U.S. patent application number 10/351955 was filed with the patent office on 2004-01-08 for polynucleotide sequence assay.
This patent application is currently assigned to Applera Corporation. Invention is credited to Bi, Wanli, Bloch, Will, Livak, Kenneth J..
Application Number | 20040005585 10/351955 |
Document ID | / |
Family ID | 22807344 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040005585 |
Kind Code |
A1 |
Bi, Wanli ; et al. |
January 8, 2004 |
Polynucleotide sequence assay
Abstract
Disclosed are methods for detecting or quantifying one or more
target polynucleotide sequences in a sample. In one aspect, a
sample is contacted with first and second probe pair that are
capable of hybridizing to a selected target sequence and a
corresponding complementary sequence, respectively. Probe cleavage
and ligation results in the formation of ligation products which
can be generated in an exponential fashion when the target sequence
and/or complement are present in the sample. In another embodiment,
a single probe pair can be used to form ligation product in a
linear fashion from a complementary template. Reagents and kits are
also disclosed.
Inventors: |
Bi, Wanli; (San Ramon,
CA) ; Livak, Kenneth J.; (San Jose, CA) ;
Bloch, Will; (White Salmon, WA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.
APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
Applera Corporation
Foster City
CA
|
Family ID: |
22807344 |
Appl. No.: |
10/351955 |
Filed: |
January 27, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10351955 |
Jan 27, 2003 |
|
|
|
09898323 |
Jul 3, 2001 |
|
|
|
6511810 |
|
|
|
|
60216514 |
Jul 3, 2000 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6862 20130101;
C12Q 1/6862 20130101; C12Q 2531/137 20130101; C12Q 2521/319
20130101 |
Class at
Publication: |
435/6 ;
435/91.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
1. A method for detecting a target polynucleotide sequence, the
method comprising (a) reacting a target polynucleotide strand
region and a target-complementary strand region with a first probe
pair and a second probe pair, the first probe pair comprising (i) a
first polynucleotide probe containing a sequence that is
complementary to a first target region in the target strand region
and (ii) a second polynucleotide probe comprising a sequence that
is complementary to a second target region in the target strand
region, wherein the second region is located 5' to the first region
and overlaps the first region by at least one nucleotide base, and
the second probe pair comprising (i) a third polynucleotide probe
containing a sequence that is complementary to a first region in
the target-complementary strand region and (ii) a fourth
polynucleotide probe containing a sequence that is complementary to
a second region in the target-complementary strand region, wherein
the second region is located 5' to the first region and overlaps
the first region by at least one nucleotide base, under conditions
effective for the first and second probes to hybridize to the first
and second regions in the target strand region, respectively,
forming a first hybridization complex, and for the third and fourth
probes to hybridize to the first and second regions in the
target-complementary strand region, respectively, forming a second
hybridization complex, (b) cleaving the second probe in the first
hybridization complex, and the fourth probe in the second
hybridization complex, to form (i) a third hybridization complex
comprising the target strand region, the first probe, and a first
fragment of the second probe having a 5' terminal nucleotide
located immediately contiguous to a 3' terminal nucleotide of the
first probe, and (ii) a fourth hybridization complex comprising the
target-complementary strand region, the third probe, and a first
fragment of the fourth probe having a 5' terminal nucleotide
located immediately contiguous to a 3' terminal nucleotide of the
third probe, (c) ligating the first probe to the hybridized
fragment of the second probe to form a first ligated strand
hybridized to the target strand region, and ligating the third
probe to the fragment of the fourth probe to form a second ligated
strand hybridized to the target-complementary strand region, (d)
denaturing the first ligated strand from the target strand region
and the second ligated strand from the target-complementary strand
region, and (e) performing one or more additional cycles of steps
(a) through (d), with the proviso that in the last cycle, step (d)
is optionally omitted.
2. The method of claim 1, wherein the first region overlaps the
second region by one nucleotide base.
3. The method of claim 1, wherein the 5' ends of the first and
third probes terminate with a group other than a nucleotide 5'
phosphate group.
4. The method of claim 3, wherein the 5' ends of the first and
third probes terminate with a nucleotide 5' hydroxyl group.
5. The method of claim 1, wherein the 5' ends of the second and
fourth probes terminate with a group other than a nucleotide 5'
phosphate group.
6. The method of claim 5, wherein the 5' ends of the second and
fourth probes terminate with a nucleotide 5' hydroxyl group.
7. The method of claim 1, wherein the 5' ends of the first, second,
third and fourth probes terminate with a group other than a
nucleotide 5' phosphate group.
8. The method of claim 1, wherein the 3' ends of the second and
fourth probes terminate with a group other than a nucleotide 3'
hydroxyl group.
9. The method of claim 8, wherein said 3' ends of the second and
fourth probes terminate with a nucleotide 3' phosphate group.
10. The method of claim 1, wherein at least one of the probes
contains a detectable label.
11. The method of claim 10, wherein the label is a fluorescent
label.
12. The method of claim 10, wherein the label is a radiolabel.
13. The method of claim 10, wherein the label is a chemiluminescent
label.
14. The method of claim 10, wherein the label is an enzyme.
15. The method of claim 10, wherein at least one of the first probe
and the third probe contains a detectable label.
16. The method of claim 15, wherein each of the first probe and
third probe contains a detectable label.
17. The method of claim 16, wherein the detectable labels on the
first probe and third probe are the same.
18. The method of claim 10, wherein at least one of the second
probe and the fourth probe contains a detectable label.
19. The method of claim 18, wherein each of the second probe and
the fourth probe contains a detectable label.
20. The method of claim 19, wherein the second probe and fourth
probe contain the same detectable label.
21. The method of claim 1, wherein said cleaving produces a second
fragment from the second probe which does not associate with the
third hybridization complex, and the method further includes
detecting said second fragment.
22. The method of claim 21, wherein at least one of the second
probe and the fourth probe contains both (i) a fluorescent dye and
(ii) a quencher dye which is capable of quenching fluorescence
emission from the fluorescent dye when the fluorescent dye is
subjected to fluorescence excitation energy, and said cleaving
severs a covalent linkage between the fluorescent dye and the
quencher dye in the second probe and/or fourth probe, thereby
increasing an observable fluorescence signal from the fluorescent
dye.
23. The method of claim 22, wherein the second probe and the fourth
probe each contain (i) a fluorescent dye and (ii) a quencher
dye.
24. The method of claim 21, wherein said cleaving further produces
a second fragment from the fourth probe which does not associate
with the fourth hybridization complex, and the method further
includes detecting both second fragments.
25. The method of claim 21, wherein said second fragment comprises
one or more contiguous nucleotides which are substantially
non-complementary to the target strand region.
26. The method of claim 25, wherein said one or more contiguous
nucleotides comprise 1 to 20 nucleotides.
27. The method of claim 21, which further includes immobilizing the
second fragment on a solid support.
28. The method of claim 21, which further includes subjecting the
second fragment to electrophoresis.
29. The method of claim 21, which further includes detecting the
second fragment by mass spectrometry.
30. The method of claim 21, which comprises detecting the second
fragment after the last cycle.
31. The method of claim 21, which comprises detecting the second
fragment during or after a plurality of cycles.
32. The method of claim 31, which comprises detecting the second
fragment during all of the cycles.
33. The method of claim 1, which further includes detecting the
first hybridization complex, the second hybridization complex, or
both, after at least one cycle.
34. The method of claim 1, which further includes detecting the
third hybridization complex, the fourth hybridization complex, or
both, after at least one cycle.
35. The method of claim 1, which further includes detecting the
first ligated strand, the second ligated strand, or both, after at
least one cycle.
36. The method of claim 35, wherein said detecting comprises an
electrophoretic separation step.
37. The method of claim 35, wherein the first ligated strand, the
second ligated strand, or both, are detected by mass
spectrometry.
38. The method of claim 35, wherein the first ligated strand is
detected.
39. The method of claim 38, wherein the first ligated strand
contains a fluorescent label.
40. The method of claim 35, wherein the first ligated strand and
second ligated strand are detected, and each ligated strand
contains a detectable label.
41. The method of claim 40, wherein each detectable label is a
fluorescent label.
42. The method of claim 35, wherein the first ligated strand, the
second ligated strand, or both, are immobilized on a solid
support.
43. The method of claim 42, wherein after the last cycle, the first
ligated strand is immobilized on the solid support and
detected.
44. The method of claim 42, wherein said reacting comprises
providing the first probe or second probe immobilized on the solid
support, so that the first ligated strand is immobilized on the
solid support.
45. The method of claim 1, wherein the first probe pair comprises a
first probe and a second probe in covalently linked form, such that
the first probe is covalently linked by its 5' end to the 3' end of
the second probe by a linking moiety.
46. The method of claim 45, wherein the second probe pair comprises
a third probe and a fourth probe in covalently linked form, such
that the third probe is covalently linked by its 5' end to the 3'
end of the fourth probe by a linking moiety.
47. The method of claim 45, wherein the linking moiety comprises a
chain of polynucleotides that is not substantially complementary to
the target polynucleotide.
48. The method of claim 1, wherein said reacting further comprises
providing a fifth polynucleotide probe which is complementary to a
sequence variant of a region to which either the first probe,
second probe, third probe, or fourth probe is complementary.
49. The method of claim 48, wherein the fifth polynucleotide probe
and the first polynucleotide probe are complementary to alternative
polymorphic sequences in the target polynucleotide strand
region.
50. The method of claim 49, wherein the target complementary
sequences of the fifth polynucleotide probe and the first
polynucleotide probe contain different 3' terminal nucleotides that
are complementary to alternative target nucleotide bases in the
alternative polymorphic sequences.
51. The method of claim 49, wherein the first polynucleotide probe
contains a first detectable label, and the fifth polynucleotide
probe contains a second detectable label that is distinguishable
from the first detectable label.
52. The method of claim 51, wherein said labels are fluorescent
labels.
53. The method of claim 48, wherein the fifth polynucleotide probe
and the second polynucleotide probe are complementary to
alternative polymorphic sequences in the target polynucleotide
strand region.
54. The method of claim 53, wherein the target complementary
sequences of the fifth polynucleotide probe and of the second
polynucleotide probe contain different 5' terminal nucleotides that
are complementary to alternative target nucleotide bases in the
alternative polymorphic sequences.
55. The method of claim 53, wherein the second polynucleotide probe
contains a first detectable label, and the fifth polynucleotide
probe contains a second detectable label that is distinguishable
from the first detectable label.
56. The method of claim 55, wherein said labels are fluorescent
labels.
57. The method of claim 1, wherein the 5' terminal base of said
first region of the target strand region abuts the 5' terminal base
of said first region of the target-complementary strand region.
58. The method of claim 1, wherein the 5' terminal base of said
first region of the target strand region is separated from the 5'
terminal base of said first region of the target-complementary
strand region by at least one nucleotide base.
59. The method of claim 1, wherein said reacting further includes
providing a third probe pair which is complementary to a second
target polynucleotide strand region and a fourth probe pair which
is complementary to a complement of the second target
polynucleotide strand region, the third probe pair comprising (i) a
fifth polynucleotide probe containing a sequence that is
complementary to a first target region in the second target strand
region and (ii) a sixth polynucleotide probe comprising a sequence
that is complementary to a second target region in the second
target strand region, wherein the second region is located 5' to
the first region and overlaps the first region by at least one
nucleotide base, and the fourth probe pair comprising (i) a seventh
polynucleotide probe containing a sequence that is complementary to
a first region in the second said target-complementary strand
region and (ii) an eighth polynucleotide probe containing a
sequence that is complementary to a second region in the second
said target-complementary strand region, wherein the second region
is located 5' to the first region and overlaps the first region by
at least one nucleotide base, under conditions effective for the
fifth and sixth probes to hybridize to the first and second regions
in the second target strand region, respectively, forming a fifth
hybridization complex, and for the seventh and eighth probes to
hybridize to the first and second regions in the second said
target-complementary strand region, respectively, forming a sixth
hybridization complex if the second said target-complementary
strand region is present in the sample.
60. The method of claim 1, wherein the first probe pair and the
second probe pair taken together constitute a first probe set, and
the method further comprises reacting a sample with a plurality of
different probe sets which are each designed to detect a different
target polynucleotide sequence which may be present in the
sample.
61. The method of claim 60, wherein said detecting comprises
detecting at least one ligated strand produced by each different
probe set when the corresponding target sequence is present.
62. The method of claim 61, wherein ligated strands from different
probe sets are detected by mass spectrometry.
63. The method of claim 61, wherein ligated strands from different
probe sets are detected by electrophoresis.
64. The method of claim 63, wherein ligated strands from different
probe sets have different electrophoretic mobilities.
65. The method of claim 64, wherein ligated strands from different
probe sets contain detectable labels which may be the same or
different.
66. The method of claim 65, wherein the labels are fluorescent
labels.
67. The method of claim 63, wherein ligated strands from at least
two different probe sets contain different fluorescent labels.
68. The method of claim 60, wherein prior to step (a), the first
probe, the second probe, the third probe, or the fourth probe from
the different probe sets is immobilized on a distinct solid support
region.
69. The method of claim 60, wherein one of the first probe, the
second probe, the third probe, or the fourth probe in each probe
set contains a distinct polynucleotide tag that identifies that
probe set.
70. The method of claim 69, which comprises hybridizing species
containing said tags to a plurality of corresponding tag
complements which are immobilized on distinct solid support
regions.
71. The method of claim 70, wherein each distinct polynucleotide
tag is attached to the 5' end of the first probe in each different
probe set.
72. The method of claim 70, wherein each distinct polynucleotide
tag is attached to the 3' end of the second probe in each different
probe set.
73. The method of claim 70, wherein said distinct solid support
regions are located on a substantially planar surface.
74. The method of claim 70, wherein said distinct solid support
regions are located on different beads.
75. The method of claim 60, wherein for each probe set, said
cleaving produces a second fragment from the second probe of the
probe set which does not associate with the third hybridization
complex, and the method further includes detecting the second
fragment.
76. The method of claim 75, wherein second fragments from different
probe sets are detected by mass spectrometry.
77. The method of claim 75, wherein second fragments from different
probe sets are detected by electrophoresis.
78. The method of claim 77, wherein second fragments from different
probe sets have different electrophoretic mobilities.
79. The method of claim 77, wherein second fragments from different
probe sets contain detectable labels which may be the same or
different.
80. The method of claim 79, wherein the labels are fluorescent
labels.
81. The method of claim 75, wherein second fragments from at least
two different probe sets contain different fluorescent labels.
82. The method of claim 75, wherein the second fragment from each
different probe set contains a distinct polynucleotide tag that
identifies the probe set.
83. The method of claim 82, which comprises hybridizing second
fragments containing said tags to a plurality of corresponding tag
complements which are immobilized on distinct solid support
regions.
84. The method of claim 83, wherein said distinct solid support
regions are located on a substantially planar surface.
85. The method of claim 83, wherein said distinct solid support
regions are located on different beads.
86. A method for detecting a target polynucleotide sequence, the
method comprising (a) reacting a target polynucleotide strand
region with a first probe pair, the first probe pair comprising (i)
a first polynucleotide probe containing a sequence that is
complementary to a first target region in the target strand region
and (ii) a second polynucleotide probe comprising a sequence that
is complementary to a second target region in the target strand
region, wherein the second region is located 5' to the first region
and overlaps the first region by at least one nucleotide base,
under conditions effective for the first and second probes to
hybridize to the first and second regions in the target strand
region, respectively, forming a first hybridization complex, (b)
cleaving the second probe in the first hybridization complex to
form (i) a second hybridization complex comprising the target
strand region, the first probe, and a first fragment of the second
probe having a 5' terminal nucleotide located immediately
contiguous to a 3' terminal nucleotide of the first probe, (c)
ligating the first probe to the hybridized fragment of the second
probe to form a first ligated strand hybridized to the target
strand region, (d) denaturing the first ligated strand from the
target strand region, and (e) performing one or more additional
cycles of steps (a) through (d), with the proviso that in the last
cycle, step (d) is optionally omitted.
87. The method of claim 86, wherein the first region overlaps the
second region by one nucleotide base.
88. The method of claim 86, wherein the 5' end of the first probe
terminates with a group other than a nucleotide 5' phosphate
group.
89. The method of claim 88, wherein the 5' end of the first probe
terminates with a nucleotide 5' hydroxyl group.
90. The method of claim 86, wherein the 5' end of the second probe
terminates with a group other than a nucleotide 5' phosphate
group.
91. The method of claim 90, wherein the 5' end of the second probe
terminates with a nucleotide 5' hydroxyl group.
92. The method of claim 86, wherein the 5' end of the first and
second probes terminate with a group other than a nucleotide 5'
phosphate group.
93. The method of claim 86, wherein the 3' end of the second probe
terminates with a group other than a nucleotide 3' hydroxyl
group.
94. The method of claim 93, wherein said 3' end of the second probe
terminates with a nucleotide 3' phosphate group.
95. The method of claim 86, wherein at least one of the probes
contains a detectable label.
96. The method of claim 95, wherein the label is a fluorescent
label.
97. The method of claim 95, wherein the label is a radiolabel.
98. The method of claim 95, wherein the label is a chemiluminescent
label.
99. The method of claim 95, wherein the label is an enzyme.
100. The method of claim 95, wherein the first probe contains a
detectable label.
101. The method of claim 95, wherein the second probe contains a
detectable label.
102. The method of claim 86, wherein said cleaving produces a
second fragment from the second probe which does not associate with
the second hybridization complex, and the method further includes
detecting said second fragment.
103. The method of claim 102, wherein the second probe contains
both (i) a fluorescent dye and (ii) a quencher dye which is capable
of quenching fluorescence emission from the fluorescent dye when
the fluorescent dye is subjected to fluorescence excitation energy,
and said cleaving severs a covalent linkage between the fluorescent
dye and the quencher dye in the second probe, thereby increasing an
observable fluorescence signal from the fluorescent dye.
104. The method of claim 102, wherein said second fragment
comprises one or more contiguous nucleotides which are
substantially non-complementary to the target strand region.
105. The method of claim 104, wherein said one or more contiguous
nucleotides comprise 1 to 20 nucleotides.
106. The method of claim 102, which further includes immobilizing
the second fragment on a solid support.
107. The method of claim 102, which further includes subjecting the
second fragment to electrophoresis.
108. The method of claim 102, which further includes detecting the
second fragment by mass spectrometry.
109. The method of claim 102, which comprises detecting the second
fragment after the last cycle.
110. The method of claim 102, which comprises detecting the second
fragment during or after a plurality of cycles.
111. The method of claim 110, which comprises detecting the second
fragment during all of the cycles.
112. The method of claim 86, which further includes detecting the
first hybridization complex after at least one cycle.
113. The method of claim 86, which further includes detecting the
second hybridization complex after at least one cycle.
114. The method of claim 86, which further includes detecting the
first ligated strand after at least one cycle.
115. The method of claim 114, wherein said detecting comprises an
electrophoretic separation step.
116. The method of claim 114, wherein the first ligated strand is
detected by mass spectrometry.
117. The method of claim 114, wherein the first ligated strand
contains a fluorescent label.
118. The method of claim 114, wherein the first ligated strand is
immobilized on a solid support.
119. The method of claim 118, wherein after the last cycle, the
first ligated strand is immobilized on the solid support and
detected.
120. The method of claim 118, wherein said reacting comprises
providing the first probe or second probe immobilized on the solid
support, so that the first ligated strand is immobilized on the
solid support.
121. The method of claim 86, wherein the first probe pair comprises
a first probe and a second probe in covalently linked form, such
that the first probe is covalently linked by its 5' end to the 3'
end of the second probe by a linking moiety.
122. The method of claim 121, wherein the linking moiety comprises
a chain of polynucleotides that is not substantially complementary
to the target polynucleotide.
123. The method of claim 86, wherein said reacting further
comprises providing a third polynucleotide probe which is
complementary to a sequence variant of a region to which either the
first probe or second probe is complementary.
124. The method of claim 123, wherein the third polynucleotide
probe and the first polynucleotide probe are complementary to
alternative polymorphic sequences in the target polynucleotide
strand region.
125. The method of claim 124, wherein the target complementary
sequences of the third polynucleotide probe and the first
polynucleotide probe contain different 3' terminal nucleotides that
are complementary to alternative target nucleotide bases in the
alternative polymorphic sequences.
126. The method of claim 124, wherein the first polynucleotide
probe contains a first detectable label, and the third
polynucleotide probe contains a second detectable label that is
distinguishable from the first detectable label.
127. The method of claim 126, wherein said labels are fluorescent
labels.
128. The method of claim 123, wherein the third polynucleotide
probe and the second polynucleotide probe are complementary to
alternative polymorphic sequences in the target polynucleotide
strand region.
129. The method of claim 128, wherein the target complementary
sequences of the third polynucleotide probe and of the second
polynucleotide probe contain different 5' terminal nucleotides that
are complementary to alternative target nucleotide bases in the
alternative polymorphic sequences.
130. The method of claim 128, wherein the second polynucleotide
probe contains a first detectable label, and the third
polynucleotide probe contains a second detectable label that is
distinguishable from the first detectable label.
131. The method of claim 130, wherein said labels are fluorescent
labels.
132. The method of claim 86, wherein the 5' terminal base of said
first region of the target strand region abuts the 5' terminal base
of said first region of the target-complementary strand region.
133. The method of claim 86, wherein the 5' terminal base of said
first region of the target strand region is separated from the 5'
terminal base of said first region of the target-complementary
strand region by at least one nucleotide base.
134. The method of claim 86, wherein said reacting further includes
providing a second probe pair which is complementary to a second
target polynucleotide strand region, the second probe pair
comprising (i) a third polynucleotide probe containing a sequence
that is complementary to a first target region in the second target
strand region and (ii) a fourth polynucleotide probe comprising a
sequence that is complementary to a second target region in the
second target strand region, wherein the second region is located
5' to the first region and overlaps the first region by at least
one nucleotide base, under conditions effective for the third and
fourth probes to hybridize to the first and second regions in the
second target strand region, respectively, forming a third
hybridization complex if the second said target-complementary
strand region is present in the sample.
135. The method of claim 86, wherein the method further comprises
reacting a sample with a plurality of different probe pairs which
are each designed to detect a different target polynucleotide
sequence which may be present in the sample.
136. The method of claim 135, wherein said detecting comprises
detecting at least one ligated strand produced by each different
probe pair when the corresponding target sequence is present.
137. The method of claim 136, wherein ligated strands from
different probe pairs are detected by mass spectrometry.
138. The method of claim 136, wherein ligated strands from
different probe pairs are detected by electrophoresis.
139. The method of claim 138, wherein ligated strands from
different probe pairs have different electrophoretic
mobilities.
140. The method of claim 139, wherein ligated strands from
different probe pairs contain detectable labels which may be the
same or different.
141. The method of claim 140, wherein the labels are fluorescent
labels.
142. The method of claim 138, wherein ligated strands from at least
two different probe pairs contain different fluorescent labels.
143. The method of claim 135, wherein prior to step (a), the first
probe or the second probe from one or more different probe pairs is
immobilized on a distinct solid support region.
144. The method of claim 135, wherein the first probe or the second
probe in each probe pair contains a distinct polynucleotide tag
that identifies that probe pair.
145. The method of claim 144, which comprises hybridizing species
containing said tags to a plurality of corresponding tag
complements which are immobilized on distinct solid support
regions.
146. The method of claim 145, wherein each distinct polynucleotide
tag is attached to the 5' end of the first probe in each different
probe pair.
147. The method of claim 145, wherein each distinct polynucleotide
tag is attached to the 3' end of the second probe in each different
probe pair.
148. The method of claim 145, wherein said distinct solid support
regions are located on a substantially planar surface.
149. The method of claim 145, wherein said distinct solid support
regions are located on different beads.
150. The method of claim 135, wherein for each probe pair, said
cleaving produces a second fragment from the second probe of the
probe pair which does not associate with the third hybridization
complex, and the method further includes detecting the second
fragment.
151. The method of claim 150, wherein second fragments from
different probe pairs are detected by mass spectrometry.
152. The method of claim 150, wherein second fragments from
different probe pairs are detected by electrophoresis.
153. The method of claim 152, wherein second fragments from
different probe pairs have different electrophoretic
mobilities.
154. The method of claim 152, wherein second fragments from
different probe pairs contain detectable labels which may be the
same or different.
155. The method of claim 154, wherein the labels are fluorescent
labels.
156. The method of claim 150, wherein second fragments from at
least two different probe pairs contain different fluorescent
labels.
157. The method of claim 150, wherein the second fragment from each
different probe pair contains a distinct polynucleotide tag that
identifies the probe pair.
158. The method of claim 157, which comprises hybridizing second
fragments containing said tags to a plurality of corresponding tag
complements which are immobilized on distinct solid support
regions.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of pending application Ser.
No. 09/898,323, filed Jul. 3, 2001, which claims the benefit of
priority of U.S. provisional application Serial No. 60/216,514,
filed Jul. 3, 2000, both of which are incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to methods for detecting or
quantifying one or more polynucleotide sequences in one or more
samples, and to reagents and kits for use therein.
REFERENCES
[0003] Albretsen et al., Anal. Biochem. 189:40 (1990).
[0004] Ausubel et al., eds., Current Protocols in Molecular Biology
Vol. 1, Chapter 2, Section I, John Wiley & Sons, New York
(1993).
[0005] Barany et al., PCT Application No. PCT/US91/06103.
[0006] Barrett, R. W., et al., U.S. Pat. No. 5,482,867 (1996).
[0007] Beaucage and Iyer, Tetrahedron 48:2223-2311 (1992).
[0008] Bergot et al., PCT Application No. PCT/US90/05565 (WO
91/07507).
[0009] Boom et al., U.S. Pat. No. 5,234,809.
[0010] Brenner, PCT Publications No. WO 96/12014 and WO
96/41011.
[0011] Breslauer et al., Proc. Natl. Acad. Sci. 83:3746-3750
(1986).
[0012] Cantor et al, U.S. Pat. No. 5,482,836.
[0013] Dieffenbach et al., in PCR Primer: A Laboratory Manual,
Dieffenbach and Dveksler, eds., pp. 133-142, CSHL Press, New York
(1995).
[0014] Drmanac, R., et al., Electrophoresis 13:566 (1992).
[0015] Drmanac, R., et al., Science 260:1649 (1993).
[0016] Eckstein, F., Oligonucleotides and Analogs: A Practical
Approach, Chapters 8 and 9, IRL Press, Oxford, GB (1991).
[0017] Fodor, S. P. A., et al., Science 251:767 (1991).
[0018] Fodor, S. P. A., et al., U.S. Pat. No. 5,445,934 (1995).
[0019] Fung et al, U.S. Pat. No. 4,757,141.
[0020] Gait, M. J., ed., Oligonucleotide Synthesis: A Practical
Approach, IRL Press, Oxford, (1984 and 1990 editions).
[0021] Grossman, P. D., and Colburn, J. C., eds., Capillary
Electrophoresis: Theory and Practice, Academic Press, Inc., New
York (1992).
[0022] Haugland, Handbook of Fluorescent Probes and Research
Chemicals, Molecular Probes, Inc., Eugene, Oreg. (1992).
[0023] Hobbs, Jr., et al., U.S. Pat. No. 5,151,507.
[0024] Hunziker, J., et al., "Nucleic Acid Analogues: Synthesis and
Properties" in Modern Synth. Methods 7:331-417 (1995, ISSN
0176-7615).
[0025] Ji et al., Anal. Chem. 65:1323-1328 (1993).
[0026] Johnston, R. F., et al., Electrophoresis 11:355 (1990).
[0027] Keller and Manak, DNA Probes, 2nd Ed., Stockton Press, New
York (1993).
[0028] Khrapko, K. R., et al., DNA Sequencing 1:375 (1991).
[0029] Knudsen, H., et al., Nucleic Acids Res. 24:494-500
(1996).
[0030] Kricka, L. J., ed., Nonisotopic DNA Probe Techniques,
Academic Press, Inc., New York (1992).
[0031] Kornberg and Baker, DNA Replication, 2nd Ed., W. H. Freeman,
San Francisco, Calif. (1992).
[0032] Mathies, R. A., et al., U.S. Pat. No. 5,091,652 (1992).
[0033] Matthews et al, Anal. Biochem. 169:1-25 (1988).
[0034] Menchen et al., PCT Publication No. WO 94/05688 (1994).
[0035] Menchen et al., U.S. Pat. No. 5,188,934.
[0036] Miller et al., Nucleic Acids Res. 16(3):9-10 (1988).
[0037] Montpetit et al., J. Virol. Methods 36:119-128 (1992).
[0038] Mullis et al., eds, The Polymerase Chain Reaction,
BirkHauser, Boston, Mass. (1994).
[0039] Osborne, CABIOS 8:83 (1991).
[0040] Pirrung et al., U.S. Pat. No. 5,143,854.
[0041] Ploem, J. S., in Fluorescent and Luminescent Probes for
Biological Activity, Mason, T. W., Ed., Academic Press, London, pp.
1-11 (1993).
[0042] Pon et al., Biotechniques 6:768-775 (1988).
[0043] Rosenblum et al., Nucl. Acids Res. 25:4500-4504 (1997).
[0044] Rychlik et al., Nucleic Acids Res. 17:8543-8551 (1989) and
18:6409-6412 (1990).
[0045] Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
Edition, Cold Spring Harbor Laboratory, New York (1989).
[0046] Scheit, Nucleotide Analogs, John Wiley Pub., New York
(1980).
[0047] Schena, M., et al., Science 270:467 (1995).
[0048] Shalon, D., Ph.D. Dissertation, Falconer Library, Stanford
University, California (1995).
[0049] Shoemaker et al., European Pub. No.EP 799,897 A1 (1997).
[0050] Taylor, J. S., Nucl. Acids Res. 13:8749 (1985).
[0051] Uhlman and Peyman, Chem. Rev. 90:543-584 (1990).
[0052] Walsh et al., Biotechniques 10(4): 506-513 (1991).
[0053] Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227-259
(1991).
[0054] Yershov, G., et al., Proc. Natl. Acad. Sci. 93:4913
(1996).
[0055] Introduction
[0056] Methods for detection and analysis of target nucleic acids
have found wide utility in basic research, clinical diagnostics,
forensics, and other areas. One important use is in the area of
genetic polymorphism. Genetic polymorphisms generally concern the
genetic sequence variations that exist among homologous loci from
different members of a species. Genetic polymorphisms can arise
through the mutation of genetic loci by a variety of processes,
such as errors in DNA replication or repair, genetic recombination,
spontaneous mutations, transpositions, etc. Such mutations can
result in single or multiple base substitutions, deletions, or
insertions, as well as transpositions, duplications, etc.
[0057] Single base substitutions (transitions and transversions)
within gene sequences can cause missense mutations and nonsense
mutations. In missense mutations, an amino acid residue is replaced
by a different amino acid residue, whereas in nonsense mutations,
stop codons are created that lead to truncated polypeptide
products. Mutations that occur within signal sequences, e.g., for
directing exon/intron splicing of mRNAs, can produce defective
splice variants with dramatically altered protein sequences.
Deletions, insertions, and other mutations can also cause
frameshifts in which contiguous residues encoded downstream of the
mutation are replaced with entirely different amino acid residues.
Mutations outside of exons can interfere with gene expression and
other processes.
[0058] Genetic mutations underlie many disease states and
disorders. Some diseases have been traced directly to single point
mutations in genomic sequences (e.g., the A to T mutation
associated with sickle cell anemia), while others have been
correlated with large numbers of different possible polymorphisms
located in the same or different genetic loci (e.g., cystic
fibrosis). Mutations within the same genetic locus can produce
different diseases (e.g., hemoglobinopathies). In other cases, the
presence of a mutation may indicate susceptibility to particular
condition for a disease but is insufficient to reliably predict the
occurrence of the disease with certainty. Most known mutations have
been localized to gene-coding sequences, splice signals, and
regulatory sequences. However, it is expected that mutations in
other types of sequences can also lead to deleterious, or sometimes
beneficial, effects.
[0059] The large number of potential genetic polymorphisms poses a
significant challenge to the development of methods for identifying
and characterizing nucleic acid samples and for diagnosing and
predicting disease. In other applications, it is desirable to
detect the presence of pathogens or exogenous nucleic acids and to
detect or quantify RNA transcipt levels.
[0060] In light of the increasing amount of sequence data that is
becoming available for various organisms, and particularly for
higher organisms such as humans, there is a need for rapid and
convenient methods for determining the presence or absence of
target mutations. Ideally, such a method should have high
sensitivity, accuracy, and reproducibility. Also, the method should
allow simultaneous detection of multiple target sequences in a
single reaction mixture.
SUMMARY OF THE INVENTION
[0061] In one aspect, the invention includes a method for detecting
a target polynucleotide sequence. In the method, a target
polynucleotide strand region and a target-complementary strand
region are reacted with a first probe pair and a second probe pair
under conditions effective for the first probe pair to hybridize to
the first and second regions in the target strand region, forming a
first hybridization complex, and for the second probe pair to
hybridize to the first and second regions in the
target-complementary strand region, forming a second hybridization
complex. In one embodiment, the first probe pair comprises (i) a
first polynucleotide probe containing a sequence that is
complementary to a first target region in the target strand region
and (ii) a second polynucleotide probe comprising a sequence that
is complementary to a second target region in the target strand
region, wherein the second region is located 5' to the first region
and overlaps the first region by at least one nucleotide base, and
the second probe pair may comprise (i) a third polynucleotide probe
containing a sequence that is complementary to a first region in
the target-complementary strand region and (ii) a fourth
polynucleotide probe containing a sequence that is complementary to
a second region in the target-complementary strand region, wherein
the second region is located 5' to the first region and overlaps
the first region by at least one nucleotide base.
[0062] Following hybridization, the second probe in the first
hybridization complex and the fourth probe in the second
hybridization complex can be cleaved to form (i) a third
hybridization complex comprising the target strand region, the
first probe, and a first fragment of the second probe having a 5'
terminal nucleotide located immediately contiguous to a 3' terminal
nucleotide of the first probe, and (ii) a fourth hybridization
complex comprising the target-complementary strand region, the
third probe, and a first fragment of the fourth probe having a 5'
terminal nucleotide located immediately contiguous to a 3' terminal
nucleotide of the third probe. The first probe may then be ligated
to the hybridized fragment of the second probe to form a first
ligated strand hybridized to the target strand region, and the
third probe can be ligated to the fragment of the fourth probe to
form a second ligated strand hybridized to the target-complementary
strand region.
[0063] Denaturation of the first ligated strand from the target
strand region, and of the second ligated strand from the
target-complementary strand region, provides single stranded
templates that can be hybridized to unreacted first and second
probe pairs for additional probe cleavage and ligation, thereby
increasing the amount of ligated probes. The occurrence of
template-dependent ligation is evidence that the target sequence
(or its complement) is present in a sample.
[0064] In one embodiment, the first region in the target strand
region overlaps the second region in the target strand region by a
single nucleotide base, and/or the first region in the
target-complementary strand region overlaps the second region in
the target-complementary strand region by a single nucleotide base.
In another embodiment, the first region in the target strand region
overlaps the second region in the target strand region by two
nucleotide bases, and/or the first region in the
target-complementary strand region overlaps the second region in
the target-complementary strand region by two nucleotide bases.
[0065] In another embodiment, the 5' ends of the first and third
probes terminate with a group other than a nucleotide 5' phosphate
group, such as a nucleotide 5' hydroxyl group. In another
embodiment, the 5' ends of the second and fourth probes terminate
with a group other than a nucleotide 5' phosphate group. In another
embodiment, the 5' ends of the first, second, third and fourth
probes terminate with a group other than a nucleotide 5' phosphate
group.
[0066] In another embodiment, the 3' ends of the second and fourth
probes terminate with a group other than a nucleotide 3' hydroxyl
group, such as a nucleotide 3' phosphate group. In another
embodiment, the 3' ends of the second and fourth probes terminate
with a group other than a nucleotide 3' phosphate group. In another
embodiment, the 3' ends of the first, second, third and fourth
probes terminate with a group other than a nucleotide 3' phosphate
group.
[0067] In one embodiment, the first, second, third and fourth
probes are provided as covalently separate entities. In another
embodiment, the first probe pair comprises a first probe and a
second probe in covalently linked form, such that the first probe
is covalently linked by its 5' end to the 3' end of the second
probe by a linking moiety. Similarly, the second probe pair may
comprise a third probe and a fourth probe in covalently linked
form, such that the third probe is covalently linked by its 5' end
to the 3' end of the fourth probe by a linking moiety.
[0068] In another embodiment, at least one of the probes contains a
detectable label. For example, at least one of the first probe or
the third probe may contain a detectable label. Similarly, at least
one of the second probe and the fourth probe may contain a
detectable label. Preferably, the label is a non-radioactive label,
and more preferably is a fluorescent label, although any suitable
label can be used.
[0069] In practicing the present invention, any method may be
employed to detect or measure probe ligation. In one embodiment,
probe cleavage produces a second fragment from the second probe
which does not associate with the third hybridization complex.
Detection or measurement of the second fragment, directly or
indirectly, is an indication that the target sequence is present.
An increased amount of the second fragment in a reaction mixture
can also be used to measure the extent of probe ligation in prior
cycles of cleavage and ligation. Similarly, cleavage of the fourth
probe can produce a fourth fragment which does not associate with
the fourth hybridization complex. Detection or measurement of the
fourth fragment, or of both the second and fourth fragments,
directly or indirectly, can indicate that the target sequence is
present.
[0070] In one embodiment, at least one of the second probe and the
fourth probe contains both (i) a fluorescent dye and (ii) a
quencher dye which is capable of quenching fluorescence emission
from the fluorescent dye when the fluorescent dye is subjected to
fluorescence excitation energy, and said cleaving severs a covalent
linkage between the fluorescent dye and the quencher dye in the
second probe and/or fourth probe, thereby increasing an observable
fluorescence signal from the fluorescent dye.
[0071] In one embodiment, the second fragment is immobilized on a
solid support for detection. In other embodiments, the second
fragment is detected using electrophoresis or mass
spectrometry.
[0072] The second fragment may be detected at any suitable time,
such as continuously, or after a selected period of time, or after
a selected number of cycles.
[0073] In another embodiment, the first ligated strand, the second
ligated strand, or both, are measured after at least one cycle. For
example, ligated strands can be immobilized on a solid support for
detection, or can be detected using electrophoresis or mass
spectrometry. In one embodiment, each detected ligated strand
contains a fluorescent label.
[0074] In yet another embodiment, the reacting step further
comprises providing a fifth polynucleotide probe which is
complementary to a sequence variant of a sequence region to which
either the first probe, second probe, third probe, or fourth probe
is complementary. For example, the fifth polynucleotide probe and
the first polynucleotide probe can be complementary to alternative
polymorphic sequences. In one preferred embodiment, the fifth
polynucleotide probe and the first polynucleotide probe contain
different 3' terminal nucleotides that are complementary to
alternative target nucleotide bases. Furthermore, the first and
fifth polynucleotide probes may contain first and second detectable
labels that are distinguishable from each other. Alternatively, the
fifth and second polynucleotide probes can be complementary to
alternative polymorphic sequences.
[0075] The first and second probe sets can be designed so that
cleavage produces cleaved probes having flush abutting ends or
staggered abutting ends. For example, to produce flush abutting
ends, the first and third probes may be designed so that the 5'
terminal base of the first region of the target strand region abuts
the 5' terminal base of said first region of the
target-complementary strand region. Alternatively, staggered ends
can be produced when the 5' terminal base of the first region of
the target strand region is separated by one or more bases from the
5' terminal base of the first region of the target-complementary
strand region.
[0076] In yet another embodiment, the first and second probe pairs
taken together constitute a first probe set, and the method further
comprises reacting a sample with a plurality of different probe
sets which are each designed to detect a different target
polynucleotide sequence which may be present in the sample. In one
embodiment, the method includes detecting at least one ligated
strand produced by each different probe set when the corresponding
target sequence is present. In one embodiment, ligated strands from
different probe sets are detected by mass spectrometry. In another
embodiment, ligated strands from different probe sets are detected
by electrophoresis, based on distinct labels or electrophoretic
mobilities, for example.
[0077] The first, second, third, or fourth probe in each probe set
can be immobilized on distinct solid support regions. For example,
prior to the reacting step, a probe from each set is immobilized on
a distinct solid support region. In one embodiment, a probe in each
probe set contains a distinct polynucleotide tag that identifies
that probe set. These tags can be used to immobilize the probes to
distinct solid support regions before, during, or preferably after
cycles of cleavage and ligation, to facilitate detection of
different target sequences. Such tags can be attached via any
suitable position in the probes, such as the 5' end of the first
probe in each different probe set, or the 3' end of the second
probe in each different probe set, for example.
[0078] In another embodiment, for each probe set, the cleaving step
releases a second fragment from the second probe of each probe set,
and the method further includes detecting a second fragment for
each target that is present. In one embodiment, the second
fragments from different probe sets are detected by mass
spectrometry. In another embodiment, second fragments are detected
by electrophoresis, based on distinct labels, distinct
electrophoretic mobilities, or both.
[0079] In another embodiment, a second fragment from each probe set
contains a distinct polynucleotide tag that identifies that probe
set. The tags can be used to immobilize the probes to distinct
solid support regions, as above.
[0080] In another aspect, the methods described herein are modified
so that the second probe pair is omitted, and one or more cycles of
probe hybridization, cleavage, and ligation produce ligated strands
at a rate that is linearly proportional to the number of
cycles.
[0081] For example, the invention also includes a method for
detecting a target polynucleotide sequence, comprising (a) reacting
a target polynucleotide strand region with a first probe pair of
the type described above, under conditions effective for the first
and second probes in the probe pair to hybridize to the first and
second regions in the target strand region, respectively, forming a
first hybridization complex, (b) cleaving the second probe in the
first hybridization complex to form (i) a second hybridization
complex comprising the target strand region, the first probe, and a
first fragment of the second probe having a 5' terminal nucleotide
located immediately contiguous to a 3' terminal nucleotide of the
first probe, (c) ligating the first probe to the hybridized
fragment of the second probe to form a first ligated strand
hybridized to the target strand region, (d) denaturing the first
ligated strand from the target strand region, and (e) performing
one or more additional cycles of steps (a) through (d), with the
proviso that in the last cycle, step (d) is optionally omitted.
[0082] Kits and various assay components and reagents are also
contemplated as discussed further herein. These and other features
and advantages of the invention will become more readily apparent
in light of the detailed description herein.
DETAILED DESCRIPTION
[0083] The present invention provides methods for detecting or
quantifying one or more selected target polynucleotide sequences in
a sample. The invention is highly accurate, permitting detection of
target sequences with high specificity, and highly sensitive,
allowing detection and/or quantitation of small amounts of target
sequences. The invention is also advantageous for genotyping and
detection of genetic polymorphisms.
[0084] Definitions
[0085] The following terms or phrases are intended to have the
meanings below unless indicated otherwise.
[0086] "Nucleoside" refers to a compound containing a base-pairing
moiety (also referred to as a "base") such as a purine,
deazapurine, or pyrimidine nucleoside base, e.g., adenine, guanine,
cytosine, uracil, thymine, deazaadenine, deazaguanosine, inosine,
or any functional equivalent thereof, which is attached to a
backbone moiety such as a sugar ring or any functional equivalent
thereof. Nucleosides include naturally occurring nucleosides which
contain a base-pairing moiety (A, C, G, T or U) linked to the
1'-carbon of a pentose ring, 2'-deoxy and 2'-hydroxyl forms thereof
(e.g., see Kornberg, 1992), and also pentose analogs and ring-open
equivalents thereof (e.g., see Scheit, 1980; Uhlmann et al.,
1990).
[0087] The term "nucleotide" as used herein refers to a phosphate
ester of a nucleoside, e.g., a triphosphate ester, wherein the most
common site of esterification is the pentose 5'-hydroxyl group. In
certain cases, term "nucleoside" refers both nucleosides and
nucleotides, for convenience. The terms nucleotide and nucleoside
as used herein are intended to include synthetic analogs having
modified nucleoside base moieties, modified sugar moieties, and/or
modified phosphate groups and phosphate ester moieties, e.g., as
described elsewhere (Scheit 1980; Eckstein, 1991).
[0088] "Polynucleotide" and "oligonucleotide" are interchangeable
for purposes of this text and refer to a polymer of nucleoside
monomers, including single, double and triple stranded
deoxyribonucleotides, ribonucleotides, .alpha.-anomeric forms
thereof, and the like. Usually the nucleoside monomers are linked
by phosphodiester linkages, such that "phosphodiester linkage"
refers to a phosphate ester bond or analog thereof wherein the
phosphorous atom is in the +5 formal oxidation state and one or
more of the oxygen atoms is replaced with a non-oxygen moiety.
Exemplary phosphate analogs include phosphorothioate,
phosphorodithioate, phosphoroselenoate, phosphorodiselenoate,
phosphoroanilothioate, phosphoranilidate, phosphoramidate,
boronophosphates, and the like, including associated counterions,
e.g., H.sup.+, NH.sub.4.sup.+, Na.sup.+, and the like, if such
counterions are present. "Polynucleotides" and "oligonucleotide"
also include polymers of non-nucleotidic monomers, linked by
phosphate ester or other linkages, which are capable of forming
sequence-specific hybrids with a target nucleic acid, e.g., peptide
nucleic acids (PNAs, e.g., see Knudsen, 1996). Chimeric structures
containing more than one type of linkage and/or nucleotide subunit
are also contemplated. Polynucleotides typically range in size from
a few monomeric units, e.g. 8-40, to hundreds or thousands of
monomeric units. Whenever a polynucleotide is represented by a
sequence of letters, such as "ATGCCTG," it will be understood that
the nucleotides are in 5' to 3' order from left to right and that
"A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, unless otherwise
noted.
[0089] "Polynucleotide probe" refers to any moiety that can
hybridize, via hydrogen binding, to a target nucleic acid sequence
with sequence specificity that is suitable for the purposes of the
present invention.
[0090] "Target-specific polynucleotide" refers to a polynucleotide
having a target-binding segment that is perfectly or substantially
complementary to a target sequence, such that the polynucleotide
binds specifically to an intended target without significant
binding to non-target sequences under sufficiently stringent
hybridization conditions.
[0091] "Label" means any moiety that, when attached to a nucleotide
or polynucleotide, renders such nucleotide or polynucleotide
detectable using known detection methods.
[0092] "Diagnosis" is intended to encompass diagnostic, prognostic,
and screening methods.
[0093] "Ligation-incompetent" refers to an entity that, under
particular conditions, is incapable of undergoing
template-dependent ligation by a ligation enzyme.
[0094] "Ligation-blocked" refers to an entity that is chemically
incapable of undergoing ligation under any conditions until a
blocking group is removed.
[0095] Samples
[0096] The target nucleic acids for use with the invention may be
derived from any organism or other source, including but not
limited to prokaryotes, eukaryotes, plants, animals, and viruses,
as well as synthetic nucleic acids, for example. The target nucleic
acids may originate from any of a wide variety of sample types,
such as cell nuclei (e.g., genomic DNA), whole cells, tissue
samples, phage, plasmids, mitrochondria, and the like. The target
nucleic acids may contain DNA, RNA, and/or variants or
modifications thereof.
[0097] Many methods are available for the isolation and
purification of target nucleic acids for use in the present
invention. Preferably, the target nucleic acids are sufficiently
free of proteins and any other interfering substances to allow
adequate target-specific probe annealing, cleavage, and ligation.
Exemplary purification methods include (i) organic extraction
followed by ethanol precipitation, e.g., using a phenol/chloroform
organic reagent (Ausubel), preferably with an automated DNA
extractor, e.g., a Model 341 DNA Extractor available from PE
Applied Biosystems (Foster City, Calif.); (ii) solid phase
adsorption methods (Walsh, 1991; Boom); and (iii) salt-induced DNA
precipitation methods (Miller), such methods being typically
referred to as "salting-out" methods. Optimally, each of the above
purification methods is preceded by an enzyme digestion step to
help eliminate protein from the sample, e.g., digestion with
proteinase K, or other proteases.
[0098] To facilitate detection, the target nucleic acid can be
amplified using a suitable amplification procedure prior to
conducting the hybridization, cleavage, and ligation steps of the
present invention. Such amplification may be linear or exponential.
In a preferred embodiment, amplification of the target nucleic acid
is accomplished using the polymerase chain reaction (PCR) (e.g.,
Mullis et al., 1994). Generally, the PCR consists of an initial
denaturation step which separates the strands of a double stranded
nucleic acid sample, followed by repetition of (i) an annealing
step, which allows amplification primers to anneal specifically to
positions flanking a target sequence; (ii) an extension step which
extends the primers in a 5' to 3' direction thereby forming an
amplicon nucleic acid complementary to the target sequence, and
(iii) a denaturation step which causes the separation of the
amplicon from the target sequence. Each of the above steps may be
conducted at a different temperature, preferably using an automated
thermocycler (PE Applied Biosystems, Foster City, Calif.). If
desired, RNA samples can be converted to DNA/RNA heteroduplexes or
to duplex cDNA by known methods (e.g., Ausubel; Sambrook).
[0099] Method
[0100] The present invention employs probe pairs that are each
designed to hybridize to a complementary target sequence, and which
are capable of undergoing specific cleavage and ligation when
hybridized to the target sequence. The probe pairs are useful, for
example, in linear and exponential probe ligation methods described
herein. Any of a variety of different probe constructs and
configurations can be used, as will be more fully understood from
the following discussion.
[0101] Typically, each probe pair comprises (i) a first
polynucleotide probe containing a sequence that is complementary to
a first target region in the target strand region and (ii) a second
polynucleotide probe comprising a sequence that is complementary to
a second target region in the target strand region. The second
region is located 5' to the first region and overlaps the first
region by at least one nucleotide base. Probes can be prepared by
any suitable method, preferably using an automated DNA synthesizer
and standard chemistries, e.g., phosphoramidite chemistry
(Beaucage; Gait, 1984, 1990).
[0102] In one aspect, the invention includes a method for detecting
a target polynucleotide sequence. In the method, a target
polynucleotide strand region is reacted with a first probe pair
under conditions effective for first and second probes of the probe
pair to hybridize to the first and second regions in the target
strand region, respectively, forming a first hybridization complex.
Following hybridization, the second probe in the first
hybridization complex can be cleaved to form a hybridization
complex comprising the target strand region, the first probe, and a
first fragment of the second probe having a 5' terminal nucleotide
located immediately contiguous to a 3' terminal nucleotide of the
first probe. The first probe may then be ligated to the hybridized
fragment of the second probe to form a first ligated strand
hybridized to the target strand region. After separation of the
first ligated strand from the target strand region by denaturation,
the target strand region in single-stranded form can be hybridized
to a new probe pair for additional probe cleavage and ligation,
thereby increasing the amount of ligated probe. The occurrence of
template-dependent ligation is evidence that the target sequence is
present in a sample.
[0103] In one embodiment, the first region overlaps the second
region by a single nucleotide base. In another embodiment, the
first region overlaps the second region by two nucleotide bases.
The invention also contemplates embodiments in which the first and
second regions overlap by 3, 4, 5, 6, 7, 8, 9, 10 or more
nucleotides.
[0104] An exemplary embodiment is illustrated in Scheme I below,
which shows a single-stranded target strand region (T0) aligned
with first polynucleotide probe (P1) and second polynucleotide
probe (P2) of a first probe pair. The two probes are shown in a 5'
to 3' orientation (left to right), whereas the target is shown in a
3' to 5' orientation. The target strand region, which is the
complement of the human ApoB sequence shown in Example 1, contains
a first region (R1) and an adjacent region (R2) that is located 5'
to the first region. "X" indicates bases that flank the two target
regions and which are not hybridized to the first and second
probes.
1 Scheme Ia P2 5'-ACTGCGAGGTCACTGTGAGTTTTC-3' (SEQ ID NO:5) P1:
5'-AAGAAATTATCTCGGTCCTCACAATAAA-3' (SEQ ID NO:16)
.vertline.<----------R2---------->.vertline.
.vertline.<------------R1------------>.vertline. T0:
3'-XXTTCTTTAATAGAGCCAGGAGTGTTATTTGACGCTCCAGTGACACTCAAAAGXX-5' (SEQ
ID NO:17)
[0105] In Scheme Ia, the first region and second region overlap by
a single base. The first probe consists of 28 contiguous bases that
are complementary to the corresponding bases in region R1. The
first probe preferably contains a 3'-hydroxyl group (--OH). The
second probe consists of 24 contiguous bases that are complementary
to corresponding bases in region R2. When both the first probe and
the second probe are hybridized to the target strand region, the 3'
terminal A base of the first probe is aligned with the 5' terminal
A base of second probe, such that both A bases may compete for
hybridization to the corresponding T base in the target strand
region (in bold type and underlined). In other words, the
target-complementary segments of the first and second probes (which
hybridize to R1 and R2) overlap by one base when they are
hybridized fully to the target sequence.
[0106] Hybridization of the first and second probes to the target
sequence produces a ternary complex can be referred to as a
"displaced strand structure", wherein the overlapping ends of the
hybridized first and second probes can compete for hybridizing to
the same complementary bases in the target strand region. It is
possible that the overlapping ends may exist in an equilibrium
between states wherein (i) the 3' end of the first probe is
hybridized directly to the target strand region, displacing the 5'
end of the second probe, (ii) the 5' end of the second probe is
hybridized directly to the target strand region, displacing the 3'
end of the first probe, (iii) the overlapping ends form a triplex
structure involving Hoogsteen or reverse Hoogsteen basepairing, or
(iv) any other possible equilibrium state(s). This hybridization
complex (1) is ligation-incompetent, meaning that the abutting ends
are not readily ligatable in the presence of a template-dependent
ligase enzyme, due to the absence of abutting, adjacent termini
that are matched to complementary target bases, and (2) is a
substrate for certain 5' nuclease enzymes (referred to herein as 5'
nucleases or 5' nuclease enzymes) which recognize hybrid structures
containing first and second polynucleotide moieties that have
overlapping target-complementary ends when hybridized to a
complementary strand. In the presence of such a 5' nuclease, the
second probe in the complex can be cleaved to form a cleaved
hybridization complex comprising the target strand, the first
probe, and a first fragment of the second probe having a 5'
terminal nucleotide located immediately contiguous to a 3' terminal
nucleotide of the first probe.
[0107] With reference to the complex formed upon hybridization of
the first and second probes with the target strand from Scheme I,
cleavage causes severance of the 5' terminal base from the second
probe, leaving the first probe and a fragment of the second probe
hybridized to the target strand. The resultant complex is
illustrated in Scheme Ib, in which the first probe and the
remaining fragment of the second probe are shown on different lines
to emphasize that their abutting ends are immediately contiguous
with each other but are not covalently linked. The 5'-end of the
remaining fragment from the second probe contains a 5'-phosphate
group due to the action of the 5' nuclease.
2 Scheme Ib P2 5'-CTGCGAGGTCACTGTGAGTTTTC-3' (SEQ ID NO:18) P1:
5'-AAGAAATTATCTCGGTCCTCACAATAAA-3' (SEQ ID NO:16) T0:
3'-XXTTCTTTAATAGAGCCAGGAGTGTTATTTGACGCTCCAGTGACACTCAAAAGXX-5' (SEQ
ID NO:17)
[0108] The hybridization complex in Scheme Ib is ligation-competent
since the abutting ends of the first probe and the fragment of the
second probe have chemical groups (a 3' hydroxyl and a 5'
phosphate) which are amenable to ligation under appropriate
conditions. For example, treatment of the cleaved complex with a
ligase enzyme is effective to produce a ligated strand (LS1)
hybridized to the target strand, as illustrated in Scheme Ic.
3 Scheme Ic LS1:
5'-AAGAAATTATCTCGGTCCTCACAATAAACTGCGAGGTCACTGTGAGTTTTC-3' (SEQ ID
NO:19) T0: 3'-XXTTCTTTAATAGAGCCAGGAGTGTTATTTGACGCTCCAGTGACACTCAA-
AAGXX-5' (SEQ ID NO:17)
[0109] Following denaturation of the ligated strand from the target
strand, the target strand can be hybridized to a new probe pair,
and probe cleavage and ligation can be repeated to form another
ligated strand. Formation of such ligated strands indicates that
the target sequence is present in the sample.
[0110] Schemes Ia to Ic illustrate a process that can be carried
out to convert multiple copies of a probe pair (which is present in
excess relative to the amount of the target strand) into ligated
strands at a linear rate that depends on the duration of each cycle
of hybridization, cleavage, ligation, and denaturation.
[0111] In a further embodiment, exponential production of ligated
strands can be achieved using first and second probe pairs which
are targeted to a target strand region and a complement of the
target strand region, respectively. An example of such an
embodiment is illustrated below with reference to Schemes
IIa-IId.
[0112] Scheme IIa shows a partial duplex sequence for an "A allele"
of the gene for human ligase I ("AHL", for A allele of human ligase
I), aligned with complementary first and second probe pairs. The
probes (Ap1 and Ap2) of the first probe pair are complementary to
first and second regions (R1 and R2) of the target strand region
T1. The first and second probes (Ap3 and Ap4) of the second probe
pair are complementary to first and second regions (R3 and R4) in
the complementary target strand region T2.
4Scheme IIa Ap1: 5'-AaCCTCACAGAGGCTGAAGTGGCA-3' (SEQ ID NO:8) Ap2:
5'-aAACAGAGAAGGAAGGAGAAGACGG-3' (SEQ ID NO:9)
.vertline.<---------R1--------->.vertline.
.vertline.<----------R2---------->.vertline. T1
3'-TTTCGGAGTGTCTCCGACTTCACCGe,uns TTGTCTCTTCCTTCCTCTTCTGCCCC-5'
(SEQ ID NO:20) T2: 5'-AAAGCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGA-
AGACGGGG-3' (SEQ ID NO: 2) .vertline.<---------R4---------
->.vertline. .vertline.<----------
-R3---------->.vertline. Ap3: 3'-TTGTCTCTTCCTTCCTCTTCTGCCaa-5'
(SEQ ID NO:10) Ap4: 3'-GGAGTGTCTCCGACTTCACCGTa- 5' (SEQ ID
NO:11)
[0113] The first probe (Ap1) of the first probe pair contains 24
nucleotides. The 5' terminal base of Ap1 is matched with respect to
a corresponding T base in the target. The second base from the 5'
end of Ap1 is mismatched with respect to a C base in T1. Bases 3 to
24 in Ap1 constitute a sequence of 22 contiguous
target-complementary bases with respect to strand region T1. The
second probe (Ap2) contains 25 nucleotides, of which the
5'-terminal A base is mismatched with respect to a corresponding G
base in strand region T1, and the remaining bases constitute a
sequence of 24 contiguous matching bases with respect to T1. Thus,
the target regions (R1 and R2) to which the first probe pair binds
are 22 and 24 nucleotides in length, respectively, and overlap by a
single base.
[0114] With reference to the second probe pair, the first probe
(Ap3) contains 26 nucleotides, of which the first two bases at the
5' end are mismatched with respect to two G bases in target strand
region T2 (the human ligase I encoding strand region, which is
complementary to target strand region T1), and the remaining bases
are complementary to corresponding bases in T2. The second probe
(Ap4) contains 23 nucleotides, of which the 5'-terminal base is
mismatched with respect to a corresponding A base in T2, and the
remaining bases are complementary to corresponding bases in T2.
Thus, the target regions (R3 and R4) the first and second regions
in strand region T2 are 24 and 22 nucleotides in length,
respectively, and the two regions overlap by a single base.
[0115] It will be appreciated that in many situations, designation
of the two strands of a duplex target as a "target strand" and
"complement of the target strand" will be an arbitrary choice, so
that reversal of these designations may also be appropriate. For
example, a gene-coding strand can be designated as a "target
strand" or as a "complement of a target strand", depending on the
preference of the user. Alternatively, both strands of a target
duplex can be referred to as "target strands".
[0116] Also, when multiple probe pairs are used to detect a
multiple possible target sequences in a sample, it will be
appreciated that the different target sequences may be present in
the same target strand (i.e., in the sample chromosome or same
restriction fragment) or may be present in different strands. For
this reason, the phrase "target polynucleotide strand region" or
"target strand region" is used to refer to a target sequence
regardless of whether two different target sequences are present in
the same strand.
[0117] When both probes of the first probe pair are hybridized to
strand region T1, the 3' terminal A base of the first probe is
aligned with an overlapping A base at the 5' end of the
target-complementary region of the second probe, such that these
two overlapping bases may compete for hybridization to the
corresponding target T base (in bold type with underlining) in
strand region T1. Similarly, when both probes of the second probe
pair are hybridized to strand region T2, the 3' terminal T base of
the first probe is aligned with an overlapping T base at the 5' end
of the target-complementary region of the second probe, such that
these two overlapping bases may compete for hybridization to the
corresponding target A base (in bold type with underlining) in
strand region T2.
[0118] Hybridization of each probe pair to a complementary sequence
in T1 or T2 produces a hybridization complex that is (1)
ligation-incompetent, and (2) a substrate for certain 5' nucleases
as discussed herein. Prior to hybridization, a duplex target should
be denatured to separate the complementary strands of the target,
followed by annealing of the separated strands with their
complementary probe pairs. The presence of an excess of each probe
pair favors formation of probe-target complexes and helps minimize
reformation of the target duplex. Resultant complexes are
illustrated in Scheme IIb.
5 Scheme IIb Ap1: 5'-AaCCTCACAGAGGCTGAAGTGGCA-3' (SEQ ID NO:8) Ap2:
5'-ACAGAGAAGGAAGGAGAAGACGG-3' (SEQ ID NO:21) T1
3'-TTTCGGAGTGTCTCCGACTTCACCGTTGTCTCTTCCTTCCTCTTCTGCCCC-5' (SEQ ID
NO:20) and Ap3: 3'-TTGTCTCTTCCTTCCTCTTCTGCCaa-5' (SEQ ID NO:10)
Ap4: 3'-GGAGTGTCTCCGACTTCACCG-5' (SEQ ID NO:22) T2:
5'-AAAGCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGAAGACGGGG-3' (SEQ ID
NO:2)
[0119] In each complex, the first probe and the remaining fragment
of the second probe have abutting ends that are immediately
contiguous with each other but are not yet covalently linked. The
5'-end of the remaining fragment from the second probe contains a
5'-phosphate group due to the action of the 5' nuclease enzyme.
Each hybridization complex in Scheme IIb is ligation-competent
since the abutting ends of the first probe and the fragment of the
second probe have chemical groups (a 3' hydroxyl and a 5'
phosphate) which are amenable to ligation under appropriate
conditions. Ligation of the abutting ends in each complex produces
a ligated strand (LS 11 or LS 12) hybridized to the target strand
region, as illustrated in Scheme IIc.
6 Scheme IIc LS11:
5'-AaCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGAAGACGG-3' (SEQ ID
NO:23) T1 3'-TTTCGGAGTGTCTCCGACTTCACCGTTGTCTCTTCCTTCCTCTTCTGCCCC-5'
(SEQ ID NO:20) and LS12:
3'-GGAGTGTCTCCGACTTCACCGTTGTCTCTTCCTTCCTCTTCTGCCaa-5' (SEQ ID
NO:24) T2: 5'-AAGCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGAAGACGGGG-3'
(SEQ ID NO:2)
[0120] Following separation of the ligated strand from the target
strand region, the ligated strand and target strand region can each
be hybridized to another first or second probe pair, and the steps
of probe cleavage and ligation can be repeated to form another
ligated strand. After each cycle of hybridization, cleavage,
ligation, and strand separation, the sum of ligated probes is
expected to be equal to C.times.2.sup.N, where C is the initial
amount of the target sequence in the sample, and N is the number of
cycles, assuming 100% yield at each step. The formation of ligated
strands indicates that the target sequence is present in the
sample.
[0121] As more cycles of hybridization, cleavage, ligation, and
strand separation are performed, probe ligation products become the
predominant template for probe hybridization, cleavage, and
ligation, and the product mixture becomes dominated by duplexes
formed from ligation of the first and second probe pairs to form
complementary ligated strands as shown in Scheme IId. Double
underlining indicates the A and T bases derived from the
3'-terminal bases of the first probes in the first and second probe
pairs, respectively.
7Scheme IId LS11: 5'-AaCCTCACAGAGGCTGAAGTGGCAACAGAG-
AAGGAAGGAGAAGACGG-3' (SEQ ID NO:23) LS12:
3'-GGAGTGTCTCCGACTTCACCGTTGTCTCTTCCTTCCTCTTCTGCCaa-5' (SEQ ID
NO:24)
[0122] It will also be appreciated that if a sample initially
contains only a single-stranded target (i.e., there is no
complementary strand), or if the ratio of target to its
complementary strand is less than 1:1, then the first cycle of
probe hybridization, cleavage, and ligation is effective to produce
a ligated strand that contains a contiguous sequence complementary
to the target sequence (target strand region) in the initial target
strand. This ligated, complementary strand can then serve as a
template for binding of a second probe pair to form a ligated
strand that contains a sequence identical to a corresponding
sequence in the initial target strand.
[0123] As noted above, the first and second probes in each probe
pair contain sequences that are complementary to first and second
target regions in the target strand, respectively, such that the
target regions overlap each other by at least one nucleotide base.
The target regions are preferably selected to be within an
invariant target sequence that will be present in the sample if the
target (e.g., a gene, a heterologous target nucleic acid, or a
pathogen nucleic acid) is present in the sample. Thus, the
target-complementary sequence in each probe is usually designed to
be perfectly complementary to its respective target region.
Furthermore, it is preferred that the portions of the probes that
bind the first and second target regions in the vicinity of the
cleavage/ligation site be perfectly complementary to the target
strand region. In other words, hybridization may be successful if a
target-complementary sequence is substantially complementary,
provided that site-specific probe cleavage and subsequent ligation
are not significantly impeded by mismatched bases. However, it may
be desirable to design a first or second probe in a probe pair that
includes a nucleotide base that is deliberately mismatched with
respect to the target, but is located near (e.g., within 2 to 4
bases of) the locus of probe cleavage and ligation (or near a known
polymorphic site), to destabilize probe hybridization with
non-target sequences.
[0124] By way of illustration only, if the 3' base of the first
probe is mismatched with respect to a corresponding base in the
target strand region, cleavage of a hybridized second probe is
possible if the aligned base in the second probe is within a probe
sequence that is complementary to the target. However, the presence
of the 3' mismatch can thereafter inhibit or prevent ligation of
the first probe to the remaining fragment of the second probe. If
the second region of a target strand region contains a base
mutation immediately 5' to the target base to which the 3'-end of
the first probe is complementary, then the mismatch with the second
probe can prevent stable formation of a hybridization complex that
is necessary for site-specific cleavage of the second probe.
[0125] In some situations, a target sequence may be susceptible to
rapid sequence mutation, as in the case of HIV and other pathogenic
organisms. For such situations, the probes should be targeted to a
conserved target region if possible, or at least to a target region
that has a minimum number of potential base variations.
Alternatively, when potential sequence variants are known, several
different probes can be included in the reaction, each targeted to
a different target sequence variant, to ensure that the target
sequence is detected. Similar strategies can be used to detect
allelic variants and single nucleotide polymorphisms (SNPs) as
appropriate.
[0126] It should also be noted that when first and second probe
pairs are used that are complementary to the two complementary
strands of a target duplex (as in Schemes IIa to IId), the two
probe pairs can be designed such that the cleavage sites in the
second probes of each pair are directly aligned with each other, or
are staggered relative to each other. For example, the 3' ends of
the first probes in the first and second probe pairs in Scheme IIa
(Ap1 and Ap3) overlap each other by a single base. Overlaps of more
than one base (e.g., 2, 3, 4, or more bases) are also contemplated.
Similarly, probe pairs can also be designed such that the 3' ends
of the second probes in each pair abut each other (zero overlap),
or are recessed relative to each other to create gaps of one or
more bases between their 3' ends (e.g., gaps of 1, 2, 3, 4, 5 or
more bases). The choice of probe design to achieve a particular
overlap or recess can be optimized for particular experimental
conditions and sample to reduce no-template or non-specific
ligations by adjusting temperature, cycle times, and other
experimental parameters as desired.
[0127] The length of the target-complementary sequence in each
probe is selected to ensure specific hybridization of the probe to
the desired target region, preferably without significant
cross-hybridization to non-target sequences in the sample. One
advantage of using a target-specific probe pair to detect a target
sequence is that both probes must bind to first and second regions
of a target sequence. If only one of the first and second probes is
hybridized to a complementary strand region, then cleavage and
ligation to the other probe does not occur.
[0128] The target complementary sequences of the probes can be of
any length suitable for practice of the invention. In general, the
lengths of the target-complementary sequences in the probes should
be sufficiently long to allow specific detection of the target
sequence, without significant interference from hybridization to
non-target sequences. Typically, the target-complementary sequence
in a probe is at least 8, 10, 15, or 18 nucleotides in length.
Preferred length ranges for the target-complementary sequences are
8 to 40 nucleotides, 10 to 35 nucleotides, 15 to 30 nucleotides,
and 18 to 24 nucleotides. When two probe pairs are used to bind to
the two strands of a target duplex, respectively, or when multiple
probe pairs are used to detect different target sequences, the
melting temperatures of the probes, when hybridized to their
complementary target sequences, preferably fall within a .DELTA.Tm
range (Tmax-Tmin) of 15.degree. C. or less, 10.degree. C. or less,
and preferably 5.degree. C. or less. Probe pairs that have similar
melting temperatures are also advantageous to obtain better
uniformity in hybridization kinetics, so that within-cycle yields
are comparable for different probe pairs.
[0129] Melting temperatures of probes can be calculated using known
methods for predicting oligonucleotide melting temperatures
(Breslauer, 1986; Rychlik, 1989 and 1990; Wetmur, 1991; Osborne,
1991; Montpetit, 1992) for example. Target-complementary probe
sequences between about 18 and 24 bases in length are preferred
because such polynucleotides tend to be very sequence-specific when
the annealing temperature is set within a few degrees of an
oligonucleotide melting temperature (Dieffenbach, 1995). Probe
characteristics can be further optimized by empirical methods, if
desired.
[0130] When a hybridization complex has formed between a probe pair
and a complementary target sequence, cleavage of the second probe
in a target hybridization complex may be accomplished using any
conditions and reagents that are effective to achieve the desired
result. Preferably, cleavage is accomplished using an enzyme from
the FEN (5' flap endonuclease) family of enzymes (also referred to
as 5' nucleases, 5' endonucleases, and 5' exo/endonucleases), or a
multi-enzyme polypeptide having FEN activity. For the following
discussion, polypeptides that contain FEN activity are referred to
collectively as 5' nucleases. Non-polymerase 5' nucleases can be
obtained from E. coli, yeast, mouse, human, Pyrococcus furiosus,
Pyrococcus woesei, Methanococcus jannaschii, and Archaeglobus
fulgidus (e.g., see D. J. Hosfield et al., J. Biol. Chem. 273:27154
(1998); B. Shen et al., Trends Biochem. Sci. 23:171 (1998); PCT
Pub. WO 98/42873; and U.S. Pat. No. 5,874,283 (Harrington et al.)).
Numerous DNA polymerase enzymes have been shown to contain 5'
nuclease activity, including DNA polymerases from Thermus
aquaticus, Thermus flavus, Thermus thermophilus, and Bacillus
stearothermophilus (e.g., see WO 97/27214, WO 98/23774, and WO
98/42873). In many cases, genes for these enzymes have been
introduced into host organisms suitable for expressing large
amounts of enzyme. Also useful are truncated or modified DNA
polymerase polypeptides which can be generated by recombinant or
proteolytic methods, and have (i) reduced polymerase activity (but
retain nuclease activity) and/or (ii) enhanced 5' nuclease
activity, chimeric and fusion polypeptides with 5' nuclease
activity, and 5' nuclease mutants (e.g., see WO 98/42873). A
variety of enzymes having 5' nuclease activity are available from
Third Wave Technologies, Madison, Wis., as well as various academic
laboratories.
[0131] The cleavage and ligation steps described herein can be
performed under any appropriate conditions that provide desired
results. Buffer conditions can be found in references such as
described above with respect to nuclease cleavage, and in
references described below with respect to ligation (see also
Examples 1 and 2 below). Typical buffers include Tris, MOPS,
Tricine, Bicine, MOBS, and other available buffers (e.g., see
Sigma-Aldrich Catalog regarding "Good buffers"). Buffer
concentrations of 5 to 100 mM are typically useful, although higher
or lower concentrations can also be used. Salts and other
additives, such as NaCl, LiCl, KCl, glycerol (e.g., 1-10 volume
percent) and the like can also be included if desired, as well as
appropriate cofactors for the particular enzymes that are used
(e.g., MgCl.sub.2 or MnCl.sub.2 for some nucleases).
[0132] As noted above, cleavage occurs in the second probe at the
internucleotide linkage located immediately 3' of the base that
aligns with the 3' most base of the first probe, when the first and
second probes are hybridized to the correct target sequence. The
cleavage reaction produces a fragment of the second probe that
remains hybridized to the target strand region, and also a second
fragment of the second probe that diffuses from the target strand.
If the first and second target regions in the target strand overlap
by a single base, then the diffusive second fragment contains the
target-complementary base from the second probe that was
immediately 5' of the cleavage site, plus any other groups linked
to that base. If the first and second target regions in the target
strand overlap by four target-complementary bases, for example,
then the diffusive second fragment contains, at its 3' end, the
segment of four target-complementary bases from the second probe
that were immediately 5' to the cleavage site, plus any other
attached groups.
[0133] The cleavage reaction catalyzed by the 5' nuclease enzyme
can be described as being both structure-specific and
sequence-specific. The reaction is structure-specific because the
5' nuclease enzyme specifically cleaves an internucleotide linkage
in the second probe between a first base that is aligned with the
3' terminal base of the first probe and a second base that is 3' to
the first base, regardless of the particular sequences of the first
probe, second probe, and target strand region. The reaction is
sequence-specific because the site of cleavage, relative to the
target sequence, is determined by the target-complementary
sequences of the first and second probes, and also by the length of
overlap between the target-complementary sequences of the
probes.
[0134] Preferably, the 5' nuclease enzyme is a thermostable enzyme
that retains substantially full activity after multiple cycles
(e.g., 30 cycles) of heating and cooling, so that there is no need
to replenish 5' nuclease enzyme during cycling. Such enzymes can be
readily obtained from thermophilic organisms as indicated above. In
an exemplary preferred embodiment, the enzyme retains at least 80%
of initial 5' nuclease activity after thirty cycles of 65.degree.
C. for 1 min. (annealing/cleaving/ligation) and 95.degree. C. for
15 seconds (strand denaturation).
[0135] According to one embodiment, the second probe in a probe
pair contains one or more cleavage-resistant internucleotide
linkages to reduce or prevent cleavage of the probes at linkage
sites other than the intended cleavage site. Such
cleavage-resistant linkages may include phosphorothioates (5' S, 3'
S, or exo S), phosphorodithioates (e.g., di-exo or di-endo),
phosphoramidates (5' to 3' N, 3' to 5' N, or exo-N), O-methyl
phosphonates, and peptide nucleic acid linkages, etc., for example.
Methods for synthesizing such linkages are well known, and are
described, for example, in U.S. Pat. No. 5,837,835 (Gryaznov et
al.), U.S. Pat. No. 5,859,233 (Hirschbein et al.), Hunziker et al.
(1995), and Uhlmann et al. (1990). In one embodiment, the
intersubunit linkages of the target-complementary portion of the
second probe are all cleavage-resistant linkages except for the
linkage that is to be cleaved. However, the occurrence and extent
of probe cleavage at secondary sites (other than the intended
linkage) may be sequence-dependent or, for other reasons, may be
limited to only a few linkages within a probe. These secondary
sites can be identified and characterized by electrophoretic or
other methods, upon which particularly susceptible linkages can be
replaced with cleavage-resistant linkages, while stable linkages
remain as standard phosphodiester linkages.
[0136] It will be appreciated that the effectiveness of a
particular type of linkage may depend on the particular 5' nuclease
that is used. For example, some endonucleases can more readily
cleave exo-S phosphorothioate linkages having Rp chirality than
linkages having Sp chirality (see Taylor et al., 1985). Also, the
presence of one or more PNA linkages close to the target cleavage
site may inhibit enzyme binding, so that such linkages may be most
useful if located at least several (e.g., at least 5) linkages from
the linkage that is to be cleaved. The use and placement of a
particular linkage type within a probe is a matter of design choice
of the user and the requirements of a particular assay.
[0137] After site-specific cleavage of the second probe, the first
probe and remaining fragment of the second probe are ligated to
form a ligated strand. The ligation step is accomplished using any
suitable conditions that are effective to promote covalent ligation
of abutting target-complementary termini of contiguously hybridized
first probe and cleaved second probe. Usually, ligation can be
accomplished enzymically using a ligase enzyme. In a preferred
mode, ligation entails coupling the 3' terminal 3' hydroxyl group
of the first probe to a 5' phosphate group of cleaved second probe,
to produce a ligated strand that is connected by a standard
phosphodiester linkage. However, any other combination of reactive
groups can be used, as long as ligation occurs when the probes are
bound to the intended target sequence.
[0138] Numerous ligase enzymes are known in the art and can be
obtained from a variety of biological and commercial sources.
Exemplary ligases include, but are not limited to, E. coli ligase,
T4 ligase, T. aquaticus ligase, T. Thernophilus ligase, Pfu ligase,
etc. (see, for example, U.S. Pat. No. 5,830,711 (Barany et al.) and
EP Patent 320308 B1 (Backman and Wang). A thermostable ligase is
preferred so that there is no need to replenish ligase activity
during temperature cycling. In an exemplary preferred embodiment,
the enzyme retains at least 80% of initial 5' nuclease activity
after thirty cycles of 65.degree. C. for 1 min.
(annealing/extension) and 95.degree. C. for 15 seconds (strand
denaturation).
[0139] Although it is preferred that ligation is carried out using
a ligase enyzme, chemical (non-enzymic) ligation is also
contemplated. In one embodiment, chemical ligation can be performed
by generating a chemically reactive group at the 5' end of the
remaining fragment of the second probe that is capable of reacting
with a corresponding reactive group at the 3' end of hybridized
first probe. When the 3' base of the first probe is immediately
contiguous with the 5' base of the fragment of the second probe,
and the 3' base and 5' base are hybridized to matching bases in the
target strand region, the two reactive groups form a covalent
linkage due to mutual close proximity. The reaction occurs at the
temperature of the reaction mixture and does not require
illumination with high energy light, although microwave irradiation
can be used to facilitate ligation. For example, the first probe
can be designed to contain a 3' bromoacetyl amino group, and the
second probe can be designed to contain a phosphorothioate linkage
at the site that is to be cleaved. Cleavage of the second probe
produces a 5' thiophosphate group that is immediately contiguous
with the 3' bromoacetyl amino group. Displacement of the bromine by
the sulfur atom of the thiophosphate group produces a
thiophosphorylacylamino linkage between the first probe and the
remaining second fragment of the second probe. The resultant
ligated strand can then be detected or can serve as a template for
hybridization, cleavage, and ligation of a complementary second
probe pair. Guidance for exemplary chemical groups that may be used
for thermal chemical ligation can be found, for example, in U.S.
Pat. No. 5,476,930 (Letsinger and Gryaznov), U.S. Pat. No.
5,741,643 (Gryaznov et al.), and references cited therein. Chemical
ligation by photoexcitation is also contemplated, as described in
EP Patent 324616 B1 (Royer et al.), for example.
[0140] The probe pairs used in the present invention are designed
to be ligation-incompetent when first and second probes are
hybridized to their corresponding first and second target regions,
due to the inability of the two probes to form a nicked duplex
structure with suitably reactive abutting probe ends. A correctly
hybridized probe pair becomes ligation competent only after
site-specific cleavage of the second probe as discussed above.
Generally, the "nicked duplex" that is produced after cleavage is
readily ligated by ligase enzyme (enzymic embodiments) or chemical
coupling (chemical embodiments) because the abutting ends of the
first probe and cleaved second probe are close to each other due to
hybridization to the target strand region. However, incorrect
ligation reactions are also possible due to erroneous probe
cleavage events, template-independent ligation reactions, and
template-dependent reactions resulting from spurious duplex
formation. Such side reactions can be inhibited by providing probes
with ligation blocked ends. For example, since the 5' ends of the
probes in the probe pairs do not participate in target-specific
ligation, they can be rendered "ligation blocked" by providing 5'
end groups that are incapable of ligation under the reaction
conditions of the invention. Thus, in an enzymic ligation
embodiment, the probes can be rendered ligation blocked by
providing a 5' terminal group that is not a nucleotide 5'
phosphate. Such non-ligatable blocking groups can be any of a large
variety of chemical entities, such as 5' deoxy, 5' hydroxy, 5'
N-acetyl, 5' O-trityl, 5' O-monomethoxytrityl, etc. For example,
when first and second probe pairs are used that are complementary
to both strands of a duplex target, the 5' ends of the first and
third probes terminate with a group other than a nucleotide 5'
phosphate group, and/or the 5' ends of the second and fourth probes
terminate with a group other than a nucleotide 5' phosphate group,
such as 5' hydroxyl.
[0141] Similarly, the 3' ends of the second probe in each probe
pair can be rendered ligation-blocked by providing a 3' terminal
group that is not a nucleotide 3' hydroxyl group. Exemplary 3'
blocking groups include 3' deoxy, 3' phosphate, 3' N-acetyl, 3'
O-trityl, 3' O-monomethoxytrityl, etc.
[0142] In another embodiment, the first and second probes of a
probe pair are provided in a covalently linked form, such that the
first probe is covalently linked by its 5' end to the 3' end of the
second probe by a linking moiety. In one embodiment, the linking
moiety comprises a chain of polynucleotides that are not
significantly complementary to the target strand, the probes, or to
any other nucleic acid in the sample. The linking moiety is
sufficiently long to allow the target-complementary sequences in
the probes to hybridize to the target strand region and to form a
viable hybridization complex for cleavage. Typically, the linking
moiety is longer than, preferably at least 10 nucleotides longer
than, the collective length of the first and second target regions.
A polynucleotide linking moiety can contain or consist of any
suitable sequence. For example, the linking moiety can be a
homopolymer of C, T, G or A. Alternatively, the linking moiety can
contain or consist of a non-nucleotidic polymer, such as
polyethylene glycol, a polypeptide such as polyglycine, etc.
[0143] In practicing the present invention, the target
polynucleotide(s) are preferably converted into single-stranded
form by denaturation according to known methods, to increase the
accessibility of target sequences for hybridization with the
complementary probes. Typically, adequate denaturation is
accomplished by heating the sample to an elevated temperature,
e.g., at least 90.degree. C. or at least 95.degree. C., for a
suitable time, usually at least several seconds to several minutes
or longer if necessary, to sufficiently remove inter- and
intra-strand secondary structure that might otherwise interfere
with probe hybridization.
[0144] The target strand regions can then be allowed to anneal to
the complementary probes under conditions effective for the first
and second probes to hybridize to the first and second regions in
the target strand region, respectively, forming a first
hybridization complex, and for third and fourth probes of a second
probe pair (if present) to hybridize to the first and second
regions in the target-complementary strand, respectively, forming a
second hybridization complex.
[0145] Hybridization (probe annealing) is performed under
conditions which are sufficiently stringent to promote sequence
specificity, yet sufficiently permissive to allow formation of
stable hybrids at an acceptable rate. The temperature and length of
time required for probe annealing depend upon several factors
including base composition, length and concentration of the primer,
and the nature of the solvent used, e.g., the concentration of
cosolvents such as DMSO (dimethylsulfoxide), formamide, glycerol,
and counterions such as magnesium. For example, hybridization
(annealing) can be carried out at a temperature that is
approximately 5 to 10.degree. C. below the melting temperature of
the probe-target hybrids in the reaction mixture, although
temperatures outside this range are also contemplated. For example,
even if the reaction temperature is at or above the melting
temperatures of first and second probes, the probes can still
transiently form a duplex with the target that can be correctly
cleaved and ligated. Typically, the annealing temperature is in the
range of 55.degree. C. to 75.degree. C.
[0146] Probes and probe pairs are provided at any concentration
that provides the desired result. Each probe pair is provided in
excess relative to the initial amount of target sequence, and also
in excess relative to the final amount of ligated product that is
expected in the reaction. Annealing is usually complete within a
few seconds or a few minutes. In one embodiment, the reaction
mixture is maintained at a constant temperature which is suitable
for hybridization, site-specific probe cleavage, and ligation.
However, it is also contemplated that the temperature for probe
hybridization can be different from the temperature or temperatures
used for probe cleavage and ligation, or that other temperature
profiles can be used. For example, after an initial hybridization
time period, the temperature can be raised to expedite the cleavage
reaction or ligation reaction, depending on the characteristics of
the probes and of any enzymes that are used. After a sufficient
amount of time, the ligated strands can be denatured by elevated
temperature as above, followed by cooling to allow the target
strand regions and ligated probe products to hybridize to new probe
pairs for another cycle.
[0147] It will be appreciated that due to the presence of excess
probe, the target strand region and the target-complementary strand
region will anneal to the corresponding complementary probe pairs
rather than to each other. Also, as a result of the annealing
conditions, most or all of the excess probes will hybridize to
their probe complements. In other words, the first probe can
hybridize to the third probe, and the second probe can hybridize to
the fourth probe. Under ordinary circumstances, such probe-probe
duplexes do not interfere with the remaining assay steps.
[0148] If the target strand region is initially present in the
sample in single-stranded form (i.e., lacking a complementary
target strand), then in the contacting step of the first cycle, a
hybridization complex will form between the target strand region
and one of the probe pairs (e.g., the first probe pair), while the
other probe pair remains in solution. However, after the first
cycle of cleavage and ligation, a target-complementary strand
region (the ligation product of the first probe and the cleaved
second probe) is available for annealing to the second probe pair
in the next cycle.
[0149] The target sequence or sequences can be detected or
quantified in any appropriate way. Target detection or
quantification can be based on the presence of any species or
complex that either is not present in the reaction mixture unless
the target is present, or is present in an amount greater than the
amount of that species that would otherwise be present in the
absence of the target sequence. By way of example but not
limitation, such detectable species may include:
[0150] 1) A first fragment from the second probe that remains
hybridized to the target strand region after cleavage of the second
probe
[0151] 2) A second fragment from the second probe which does not
associate with the third hybridization complex, and the method
further includes detecting said second fragment.
[0152] 3) A first hybridization complex, a second hybridization
complex, or both, which are formed by hybridization of first and
second probe pairs, respectively, to complementary target strand
regions (or to complementary ligated strands)
[0153] 4) A third hybridization complex, a fourth hybridization
complex, or both, which are formed after site-specific cleavage of
the second probe of each probe pair in the complex mentioned in
preceding item 3).
[0154] 5) A first ligated strand, a second ligated strand
(complementary to the first), or both, which result from probe
ligation.
[0155] Each species can be detected based on a unique property,
such as electrophoretic mobility, mass, or a particular detectable
label (or detectable signal associated with such label). Methods
for electrophoretic separation of nucleic acids and other species
are well known, and are described, for example in the works of
Ausubel (1993, and later editions) and Sambrook et al. (1989). The
invention also contemplates the use of probes that have distinct
electrophoretic mobilities due to the presence of polymer segments
or other moieties that confer distinct mobilities to the detected
species in sieving or non-sieving media, as taught in U.S. Pat.
Nos. 5,470,705, 5,514,543, and 5,580,732 (Grossman et al.), for
example.
[0156] In one embodiment, to facilitate detection, at least one
probe contains a label. Any suitable label can be used. Labels may
be direct labels which themselves are detectable or indirect labels
which are detectable in combination with other agents. Exemplary
direct labels include but are not limited to fluorophores,
chromophores, radioisotopes (e.g., .sup.32P, .sup.35S, .sup.3H),
spin-labels, chemiluminescent labels, and the like. Exemplary
indirect labels include enzymes which catalyze a signal-producing
event, and ligands such as an antigen or biotin which can bind
specifically with high affinity to a detectable anti-ligand, such
as a labeled antibody or avidin. Many comprehensive reviews of
methodologies for labeling DNA provide guidance applicable to the
present invention. Such reviews include Matthews et al. (1988);
Haugland (1992), Keller and Manak (1993); Eckstein (1991); Kricka
(1992), and the like. Additional methods for creating labeled
nucleotides are described in Fung et al.; Hobbs et al., Menchen et
al., and Bergot et al., and Rosenblum et al. (all supra).
[0157] In a preferred embodiment, the second probe in at least one
probe pair contains both (1) a fluorescent dye and (2) a quencher
dye that quenches at least a portion of the fluorescent dye when
both dyes are present in the probe. The two dyes are positioned in
the second probe so that they are separated by the linkage that is
to be specifically cleaved in the cleavage step. Cleavage of the
second probe results in a first fragment which contains most or all
of the target-complementary sequence of the probe (and which
remains hybridized to the target strand region), and a second
fragment that diffuses from the hybridization complex. Separation
of the fluorescent dye and the quencher dye by diffusion leads to
an increased fluorescent signal from the fluorescent dye. Methods
for preparing suitable probes containing fluorescer/quencher pairs
can be found in Livak et al. (1995) and U.S. Pat. No. 5,876,930
(Livak et al.), for example. Quenchers are also available from
various commercial sources, such as Epoch Biosciences.
[0158] In another embodiment, a first probe in a probe pair can
contain a donor moiety, and a second probe can contain an acceptor
moiety, so that upon ligation, the donor moiety and acceptor moiety
are brought into close proximity so that fluorescence emission of
the acceptor moiety is increased.
[0159] In another embodiment, a first probe in a probe pair can
contain a fluorescer moiety, and a second probe can contain a
quencher moiety, so that upon ligation, fluorescence emission from
the fluorescer moiety decreases due to quenching.
[0160] One or more probes may also contain a member of a specific
binding pair. "Specific binding pair" refers to a pair of molecules
that specifically bind to one another to form a binding complex.
Examples of specific binding pairs include, but are not limited to
antibody-antigen (or hapten) pairs, ligand-receptor pairs,
enzyme-substrate pairs, biotin-avidin pairs, complementary
polynucleotide pairs, and the like. The use of a binding pair can
be used to attach various labels to the probe, as discussed above,
or to capture the probe on a solid support that is coated with the
other member of the binding pair.
[0161] In yet another embodiment, ligation is detected or
quantified using an intercalating dye such as ethidium bromide or
SYBR GREEN (Molecular Probes) or a minor groove binder such as
Hoechst 33258, for example, which are compounds that exhibit
increased fluorescence in proportion to the amount of
double-stranded nucleic acid in a sample.
[0162] Multiple Targets; Arrays
[0163] The present invention can be used to detect a plurality of
different target sequences in a single sample or in a plurality of
samples. In one embodiment, different target sequences are detected
separately in separate reaction mixtures. In another embodiment, a
sample can be contacted with a plurality of probe sets which are
each designed to detect a different target sequence that may be
present in the sample. The various target sequences can be detected
based on detectable characteristics that are unique for each probe
pair, such as mass, electrophoretic mobility, fluorescence signal,
or a combination thereof. Methods of electrophoresis are well known
and are described, for example, in Ausubel, Sambrook et al. (1989),
and Grossman and Colburn (1992). The number of target sequences,
and corresponding probe pairs, that can be used in a single
reaction is a matter of choice by the user, and will depend in part
on the resolvability of the properties that are used to distinguish
the various reaction products.
[0164] In one embodiment, one of the first probe and second probe
of a probe pair contains a distinct polynucleotide tag (a tag
having a defined polynucleotide sequence) that identifies that
probe pair. The tag can be directly attached to the distal end of
the target-complementary sequence of a probe, or optionally can be
linked to the probe by an intervening spacer group. In another
embodiment, the tag is linked to an internal site within the
target-complementary sequence of the probe. Thus, the tag can be
linked to an intersubunit linking group, or to a nucleotide base,
within a probe. For example, each tag can be attached to the 5' end
of the first probe in each different probe pair, or to the 3' end
of the second probe in each different probe pair.
[0165] Tagged probes or tagged probe fragments can be separated
from each other by hybridization to corresponding tag complements
which are immobilized on distinct solid support regions.
Preferably, the solid support regions are configured as an
addressable array. By "addressable array" is meant that the
identity of each probe or probe fragment is known or can be
determined from the position of hybridization of that probe or
probe fragment on the array. Preferably, the tag complements are
immobilized in discrete regions on a planar surface, such that each
discrete region contains only tag complements having a particular
sequence, and such that the sequence of the tag complement at each
different discrete region is known. Conveniently, the tag
complements are distributed as a periodic two-dimensional array of
discrete tag complement regions which can be indexed via X and Y
coordinates, or any equivalent thereof.
[0166] Solid phase supports can be formed using any material that
allows for the tag segments to hybridize specifically to their
complementary tag complements on the support. Exemplary support
materials include glass; quartz; silicon; polycarbonate; metallic
materials such as GaAs, copper, or germanium; a polymerized gel,
such as crosslinked polyacrylamide; or membranes such as nylon,
polyvinylidine difluoride (PVDF), or poly-tetrafluoroethylene.
[0167] Immobilization of tag-complements in the array is
accomplished using any of a variety of suitable methods. In one
approach, the tag complements are deposited onto a solid phase
surface using liquid dispensing methods. For example, deposition
can be accomplished robotically on a poly-lysine-coated microscope
slide, followed by treatment with succinic anhydride to couple the
tag complements to the polylysine moieties, as described by Schena
et al. (1995) and Shalon (1995). For covalent attachment, the
tag-complements may include a suitably reactive functionality for
covalent attachment to the support. Exemplary linking chemistries
are disclosed in Barany et al. (1991), Pon et al. (1988), and
Menchen et al. (1994).
[0168] In another approach, tag complements can be synthesized on a
support by photolithographic methods, as described in Fodor et al.
(1991, 1995), Pirrung et al. (supra), and Shoemaker (1997).
Photoremovable groups are attached to a substrate surface, and
light-impermeable masks are used to control the addition of
monomers to selected regions of the substrate surface by activating
light-exposed regions. Monomer addition to the growing polymer
chains is continued using different mask arrangements until the
desired, different sequence tag complements are formed at the
desired addressable locations. The masking method of Fodor et al.
may also be modified to accommodate block-polymer synthesis. For
example, an array of linker groups (e.g., a polypeptide, or an
N-protected aminocaproic acid linked to an aminopropyl group) can
be formed on the substrate surface via simultaneous activation of
all immobilization regions to form a "carpet" of linker groups. The
tag complements are then individually deposited on (or adsorbed to)
the substrate surface as liquid drops at selected addressable
locations, and are exposed to light or heat as appropriate to
couple the binding moieties to the immobilized linker groups,
preferably while a sufficient amount of solvent still remains from
each drop.
[0169] Alternatively, the tag complements may be immobilized on the
support(s) non-covalently, e.g., using ligand-receptor type
interactions. For example, the tag complements may contain
covalently attached biotin groups as linker groups, for binding to
avidin or streptavidin polypeptides which have been attached to a
support (e.g., Barrett, 1996).
[0170] Linker segments may also be included between the tag
complement sequence and the support to provide a spacer arm which
allows the tag-specific binding region to separate from the
support, rendering the binding region more accessible to the
sample. Exemplary linker groups are described, for example, in
Fodor et al. (1995) and Brenner (PCT Publications cited above).
Preferably, the tag complement is separated from the support by a
chain comprising at least 10 chain atoms.
[0171] The support may include depressions in the support for
holding the deposited tag complements. Elevated protrusions can
also be used, onto which the tag complements are deposited. In yet
another approach, tag complements can be formed on beads as
described in U.S. Pat. No. 5,846,719 (Brenner et al.), for example.
Alternatively, tag complements are attached to an array of
individual beads attached to a surface, via magnetic force if the
beads are magnetic (Albretsen, 1990), or with an adhesive.
[0172] In another approach, an array is formed on a substrate, such
as a glass plate, which is covered with a rectangular array of
pieces of polyacrylamide gel (e.g., Khrapko et al., 1991). A
different tag complements is deposited at a selected site and is
bound thereto by reacting a 3'-terminal dialdehyde on the tag
complements with hydrazide groups on the polyacrylamide gel piece.
Tag complement arrays in accordance with the invention may also be
formed by robotic deposition of tag complements onto nylon (Khrapko
et al., supra). Following deposition, immobilization of the tag
complements may be facilitated by heat or photoactivation as
appropriate.
[0173] To reduce the amounts of assay reagents used for tag
detection, arrays may be formed as microarrays having tag
complement region densities of greater than 100 regions/cm.sup.2,
300 regions/cm.sup.2, 10.sup.3 regions/cm.sup.2, 3.times.10.sup.3
regions/cm.sup.2, 10.sup.4 regions/cm.sup.2, 10.sup.5
regions/cm.sup.2, or 10.sup.6 regions/cm.sup.2. In addition, the
number of different sequence tag complements in each array is
preferably equal to or greater than 10, 20, 50, 100, 200, 500,
1000, 3000, 10,000, 30,000, 100,000, or 300,000.
[0174] The tags and tag complements may be single or double
stranded, such that sequence specific hybridization forms either
duplexes by Watson and Crick base-pairing, or triplexes by forward
or reverse Hoogsteen bonding. In embodiments where specific
hybridization occurs via triplex formation, coding of tag sequences
follows the same principles as for duplex-forming tags. However,
there are further constraints on the selection of word sequences.
Generally, third strand association via Hoogsteen type of binding
is most stable along homopyrimidine-homopurine tracks in a double
stranded target. Usually, base triplets form in T-A*T or C-G*C
motifs (where "-" indicates Watson-Crick pairing and "*" indicates
Hoogsteen type of binding); however, other motifs are also
possible. For example, Hoogsteen base pairing permits parallel and
antiparallel orientations between the third strand (the Hoogsteen
strand) and the purine-rich strand of the duplex to which the third
strand binds, depending on conditions and the composition of the
strands. Furthermore, the invention also contemplates the use of
non-standard base pairing moieties such as disclosed in U.S. Pat.
No. 5,432,272 (Benner) and which are available from Erogen as the
"AEGIS" system.
[0175] There is extensive guidance in the literature for selecting
appropriate sequences, orientation, conditions, nucleoside type
(e.g. whether ribose or deoxyribose nucleosides are employed), base
modifications (e.g. methylated cytosine, and the like in order to
maximize, or otherwise regulate, triplex stability as desired in
particular embodiments, e.g., Brenner (supra). More generally,
conditions for annealing single-stranded or duplex tags to
single-stranded or duplex sequence complements are well known, e.g.
Brenner (supra), Ji et al. (1993), Cantor et al. (supra), Wetmur
(1991), Breslauer et al. (1986), Schena (1995), and the like.
[0176] Detection
[0177] Any detection method may be used which is suitable for the
type of label employed. Thus, exemplary detection methods include
radioactive detection, optical absorbance detection, e.g.,
UV-visible absorbance detection, optical emission detection, e.g.,
fluorescence or chemiluminescence. For example, captured tagged
species can be detected on an array by scanning all or portions of
each array simultaneously or serially, depending on the scanning
method used. For fluorescence labeling, selected regions on an
array may be serially scanned one-by-one or row-by-row using a
fluorescence microscope apparatus, such as described in Fodor
(1995) and Mathies et al. (1992). Hybridization patterns may also
be scanned using a CCD camera (e.g., Model TE/CCD512SF, Princeton
Instruments, Trenton, N.J.) with suitable optics (Ploem, 1993),
such as described in Yershov et al. (1996), or may be imaged by TV
monitoring (Khrapko, 1991). For radioactive signals (e.g.,
.sup.32P), a phosphorimager device can be used (Johnston et al.,
1990; Drmanac et al., 1992; 1993). Other commercial suppliers of
imaging instruments include General Scanning Inc., (Watertown,
Mass., www.genscan.com), Genix Technologies (Waterloo, Ontario,
Canada; www.confocal.com), and Applied Precision Inc. Such
detection methods are particularly useful to achieve simultaneous
scanning of multiple tag complement regions.
[0178] Measured signals can be analyzed manually or by appropriate
computer methods to tabulate results. The results can be measured
to provide qualitative or quantitative results, depending on the
needs of the user. Reaction conditions can include appropriate
controls for verifying the integrity of hybridization, and for
providing standard curves for quantitation, if desired.
[0179] Kits
[0180] The invention also contemplates kits which are useful in
practicing the invention. Such kits may include one or more probe
pairs as discussed above, and optionally, a 5' nuclease enzyme and
a ligase enzyme. The kit may also include buffers and any other
reagents that facilitate the method.
[0181] From the foregoing, it can be seen how the features and
benefits of the invention can be achieved. The invention provides a
convenient method for determining the presence or absence of one or
more target sequences, and for quantification as well. The method
is amenable to high-throughput processing of many target sequences
and many different samples. The invention can be used for a variety
of purposes, such as genetic screening, allele determination,
sample identification, disease diagnosis, forensics, agricultural
analysis, and many others. The method can also be used to establish
a sequence profile of one or more samples, for identifying or
distinguishing samples.
[0182] The invention is further illustrated by way of certain
examples which are not intended to limit the invention in any
way.
EXAMPLE 1
[0183] Afu FEN was obtained from Third Wave Technology (Madison,
Wis.). AMPLIGASE.TM. was purchased from Epicentre Technologies.
Reaction buffer (1.times.) contained 10 mM MOPS pH 7.5, 10 .mu.M
NAD.sup.+, 3.0 mM MgCl.sub.2, 0.05% NP-40, 0.05% TWEEN-20 (v:v),
and 60 nM ROX passive reference (Applied Biosystems).
[0184] Genomic DNA that was homozygous for the A allele of human
ligase I (from Raji leukemia cells) was obtained from PE Biosystems
(DNA Template Reagent, Part No. 401970). Genomic DNA that was
homozygous for the C allele of human ligase I, or heterozygous for
the A and C alleles, was obtained from Coriell Institute for
Medical Research.
[0185] Probe sets (see below) were prepared for detecting the
following target sequences:
8 Target 1: Human ApoB 5'-AAGAAATTATCTCGGTCCTCACAATAAACTGC-
GAGGTCACTGTGAGTTTTCCT-3' (SEQ ID NO:1) Target 2: Human Ligase I (A
allele) 5'-AAGCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGAA- GACGGGG-3'
(SEQ ID NO:2) Target 3: Human Ligase I (C allele)
5'-AAAGCCTCACAGAGGCTGAAGTGGCCACAGAGAAGGAAGGAGAAGACGGGG-3' (SEQ ID
NO:3)
[0186] The following probe sets were synthesized by the
phosphoramidite synthesis method, where F=6-Fam, and Q=Tamra, and
all probe sequences are 5' to 3' (see Mullah et al., Nucl. Acids
Res. 26:1026-1031 (1998); and "Chemical methods for 5' non-isotopic
labelling of PCR probes and primers" (Chapter 3) by Alex Andrus, in
PCR 2: A Practical Approach, M. J. McPherson et al., eds, IRL
Press, NY (1995)):
9 ApoB Probe Set(control): ApoB probe 1:
AAGAAATTATCTCGGTCCTCACAATAAAC (SEQ ID NO:4) ApoB probe 2:
F-ACTGCGAGGTCACTGTGAGTTTTC-Q (SEQ ID NO:5) ApoB probe 3:
AAGAAAACTCACAGTGACCTCGCAG (SEQ ID NO:6) ApoB probe 4:
F-AGTTTATTGTGAGGACCGAGATAATTTC-Q (SEQ ID NO:7) A-Allele of Human
Ligase (AHL) Probe Set: AHL probe 1: AACCTCACAGAGGCTGAAGTGGCA (SEQ
ID NO:8) AHL probe 2: F-AAACAGAGAAGGAAGGAGAAGACGG-Q (SEQ ID NO:9)
AHL probe 3: AACCGTCTTCTCCTTCCTTCTCTGTT (SEQ ID NO:10) AHL probe 4:
F-ATGCCACTTCAGCCTCTGTGAGG-Q (SEQ ID NO:11) C-allele of human ligase
(CHL) probe set: CHL probe 1: CCCCTCACAGAGGCTGAAGTGGCC (SEQ ID
NO:12) CHL probe 2: F-ACACAGAGAAGGAAGGAGAAGACGG-Q (SEQ ID NO:13)
CHL probe 3: CCCCGTCT TCTCCTTCCTTCTCTGTG (SEQ ID NO:14) CHL probe
4: F-AGGCCACTTCAGCCTCTGTGAGG-Q (SEQ ID NO:15)
[0187] Alignments of the probes with corresponding target sequences
are shown below. Only one target strand region is shown for each
target sequence, for which probes 3 and 4 from each probe set are
complementary. Probes 1 and 2 from each probe set are complementary
to the complement (not shown) of the target strand region. The A
base and C base that distinguish the A and C alleles, respectively,
of the human ligase I gene are highlighted by bold and underlining.
Double underlining indicates bases at the 3' termini of the first
and third probes that are invasive with respect to same-sequence
bases at or near the 5' terminal ends of the second and fourth
probes, respectively. Lower case letters indicate bases which are
non-complementary with respect to the target sequence (or the
complement of the target).
10 ApoB Alignment ApoP1: 5'-AAGAAATTATCTCGGTCCTCACAATAAAC-3- ' (SEQ
ID NO:4) ApoP2 5'-F-ACTGCGAGGTCACTGTGAGTTTTC-Q-3' (SEQ ID NO:5)
ApoTgt: AAGAAATTATCTCGGTCCTCACAATAAACTGCGAG- GTCACTGTGAGTTTTCCT-3'
(SEQ ID NO:1) ApoP3: 3'-GACGCTCCAGTGACACTCAAAAGaA-5' (SEQ ID NO:6)
ApoP4: 5'-Q-CTTTAATAGAGCCAGGAGTGTTATTTGA-F-5' (SEQ ID NO:7) AHL
Alignment AHLp1: 5'-AaCCTCACAGAGGCTGAAGTGGCA-3' (SEQ ID NO:8)
AHLp2: 5'-F-aAACAGAGAAGGAAGGAGAAGACGG-Q-3' (SEQ ID NO:9) AHLTgt:
AAAGCCTCACAGAGGCTGAAGTGGCAACAGAGAAGGAAGGAGAAGACGGGG-3- ' (SEQ ID
NO:2) AHLp3: 3'-TTGTCTCTTCCTTCCTCTTCTGCCaa-5' (SEQ ID NO:10) AHLp4:
3'-Q-GGAGTGTCTCCGACTTCACCGTa-F-5' (SEQ ID NO:11) CHL Alignment
CHLp1: 5'-cCCCTCACAGAGGCTGAAGTGGCC-3' (SEQ ID NO:12) CHLp2:
5'-F-aCACAGAGAAGGAAGGAGAAGACGG-Q-3' (SEQ ID NO:13) CHLTgt:
AAAGCCTCACAGAGGCTGAAGTGGCCACAGAGAAGGAAGGAGAAGACGGGG-3' (SEQ ID
NO:3) CHLp3: 3'-GTGTCTCTTCCTTCCTCTTCTGCCCC-5' (SEQ ID NO:14) CHLp4:
3'-Q-GGAGTGTCTCCGACTTCACCGGa-F-5' (SEQ ID NO:15)
[0188] Reaction mixtures (30 .mu.L each) were prepared containing
approximately 1 to 3 ng of genomic DNA, 100 nM of each probe from
the ApoB, AHL, or CHL probe set, 1 ng of Afu FEN, and 5 units of
AMPLIGASE.TM. in 1.times. reaction buffer. Reaction tubes were
placed in a 96 well optical plate (Part No. N801-0560) of a PE
Biosystems GENEAMP.TM. System 7700. After heating to 95.degree. C.
for 2 min., the reaction mixtures were subjected to 50 two-step
heating cycles of 65.degree. C. for 1 min. and 95.degree. C. for 15
sec. For each well, spectra were collected within a wavelength
window of 500 to 650 nm during each data collection cycle. Each
data collection cycle time lasted about 7 seconds. The spectra
recorded for each well were deconvoluted to reflect the signal
intensities of each individual dye, and the signal intensity for
FAM at the end of each cycle was plotted as a ratio with respect to
the signal intensity of ROX, as a function of cycle number. Results
are shown in Table 1 below, which show calculated values for the
cycle number (Ct) in which specific signal was detectable over an
arbitrarily selected threshold level, such that a lower estimated
Ct value indicates a higher starting target concentration.
11 TABLE 1 Sample Probe Set in Reaction Mixture Zygosity ApoB AHL
CHL None 37.2 .+-. 0.4 35.9 .+-. 0.2 42.8 .+-. 1.2 A/A 32.2 .+-.
0.1 30.5 .+-. 0.2 41.0 .+-. 0.4 A/C 30.3 .+-. 0.1 30.2 .+-. 0.2
31.2 .+-. 0.1 C/C 32.5 .+-. 0.2 36.0 .+-. 0.4 32.7 .+-. 0.2
[0189] The results demonstrate that the AHL and CHL probe sets
provide specific detection of each target-matched genomic sequence.
Specifically, a Ct value of 30.5 was observed for the homozygous A
sample in the presence of the AHL probe set, whereas the CHL probe
set showed no detectable amplification through 40 cycles.
Conversely, a Ct value of 32.7 was calculated for the homozygous C
sample in the presence of the CHL probe set, whereas the AHL probe
set showed no detectable amplification until about cycle 36. For
the heterozygous A/C sample, detectable signals were observed at
about the same cycle numbers (about 30 or 31) for the AHL and CHL
probe sets, respectively, consistent with a 1:1 allelic ratio.
[0190] The late-occurring signals observed with the AHL and CHL
probe sets in the presence of non-target allelic samples were
significantly shallower in slope than the slopes of the signals
produced by the target-matched probe sets, and were probably
attributable to non-template background reactions for which signals
are provided in the row of data identified as "None". For example,
in the absence of genomic DNA, the AHL probe set produced a Ct
value of 35.9, which is substantially the same as the Ct value of
36.0 obtained for the AHL probe set reacted with the homozygous C
sample. Similarly, in the absence of genomic DNA, the CHL probe set
produced a Ct value of 42.8, which is close to the Ct value of 41.0
obtained for reaction of the CHL probe set with the homozygous A
sample.
[0191] The results for target-matched AHL and CHL probe sets also
agreed well with data obtained with the ApoB probe set, such that
the Ct values obtained for the ApoB signal were within about 2
cycles of the Ct values observed for target-matched AHL and CHL
probe sets. The disparity between the ApoB Ct values and the
target-matched AHL or CHL values may be attributable to different
amplification efficiencies for different probe sets, and pipetting
errors. In all cases, the no-sample control reactions for the
different probe sets occurred in much later cycles than the Ct
cycle numbers, confirming the target-specificity of the probe
sets.
EXAMPLE 2
[0192] The conditions in Example 1 were repeated using different
concentrations of target DNA homozygous for the C allele of human
ligase I (0, 1, 10, 100, and 1000 copies, each in quadruplicate) in
the presence of the CHL probe set. The results are shown below:
12 TABLE 2 Target Copy Number Ct 0 43.7 .+-. 0.6 1 42.7 .+-. 0.8 10
39.8 .+-. 0.1 100 35.6 .+-. 0.2 1000 31.2 .+-. 0.2
[0193] The results show that as expected, the Ct values showed an
inverse linear relationship to the log of target copy number, and
fewer than 10 copies could be reliably detected.
[0194] All references cited herein are incorporated by reference as
if each was separately but expressly incorporated by reference.
[0195] Although the invention has been described with reference to
particular embodiments, it will be appreciated that various changes
and modifications may be made without departing from the scope and
spirit of the invention.
Sequence CWU 1
1
24 1 53 DNA Homo sapiens 1 aagaaattat ctcggtcctc acaataaact
gcgaggtcac tgtgagtttt cct 53 2 51 DNA Homo sapiens 2 aaagcctcac
agaggctgaa gtggcaacag agaaggaagg agaagacggg g 51 3 51 DNA Homo
sapiens 3 aaagcctcac agaggctgaa gtggccacag agaaggaagg agaagacggg g
51 4 29 DNA Unknown Ligation probe 1 for detecting SEQ ID NO1 4
aagaaattat ctcggtcctc acaataaac 29 5 24 DNA Unknown Ligation probe
2 for detecting SEQ ID NO1 5 actgcgaggt cactgtgagt tttc 24 6 25 DNA
Unknown Ligation probe 3 for detecting SEQ ID NO1 6 aagaaaactc
acagtgacct cgcag 25 7 28 DNA Unknown Ligation probe 4 for detecting
SEQ ID NO1 7 agtttattgt gaggaccgag ataatttc 28 8 24 DNA Unknown
Ligation probe 1 for detecting SEQ ID NO2 8 aacctcacag aggctgaagt
ggca 24 9 25 DNA Unknown Ligation probe 2 for detecting SEQ ID NO2
9 aaacagagaa ggaaggagaa gacgg 25 10 26 DNA Unknown Ligation probe 3
for detecting SEQ ID NO2 10 aaccgtcttc tccttccttc tctgtt 26 11 23
DNA Unknown Ligation probe 4 for detecting SEQ ID NO2 11 atgccacttc
agcctctgtg agg 23 12 24 DNA Unknown Ligation probe 1 for detecting
SEQ ID NO3 12 cccctcacag aggctgaagt ggcc 24 13 25 DNA Unknown
Ligation probe 2 for detecting SEQ ID NO3 13 acacagagaa ggaaggagaa
gacgg 25 14 26 DNA Unknown Ligation probe 3 for detecting SEQ ID
NO3 14 ccccgtcttc tccttccttc tctgtg 26 15 23 DNA Unknown Ligation
probe 4 for detecting SEQ ID NO3 15 aggccacttc agcctctgtg agg 23 16
28 DNA Unknown Ligation probe P1 for detecting SEQ ID NO1 16
aagaaattat ctcggtcctc acaataaa 28 17 51 DNA Unknown DNA segment
containing SEQ ID NO1 17 ttctttaata gagccaggag tgttatttga
cgctccagtg acactcaaaa g 51 18 23 DNA Unknown Cleaved form of probe
P2 18 ctgcgaggtc actgtgagtt ttc 23 19 51 DNA Unknown Ligation
product of probes P1 and P2 from Scheme Ib, following cleavage of
P2 19 aagaaattat ctcggtcctc acaataaact gcgaggtcac tgtgagtttt c 51
20 51 DNA Unknown Complement of SEQ ID NO2 20 tttcggagtg tctccgactt
caccgttgtc tcttccttcc tcttctgccc c 51 21 23 DNA Unknown Cleaved
form of probe Ap2 from Scheme IIa 21 acagagaagg aaggagaaga cgg 23
22 21 DNA Unknown Cleaved form of probe Ap4 from Scheme IIa 22
ggagtgtctc cgacttcacc g 21 23 47 DNA Unknown Ligation product of
probes Ap1 and Ap2 from Scheme IIb, following cleavage of Ap2 23
aacctcacag aggctgaagt ggcaacagag aaggaaggag aagacgg 47 24 47 DNA
Unknown Ligation product of probes Ap3 and Ap4 from Scheme IIb,
following cleavage of Ap4 24 ggagtgtctc cgacttcacc gttgtctctt
ccttcctctt ctgccaa 47
* * * * *
References