U.S. patent application number 10/384356 was filed with the patent office on 2004-01-08 for neutralizing high affinity human monoclonal antibodies specific to rsv f-protein and methods for their manufacture and therapeutic use thereof.
This patent application is currently assigned to IDEC PHARMACEUTICALS CORPORATION. Invention is credited to Brams, Peter.
Application Number | 20040005323 10/384356 |
Document ID | / |
Family ID | 23939500 |
Filed Date | 2004-01-08 |
United States Patent
Application |
20040005323 |
Kind Code |
A1 |
Brams, Peter |
January 8, 2004 |
Neutralizing high affinity human monoclonal antibodies specific to
RSV F-protein and methods for their manufacture and therapeutic use
thereof
Abstract
A highly efficient method for generating human antibodies in
particular which are specific to be RSV fusion protein which
combines in vitro primary of human spleen cells and antigen
boosting in SCID mice is taught. This method provides for very high
human antibody titers which are predominantly of the IgG isotype
which contain antibodies of high specificity and affinity to
desired antigens. This method is well suited for generating human
monoclonal antibodies for therapeutic and diagnostic applications
as well as for rescue of human cells for generation of
combinational human antibody gene libraries. Two human monoclonal
antibodies, RF-1 and RF-2 which each possess an affinity for RSV
F-protein .ltoreq.2.times.10.sup.-9 Molar are taught as well as
their corresponding amino acid and DNA sequences. These antibodies
are to be used therapeutically and prophylactically for treating or
preventing RSV infection, as well as for diagnosis of RSV in
analytes.
Inventors: |
Brams, Peter; (San Diego,
CA) |
Correspondence
Address: |
PILLSBURY WINTHROP, LLP
P.O. BOX 10500
MCLEAN
VA
22102
US
|
Assignee: |
IDEC PHARMACEUTICALS
CORPORATION
|
Family ID: |
23939500 |
Appl. No.: |
10/384356 |
Filed: |
March 10, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10384356 |
Mar 10, 2003 |
|
|
|
09740002 |
Dec 20, 2000 |
|
|
|
6537809 |
|
|
|
|
09740002 |
Dec 20, 2000 |
|
|
|
09335697 |
Jun 18, 1999 |
|
|
|
6413771 |
|
|
|
|
09335697 |
Jun 18, 1999 |
|
|
|
08770057 |
Dec 19, 1996 |
|
|
|
5958765 |
|
|
|
|
08770057 |
Dec 19, 1996 |
|
|
|
08488376 |
Jun 7, 1995 |
|
|
|
5811524 |
|
|
|
|
Current U.S.
Class: |
424/159.1 ;
530/388.15; 530/388.3 |
Current CPC
Class: |
A61P 31/00 20180101;
C07K 14/005 20130101; A61K 2039/505 20130101; C12N 2760/18522
20130101; A61P 31/12 20180101; A61K 38/00 20130101; C07K 16/00
20130101; A61P 11/00 20180101; C07K 2317/21 20130101; C07K 2317/92
20130101; C12N 2799/028 20130101; C07K 16/1027 20130101 |
Class at
Publication: |
424/159.1 ;
530/388.3; 530/388.15 |
International
Class: |
A61K 039/42; C07K
016/08 |
Claims
In the claims:
1. A human monoclonal antibody which specifically binds the RSV
fusion protein and which possesses an affinity for the RSV
F-protein of .ltoreq.2.times.10.sup.-9 molar.
2. The human monoclonal antibody of claim 1 which neutralizes RSV
in vitro.
3. A human monoclonal antibody which specifically binds to the RSV
fusion protein which is selected from the group consisting of RF-1,
RF-2 and recombinant human monoclonal antibodies which contain the
variable heavy and light domains of either RF-1 or RF-2.
4. The human monoclonal antibody of claim 3 wherein said antibody
is RF-1.
5. The human monoclonal antibody of claim 3 wherein said antibody
is RF-2.
6. The human antibody of claim 3, wherein said antibody is a
recombinant antibody which contains either the human gamma 1, human
gamma 4, or human gamma 4 PE constant region.
7. Eukaryotic cells which have been transfected with DNA sequences
which encode for the heavy and light variable domains of either
RF-1 or RF-2.
8. The cells of claim 7 wherein said eukaryotic cells are CHO
cells.
9. The eukaryotic cells of claim 7 wherein said DNA sequences are
selected from the DNA sequences set forth in any one of FIGS. 7a,
7b, 8a, 8b, 9a, 9b, 10a or 10 b.
10. An Epstein-Barr immortalized B cell line which secretes a human
monoclonal antibody which possesses an affinity for the RSV fusion
protein of .ltoreq.2.times.10.sup.-9 molar.
11. The cell line of claim 10 wherein said antibody neutralizes RSV
in vitro.
12. The cell line of claim 10 wherein said cell line is selected
from the group consisting of RF-1 and RF-2.
13. A method for producing human antibodies specific to the RSV
fusion (F) protein which comprises: (i) priming human splenocytes
in vitro in the presence of IL-2; (ii) transferring said primed
human splenocytes into a SCID mouse; (iii) boosting said SCID mouse
with RSV F-protein; and (iv) isolating human B cells from said SCID
mouse which secrete human monoclonal antibodies specific for the
RSV F-protein.
14. The method of claim 13 wherein said isolated human B cells are
immortalized.
15. The method of claim 14 wherein immortalization is effected
using Epstein-Barr Virus (EBV).
16. The method of claim 15 wherein said EBV immortalized cells are
cloned using the mouse thyoma cell line EL-4 B5 as a feeder
layer.
17. The method of claim 13 wherein the priming step is effected in
the presence of IL-4 or IL-6.
18. A DNA sequence which encodes for the variable heavy and/or
variable light domain of RP-1 or RF-2.
19. An expression vector which provides for the expression of a DNA
sequence according to claim 18.
20. The DNA sequence of claim 18 which is selected from the group
consisting of the DNA sequences set forth in FIGS. 7a, 7b, 8a, 8b,
9a, 9b, 10a and 10b.
21. A method for preventing or treating RSV infection in
susceptible or RSV infected persons which comprises administering a
prophylactically or therapeutically effective amount of one or more
human monoclonal antibodies which possess an affinity to the RSV
F-protein of .ltoreq.2.times.10.sup.-9 molar and which also
neutralize RSV in vitro.
22. The method of claim 21 wherein said antibodies are selected
from the group consisting of RF-1, RF-2 and recombinant human
monoclonal antibodies which contain the variable heavy and light
domains of RF-1 or RF-2.
23. The method of claim 21 wherein said antibodies are administered
by injection or by aerosol.
24. The method of claim 21 wherein said antibodies are administered
in combination with an adjuvant.
25. The method of claim 24 wherein said adjuvant is Complete
Freund's Adjuvant (CFA), Alum or a combination thereof.
26. A pharmaceutical composition suitable for preventing or
treating RSV infection in susceptible or RSV infected persons which
comprises a prophylactically or therapeutically effective amount of
human monoclonal antibodies which neutralize RSV in vitro and which
possess an affinity for the RSV F-protein of
.ltoreq.2.times.10.sup.-9 molar and a pharmaceutically acceptable
carrier.
27. The pharmaceutical composition of claim 26 wherein said human
monoclonal antibodies are selected from the group consisting of
RF-1, RF-2 and recombinant human monoclonal antibodies which
contain the variable heavy and light domains of either RF-1 or
RF-2.
28. A method of detecting the presence of RSV in an analyte which
comprises incubating, said analyte with a human monoclonal antibody
which possesses an affinity for the RSV F-protein of
.ltoreq.2.times.10.sup.-9 molar under conditions which provide for
the formation of RSV F-protein antibody immune complexes; and
detecting the presence of said RSV F-protein antibody immune
complexes to determine whether RSV is present in the analyte.
29. The method of claim 28 wherein said antibody is RF-1 or
RF-2.
30. The method of claim 29 wherein said antibody is directly or
indirectly attached to a reporter molecule.
31. The method of claim 30 wherein said reporter molecule is a
detectable enzyme or radionuclide.
32. The method of claim 28 wherein the analyte comprises fluid
obtained from respiratory tissue.
33. A test kit for assaying the presence of RSV in an analyte which
comprises: (i) a human monoclonal antibody having an affinity for
the RSV F-protein of .ltoreq.2.times.10.sup.-9 molar; and (ii) a
reporter molecule which is directly or indirectly attached to said
human monoclonal antibody.
34. The test kit of claim 33 wherein said human monoclonal antibody
is RF-1 or RF-2.
Description
BACKGROUND OF THE INVENTION
[0001] Respiratory syncytial virus (RSV) is a Parmixovirus of the
Pneumovirus genus which commonly infects the upper and lower
respiratory tract. It is so contagious that by age two, a large
percentage of children have been infected by it. Moreover, by age
four, virtually all humans have an immunity to RSV.
[0002] Typically, RSV infections are mild, remaining localized in
the upper respiratory tract and causing symptoms similar to a
common cold which require no extensive-treatment. However, in some
subjects, e.g., immunosuppressive individuals such as infants,
elderly persons or patients with underlying cardiopulmonary
diseases, the virus may penetrate to the lower respiratory tract
requiring hospitalization and breathing support. In some of these
cases, RSV infection may cause permanent lung damage or even be
life threatening. In the United States alone, RSV results in about
90,000 hospitalizations each year, and results in about 4500
deaths.
[0003] RSV appears in two major strain subgroups, A and B,
primarily based on serological differences associated with the
attachment glycoprotein, G. The major surface glycoprotein, i.e.,
the 90 kb G protein, can differ up to 50% at the amino acid level
between isolates Johnson et al, Proc. Natl. Acad. Sci. (1987), 84,
5625-5629. By contrast, a potential therapeutic target, the 70 kD
fusion (F) protein, is highly conserved across different RSV
strains, about i.e., 89% on the amino acid level Johnson et al. J.
Gen. Virol. (1988), 69, 2623-2628, Johnson et al. J. Virol. (1987),
10, 3163-3166, P. L. Collins. Plenum Press. New York (1991),
103-162. Moreover, it is known that antibodies elicited against
F-protein of a given type are cross-reactive with the other
type.
[0004] The F-protein is a heterodimer, generated from a linear
precursor, consisting of disulfide-linked fragments of 48 and 23 kD
respectively Walsh et al, J. Gen. Virol, (1985), 66, 401-415.
Inhibition of syncytia formation by polyclonal antibodies is
associated with significant reaction to the 23 kD fragment.
[0005] As noted, while RSV infections are usually mild, in some
individuals RSV infections may be life threatening. Currently,
severe RSV infection is treated by administration of the antiviral
agent Ribavarin. However, while Ribavarin exhibits some efficacy in
controlling RSV infection, its use is disfavored for several
reasons. For example, it is highly expensive and may be
administered only in hospitals. Other known RSV treatments only
treat the symptoms of RSV infection and include the use of
aerosolized bronchodilators in patients with bronchiolitis and
corticosteroid therapy in patients with bronchiolitis and RSV
pneumonia.
[0006] To date, RSV vaccines intended to boost antiviral protective
antibodies have been largely unsuccessful. For example, a vaccine
based on formalin-inactivated RSV that was tested approximately 25
years ago, induced antibodies that were deficient in fusion
inhibiting activity Murphy et al. Clinical Microbiology (1988), 26,
1595-1597, and sometimes even exacerbated the disease. This may
potentially be explained to the inability of the formalin
inactivated virus to induce protective antibodies. While high
antibody titers were measured in vaccine recipients, specific
protective titers were lower than in the control population. This
may be because formalin inactivated RSV does not display the
necessary conformational epitopes required to elicit protective
antibodies.
[0007] While there is no known effective RSV vaccine to date, there
exists some clinical evidence that antibody therapy may confer
protection against RSV infection in susceptible individuals, and
may even clear an existing RSV infection. For example, it has been
reported that newborn infants show a low incidence of severe
bronchiolitis, which is hypothesized to be attributable to the
presence of protective maternal antibodies Ogilvie et al. J. Med
Virol (1981), 7, 263-271. Also, children who are immune to
reinfection exhibit statistically higher anti-F-protein titers than
those who are reinfected. Moreover, intravenous immune globulin
(IVIG) prepared from high titer RSV-immune donors reduces nasal RSV
shedding and improves oxygenation Hemming et al. Anti. Viral Agents
and Chemotherapy (1987), 31, 1882-1886. Also, recent studies have
suggested that the virus can be fought and lung damage prevented by
administering RSV-enriched immune globulin (RSVIG) Groothuis et al.
The New England J. Med (1993), 329, 1524-1530, K. McIntosh. The New
England J. Med. (1993), 329. 1572-1573, J. R. Groothuis. Antiviral
Research, (1994), 23, 1-10, Siber et al. J. Infectious Diseases
(1994), 169, 1368-1373. Siber et al. J. Infectious Diseases (1992).
165: 456-463.
[0008] Similarly, some animal studies suggest that antibody therapy
with virus neutralizing antibodies may confer protection against
RSV or even clear an existing RSV infection. For example, in vitro
neutralizing mouse monoclonal antibodies have been reported to
protect mice against infection and also to clear established RSV
infections Taylor et al. J. Immunology, (1984), 52, 137-142, Stott
et al. "Immune Responses. Virus Infections and Disease, I.R.L.
Press, London (1989), 85-104. Also, monoclonal antibodies to the
F-protein of RSV have shown high efficacy in both in vitro and in
vivo RSV models Tempest et al. Bio/Technology, (1991), 9, 266-271,
Crowe et al. Proc. Natl. Acad. Sci. (1994), 91, 1386-1390, Walsh et
al. Infection and Immunity, (1984), 43, 756-758, Barbas III. et al.
Proc. Natl. Acad. Sci. (1992), 89, 10164-10168, Walsh. et al. J.
Gen. Virol. (1986), 67, 505-513. Antibody concentrations as low as
520-2000 .mu.g/kg body weight have been reported to result in
almost instant recovery in animal studies Crowe et al. Proc. Natl.
Acad. Sci. (1994), 91, 1386-1390. Moreover, these monoclonal
antibodies have been disclosed to neutralize both A and B strains,
including laboratory strains and wildtype strains. These antibodies
were administered either by injection Groothuis et al. The New
England J. Med. (1993), 329, 1524-1530, Siber et al. J. Infectious
Diseases (1994), 169, 1368-1373 or by aerosol Crowe et al. Proc.
Natl. Acad. Sci. (1994), 91, 1386-1390.
[0009] Two different types of potentially therapeutic monoclonal
antibodies to the RSV F-protein have been previously described in
the literature, humanized murine antibodies Tempest et al, Biol.
Technology, (1991) 9, 266-271, or true human antibodies (Fab
fragments) Barbas III. et al. Proc. Natl. Acad. Sci. (1992), 89.
10164-10168. Humanized murine antibodies were generated by CDR
grafting a cross-strain neutralizing murine anti-F-protein antibody
onto a generic human Fc, as well as structural areas of the
variable part. The human Fab fragments were produced by
combinatorial library technology using human bone marrow cells
obtained from an HIV positive donor (immunocompromised). The
therapeutic in vivo titers of the humanized and human RSV
antibodies were 5 and 2 mg/kg body weight, respectively. It is
noted, however, that the humanized antibodies were tested in a
syncytia inhibition assay, whereas the human anti-RSV Fab fragments
were assayed to determine their virus neutralization activity.
Therefore, the results reported with the humanized and human
anti-RSV antibodies are not directly comparable.
[0010] The Fab fragment generated by the combinatorial library
technology were disclosed to be efficient in aerosol. This is
probably because of the relatively small size of the molecule.
These results are highly encouraging because a major target
population for an RSV vaccine is infants. Therefore, aerosol is a
particularly desirable mode of administration.
[0011] However, notwithstanding the previous published reports of
humanized and Fab fragments specific to RSV, there still exists a
significant need for improved anti-RSV antibodies having improved
therapeutic potential, in particular anti-RSV antibodies which
possess high affinity and specificity for the RSV F-protein which
effectively neutralize and prevent RSV infection.
[0012] Antibody therapy can be subdivided into two principally
different activities: (i) passive immunotherapy using intact
non-labeled antibodies of labeled antibodies and (ii) active
immunotherapy using anti-idiotypes for re-establishment of network
balance in autoimmunity.
[0013] In passive immunotherapy, naked antibodies are administered
to neutralize an antigen or to direct effector functions to
targeted membrane associated antigens. Neutralization would be of a
lymphokine, a hormone, or an anaphylatoxin, i.e., C5a. Effector
functions include complement fixation, macrophage activation and
recruitment, and antibody dependent cell mediated cytotoxicity
(ADCC). Naked antibodies have been used to treat leukemia Ritz et
al. S.F. Blood. (1981), 58, 141-152 and antibodies to GD2 have been
used in treatments of neurobiastomas Schulz et al. Cancer Res.
(1984), 44:5914 and melanomas Irie et al. Proc. Natl. Acad. Sci.,
(1986, 83:8694. Also, intravenous immune gamma globulin (IVIG)
antibodies with high anti-RSV titers recently were used in
experimental trials to treat respiratory distress caused by RSV
infection Hemming et al. Anti. Viral Agents and Chemotherapy,
(1987), 31, 1882-1886, Groothuis et al. The New England J. Med.
(1993), 329, 1524-1530, K. McIntosh. The New England J. Med.
(1993), 329, 1572-1573, J. R. Groothuis. Antiviral Research,
(1994), 23, 1-10, Siber et al. J. Infectious Diseases (1994), 169,
1368-1373.
[0014] The therapeutic efficacy of a monoclonal antibody depends on
factors including, e.g., the amount, reactivity, specificity and
class of the antibody bound to the antigen. Also, the in vivo
half-life of the antibody is a significant therapeutic factor.
[0015] Still another factor which may significantly affect the
therapeutic potential of antibodies is their species of origin.
Currently, monoclonal antibodies used for immunotherapy are almost
exclusively of rodent origin Schulz et al. Cancer Res. (198,),
44:5914, Miller et al. Blood (1981), 58, 75-86, Lanzavecchia et al.
J. Edp. Med. (1988), 167, 345-352, Sikora et al. Br. Med. Bull.
(1984), 40:240, Tsujisaki et al. Cancer Research (1991), 51:2599,
largely because the generation of rodent monoclonal antibodies uses
well characterized and highly efficient techniques Kohler et al.
Nature, (1975), 256:495, Galfre et al. Nature, (1977), 266:550.
However, while rodent monoclonal antibodies possess therapeutic
efficacy, they can present restrictions and disadvantages relative
to human antibodies. For example, they often induce sub-optimal
stimulation of host effector functions (CDCC, ADCC, etc.). Also,
murine antibodies may induce human anti-murine antibody (HAMA)
responses Schroff et al. Can. Res. (1985, 45:879-885, Shawler et
al. J. Immunol. (1985), 135:1530-1535. This may result in shortened
antibody half-life Dillman et al. Mod. (1986), 5, 73-84, Miller et
al. Blood, (1983), 62:988-995 and in some instances may cause toxic
side effects such as serum sickness and anaphylaxis.
[0016] In some subjects, e.g., heavily immunosuppressed subjects
(e.g., patients subjected to heavy chemical or radiation mediated
cancer therapy Irie et al. Proc. Natl. Acad. Sci. (1986), 83:8694,
Dillman et al, Mod. (1986), 5, 73-84, Koprowski et al. Proc. Natl.
Acad. Sci. (1984), 81:216-219), use of murine monoclonal antibodies
causes limited negative side effects. By contrast, in patients with
normal or hyperactive immune systems, murine antibodies, at least
for some disease conditions may exhibit limited efficacy.
[0017] In an effort to obviate limitations of murine monoclonal
antibodies, recombinant DNA techniques have been applied to produce
chimeric antibodies Morrison et al. Proc. Natl. Acad. Sci. (1984).
81:216-219, Boulianne et al. Nature, (1984), 312, 644-646,
humanized antibodies by "CDR grafting" Riechmann et al. Nature
(1984), 332, 323-327 and "veneered" antibodies by substitution of
specific surface residues with other amino acids to alleviate or
eliminate antigenicity.
[0018] However, although such antibodies have been used
successfully clinically Gillis et al. J. Immunol. Meth (1989),
25:191, they have proven cumbersome to produce. This is because the
understanding of the requirements for optimal antigen recognition
and affinity is not yet fully understood. Also, the human framework
and the mouse CDR regions often interact sterically with a negative
effect on antibody activity. Moreover, such antibodies sometimes
still induce strong HAMA responses in patients.
[0019] Human antibodies present major advantages over their murine
counterparts; they induce optional effector functions, they do not
induce HAMA responses and host antigen-specific antibodies may lead
to identification of epitopes of therapeutic value that may be too
subtle to be recognized by a xenogeneic immune system Lennox et al.
"Monoclonal Antibodies in Clinical Medicine." London: Academic
Press (1982).
[0020] While human antibodies are highly desirable, their
production is complicated by various factors including ethical
considerations, and the fact that conventional methods for
producing human antibodies are often inefficient. For example,
human subjects cannot generally be adequately immunized with most
antigens because of ethical and safety considerations.
Consequently, reports of isolation of human monoclonal antibodies
with useful affinities, .gtoreq.10.sup.8 molar to specific antigens
are few McCabe et al. Cancer Research, (1988), 48, 4348-4353. Also,
isolation of anti-viral human monoclonal antibodies from donor
primed cells has proved to be unwieldy. For example, Gorny reported
that on]v 7 of 14,329 EBV transformed cultures of peripheral blood
mononuclear cells (PMBC's) from HIV positive donors resulted in
stable, specific anti-HIV antibody producing cell lines Gorny et
al. Proc. Natl. Acad. Sci. (1989), 86:1624-1628.
[0021] To date, most human anti-tumor antibodies have been
generated from peripheral blood lymphocytes (PBLs) Irie et al. Br.
J. Cancer, (1981), 44:262 or tumor draining lymph node lymphocytes
Schlom et al. Proc. Natl. Acad. Sci. (1980), 77:6841-6845, Cote et
al. Proc. Natl. Acad. Sci. (1983), 80:2096-9030 from cancer
patients. However, such antibodies often react with intracellular,
and thus therapeutically useless antigens Ho et al. In Hybridoma
Technology. Amsterdam (1988), 37-57 or are of the IgM class McCabe
et al. Cancer Research (1988), 48, 4348-4353, a class of antibodies
with lesser ability to penetrate solid tumors than IgGs. Few of
these human antibodies have moved to clinical trials Drobyski et
al. R.C. Transplantation (1991), 51, 1190-1196, suggesting that the
rescued antibodies may possess sub-optimal qualities. Moreover,
since these approaches exploit the testing donor primed B cells, it
is clear that these cells are not an optimal source for rescue of
useful monoclonal antibodies.
[0022] Recently, generation of human antibodies from primed donors
has been improved by stimulation with CD40 resulting in expansion
of human B cells Banchereau et al. F. Science (1991), 251:70, Zhang
et al. J. Immunol. (1990), 144, 2955-2960, Tohma et al. J. Immunol.
(1991), 146:2544-2552 or by an extra in vitro booster step primer
to immortalization Chaudhuri et al. Cancer Supplement (1994), 73,
1098-1104. This principle has been exploited to generate human
monoclonal antibodies to cytomegalovirus, Epstein-Barr Virus (EBV)
and Hemophilus influenza with cells from primed donors (42-44),
with a significantly higher yield than obtained with other methods
(32).
[0023] Moreover, to address the limitations of donor priming,
immunization and cultivation ex vivo of lymphocytes from healthy
donors has been reported. Some success in generating human
monoclonal antibodies using ex homine boosting of PBL cells from
primed donors has been reported Maeda et al. Hybridoma (1986),
5:33-41, Kozbor et al, J. Immunol. (1984), 14:23, Duchosal et al,
Nature (1992, 355:258-262. The feasibility of immunizing in vitro
was first demonstrated in 1967 by Mishell and Dutton Mishell et al.
J. Exp. Med (1967), 126:423-442 using murine lymphocytes. In 1973,
Hoffman successfully immunized human lymphocytes Hoffman et al.
Nature (1973), 243 :408-410. Also, successful primary immunizations
have been reported with lymphocytes from peripheral blood Luzzati
et al. J. Exp. Med. (1975), 144:573:585, Misiti et al. J. Exp. Med.
(1981), 154:1069-1084, Komatsu et al. Int. Archs. Allergy Appl.
Immunol. (1986), 80:431-434, Ohlin et al. C.A.K. Immunology (1989),
68:325 (1989) tonsils Strike et al. J. Immunol. (1978),
132:1789-1803 and spleens, the latter obtained from trauma Ho et
al. In Hybridoma Technology, Amsterdam (1988), 37-57, Boerner et
al. J. Immunol. (1991), 147:86-95, Ho et al. J. Immunol. (1985),
135:3831-3838, Wasserman et al. J. Immunol. Meth. (1986),
93:275-283, Wasserman et al. J. Immunol. Meth. (1986), 93:275-283,
Brams et al. Hum. Antibod. Hybridomas (1993), 4, 47-56, Brams et
al. Hum. Antibod. Hybridomas (1993), 4, 57-65 and idiopathic
thrombocytopenia purpura (ITP) patients Boerner et al. J. Immunol
(1991) 147:86-95. Brams et al. Hum. Antibod. Hybridomas (1993) 4,
47-56, Drams et al. Hum. Antibod. Hybridomas (1993), 4, 57-65,
McRoberts et al. "In Vitro Immunization in Hybridoma Technology".
Elsevier, Amsterdam (1988), 267-275, Lu et al. P. Hybridoma (1993),
12, 381-389.
[0024] In vitro immunization offers considerable advantages, e.g.,
easily reproducible immunizations, lends itself easily to
manipulation of antibody class by means of appropriate cultivation
and manipulation techniques Chaudhuri et al. Cancer Supplement
(1994), 73, 1098-1104. Also, there is evidence that the in vivo
tolerance to self-antigens is not prevalent during IVI Boerner et
al. J. Immunol. (1991), 147:86-95, Brams et al, J. Immunol. Methods
(1987), 98:11. Therefore, this technique is potentially applicable
for production of antibodies to self-antigens, e.g., tumor markers
and receptors involved in autoimmunity.
[0025] Several groups have reported the generation of responses to
a variety of antigens challenged only in vitro, e.g., tumor
associated antigens (TAAs) Boerner et al. J. Immunol. (1991),
147:86-95, Borrebaeck et al. Proc. Natl. Acad. Sci. (1988),
85:3995. However, unfortunately, the resulting antibodies were
typically of the IgM and not the IgG subclass McCabe et al. Cancer
Research (1988), 48, 4348-4353, Koda et al. Hum. Antibod.
Hybridomas, (1990), 1:15 and secondary (IgG) responses have only
been reported with protocols using lymphocytes from immunized
donors. Therefore, it would appear that these protocols only
succeed in inducing a primary immune response but require donor
immunized cells for generation of recall responses.
[0026] Also, research has been conducted to systematically analyze
cultivation and immunization variables to develop a general
protocol for effectively inducing human monoclonal antibodies in
vitro Boerner. J. Immunol. (1991) 147:86-95, Brams et al. Hum.
Antibod. Hybridomas (1993), 4, 47-56, Lu et al. Hybridoma (1993),
12, 381-389. This has resulted in the isolation of human monoclonal
antibodies specific for ferritin Boerner et al. J. Immunol. (1991),
147:86-95, induced by IVI of naive human spleen cells. Also, this
research has resulted in a protocol by which de novo secondary
(IgG) responses may be induced entirely in vitro Brams et al. Hum.
Antibod. Hybridomas (1993), 4, 57-65.
[0027] However, despite the great potential advantages of IVI, the
efficiency of such methods are severely restricted because of the
fact that immune cells grow in monolayers in culture vessels. By
contrast, in vivo germinal centers possessing a three-dimensional
structure are found in the spleen during the active phases of an
immune response. These three-dimensional structures comprise
activated T- and B-cells surrounded by antigen-presenting cells
which are believed by the majority of immunologists to compare the
site of antigen-specific activation of B-cells.
[0028] An alternative to the natural splenic environment is to
"recreate" or mimic splenic conditions in an immunocompromised
animal host, such as the "Severe Combined Immune Deficient" (SCID)
mouse. Human lymphocytes are readily adopted by the SCID mouse
(hu-SCID) and produce high levels of immunoglobulins Mosier et al.
Nature (1988), 335:256, McCune et al. L. Science (1988), 241,
1632-1639. Moreover, if the donor used for reconstitution has been
exposed to a particular antigen, a strong secondary response to the
same antigen can be elicited in such mice. For example, Duchosal et
al. Duchosal et al. Nature (1992), 355:258-262 reported that human
peripheral blood B-cells from a donor vaccinated with tetanus
toxoid 17 years prior could be restimulated in the SCID environment
to produce high serum levels, i.e., around 10.sup.4. They further
disclosed cloning and expression of the genes of two human anti-TT
antibodies using the lambda and the M13 phage combinatorial library
approach Huse et al. R.A. Science (1989), 246:1275 from the
extracted human cells. The reported antigen affinities of the
antibodies were in the 10.sup.8-10.sup.9/M range. However, this
protocol required donor primed cells and the yield was very low,
only 2 clones were obtained from a library of 370,000 clones.
[0029] Therefore, previously the hu-SPL-SCID mouse has only been
utilized for producing human monoclonal antibodies to antigens
wherein the donor has either been efficiently primed naturally or
by vaccination Sthli et al. Methods in Enzymology (1983), 92,
26-36, which in most cases involves exposure to viral or bacterial
antigens. Also, the reported serum titer levels using the hu-SCID
animal model are significantly lower than what is typically
achieved by immunization of normal mice.
[0030] Additionally, two protocols have been described by which
induction of primary antibody responses can be followed by
induction of secondary antibody responses in hu-SCID mice using
naive human lymphocytes. However, use of both of these protocols
are substantially restricted. In the first protocol, primary
responses are induced in hu-SCID mice into which human fetal liver,
thymus and lymph nodes have been surgically implanted. However,
this method is severely restricted by the limited availability of
fetal tissue, as well as the complicated surgical methodology of
the protocol McCune et al. L. Science (1988), 241, 1632-1639. In
the second protocol, lethally irradiated normal mice were
reconstituted with T- and B-cell depicted human bone marrow and
SCID mouse bone marrow cells Lubin et al. Science. (1991). 252.427.
However, this method is disadvantageous because it requires a four
month incubation period. Moreover, both protocols result in very
low antibody titers, i.e., below 10.sup.4.
[0031] Also, Carlson et al. Carlsson et al. J. Immunol. (1992),
148:1065-1071 described in 1992 an approach using PBMCs from an
antigen (tetanus toxoid) primed donor. The cells were first
depleted of macrophages and NK cells before being subjected to a
brief in vitro cultivation and priming period prior to transfer
into a SCID mouse. The hu-SPL-SCID mouse was then boosted with
antigen. This method was reported to result in average TT specific
human IgG titers of 10.sup.4 in the hu-SPL-SCID serum, with up to
5.times.10.sup.5 reported.
[0032] Production of human monoclonal antibodies further typically
requires the production of immortalized B-cells, in order to obtain
cells which secrete a constant, ideally permanent supply of the
desired human monoclonal antibodies. Immortalization of B-cells is
generally effected by one of four approaches: (i) transformation
with EBV, (ii) mouse-human heterofusion, (iii) EBV transformation
followed by heterofusion, and (iv) combinatorial immunoglobulin
gene library techniques.
[0033] EBV transformation has been used successfully in a number of
reports, mainly for the generation of anti-HIV antibodies Gorny. et
al. Proc. Natl. Acad. Sci. (1989), 86:1624-1628, Posner. et al. J.
Immunol. (1991), 146:4325-32. The main advantage is that
approximately one of every 200 B-cells becomes transformed.
However, EBV transformed cells are typically unstable, produce low
amounts of mainly IgM antibody clone poorly and cease making
antibody after several months of culturing Heterofusion Carrol. et
al. J. Immunol. Meth. (1986), 89:61-72 is typically favored for
producing hybridomas which secrete high levels of IgG antibody.
Hybridomas are also easy to clone by limiting dilution. However, a
disadvantage is the poor yield, i.e., .ltoreq.1 hybridomas per
20,000 lymphocytes Boerner. et al. J. Immunol. (1991), 147:86-95,
Ohlin. et al. C.A.K. Immunology (1989), 68:325, Xiu-mei et al. Hum.
Antibod. Hybridomas (1990), 1:42, Borrebaeck C.A.K. Abstract at the
"Second International Conference" on "Human Antibodies and
Hybridomas." Apr. 26-28, 1992, Cambridge, England. Combining EBV
transformation followed by heterofusion offers two advantages: (i)
human B-cells fuse more readily to the fusion partner after EBV
transformation, and (ii) result in more stable, higher producing
hybridomas Ohlin. et al. Immunology (1989), 68:325, Xiu-mei. et al.
Hum. Antibod. Hybridomas (1990), 1:42, Borrebaeck C.A.K. Absract at
the "Second International Conference" on "Human Antibodies and
Hybridomas." Apr. 26-28, 1992, Cambridge, England. The advantage of
the final technique, i.e., combinatorial immunoglobulin gene
library technique is the fact that very large libraries can be
screened by means of the M13 Fab expression technology Huse. et al.
Science (1989), 246:1275, William Huse. Antibody Engineering: A
Practical Guide. Borrebaeck C.A.K. ed. 5:103-120 and that the genes
can easily be transferred to a production cell line. However, the
yield is typically extremely low, on the order of 1 per 370,000
clones Duchosal. et al. Nature (1992), 355:258-262.
[0034] Thus, based on the foregoing, it is apparent that more
efficient methods for producing human monoclonal antibodies, in
particular antibodies specific to RSV, would be highly
advantageous. Moreover, it is also apparent that human antibodies
specific to the RSV F-protein having superior binding affinity,
specificity and effector functions than those currently available
would also be highly desirable.
OBJECTS OF THE INVENTION
[0035] It is an object of the invention to provide improved methods
for producing human antibodies of high titers which are specific to
desired antigens.
[0036] It is a more specific object of the invention to provide a
novel method for producing high titer human antibodies which
comprises (i) antigen priming of naive human splenocytes in vitro,
(ii) transferral of in vitro antigen primed splenocyte cells to an
immunocompromised donor, e.g., a SCID mouse, and (iii) boosting
with antigen.
[0037] It is another specific object of the invention to provide
improved methods for producing human monoclonal antibodies which
are specific to respiratory syncytial virus (RSV), and in
particular the RSV fusion (F) protein.
[0038] It is another object of the invention to provide an improved
method for producing EBV immortalized B-cells which favors the
formation of EBV immortalized B-cells which predominantly secrete
IgG.
[0039] It is a more specific object of the invention to provide an
improved method for producing EBV immortalized human B-cells which
predominantly secrete IgG's which comprises:
[0040] (i) antigen priming of naive human splenocytes in vitro,
[0041] (ii) transferral of such in vitro antigen primed naive
splenocytes to an immunocompromised donor, e.g., a SCID mouse.
[0042] (iii) boosting the immunocompromised donor with antigen;
[0043] (iv) isolation of human antibody producing B-cells from the
antigen boosted immunocompromised donor, e.g., SCID mouse; and
[0044] (v) EBV transformation of said isolated human antibody
producing B-cells.
[0045] It is another object of the invention to provide novel
compositions containing EBV transformed human B-cells obtained from
SCID mice which predominantly secrete human IgG's.
[0046] It is a more specific object of the invention to provide
novel compositions containing EBV transformed human B-cells which
predominantly secrete human IgG's produced by a method
comprising:
[0047] (i) antigen priming of naive human splenocytes in vitro;
[0048] (ii) transferral of resulting in vitro antigen primed naive
splenocytes to an immunocompromised animal donor, e.g., a SCID
mouse;
[0049] (iii) boosting the immunocompromised animal donor, e.g.,
SCID mouse, with antigen;
[0050] (iv) isolation of human antibody producing B-cells from the
antigen boosted immunocompromised donor, e.g., SCID mouse; and
[0051] (v) EBV transformation of said isolated human antibody
producing B-cells.
[0052] It is another specific object of the invention to produce
RSV neutralizing human monoclonal antibodies having an affinity to
the RSV F-protein of .ltoreq.2.times.10.sup.-9 Molar.
[0053] It is still another object of the invention to provide EBV
immortalized cell lines which secrete RSV neutralizing human IgG
monoclonal antibodies having an affinity to the RSV F antigen of
.ltoreq.2.times.10.sup.9 Molar.
[0054] It is a more specific object of the present invention to
provide two EBV immortalized cell lines, RF-2 and RF-1, which
respectively secrete human monoclonal antibodies also referred to
as RF-2 and RF-1 which neutralize RSV in vivo and each possess an
affinity for the RSV F-protein of .ltoreq.2.times.10.sup.-9.
[0055] It is another object of the invention to transfect
eukaryotic cells with DNA sequences encoding the RF-1 or RF-2 heavy
and light variable domains to produce transfectants which secrete
human antibodies containing the variable domain of RF-1 or
RF-2.
[0056] It is a more specific object of the invention to provide
transfected CHO cells which express the RF-1 or RF-2 heavy and
light variable domains.
[0057] It is another object of the invention to treat or prevent
RSV infection in humans by administering a therapeutically or
prophylactically effective amount of RSV neutralizing human
monoclonal antibodies which are specific to the RSV F-protein and
which exhibit a Kd for the RSV F-protein of
.ltoreq.2.times.10.sup.-9 molar.
[0058] It is a more specific object of the invention to treat or
prevent RSV infection in humans by administering a therapeutically
or prophylactically effective amount of RF-1 or RF-2 or a human
monoclonal antibody expressed in a transfected eukaryotic cell
which contains and expresses the variable heavy and light domains
of RF-1 or RF-2.
[0059] It is another object of the invention to provide vaccines
for treating or preventing RSV infection which comprise a
therapeutically or prophylactically effective amount of human
monoclonal antibodies specific to the RSV F-protein having a Kd for
the RSV F-protein of .ltoreq.2.times.10.sup.-9 molar, which
neutralize RSV in vitro, in combination with a pharmaceutically
acceptable carrier or excipient.
[0060] It is a more specific object of the invention to provide
vaccines for treating or preventing RSV infection which comprise a
therapeutically or prophylactically effective amount of RF-1 or
RF-2 or human monoclonal antibodies derived from a transfected
eukaryotic cell which contains and expresses DNA sequences encoding
the variable heavy and light domains of RF-1 or RF-2, in
combination with a pharmaceutically acceptable carrier or
excipient.
[0061] It is another object of the present invention to provide a
method for diagnosis of RSV infection by assaying the presence of
RSV in analytes, e.g., respiratory fluids using human monoclonal
antibodies which possess an affinity for the RSV fusion (F) protein
or .ltoreq.2.times.10.sup.-9 molar.
[0062] It is still another object of the invention to provide novel
immunoprobes and test kits for detection of RSV infection which
comprise human monoclonal antibodies specific to the RSV F-protein,
which possess an affinity for the RSV F protein of
.ltoreq.2.times.10.sup.-9 molar, which antibodies are directly or
indirectly attached to a suitable reporter molecule, e.g., an
enzyme or a radionuclide. In the preferred embodiment these human
monoclonal antibodies will comprise RF-1 or RF-2 or recombinant
human monoclonal antibodies produced in eukaryotic cells, e.g., CHO
cells, which are transfected with the variable heavy and light
domains of RF-1 or RF-2.
BRIEF DESCRIPTION OF THE INVENTION
[0063] The present invention in its broadest embodiments relates to
novel methods for making human antibodies to desired antigens,
preferably antigens involved in prophylaxis, treatment or detection
of a human disease condition. These methods comprise antigen
priming of native human splenocytes in vitro, transferral of the
resultant in vitro antigen primed splenocyte cells to an
immunocompromised donor, e.g., a SCID mouse, and boosting said
immunocompromised donor with antigen.
[0064] The present invention also relates to methods for producing
Epstein-Barr Virus (EBV) immortalized B-cells which favors the
production of cells which secrete IgGs comprising: antigen priming
of naive human splenocytes in vitro; transferral of resultant in
vitro antigen primed splenocytes to an immunocompromised donor,
e.g., a SCID mouse; boosting the immunocompromised donor with
antigen; isolating human antibody secreting B-cells, preferably IgG
secreting, from the antigen boosted immunocompromised donor, e.g.,
SCID mouse; and EBV transformation of said isolated human antibody
secreting cells.
[0065] The present invention more specifically relates to improved
methods for making human antibodies to RSV, in particular the RSV
fusion (F) protein which exhibit high affinity to RSV F-protein and
which also neutralize RSV infection, as well as the human
monoclonal antibodies which result from these methods. This is
preferably effected by priming of naive human splenocytes in vitro
with Il-2 and optionally the RSV F-protein; transferral of the
resultant in vitro primed splenocyte cells to an immunocompromised
donor, e.g., a SCID mouse, and boosting with RSV F-protein to
produce human B-cells which secrete neutralizing anti-RSV F-protein
human antibodies having high affinity to the RSV F-protein. i.e.,
.ltoreq.2.times.10.sup.-9 molar.
[0066] The resultant B-cells are preferably immortalized so as to
provide a constant stable supply of human anti-RSV F-protein
monoclonal antibodies. In the preferred embodiment B-cells are
isolated from the antigen boosted SCID mouse and transformed with
EBV virus to produce EBV transformed human B-cells which
predominantly secrete human IgGs.
[0067] These cells are then cloned to select EBV transformed cell
lines which secrete human monoclonal antibodies having high
affinity to RSV F-protein, i.e. .ltoreq.10.sup.-7 and preferably
.ltoreq.2.times.10.sup.-- 9 molar.
[0068] The present invention also relates to the use of such
anti-RSV F-protein human monoclonal antibodies as therapeutic
and/or prophylactic, as well as diagnostic agents. As noted, the
subject methods result in the generation of human monoclonal
antibodies which exhibit high affinity to the RSV F-protein, i.e.,
which possess a Kd for the RSV F-protein of
.ltoreq.2.times.10.sup.-9 molar, which also neutralize RSV in
vitro. Therefore, these antibodies are ideally suited as
prophylactic and therapeutic agents for preventing or treating RSV
infection given the fact that the RSV F-protein is a surface
protein which is highly conserved across different RSV isolates.
Also, given the high affinity and specificity of the subject human
monoclonal antibodies to RSV F-protein, they also may be used to
diagnose RSV infection.
[0069] More specifically, the present invention provides two
particular human monoclonal antibodies to the RSV F-protein, i.e.,
RF-1 and RF-2, as well as recombinant human antibodies derived
therefrom which are preferably produced in CHO cells, which cells
have been transfected with DNA sequences encoding the variable
heavy and light domains of RF-1 or RF-2. These antibodies are
particularly useful as prophylactic and/or therapeutic agents for
treatment or prevention of RSV infection. Moreover, these
antibodies are useful as diagnostic agents because they bind the
RSV F-protein with high affinity, i.e., each possess affinity for
the RSV F-protein of .ltoreq.2.times.10.sup.-9. They are especially
useful as therapeutic agents because of their high affinity and
specificity for the RSV F-protein, and their ability to effectively
neutralize RSV infection in vitro.
BRIEF DESCRIPTION OF THE FIGURES
[0070] FIG. 1 depicts immunoblot of F protein with anti-F protein
hu-SPL-SCID sera: Notice (A) and denatured (B) F protein was run in
SDS-PAGE and transferred to nitrocellulose by Western blot.
Nitrocellulose strips were reacted with positive control mouse
anti-F protein MAb (lanes 1A and 1B), negative control hu-SPL-SCID
serum anti-TT (lanes 2A and 2B) and hu-SPL-SCID anti-F protein sera
from mice #6 (lanes 3A and 3B), #3 (lanes 4A and 4B) and #4 (lanes
#5A and 5B).
[0071] FIG. 2 depicts immunofluorescence of HEP-2 cells with
hu-SPL-SCID sera anti-F protein. Uninfected (left) and RSV-infected
HEp-2 cells were reacted with serum from hu-SPL-SCID mouse #6
diluted 1:50 taken 15 days after boost. Binding was revealed GAH
IgG-FITC.
[0072] FIG. 3 depicts the reactivity of purified RF-1 and RF-2 to
plastic bound affinity purified RSV F-protein. The reactivity of a
reference human anti-RSV serum, LN, is also recorded. The ELISA
plate was coated with 50 ng RSV F-protein.
[0073] FIG. 4 depicts IEF of RF-1 (lane 2) and RF-2 (lane 3) human
MAb purified from tumor cell supernatants. IEF was performed on a
pH gradient of 3-10. Lane 1 represents the pi standards.
[0074] FIG. 5 depicts indirect Immunofluorescence flow cytometry
assay of HEp-2 cells and HEp-2-cells infected with RSV,
1.times.10.sup.6, incubated with various amounts of RF-1 and
subsequently with a FITC-labeled GAH IgG. The relative average
intensity of the entire population is recorded.
[0075] FIG. 6 depicts NEOSPLA vector used for expression of human
antibodies. CMV=cytomegalovirus promoter. BETA=mouse beta globin
major promoter. BGH=bovine growth hormone polyadenylation signal.
SVO=SV40 origin of replication. N1=Neomycin phosphotransferase exon
1. N2=Neomycin phosphotransferase exon 2. LIGHT=Human
immunoglobulin kappa constant region. Heavy=Human immunoglobulin
gamma 1 or gamma 4 PE constant region. L=leader. SV=SV40
polyadenylation region.
[0076] FIG. 7a depicts the amino acid and nucleic acid sequence of
the variable light domain of RF-1.
[0077] FIG. 7b, depicts the amino acid and nucleic acid sequence of
the variable heavy domain of RF-1.
[0078] FIG. 8a depicts the amino acid and nucleic acid sequence of
the variable light domain of RF-2.
[0079] FIG. 8b depicts the amino acid and nucleic acid sequence of
the variable heavy domain of RF-2.
[0080] FIG. 9a depicts the amino acid and nucleic acid sequence of
the RP-1 light chain, the leader sequence, and the human kappa
constant domain sequence.
[0081] FIG. 9b depicts the amino acid and nucleic acid sequence of
the RF-1 heavy chain, a leader sequence, and the human
gamma/constant domain sequence.
[0082] FIG. 9a depicts the human constant domain sequence.
[0083] FIG. 10 depicts schematically the NEOSPLA vector, referred
to as NSKE1 containing the RF-1 nucleic acid sequence and human
gamma/constant domain set forth in FIGS. 9a-9c.
[0084] FIG. 11a depicts the amino acid and nucleic acid sequence of
the RF-2 light chain, leader sequence, and human Kappa constant
domain.
[0085] FIG. 11b depicts the amino acid and nucleic acid sequence of
the RF-2 heavy chain, leader sequence, and human gamma/constant
domain.
[0086] FIG. 11c depicts the amino acid and nucleic acid sequence of
the human gamma/constant domain.
[0087] FIG. 12 depicts schematically the NEOSPLA expression vector,
referred to as NSKG1 containing the RF-2 nucleic acid sequences and
human gamma/constant domain sequences set forth in FIGS.
11a-11c.
DETAILED DESCRIPTION OF THE INVENTION
[0088] As discussed, the present invention provides a novel highly
efficient method for producing human monoclonal antibodies to
desired antigens, preferably antigens which are involved in a human
disease condition. Antigens involved in a human disease condition
typically will be surface antigens which comprise suitable
therapeutic targets for antibodies. For example, this includes
surface proteins of viruses and antigens expressed on the surface
of human cancer cells. In the preferred embodiment, the surface
antigen will comprise the fusion protein (F-protein) of RSV.
[0089] Human disease conditions includes by way of example viral
infections, e.g., RSV, papillomavirus, hepatitis, AIDS, etc.,
cancer, bacterial infections, yeast infections, parasite infection,
e.g., malaria, etc. Essentially, human disease conditions are
intended to embrace any human disease condition potentially
preventable or treatable by the administration of human monoclonal
antibodies specific to a particular antigen.
[0090] The subject method for producing human monoclonal antibodies
essentially involves the combination of in vitro priming of naive
human spleen cells, transferral of these spleen cells to
immunocompromised donors, i.e., SCID rice, followed by antigen
boosting of SCID mice which have been administered said spleen
cells. It has been surprisingly discovered that the combination of
these two known methods for producing human antibodies results in
synergistic results. Specifically, it results in very enhanced
antigen specific responses to the immunizing antigen as well as
very high titers of human monoclonal antibodies of the IgG isotype.
More specifically, it has been found that this combination results
in unprecedented high secondary responses: the human IgG responses
in the hu-SPL-SCID serum were 10-fold higher than those resulting
from transfer of naive cells in SCID and specific antibody
responses were 1000-fold increased. Also, the resulting antibodies
are found to be of high affinity and specificity comparable to
antibodies produced in experimentally hyperactive immune animals.
It has also been found that when using naive spleen cells, to
obtain such unexpected results it is necessary to challenge with
antigen both in vitro and after introduction into the resultant
hu-SPL-SCID mouse. Also, it is preferable but not essential to
introduce additional fresh non-primed spleen cells to the
hu-SPL-SCID donor just prior to antigen boosting. This has been
found to result in still further enhancement of the antibody
response.
[0091] The present invention was developed after an optimal in
vitro primary and boosting protocol for the generation of secondary
responses from naive human spleen cells had previously been
disclosed Brams et al. Hum. Antibod. Hybridomas (1993), 4, 57-65.
The protocol Brams et al. Hum. Antibod. Hybridomas (1993), 4, 57-65
was found to provide for antigen specific IgG responses about 2 to
10 times higher than obtained from cultures subjected to one
antigen challenge. This in vitro immunization (IVI) protocol was
developed and optimized using very different antigens, i.e., horse
ferritin (HoF), calmodulin, prostate specific antigen (PSA), mouse
IgG, transferrin, Keyhole Limpet Hemocyanine (KLH) di-nitro-phenyl
(DNP) bound to T-cell dependent protein carriers and RSV fusion (F)
protein.
[0092] Essentially, this protocol involves restimulation of the
spleen cell culture on day 1 after culturing is started with
antigen together with autologous spleen cells in a 1:1 ratio. It
has been demonstrated that the IgG responses measured using this
protocol were the result of repeated antigen exposure, and are
equivalent to secondary responses.
[0093] These experiments further demonstrated that intact spleens
were the optimal source of lymphocytes, including trauma- and ITP
spleens. By contrast, peripheral blood lymphocytes (PBLs), and
cells from tonsils or lymph nodes proved to be inferior for
induction of antigen-specific responses. Moreover, depletion or
neutralization of any cellular component resulted in inferior
responses Boerner et al. J. Immunol. (1991), l47:86-95. Also, these
experiments indicated that for a given spleen cell preparation and
antigen, that there exists a unique optimal antigen
concentration.
[0094] Therefore, having established an optimal in vitro primary
and boosting protocol for generation of secondary responses from
naive human spleen cells; it was conceived to test this protocol in
combination with previous in vivo methods for producing human
monoclonal antibodies, i.e., the SCID mouse. It was unknown prior
to testing what effect, if any, administration of antigen primed
spleen cells would have on the resultant production of human
monoclonal antibodies to a given antigen by the SCID mouse or the
ability of human lymphocytes to be maintained therein. However, it
was hoped that this would provide for enhanced antigen boost and
enhanced expression of the in vitro antigen primed naive spleen
cells.
[0095] In this regard, it has been previously reported that human
lymphocytes can establish themselves and remain alive for several
months in SCIDs McCune et al. Science (1988), 241, 1632-1639, Lubin
et al. Science (1991), 252:427. However, as noted, surpa previous
methods using SCIDs or human monoclonal antibodies to antigens have
used cells from donors previously exposed to the antigen either
naturally or by vaccination and have typically not resulted in high
human antibody titers.
[0096] Quite surprisingly, it was found that combination of in
vitro primary and boosting protocol for generation of secondary
responses from human naive spleen cells Brams et al. Hum. Antibod.
Hybridomas (1993), 4, 57-65 in the hu-SCID model resulted in
synergistic results as evidenced by highly significant antigen
specific IgG responses to the immunizing antigen.
[0097] Further, it was also discovered that the combination of
these methods (using horse ferritin (HoF) as a model antigen)
that:
[0098] (i) introduction of an in vitro immunization step prior to
transfer into SCIDs is essential for reliably inducing significant
antigen-specific responses;
[0099] (ii) human cells must be transferred into the peritoneum to
achieve optional maintenance of human splenocytes in the SCID
mouse;
[0100] (iii) optimal in vitro cultivation is about three days;
[0101] (iv) use of IL-2 and optionally IL-4 or IL-6 in vitro
results in highest antibody titers of antigen specific responses in
the hu-SPL-SCID mice;
[0102] (v) the hu-SPL-SCID in mouse is preferably boosted with
antigen emulsified in an adjuvant, e.g., Freunds Complete Adjuvant
(FCA) and/or Alum;
[0103] (vi) killing or neutralization of NK cells, whether of
murine or human origin surprisingly has no benefit on antibody
production. However, it was found that use of the SCID-beige mouse,
an NK low line, as the host for the in vitro primed cells, provides
for a superior response when boosting is effected using a
combination of adjuvants, i.e., FCA and Alum.
[0104] (vii) spleens, but not lymph nodes of 1/3 of the hu-SPL-SCID
mice were enlarged up to 25 times compared to normal SCIDs.
Moreover, of these up to two-thirds of the cells in such spleens
tested positive for normal human lymphocyte membrane markers.
[0105] More specifically, the subject method comprises priming
naive human splenocytes in vitro, for about 1 to 10 days,
preferably about 3 days with antigen, transferral of the primed
cells to a SCID mouse, and subsequently boosting the mouse with
antigen about 3 to 14 days later, preferably about 7 days later.
This has been demonstrated to result in high antigen specific IgG
responses in the sera of the resultant hu-SPL-SCID mouse from about
day 24 onwards. Typically, the serum end-dilution titers are about
10.sup.6 (half maximal responses at approximately 50 mg IgG/ml)
using a naive antigen, horse ferritin and 10.sup.7 (half maximal
responses at approximately 5 mg IgG/ml) when a recall response is
induced with a viral antigen, i.e., the fusion protein of RSV. It
is expected based on these results that similar responses will be
obtained using other antigens.
[0106] As noted, optimal induction of the desired antibody response
requires antigen challenge of the human cells both in vitro and in
vivo in the hu-SPL-SCID mouse. It was also found that IL-2 is
necessary during in vitro priming, and that IL-4 and IL-6
administered concomitantly with IL-2 further enhanced responses in
the hu-SPL-SCID mouse. Moreover, SCID reconstitution is facilitated
but was not dependent on concomitant intraperitoneal administration
of irradiated allogeneic lymphocytes.
[0107] It was further discovered that there was significant
variation in the antibody responses from one spleen to another. For
example, some spleens required concomitant administration of
antigen and fresh autologous spleen cells on day 10 for generation
of antigen specific antibody responses. Also, it was found that the
level of antibody responses varied somewhat in different
hu-SPL-SCID mice. However, based on the teachings in this
application one skilled in the art can readily select suitable
conditions so as to produce an optimal antigen specific antibody
response to a given antigen.
[0108] For example, by testing several different spleen
preparations for their ability to produce specific antibody in
culture, e.g., after ten days of in vitro immunization, one can
identify the highest responder. Moreover, since large numbers of
cells are prepared and frozen from each spleen, it is possible to
set up a new in vitro immunization for three days from the selected
spleen and follow up with transfer in SCID mice. By contrast, other
cellular materials, e.g., peripheral blood cells are not amenable
to such optimization, given the fairly limited amount of PBL's
recoverable from one donor in a single transferral.
[0109] As previously noted, in contrast to previous reports, it was
found that for the present method, when peripheral blood cells were
used, neutralization of human NK activity had no effect on spleens.
Moreover, neutralization of SCID NK cells with complement fixing
anti-asialo GMI antibodies decreased antigen-specific IgG
responses. By contrast, use of the SCID/beige mouse, a strain with
reduced NK cell levels did provide for significantly increased
antigen specific IgG responses compared to normal SCID.
[0110] Additionally, two immunization routes, intravenous (IV) and
intraperitoneal (IP) were compared for their ability to provide for
reconstitution of SCID mice, i.e., maintenance of spleen cells
therein and the production of human antibodies. It was found that
the peritoneum was the optimal site of cell transfer and
immunization. Moreover, date, transfer of cells intravenously has
never been found to result in repopulation when more than 0.01
.mu.g/ml human IgG was detected in the mouse serum.
[0111] It was also found that the resultant IgG concentrator
directly correlated with the number of transferred human cells. For
example, repopulation of SCIDs was 92% when 5.times.10.sup.6 in
vitro primed spleen cells were injected intraperitoneally, and
virtually 100% when 5.times.10.sup.7 in vitro primed spleen cells
were injected intraperitoneally. One skilled in the art can, based
on the teachings in this application, select an optimal number of
injected in vitro primed spleen cells. In general, this will range
from about 10.sup.4 to about 10.sup.8 cells, more preferably about
10.sup.6 to 10.sup.8 cells, and most preferably at least about
10.sup.7 to 10.sup.8 cells.
[0112] It was also found that the antibody response is affected by
the presence of the particular adjuvant. More specifically, it was
observed that maximal human antibody responses were achieved when
the hu-SPL-SCID mice were boosted with antigen emulsified in
Complete Freund's adjuvant (CFA) or using CFA and Alum together.
Tests in hu-SPC-SCID boosted with ferritin showed that CFA was a
better adjuvant than Alum, eliciting 33 mg and 13 mg/ml human IgG
respectively. Combination of CFA and Alum did not improve response
in SCID. However, use of these adjuvants in SCID/beige-hu (which
mice comprise a mutation resulting in reduced NK cell activity)
results in 8-10 fold increase in IgG production compared to CFA
alone. However, it is expected that other adjuvants, or
combinations thereof, may also produce similar or even enhanced
results. The highest total human IgG concentrate using Complete
Freund's adjuvant and Alum together was about 10 mg/ml, and the
specific highest IgG concentration was about 500 .mu.g/ml
monoclonal antibody equivalent.
[0113] Using this method with ferritin produced polyclonal antibody
responses comparable to that obtained in hyperimmune goats, rabbits
and pigs in terms of specificity, reactivity, and use of Ig chain
isotypes. The hu-SPL-SCID serum antibodies were mostly IgG, bound
only to cells from tissues high in ferritin, and not to cells from
ferritin-low or ferritin-negative tissues, and recognized both
natural ferritin as well as denatured ferritin in a Western blot.
These results are extremely unexpected both in antibody
concentration and the antigen specificity of human antibodies
obtained. Moreover, similar results are obtained using different
antigens.
[0114] After injection, it is found that human cells tend to
accumulate at two sites, i.e., the peritoneum and the mouse spleen.
While no more than about 7% of human cells were found in the blood,
the lymph nodes and the liver were of human antigen, between 25%
and 33% of the cells were of human origin in enlarged spleens and
in the occasional tumors in some animals. These human cells were
almost exclusively B and T-cells, with a small amount of CD14.sup.+
cells, mostly monocytes, in the enlarged spleens.
[0115] These results were determined by flow cytometry
investigating spleen, lymph nodes, liver and peritoneum. In those
cases that the human splenocytes repopulated the spleen, it was
found that the spleens were often enlarged, up to 25 times the size
of native SCID spleens. The human cells constituted up to about 30%
of the total number of cells in the spleen when measured
immediately after extraction, with the remainder of unknown origin.
However, after 3 days in culture, a majority of surviving cells
were found to be of human origin as the cells bound antibodies and
exhibited no cross reactivity with mouse lymphocytes.
[0116] It was further observed that the reconstituted mice could be
divided into two groups, those with normal size spleens and those
with enlarged spleens. Hu-SPI-SCID mice with enlarged spleens,
i.e., 25 times normal size had human IgG levels approximately 150
times higher than those with normal spleens, and the level of
antigen specific human IgG was approximately 10,000 higher in those
with normal size spleens which were treated similarly. It was also
found that the relative affinity of the antigen specific response
increased throughout the response, indicating that a higher
percentage of the total immunoglobulin pool was comprised of
antibodies having better binding properties. These results indicate
that the system is antigen driven.
[0117] These results are highly significant and indicate that it
should generally be possible to rescue human cells from the
hu-SPL-SCID and use same for generating combinatorial human
antibody gene libraries thereby resulting in human monoclonal
antibodies of high affinity and specificity that may be used
clinically and/or diagnostically.
[0118] More specifically, the present invention provides novel
human monoclonal antibodies to the RSV F-protein which exhibit high
affinity to the RSV F-protein, i.e., .ltoreq.2.times.10.sup.-9
molar protein and which human monoclonal antibodies are capable of
neutralizing RSV in vitro. The present invention further provides
methods for manufacture of such human monoclonal antibodies to the
RSV F-protein.
[0119] In general, such human antibodies are produced by in vitro
immunization of naive human splenocytes with RSV F-protein,
transferral of such in vitro immunized human splenocytes into an
immunocompromised animal donor, i.e., a SCID mouse, boosting said
animal with RSV F-protein, and isolation of human B cells therefrom
which secrete human monoclonal antibodies to the RSV F-protein,
immunization of said human B cells, and cloning of said immunilized
B cells to select cells which secrete human monoclonal antibodies
having a high affinity to RSV F-protein, preferably at least
10.sup.-7 molar and more preferably .ltoreq.2.times.10.sup.-9
molar.
[0120] As discussed, it has been discovered that the combination of
in vitro immunization, in particular of human splenocytes, i.e.,
which have or have not been previously exposed to the RSV F-antigen
and transferred to an immunocompromised animal donor, i.e., SCID
mouse which is then boosted with RSV F-protein antigen affords
significant advantages relative to conventional methods for making
human antibodies in SCID mice. Namely, it provides for very high
antibody titers, i.e., the highest anti-F protein titers being
about 10.sup.-7, high IgG concentrations, i.e., about 3 mg/ml for
the highest responders. Moreover, this method allows for the
production of human antibodies having highly advantageous
combinations of properties, i.e., which exhibit both high affinity
to the RSV F-protein and which moreover display substantial in
vitro neutralizing activity.
[0121] As described in greater detail in the examples, the present
inventors have isolated two human monoclonal antibodies, RF-1 which
exhibits an affinity constant Ka to the F-protein, Ka=10.sup.10 M
when determined by plasmon resonance, and RF-2 which exhibits an
affinity constant of Ka=5.times.10.sup.8 M when determined by
titration microcolorimetry. Also, the calculated Kd of RF-2 was
2.times.10.sup.-9 M. Moreover, both of these antibodies display in
vitro virus neutralizing properties at concentrations of between 8
and 120 ng/ml as well as exhibiting an ability to inhibit the
fusion of previously RSV infected cells. Significantly, this in
vitro neutralization activity is applicable against a broad variety
of different wild and laboratory RSV strains, both of the A and B
virus types.
[0122] Given these results, i.e. the high affinity of the subject
antibodies to the RSV F-protein, which comprises a surface protein
expressed on the surface of RSV infected cells, as well as ability
to effectively neutralize the virus, and to inhibit fusion of
virally infected cells, the subject human monoclonal antibodies
should be suitable both as therapeutic and prophylactic agents,
i.e., for treating or preventing RSV infection in susceptible or
RSV infected subjects. As noted, RSV infection is particularly
prevalent in infants, as well as in immunocompromised persons.
Therefore, the subject monoclonal antibodies will be particularly
desirable for preventing or treating RSV infection in such
subjects.
[0123] Moreover, given the human origin of the subject monoclonal
antibodies, they are particularly suitable for passive
immunotherapy. This is because they likely will not be subject to
the potential constraints of murine monoclonal antibodies, i.e.,
HAMA responses and absence of normal human effector functions. In
fact, based on the characterization of the subject human monoclonal
antibodies (described in examples infra), it would appear that both
RF-1 and RF-2 exhibit substantially greater in vitro neutralization
activity and ability to inhibit fusion of previously infected RSV
cells than previously disclosed murine or chimeric anti-F protein
antibodies and human Fab fragments derived from recombinational
libraries. Also, given their human origin it is expected that such
neutralization activity will be maintained upon in vivo
administration.
[0124] Another advantage of the subject human monoclonal antibodies
is their substantial absence of reactivity with normal tissues. As
shown infra, the subject human monoclonal antibodies bind only to
RSV infected cells, not to cell lines representing lymphoid tissue,
liver, prostrate or laryngeal epidermis. Therefore, these
antibodies upon in vivo administration should efficiently bind to
RSV infected cells and not to normal tissues and thereby should
provide for neutralization of RSV infection. Further, based on the
disclosed properties, it is expected that the subject human
monoclonal antibodies to the RSV F-protein may be used to protect
susceptible hosts against RSV infection.
[0125] More specifically, the subject human monoclonal antibodies
to the RSV F-protein are produced by obtaining human splenocytes,
e.g., from a trauma or ITP source, which are then primed in vitro.
This essentially comprises culturing said naive human splenocytes
in vitro in the presence of a sufficient amount of Il-2 and
optionally RSV F-protein to induce immunization, also referred to
as antigen priming. In general, the amount of RSV F-protein that
may be used ranges from about 1 to 200 ng/ml RSV protein, more
preferably 10 to 100 ng/ml, and most preferably about 40 ng/ml of
RSV F-protein.
[0126] The in vitro culture medium will preferably also contain
lymphokines, in particular IL-2 and optionally IL-4 and IL-6. The
amount thereof will be amounts which provide for immunization and
the desired production of antibody producing cells. For example, in
the case of IL-2, an amount ranging from about 5 to 200 IU/ml, and
more preferably from about 10 to 50 IU/ml, most preferably 25 IU/ml
is suitable.
[0127] This culture medium will also contain other constituents
necessary to maintain the viability of human splenocytes in
culture, e.g., amino acids and serum. In the examples, a culture
medium containing IMDM supplemented with 2 mM glutamine, 2 mM
sodium pyruvate, non-essential amino acids, 25 IU/ml IL-2 and 20%
fetal calf serum was used. However, one skilled in the art, based
on the teachings in this application, can vary the culture medium
using, routine optimization.
[0128] The in vitro immunization step will be effected for a time
sufficient to induce immunization. In general, the cells will be
cultured in the presence of RSV F-protein from about 1 to 10 days
and preferably for about 3 days. However, this will vary dependent,
e.g., upon the particular spleen sample. Similarly, one skilled in
the art, based on the teachings in this application and using known
methods may determine a suitable duration for the in vitro
immunization step.
[0129] The antigen used for the in vitro immunization will
preferably be a purified RSV F-protein so as to ensure that the
splenocytes are immunized against the F-protein and not against
other useless (non-surface) antigens. Methods for obtaining
purified RSV protein are known in the art. The present inventors in
particular utilized the method of Walsh et al. J. Gen Virol., 70,
2953-2961, 1989. However, the particular method is not critical
provided that RSV F-protein of sufficient purity to obtain human
monoclonal antibodies having specificity to the RSV F-protein are
obtained. Alternatively, the RSV F-protein may be produced by
recombinant methods as described in U.S. Pat. No. 5,288,630 issued
on Feb. 22, 1994.
[0130] After in vitro immunization, the RSV F-protein immunized or
primed naive human splenocytes are then introduced into an
immunocompromised donor, i.e., a SCID mouse. This is preferably
effected by intraperitoneally administering the RSV F-protein
primed human splenocytes into SCID mice. The number of such
splenocytes which is administered will typically vary from about
10.sup.4 to 10.sup.8 spleen cells, with about 10.sup.7 to 10.sup.8
spleen cells being preferred. The number of such cells is that
which results in the desired reconstitution, i.e., SCID mice which
produce recoverable concentrations of human antibodies specific to
the RSV F-protein. Preferably, such spleen cells will be suspended
in HBSS at a concentration of about 8.times.10.sup.8 cells/ml prior
to administration.
[0131] After intraperitoneal transferral of splenocytes, the SCID
mice are then boosted with the RSV F-protein. This is effected at a
time sufficiently proximate to the transferal of splenocytes such
that the desired production of human anti-RSV F-protein antibodies
is realized. In general, this may be effected 3 to 14 days after
transferral, and optimally about 7 days after transferral.
Preferably, said antigen administration will be effected
intraperitoneally. The amount of RSV F-protein administered will
range from about 1 to 50 .mu.g and preferably about 1 to 10 .mu.g.
In the examples, 5 .mu.g protein was administered. However, the
amount and time of immunization may vary dependent upon the
particular mouse, spleen sample, and purity of RSV F-protein.
[0132] Preferably, antigen boosting will be effected in the
presence of an adjuvant, e.g., Complete Freund's Adjuvant, Alum,
Saponin, etc., with Complete Freund's Adjuvant (CFA) and Alum being
preferred. However, it is expected that other known adjuvants may
be substituted to obtain substantially equivalent or even enhanced
results.
[0133] After antigen boosting, the SCID mice are then bled, e.g.,
tail bled, and their serum tested for human IgG concentration and
anti-F protein antibody titers. Those animals which exhibit the
highest antibody titers and concentration are then used for
recovery of human IgG secreting cells.
[0134] It has been discovered that SCID mice having the highest
anti-F human antibody titers developed large abdominal tumors which
provide a good source of human antibody secreting cells.
Preferably, these tumors are recovered by excision under sterile
conditions, single cell suspensions are prepared, and the cells are
then washed and cultured. In the examples, the cells are washed
with IMDM containing 2% fetal calf serum, and the cells cultured in
suspension of 10.sup.6 cells/ml in T-25 flasks containing IMDM with
10% FCS. However, such culturing conditions may be varied by one
skilled in the art.
[0135] These cells are then immortalized preferably using EBV.
Immortalized cells which secrete anti-F protein antibodies are then
identified by known methods, e.g., ELISA. As noted, this method has
been demonstrated to result in the identification of two distinct
human monoclonal antibodies which specifically bind RSV F-protein,
i.e. RF-1 and RF-2. However, based on the teachings in their
application, in particular the examples, other human monoclonal
antibodies to the RSV F-protein having similar properties may be
obtained by one skilled in the art absent undue experimentation.
These antibodies are distinct given the fact that most were
generated in two different experiments, using different SCID mice.
The cell lines which express RF-1 and RF-2 have been maintained in
culture for prolonged time, i.e., about 18 and 16 months
respectively; dividing with an approximate doubling time of about
36-48 hours. The specific antibody concentration is on average
about 0.8-1 .mu.g/ml in a culture seeded at 0.5.times.10.sup.6
cells/ml grown for three days.
[0136] As discussed in greater detail infra, both RF-1 and RF-2 are
IgG (1, k) with half-maximal binding to F-protein in ELISA at 0.6
and 1 ng/ml respectively, and exhibiting isoelectric points of
about 8.8 and 8.9 respectively.
[0137] Moreover, these antibodies exhibit high affinity to the RSV
F-protein. Specifically, for RF-1 the dissociation constant for
RF-1 as determined by plasmon resonance on an IASYS machine is
about 10.sup.-10 M. The Ka constant for RF-2 is similarly high;
when determined by titration microcolorimetry according to Wiseman
et al. (1989) and Robert et al. (1989) it is about
2.times.10.sup.-9 M.
[0138] Additionally, these antibodies have been demonstrated to
effectively bind RSV infected cells, while not binding normal human
cells tested, e.g., respiratory tract lining (HEp-2, a laryngeal
epidermoid carcinoma, CCL 23), liver (HepG2, a human hepatoma cell
line, HB 8068), lymphoid tissue, SB, a human B lymphoblastoid cell
line, cat. no. CCL 120 and HSB, a T lymphoblastoid line, cat. no.
CCL 120.1, and prostrate (LNCaP.FGC, a human prostrate
adenocarcinoma line, cat. no. CRL 1740).
[0139] Significantly, both RF-1 and RF-2 both have been shown to
exhibit substantial in vitro RSV viral neutralization. This was
demonstrated in two different assays (described in greater detail
infra), i.e., an infection neutralization assay effected by
pre-reacting the virus with purified monoclonal antibody prior to
its addition to cells (which measures ability of antibody to
inhibit virus infectivity) and a fusion inhibition assay which
measures the ability of the monoclonal antibody to inhibit virus
growth and expansion after virus entry into the cell.
[0140] Moreover, as discussed in greater detail infra, both RF-1
and RF-2 inhibited virus infection of twelve different isolates at
concentrations respectively ranging from about 30 ng/ml to 1000
ng/ml. Thus, RF-2 apparently performs better than RF-1, yielding to
50% virus inhibition (ED50) at concentrations which are about 1.25
to 10 times lower than RF-1.
[0141] By contrast, higher concentrations of monoclonal antibody
are required to inhibit fusion and viral antigen expression in
previously infected cells, with RF-1 being about 5 to 10 times more
potent than RF-2. Moreover, both RF-1 and RF-2 were effective
against a Type B RSV, Type B prototype RS 6556, and a Type A RSV,
Type A prototype RS Long. Thus, the in vitro results indicate that
the subject human monoclonal antibodies may be used to treat or
prevent RSV infection caused by different RSV strains, both of Type
A and Type B prototype. As discussed previously, the RSV F-protein
is fairly well conserved in different RSV isolates. Therefore, it
is likely that the subject monoclonal antibodies to the RSV
F-protein bind to a conserved epitope of RSV F-protein.
[0142] As discussed, the subject human monoclonal antibodies or
recombinant human antibodies containing the variable heavy and
light sequences therefrom (preparation discussed infra) will be
used as therapeutic and prophylactic agents to treat or prevent RSV
infection by passive antibody therapy. In particular, the DNA
sequence encoding these DNA variable domains may be incorporated in
IDEC's proprietary expression vector which is depicted in FIG. 2.
This version is substantially described in commonly assigned U.S.
Ser. No. 08/379,072. filed on Jan. 25, 1995, herein incorporated by
reference. This vector constant human constant domain, for example,
human gamma 1, human gamma 4 or a mutated form thereof referred to
as gamma 4 PE. (See U.S. Ser. No. 08/379,072, incorporated by
reference herein.) In general, this will comprise administering a
therapeutically or prophylactically effective amount of the subject
human monoclonal antibodies to a susceptible subject or one
exhibiting RSV infection. A dosage effective amount will preferably
range from about 50 to 20,000 .mu.g/K, more preferably from about
100 to 5000 .mu.g/Kg. However, suitable dosages will vary dependent
on factors such as the condition of the treated host, weight, etc.
Suitable effective dosages may be determined by those skilled in
the art.
[0143] The subject human monoclonal antibodies may be administered
by any mode of administration suitable for administering
antibodies. Typically, the subject antibodies will be administered
by injection, e.g., intravenous, intramuscular, or intraperitoneal
injection, or more preferably by aerosol. As previously noted,
aerosol administration is particularly preferred if the subjects
treated comprise newborn infants.
[0144] Formulation of antibodies in pharmaceutically acceptable
form may be effected by known methods, using known pharmaceutical
carriers and excipients. Suitable carriers and excipients include
by way of example buffered saline, bovine serum albumin, etc.
[0145] Moreover; the subject antibodies, given their high
specificity and affinity to RSV infected cells possess utility as
immunoprobes for diagnosis of RSV infection. This will generally
comprise taking a sample, e.g. respiratory fluid, of a person
suspected of having RSV infection and incubating the sample with
the subject human monoclonal antibodies to detect the presence of
RSV infected cells.
[0146] This will involve directly or indirectly labeling the
subject human antibodies with a reporter molecule which provides
for detection of human monoclonal antibody-RSV immune complexes.
Examples of known labels include by way of example enzymes, e.g.
.beta.-lactamase, luciferase, etc. and radiolabels.
[0147] Methods for effecting immunodetection of antigens using
monoclonal antibodies are well known in the art. Also, the subject
anti-RSV F-protein antibodies in combination with a diagnostically
effective amount of a suitable reporter molecule may be formulated
as a test kit for detection of RSV infection.
MATERIALS AND METHODS
[0148] The followings Materials and Methods were used in Examples 1
to 6.
[0149] F Protein Preparation and Purification:
[0150] F protein was prepared essentially according to the method
of Walsh et al. J. Gen. Virol, 70, 2953-2961, (1989). Briefly,
HEp-2 cells at 70% confluency were infected with the Long strain of
RSV, a lab adapted strain of the A type. After culture for 48 hours
in T-150 culture flasks in IMDM supplemented with 5% fetal calf
serum, 2 mM glutamine and 2 mM sodium pyruvate, the cells were
lysed in a lysing buffer of PBS containing 1% Triton X-100 and 1%
deoxycholate. F protein was purified from the crude cell lysate on
an affinity column of Sephadex coupled to a murine monoclonal
anti-F antibody, B4 (a kind gift from Hiroyki Tsutsumi) (Tsutsumi
et al. 1987). The column was washed extensively with lysing buffer
and purified F protein was eluted in 0.1 M glycine pH 2.5,
containing 0.1% deoxycholate. The eluate was neutralized
immediately with 1 M Tris, pH 8.5 and dialyzed against PBS. After
the detergent was removed on a Extracti-D gel column (Pierce,
Rockford, Ill., Cat. No. 20346), F protein concentration was
determined by EIA and the solution was sterilized by gamma
irradiation.
[0151] Lymphoid Cell Preparation:
[0152] Spleen was obtained following clinically indicated
splenectomy of an idiopathic trombopenic purpura (ITP) patient. A
single cell suspension was prepared by sieving through a metal
mesh, and washed in IMDM media supplemented with 2% fetal calf
serum. Red blood cells were eliminated by treatment with ammonium
chloride lysing buffer for 90 seconds at 37.degree. C. The white
blood cell enriched suspension was then washed twice with serum
containing media, resuspended in ice cold freezing media (95% FCS
with 5% DMSO) at 10.sup.8 cells/ml and frozen in liquid nitrogen
until use.
[0153] In Vitro Immunization (WIV):
[0154] Cultures were set-up in IMDM supplemented with 2 mM
glutamine, 2 mM sodium pyruvate, non-essential amino acids, 25
.mu.g/ml IL-2 and 10% fetal calf serum. An antibiotics cocktail was
added including 2.5 .mu.g/ml amphotericin, 100 .mu.g/ml ampicillin,
100 .mu.g/ml kanamycin, 5 .mu.g/ml chlonetracycline, 50 .mu.g/ml
neomycin and 50 .mu.g/ml gentamicin. The cells were cultured in
6-well clusters at 3.times.10.sup.6 cells/ml with 40 ng/ml F
protein. After three days, the cells were collected, washed and
resuspended in HBSS at 8.times.10.sup.8 cells/ml for SCID
reconstitution.
[0155] Reconstitution of SCID Mice:
[0156] Five to eight week old female CB17/SCID mice were
reconstituted by intraperitoneal injection of 200 .mu.l of HBSS
containing 4.times.10.sup.7 human spleen cells subjected to IVI;
the mice were boosted one week later ip with 5 .mu.g F protein in
CFA and tail bled after another 15 days. Their serum was tested for
human IgG concentration and anti-F protein antibody titer.
[0157] Recovery of Human Cells from hu/SCID Mice:
[0158] Two hu-SPL-SCID mice with high anti-F human antibody titers
developed large abdominal tumors. Tumors were recovered by excision
from sacrificed mice under sterile conditions, single cell
suspensions were prepared, the cells were washed with IMDM
containing 2% fetal calf serum and cultured at 10.sup.6/cells ml in
T-25 flasks in IMDM with 10% FCS.
[0159] Testing for Human IgG and Anti-F Protein Antibodies:
[0160] The testing for human IgG and anti-F antibodies was
performed in ELISA. For that purpose, plates were coated overnight
with GAH-Ig (0.05 .mu.g/well) or F protein (0.05 .mu.g/well)
respectively in 0.1 M bicarbonate buffer, pH 9.5 and blocked with
PBS containing 1% fetal calf serum. Serial dilutions of mouse sera,
culture supernatants or purified antibodies were reacted to the
plate. Bound human IgG were revealed by the subsequent addition of
GAH IgG-HRP and OPD substrate (Sigma, . . . , . . . ). Selected
high titer human serum was used as a positive control in both
assays and purified polyclonal human IgG, or (.gamma., .kappa.)
myeloma protein were used as a standard in the estimation of the
concentration of human IgG and monoclonal antibodies
respectively.
[0161] Isotyping of Human Antibodies:
[0162] Isotyping was performed in ELISA on F protein coated plates
as described above. Bound human IgG were revealed by the subsequent
addition of HRP conjugated mouse monoclonal antibodies specific for
human .gamma.1, .gamma.2, .gamma.3, .gamma.4, .mu., .kappa. and
.lambda. chains. Positive controls were run with myeloma proteins
of the (.gamma.1, .kappa.), (.gamma.2, .kappa.), (.gamma.3,
.lambda.), (.gamma.4, .lambda.) or (.lambda., .lambda.) isotype and
free .kappa. and .lambda. chains.
[0163] Protein A Purification:
[0164] Antibodies were purified from culture supernatants on a
protein A-Sepharose 4B column. Briefly, supernatants were
collected, filtered through 0.2 mm filters and supplemented with
0.02% sodium azide. Columns (gel volume approximately 0.5 ml) were
equilibrated in PBS with 0.02% sodium azide, then loaded with
supernatant at low speed. After extensive washing, bound human
monoclonal IgG were eluted in 0.1 M sodium citrate buffer, pH 3.5,
dialyzed against PBS-azide using Centricon 10 filters (Amicon, , )
and sterilized by gamma irradiation until further use. Columns were
regenerated with citric acid pH 2.5 and re-equilibrated with PBS
with 0.02% sodium azide for subsequent use.
[0165] Isoelectric Focusing:
[0166] Isoelectric focusing (IEF) of human antibodies was performed
in polyacrylamide pre casted gels (Pharmacia, Uppsala, Sweden, Cat.
No. 80-1124-80), pH 3-pH 10. Briefly, 20 .mu.l of samples were
loaded and run at 1500 volts for 90 minutes. Standards of pi 5.8 to
10.25 were used for pi reference ( . . . ). Gels were stained in
Coomassie blue stain and destained in destaining buffer containing
25% methanol, 68% water and 8% acetic acid.
[0167] Western Blot:
[0168] Purified F protein, both native and denatured by boiling,
was migrated in a 10% polyacrylamide gel. The gel was blotted on a
nitrocellulose sheet at 30 volts for 2 hours and 60 volts
overnight. After transfer, the nitrocellulose was blocked for 1
hour at room temperature with 1% BSA and 0.1% Tween-20 in PBS.
Different strips were washed in PBS and the primary antibodies,
hu-SPL-SCID anti-F protein sera, or hu-SPL-SCID anti-tetanus toxoid
negative control, or mouse anti-F protein positive control, were
added for 1 hour. All sera were diluted 1:500. After extensive wash
with PBS, the secondary antibody, GAH IgG-HRP for the samples and
the negative control, or GAM IgG for the positive control, was
added for 1 hour. Blots were revealed with 4-chloro-1-naphtol.
[0169] Immunofluorescence:
[0170] RSV infected HEp-2 cells (4.times.10.sup.4) were fixed on
glass slides using ice cold acetone and were reacted with 20 .mu.l
of serum diluted 1:10 or purified MAb, 2 .mu.g/ml, for 1 hour at
37.degree. C. The slides were washed and the bound antibodies were
revealed with GAH IgG-FITC, for 30 minutes at 37.degree. C. and
observed under a fluorescence microscope.
[0171] FACScan Analysis:
[0172] RSV-infected HEp-2 cells (10.sup.6 cells/sample) were washed
with washing buffer (PBS with sodium azide 0.1%). The cell pellet
was resuspended in 50 .mu.l of incubation buffer (PBS with sodium
azide 0.1% supplemented with BSA 0.1%) contaiiing 2 .mu.g/ml RF-1
or RF-2. After 15 minutes incubation on ice, the cells were washed
and resuspended in incubation buffer containing GAH IgG-FITC for
another 15 minutes on ice. After 3 washes, the cells were fixed in
1 ml PBS with 1% formaldehyde and analyzed in a Becton-Dickinson
FACScan apparatus.
[0173] Affinity Determination:
[0174] Two methods were used to determine the affinity of human
MAbs to soluble F protein:
[0175] In plasmon resonance, using an IASYS machine, antibody was
bound covalently to the wet side of a device from which the change
in mass can be determined based on the change of refraction of
light shone on the dry side of the device. Different concentrations
of F-protein were added and subsequently eluted off with a steady
flow of PBS. The change in mass as a result of F-protein release
from the antibody was measured, and from the kinetics a K.sub.off
was determined. Ka was calculated by testing the off-rate from
different levels of initial saturation.
[0176] Alternatively, affinity constant was determined by
micro-calorimetry according to Wiseman et al and Robert et al., as
follows: RF-2 and F protein were co-incubated at a known
concentration in a thermo-chamber at 42.degree. C. and the enthalpy
chance due to the immune complex formation in the solution was
measured. The reaction was repeated at 50.degree. C. The binding
association constant K was calculated as a function of temperature
and enthalpy change according to Robert et al. in the following
equation:
K=Kobs.e
.sup..DELTA.Hobs/R.(1/T-1/Tobs)-e.sup..DELTA.CTobs/R.(1/T-1/Tobs)-
.multidot.(T/Tobs).sup..DELTA.C/R
[0177] where Kobs is the binding equilibrium constant and
.DELTA.H.sup.obs is the enthalpy change observed experimentally, at
a given absolute temperature, Tobs; R is the universal gas constant
(1.987) and .DELTA.C is the experimentally determined binding heat
capacity change.
[0178] Complement-Enhanced Virus Neutralization Assay:
[0179] Two laboratory strains (Long, type A and 18537, type B) and
ten wild type RS virus isolates, which were isolated from
hospitalized infants, were used to assess the neutralizing capacity
of anti-F protein human MAbs. Serial dilutions of human MAb were
pre-incubated with virus (50-100 pfu) in the presence of complement
for 30 minutes at room temperature, in 100 .mu.l IMDM/well of
microtitration plate. HEp-2 cells (5.times.10.sup.4/well) were
added in 100 .mu.l and incubated for 3 days at 37.degree. C., 5%
CO.sub.2. The plates were washed, fixed with acetone and air dried
and RSV antigen was detected by ELISA using mouse MAbs. The
neutralization end point was determined arbitrarily as the dilution
which reduced antigen production by 50% compared to control wells
with no antibody.
[0180] Virus Fusion Inhibition Assay:
[0181] Fusion inhibition titers were determined by pre incubating
100 TCID.sub.50 RSV Long (prototype A virus) or RS 6556 (Type B
clinical isolate) with VERO cells (5.times.10.sup.3/well) in
microtitration plates, for 4 hours at 37.degree. C., 5% CO2.
Various concentrations of human monoclonal antibodies or controls
were added to each well and quadruplicate cultures were incubated
for 6 days at 37.degree. C., 5% CO.sub.2. Control cultures
contained virus non infected cells (negative) or infected cells in
the absence of antibody (positive). Virus growth was detected in
ELISA using rabbit polyclonal anti-F protein antisera and
HRP-labelled anti-rabbit IgG. The reaction was developed with
TMBlue substrate (KPI, Gaithersburg, Md.). Titers (ED50) were
defined as the concentration of antibody inhibiting virus growth by
50% based on regression analysis of the MAb dose response.
EXAMPLE 1
[0182] HU-SPL-SCID Titers:
[0183] Fifteen SCID mice received human spleen cells from a single
donor with ITP condition. The cells were previously cultured for
three days in the presence of IL-2 and different concentrations of
soluble F protein. All animals were successfully reconstituted and,
after boost with F protein, total human IgG concentrations varied
from 12 .mu.g/ml to 10 mg/ml in the serum and anti-F protein titers
varied from 3.times.10.sup.2 to 10.sup.6 (Table I). No correlation
was observed between in vitro F protein exposure and anti-F protein
titer in vivo. It has been previously observed with the subject
method, in the horse ferritin antigen system, that antigen exposure
is necessary during in vitro cultivation of the spleen cells to
subsequently ensure specific antibody titer in vivo. The
discrepancy between these two systems may be attributed to the
difference in the antigens involved: since humans are not naturally
exposed to horse ferritin, the IVI step involves an antigen priming
of the spleen cells and induces a primary response in vitro; on the
other hand, virtually all humans are immune to RSV through natural
infection in early life, which leads to a permanent memory to F
protein, therefore stimulation with IL-2 alone in vitro followed by
one boost in vivo is enough to induce secondary responses.
[0184] The antisera were polyclonal, as judged from isoelectric
focusing patterns (data not shown). They were tested for reactivity
to F protein in Western blot. Our results showed that polyclonal
human Abs did recognize soluble native F protein both in its dimer
form (140 KD) and its monomer form (70 KD); they also reacted
strongly with denatured F protein, binding specifically to the 2
subunits of 48 KD and 23 KD (representative data in FIG. 1). This
suggests that at least a fraction of the humoral response to F
protein is directed against linear, non conformational epitopes of
the molecule. Immunofluorescence studies further demonstrated the
specificity of the hu-SPL-SCID sera, since immune sera, but not
naive SCID mouse sera, reacted strongly with RSV-infected HEp-2
cells (FIG. 2). No reactivity was observed towards non-infected
HEp-2 cells used as negative control. It was concluded therefore
that soluble F protein was an adequate antigen for the generation
of antibodies specific to the membrane viral antigen expressed on
naturally infected cells.
EXAMPLE 2
[0185] Identification of Antibodies in Tumor Cell Cultures:
[0186] All mice with high anti-F protein titers were sacrificed and
human cells were harvested from peritoneal lavage and spleens. Two
mice (hu-SPL-SCID #6 and hu-SPL-SCID #15) spontaneously developed
abdominal solid tumors that were recovered and teased into single
cell suspension. The tumor cells secreted specific anti-F protein
antibodies as determined in ELISA. These tumors and antibodies are
referred to as RF-1 (RSV F-protein) and RF-2. RF-1 and RF-2 were
generated in two different experiments separated by approximately
two months and were isolated from individual hu-SPL-SCID mice, and
are thus distinct antibodies; they have established themselves in
culture for more than 18 months and 16 months respectively,
dividing with an approximate doubling time of 36-48 hours. Specific
antibody concentration is typically of 0.5-1 .mu.g/ml in a culture
seeded at 0.5.times.10.sup.6 cells/ml and grown for three days.
[0187] For further characterization, both human MAbs were purified
from culture supernatants by affinity chromatography, using Protein
A Sepharose columns. Both RF-1 and RF-2 are IgG(.sub.l,k), with
half maximal binding to F-protein in ELISA at 0.6 and 1 ng/ml
respectively (FIG. 3). From the migration pattern in IEF, RF-1 and
RF-2 isoelectric points were determined to be 8.8 and 8.9
respectively (FIG. 4). RF-1 and RF-2 specifically recognized RSV
infected HEp-2 cells in flow cytometry (FIG. 5). The dissociation
constant, Kd, for RF-1 was determined by plasmon resonance on an
IASYS machine to be in the 10.sup.-10 M range. The Kd constant of
RF-2 was determined by titration micro calorimetry, according to
Wiseman et al (1989) and Robert et al. (1989) to be
2.times.10.sup.-9 M.
EXAMPLE 3
[0188] Tissue Specificity of Anti-F-Protein:
[0189] Purified antibodies were screened for reactivity to a series
of human cell lines available at ATCC by means of indirect
immunofluorescence assays measured by flow cytometry (Table II):
The results showed that the antibodies did not bind to cell lines
representing respiratory tract lining (HEp-2, a laryngeal
epidermoid carcinoma, Cat. No. CCL 23), liver (HepG2, a human
hepatoma cell line, Cat. No. HB 8065), lymphoid tissue (SB, a human
B lymphoblastoid cell line, Cat. No. CCL 120 and HSB, a T
lymphoblastoid line, cat. no. CCL 120.1) and prostate (LNCaP.FGC, a
human prostate adenocarcinoma line, Cat. No. CRL 1740).
EXAMPLE 4
[0190] In Vitro Functional Activity:
[0191] To determine whether the antibodies had virus neutralizing
effect in vitro, they were subjected to two types of functional
assays: Infection neutralization assays were performed by
pre-reacting the virus with purified MAb prior to its addition to
the cells and therefore reflect the ability of the MAb to inhibit
virus infectivity; fusion inhibition reflects the ability of the Ab
to inhibit virus growth and expansion after virus entry in the
cell. The outcome of both assays was measured as the amount of
virus released in the culture after a given incubation time, as
determined by viral antigen titration in EIA.
[0192] Both Abs were able to inhibit virus infection, of all twelve
isolates tested, at concentrations ranging from 30 ng/ml to 1000
ng/ml and from 8 ng/ml to 165 ng/ml, for RF-1 and RF-2
respectively. RF-2 performed consistently better than RF-1,
yielding to 50% virus inhibition (ED50) at concentrations 1.25 to
10 times lower than RF-1. Representative data are indicated in
Table III.
[0193] As expected, higher concentrations of MAb were required to
inhibit fusion and viral antigen expression in previously infected
cells. In this assay, RF-1 was 5 to 10 times more potent than RF-2.
Both MAb were more effective in the Type B prototype RS 6556 than
in the Type A prototype RS Long (Table III).
1TABLE I Table I: Splenocytes from a single donor were cultured in
the presence of IL-2 for 3 days, with or without F protein. SCID
mice were reconstituted with 4 .times. 10.sup.7 cells and boosted
with 10 .mu.g of F protein ip in CFA. In mice # 1, 2, 3, 4 and 5,
fresh autologous cells (20 .times. 10.sup.6) were injected with the
boost. Human IgG concentration was determined by comparison to a
standard curve of polyclonal IgG and anti-F protein titer was
determined by end point dilution in EIA. hu IgG mouse # [Ag] in
vitro fresh cells (.mu.g/ml) anti-F titer 1 1 .mu.g/ml + 1,000
10.sup.6 2 1 .mu.g/ml + 12.3 10.sup.3 3 1 .mu.g/ml + 3,000 10.sup.6
4 1 .mu.g/ml + 8,750 10.sup.6 5 1 .mu.g/ml + 1,000 10.sup.6 6 1
.mu.g/ml - 1,500 10.sup.5 7 1 .mu.g/ml - 162 10.sup.5 8 1 .mu.g/ml
- 4,500 10.sup.6 9 1 .mu.g/ml - 333 10.sup.5 10 40 ng/ml - 3,300 5
.times. 10.sup.5 11 40 ng/ml - 554 3 .times. 10.sup.2 12 1 .mu.g/ml
- 10,000 5 .times. 10.sup.5 13 1 .mu.g/ml - 200 5 .times. 10.sup.4
14 0 .mu.g/ml - 182 5 .times. 10.sup.4 15 0 .mu.g/ml - 3,300
10.sup.5
[0194]
2TABLE II Table II: Reactivity of RF-2 with various cell lines.
Various cell lines were subjected to indirect immunofluorescence
labeling with RF-2, 200 ng/10.sup.6 cells. A Fab goat anti-human
IgG-FITC was used as second step. (-) indicates the presence of
RF-2 did not result in change of channel for the average
fluorescence; (+) indicated increase of average labeling by 0.5
log. Cell line Tissue Type Tissue Labeling HEp-2 Laryngeal
epidermis - RSV infected-HEp-2 Laryngeal epidermis (RSV) ++++ SB
Lymphoid - HSB Lympboid - LNCaP Prostate - HepG2 Liver -
[0195]
3TABLE III ED.sub.50 is defined as concenrration of antibody
inhibiting virus growth by 50% based on regression analysis of the
monoclonal antibody dose-response. Fusion Inhibition activity
Infection Neutralization Activity ED.sub.50 titer ED.sub.50 titer
Antibody RS Long (Type A) RS 6556 (Type B) Antibody MR 144 (Type A)
18537 (Type B) RF-1 660 ng/ml 40 ng/ml RF-1 30 ng/ml 30 ng/ml RF-2
3300 ng/ml 400 ng/ml RF-2 8 ng/ml 12 ng/ml
EXAMPLE 5 (COMPARATIVE)
[0196] Induction of IgG Recall Responses to F-Protein In Vitro:
[0197] More than 95% of the population over 2 years of age have
been exposed to, and responded successfully to RSV Henderson et al.
J. Med. (1979), 300, 530-534. Challenge of spleen cell in vitro
with RSV F-protein should, therefore, result in recall responses,
and, indeed, mainly IgG responses were induced in vitro with spleen
cells (see FIG. 5). The optimal antigen concentration, 40 ng/ml,
was at least one order of magnitude lower than what was observed
for antigens inducing primary responses, i.e. ferritin, Ilig/ml,
Boerner et al, J. Immunol., 1991, 147, 86-95; Brams et al, Hum.
Antibod. Hybridomas, 1993, 4, 47-56. Therefore, it must be
considered that in vitro priming with F-protein induces secondary
like responses. Several attempts to induce significant in vitro
responses to RSV F-protein failed with PBMCs and tonsil derived
cells.
[0198] A limited effort to generate monoclonal antibodies from in
vitro primed spleen cells resulted in several monoclonal IgG
antibodies to RSV F-protein. Most of these, however, cross-reacted
to one of several control antigens in ELISA (results not
shown).
EXAMPLE 6
[0199] Cloning of the Genes Coding for RF-2:
[0200] Neither the RF-1 nor the RF-2 clone produce significant
amounts of antibody. Also, both of these cell lines grow best in
media with 20% FCS, which is disadvantageous because it results in
contamination of the purified antibody with bovine IgG. Therefore,
in order to be able to produce and purify amounts of antibody
necessary for doing meaningful animal model tests, which typically
requires up to 1 gram of one selected antibody, it is advantageous
to transfer the genes coding for RF-1 and RF-2 to a production
vector and cell line. The present assignee, IDEC Pharmaceuticals,
Inc., has developed a very efficient eukaryotic production system
which results in the production of human monoclonal antibodies in
CHO cells. This vector system is described in commonly assigned
U.S. Ser. No. 08/379,072, filed Jan. 25, 1995, and in commonly
assigned U.S. Ser. No. 08/149,099, filed Nov. 3, 1993, both of
which are incorporated by reference herein. Routinely using this
system antibody gene transfected CHO cells produce around 200 mg
antibody per liter of serum free medium in spinner cultures and
greater than 500 mg/liter in fermentors after amplification in
methotrexate.
[0201] Cell culture cloned (see below) RF-2 cells, approximately
5.times.10.sup.6, were subjected to RNA extraction using a mRNA
isolation kit, Fast Tract (InVitroGen, San Diego, Calif.), and
single stranded cDNA was prepared using an oligo-dT primer and
reverse transcriptase. An aliquot of cDNA was used as the starting
material for polymerase chain reaction (PCR) amplification of the
variable region genes. PCR was performed using two sets of primers.
(see Table IV).
4TABLE IV* Heavy chain primers with Mlu 1 site V.sub.H1 5'
(AG).sub.10ACGCGTG(T/C)CCA(G/C)TCCCAGGT(G/C)CAGCTGGTG 3' V.sub.H2 5
(AG).sub.10ACGCGTGTC(T/C)TGTCCCAGGT(A/G)CAG(C/T)T- G(C/A)AG 3'
V.sub.H3 5 (AG).sub.10ACGCGTGTCCAGTGTGAGGTGCAG- CTG 3' V.sub.H4 5
(AG).sub.10ACGCGTGTCCTGTCCCAGGTGCAG 3' V.sub.H5 5
(AG).sub.10ACGCGTGTCTGGCCGAAGTGCAGCTGGTG 3' Heavy chain constant
region primer anti-sense strand with Nhe 1 site IgGl-4
(AG).sub.10GCCCTTGGTGCTAGCTGAGGAGACGG 3' Kappa Chain primers with
Dra III site 1. 5' (AG).sub.10CCAGGTGCACGATGTGACATCCAGATGACC 3' 2.
5' (AG).sub.10CCTGGATCACGATGTGATATTGTGATGAC 3' 3. 5'
(AG).sub.10CCAGATACACGATGTGAAATTGTGTTGAC 3' 4. 5'
(AG).sub.10TCTGGTGCACGATGTGACATCGTGATGAC 3' Kappa constant region
primer anti-sense strand with Bsi WI site C.sub.k 5
(AG).sub.10TGCAGCCACCGTACGTTTGATTTCCA(G/C)CTT 3' *Legend for Table
IV: Synthetic oligonucleotide primers used for the PCR
amplification of human immunoglobulin heavy and light chain
variable regions. Restriction sites for cloning are underlined in
bold.
[0202] The first set of primers was designed for amplifying the
heavy chain variable regions. It consists of one 3 primer that
binds in the J region and five family-specific 5' primers that bind
in the late leader and framework 1 region. A second set of primers
was designed for amplifying the Kapp variable region. It consists
of one 3' primer and four 5' primers that bind in the late leader
and framework 1 regions. The PCR reactions were electrophoresed on
agarose gels and correctly sized 350 base pair bands were excised.
The DNA was electrocuted, cut with appropriate restriction enzymes
and cloned into IDEC's NEOSPLA expression vector. (See FIG. 6) The
NEOSPLA vector used for expression of human antibodies contains the
following: CMV=cytomegalovirus promoter, BETA mouse beta globin
major promoter, BGH bovine growth hormone polyadenylation signal,
SVO=SV40 origin of replication. N1=Neomycin phosphoamsferase exon
1, N2=Neomycin phosphotransferase exon 2. LIGHT=Human
immunoglobulin kappa constant region. Heavy=Human immunoglobulin
gamma 1 or gamma 4 PE constant region. L=leader. SV=SV40
polyadenylation region.
[0203] IDEC's NEOSPLA expression vectors were designed for large
scale production of immunoglobulin genes (See, Reff et al, Blood,
(1994), 83, 435-445, incorporated by reference in its entirety).
Mouse/human chimerics, primate/human chimerics and human antibodies
have been successfully expressed at high levels using these
vectors. NEOSPLA contains a neomycin phosphotransferase gene for
selection of CHO cells that have stably integrated the plasmid
vector DNA. In addition, NEOSPLA contains a dihydrofolate reductase
gene for amplification in methotrexate, a human constant light
chain (either .kappa. or .lambda.) and a human constant heavy chain
region (either .gamma.1 or .gamma.4(PE)). Gamma 4 (PE) is the human
.gamma.4 constant region with 2 mutations, a glutamic acid in the
CH2 region which was introduced to eliminate residual FcR binding,
and a proline substitution in the hinge region, intended to enhance
the stability of the heavy chain disulfide bond interaction, Algre
et al, J. Immunol., 148, 3461-3468, (1992); Angal et al., Mol.
Immunol., 30, 105-108 (1993), both of which are incorporated by
reference herein. Unique restriction sites have been incorporated
into the vector in order to facilitate insertion of the desired and
light variable region. Reff et al., Blood, (1994) 83, 435-445.
[0204] The light chain of RF-2 has been cloned into NEOSPLA in
duplicate and sequenced following the method of Sanger et al.
Sanger et al., Proc. Natl. Acad. Sci. (1977), 74, 5463-5467. The
kappa chain is a member of the kappa 2 subgroup. Similarly, the
human heavy chain variable region of RF-2 has been isolated and
cloned in front of the human .gamma.1 constant domain.
[0205] The light chain coding genes of RF-1 and RF-2 were readily
cloned, whereas cDNA for the genes encoding the heavy chains could
not be generated using the common Tac reverse transcriptase.
However, this problem was obviated by substituting a high
temperature, 70.degree. C., reverse transcriptase. Thereby, intact
PCR products could be generated with primers primarily derived from
V.sub.H2 family genes.
[0206] The amino acid sequence and the nucleic acid sequence for
the RF-1 light and heavy variable domains may be found in FIGS. 7a
and 7b, respectively. The amino acid sequence and the nucleic acid
sequence for the light and heavy variable domains for RF-2 may be
found in FIGS. 8a and 8B, respectively. FIGS. 9a-9c depict the
nucleic acid and amino acid sequence of RF-1 as expressed in the
subject NEOSPLA vector. FIGS. 9a and 9b depict the leader, variable
light and heavy, and human constant domain sequences, i.e., the
human kappa domain and the human gamma/constant domain. FIG. 9c
shows the amino acid and nucleic acid sequence of the human
gamma/constant domain. FIG. 10 depicts schematically an expression
vector which provides for the expression of the sequences set forth
in FIGS. 9a-9c and thereby recombinant RF-1 in CHO cells.
[0207] FIGS. 11a-11a similarly depict the amino acid and nucleic
acid sequences of the leader sequence, Rf-1 variable light human
kappa constant region, RF-2 variable heavy, and human
gamma/constant domain. FIG. 12 depicts schematically an expression
vector which provides for the expression of recombinant RF-2 in CHO
cells.
EXAMPLE 7
[0208] Development of a Protocol for Cloning of EBV Transformed
Cells:
[0209] Antibody production from EBV transformed cells continuously
decrease, and ultimately ceases. Kozbor et al., J. Immunol. (1981),
127, 1275-1280. To immortalize the antibody production, it is
therefore essential to extract the immunoglobulin coding genes from
the cells before this event and transfer those into an appropriate
expression system. In order to isolate the genes coding for the
antigen binding variable domains of antibodies produced by EBV
transformed cells, it is essential to ensure that the cell material
is monoclonal. EBV transformed cells are, however, very difficult
to clone whether by limiting dilution or in semisolid agar.
Isoelectric focusing gel electrophoresis of protein A purified
preparations of our two anti-F protein antibodies, RF-1 and RF-2,
showed at least two populations of antibodies in the RF-2
preparation and the possibility of oligoclonality in the RF-1
preparation.
[0210] By using the mouse thyoma line EL-4 B5 Zhang et al, J.
Immunol., (1990), 144, 2955-2960, as feeder layer, cells were
expanded from a single cell through limiting dilution. The human
thyoma cell line EL-4 B5 expresses gp39 in a membrane receptor way
that induces B cells to grow 5.times.10.sup.4 EL-4 B5 cells/well
were plated out in a microliter plate, and cells from the cultures
were plated out on the EL-4 B5 layer at various concentrations,
from 0.38 cells/well and up. The number of wells with growth for
each of the concentration plated were counted after an appropriate
amount of time.
[0211] The supernatant was tested for presence of human IgG and for
antigen-specific IgG. With this protocol we have isolated and
cloned the cells that produce RF-1 (see Table V) and RF-2 (see
Table VI), respectively, from the original oligoclonal
preparations. The non-specific antibodies found in the cloning were
only analyzed with respect to isotype, and were found to be the
same as the specific antibodies, IgG1k. Based on the yield of
F-protein specific clones from freezes made at various time points
during the cultivation of RF-1, as well as the amount of IgG that
was produced, it was estimated that the specific antibody made up
approximately {fraction (1/20)} of the total antibody amount
shortly after the start of the culture and disappeared after
approximately 8 months in culture. RF-2 made up a much higher part
of the total IgG, no less than 10% at any given time. Antibody from
the oligoclonal preparations was used to generate the in vitro
neutralization data, resulting in an overestimation of the ED50
titers. Our affinity studies with plasmon resonance, however, were
not dependent on using pure antibodies. The affinity studies using
titration micro calorimetry was done with cloned material.
5TABLE V* # cells/well # wells # anti-F wells (%) # wells with
growth (%) 30 48 48 (100) 48 (100) 10 48 48 (100) 48 (100) 3.3 96
27 (28) 68 (71) 1.1 192 17 (9) 112 (58) 0.38 384 18 (5) 116 (30)
*Legend for Table V: Cloning of RF-1 by limiting dilution. EL4-B5
cells were plated out at 5 .times. 104 cells/well in a flat
bottomed 96 well plate. Approximately 24 hours later, RF-1 cells in
exponential growth were plated out on the feeder layer at the
described concentrations. After 2-3 weeks, the wells were scored
for growth and for presence of anti-F activity.
[0212]
6 TABLE VI* # anti-F # wells with # cells/well # wells wells (%)
growth (%) 30 40 40 (100) 15 (37.5) 10 120 120 (100) 22 (18) 3.3
120 102 (85) 9 (7.5) 1.1 120 50 (41.6) 1 (0.83) .33 180 30 (16.7) 5
(2.8) *Legend for Table XIV: Cloning of RF-2 by limiting dilutio/n.
Done as in Table VIII.
[0213] In order to confirm the clinical applicability of the two
human monoclonal antibodies with in vitro virus neutralizing
activity, these antibodies are further characterized with respect
to their efficacy in clearing RSV infection in two different animal
models. These preclinical performance evaluations are effected with
material produced by CHO cells transfected with the cloned genes
coding for the antibodies inserted into a proprietary expression
vector (see FIG. 6). Two antibody models, one with intact
complement and Fc receptor binding domains, .gamma.1. and one void
of these domains, .gamma.4 (PE mutant), Alegre et al., J. Immunol.,
(1992), 148, 3461-3468; Angal et al., Molecular Immunology, (1993),
30, 105-108, will be tested. The rationale for testing .gamma.4
version is based on two considerations: (i) Anti-F-protein Fabs
have shown significant virus neutralizing effect in vitro Barbas et
al., Proc. Natl. Acad. Sci. (1992), 89, 10164-10168, as well as in
vivo, Crowe et al, Proc. Natl. Acad. Sci. (1994), 91, 1386-1390,
albeit when administered directly into the lung, (ii) potentially
avoiding lung damage caused by effector function activation in
sensitive tissue already stressed by virus infection could be
advantageous. A set of nonspecific control antibodies, one .gamma.1
and one .gamma.4 (PE), will be generated from an in-house
non-specific hybridoma IgG.sub.1 antibody.
[0214] The first animal model is a mouse model, Taylor et al., J.
Immunology (1984), 52, 137-142; Walsh, E. E., J. Infectious
Diseases (1994), 170, 345-350. This model is used to determine the
effective dose, defined as the smallest dose resulting in a 2 log
reduction in virus load in the lung tissue after 1 weeks
incubation. This model is also used to determine which of the
antibody models to proceed with. The second animal model is a
primate model using the African green monkey, Kakuk et al, J.
Infectious Diseases (1993), 167, 553-561. RSV causes lung damage in
the African green monkey, and this model's main purpose is for
evaluating the damage preventing properties of the antibodies. The
number of tests with this model will be limited to test one
antibody in 5 different doses. The antibody, the dose and the
infusion date relative to infection date will be determined based
on the findings with the mouse model. Lung section is examined for
virus load in plaque assay and by light microscopy for detection of
lesions caused by RSV.
[0215] It will be observed if any changes in the amino acid
sequence have taken place during the process of stimulating and
expanding the cells that produce the two antibodies. This is done
by testing with a set of PCR primers based on the CDR3 regions of
the heavy chains of RF-1 and RF-2 whether the sequences of the
genes coding for RF-1 and RF-2 are present in the original frozen
cell material from which the two cell lines were generated. The
positive control is RF-1 and RF-2 spiked source cells. The analysis
follows the principles established by Levy et al., 1989, Levy et
al., J. Exp. Med. (1989), 169:2007 and Alegre et al., J. Immunol.
(1992), 148, 3461-3468; Angal et al., Molecular Immunology (1993),
30, 105-108; Foote et al., Nature (1991), 352, 530-532; Rada et
al., Proc. Natl. Acad. Sci. (1991), 88, 5508-5512; Kocks et al.,
Rev. Immunol. (1989), 7, 537-559; Wysocki et al., Proc. Natl. Acad.
Sci. (1986), 83, 1847-1851; Kipps et al., J. Exp. Med. (1990), 171,
189-196; Ueki et al., Exp. Med. (1990), 171, 19-34.
EXAMPLE 8
[0216] Generate CHO Cell Lines that Produce Large Amounts (>100
mg/liter) of RF-1 and RF-2:
[0217] a. Transfect Expression Plasmids, Isolate and Expand G418
Resistant CHO Clones Expressing the Highest Levels of RF-1 and
RF-2.
[0218] Once the RF-1 and RIF-2 variable region genes are cloned
into NEOSPLA, Chinese hamster ovary (CHO) cells (DG44), Urlaub et
al., J. Somat. Cell Mol. Genet., (1986), 16, 555, are transformed
with the plasmid DNA. CHO cells are Crown in SSFM H minus
hyroxanthine and thymidine (GIBCO). 4.times.10.sup.6 cells are
electroporated with 25 .mu.g plasmid DNA using a BTX 600
electroporation device (BTX, San Diego, Calif.) in 0.4 ml
disposable cuvettes. Prior to electroporation, the plasmid DNA will
be restricted with Pac I which separates the genes expressed in
mammalian cells from the portion of the plasmid used for growth in
bacteria. Conditions for electroporation are 230 volts, 400 micro
faradays, 13 ohms. Each electroporation is plated into a 96 well
dish (about 40,000 cells/well). Dishes are fed with media
containing G418 (Geneticin, GIBCO) at 400 .mu.g/ml three days
following electroporation, and thereafter, periodically, until
colonies arise. Supernatant from colonies is assayed in ELISA for
the presence of human IgG and for anti-F-protein activity.
[0219] b. Amplify the Expression of Antibody in Methotrexate.
[0220] The G418 resistant colonies producing the highest amount of
immunoglobulin are then transferred to larger vessels and expanded.
The expression of the highest secreting G418 clone is increased by
gene amplification, by selection in 5 nM methotrexate (MIX) in 96
well dishes. The 5 nM colonies producing the highest amount of
antibody are then expanded and then expression amplified again by
selection in 50 nM MNTX in 96 well dishes. Following this protocol,
we have previously been able to derive CHO cells that secrete
greater then 200 mgs/liter in 7 days in spinner culture (greater
than 0.5 gram/liter in fermentors in 6 days). Human antibody is
then purified from supernatant using protein A affinity
chromatography.
[0221] c. Produce and Purify Antibody.
[0222] 100 mg of each antibody is generated. The selected antibody
is produced in amounts determined from the mouse model studies.
Spinner flasks with selected CHO transfectomas in CHO-S SFM II
serum free medium (GIBCO Cat. No. 91-0456DK) with 50 nM
methotrexate are used to produce antibody in the required amounts.
Supernatant are harvested and filtered through a set of filters to
remove particular material, ending up with a 0.2 nm filter. The
supernatant is run through a protein A column with a predetermined
size based on the total amount of antibody. After washing, the
antibody is eluted from the column with 0.1 M Glycine/HCI, pH 2.8,
into a neutralization buffer, 1 M Tris./HCI, pH 7.4. The
elution/neutralization buffer is exchanged extensively,
.gtoreq.1000 times, with sterile PBS by ultrafiltration through an
Amicon Centriprep or Centricon 30 (Cat. no. 4306 and 4209). The
concentration of antibody is adjusted to 2 mg/ml and sterilized by
filtration through a 0.2 nm filter. The antibody is purified and
stored on ice in 2 ml cryotubes until use in animals.
EXAMPLE 9
[0223] Characterize RF-1 and RF-2 in Respect to Performance in RSV
Animal Models:
[0224] The performance of RF-1 and RF-2 is determined using
appropriate animal models. The evaluation is divided into two
steps, first (a) a Balb/c model, Taylor et al., J. Immunology
(1984), 52, 137-142; Crowe et al., Proc. Natl. Acad. Sci. (1994),
91, 1396-1390: Connors et al., J. Virology (1992), 66, 7444-7451,
to determine the potency of the antibodies, as well as to determine
what type of support (effector) functions are essential for the
antibody to clear the virus load. From the data gained in the mouse
model, one candidate is chosen for further studies in a primate
model. The primate model is an African green monkey model, Kakuk et
al., J. Infectious Diseases (1993), 167, 553-561. A primate model
is especially suitable for confirming that the subject monoclonal
antibodies can be used to prevent virus associated lung damage.
[0225] a. Test Performance in Mouse Model.
[0226] The rodent-model we have chosen is the Balb/c mouse. This
model is well characterized, Crowe et al., Proc. Natl. Acad. Sci.
(1994), 91, 1386-1390; Connors et al., J. Virology (1992), 66,
7444-7451, for studies on passive therapy studies. Balb/c mice are
highly permissive to growth of RSV in both upper and lower airways
at all ages, Taylor et al., J. Immunology (1984), 52, 137-142.
Animals are housed in groups of 5, fed standard mouse chow and
water ad libitum and cared for according to the Rochester General
Hospital vivarium guidelines. These guidelines are in compliance
with the New York State Health Department, the Federal Animal
Welfare Act and DHHS regulations. All procedures, including
injections, virus infection, orbital bleeding and sacrifice by
cervical dislocation, are performed under penthrane anesthesia in a
vented hood.
[0227] i. Determine Effective Dose of Antibody and Compare
Performance of .gamma.1 and .gamma.4 (PE Version) of RF-1 and
RF-2.
[0228] Groups of 5 mice are infected by intranasal instillation of
106 Long (subgroup A) or 10.sup.5 18537 (subgroup B) plaque forming
units (PFU) of RSV in a 100 .mu.L volume on day 0. On day four, at
peak virus titer , animals will be injected intraperitoneally with
each of the four F-protein specific monoclonal antibody
preparations or control antibody. The doses tested are initially
centered around a reference dose calculated to provide a serum
neutralization titer of approximately 1:300 or greater from in
vitro studies. This titer has been associated with protective
levels against challenge with RSV in small animals. Dose response
is evaluated by treatment with 25, 5, 1, 1/5 and {fraction (1/25)}
of the reference dose. Experiments with higher or lower doses are
performed if warranted. Control mice are injected with an
equivalent dose of the isotype matched monoclonal antibodies, as
described above. Twenty-four hours later; day 5 is the peak of
virus shedding, the mice are sacrificed. Serum is obtained by
intracardiac puncture and the nasal turbinates and lungs are
removed, weighed and homogenized in 1 and 2 ml of NMM,
respectively. Homogenates are titered for virus on HEp-2 cells, and
virus titers expressed as TCID.sub.50/gm tissue. The mean titers
between groups are compared to the control group by the student
t-test. Serum is obtained at the time of infection and at sacrifice
for human monoclonal antibody quantification by enzyme immunoassay
and neutralization assay. It is anticipated that the greatest
reductions in virus titer will be in lung virus growth since IgG
isotypes are not actively secreted (in contrast to IgA) in the
upper respiratory tree. Should therapy on day 4 of infection prove
ineffective at reducing lung virus, therapy on days 2 and/or 3 will
be assessed.
[0229] The titer of each monoclonal antibody in stock solutions and
in serum from injected animals is determined using an ELISA, as
described supra. RSV fusion protein purified by affinity
chromatography according to established methods (82) is used in the
solid phase. A separate assay for the RSV G protein will also be
devised for evaluation of mouse IgG responses to experimental RSV
infection. Rabbit antibody specific for human IgG and mouse IgG
(available from Virion Systems, Inc., Bethesda, Md.) is used to
detect human monoclonal antibody or mouse antibody in the
ELISA.
[0230] The dose response effect of the monoclonal antibodies are
determined for the antibodies as the lowest antibody titer which
reduces virus titers more than 2 log.sub.10 or >99% reduction in
virus titer. The degree of protection are correlated to the serum
antibody levels achieved at the time of sacrifice. In addition, the
potential synergistic effect of various combinations of human
monoclonal antibodies is determined. The results of the initial in
vitro studies outlined above will be used to guide the in vivo
experiments. For instance, if RF-1 and RF-2 have distinct antigenic
binding sites on the RSV F protein, combinations of the same
isotype (.gamma.1 or .gamma.4) may provide for synergistic
protection.
[0231] ii. Histological Evaluation of Lung Tissue.
[0232] The effect of passive therapy on lung inflammation is
evaluated by standard histopathological and immunohistochemical
techniques. Both peribronchiolar infiltrates and alveolar
infiltrates have been described in the mouse following either
primary or secondary infections, Conners et al, J. Virology,
(1992), 66, 7444-7451. Experimental animals are treated with
monoclonal antibody, as described above. Uninfected untreated
control mice serve as comparisons for evaluating histological
effects. On days 5 and 8 after infection, the lungs are removed and
inflated with formalin under constant filling pressure (30 cm
H.sub.2O) for 30 minutes. After sectioning and staining with
hematoxylin-eosin, the degree of inflammatory infiltrate (PMN and
lymphocytic separately) in the peribronchiolar and alveolar areas
is determined using a standardized scoring system. Since it is
anticipated that the .gamma.1 and .gamma.4 monoclonal antibodies
may fix and activate complement differentially, the lung sections
are stained for mouse C3 deposition in areas of inflammation using
a commercially available rabbit anti-mouse C3 antibody (Viron
Systems, Inc. Bethesda, Md.) and peroxidase conjugated goat
and-rabbit IgG.
[0233] In addition to evaluation of histological changes seen in
fixed pulmonary tissues, pulmonary inflammation is assessed by
evaluation of alveolar cytology. Groups of mice, treated as
described above, are sacrificed and a bronchoalveolar lavage (BAL)
performed by repeatedly infusing 3 ml PBS into the lower airway.
Cell counts of the BAL will be performed, and the cell type
identified by staining of cytocentrifuge preparations.
[0234] iii. Effect of Antibody Therapy on the Natural Immune
Response to Infection.
[0235] In the cotton rat and owl monkey models, passive therapy of
RSV infection with polyclonal IgG preparations diminishes the
subsequent natural antibody response to the virus, although animals
are fully protected upon re challenge, Hemming et al., J.
Infectious Diseases (1985), 152, 1083-1086; Prince et al., Virus
Research (1985), 3, 193-206. In contrast, Graham found that treated
mice had both blunted antibody responses and were susceptible to
virus re challenge, Graham et al., Ped. Research (1993), 34,
167-172. To assess tis possibility using human monoclonal
antibodies, mice are infected with the Long strain of RSV and
treated with a protective dose of antibody on day 4, as outlined
above. Controls will include infected untreated animals, and
uninfected treated animals. Mice are bled for antibody
determination every other week for 8 weeks and then every 4 weeks
for an additional 8 weeks. Both human monoclonal antibody and mouse
antibody to the RSV F and G proteins are determined by ELISA. In
addition, the neutralization titer of the serum determined at each
time point. The contributions to neutralization by the residual
human monoclonal antibody and actively produced mouse antibody are
inferred from the ELISA results and by the results of neutralizing
activity of the uninfected antibody treated controls. When human
monoclonal antibody is undetectable by ELISA, animals are
rechallenged with the same strain of RSV. After 4 days, the animals
are sacrificed and the lungs and nasal tissues titered for virus
and compared to control groups.
[0236] In order to assess the impact of monoclonal antibody therapy
on cytotoxic T-cells (CTL) induction, similar experiments are
carried, but six weeks after infection, mice are sacrificed and
spleen cell cultures stimulated with live RSV for 5 days, Walsh, E.
E., J. Infectious Diseases (1994), 170, 345-350. CTL activity is
assessed by standard Chromium 51 release assay using persistently
infected Balb/c fibroblast cell line (BCH4 cells) and compared to
an uninfected Balb/c fibroblast line.
[0237] Based primarily on the effective dose studies of passive
therapy of established RSV infections, it is then determined which
antibody, RF-1 or RF-2, is the most efficacious for preventing or
treating RSV infection. The choice between the .gamma.1 or .gamma.4
(PE) versions takes the lung histology studies into account, in
particular whether recruitment of complement appear to be
significantly enhanced with the Clq binding antibody. Massive
activation of complement could potentially have adverse effects,
although enhanced vascularization that follows might increase the
virus-antibody confrontation.
[0238] c. Test Performance in Monkey Model.
[0239] The decisive test for the selected antibody is in a primate
model. We have chosen the African green monkey (Cercopithecus
aethiops) because it is highly permissive for RSV, and infection
leads to enhanced lung pathology and detectable lesions, Kakuk et
al., J. Infectious Diseases (1993), 167, 553-561. African green
monkeys are also readily available and not endangered. This monkey
weighs between 5 and 10 kgs. The highest expected maximal dose of
antibody is 20 mgs/kg. Three animals of each 10 kgs with 20 mgs/kg
equals 600 mgs of antibody. Some wild African green monkeys are
naturally immune to RSV, and a requirement for entering, monkeys
into our study is that they are serum negative to RSV.
[0240] Based on the baseline established in the mouse model,
effective dose/kg and infection time prior to therapy, a limited
series of tests are performed in order to establish effective dose
for virus reduction, as well as to confirm whether this correlates
with prevention of lung pathology, in particular parenchymal
inflammatory involvement. Only one virus strain, Lono (subtype A)
is tested. Initially 25, 5, 1, and {fraction (1/25)} times the
reference dose is tested. Two control groups, one that receive
virus but no antibody and another that receives virus and maximal
dose of the isotype matched control antibody, are analyzed.
Essentially, the experiments are effected as described above.
Monkeys in groups of 3 are also infected by intranasal instillation
with 10.sup.6 PFU of virus. Six to seven days after infection with
virus the monkeys are sacrificed and lung and pharynx samples are
taken for viral assays as described above and for histology.
[0241] Histology are performed essentially, as described above.
Briefly, the lungs are perfused with 10% neutral buffered formalin
under constant filling pressure. The lungs will remain in formalin
for at least one week. After sectioning and staining with
hematoxylin-eosin, the slides are evaluated histopathologically
according to Kakuk et al., J. Infectious Diseases (1993), 167,
553-561. Serum samples are also be taken in order to determine the
titer of human are antibody to RSV in ELISA and in Infection
Neutralization assays.
EXAMPLE 10
[0242] 1. Confirm Tissue Specificity by in Vitro Test on Human
Tissue Sections.
[0243] The antibody is then further tested for potential cross
reactivity to normal tissues by immunohistology studies on
different frozen normal tissue sections from two different
individuals. Briefly, Cryostat microtome cuts of frozen tissues are
subjected to 3 tests: Fixation analysis, a Nitration analysis and a
specificity/distribution analysis Purified biotin labeled anti-RSV
F-protein antibody in PBS with 1% BSA is added, and the slide is
incubated for 30 min. in a humidified chamber at 200C. The slide is
then washed in PBS with 1% BSA. The slide is subsequently incubated
with Avidin-HRP in PBS with 1% BSA for 30 min. HRP is allowed to
react with 3,3 diaminobenzidine-tetrahydrochloride, which forms an
insoluble precipitate stain mediated by oxidation with HRP. This
will identify any potential cross reactions of the subject human
monoclonal antibodies. This test will be performed by Impath
Laboratories, N.Y., N.Y., ad is approved by the FDA for I.N.D.
submissions for products destined for human therapy. This histology
approach uses pre-existing tissue and is less costly than the
alternative, targeting studies of RSV infected monkeys with
radiolabeled antibody.
Sequence CWU 1
1
* * * * *