgg gttttcgagc
tatgtcacca acatcatgga 960 cgtgatggat cgcgtgaacc ccgacgggat
ggccttcatt ccactgagag tgatcccatt 1020 cctacgagag aagggcgtcc
cacaggaaac gctggcaggc atcactgtga ctaacccggc 1080 gcggttcttg
tcaccgacct tgcgggcgtc aaagggcaat tcgaagcttg aaggtaagcc 1140
tatccctaac cctctcctcg gtctcgattc tacgcgtacc ggtcatcatc accatcacca
1200 ttgagtttaa actatataga ataaaagaag aaaccttagc tgagcaataa
ctagcataac 1260 cccttggggc ctctaaacgg gtcttgaggg gttttttgct
gaaaggagga actatatccg 1320 gattaacgct tacaatttag gtggcacttt
tcggggaaat gtgcgcggaa cccctatttg 1380 tttatttttc taaatacatt
caaatatgta tccgctcatg agacaataac cctgataaat 1440 gcttcaataa
tgtgaggagg gccaccatgg ccaagttgac cagtgccgtt ccggtgctca 1500
ccgcgcgcga cgtcgccgga gcggtcgagt tctggaccga ccggctcggg ttctcccggg
1560 acttcgtgga ggacgacttc gccggtgtgg tccgggacga cgtgaccctg
ttcatcagcg 1620 cggtccagga ccaggtggtg ccggacaaca ccctggcctg
ggtgtgggtg cgcggcctgg 1680 acgagctgta cgccgagtgg tcggaggtcg
tgtccacgaa cttccgggac gcctccgggc 1740 cggccatgac cgagatcggc
gagcagccgt gggggcggga gttcgccctg cgcgacccgg 1800 ccggcaactg
cgtgcacttc gtggccgagg agcaggactg acacattgaa aaaggaagag 1860
tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc
1920 tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
agttgggtgc 1980 acgagtgggt tacatcgaac tggatctcaa cagcggtaag
atccttgaga gttttcgccc 2040 cgaagaacgt tttccaatga tgagcacttt
taaagttctg ctatgtggcg cggtattatc 2100 ccgtattgac gccgggcaag
agcaactcgg tcgccgcata cactattctc agaatgactt 2160 ggttgagtac
tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt 2220
atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat
2280 cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
taactcgcct 2340 tgatcgttgg gaaccggagc tgaatgaagc cataccaaac
gacgagagtg acaccacgat 2400 gcctgtagca atgccaacaa cgttgcgcaa
actattaact ggcgaactac ttactctagc 2460 ttcccggcaa caattaatag
actggatgga ggcggataaa gttgcaggac cacttctgcg 2520 ctcggccctt
ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc 2580
tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta
2640 cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
agataggtgc 2700 ctcactgatt aagcattggt aactgtcaga ccaagtttac
tcatatatac tttagattga 2760 tttaaaactt catttttaat ttaaaaggat
ctaggtgaag atcctttttg ataatctcat 2820 gaccaaaatc ccttaacgtg
agttttcgtt ccactgagcg tcagaccccg tagaaaagat 2880 caaaggatct
tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 2940
acgcgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg
3000 taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag
ccgtagttag 3060 gccaccactt caagaactct gtagcaccgc ctacatacct
cgctctgcta atcctgttac 3120 cagtggctgc tgccagtggc gataagtcgt
gtcttaccgg gttggactca agacgatagt 3180 taccggataa ggcgcagcgg
tcgggctgaa cggggggttc gtgcacacag cccagcttgg 3240 agcgaacgac
ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc 3300
ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagacg
3360 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg
ggtttcgcca 3420 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg
gggcggagcc tatggaaaaa 3480 cgccagcaac gcggcctttt tacggttcct
ggccttttgc tggccttttg ctcacatgtt 3540 ctttcctgcg ttatcccctg
attctgtgga taaccgtatt accgcctttg agtgagctga 3600 taccgctcgc
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 3660
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gca 3713 30
33 DNA Artificial Sequence Description of Artificial SequenceShows
various mutagene primers used to introduce sequence changes into
the OPD gene. 30 gcggctacag gtttagcttt cgacccgcca ctt 33 31 33 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 31 gcggctacag gtttgcactt cgacccgcca ctt 33 32 33 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 32 gcggctacag gtttggtgtt cgacccgcca ctt 33 33 35 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 33 gcggctacag gtttgtattt cgacccgcca ctttc 35 34 35 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 34 gcggctacag gtttgatctt cgacccgcca ctttc 35 35 35 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 35 gcggctacag gtttgttctt cgacccgcca ctttc 35 36 32 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 36 taaacctgta gccgccacga tatgaacgtc gg 32 37 32 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 37 caaacctgta gccgccacga tatgaacgtc gg 32 38 36 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 38 gcgtcagcat ctgcagctct gggcatccgt tcgtgg 36 39 36 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 39 gcgtcagcat ctgcaaccct gggcatccgt tcgtgg 36 40 36 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 40 gcgtcagcat ctgcaagcct gggcatccgt tcgtgg 36 41 36 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 41 gcgtcagcat ctgcaatcct gggcatccgt tcgtgg 36 42 36 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 42 gcgtcagcat ctgcagttct gggcatccgt tcgtgg 36 43 38 DNA
Artificial Sequence Description of Artificial SequenceShows various
mutagene primers used to introduce sequence changes into the OPD
gene. 43 tgcagatgct gacgcattat cttcgagacc aatcgcac 38
* * * * *