U.S. patent application number 10/238745 was filed with the patent office on 2004-01-01 for method for treatment of cancer and infectious diseases and compositions useful in same.
Invention is credited to Hartl, F. Ulrich, Hoe, Mee H., Houghton, Alan, Mayhew, Mark, Rothman, James E., Takeuchi, Yoshizumi.
Application Number | 20040002469 10/238745 |
Document ID | / |
Family ID | 27357176 |
Filed Date | 2004-01-01 |
United States Patent
Application |
20040002469 |
Kind Code |
A1 |
Rothman, James E. ; et
al. |
January 1, 2004 |
Method for treatment of cancer and infectious diseases and
compositions useful in same
Abstract
Administration of expressible polynucleotides encoding
eukaryotic heat shock proteins to mammalian cells leads to the
stimulation of an immune response to antigens present in those
cells. This makes it possible to stimulate an immune response to
target antigens, including target tumor antigens or antigens
associated with an infectious disease, without having to isolate a
unique antigen or antigen-associated heat shock protein for each
target antigen by administering to a mammalian subject or to a
group of mammalian cells containing the antigen, an expressible
polynucleotide encoding a heat shock protein. The expressed heat
shock protein may have the same structure as native heat shock
proteins, or may have a modified form adapted to control the
trafficking of the expressed heat shock protein within the
cells.
Inventors: |
Rothman, James E.; (New
York, NY) ; Hartl, F. Ulrich; (Munich, DE) ;
Hoe, Mee H.; (New York, NY) ; Houghton, Alan;
(New York, NY) ; Takeuchi, Yoshizumi; (Kobe,
JP) ; Mayhew, Mark; (Tarrytown, NY) |
Correspondence
Address: |
KENYON & KENYON
ONE BROADWAY
NEW YORK
NY
10004
US
|
Family ID: |
27357176 |
Appl. No.: |
10/238745 |
Filed: |
September 10, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10238745 |
Sep 10, 2002 |
|
|
|
09511454 |
Feb 23, 2000 |
|
|
|
09511454 |
Feb 23, 2000 |
|
|
|
09011648 |
Feb 13, 1998 |
|
|
|
6331299 |
|
|
|
|
09011648 |
Feb 13, 1998 |
|
|
|
PCT/US96/13233 |
Aug 16, 1996 |
|
|
|
60002490 |
Aug 18, 1995 |
|
|
|
60002479 |
Aug 18, 1995 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
A61K 39/0005 20130101;
A61K 2039/53 20130101; A61K 2039/622 20130101; C07K 14/47 20130101;
A61K 48/00 20130101; A61K 47/6901 20170801; A61K 2039/5156
20130101; C07K 7/06 20130101; A61K 38/00 20130101; A61K 47/646
20170801; A61K 39/0011 20130101; A61K 2039/6043 20130101; C07K 7/08
20130101; A61K 2039/5152 20130101; A61K 2039/625 20130101; A61K
47/65 20170801 |
Class at
Publication: |
514/44 |
International
Class: |
A61K 048/00 |
Goverment Interests
[0001] The invention described herein was made in the course of
work under NIH Core Grant No. CA 08748. The United States
government may have certain rights in this invention.
Claims
1. A method for stimulating a therapeutic immune response in a
subject in need of such treatment, comprising the step of
introducing to the subject, or to a target group of cells from the
subject, an expressible polynucleotide encoding a eukaryotic heat
shock protein.
2. A method for stimulating a prophylactic immune response against
recurrence of a disease from which a subject is suffering,
comprising administering to the subject, or to a target group of
cells from the subject harboring an antigen associated with the
disease, an expressible polynucleotide encoding a eukaryotic heat
shock protein.
3. The method according to claim 1 or 2, wherein the eukaryotic
heat shock protein is an XDEL-negative heat shock protein.
4. The method according to claim 1 or 2, wherein the eukaryotic
heat shock protein is a heat shock protein from which the
carboxy-terminal XDEL retention sequence has been deleted.
5. The method according to claim 1 or 2, wherein the eukaryotic
heat shock protein is a heat shock protein in which the
carboxy-terminal XDEL retention sequence has been masked.
6. The method according to claim 1 or 2, wherein the expressible
polynucleotide encodes a eukaryotic heat shock protein having a
carboxy-terminal retention sequence of the sequence XDEL.
7. The method according to claim 6, wherein the eukaryotic heat
shock protein is BiP.
9. The method according to any of claims 1 to 8, wherein the cells
are cancer cells.
10. The method according to any of claims 1 to 8, wherein the cells
are neoplastic cells.
11. The method according to claim 10, wherein the neoplastic cells
are selected from among sarcoma cells, lymphoma cells, leukemia
cells, carcinoma cells and melanoma cells.
12. The method according to any of claims 1 to 8, wherein the cells
are infected with a virus.
13. The method according to any of claims 1 to 8, wherein the cells
are infected with a parasite.
14. The method according to any of claims 1 to 8, wherein the cells
are infected with a mycoplasma.
15. The method according to any of claims 1 to 8, wherein the cells
are infected with a bacterium.
16. The method according to any of claims 1 to 8, wherein the cells
are infected with a fungus or yeast.
17. The method according to any of claim 1 to 16, wherein the
expressible polynucleotide is introduced into a target group of
cells ex vivo, and the target group of cells are thereafter
administered to the subject.
18. The method according to claim 17, wherein the composition is
administered by transfection in a liposome.
19. The method according to any of claim 1 to 18, wherein the
subject is a human.
20. A recombinant vector comprising (a) a promoter system effective
to promote expression of the vector in mammalian cells; and (b) a
region encoding a cytosolic heat shock protein (i) an amino
terminal signal sequence effective to promote uptake of the
expressed cytosolic heat shock protein by the endoplasmic reticulum
and (ii) a carboxy-terminal retention sequence effective to promote
retention of the heat shock protein in the endoplasmic
reticulum.
21. The recombinant vector of claim 20, wherein the signal sequence
comprises a positively charged N-terminal region, a hydrophobic
core region and a third region of greater polarity than the
hydrophobic region.
22. The recombinant vector according to claim 20 or 21, wherein the
cytosolic heat shock protein is hsp70.
23. A method for stimulating an immune response to an antigen
present in a target group of mammalian cells, comprising
administering to the target group of cells an expressible
polynucleotide, wherein expression of the polynucleotide is
effective to increase the amount of antigen-associated heat shock
protein present in the cells.
24. The method according to claim 23, wherein the expressible
polynucleotide encodes a eukaryotic heat shock protein.
25. The method according to claim 23 or 24, wherein the expressible
polynucleotide encodes a peptide having a retention sequence
recognized by the erd-2 receptors.
26. The method according to claim 25, wherein the retention
sequence is XDEL.
Description
BACKGROUND OF THE INVENTION
[0002] This application relates to the use of heat shock proteins
and similar peptide-binding proteins to stimulate an immunological
response against antigens, including cancer-related antigens,
autoimmune antigens and infectious disease antigens, found in a
mammalian host.
[0003] Heat shock proteins were originally observed to be expressed
in increased amounts in mammalian cells which were exposed to
sudden elevations of temperature, while the expression of most
cellular proteins is significantly reduced. It has since been
determined that such proteins are produced in response to various
types of stress, including glucose deprivation. As used herein, the
term "heat shock protein" will be used to encompass both proteins
that are expressly labeled as such as well as other stress
proteins, including homologs of such proteins that are expressed
constitutively (i.e., in the absence of stressful conditions).
Examples of heat shock proteins include BiP (also referred to as
grp78), hsp/hsc70, gp96 (grp94), hsp60, hsp40 and hsp90.
[0004] Heat shock proteins have the ability to bind other proteins
in their non-native states, and in particular to bind nascent
proteins emerging from the ribosomes or extruded into endoplasmic
reticulum. Hendrick and Hartl, Ann. Rev. Biochem. 62: 349-384
(1993); Hartl, Nature 381: 571-580 (1996). Further, heat shock
proteins have been shown to play an important role in the proper
folding and assembly of proteins in the cytosol, endoplasmic
reticulum and mitochondria; in view of this function, they are
referred to as "molecular chaperones". Frydman et al., Nature 370:
111-117 (1994); Hendrick and Hartl., Ann. Rev. Biochem. 62:349-384
(1993); Hartl., Nature 381:571-580 (1996).
[0005] For example, the protein BiP, a member of a class of heat
shock proteins referred to as the hsp70 family, has been found to
bind to newly synthesized, unfolded u immunoglobulin heavy chain
prior to its assembly with light chain in the endoplasmic
reticulum. Hendershot et al., J. Cell Biol. 104:761-767 (1987).
Another heat shock protein, gp96, is a member of the hsp90 family
of stress proteins which localize in the endoplasmic reticulum. Li
and Srivastava, EMBO J. 12:3143-3151 (1993); Mazzarella and Green,
J. Biol. Chem. 262:8875-8883 (1987). It has been proposed that gp96
may assist in the assembly of multi-subunit proteins in the
endoplasmic reticulum. Wiech et al., Nature 358:169-170 (1992).
[0006] It has been observed that heat shock proteins prepared from
tumors in experimental animals were able to induce immune responses
in a tumor-specific manner; that is to say, heat shock protein
purified from a particular tumor could induce an immune response in
an experimental animal which would inhibit the growth of the same
tumor, but not other tumors. Srivastava and Maki, 1991, Curr.
Topics Microbiol. 167: 109-123 (1991). The source of the
tumor-specific immunogenicity has not been confirmed. Genes
encoding heat shock proteins have not been found to exhibit
tumor-specific DNA polymorphism. Srivastava and Udono, Curr. Opin.
Immunol. 6:728-732 (1994). High resolution gel electrophoresis has
indicated that gp96 may be heterogeneous at the molecular level.
Feldweg and Srivastava, Int. J. Cancer 63:310-314 (1995). Evidence
suggests that the source of heterogeneity may be populations of
small peptides adherent to the heat shock protein, which may number
in the hundreds. Id. It has been proposed that a wide diversity of
peptides adherent to tumor-synthesized heat shock proteins may
render such proteins capable of eliciting an immune response in
subjects having diverse HLA phenotypes, in contrast to more
traditional immunogens which may be somewhat HLA-restricted in
their efficacy. Id.
[0007] Lukacs et al., J. Exp. Med. 178: 343-348 (1993), have
reported the transfection of tumor cells with a mycobacterial heat
shock protein-encoding gene, and the observation that the
transfected cells lose tumorigenicity and induce what appears to be
T-cell mediated protection against tumors in mice immunized using
the transfected cells. Lukacs et al. suggest that the loss of
tumorigenicity could result from the interaction of the heat shock
protein with p53 via increased efficiency of chaperone activity to
produce proper folding and conformation of otherwise ineffective
p53 protein. They further suggest that the highly immunogenic
nature of the 65 kD bacterial hsp enhances the recognition of
other, tumor-associated antigen molecules.
[0008] It has been suggested in the literature that mycobacterial
heat shock proteins may play a role in the onset of autoimmune
diseases such a rheumatoid arthritis. Thus, the practical utility
of such bacterial proteins in vaccines for the treatment of humans
is questionable. It is an object of the present invention to
provide vaccine compositions which can be used to stimulate an
immune response to antigens, including tumor and infectious disease
antigens, present in mammalian cells without the introduction of
mycobacterial proteins.
SUMMARY OF THE INVENTION
[0009] It has now been found that administration of expressible
polynucleotides encoding eukaryotic heat shock proteins to
mammalian cells leads to the stimulation of an immune response to
antigens present in those cells. This makes it possible to
stimulate an immune response to treat a subject's disease
condition, including an immune response to a tumor or an infectious
disease, without having to isolate or characterize an antigen
associated with the disease. Thus, the present invention provides a
method for stimulating a therapeutic or prophylactic immune
response in a mammalian subject by treating the subject or a group
of cells from the subject with an expressible polynucleotide
encoding a eukaryotic heat shock protein. The expressed heat shock
protein may have the same structure as native heat shock proteins,
or may be a modified form adapted to control the trafficking of the
expressed heat shock protein within the cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIGS. 1A-H show tumor formation in mice injected with CMS-5
sarcoma cells and CHS-5 sarcoma cells acutely transfected with
BiP-expressing vectors; and
[0011] FIGS. 2A-F show tumor formation in mice injected with CMS-5
sarcoma cells and CHS-5 sarcoma cells stably transfected with
BiP-expressing vectors.
DETAILED DESCRIPTION OF THE INVENTION
[0012] The present invention provides a method for inducing or
enhancing an immune response to an antigen present in a target
group of cells without requiring prior identification,
characterization or isolation of the antigen. The method of the
invention may be used to induce an immune response to the antigen
in the case where there is no existing detectable disease-related
immune response prior to practicing the method, or to enhance the
disease-related immune response to a greater level. For purposes of
simplicity, the specification and claims of this application will
use the term "stimulating an immune response" to encompass both
inducing a new immune response and enhancing a pre-existing immune
response.
[0013] We have found that administration of expressible
polynucleotides encoding eukaryotic heat shock proteins to
mammalian cells leads to the stimulation of an immune response to
antigens present in those cells. While we do not intend to be bound
by any particular mechanism, the full potential of our observations
is best understood in the context of two mechanistic models which
explain the observations.
[0014] The first mechanism is based on the fact that heat shock
proteins like BiP and gp96 are normally localized in the
endoplasmic reticulum and are known to bind peptides and proteins
in this location, and the belief that such binding may be a step in
the presentation of an antigen to the immune system. Increasing the
concentration of one or more heat shock proteins resident in the
endoplasmic reticulum may cause an improvement in the efficiency of
this process, and thus an increased immune response to the antigens
present in the transfected cells.
[0015] The second mechanism is based upon the understanding that
heat shock proteins and other proteins secreted from the
endoplasmic reticulum may be recaptured by receptors known as erd-2
(KDEL) receptors and returned to the endoplasmic reticulum. This
recapture process requires the presence of a specific retention
sequence on the heat shock protein such XDEL. XDEL is the single
letter amino-acid code for the amino acid sequence
variable-Asp-Glu-Leu. Specific carboxy-terminal retention sequences
are KDEL (Lys-Asp-Glu-Leu) and HDEL (His-Asp-Glu-Leu). By
eliminating this retention sequence in heat shock proteins which
bind to antigens or by otherwise interfering with the ability of
the erd-2 receptor to recapture these heat shock proteins, the
amount of antigen-associated heat shock protein secreted by a cell
and therefore accessible to the immune system can be increased.
[0016] In accordance with either of these mechanisms, the
stimulation of the immune response which is observed when an
expressible polynucleotide encoding a heat shock protein is
expressed in the cell flows from an increase in the amount of
antigen-associated heat shock protein. Thus, in accordance with one
embodiment of the invention there is provided a method for
stimulating an immune response to an antigen present in a target
group of mammalian cells, comprising administering to the target
group of cells a composition effective to increase the amount of
antigen-associated heat shock protein present in the cells. This
can be accomplished in several ways.
[0017] First, the amount of antigen-associated heat shock protein
can be increased by administering a polynucleotide encoding a heat
shock protein which is expressed to produce recombinant heat shock
protein that is processed and transported within the cell in the
same manner as wild-type heat shock protein.
[0018] Second, the amount of antigen-associated heat shock protein
can be increased by administering an expressible polynucleotide
encoding a heat shock protein in a modified form adapted to control
the trafficking of the expressed heat shock protein within the
cells. This would include alterations of heat shock protein which
either facilitate its secretion from the cell or its localization
and/or retention on the cell. For example, secretion may be
facilitated by mutating or eliminating portions of the heat shock
protein that serve to retain the heat shock protein in the cell
(for example by deleting sequences recognized by the erd-2 receptor
such as KDEL or a functionally equivalent sequence or by adding an
agent that interferes with binding of heat shock protein to erd-2),
or by supplying mutated non-heat shock proteins (e.g. erd-2
mutants) that increase heat shock protein secretion. Alternatively
localization and retention may be accomplished by increasing the
number and/or strength of retention or retrieval signals (e.g.
increasing erd-2 levels) or my by adding to a heat shock protein, a
membrane anchor containing additional retention or retrieval
sequence as well as transmembrane and cytoplasmic domains (e.g.,
KKXX at the C-terminal end, or XXRR at the N-terminal end or
function equivalents thereof.)
[0019] Third, the amount of an antigen-associated heat shock
protein can be increased by administering an expressible
polynucleotide encoding a peptide or peptide which competitively
inhibits the interaction of heat shock proteins with cellular
elements to modify the trafficking of those heat shock proteins
within the cell.
Preparation of Expressible Polynucleotides
[0020] The construction of expressible polynucleotides for use in
the three embodiments of the invention share many common elements
and use generally well known techniques. These techniques are set
forth in numerous literature references known to persons skilled in
the art and so will not be repeated exhaustively here.
[0021] Expressible polynucleotide encoding a heat shock protein
which is expressed to produce recombinant heat shock protein that
is processed and transported within the cell in the same manner as
wild-type heat shock protein can be constructed by incorporating a
cDNA encoding a wild-type heat shock protein or a modified heat
shock protein that retains both its heat shock protein
functionality and the XDEL retention sequence into a mammalian
expression vector. Genes for various mammalian heat shock proteins
have been cloned and sequenced, including, but not limited to,
gp96, human: Genebank Accession No. X15187; Maki et al., Proc.
Nat'l Acad. Sci. 87: 5658-5562 (1990), mouse: Genebank Accession
No. M16370; Srivastava et al., Proc. Nat'l Acad. Sci. 84:3807-3811
(1987)); BiP, mouse: Genebank Accession No. U16277; Haas et al.,
Proc. Nat'l Acad. Sci. U.S.A. 85: 2250-2254 (1988), human: Genebank
Accession No. M19645; Ting et al., DNA 7: 275-286 (1988); hsp70,
mouse: Genebank Accession No. M35021; Hunt et al., Gene 87: 199-204
(1990), human: Genebank Accession No. M24743; Hunt et al., Proc.
Nat'l Acad. Sci. U.S.A. 82: 6455-6489 (1995); and hsp40 human:
Genebank Accession No. D49547; Ohtsuka K., Biochem Biophys. Res.
Commun. 197: 235-240 (1993).
[0022] In general, any type of mammalian expression vector can be
used, although those with the highest transfection and expression
efficiencies are preferred to maximize the levels of expression.
Specific types of vectors which can be employed include herpes
simplex viral based vectors: pHSV1 (Geller et al. Proc. Natl. Acad.
Sci 87:8950-8954 (1990)); recombinant retroviral vectors: MFG
(Jaffee et al. Cancer Res. 53:2221-2226 (1993)); Moloney-based
retroviral vectors: LN, LNSX, LNCX, LXSN (Miller and Rosman
Biotechniques 7:980-989 (1989)); vaccinia viral vector: MVA (Sutter
and Moss Proc. Natl. Acad. Sci. 89:10847-10851 (1992)); recombinant
adenovirus vectors pJM17 (Ali et al Gene Therapy 1:367-384 (1994)),
(Berkner K. L. Biotechniques 6:616-624 1988); second generation
adenovirus vector: DE1/DE4 adenoviral vectors (Wang and Finer
Nature Medicine 2:714-716 (1996)); and Adeno-associated viral
vectors: AAV/Neo (Muro-Cacho et al. J. Immunotherapy 11:231-237
(1992)). Specific suitable expression systems for this purpose
include pCDNA3 (In-Vitrogen), plasmid AH5 (which contains the SV40
origin and the adenovirus major late promoter), pRC/CMV
(In-Vitrogen), pCMU II (Paabo et al., EMBO J. 5: 1921-1927 (1986)),
pzip-Neo SV (Cepko et al., Cell 37: 1053-1062 (1984)) and
pSR.alpha. (DNAX, Palo Alto, Calif.).
[0023] Expressible polynucleotides encoding any of the various
modified forms heat shock proteins described above are constructed
using similar techniques. For example, heat shock proteins can be
produced which are modified to delete or block the carboxy-terminal
XDEL sequence. Such a heat shock protein is adapted to permit the
heat shock protein to be secreted from the endoplasmic reticulum
and to interfere with the return of the protein to the endoplasmic
reticulum that is mediated by the erd-2 receptors because the
signal peptide recognized by the erd-2 receptors is missing.
Proteins of this type are referred to in the specification and
claims of this application as XDEL-negative heat shock
proteins.
[0024] Expressible XDEL-negative polynucleotides can be constructed
by deleting the nucleotides encoding the amino acid sequence XDEL
at the carboxy-terminus of the heat shock protein. This can be
accomplished by PCR amplification of the wild-type cDNA using a
primer that hybridizes in the region immediately adjacent to the
portion coding for the XDEL signal, combined with a restriction
site to be used for cloning the product into a desired vector for
expression of the modified heat shock protein in mammalian cells as
described above.
[0025] As an alternative to the use of expressible poly-nucleotides
encoding deletion mutants of heat shock proteins, the method of the
invention may also employ expressible polynucleotides which encode
heat shock proteins in which the carboxy-terminal retention
sequence XDEL is masked by the addition of additional amino acids
to the carboxy-terminal end. The masking amino acids can serve only
the masking function, or can be derived from an infectious agent
(for example E7/E6 from human papilloma virus) in which case the
masking amino acids may also function as an antigen.
[0026] Addition of masking amino acids can be accomplished as
described in Munro et al., Cell 48: 899-907 (1987) in which a
mutant (SAGGL) having two amino acids added after the XDEL was
prepared by cloning in appropriate restriction sites to permit
substitution of a sequence including the additional bases, or by
PCR amplification of the heat shock protein using a primer that
hybridizes with the bases encoding the XDEL retention sequence and
which has additional bases encoding the added nucleotides inserted
between the XDEL-encoding bases and the stop codon. The number of
additional amino acids does not matter, so long as the added amino
acids do not alter the function of the heat shock protein. The
nucleotides encoding the masked heat shock protein are then
introduced into a mammalian expression vector as described
above.
[0027] Another method which may be used to increase the amount of
antigen-associated heat shock protein in the cells is to modify
cytosolic heat shock proteins with an amino-terminal signal which
causes the protein to be taken up into the endoplasmic reticulum
where it can gain access to the secretory pathway. Amino-terminal
signals which can accomplish this function are described in the
art, including for example in von Heijne, G., J. Mol. Biol. 184:
99-105 (1985). These signals generally comprise a
positively-charged amino acid or group of a few amino acids at the
amino terminal end of the peptide, a hydrophobic core region and a
third region of greater polarity than the hydrophobic region. Such
additional signal sequences can be introduced using PCR with a
modified primer that includes the bases for the desired
amino-terminal amino acids. A representative cytosolic heat shock
protein which might be modified in this manner is hsp 70.
[0028] The expressible polynucleotide used in the method of the
present invention may also encode a peptide or protein that
competitively inhibits the interaction of heat shock proteins with
cellular elements to modify the trafficking of those heat shock
proteins within the cell. In particular, the expressible
polynucleotide may encode a peptide or protein that includes a
carboxy-terminal XDEL retention sequence which will compete with
heat shock proteins, including endogenous heat shock proteins, for
binding to the erd-2 receptors. This competitive peptide may itself
be a heat shock protein, for example BiP, that retains the XDEL
retention sequence, or it may be some other peptide or protein with
a carboxy-terminal XDEL sequence.
Administration of Expressible Polynucleotides
[0029] The resulting expressible polynucleotide is delivered into
cells of the subject by ex vivo or in vivo methods, for example as
part of a viral vector as described above, or as naked DNA.
Suitable methods include injection directly into tissue and tumors,
transfection using liposomes (Fraley et al, Nature 370: 111-117
(1980)), receptor-mediated endocytosis (Zatloukal, et al., Ann.
N.Y. Acad. Sci. 660: 136-153 (1992)), particle bombardment-mediated
gene transfer (Eisenbraun et al., DNA & Cell. Biol. 12: 791-797
(1993)) and transfection using peptide presenting bacteriophage.
Barry et al. Nature Medicine 2: 299-305 (1996).
[0030] The expressible polynucleotide may be administered to a
subject in need of treatment in order to obtain a therapeutic
immune response. The term "therapeutic immune response", as used
herein, refers to an increase in humoral and/or cellular immunity,
as measured by standard techniques, which is directed toward an
antigen associated with the subject's disease condition.
Preferably, but not by way of limitation, the induced level of
humoral immunity directed toward the antigen is at least four-fold,
and preferably at least 16-fold greater than the levels of the
humoral immunity directed toward the antigen prior to the
administration of the expressible polynucleotide of this invention
to the subject. The immune response may also be measured
qualitatively, by means of a suitable in vitro assay or in vivo,
wherein an arrest in progression or a remission of neoplastic or
infectious disease in the subject is considered to indicate the
induction of a therapeutic immune response.
[0031] A further aspect of the invention is the administration of
an expressible polynucleotide in combination with other forms of
treatment including surgery, radiation therapy, and chemotherapy,
to provide a vaccination against recurrence of cancer. By priming
the immune system of subjects to recognize the cancer cells of
their own cancers, the immune system will be more prepared to
counter a subsequent regrowth, thus improving the prognosis for the
subjects. This same type of vaccination can be used to improve a
subject's resistance to recurrent diseases, including many
parasitic and viral diseases. Thus, the expressible polynucleotides
of the invention may be administered to stimulate a prophylactic
immune response. The term "prophylactic immune response", as used
herein, refers to an increase in long term humoral and/or cellular
immunity, as measured by standard techniques, which is directed
toward an antigen associated with the subject's disease condition.
In general, the prophylactic immune response is measured
qualitatively, wherein a delay in the onset of recurring system is
achieved.
[0032] The subject treated in the method of the invention may be a
human or non-human subject.
[0033] In various embodiments of the invention, the polynucleotide
may encode a heat shock protein derived from the same species or
alternatively from a different species relative to the species of
the subject.
[0034] The cells into which the expressible polynucleotide are
introduced may be neoplastic cells or other cancer cells from the
subject to be treated or vaccinated. In particular, the method of
the invention is usefully applied to treat or vaccinate subjects
suffering from cancer including solid tumors and neoplastic disease
such as sarcoma, lymphoma, carcinoma, leukemia and melanoma. The
method of the invention may also be utilized to stimulate an immune
response to infectious diseases, including parasitic, fungal,
yeast, bacterial, mycoplasmal and viral diseases, where a
particular class of cells can be identified as harboring the
infective entity. For example, but not by way of limitation, the
cells treated may be infected with a human papilloma virus, a
herpes virus such as herpes simplex or herpes zoster, a retrovirus
such as human immunodeficiency virus 1 or 2, a hepatitis virus, an
influenza virus, a rhinovirus, respiratory syncytial virus,
cytomegalovirus, adenovirus, Mycoplasma pneumoniae, a bacterium of
the genus Salmonella, Staphylococcus, Streptococcus, Enterococcus,
Clostridium, Escherichia, Klebsiella, Vibrio, Mycobacterium,
amoeba, a malarial parasite, Trypanosoma cruzi, etc. Thus, for
example, in the case of human papilloma virus (HPV) the expressible
polynucleotide could be introduced into epithelial cells infected
with HPV from the subject to be treated.
[0035] The method of the invention can be practiced using various
compositions. One such composition of matter is a recombinant
vector comprising a promoter system effective to promote expression
of the vector in mammalian cells; and a region encoding a
XDEL-negative heat shock protein. The vector may be one in which
the bases encoding a XDEL-retention sequence have been deleted from
the region encoding the heat shock protein, or one in which
additional bases have been added to the region encoding the heat
shock protein to mask the XDEL-retention sequence in the expressed
product. An exemplary vector would include gp96, preferably human
gp96, as the heat shock protein.
[0036] A further composition of matter in accordance with the
invention is a recombinant vector comprising a promoter system
effective to promote expression of the vector in mammalian cells;
and a region encoding a cytosolic heat shock protein such as hsp70
to which a signal comprising a positively-charged amino acid or
group of a few amino acids at the amino terminal end of the
peptide, a hydrophobic core region and a third region of greater
polarity than the hydrophobic region is attached to promote uptake
of the expressed cytosolic heat shock protein by the endoplasmic
reticulum has been added.
[0037] The invention will now be further described by way of the
following non-limiting examples.
EXAMPLE 1
Preparation of XDEL Deletion Mutants
[0038] The preparation of mammalian expression vectors encoding
full-length and KDEL-deleted Drosophila BiP cDNAs (dBiP, also
referred to a grp78) is described in Munro et al., Cell 48: 899-907
(1987). The expression vector encoding dBIP with a KDEL deletion
(KDEL-deleted dBiP, SAGM2) has the KDEL retention sequence replaced
with a c-myc sequence in a modified AHP2 plasmid. A further
construct, WT dBiP (SAGMK1) has the c-myc sequence inserted between
the KDEL retention sequence and the balance of the dBiP.
[0039] Wild type mouse BiP cDNA was cloned into plasmid pBSBiP.
Haas, Proc. Nat'l Acad. Sci. USA 85: 2250-2254 (1988) In this
plasmid, the BiP sequence is flanked by BamH I sites. The BamH I
fragment was therefore recovered from pBSBiP and cloned into the
BamH I site of mammalian expression vector pCDNA3 (In-Vitrogen).
Mouse KDEL-deleted BiP was constructed using pCDNA3 by cloning the
Bgl II-EcoR V PCR fragment (nucleotide 1360 to nucleotide 1981) of
BiP using two oligonucleotide primers complementary to BiP. The
nucleotides coding for the last four amino acids (KDEL) were
omitted, and a stop codon and an EcoR V restriction site put in its
place.
EXAMPLE 2
Preparation of Tumor Cells Expressing BiP
[0040] CMS-5 sarcoma cells, a methylocholanthrene-induced
fibrosarcoma of BALB/c mouse origin, were adapted to culture and
grown in DMEM medium (Gibco Life Technologies, Inc.) supplemented
with 10% FCS. Sub-confluent monolayers (2.times.10' cells) were
transfected with 2 ug of mammalian expression vector containing BiP
or KDEL-deleted BiP using lipofectamine (Gibco) according to the
manufacturer's directions. Briefly, the expression vector and 6 ul
of lipofectamine were diluted separately in 100 uL serum-free
medium (OPTI-MEM.RTM. I Reduced Serum Medium, Gibco-BRL). The two
solutions were then mixed and incubated at room temperature for 45
minutes to allow formation of DNA-liposome complexes. 800 uL
OPTI-MEM.RTM. was added to the complexes, mixed, and overlaid onto
rinsed cells. After a 6 hour incubation at 37.degree. C., 1 mL
growth medium containing 20% FCS was added. Fresh medium was added
to the cells 24 hours post-transfection.
[0041] Stable clones were selected by adding 800 ug/mL geneticin
(Gibco-BRL) to the cells 72 hours later. The selection medium was
changed every 3 days. Colonies of stably transfected cells were
seen after 10 to 14 days. Expression of BiP for each clone picked
was assayed for by radiolabeling. Newly synthesized BiP was
detectable by immunoprecipitation and gel electrophoresis.
[0042] Acutely (transiently) BiP expressing clones were trypsinized
and used for animal injection 60 hours post-transfection.
EXAMPLE 3
Vaccination With BiP Expressing Tumor Cells
[0043] Freshly prepared acutely transfected CMS-5 sarcoma cells
prepared in accordance with Example 2 were prepared for use in
vaccination of mice by trypsinization and then washing three times
in PBS. 2.times.10' cells were injected intradermally into the
abdomen of CB6F-1/J [Balb/c.times.C57BL/6 F1] mice (Jackson
Laboratories) and monitored for tumor growth over a 90 day period.
The results are summarized in Table 1 and shown graphically in
FIGS. 1A-H. As shown, injection with the parental CMS-5 sarcoma
cells, with mock transfected cells, and with cells transfected with
KDEL-deleted vectors led in all cases to the formation of tumors.
Tumors also developed in one control mouse where the cells were
transfected with the vector only (no BiP). On the other hand, only
one of six mice transfected with the complete wild-type drosophila
BiP (including the c-myc) or wild-type mouse BiP developed
tumors.
1 TABLE 1 Number of Tumor Free Mice per Percent number of mice
Tumor Free Cell Line injected Survivals Parental CMS5 0/4 0% Mock
Transfected 0/3 0% Vector Only 1/3 33% Mouse BiP wild type 2/3 66%
Mouse BiP KDEL deleted 0/3 0% Drosophila BiP wild type 3/3 100%
Drosophila BiP KDEL deleted 0/3 0%
EXAMPLE 4
[0044] The experiment of Example 3 was repeated using larger groups
of mice and using two different clones of stable mouse
BiP-expressing transfected cells. As shown in Table 2 and FIGS.
2A-F, the results were essentially the same, with none of the mice
injected with the vector expressing wild-type mouse BiP having any
detected tumor formation.
2 TABLE 2 Number of Tumor Free mice per Percent number mice Tumor
Free Cell Lines injected Survivals Parental CMS5 0/4 0% Vector Only
4/15 27% Mouse BiP wild type: clone 1 6/6 100% Mouse BiP wild type:
clone 2 11/11 100% Mouse BiP KDEL deleted: clone 1 1/9 11% Mouse
BiP KDEL deleted: clone 2 2/15 13%
EXAMPLE 5
[0045] Tumor-free mice that had been injected with the wild-type
BiP expression vector in the experiment of Example 4 were
rechallenged after an interval of two months by injection of
2.times.10' or 10.times.10' CMS-5 sarcoma cells into the left flank
of each mouse. Unimmunized CB6F-l/J mice of the same age group that
had not been previously immunized were injected at the same time
with 2.times.10' CMS-5 sarcoma cells as controls. As shown in Table
3, none of the previously immunized mice developed detectable
tumors, while all three of the control mice developed tumors and
died.
3 TABLE 3 Number of Tumor Free Mice/Number of Mice Rejected Tumor
Injected % Survivals Mouse BiP wild type: 3/3 100% clone 1 3/3 100%
Mouse BiP wild type: 5/5 100% clone 2 6/6 100% Control 0/3 0%
EXAMPLE 6
Construction of Vector Expressing gp96
[0046] To create an expressible vector encoding gp96, the coding
region of murine GP96 (mGP96) was digested with BamH I, blunted
with Klenow and cloned into the mammalian expression vector pRC/CMV
(In-Vitrogen) which has been digested with Xba I and also blunted
with Klenow. The resulting plasmid, p96/CMV was then used as
template for generating a fragment spanning nucleotides 1653 to
2482 that lacks the nucleotides encoding the amino acids KDEL. The
primers used for amplification of this fragment were
4 5' primer: GCGGATCCTAGTTTAGACCAGTATGTC [SEQ ID No. 1] 3' primer:
CCGAATTCGGGCCCCAATTTACTCTGTAGATTCCTTTTCTGTTT [SEQ ID No. 2]
[0047] The restrictions sites for BamH I in the 5'-primer and EcoR
I and Sal I in the 3'-primer are shown in bold italics. A stop
codon (shown underlined) is provided four nucleotides from the Sal
I restriction site in the 3'-primer. The BamH I/EcoR I PCR fragment
was subcloned into pBlueScript II (Stratagene) to further amplify
the amount of DNA. The amplified DNA was then digested with PfIM I
and Apa I, gel purified and subcloned into p96/CMV to give pMS215
which codes for KDEL-deleted gp96.
EXAMPLE 7
Vaccination With GP96 Expressing Vectors
[0048] Plasmids encoding the wt mGp96 (pMS216) and KDEL deleted
mGp96 (215) are transfected into CMS-5 sarcoma cells as described
in Example 2. 86 h post transfection, the acutely transfected CMS-5
sarcoma cells are trypsinized, washed in PBS and prepared for use
in vaccination of mice as described in Example 3.
[0049] Various publications are cited herein, the contents of which
are hereby incorporated by reference in their entireties.
Sequence CWU 1
1
* * * * *