U.S. patent application number 10/359091 was filed with the patent office on 2004-01-08 for production of human parathyroid hormone from microorganisms.
This patent application is currently assigned to NPS Allelix Corp.. Invention is credited to Alestrom, Peter, Gabrielsen, Odd Stokke, Gautvik, Kaare M., Oyen, Tordis Beate.
Application Number | 20040005668 10/359091 |
Document ID | / |
Family ID | 27503356 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040005668 |
Kind Code |
A1 |
Gautvik, Kaare M. ; et
al. |
January 8, 2004 |
Production of human parathyroid hormone from microorganisms
Abstract
The invention provides recombinant plasmids containing in DNA
sequences coding for human preproparathyroid hormone. The invention
further provides microorganisms, for example E. coli, transformed
by these plasmids. The invention also provides a plasmid for
insertion into yeast and a transformed yeast in which the plasmid
contains DNA coding for parathyroid hormone. Parathyroid hormone is
then secreted by the transformed yeast. Further the invention
provides alternate polypeptides having parathyroid hormone
activity, including PTH analogs, fragments and extensions, and
provides alternate leader sequences and secretion signal sequences
which can be used in the present invention. Finally, there are
provided methods for purification of the secreted PTH hormone
and/or derivatives.
Inventors: |
Gautvik, Kaare M.; (Oslo,
NO) ; Alestrom, Peter; (Sollihogda, NO) ;
Oyen, Tordis Beate; (Oslo, NO) ; Gabrielsen, Odd
Stokke; (Oslo, NO) |
Correspondence
Address: |
FOLEY AND LARDNER
SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
NPS Allelix Corp.
|
Family ID: |
27503356 |
Appl. No.: |
10/359091 |
Filed: |
February 6, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10359091 |
Feb 6, 2003 |
|
|
|
08463222 |
Jun 5, 1995 |
|
|
|
08463222 |
Jun 5, 1995 |
|
|
|
08340664 |
Nov 16, 1994 |
|
|
|
08340664 |
Nov 16, 1994 |
|
|
|
08087471 |
Jul 2, 1993 |
|
|
|
5420242 |
|
|
|
|
08087471 |
Jul 2, 1993 |
|
|
|
07821478 |
Jan 15, 1992 |
|
|
|
07821478 |
Jan 15, 1992 |
|
|
|
07404970 |
Sep 8, 1989 |
|
|
|
07404970 |
Sep 8, 1989 |
|
|
|
07393851 |
Aug 14, 1989 |
|
|
|
5010010 |
|
|
|
|
07393851 |
Aug 14, 1989 |
|
|
|
06921684 |
Oct 22, 1986 |
|
|
|
Current U.S.
Class: |
435/69.4 ;
435/254.2; 435/320.1; 530/399; 536/23.5 |
Current CPC
Class: |
C12N 15/66 20130101;
C07K 2319/02 20130101; C12N 15/64 20130101; C12N 15/70 20130101;
C12N 15/67 20130101; A61K 38/00 20130101; C12N 15/81 20130101; C07K
14/635 20130101 |
Class at
Publication: |
435/69.4 ;
435/254.2; 435/320.1; 530/399; 536/23.5 |
International
Class: |
C12P 021/02; C12N
001/18; C07K 014/635; C07H 021/04; C12N 015/74 |
Claims
We claim:
1. Essentially pure recombinant hPTH.
2. Substantially pure synthetic hPTH.
3. Substantially pure recombinant hPTH.
4. The substantially pure recombinant hPTH of claim 3 wherein said
hPTH is at least about 90% pure.
5. The substantially pure recombinant hPTH of claim 4 wherein said
hPTH is at least about 95% pure.
6. Substantially pure recombinant hPTH which is resistant to
degradation by a KEX2 like proteolytic enzyme.
7. A substantially pure hPTH derivative which is both intact and
exhibits native biological activity.
8. A substantially pure hPTH derivative which is resistant to
degradation by a KEX2 like proteolytic enzyme and which is both
intact and exhibits native biological activity.
9. A genetically engineered microorganism capable of expressing an
intact hPTH.
10. The microorganism of claim 9 wherein said organism is
yeast.
11. A substantially pure intact hPTH, obtained by expression and
secretion of said hPTH from a genetically engineered
microorganism.
12. The substantially pure intact hPTH of claim 11, wherein said
hPTH is resistant to degradation by a KEX2 like proteolytic
enzyme.
13. The substantially pure intact hPTH of claim 11, which is
obtained by a purification step after expression and secretion.
14. The substantially pure intact hPTH of claim 12, which is
obtained by a purification step after expression and secretion.
15. The substantially pure intact hPTH of claim 11, wherein said
genetically engineered microorganism is yeast.
16. A substantially pure intact hPTH derivative, obtained by
expression and secretion of said hPTH from a genetically engineered
microorganism.
17. The substantially pure intact hPTH derivative of claim 16,
wherein said hPTH is resistant to degradation by a KEX2 like
proteolytic enzyme.
18. The substantially pure intact hPTH derivative of claim 16,
which is obtained by a purification step after expression and
secretion.
19. The substantially pure intact hPTH derivative of claim 17,
which is obtained by a purification step after expression and
secretion.
20. The substantially pure intact hPTH of claim 16, wherein said
genetically engineered microorganism is yeast.
Description
[0001] This is a Divisional application of prior application Ser.
No. 08/087,471, filed on Jul. 2, 1993, which is a File Wrapper
Continuation of Ser. No. 07/821,478, filed on Jan. 15, 1992, which
is a Continuation of Ser. No. 07/404,970, filed on Sep. 8, 1989,
now abandoned, which is a Continuation-In-Part of Ser. No.
07/393,851, filed on Aug. 14, 1989, which issued as U.S. Pat. No.
5,010,010 on Apr. 23, 1991, which application, in turn, is a File
Wrapper Continuation of Ser. No. 06/921,684, filed on Oct. 22,
1986, abandoned.
FIELD OF THE INVENTION
[0002] This invention relates to genetically engineered
microorganisms containing DNA coding for human preproparathyroid
hormone.
BACKGROUND OF THE INVENTION
[0003] This application is a continuation-in-part of application
Ser. No. 07/393,851 filed Aug. 14, 1989, which is a continuation of
Application Serial No. 06/921,684 filed Oct. 22, 1986, now
abandoned.
[0004] A number of proteins and peptides that are normally
synthesized by mammalian cells have proven to have medical,
agricultural and industrial utility. These proteins and peptides
may be of different molecular size and have a number of different
functions, for example, they may be enzymes, structural proteins,
growth factors and hormones. In essence both proteins and peptides
are composed of linear sequences of amino acids which form
secondary and tertiary structures that are necessary to convey the
biological activity. Human parathyroid hormone has a relatively
small molecular weight, which has made it possible to synthesize
the peptide chemically by the sequential addition of amino acids.
Thus, parathyroid hormone is commercially available, but in very
small quantities at high cost. As a result, there is no human
parathyroid hormone available at a reasonable price to supply the
many potential medical, agricultural and industrial
applications.
[0005] During the past ten years, microbiological techniques
employing recombinant DNA have made it possible to use
microorganisms for the production of species-different peptides.
The microorganism is capable of rapid and abundant growth and can
be made to synthesize the foreign product in the same manner as
bacterial peptides. The utility and potential of this molecular
biological approach has already been proven by microbiological
production of a number of human proteins that are now available for
medical and other uses.
[0006] Parathyroid hormone (PTH) is one of the most important
regulators of calcium metabolism in mammals and is also related to
several diseases in humans, animals, e.g. milk fever, acute
hypocalsemia and otherwise pathologically altered blood calcium
levels. This hormone therefore will be important as a part of
diagnostic kits and will also have potential as a therapeutic in
human and veterinary medicine.
[0007] The first synthesis of DNA for human preproparathyroid
hormone was described by Hendy, G. N., Kronenberg, H. M., Potts,
Jr. J. T. and Rich, A. 78 Proc. Natl. Acad. Sci. 7365-7369 (1981).
DNA complementary in sequence to PTH mRNA was synthesized and made
double stranded (Hendy et al. supra). This cDNA was cloned in pBR
322 DNA and E. coli 1776 was transfected. Of the colonies with
correct antibiotic resistance, 23 out of 200 clones were identified
as containing specific human PTH cDNA inserts. However, none of the
23 human PTH clones contained the full length insert (Hendy et al.,
supra). Later Breyel, E., Morelle, G., Auf'mkolk, B., Frank, R.,
Blocker, H. and Mayer, H., Third European Congress on
Biotechnology, Sep. 10-14, 1984, Vol. 3, 363-369 described the
presence of the human PTH gene in a fetal liver genomic DNA library
constructed in the phage Charon 4A. A restriction enzyme fragment
of the PTH gene was recloned and transfected into E. coli.
[0008] However, the work of Breyel, supra, demonstrated that E.
coli degrades human PTH. Thus, a microorganism which shows a stable
production of intact human parathyroid hormone has so far not been
described. Further, parathyroid hormone has never before been
isolated from yeast.
SUMMARY OF THE INVENTION
[0009] Accordingly, it is an object of the present invention to
provide a plasmid containing DNA coding for human preproparathyroid
hormone (hPTH) for insertion in Escherichia coli. It is another
object of the present invention to provide a genetically engineered
E. coli containing DNA coding for human preproparathyroid
hormone.
[0010] A further object of the present invention is to provide a
plasmid for insertion in yeast containing DNA coding for
parathyroid hormone ("PTH"), It is also an object of the present
invention to provide a transformed yeast containing DNA coding for
parathyroid hormone including human parathyroid hormone, and from
which transformed yeast, parathyroid hormone may be obtained.
[0011] Another object of the present invention is to provide new
polymers having parathyroid hormone activity including PTH
fragments, extension and analogs. Yet another object is to provide
alternate leader sequences and secretion signal sequences which can
be used in the practice of the present invention.
[0012] A still further object of the invention is to provide
downstream process technology for purification of intact PTH, as
well as purification of analogs, fragments and extensions.
[0013] Other objects and advantages of the present invention will
become apparent as the description thereof proceeds.
[0014] In satisfaction of the foregoing objects and advantages,
there is provided by the present invention a novel plasmid for
insertion in E. coli, containing DNA coding for human
preproparathyroid hormone. The plasmid when inserted into E. coli
functions to transform the E. coli such that the E. coli then
produces multiple copies of the plasmid and thus of the cDNA coding
for human preproparathyroid hormone. The plasmid for human
insertion into E. Coli of the present invention and thus the
transformed E. coli are distinguishable over prior art plasmids and
microorganisms, for example as described in Hendy et al., supra, in
that the plasmid of the present invention contains a double start
codon at the 5' end of the DNA coding for preproparathyroid
hormone. The presence of the double start codon may cause a
production microorganisms transformed with a plasmid containing the
cDNA to produce preproparathyroid hormone at an increased rate and
in an improved yield over prior art transformed microorganisms.
[0015] There is further provided by the present invention a plasmid
for insertion into yeast containing DNA coding for parathyroid
hormone. In a preferred embodiment, this plasmid is prepared by
recloning the plasmid for insertion in E. coli described above.
Moreover, the invention provides a yeast transformed by said
plasmid for insertion in yeast such that the yeast produces and
secretes parathyroid hormone. Thus, the invention provides a method
by which parathyroid hormone may be isolated from yeast culture
medium. In a preferred embodiment, the transformed yeast is
Saccharomyces cerevisiae. In another preferred embodiment, the
parathyroid hormone is human parathyroid hormone.
[0016] By use of in vitro mutagenesis, the present invention also
provides substitution of one or more amino acids in human
parathyroid hormone and peptides having parathyroid hormone
agonistic or antagonistic activity. Further, there are provided
analogs, fragments, or extensions of the parathyroid hormone
(collectively referred to as "derivatives") which also show
agonistic or antagonistic activity. Examples of these peptides have
been produced as secretory products in yeast and in E. coli.
[0017] The present invention further provides different leader
sequences and secretion signal sequences that may be used for the
production and secretion of the PTH hormone and/or its derivatives.
In at least one instance, an alternate leader sequence provides
improved production of the desired hormone or derivative.
[0018] Additionally, the invention provides a downstream process
technology for purification of human parathyroid hormone and
derivatives. The process involves a purification procedure yeast or
E. coli medium or periplasmic solution, and consists principally of
cation exchange chromatography followed by two steps of high
pressure liquid chromatography. The final product is more than 95
percent pure and can be submitted directly to N-terminal amino acid
sequencing as well as amino acid composition determination.
[0019] Human parathyroid hormone (hPTH) is a key regulator of
calcium homeostasis. The hormone is produced as a 115 amino-acid
prepro-peptide. Before secretion the prepro part is cleaved off,
yielding the 84 amino acid mature hormone. Through its action on
target cells in bone and kidney tubuli, hPTH increases serum
calcium and decreases serum phosphate, while opposite effects are
found regarding urinary excretion of calcium and phosphate. At
chronically high secretory rates of PTH (hyperparathyroidism) bone
resorption supersedes formation. However, prolonged exposure to
low/moderate doses of a biologically active PTH-fragment stimulates
bone formation and has also been reported to be effective in the
treatment of osteoporosis by inducing an anabolic response in bone
(Reeve et al. 1980 Br Med J 250, 1340-1344 Slovik et al. 1986 J
Bone Min Ros 1, 577). So far studies on intact hPTH have been
hampered by the limited availability and the high price of the
hormone. Hence a system for the efficient expression of hPTH in
microorganisms would be very advantageous for the further
progression of studies on hPTH and its role in bone biology and
disease.
[0020] Poly (A).sup.+-selected RNA was isolated from human
parathyroid adenomas immediately after surgery. The RNA was
size-fractionated, cDNA was prepared and cloned into the PstI site
of pBR322 by the GC-tailing method. The library was screened by
using synthetic oligonucleotides. Sixty-six clones of a total of
34,000 were found to be positive for both 5' and 3' PTH sequences.
The correct identity of four of these clones was verified by DNA
sequence analysis.
[0021] Employing the promoter and signal sequence of Staphyloccous
aureous protein A we have expressed hPTH in Eacherichis coli as a
secretory peptide. Immunoreactive PTH was isolated both from growth
medium and periplasmic space. We obtained up to 10 mg/l hPTH as
judged by reactivity in radioimmunoassay.
[0022] hPTH was expressed in Saccharomyces cerevisiae after fusing
hPTH cDNA to an expression vector coding for the prepro-region of
the yeast mating factor a. During the secretion process, the
.alpha.-factor leader sequence is cleaved off by an endopeptidase
specific for a dibasic amino acid sequence and encoded by the KEX2
gene.
[0023] By hPTH-specific radioimmunoassay a significant amount of
hPTH immunoreactive material was detected in the growth medium,
corresponding to about 1 mg hPTH pr 1 medium, of the yeast strain
FL200 transformed with fusion plasmid p.alpha.LXPTH. No
immunoreactive hPTH was secreted from cells transformed with the
vector p.alpha.LX.
[0024] Parallel cultures of the yeast strain FL200 transformed with
one of the three expression plasmide PUCXPTH, p.alpha.UXPTH-1 and
p.alpha.LXPTH with copy numbers near unity, normal high (.about.30)
and very high (>50) respectively were grown and both growth
medium, a periplasmic fraction and an intracellular soluble
fraction were assayed for hPTH immunoreactive peptides.
[0025] The results show that the intermediate copy number gave the
highest production. The produced PTH was secreted completely to the
growth medium. The secreted products were concentrated from the
growth medium and analyzed on SDS-PAGE. A distinct band with the
same molecular weight as hPTH standard was visible on the gel.
[0026] hPTH immunoreactive material was concentrated from the
growth medium by passage through a S Sepharose Fast flow column and
eluted quantitatively. Recombinant hPTH was purified by reverse
phase HPLC. The column was eluted with a linear gradient of
acetonitrile/trifluoroacetic acid. A major peak (fractions 32 and
33) with the same retention time as standard hPTH (1-84) was
resolved into two peaks in a second HPLC urification step. The
major peak from the 2.HPLC eluted exactly as standard hPTH (1-84)
and co-chromatographed with hPTH (1-84) as one symmetric peak.
SDS-PAGE of the peak fraction showed one band co-migrating with
hPTH standard suggesting that the recombinant PTH was essentially
pure. The recombinant hPTH was subjected to N-terminal amino acid
analysis. We were able to determine unambiguously 45 amino acids
from the N-terminal end in the E. coli protein and 19 amino acids
in the yeast protein. The sequence was identical to the known
sequence of hPTH. The sequence analysis indicated that the
recombinant PTH was more than 90 percent pure. The recombinant hPTH
from E. coli and Saccharomyces cerevisiae was fully active in
adenylate cyclase assay and also induced hypercalcemia in rats
after injection.
[0027] We have successfully expressed biologoically active intact
human parathyroid hormone as a secretory peptide in Escherichia
coli and Saccharomyces cerevisiae, and developed a down-stream
purification technology.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 shows all possible variations of the DNA sequence
coding for human preproparathyroid hormone.
[0029] FIG. 2 shows the specific human preproparathyroid hormone
DNA coding sequence of the clone pSShPTH-10.
[0030] FIG. 3 shows a DNA sequence coding for human
preproparathyroid hormone and having a double start codon at the 5'
terminal end with flanking sequences in which are shown all
possible variations of the DNA which may be present on the plasmid
of the present invention.
[0031] FIG. 4 shows the specific human preproparathyroid hormone
DNA coding sequence of the clone pSSHPTH-10 with flanking
sequences.
[0032] FIG. 5 shows the actual amino acids sequence of the human
preproparathyroid hormone for which the DNA sequence in close
pSShPTH-10 codes.
[0033] FIG. 6 shows the sequence of the MF.alpha.1-hPTH fusion gene
with all possible combinations of the DNA coding for hPTH.
[0034] FIG. 7 shows the sequence of the MF.alpha.1-hPTH fusion
gene.
[0035] FIG. 8 Analysis of expression products by SDS-PAGE and
immonoblotting.
[0036] Saccharomyces cerevisiae transformed with a PTH cDNA
carrying plasmid was grown in liquid culture medium. The secreted
products were concentrated and analyzed on SDS-PAGE. Panel a shown
a silver stained gel with molecular size marker (lane S), hPTH
standard (lane P), and concentrated yeast growth medium (lane 1).
After blotting onto a PVDF membrane, blots were probed with hPTH
specific antibodies, one reactive against the aminoterminal part of
the hormone (panel b), another reactive against the middle region
of the hormone (panel c). Lanes in panel b and c are numbered as in
panel a.
[0037] FIG. 9. Purification of recombinant hPTH from the growth
medium.
[0038] A: Chromatogram of the 1.HPLC purification
[0039] B: Chromatogram of the 2.HPLC purification of fractions 32
and 33 from panel A. The peak of the recombinant hPTH is indicated
by black.
[0040] C: 2.HPLC run of 1 ug standard hPTH (1-84)
[0041] D: Co-chromatography of the recombinant PTH pack from panel
B and 1 ug of standard hPTH (1-84)
[0042] E: Silver staining of SDS-PAGE of the proteins in the hPTH
pack
[0043] 1: recombinant hPTH, 1 ug
[0044] 2: hPTH (1-84) (.sigma.), 3 ug (Note HMW Impurities)
[0045] FIG. 10. Construction of PPTH-M13-.DELTA.EA/KQ.
[0046] FIG. 11. Schematic representation of the mutation introduced
in the gene fusion between the yeast .alpha.-factor prepro region
and the human parathyroid hormone.
[0047] FIG. 12. SDS PAGE of concentrated yeast growth medium
containing mutated and wild type hPTH. Aliquots of concentrated
growth medium from yeast strain BJ1991 transformed with the
expression plasmids p.alpha.UXPTH-2.sup.9 (lane 2) and
p.alpha.UXPTH-Q26 (lane 1) were analyzed by 15% PAGE in the
presence of 0.1% SDS, and visualized by silver staining as
described in Experimental Protocol. Lane M shows a molecular size
marker including a hPTH standard. The latter is marked with an
arrow.
[0048] FIG. 13. Purity of purified hPTH (1-84,Q26). Yeast growth
medium from yeast strain BJ1991 transformed with the expression
plasmids p.alpha.UXPTH-Q26 were concentrated and purified by
reversed phase HPLC as described in Experimental Protocol. The
purity of the recombinant hormone was then analyzed by analytical
HPLC (Panel A) and SDS PAGE (Panel B, lane 2). In Panel B the
purified hPTH (1-84,Q36) is compared with the wild type hormone
purified by two runs on HPLC (lane 3). The molecular weight market
in lane M is the same as in FIG. 2. Lane 1 shows a reference PTH
produced in E. coli.
[0049] FIG. 14. Two dimensional gelelectrophoretic analysis of hPTH
(1-84,Q26). An aliquot of concentrated growth medium from yeast
strain BJ1991 transformed with the expression plasmids
p.alpha.UXPTH-Q26 was separated on an acetic acid 15% PAGE. The two
main bands (band 1 and 2) migrating close to the hPTH standard were
then cut out, equilibrated with SDS loading buffer and run into a
second dimension 15% PAGE containing 0.1% SDS in separate lanes in
triplicate. This gel was divided in three and one part was colored
with silver (Panel A), one part blotted and treated with hPTH
N-terminal region specific antibodies (Panel B) and one part
blotted and treated with hPTH middle-region specific antibodies
(Panel C). Lanes 1 and 2 show band 1 and 2, PTH.sub.e is a
reference hPTH produced in E. coli, PTH.sub.c is a commercial hPTH
reference. Lane S shows a molecular weight standard.
[0050] FIG. 15. Biological activity of hPTH (1-84,Q26). Recombinant
hPTH (1-84,Q26) (.box-solid.) was purified on HPLC and assayed for
biological activity in a hormone-sensitive osteoblast adenylate
cyclase (AC) assay as described in Materials and Methods. The
experiments were carried out in triplicate determinations. hPTH
(1-84) from Sigma (.largecircle.) and recombinant yeast hPTH (1-84)
(.tangle-solidup.) were used as references.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0051] As indicated above, the present invention is directed to a
plasmid for insertion in E. coli containing DNA coding for human
preproparathyroid hormone. The invention is also directed to the
resulting transformed E. coli.
[0052] The invention further is directed to a plasmid for insertion
into yeast which contains DNA coding for parathyroid hormone and
which is derived from the plasmid for insertion into E. coli.
Finally, the invention is directed to a transformed yeast from
which parathyroid hormone may be recovered.
[0053] The invention further provides methods of producing and
isolating the plasmids and transformed microorganisms. Poly(A)
selected RNA was isolated from human parathyroid adenomas collected
immediately after surgery. The poly(A) RNA was enriched for correct
size mRNA by ultracentrifugation through sucrose gradients.
Preproparathyroid hormone of correct molecular weight was
translated in vitro from this size fractionated poly(A) RNA as
judged by sodium dodecylsulphate polyacrylamide gel electrophoreses
after immuno precipitation with antiparathyroid antiserum. The
specific messenger RNA for the human PTH was used as template for
complementary DNA synthesis using oligo d(T)18 as a primer and
avian myoblastosis virus reverse transcriptase. After removal of
the RNA templates by alkali hydrolysis, the second strand
complementary DNA was synthesized by incubating the purified first
strand DNA in the presence of the Klenow fragment of E. coli DNA
polymerase I. The double stranded comlementary DNA was made blunt
ended by the action of Aspergillus oryzae single strand specific
endonuclease S1 and complementary DNA longer than 500 base pairs
was isolated after neutral sucrose gradient centrifugation.
Approximately 20 bases long d(C)-tail protrusions were
enyzmatically added to the 3 ends of the cDNA. This modified
complementary DNA was annealed to restriction enconuclease PstI
cleaved and d(G)-tailed vector pBR322. Resulting recombinant
plasmid DNA's were transformed into E. coli KI2 BJ 5183. Positive
transformants were analyzed for by colony hybridization using two
different synthetic deoxyribooligonucleotides which covered the
N-terminal coding region as well as the 3' non-coding part of the
hormone mRNA sequence, respectively. Six out of 66 clones that were
positive for both probes were submitted for detailed analysis by
restriction endonuclease mapping showing that they all were
identical except for some size heterogenity at the regions flanking
the start codon and the XbaI site 3' for the stop codon. One clone,
pSShPTH-10, was subjected to DNA sequence analysis revealing a 432
nucleotide long human parathyroid hormone complementary DNA
sequence inserted in the PstI site of pBR 322. The entire cDNA
sequence was found to be identical to the sequence previously
described by Hendy, et al., surra, except for a 5 base pair
deletion in front of the start codon.
[0054] FIG. 2 shows the human preproparathyroid hormone DNA
sequence of pSShPTH-10. This may be compared with FIG. 1, which
shows all possible variations of the DNA sequence for human
preparathyroid hormone without the 5' double start codon. FIG. 3
shows the DNA sequence of the clone of the present invention with
the flanking sequences. In a preferred embodiment, the plasmid for
insertion in E. coli coding for human preproparathyroid hormone is
pSShPTH-10, the DNA sequence of which, including the flanking
sequence, is shown in FIG. 4.
[0055] The invention further provides a plasmid for insertion into
yeast containing DNA coding for parathyroid hormone. The
parathyroid hormone may be human or animal parathyroid hormone, for
example pig or bovine parathyroid hormone. The plasmid for
insertion in yeast of the present invention may be recloned from
plasmids containing DNA coding for human or animal parathyroid
hormone. In a preferred embodiment, the plasmid for insertion in
yeast contains DNA coding for human parathyroid hormone. As shown
in the following examples, the hTPH sequence from pSShPTH-10 has
been recloned and inserted in designed vectors for expression in
Saccharomyces cerevisiae.
[0056] pSShPTH-10 was digested to form a 288 bp BglII-XbaI
fragment. This fragment was then subcloned into pUC19 between the
BamHI and XbaI sites. The subclone was then digested with Dpn I,
and the largest resulting fragment was isolated. The said fragment
was then digested with SalI.
[0057] The plasmid pSS.alpha.LX5-hPTH1 that in yeast MAT cells
leads to the expression and secretion of PTH was constructed in
three stages:
[0058] 1. Construction of the yeast shuttle vector pL4 (which
replicates in both E. coli and Saccharomyces cerevisiae).
[0059] 2. Cloning of a DNA fragment containing the yeast mating
pheromone MF.alpha.1 gene and its insertion into the yeast shuttle
vector to make the p.alpha.LX5 vector.
[0060] 3. Insertion of a DNA fragment from the coding region of the
hPTH gene of pSShPTH-10 into paLX5 in reading frame with the prepro
part of the MF 1 gene, thereby producing the vector
pSS.alpha.LX5-hPTH1.
[0061] The shuttle vector pL4 was constructed by inserting into
pJDB207, an EcoRI-AvaII fragment containing the ADHI promoter
isolated from PADHO40. A SphI fragment was then deleted, resulting
in a plasmid pALX1. The PstI site in the B-lactamase gene was
deleted and the plasmid was partially digested with PvuI and BglI
and ligated to a PvuI BglI fragment of pUC8, to form pALX2. AfteV a
further oligonucleotide insertion, the plasmid was digested with
HindIII and religated to form pALX4.
[0062] Total yeast DNA from the Y288C strain was digested with
EcoRI, and the 1.6-1.8 kb fragments isolated. These were ligated to
EcoRI-cleaved pBR322, and E. coli was transformed. The clones were
screened for MF.alpha.1 inserts by oligonucleotide hybridization.
The DNA selected thereby was then used to transform E. coli. The
resulting plasmid pMF.alpha.1-1 was digested with EcoRI, made blunt
ended by Klenow enzyme, and then digested with BglII. The
MF.alpha.1 fragment was isolated, and ligated to pL5 (digested with
BamHI, made blunt ended with Klenow enzyme, and digested with
BglII) to yield p.alpha.LX5.
[0063] In order to insert the human PTH cDNA fragment into
p.alpha.LX5, the p.alpha.LX5 was digested with HindIII, creating
sticky ends and the site was made blunt ended with the DNA
polymerase I Klenow fragment and DNTP. The p.alpha.LX5 was then
digested with SalI to create a sticky ended DNA complementary to
the SalI digested human PTH fragment described above.
[0064] The SalI digested human PTH fragment was then inserted into
the SA1I digested p.alpha.LX5. The resulting plasmid
pSS.alpha.LX5-PTH was then inserted into yeast, thereby
transforming yeast so that the yeast produces and secretes intact
human parathyroid hormone. In a preferred embodiment, the
transformed yeast is Saccharomyces cerevisiae.
[0065] As explained above, the invention provides alternate leader
sequences which may be used for the production of parathyroid
hormone or derivatives thereof, as taught by the present invention.
The method set forth above discloses the use of the .alpha.-factor
leader sequence. However, other sequences may be used, at least one
of which has been shown to process PTH with greater efficiency than
does the entire .alpha.-factor leader sequence. It has been
discovered that the deletion from the .alpha.-factor leader of a
12-base sequence which comprises the yeast STE13 recognition site
produces a more efficient production mechanism for PTH and/or its
derivatives. pSS.alpha.UXPTH-AEA contains the .alpha.-factor hPTH
fusion gene placed between the .alpha.-factor promoter and
terminator, in which the region encoding the Glu-Ala-Glu-Ala
recognition sequence of the yeast STE13 aminopeptidase has been
deleted. As another example of an alternative leader sequence, a
leader sequence comprised of only the first nineteen amino acids of
the .alpha.-factor is also used in the method of the present
invention.
[0066] Also shown is an example of site specific mutagenesis
changing the codon for the amino acid 26 in the PTH gene, thereby
transforming a lysine-codon (K) to glutamine-codon (Q) using the
Muta-Gene.TM. in vitro mutagenesis kit from Bio-Rad. For this
purpose, the plasmid p.alpha.PTH-M13-.DELTA.EA was used to
transform the E. coli strain CJ236. A uracil-containing
single-stranded DNA which was prepared from the phage was annealed
to a synthetic oligonucleotide, and second strain synthesis was
carried out with T4 DNA polymerase and ligation with T4 DNA ligase.
The heteroduplex DNA was transformed into the E. coli strain MV1190
to be repaired into a homoduplex by removal of uracil incorporated
in the parental strand. Positive clones were verified by DNA
sequencing and one of these was called
p.alpha.PTH-M13-.DELTA.EA/KQ. Finally, the entire expression
cassette between a BamHI and a filled-in EcoRI site was isolated
from this vector construction and inserted into the BamHI and PvuII
site of the yeast shuttle vector YEp24 and this final expression
plasmid was designated pSS.alpha.UXPTH-.DELTA.EA/KQ.
[0067] A point mutation was introduced in the gene encoding the
human parathyroid hormone leading to a change of the 26th amino
acid from Lysine (K26) to Glutamine (Q26). When this gene was
expressed and secreted in Saccharomyces cerevisiae using the
.alpha.-factor fusion system, the full length hormone was found in
the growth medium with no degradation products present. This
contrasts the situation when the wild type gene is expressed in the
same system. Then the major product is a hormone fragment hPTH
(27-84), and only up to 20% of the immunoreactive secreted material
is hPTH (1-84). The yield after a two step purification of the
degradation resistant hormone was 5-10 fold higher than what was
obtained with the wild type hormone. The secreted hPTH (1-84,Q26)
had correct size, full immunological reactivity with two different
hPTH specific antibodies and correct N-terminal amino acid
sequence. Furthermore, the introduced mutation had no effect on the
biological activity of the hormone as judged from its action in a
hormone-sensitive osteoblast adenylate cyclase assay.
[0068] Human parathyroid hormone (hPTH) is one of the key calcium
regulating hormones in the body. The hormone is produced in the
parathyroid gland as a 115 amino acid prepro-peptide that is
processed during secretion to an 84 amino acid mature
hormone..sup.1/ It acts primarily on kidney and bone cells,
stimulating calcium back resorption and calcium mobilization,
respectively..sup.2-4 The hormone seems to exhibit differential
catabolic as well as anabolic effects and its overall physiological
action is probably to generate a positive calcium balance and
enhance bone formation. The area of potential utility includes
possible use in treatment of postmenopausal osteoporosis as well as
in prevention of postpartum hypocalcaemia in cows. Sufficient
supplies of authentic recombinant hPTH are of considerable interest
to evaluate such applications.
[0069] hPTH is an easily degraded polypeptide. Already in the
parathyroid gland large amounts of carboxyl-terminal PTH fragments
are generated..sup.1/ Structural studies have suggested that hPTH
may contain two domains with the easily cleaved region placed in a
connecting stalk between these domains..sup.5/ Not surprisingly
therefore, degradation of hPTH has been a major problem when the
hormone is expressed in heterologous organisms. In E. coli low
expression levels combined with degraded hormone peptides of short
half-life were observed..sup.6-8 The most successful expression
system for hPTH so far is Saccharomyces cerevisiae where the
hormone is expressed as a secretory peptide..sup.2/ By that
approach we were able to obtain significant amounts of authentic
hPTH (1-84) with full biological activity. But even if conditions
were found which eliminated proteolytic attacks at some sites in
the putative stalk region of the hormone, a significant fraction of
the secreted peptides was still cleaved after a pair of basic amino
acids found in the hPTH sequence reducing the yield of full length
peptide hormone. The cleavage site resembles that recognized by the
yscF protease (the KEX2 gene product)..sup.10,11/ We reasoned that
the elimination of the putative yscF cleavage in hPTH could lead to
a significant gain in the yield of undegraded hPTH secreted from
yeast. In the present report we describe the removal of the
putative yscF cleavage sites by in vitro mutagenesis of the hPTH
coding region. When the amino acid at position 26 in hPTH was
changed from Lysine (K26) to Glutamine (Q26), the major degradation
product hPTH (27-84) previously observed disappeared in the growth
medium and the yield of full-length hormone increased 5- to
10-fold. The secreted degradation resistant hPTH)1-84, Q26) had
correct size, full immunological reactivity with two different hPTH
specific antibodies and correct N-terminal amino acid sequence.
Furthermore, the introduced mutation had no effect on the
biological activity of the hormone as judged from its action in a
hormone-sensitive osteoblast adenylate cyclase assay.
[0070] The Saccharomyces cerevisiae strain used for the hPTH
expression was BJ1991 (a, trp1, ura3-52, leu2, prb1-1122, pep4-3).
Yeast cells were transformed by the lithium method.sup.12/, and
transformants grown at 30.degree. C. in YNBGC medium (0.67 percent
yeast nitrogen base, 2 percent glucose, 1 percent casamino acids
(Difco).
[0071] The p.alpha.UXTH-2 plasmid used as a reference for
expression of authentic hPTH (1-84) is described..sup.2/ In order
to change the codon 26 in the hPTH gene from AAG (Lysine) to CAG
(Glutamine), an a-factor hPTH gene fusion subcloned in M13 mp19
(designated M13PTH-3 in .sup.9/) was modified by in vitro
mutagenesis using the "Muta-gene.TM. in vitro mutagenesis kit"
(Bio-Rad) based on the method of Kunkel et al..sup.13/. The
mutagenizing oligonucleotide had the sequence
5'-GGCTGCGTCAGAAGCTGC-3- ' where all nucleotides except the ninth
are complementary to the actual hPTH sequence. Positive clones were
verified by DNA sequencing..sup.14/ One of those were picked and
called M13PTH-Q26. The entire expression cassette between a BamHI
and a filled in EcoRI site was finally isolated from M13PTH-Q26 and
inserted between the BamHI and PvuII site of the yeast shuttle
vector YEp24..sup.15/ This expression plasmid was designated
paUXPTH-Q26. The translation product from the hPTH gene between
amino acid 25 and 27 should now change from Arg-Lys-Lys to
Arg-Gln-Lys.
[0072] Radioimmunoassay of hPTH in yeast culture media was carried
out as described..sup.9/, 16/. For electrophoretic analysis, yeast
culture media were concentrated as previously described.sup.9/, and
separated on a 15 percent polyacrylamide gel in the presence of
SDS.sup.17/, and either stained with silver.sup.18/ or further
analyzed by protein blotting using Immobilon PVDF Transfer
Membranes (Millipore) and the buffers of Towbin et al..sup.19/
Reference hPTH (1-84) was purchased from Peninsula Laboratories
(USA). Protein blots were visualized as described..sup.9/
[0073] The concentrated medium from the Sepharose S column was
subjected to further purification by reversed phase HPLC using a
Vydac protein peptide C18 column (The Separation Group, Hesperia,
Calif., USA). The column was eluted with a linear gradient of
acetonitrile/0.1 percent trifluoroacetic acid.
[0074] Proteins to be sequenced was purified either by HPLC as
described above or by SDS polyacrylamide gelelectrophoresis
followed by blotting onto polyvinylidene difluoride
membranes..sup.20/ Automated Edman degradation was performed on a
477A Protein Sequencer with an on-line 120A phenylthiohydantoin
amino acid analyzer from Applied Biosystems (Foster City, Calif.,
USA). All reagents were obtained from Applied Biosystems.
[0075] The adenylate cyclase stimulating activity of the
recombinant hPTH was assayed as previously described.sup.9, 21, 22/
hPTH (1-84) from Sigma was used as reference.
[0076] Different strategies could be envisaged to avoid the
degradation of parathyroid hormone during expression in
heterologous organisms. One recently reported strategy is to
express intracellularly in E. coli a cro-lacZ-hPTH fusion protein
that subsequently is cleaved by strong acid to give
proline-substituted hPTH..sup.23/ However, since secretion of the
hormone in yeast seems to be a more efficient way of producing a
correctly processed hormone, and also is superior with respect to
downstream processing, we rather adopted a strategy to improve this
system. Only one major cleavage site is used during secretion in
yeast when the cells are grown under proper conditions: after a
pair of basic amino acids in position 25 and 26 in the hPTH
sequence. This cleavage site resembles that recognized by the yscF
protease (the KEX2 gene product). We reasoned that a substitution
of a glutamine for the lysine 26, as illustrated in FIG. 11, ought
to be a structurally conservative change that should exclude the
hormone as a substrate for the yscF protease.
[0077] The yeast strain BJ1991 was transformed with the plasmids
paUXPTH-Q26 containing the mutated hPTH coding region. One
transformant was grown in YNBGC medium lacking uracil and the cell
free medium was concentrated and analyzed in different gel systems.
FIG. 12 shows a silver-stained SDS polyacrylamide gel where
concentrated medium from paUXPTH-Q26 transformed cells (mutated
hPTH, lane 1) is compared with that from paUXPTH-2 transformed
cells (wild type hPTH, lane 2). In the latter case the strongest
band has a molecular mass lower than the standard hPTH, and
previous microsequencing has shown that it corresponds to the
hormone fragment hPTH (27-84). In the lane with the mutated product
(lane 1), this band is absent showing that the cleavage between
amino acid 26 and 27 has been totally eliminated as a result of the
mutation. Now the major product is a polypeptide that migrates
close to the full length hPTH standard. consistently, this band had
a migration slightly faster than the standard in an anionic gel
system and a migration slightly slower than the standard in a
cationic gel system in accordance with the single charge difference
between the mutated (one positive charge less) and the wild type
hormone. In addition to the main product a few weaker bands were
present of apparently higher molecular mass which might be
O-glycosylated forms of the hormone.
[0078] This hPTH (1-84,Q26) candidate was further analyzed by two
dimensional gel electrophoresis and protein blotting. In the first
dimension acetic acid/urea gel a simple pattern with mainly two
bands was found. These were cut out and run on a second dimension
SDS polyacrylamide gel. The silver stained second dimension gel as
well as two protein blots probed with different PTH antibodies, are
shown in FIG. 14. The hPTH (1-84,Q26) candidate migrating closest
to the hPTH standard in both dimensions, reacted with two hPTH
specific antibodies raised against N-terminal region and the
middle/C-terminal region of the hPTH respectively.
[0079] The nature of the hPTH (1-84,Q26) candidate was finally
confirmed by N-terminal amino acid sequencing, both directly on the
polypeptide band after blotting onto a PVDF membrane filter, and
after purification on reversed phase HPLC. Correct amino-terminal
sequence was found in both cases. Furthermore, the expected change
from lysine to glutamine in position 26 was confirmed by sequencing
through this position.
[0080] Since the elimination of the internal cleavage of the
secreted hPTH leads to fewer polypeptides with similar properties
in the growth medium, this form of the hormone could also be
isolated by a simplified purification procedure. Already in the
first concentration step using a Sepharose S column, a certain
purification is achieved. All hPTH immunoreactive material is
retained, but some high molecular weight material is removed in the
pH 6 wash of the Sepharose S column. This first concentrated eluate
already contained more than 80 percent hPTH (1-84, Q26). Then, a
single run on a reversed phase HPLC C18 column, was enough to give
near homogeneous hPTH (1-84, Q26). The purity was checked both by
SDS polyacrylamide gelelectrophoresis and sensitive
silver-staining, and by analytical HPLC as illustrated in FIG. 13A.
A single peak is found in the chromatogram (FIG. 13A), and a single
band with only a trace of a closely migrating hPTH band (probably
an O-glycosylated form of the hormone) could be seen in the SDS
polyacrylamide gel (FIG. 13B). When the yield of pure full length
mutated hormone was compared with that of the wild type, 5 to 10
fold higher yields were usually achieved. This is consistent with
our previous estimate of the fraction of full length hormone (up to
20 percent) obtained when the wild type is expressed..sup.9/
[0081] The biological activity of the secreted hPTH (1-84, Q26) was
tested in a hormone-sensitive osteoblast adenylate cyclase
assay..sup.9, 21, 22/ The purified hPTH (1-84, Q26) was analyzed
for its ability to stimulate the adenylate cyclase activity of OMR
106 osteosarcoma cells above the basal level. The quantitative
analysis shown in FIG. 15, clearly demonstrates that hPTH (1-84,
Q26) has a stimulatory effect comparable to that of a commercial
hPTH control. The stimulation curve practically coincides with that
of purified recombinant wild type hPTH (1-84). Consequently, no
difference in biological activity could be detected between the
wild type hormone and the degradation resistant mutated
hormone.
[0082] We have shown that the easily degraded human parathyroid
hormone can be expressed in a correctly processed and intact form
in Saccharomyces cerevisiae after the introduction of a single,
structurally conservative mutation in the 26th amino acid of the
hormone. The increase in final yield of pure full length hormone is
5- to 10-fold compared to what is obtained with wild type hormone
expressed in the same system. The mutation also simplifies the
downstream purification of the hormone. A concentration step
followed by a single HPLC run was enough to give near homogeneous
recombinant hormone.
[0083] We have previously described conditions of growth that
eliminates secondary cleavages in the protease sensitive "stalk"
region of the hormone .sup.9/. Here we describe how the final
dibasic cleavage site can be eliminated. After introduction of the
mutation, a form of the hormone is produced that totally resists
the frequent cleavage found in the wild type hormone after the
Arg25-Lys26 motif. The possible internal cleavage at putative
dibasic amino acids is one of the severe drawbacks of the
.alpha.-factor secretion system. To our knowledge this is the first
reported case where this problem has been successfully
overcome.
[0084] Previous reports have shown that the biological activity of
the hormone resides in the first third of the molecule in a minimum
structure comprised of amino acids 1-27. Furthermore, the triple
basic amino acid motif from position 25-27 seems to be conserved
between the bovine.sup.25/, porcine.sup.26/ and human
hormone.sup.27/. It was therefore not obvious that the introduction
of a mutation in position 26 would not destroy the biological
activity of hPTH. However, no difference between the recombinant
hPTH products could be detected in the adenylate cyclase assay,
showing that the introduced mutation does not affect the biological
activity of the hormone.
[0085] hPTH is a multifunctional hormone with many potential uses,
for example in diagnostics and as a drug in veterinary medicine. A
fragment of hPTH together with 1,25(OH).sub.2 vitamin D.sub.3 has
also been reported to induce bone formation in humans .sup.27, 28/,
and one of the major areas of potential use of a recombinant hPTH
is therefore in the treatment of osteoporosis. To evaluate such
applications, sufficient supplies of recombinant hPTH are
essential. In the present report we have described what we believe
is the most efficient way of producing full length biologically
active parathyroid hormone so far.
[0086] Moreover, the method of the present invention may be used to
produce parathyroid hormone derivatives having parathyroid hormone
agonistic or antagonistic activity. These derivatives include
hormone analogs, such as the example described above in which the
lysine at position 26 is substituted with glutamine, or may be
fragments or extensions of the hormone, i.e., polypeptides having
parathyroid hormone agonist or antagonist activity which are
respectively shorter or longer than the hormone itself. Parathyroid
hormone agonistic effect in this connection will be demonstrated by
activation of adenylyl cyclase in bone cells and kidney cells. The
in vivo effects of such activity mimic the effects of native
parathyroid hormone with respect to plasma calcium concentration
alterations as well as the well known hormonal actions on calcium
and phosphate re-absorption and excretion in the kidney.
Furthermore, the PTH derivatives of the present invention having
agonist activity shall also have the capacity to reduce the
alkaline phosphatase activity of certain osteoblast cell lines, and
stimulate ornithine decarboxylase activity bone cells (UMR 106
cells) or chicken condrocytes and stimulate DNA synthesis in
chicken condrocytes. Moreover, the derivatives shall have the
capability of blocking the action of parathyroid hormone itself or
of any of the other agonist derivatives.
[0087] The invention also provides alternate secretion signal
sequences for the secretion of the PTH hormone or its derivatives
from yeast. As disclosed above, parts of the MF.alpha.1 gene may be
inserted into the plasmid of the present invention to cause the
yeast to secrete the intact PTH hormone or derivatives. However,
other signal sequences will also function in the methods of the
present invention. The process of protein secretion requires the
protein to bear an amino-terminal signal peptide for correct
intracellular trafficking, the sequence of which is termed "signal
sequence". Two classes of signal sequences will function in the
plasmids of the present invention, and will cause secretion of the
PTH hormone or derivative from yeast: "optimalized consensus signal
sequences" and other functional signal sequences. An "optimalized
consensus signal sequence" is any amino-terminal amino acid
sequence that is composed of the following three parts:
[0088] 1. An amino-terminal positively charged region. The size of
this region may vary from 1-20 amino acids. The only specific
characteristic is a positive charge at physiological pH conferred
by the presence of one to three basic amino acids (Lys or Arg).
[0089] 2. A hydrophobic core region. The size of this region may
vary from 7-20 amino acids, and it is predominantly composed of
hydrophobic amino acids (Phe, Ile, Leu, Met, Val, Tyr, or Trp).
[0090] 3. A polar COOH-terminal region composed of five amino acids
(from position -5 to -1 relative to the cleavage site) that defines
the cleavage site. The specific character of this region is that
the amino acid in position -1 must be a small neutral amino acid
(Ala, Ser, Gly, Cys, Thr, or Pro), and that the amino acid in
position -3 must be either a hydrophobic amino acid (Phe, Ile, Leu,
Met, Val) or a small neutral amino acid (Ala, Ser, Gly, Cys, Thr,
or Pro).
[0091] See von Heijne, G. (1983) "Patterns of Amino Acids near
Signal-Sequence Cleavage Sites." Eur. J. Biochem. 133, 17-21, and
von Heijne, G. (1985) "Signal sequences. The limits of variation."
J. Mol. Biol. 184, 99-105. However, Kaiser, C. A., Preuss, D.,
Grisafi, P., and Botstein, D. (1987) "Many Random Sequences
Functionally Replace the Secretion Signal Sequence of Yeast
Invertase." Science 235, 312-217, found the specificity with which
signal sequences were recognized in yeast to be low and that any
amino-terminal peptide with a hydrophobicity above some threshold
value would function. Therefore, "functional signal sequence" is
defined as any amino-terminal amino acid sequence that can direct
secretion in yeast even if it does not fit all the criteria of an
optimal signal sequence.
[0092] Specific examples of signal sequences functional in yeast
that conform to the description of an optimal signal sequence
are:
[0093] 1. Met,Lys,Ala,Lys-Leu,Leu,Val,Leu,Leu,Thr,A 1a,
Phe-Val,Ala,Thr,Asp,Ala (Jabbar, M. A., and Nayak, D. P. (1987)
"Signal Processing, Glycosylation, and Secretion of Mutant
Hemagglutinins of a Human Influenza Virus by Saccharomyces
cerevisiae." Molec. Cell. Biol. 7, 1476-1485.) from a human
influenza virus hemagglutinin.
[0094] 2. Met,Arg,Ser-Leu,Leu,Ile,Leu,Val,Leu,Cys,P he,
Leu,Pro-Leu,Ala,Ala,Leu,Gly (Jigami, Y., Muraki, M., Harada, N.,
and Tanaka, H. (1986) "Expression of synthetic human-lysozyme gene
in Saccharomyces cerevisiae: use of a synthetic chicken-lysozyme
signal sequence for secretion and processing." Gene 43, 273-279.)
from chicken lysozyme.
[0095] 3. Met,Arg,Phe,Pro,Ser-Ile,Phe,Thr,Ala,Val,L eu,
Phe,Ala,Ala-Ser,Ser,Ala,Leu,Ala (Ernst, J. F. (1988) "Efficient
Secretion and Processing of Heterologous Proteins in Saccharomyces
cerevisiae is mediated solely by the Pre-Segment of a-factor
Precursor." DNA 7, 355-360. Kurjan, J. and Herskowitz, I. (1982)
"Structure of a Yeast Pheromone Gene (MFa): "A putative
.alpha.-factor Precursor contains four Tandem Copies of Mature
.alpha.-factor". Cell 30, 933-934.) from yeast .alpha.-factor
precursor.
[0096] A specific example of signal sequences functional in yeast
that conforms to the description of a functional signal sequence is
Met,Asn,Ile,Phe,Tyr,Ile,Phe,Leu,Phe,Leu,Ser,Phe,Val-Gln, Gly,
Thr,Arg,Gly. Baldari, C., Marray, J. A. H., Ghiara, P., Cesareni,
G., and Caleotti, C. L. (1987) "A novel leader peptide which allows
efficient secretion of a fragment of human interleukin 1B in
Saccharomyces cerevisiae." EMBO J. 6. 229-234. from Klyveromyces
lacis killer toxin.
[0097] Finally, the invention provides three different steps which
taken together, represent an effective and convenient procedure for
purification of human recombinant parathyroid hormone (PTH). A
cation exchange chromatography using S-Sepharose column as
described in the text, washed at pH 6 and eluted at pH 8.5. The
immunoreactivity of the intact PTH migrates within the peak.
[0098] FIG. 9 shows high performance liquid chromatography (HPLC)
of hPTH which was eluted with trifluoraecetic acid and a linear
gradient of acetonitril of 35-60%. The position of intact hPTH is
indicated in the second HPLC step the acetonitril gradient has been
changed to 40-45% and intact hPTH elutes as one symmetrical
peak.
[0099] Although the methods of making the invention disclosed
herein are shown in detail, these methods are presented to
illustrate the invention, and the invention is not limited thereto.
The methods may be applied to a variety of other plasmids
containing DNA coding for human or animal PTH to produce the
plasmids for insertion in yeast of the present invention.
[0100] The plasmids of the present invention and transformed
microorganisms were produced as set forth in the following
examples.
EXAMPLE 1
[0101] Isolation of mRNA and Synthesis of Complementary DNA (cDNA)
of Human Parathyroid Hormone.
[0102] Starting material for the invention was parathyroid adenomas
obtained from patients by surgery. The parathyroid tissue was
placed on dry ice directly after removal and transported to a
laboratory for preparation of RNA. The frozen tissue was
homogenized with an ultra Turax homogenizer in the presence of 4 M
Guanidinium thiocyanate and the RNA content was recovered by serial
ethanol precipitations as described by Chirgwin, J. M., Przybyla,
A. E., MacDonald, R. J. and Rutter, W. J., 18 Biochemistry
5294-5299 (1979). The RNA preparation was applied to oligo d(T)
cellulose affinity chromatography column in order to enrich for
poly(A) containing mRNA. The poly(A) rich RNA was further enriched
for parathyroid hormone (PTH) mRNA sized RNA by ultracentrifugation
through a 15-30% linear sucrose gradient. The resulting gradient
was divided into 25 fractions and every third fraction was assayed
for PTH mRNA content by in vitro translation followed by
immunoprecipitation with anti PTH antiserum (Gautvik, K. M.,
Gautvik, V. T. and Halvorsen, J. F., Scand. J. Clin. Lab. Invest.
43, 553-564 (1983)) and SDS-polyacrylamide gel electrophoresis
(Laemmeli, U.K., 227 Nature 680 (1970)). The RNA from the fractions
containing translatable PTH mRNA was recovered by ethanol
precipitation. This RNA, enriched for PTH mRNA, was used as a
template for cDNA synthesis using oligo d(T)18 as a primer and
avian myoblastosis virus reverse transcriptase for catalysis of the
reaction (Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular
Cloning pp. 230-243 (1982)). After first strand synthesis, the RNA
templates were removed by alkali hydrolysis. The second strand cDNA
was synthesized by incubating the purified first strand cDNA in the
presence of the Klenow fragment of E. coli DNA polymerase I
(Maniatis, supra). This in vitro synthesized double stranded cDNA
was made blunt ended by the action of Aspergillus oryzae single
strand specific endonuclease S1 (Maniatis, supra). The blunt ended
double stranded cDNA was size fractionated over a 15-30% neutral
sucrose gradient. The size distribution of each fraction was
estimated by agarose gel electrophoresis together with known DNA
fragment markers. Fractions containing cDNA larger than
approximately 500 base pairs were pooled and the cDNA content was
collected by ethanol precipitation.
EXAMPLE 2
[0103] Cloning of cDNA PTH in Plasmid pBR 322 and Transformation of
E. Coli K12 BJ5183.
[0104] An approximate 20 base long d(C)-tail protrusion was
enzymatically added to the 3' ends of the cDNA by the action of
terminal deoxynucleotidyl transferase (Maniatis, supra). The
d(C)-tailed cDNA was annealed to restriction endonuclease Pst I
cleaved and d(G)-tailed vector pBR322 and the resulting recombinant
plasmid DNA's were transformed into E. coli K12 BJ 5183 cells which
were made competent by the method of Hanahan, D., 166 J. Mol. Biol.
166, 557-580 (1983). A total of 33,000 transformants were analyzed
for PTH cDNA content by colony hybridization (Hanahan, D. and
Meselson, Gene 10, 63 (1980)).
[0105] Two to three thousand transformants were plated directly on
each 82 mm diameter nitrocellulose filter, placed on top of rich
medium agar plates containing tetracycline, and incubated at 37
degrees Centigrade until approximately 0.1 mm diameter colonies
appeared. Duplicate replicas of each filter was obtained by serial
pressing of two new filters against the original filter. The
replica filters were placed on top of new tetracycline containing
agar plates and incubated at 37 degrees Centigrade until
approximately 0.5 mm diameter colonies appeared. The master filter
with bacterial colonies was kept at 4 degrees Centigrade placed on
top of the agar plate and the duplicate replica filters were
removed from the agar plates and submitted to the following colony
hybridization procedure.
EXAMPLE 3
[0106] Characterization of Bacterial Clones Containing Recombinant
cDNA PTH and of the DNA Sequence of Clone pSSHPTH-10.
[0107] The cells in the respective colonies were disrupted in situ
with alkali and sodium chloride leaving the DNA content of each
bacterial clone exposed. The procedure allows the DNA to bind to
the filter after which it was neutralized with Tris-buffer and
dried at 80 degrees Centigrade. The majority of cell debris was
removed by a 65 degree Centigrade wash with the detergent sodium
dodecylsulphate (SDS) and sodium chloride leaving the DNA bound to
the filters at the position of the former bacterial colonies. The
filters were presoaked in 6.times.SSC (0.9 M NaCl, 0.09M
Na-citrate), 1.times.Denhart's solution (0.1 g/ml FIcoll, 0.1 g/ml
polyvinyl pyrrolidone, 0.1 g/ml bovine serum albumin), 100 g/ml
herring sperm DNA, 0.5% SDS and 0.05% sodium pyrophosphate for 2
hours at 37 degrees Centigrade (Woods, D. E. 6 Focus Vol. No. 3.
(1984)).
[0108] The hybridization was carried out at 42 degrees Centigrade
for 18 hours in a hybridization solution (6.times.SSC,
1.times.Denhart's solution, 20 g/ml tRNA and 0.05% sodium
pyrophophate) supplemented with 32P-labelled DNA probe. (Woods
supra).
[0109] The DNA used as a hybridization probe was one of two
different synthetic deoxyribo oligonucleotides of which the
sequences were deduced from the published human PTH cDNA sequence
of Hendy, supra. The first probe was a 24-mer oligonucleotide
originating from the start codon region of the human preproPTH
coding sequence having a nucleotide sequence reading
TACTATGGACGTTTTCTGTACCGA. The second oligonucleotide was a 24-mer
spanning over a cleavage site for the restriction endonuclease XbaI
located 31 nucleotides downstream of the termination codon and
consisted of the nucleotide sequence CTCAAGACGAGATCTGTCACATCC.
[0110] Labelling was carried out by transfer of 32 P from 32
P-.delta.-ATP to the 5' end of the oligonucleotides by the action
of polynucleotide kinase (Maxam, A. M. and Gilbert, W., 65 Methods
Enzymol., 499 (1980)).
[0111] The hybridized filters were washed in 6.times.SSC, 0.05%
sodium pyrophosphate at 42 degrees Centigrade prior to
autoradiography. Sixty-six clones were found to be positive for
both probes as judged from hybridization to both copies of the
duplicate replica filters. All those were picked from the original
filters with the stored cDNA library and amplified for indefinitive
storage at -70 degrees Centigrade. Six of these were chosen for
plasmid preparation and a more detailed analysis by restriction
endonuclease mapping, showing that all were identical except for
some size heterogenity at the regions flanking the start codon and
Xba I site, respectively.
EXAMPLE 4
[0112] Clone pSShPTH-10.
[0113] One clone, pSShPTH-10, was subjected to DNA sequence
analysis according to the method of Maxam and Gilbert, supra. This
clone consists of a 432 base pair long PTH cDNA sequence inserted
in the Pst I site of pBR322 having 27 G/C base pairs at the 5' end
and 17 G/C base pairs at the 3' end. The complete DNA sequence of
the cDNA insert of pSSHPTH-10 is shown in FIG. 4. It is identical
to the sequence of Hendy, et al., supra except for a five base pair
deletion right in front of the start codon, changing the published
(Hendy, supra) start-stop (ATGTGAAG) signal (deletion is
underlined) preceding the used start codon (ATG) to a double start
signal (ATGATG).
EXAMPLE 5
[0114] Construction of the Yeast Shuttle Vector pL4.
[0115] Before the hPTH-yeast-expression project was initiated, a
family of general yeast expression vectors were developed. One of
these, pL4, later was used to make pSS LX5-hPTH1, as described
below:
[0116] The plasmid pJDB207, constructed by Beggs, J. D.,
"Multiple-copy yeast plasmid vectors," Von Wettstein, D., Friis,
J., Kielland-Brandt, M. and Stenderup, A. (Eds) Molecular Genetics
in Yeast (1981), Alfred Benzon Symposium Vol. 16, 383-390, was
chosen as the basis for the general expression vectors. It contains
an EcoRI fragment of the yeast 2 micron DNA inserted into the
pBR322 derivative pAT153. It also contains the yeast LEU2 gene. The
copy number of pJDB207 in yeast cir.sup.+ cells is very high
relative to that of other plasmids and it is unusually stable after
non-selective growth in a cir.sup.+ strain, Parent, S. A.,
Fenimore, C. M., and Bostian, K. A. "Vector Systems for the
Expression, Analysis and Cloning of DNA Sequences in S. cerevisiae
". 1 Yeast 83-138 (1985); Erhart, E. and Hollenberg, C. P., "The
Presence of a Defective LEV2 Gene on 2 Micron DNA Recombinant
Plasmids of Saccharomyces cerevisiae is Responsible for Curing and
High Copy Number," 156 J. Bacteriol. 625-635 (1983). These
properties are related to a partial defective promoter in the
selective marker gene LEU2 (often named LEU2d, d for defective),
Erhart et al., supra, which is not changed in the following
constructs.
[0117] A 1260 base pair EcoRI-AvaII fragment containing the ADHI
promoter was isolated from the plasmid pADH040. After a fill in
reaction with the Klenow fragment of DNA polymerase I and all four
dNTPs, BamHI linkers were attached and the fragment was cloned into
the unique BamHI site of pJDB207. From the plasmid with the
promoter in a counterclockwise direction, a 1050 base pair SphI
fragment was then deleted (from the SphI site in pJDB207 to the
SphI site in the promoter fragment) leaving only a single BamHI
site. This plasmid was designated pALX1.
[0118] Then the PstI site in the B-lactamase gene of pALX1 was
eliminated without inactivating the gene. pALX1 was digested to
completion with PstI and nuclease S1 to destroy the PstI site, and
then subjected to a partial digestion with PvuI BglI. At the same
time a 250 base pair PVUI BglI fragment was isolated from pUC8,
Vierira, J. and Messing, J. 19 Gene 259 (1982), that contains the
corresponding part of a B-lactamase without a PstI site. This was
ligated to the partially digested pALX1. In all the ampicillin
resistant clones isolated the B-lactamase gene had been restored by
incorporating the pUC8 fragment. This plasmid was called pALX2.
[0119] The following oligonucleotide was purchased from Prof. K.
Kleppe, University of Bergen, and inserted into the BamHI site of
pALX2:
1 BglII * * * HindIII GATCAGATCTGCAGGATGGATCCA- AAGCTT: initiation
codon TCTAGACGTCCTACCTAGGTTTCGAACTAG *: optimal ATG PstI BamHI
context
[0120] Plasmids with the proper orientation were isolated and
designated pALX3.
[0121] Finally the pALX3 was digested with HindIII and religated to
delete a HindIII fragment of 480 base pairs. The resulting vector
is called pALX4.
[0122] pL4 is a derivative of pALX4 in which the ADHI promoter is
deleted. pL4 was used as a basis for the insertion of other
promoters. pALX4 was first digested with BglII and SalI. The
resulting sticky ends were filled-in with the Klenow fragment of
DNA polymerase 1 and 4 dNTPs followed by religation. By this
treatment the ADHI promoter is eliminated and the BglII site
regenerated to give the vector pL4.
EXAMPLE 6
[0123] Construction of p.alpha.LX5.
[0124] The gene for the yeast mating pheromone MF.alpha.1 was first
cloned by Kurjan, J. and Herskowitz, I., "Structure of a Yeast
Pheromone Gene (MF.alpha.): A Putative -factor Precursor Contains
Four Tandem Copies of Mature -factor". 30 Cell, 933-943 (1982). The
published sequence was used to reclone the MF.alpha.1 gene. Total
yeast DNA from the strain Y288C was digested with EcoRI and
digestion products in the size range from 1.6 to 1.8 kb were
isolated from a preparative agarose gel. These were then ligated to
dephophorylated EcoRI cleaved pBR322 and used to transform E. coli
BJ5183. The resulting clones were screened for MF.alpha.1 gene
inserts by hybridization to a labeled oligonucleotide of the
following composition:
[0125] TGGCATTGGCTGCAACTAAAGC
[0126] DNA from purified positive clones was then used to transform
E. coli JA221 from which plasmid DNA was prepared. The plasmid used
in the following constructs was pMF.alpha.1-1.
[0127] pMF.alpha.1-1 was digested with EcoRI, filled-in with the
Klenow fragment of DNA polymerase 1 and 4 dNTPs, phenol extracted
and digested with BglII. The 1.7 kb MF 1 gene fragment was isolated
from an agarose gel. Before inserting it into the yeast shuttle
vector, the HindIII site of pL4 was eliminated by HindIII
digestion, Klenow fill-in reaction and religation to give the pL5
shuttle vector. pL5 was digested with BamHI, filled-in with the
Klenow fragment of DNA polymerase I and 4 dNTPs, phenol extracted
and digested with BglII. After purification on gel it was ligated
to the MF.alpha.1 fragment to give the expression vector
p.alpha.LX5.
EXAMPLE 7
[0128] Construction of pSS LX5-HPTH1.
[0129] A 288 base pair BglII XbaI fragment from the pSSHPTH-10
plasmid was isolated and subcloned in pUC19 using the BamHI and
XbaI site of this vector. This subclone designated PUC-HPTH, was
digested with DpnI and the largest fragment isolated. This fragment
was then digested with SalI and the smallest of the two resulting
fragments was again isolated, yielding a sticky end on the SalI cut
side and a blunt end at the DpnI cut side.
[0130] p.alpha.LX5 was digested with HindIII, filled-in with the
Klenow fragment of DNA polymerase 1 and 4 dNTPs, phenol extracted
and digested with SalI. After purification from gel, it was ligated
to the hPTH fragment described above. The resulting clones had the
HindIII site regenerated verifying that the reading frame was
correct. This plasmid called pSS.alpha.LX5-hPTH1. The sequence of
the MF.alpha.1-hPTH fusion gene is shown in FIG. 6.
EXAMPLE 8
[0131] Expression And Secretion Of HPTH In Yeast.
[0132] The yeast strain FL200 (, ura3, leu2) was transformed with
the plasmids p.alpha.LX5 and pSS.alpha.LX5-hPTH1 using the
spheroplast method. One transformant of each kind was grown up in
leu.sup.- medium and aliquots of the cell-free medium were analyzed
by SDS-PAGE developed by silver-staining. Two major bands were seen
in the medium from the pSS.alpha.LX5-H1 transformant that were not
present in the medium from the p LX5 transformant: one band of
approximately 9000 daltons, the expected size of HPTH, and one band
of approximately 16000 daltons that could correspond to an
unprocessed MF.alpha.1-hPTH fusion product. Both polypeptides
reacted with antibodies against human PTH in a manner identical to
the native hormone.
[0133] The examples are included by way of illustration, but the
invention is not limited thereto. While the above examples are
directed to providing a S. cerevisiae which produces and excretes
human parathyroid hormone, the method of the present invention may
be applied to produce a plasmid containing DNA coding for
parathyroid hormone from any species. Further, said plasmid may be
inserted into any species of yeast. The invention thus is not
limited to S. cerevisiae.
[0134] The cloned human parathyroid hormone produced by the yeast
of the present invention has a variety of known and potential uses.
For example, it is current medical theory that human parathyroid
hormone will be highly effective in treating osteoporosis.
Genetically engineered parathyroid hormone may be useful in an
analytical kit for measuring parathyroid hormone levels in humans
and animals. Human parathyroid hormone or fragments thereof may
also be used for treatment of humans or animals displaying reduced
or pathologically altered blood calcium levels. It is anticipated
that many other uses will be discovered when genetically engineered
parathyroid hormone is available in large quantities, for example
as a result of the present invention.
EXAMPLE 9
[0135] Deletion of the STE 13 Recognition Sequence Positioned
N-terminal for the Parathyroid Hormone.
[0136] In order to delete the STE13 recognition sequence
(Glu-Ala-Glu-Ala) located immediately N-terminal to PTH by site
directed in vitro mutagenesis of the fusion gene, a 1495 bp XbaI
fragment was isolated from pSS.alpha.LX5-PTH. This contained the
.alpha.-factor promoter (MF.alpha.prom), the .alpha.-factor leader
sequence (PP) and the human PTH gene (hPTH) including the stop
codon. The fragment was subcloned into M13 mp19 to give the plasmid
p PTHx-M13. An oligonucleotide with the sequence GGATAAAAGATCTGTGAG
was made where the first ten nucleotides are complementary to the
sequence of the .alpha.-factor leader in p.alpha.PTHx-M13 just
proceeding the Glu-Ala-Glu-Ala coding region, and the last eight
nucleotides are complementary to the beginning of the human PTH
sequence. When this oligonucleotide was annealed to single-stranded
DNA prepared from the recombinant phage, the following heteroduplex
was generated:
2 oligonucleotide: 5'-GGATAAAAGATCTGTGAG-3' p PTHx-M13
3'-CCTATTTTCTAGACACTC-5' C A T G [to be removed] CCGACTTC
translation product . . AspLysArgSerVal . . . (upper) . . .
AspLysArgGluAlaGluAlaSerVal . . . (lower)
[0137] After second strand synthesis and ligation with the Klenow
fragment of DNA polymerase I and T4 DNA ligase, closed circular
heteroduplex DNA was isolated by sedimentation through an alkaline
sucrose gradient as described in Carter, P., Bedouelle, H., Waye,
M. M. Y., and Winter, G. (1985) "oligonucleotide site-directed
mutagenesis in M13. An experimental manual," MRC Laboratory of
Molecular Biology, Cambridge CB2 2QH., the disclosure of which is
hereby incorporated by reference. The heteroduplex DNA was used to
transform a BMH 71-18 mutL strain of E. coli defective in mismatch
repair (kindly provided by Dr. G. Winter). Positive clones with the
looped out sequence 3'-CTCCGACTTCGA-5' deleted were identified by
colony hybridization using the mutagenizing oligonucleotide as the
probe and by DNA sequencing. The plasmid in these clones was
designated p.alpha.PTHx-M13.DELTA.EA.
[0138] The .alpha.-factor transcription terminator was then
inserted into one of the positive M13 clones as a SalI HindIII
fragment isolated from pMF.alpha.1, to give a plasmid called
p.alpha.PTH-M13-.DELTA.EA. The entire expression cassette between a
BamHI and a filled-in EcoRI site was finally isolated from
p.alpha.PTH-M13-.DELTA.EA and inserted between the BamHI and PvuII
site of the yeast shuttle vector YEp24 by the method described in
Botstein, D., Falco, S. C., Stewart, S. E., Brennan, M., Scherer,
S., Stinchcomb, D. T., Struhl, K., and Davis, R. W. (1979) Gene 8,
17-24, which is hereby incorporated by reference. This expression
plasmid was designated pSS.alpha.UXPTH-.DELTA.EA.
EXAMPLE 10
[0139] Conversion of Intact hPTH by Substitution of Lysine with
Glutamine at Position 26, Designated PTHQ.sub.26,
[0140] In order to change the amino acid at position 26 in the
human PTH from lysine to glutamine, the fusion gene in
p.alpha.PTH-M13-.DELTA.EA was further modified by in vitro
mutagenesis using the "Muta-gene.TM. in vitro mutagenesis kit"
obtained from Bio-Rad based on the method of Kunkel; Kunkel, T. A.,
Roberts, J. D., and Sakour, R. A. (1987) "Rapid and efficient
site-specific mutagenesis without phenotypic selection" in Methods
of Enzymologi, (Wu, R., and Grossman, L., eds.) vol. 154, pp
367-381, which is hereby incorporated by reference. The E. coli
strayin or CJ236 (dut, ung, thi, rel A; pCJ105 (Cm.sup.r)) was
transformed with the p.alpha.PTH-M13-.DELTA.EA plasmid. The
single-stranded DNA that was prepared from the phage contained a
number of uracils in thymine positions as a result of the dut
mutation (inactivates dUTPase) and the unq mutation (inactivates
the repair enzyme uracil N-glycosylase). An oligonucleotide with
the sequence GGCTGCGTCAGAAGCTGC was made where all nucleotides
except the ninth are complementary to an internal PTH sequence in
p.alpha.PTHx-M13. When this oligonucleotide was annealed to the
single-stranded DNA, the following heteroduplex was generated:
3 C / .backslash. oligonucleotide: 5'-GGCTGCGT CAGAAGCTGC-3'
pcrPTH-M13-AEA 3' . . . CCGACGCA TCTTCGACG . . . 5' .backslash. / T
Translation product . . . LeuArgGlnLysLeU . . . (upper) . . .
LeuArgLysLysLeU . . . (lower)
[0141] After second strand synthesis and ligation with T4 DNA
polymerase and T4 DNA ligase, the heteroduplex DNA was transformed
into the E. coli strain MV1190 ((lac-pro AB), thi, sup E,
.DELTA.(sr1-rec A)306::Tn10(tet.sup.r)[F': tra D36, pro AB, lac
I.sup.q Z M15]) which contains a proficient uracil N-glycosylase.
During the repair process in this host eliminating the uracils in
the paternal strand, the in vitro synthesized strand will serve as
a repair template conserving the mutation. Positive clones were
verified by DNA sequencing. One of those were picked and called
p.alpha.PTH-M13-.DELTA.EA/KQ. The entire expression cassette
between a BamHI and a filled-in EcoRI site was finally isolated
from p.alpha.PTH-M13-.DELTA.EA/KQ and inserted between the BamHI
and PvuII site of the yeast shuttle vector YEp24. This expression
plasmid was designated pSS.alpha.UXPTH-.DELTA.EA/KQ.
EXAMPLE 11
[0142] Expression and Secretion of hPTH.sub.Q26 in Yeast.
[0143] The yeast strain BJ1991 (.alpha.,
Leu2,wa3-52,trp1,pr67-112,pep4-3) was transformed with the plasmids
pSS.alpha.UXPTH-.DELTA.EA and pSS.alpha.UXPTH-.DELTA.EA/KQ using
the lithium method. One transformant of each kind was grown in
medium lacking uracil and the cell free medium was analyzed as
described below.
EXAMPLE 12
[0144] Purification of Heterologous hPTH from Yeast Medium
Concentration and Purification by S-Sepharose .sup.R Fast Flow.
[0145] Samples of cell free yeast medium (1-10 1) (containing 1%
Glucose, 2% casamino acid, 134% yeast nitrogen base w/o amino
acids, 60 mg/ml trp, 180 kg/l) were adjusted to pH 3.0 and run
through a 10 ml.times.10 S-Sepharose.sup.R (Pharmacia AB) fast flow
column, pre-equilibrated with 0.1M glycine pH 3.0. The loaded
column was eluted by 13 ml 0.1M acetic acid buffered to pH 6.0,
followed by 20 ml 0.1M NH.sub.4HC).sub.3 pH 8.5. The peptides
eluted from the column were monitored by a Pharmacia optical unit
(Single path monitor UVI, Pharmacia AB, Uppsala, Sweden) at 280 nm,
and collected in 2 ml fractions by an LKB 2070 Ultrorac II fraction
collector (LKB, AB, Bromma, Sweden).
EXAMPLE 13
[0146] Purification by HPLC.
[0147] Collected fractions from S-Sepharose fast flow
chromatography were subjected to further purification by reversed
phase HPLC using a 25 cm.times.4.2 cm Vydac protein peptide C18
column (The Separations Group, Hesperia, Calif., USA) and an LDC
gradient mixer, LDC contamertric pumps model I and III with a high
pressure mixing chamber and LDC spectromonitor III with variable UV
monitor. (LDC Riviera Beach Fla., USA). Chromatograms were recorded
by a Vitatron 2 channel recorder. The analytical conditions were as
follows:
[0148] First HPLC Purification Step:
[0149] Gradient: 35-60%B, 60 min., linear
[0150] A: 0.1% trifluoroacetic acid (TFA)
[0151] B: 70% acetonitril in A (ACN)
[0152] Flow: 1.0 ml/min
[0153] Detection: UV 220 nm
[0154] Second HPLC Purification Step:
[0155] Same as first step, with the following modification:
[0156] Gradient: 40-45%B 60 min; linear.
EXAMPLE 14
[0157] Assessment of the hPTH.sub.Q26 Product.
[0158] This PTH analog was verified to represent the designed
product by N-terminal amino acid sequence analysis including amino
acid no. 30 and shown to be hPTH identical except for the lysine to
glutamine substitution at position 26.
[0159] Moreover, the resulting amino acid composition had the
expected alterations, in that the sequence contained one residue
less of lysine and one residue more of glutamine.
[0160] Its biological activity was assessed after purification by
testing the effect of synthetically bought human parathyroid
hormone fitures in comparison to the recombinant analogue which was
equally potent in stimulating the adenylyl cyclase of bone cell
membranes from rat calveria as well as from an osteosarcoma cell
line.
EXAMPLE 15
[0161] Additional Examples of Amino Acid Substitutions by Site
Specific In Vitro Mutagenesis.
[0162] By the above method, it is possible to obtain any amino acid
substitution or sequences of amino acid alterations in the PTH
molecule. By use of the "Muta-Gene.TM.in vitro mutagenesis kit" and
synthetic oligonucleotides with the desired sequence corresponding
to the amino acid alteration(s), this may be carried out. Each of
these oligonucleotides can be annealed to the single-stranded DNA
in order to generate a hetroduplex as indicated above.
[0163] Followed by second strand synthesis and ligation with T4 DNA
polymerase and T4 DNA ligase, the heteroduplex DNA is transformed
into the E. coli strain MV 1190 with specifications as stated
above. In each of these cases, the repair process in this bacterial
host will eliminate the uracils in the parenteral strands and at
the same time, the in vitro synthesized strand will serve as a
repair template whereby the introduced DNA changes will be
conserved. All the positive clones will be DNA sequenced and the
expression cassettes isolated as described above and inserted into
the yeast shuttle vector YEp 24 for transformation of Saccharomyces
cerevisiae.
[0164] This general approach with the specific alterations as
indicated, enables the generation of any desired PTH peptide and
PTH like peptide. For example, amino acid substitutions, deletions,
insertions or extensions confined within the first 26 amino acids
in the N-terminal region can produce agonists with increased
affinity for the PTH receptors as well as antagonists which bind to
the receptor, but are biologically inactive. The mid-region or the
C-terminal part of the molecule is of importance for modifying the
binding of PTH to the different receptors in bone cells and the
kidney. Changes in either of these regions produce an increased or
diminished binding affinity to the receptors in bone cells and the
kidney, and this may propose specialization in binding
characteristics so that the PTH derivative could bind and function
only in bone cells or in the kidney, or alteration, i.e.,
stimulation or blockade, of the biological activity at one or both
receptor sites.
[0165] The inventions have been described herein with reference to
certain preferred embodiments. However, as obvious variations
thereon will become apparent to those skilled in the art, the
inventions are not to be considered limited thereto.
EXAMPLE 16
[0166] Comparison of the Biological Activity of Human Parathyroid
Hormone (hPTH 1-84, Bachem Fine Chemicals, Cal. USA) with QPTH
[0167] The purpose of this study was to compare the biological
activity of the recombinant QPTH with the standard PTH preparation
of Bachem human PTH (1-84). We examined the ability of the two
agents to induce hypercalcemia in rats. Both the maximum plasma
calcium levels as well as the duration of action was monitored.
[0168] Methods:
[0169] Male Wistar rats (150-200) were parathyroidectomized using
electrocautery 18 hours before the start of the experiment. The
animals were fasted overnight, and anesthetized the next day using
hypnorm dormicum (0.2 ml per rat). The carotid artery was
cannulated using polyethylene-50 tubing. The cannula was connected
to a syringe containing Ringers Acetate, 4% bovine serum albumin
(BSA), and 25 units heparin/ml. Five minutes after injection of 200
l of the heparinized Ringers, a baseline blood sample was drawn
(300 l). The animals were trachesostomized to prevent respiratory
failure due to damage to the recurrent laryngeal nerve running
through the thyroid gland. The PTH was then injected
subcutaneously, in a volume of 200 l. Both hPTH and QPTH had been
dissolved into 50 l of 0.01 N acetic acid, allowing at least one
half hour for complete dissolution. After dissolving in the acetic
acid, the agents were brought up in 450 l of Ringers Acetate
containing 1% BSA. Blood samples were then drawn at 1, 2, 3, and 4
hours after the injection of the PTH. The rats were reheparinized 5
minutes before drawing each blood sample using 200 l of the
heparinized Ringers solution.
[0170] The blood samples were centrifuged in a clinical centrifuge
for 10 minutes, then the plasma was analyzed for calcium using a
Cobas autoanalyzer.
[0171] Both the Bachem hPTH and the QPTH induced hypercalcemia in
the rats to about the same degree and lasting about 2 hours. No
significant difference in the calcium response was seen until 4
hours after the injections. Then the QPTH maintained the serum
calcium better (p<0.05) than synthetic Bachem PTH.
[0172] The zero time plasma calcium (baseline) indicates the time
of PTH injection and was set equal to zero. The changes in plasma
calcium from zero are given as positive or negative values
depending on the change (increase or reduction) in the measured
values.
4 Time after injection (hrs) [calcium mg/100 ml from baseline]
Median values Preparation 1 2 3 4 hours Bachem hPTH +0.45 +0.30
-0.20 -0.70* baseline: 6.84 .+-. 0.30 (mg/100 ml) QPTH +0.55 +0.25
0.0 -0.50 baseline: 7.011 .+-. 0.29 (mg/100 ml) (n = 7) *a
significant difference of p 0.05 (Wilcoxon, two-sided test)
REFERENCES
[0173] 1/ Cohn, D. V., and Elting, J. 1983. Biosynthesis,
Processing, and Secretion of Parathormone and Secretory Protein-I.
In Recent Progress in Hormone Research (Greep, R. O., ed.) vol. 39,
pp. 181-209, Academic Press, NY.
[0174] 2/ Norman, A. W., Roth, J., and Orci, L. 1982. The vitamin D
endocrine system--steroid metabolism, hormone receptors, and
biological response (calcium binding proteins). Endocr. Rev. 3,
331-366.
[0175] 3/ Morel, F. 1983. Regulation of Kidney Functions by
Hormones: A New Approach. In Greep, R. O. (Ed.), Recent Progress in
Hormone Research Academic Press, NY, vol. 39, pp. 271-304.
[0176] 4/ Potts, J. T., Kronenberg, H. M., and Rosenblatt, M. 1982.
Adv. Protein chem. 32, 323-395.
[0177] 5/ Fiskin, A. M., Cohn, D. V., and Peterson, G. S. 1977. J.
Biol. Chem. 252, 8261-______.
[0178] 6/ Born, W., Freeman, M., Hendy, G. N., Rapoport, A., Rich,
A., Potts, J. T. Jr., and Kronenberg, H. M. 1987. Human
preproparathyroid hormone synthesized in Escherichia coli is
transported to the surface of the bacterial inner membrane, but not
processed to the mature hormone. Mol. Endocr. 1, 5-14
[0179] 7/ Morelle, G., and Mayer, H. 1988. Biochim. Biophys. Acta
950, 459-462
[0180] 8/ Rabbani, S. A., Yasuda, T., Benett, H. P. J., Sung, W.
L., Zahab, D. M., Tam, C. S., Goltzman, D., and Hendy, G. N. 1988.
Recombinant Human Parathyroid Hormone Synthesized in Escherichia
coli. Purification and Characterization. J. Biol. Chem. 263,
1307-1313
[0181] 9/ Gabrielsen, O. S., Reppe, S., Sletten, K., and Oyen, T.
B., Sather, O., Hogset, A., Blingsmo, O. R., Gautvik, V. T.,
Gordeladze, J. O., Alestrom, P., and Gautvik, K. M. 1989.
Expression and secretion of human parathyroid hormone in
Saccharomyces cerevisiae. Submitted.
[0182] 10/ Bussey, H. 1988. Proteases and the Processing of
Precursors to Secreted Proteins in Yeast. Yeast 4, 17-26
[0183] 11/ Fuller, R. S., Sterne, R. E., and Thorner, J. 1988.
Enzymes required for yeast prohormone processing Ann. Rev. Physiol.
50, 345-362
[0184] 12/ Carter, B. L. A., Irani, M., Mackay, V. L., Seale, R.
L., Sledziewski, A. V., and Smith, R. A. 1987. Expression and
secretion of foreign genes in yeast. In DNA cloning Volume III. A
practical approach. (Glover, D. M., ed.) pp. 141-161, IRL Press,
Oxford.
[0185] 13/ Kunkel, T. A., Roberts, J. D., and Zakour, R. A. 1987.
Methods in Enzymol.
[0186] 14/ Sanger, F. et al. 1977. Proc. Natl. Acad. Sci. USA 74,
5463
[0187] 15/ Botstein, D., Falco, S. C., Stewart, S. E., Brennan, M.,
Scherer, S., Stinchcomb, D. T., Struhl, K., and David, R. W. 1979.
Sterile host yeast (SHY): a eukaryotic system of biological
containment for recombinant DNA experiments. Gene 8, 17-23
[0188] 16/ Gautvik, K. M., Teig, V., Halvorsen, J. F., Arnesen, E.,
Myhre, L., Heimann, P., and Tollman, R. 1979. Development of
sequence specific radioimmunoassay of human parathyroid hormone and
its use in the diagnosis of hyperparathyroidism. Scand. J. clin.
Lab. Invest. 39, 469-478
[0189] 17/ Laemmli, U. K. 1970. Cleavage of structural proteins
during assembly of the head of bacteriophage T4. Nature 227,
680-685
[0190] 18/ Btirk, R. R., Eschenbruch, M., Leuthard, P., and Steck,
G. 1983. Sensitive Detection of Proteins and Peptides in
Polyacrylamide. Gels after Formaldehyde Fixation Methods in
Enzymol. 91, 247-254
[0191] 19/ Towbin, H., Staehelin, T., and Gordon, J. 1979.
Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: Procedure and some applications. Proc. Natl.
Acad. Sci. USA 76, 4350-4354
[0192] 20/ Matsudaira, P. 1987. Sequence from Picomole Quantities
of Proteins Electroblotted onto Polyvinylidene Difluoride
Membranes. J. Biol. Chem. 262, 10035-10038
[0193] 21/ Gautvik, K. M., Gordeladze, J. O., Jahnsen, T., Haug,
E., Hansson, V., and Lystad, E. 1983. Thyroliberin receptor binding
and adenylyl cyclase activation in cultured prolactin-producing rat
pituitary tumor cells (GH cells). J. Biol. Chem. 258,
10304-10311
[0194] 22/ Gautvik, K. M., Gordeladze, J. O., Moxheim, E., and
Gautvik, V. T. 1984. Peripheral Metabolism of Parathyroid Hormone
in Patients with Primary Hyperparathyroidism as Judged by
Immunological and Biological Studies. Eur. Surg. Res. 16 (suppl.
2), 41-54
[0195] 23/ Wingender, E., Bercz, G., Blocker, H., Frank, R., and
Mayer, H. 1989. Expression of Human Parathyroid Hormone in
Escherichia coli. J. Biol. Chem. 264, 4367-4373
[0196] 24/ Niall, H. D., Keutmann, H. T., Sauer, R., Hogan, M.,
Dawson, B., Aurbach, G. D., and Potts, J. T. Jr. 1974. Hoppe
Seylers Z. Physiol. Chem. 351, 1586
[0197] 25/ Sauer, R. T., Niall, H. D., Hogan, M. L., Keutmann, H.
T., O'Riordan, J. L. H., and Potts, J. T. Jr. 1974. Biochemistry
13, 1994
[0198] 26/ Keutmann, H. T., Sauer, M. M., Hendy, G. N., O'Riordan,
J. L. H., and Potts, J. T. Jr. 1978. Complete Amino Acid Sequence
of Human Parathyroid Hormone. Biochemistry 17, 5723-5729
[0199] 27/ Reeve, J., Meunier, P. J., Parsons, J. A., Bernat, M.,
Bijvoet, O. L. M., Courpron, P., Edouard, C., Klenerman, L., Neer,
R. M., Renier, J. C., Slovik, D., Vismans, F. J. F. E., and Potts,
J. T. Jr. 1980. Anabolic effect of human parathyroid hormone
fragment on trabecular bone in involutional osteoporosis: a
multicentre trial. Br. Med. J. 280, 1340-1351
[0200] 28/ Slovik, D. M., Rosenthal, D. I., Doppelt, S. H., Potts,
J. T. Jr., Daly, M. A., Campbell, J. A., and Neer, R. M. 1986.
Restoration of Spinal Bone in Osteoporotic Men by Treatment With
Human Parathyroid Hormone (1-34) and 1,25-Dihydroxyvitamin D. J.
Bone Min. Res. 1, 377-381
Sequence CWU 1
1
29 1 348 DNA Homo sapiens modified_base (9)..(9) a, t, c or g 1
atgathccng cnaargayat ggcnaargtn atgathgtna tgytngcnat htgyttyytn
60 acnaarwsng ayggnaarws ngtnaaraar mgnwsngtnw sngarathca
rytnatgcay 120 aayytnggna arcayytnaa ywsnatggar mgngtngart
ggytnmgnaa raarytncar 180 gaygtncaya ayttygtngc nytnggngcn
ccnytngcnc cnmgngaygc nggnwsncar 240 mgnccnmgna araargarga
yaaygtnytn gtngarwsnc aygaraarws nytnggngar 300 gcngayaarg
cngaygtnaa ygtnytnacn aargcnaarw sncartrr 348 2 351 DNA Homo
sapiens 2 tatgatgata cctgcaaaag acatggctaa agttatgatt gtcatgttgg
caatttgttt 60 tcttacaaaa tcggatggga aatctgttaa gaagagatcg
tggagtgaaa tacagcttat 120 gcataacctg ggaaaacatc tgaactcgat
ggagagagta gaatggctgc gtaagaagct 180 gcaggatgtg cacaattttg
ttgcccttgg agctcctcta gctcccagag atgctggttc 240 ccagaggccc
cgaaaaagga agacaatgtc ttggttgaga gccatgaaaa aagtcttgga 300
gaggcagaca aagctgatgt gaatgtatta actaaagcta aatcccagtg a 351 3 432
DNA Homo sapiens modified_base (13)..(13) a, t, c or g 3 tatgatgath
ccngcnaarg ayatggcnaa rgtnatgath gtnatgytng cnathtgytt 60
yytnacnaar wsngayggna arwsngtnaa raarmgnwsn gtnwsngara thcarytnat
120 gcayaayytn ggnaarcayy tnaaywsnat ggarmgngtn gartggytnm
gnaaraaryt 180 ncargaygtn cayaayttyg tngcnytngg ngcnccnytn
gcnccnmgng aygcnggnws 240 ncarmgnccn mgnaaraarg argayaaygt
nytngtngar wsncaygara arwsnytngg 300 ngargcngay aargcngayg
tnaaygtnyt nacnaargcn aarwsncart rraaatgaaa 360 acagatattg
tcagagttct gctctagaca gtgtagggca acaatacatg ctgctaattc 420
aaagctctat ta 432 4 432 DNA Homo sapiens 4 tatgatgata cctgcaaaag
acatggctaa agttatgatt gtcatgttgg caatttgttt 60 tcttacaaaa
tcggatggga aatctgttaa gaagagatct gtgagtgaaa tacagcttat 120
gcataacctg ggaaaacatc tgaactcgat ggagagagta gaatggctgc gtaagaagct
180 gcaggatgtg cacaattttg ttgcccttgg agctcctcta gctcccagag
atgctggttc 240 ccagaggccc cgaaaaaagg aagacaatgt cttggttgag
agccatgaaa aaagtcttgg 300 agaggcagac aaagctgatg tgaatgtatt
aactaaagct aaatcccagt gaaaatgaaa 360 acagatattg tcagagttct
gctctagaca gtgtagggca acaatacatg ctgctaattc 420 aaagctctat ta 432 5
432 DNA Homo sapiens CDS (5)..(349) 5 tatg atg ata cct gca aaa gac
atg gct aaa gtt atg att gtc atg ttg 49 Met Ile Pro Ala Lys Asp Met
Ala Lys Val Met Ile Val Met Leu 1 5 10 15 gca att tgt ttt ctt aca
aaa tcg gat ggg aaa tct gtt aag aag aga 97 Ala Ile Cys Phe Leu Thr
Lys Ser Asp Gly Lys Ser Val Lys Lys Arg 20 25 30 tct gtg agt gaa
ata cag ctt atg cat aac ctg gga aaa cat ctg aac 145 Ser Val Ser Glu
Ile Gln Leu Met His Asn Leu Gly Lys His Leu Asn 35 40 45 tcg atg
gag aga gta gaa tgg ctg cgt aag aag ctg cag gat gtg cac 193 Ser Met
Glu Arg Val Glu Trp Leu Arg Lys Lys Leu Gln Asp Val His 50 55 60
aat ttt gtt gcc ctt gga gct cct cta gct ccc aga gat gct ggt tcc 241
Asn Phe Val Ala Leu Gly Ala Pro Leu Ala Pro Arg Asp Ala Gly Ser 65
70 75 cag agg ccc cga aaa aag gaa gac aat gtc ttg gtt gag agc cat
gaa 289 Gln Arg Pro Arg Lys Lys Glu Asp Asn Val Leu Val Glu Ser His
Glu 80 85 90 95 aaa agt ctt gga gag gca gac aaa gct gat gtg aat gta
tta act aaa 337 Lys Ser Leu Gly Glu Ala Asp Lys Ala Asp Val Asn Val
Leu Thr Lys 100 105 110 gct aaa tcc cag tgaaaatgaa aacagatatt
gtcagagttc tgctctagac 389 Ala Lys Ser Gln 115 agtgtagggc aacaatacat
gctgctaatt caaagctcta tta 432 6 115 PRT Homo sapiens 6 Met Ile Pro
Ala Lys Asp Met Ala Lys Val Met Ile Val Met Leu Ala 1 5 10 15 Ile
Cys Phe Leu Thr Lys Ser Asp Gly Lys Ser Val Lys Lys Arg Ser 20 25
30 Val Ser Glu Ile Gln Leu Met His Asn Leu Gly Lys His Leu Asn Ser
35 40 45 Met Glu Arg Val Glu Trp Leu Arg Lys Lys Leu Gln Asp Val
His Asn 50 55 60 Phe Val Ala Leu Gly Ala Pro Leu Ala Pro Arg Asp
Ala Gly Ser Gln 65 70 75 80 Arg Pro Arg Lys Lys Glu Asp Asn Val Leu
Val Glu Ser His Glu Lys 85 90 95 Ser Leu Gly Glu Ala Asp Lys Ala
Asp Val Asn Val Leu Thr Lys Ala 100 105 110 Lys Ser Gln 115 7 874
DNA Artificial Sequence Description of Artificial Sequence
MF-alpha1-hPTH fusion gene 7 agtgcaagaa aaccaaaaag caacaacagg
ttttggataa gtacatatat aagagggcct 60 tttgttccca tcaaaaatgt
tactgttctt acgattcatt tacgattcaa gaatagttca 120 aacaagaaga
ttacaaacta tcaatttcat acacaatata aacgaccaaa agaatgagat 180
ttccttcaat ttttactgca gttttattcg cagcatcctc cgcattagct gctccagtca
240 acactacaac agaagatgaa acggcacaaa ttccggctga agctgtcatc
ggttactcag 300 atttagaagg ggatttcgat gttgctgttt tgccattttc
caacagcaca aataacgggt 360 tattgtttat aaatactact attgccagca
ttgctgctaa agaagaaggg gtatctttgg 420 ataaaagaga ggctgaagct
wsngtnwsng arathcaryt natgcayaay ytnggnaarc 480 ayytnaayws
natggarmgn gtngartggy tnmgnaaraa rytncargay gtncayaayt 540
tygtngcnyt nggngcnccn ytngcnccnm gngaygcngg nwsncarmgn ccnmgnaara
600 argargayaa ygtnytngtn garwsncayg araarwsnyt nggngargcn
gayaargcng 660 aygtnaaygt nytnacnaar gcnaarwsnc artrraaatg
aaaacagata ttgtcagagt 720 tctgctctag agtcgacttt gttcccactg
tacttttagc tcgtacaaaa tacaatatac 780 ttttcatttc tccgtaaaca
acctgttttc ccatgtaata tccttttcta tttttcgttt 840 cgttaccaac
tttacacata ctttatatag ctat 874 8 874 DNA Artificial Sequence
Description of Artificial Sequence MF-alpha1-hPTH fusion gene 8
agtgcaagaa aaccaaaaag caacaacagg ttttggataa gtacatatat aagagggcct
60 tttgttccca tcaaaaatgt tactgttctt acgattcatt tacgattcaa
gaatagttca 120 aacaagaaga ttacaaacta tcaatttcat acacaatata
aacgaccaaa agaatgagat 180 ttccttcaat ttttactgca gttttattcg
cagcatcctc cgcattagct gctccagtca 240 acactacaac agaagatgaa
acggcacaaa ttccggctga agctgtcatc ggttactcag 300 atttagaagg
ggatttcgat gttgctgttt tgccattttc caacagcaca aataacgggt 360
tattgtttat aaatactact attgccagca ttgctgctaa agaagaaggg gtatctttgg
420 ataaaagaga ggctgaagct tctgtgagtg aaatacagct tatgcataac
ctgggaaaac 480 atctgaactc gatggagaga gtagaatggc tgcgtaagaa
gctgcaggat gtgcacaatt 540 ttgttgccct tggagctcct ctagctccca
gagatgctgg ttcccagagg ccccgaaaaa 600 aggaagacaa tgtcttggtt
gagagccatg aaaaaagtct tggagaggca gacaaagctg 660 atgtgaatgt
attaactaaa gctaaatccc agtgaaaatg aaaacagata ttgtcagagt 720
tctgctctag agtcgacttt gttcccactg tacttttagc tcgtacaaaa tacaatatac
780 ttttcatttc tccgtaaaca acctgttttc ccatgtaata tccttttcta
tttttcgttt 840 cgttaccaac tttacacata ctttatatag ctat 874 9 18 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
oligonucleotide 9 ggataaaaga tctgtgag 18 10 18 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 10 ggctgcgtca gaagctgc 18 11 17 PRT Influenza virus
11 Met Lys Ala Lys Leu Leu Val Leu Leu Thr Ala Phe Val Ala Thr Asp
1 5 10 15 Ala 12 18 PRT Homo sapiens 12 Met Arg Ser Leu Leu Ile Leu
Val Leu Cys Phe Leu Pro Leu Ala Ala 1 5 10 15 Leu Gly 13 19 PRT
Saccharomyces cerevisiae 13 Met Arg Phe Pro Ser Ile Phe Thr Ala Val
Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala 14 18 PRT
Kluyveromyces lactis 14 Met Asn Ile Phe Tyr Ile Phe Leu Phe Leu Ser
Phe Val Gln Gly Thr 1 5 10 15 Arg Gly 15 24 DNA Artificial Sequence
Description of Artificial Sequence Probe 15 tactatggac gttttctgta
ccga 24 16 24 DNA Artificial Sequence Description of Artificial
Sequence Synthetic oligonucleotide 16 ctcaagacga gatctgtcac atcc 24
17 30 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 17 gatcagatct gcaggatgga tccaaagctt 30 18
30 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 18 gatcaagctt tggatccatc ctgcagatct 30 19
22 DNA Artificial Sequence Description of Artificial Sequence Probe
19 tggcattggc tgcaactaaa gc 22 20 4 PRT Homo sapiens 20 Glu Ala Glu
Ala 1 21 30 DNA Artificial Sequence Description of Artificial
Sequence Synthetic oligonucleotide 21 ctcacagaag cttcagcctc
tcttttatcc 30 22 5 PRT Artificial Sequence Description of
Artificial Sequence Synthetic peptide 22 Asp Lys Arg Ser Val 1 5 23
9 PRT Artificial Sequence Description of Artificial Sequence
Synthetic peptide 23 Asp Lys Arg Glu Ala Glu Ala Ser Val 1 5 24 12
DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 24 agcttcagcc tc 12 25 18 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 25 ggctgcgtca gaagctgc 18 26 19 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 26 ggctgcgtcc agaagctgc 19 27 18 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 27 gcagcttctt acgcagcc 18 28 5 PRT Artificial
Sequence Description of Artificial Sequence Synthetic peptide 28
Leu Arg Gln Lys Leu 1 5 29 5 PRT Artificial Sequence Description of
Artificial Sequence Synthetic peptide 29 Leu Arg Lys Lys Leu 1
5
* * * * *